{"text": "The search for novel antitumour drugs has reached a plateau phase. The carcinomas remain almost as intractable as they did 40 years ago and the need for effective therapy is pressing. There is an argument that the current pharmacopoeia is sufficient but, to be effective, the biochemical mechanisms of drug resistance must be circumvented. In tackling the question of why certain cancer cells are resistant, the converse question of why others are sensitive still remains to be answered fully. Asking the fundamental question of why and how a cell dies may provide clues as to what avenues lie open for improved chemotherapy. In this review we survey the recent literature on cell death and we argue that it is possible that the outcome of chemotherapy may be determined by the response of the cell to the formation of the drug-target complex, and/or its sequellae, rather than to the biochemical changes brought about by the drug alone. One of these responses, determined by the phenotype of the cell, may be activation of a genetic programme for cell death."}
{"text": "Presently, health costs associated with nitrate in drinking water are uncertain and not quantified. This limits proper evaluation of current policies and measures for solving or preventing nitrate pollution of drinking water resources. The cost for society associated with nitrate is also relevant for integrated assessment of EU nitrogen policies taking a perspective of welfare optimization. The overarching question is at which nitrogen mitigation level the social cost of measures, including their consequence for availability of food and energy, matches the social benefit of these measures for human health and biodiversity.Epidemiological studies suggest colon cancer to be possibly associated with nitrate in drinking water. In this study risk increase for colon cancer is based on a case-control study for Iowa, which is extrapolated to assess the social cost for 11 EU member states by using data on cancer incidence, nitrogen leaching and drinking water supply in the EU. Health costs are provisionally compared with nitrate mitigation costs and social benefits of fertilizer use.3) for more than ten years. We estimate the associated increase of incidence of colon cancer from nitrate contamination of groundwater based drinking water in EU11 at 3%. This corresponds to a population-averaged health loss of 2.9 euro per capita or 0.7 euro per kg of nitrate-N leaching from fertilizer.For above median meat consumption the risk of colon cancer doubles when exposed to drinking water exceeding 25 mg/L of nitrate (NO3 are probably beneficial for society and that a stricter nitrate limit and additional measures may be justified. The present assessment of social cost is uncertain because it considers only one type of cancer, it is based on one epidemiological study in Iowa, and involves various assumptions regarding exposure. Our results highlight the need for improved epidemiological studies.Our cost estimates indicate that current measures to prevent exceedance of 50 mg/L NO Nitrogen is emitted to the environment by various sources in various forms that lead to a multitude of effects on human health, ecosystems and climate. On the other hand nitrogen is a key input for food production and deficient in many parts of the developing world. Therefore, Galloway et al.  concludeThe existence of adverse health impacts of nitrate via drinking water has been debated ,3. ThereThere is consensus that the role of nitrate exposure in causing methaemoglobinaemia is minor  and not Although there is evidence for both beneficial and adverse health effects of increased nitrate intake in drinking water, these effects are likely to be small and uncertain compared to other factors like life style and diet. Moreover, health effects may also results from other drinking water pollutants . Therefore, it is not surprising that epidemiological studies into the relation between nitrate in drinking water and cancers  often provide weak associations, both positive and negative . Ward et2O, NO2 and NH3 to the atmosphere [The present paper provides a method to assess the health costs by nitrates in drinking water. We compare the results with very rough estimates of the costs of improved water treatment and of reduced fertilizer use. However, the problem is more complex because of the multiple impacts and pathways of nitrogen in the environment. Nitrogen is a major factor for eutrophication and biodiversity loss and contributes to global warming. Even though most nitrates in drinking water come from fertilizer, a full analysis would have to consider more than just the passage from fertilizer to drinking water. Since part of the fertilizer nitrogen also ends up as emission of Nmosphere , the damFor our assessment we assume a link with colon cancer as working hypothesis to provide a tentative assessment of health loss and social cost of nitrate in drinking water in the European Union. Ward et al.  indicateData were taken from IARC , Michelihttp://www.ikcnet.nl/). Total prevalence of colon cancer in the Netherlands, 169 cases per 100,000, compares well to the average situation in the Europe, 176 cases per 100,000 [We inferred loss of healthy life years and life years due to premature death using data on colon cancer incidence and mortality per five year age class between 1989 and 2006 provided by the Dutch Cancer Registry , the odds ratio almost doubled as compared to the reference group that was not exposed to NO3-N levels exceeding 5 mg/L. This association was not found for rectum cancer.We derive the increased colon cancer risk from DeRoos et al. , a case-3-N exceeding 5 mg/L for more than ten years, but only the increased risk of approximately a factor 2 for the subpopulation with above median meat intake is statistically significant (95% CI). For the purpose of this assessment we assumed a doubling of colon cancer incidence for above median meat consumers exposed to a NO3-N concentration exceeding 5 mg/L (22.5 mg/L NO3). In an ecologic study, Gulis et al. [3-N concentrations of 4.5 mg/L in drinking water as compared to a reference group below 2.2 mg/L. These results are similar to those of DeRoos [3-N concentrations exceeding 2.2 mg/L, but did find nearly a doubling of the relative risk of mortality for stomach cancer. Gulis et al. [Figure s et al.  found anf DeRoos , for whif DeRoos  combinedf DeRoos  did not s et al.  state th2, with model estimates of the agricultural nitrogen leaching from the rooting zone by Velthof et al. [First, we investigated potential associations between observed nitrate concentrations in shallow aquifers and estimates of the nitrogen leaching from agricultural land. For this purpose we combined monitoring data reported by Zwart et al.  to the Ef et al. . Velthoff et al. . The med2 = 0.67) was found between the % of samples with exceedance and the mean nitrogen leaching intensity (kg/ha/yr)  Figure ; eq. 1.3 was exceeded and therefore also a proxy for the percentage of the population, using private wells or small communal supplies, that is exposed to drinking water exceeding 25 mg/L NO3. We did not consider temporal trends of nitrate in groundwater.where LAE = fraction of land area in country with exceedance and N-leach = mean nitrogen leaching intensity (kg/ha/yr). We assume the percentage of exceedance in monitoring to be proportional to the land area where 25 mg/L NO3 may result from incidental exceedance in public supplies or structural exceedance in small local facilities or private wells.The relationship between nitrate in groundwater and in drinking water depends on the drinking water infrastructure and water treatment in the different EU member states. Important variables are the percentage of the population connected to public supply, the presence of drinking water treatment in public supplies and the relative use of surface water and groundwater. These parameters vary considerably across the EU; for 12 member states, selected for data availability, connection to large public supplies (serving more than 5000 customers or delivering more than on million liters per day) ranged from 36 to 100% and use of groundwater for public supply from 25 to 99% (Table 3) or nitrite (0.5 mg/L NO2) between 1995 and 2000 occurred in 0 and 4.5% of the water samples for large supplies in 12 reporting EU member states [Non-compliance with EU legal limits in the EU drinking water directive  for eithr states . Non-comr states .It may be expected that exposure in eastern European countries is higher than in northern and western Europe in view of a lower access of the rural population to improved drinking water supply (10-70% ) and low3 in 2001 were reported [3. Data on exceedance of 25 mg/L NO3 for the other 11 member states were not available and estimated using the Dutch value and the ratio of exceedance of 25 mg/L NO3 in untreated groundwater. Next exposure to drinking water from groundwater in public and private supplies exceeding 25 mg/L NO3 and using groundwater can be calculated (eqs. 2 and 3).In the Netherlands, nitrate concentrations in drinking water exceeding 25 mg/L NOL = fraction (%) of population in country exposed through large public supply systems; Exc EU = sum of levels (%) of non compliance to 50 mg NO3 and 0.1 mg/L NO2 for drinking water samples between 1995 and 2000 as officially reported to EU; Exc 25 mg/L = estimated fraction (%) of drinking water with NO3 between 25 and 50 mg/L taking the exceedance value of 5.3% for the Netherlands (NL) and assuming that Exc 25 mg/L is proportional to LAEcountry/LAENL; Connect = fraction (%) of population connected to large public supply; and Grw = fraction (%) of drinking water production from groundwater.where PopS = fraction (%) of population in country exposed through private wells and small public supply systems.where Pop3 concentrations above 25 mg/L the half that consumes more than the median amount of meat, has a risk of colon that is twice as high as for the total population (eq. 4).First the total colon cancer incidence was taken from section 'Present incidence and prevalence of colon cancer in Europe'. Next the proportion of cases associated with nitrate was inferred from section 'Increased risk of colon cancer due to exceedance of the nitrate standard in drinking water', where we assume that of the population exposed to NO3 in groundwater based drinking water; Incidence = crude total incidence of colon cancer ; \u0394R = increased risk of colon cancer for individuals that have consumed drinking water with NO3 in excess of 25 mg/L longer than 10 years and with above median meat consumption  and the number of years lived with disability (YLD), i.e. the loss of healthy life years. Thus we combine the nitrate related additional colon cases with the result of the section 'Loss of healthy life years and life years from premature death for colon cancer' to calculate the YLD and YLL both for individual member states and the EU (eq. 5).where Soc-Cost = social cost of loss of healthy life years and premature death from additional colon cancer; YLD = Years of life lived with disease (per colon cancer case); VYLD = value of a YLD = QALY score - VOLY; YLL = years of life lost (per colon cancer case); and VOLY = economic value of a life year.For the value of a life year (VOLY) we take 40,000 euro/YLL, as determined by a large contingent valuation study in nine EU countries by Desaigues et al. ; that vaFor the valuation of years lived with disability (YLD) we invoke the DALY and QALY scores that have been published for colon cancer. The DALY (Disability Adjusted Life Year) is an indicator for the severity of a health condition. Developed by the World Health Organization, the DALY is a number between 0  and 1 (death). The QALY  is a similar indicator, but its range is opposite, from 0 (death) to 1 . A DALY is roughly equivalent to 1 - QALY, although their precise definitions involve differences such as discounting and age-weighting (for DALY but not QALY). Such differences do not matter in view of the uncertainties, and we set the monetary value of a DALY or QALY equal to 1 VOLY = 40,000 euro/YLL. Mathers et al.  indicateNeedless to say, the uncertainties of the monetary valuation are large. In particular we note that often an alternative approach is used for the monetary valuation of fatal cancers, based on the value of a prevented fatality  for which the DG Environment of the European Commission assumes approximately one million euro ; some ecA unit N-cost or -benefit is defined as the monetary value of an effect  expressed per kg of pollutant or kg N in pollutant or per kg N in applied fertilizer. The unit N-cost approach allows a first comparison of the social benefit of less nitrate in drinking water to the social cost of measures to mitigate nitrate e.g. by water treatment or reduction of fertilizer use (eq. 6).where UCN = Unit damage cost (euro per kg of N leaching); and N-loss = nitrogen leaching loss from agricultural land (kg).3 ranged between 20% and 60% , to nearly 13% in Denmark. For the 12 EU member states, the total exposed population amounts to 23 million persons  of which 8 million persons (2.3%) were exposed through public supply.Connection to large public water supply varies considerably and is, among other factors, related to population density, cost for installing drinking water infrastructure and national policies. Also the use of groundwater for drinking water varies and is typically related to the presence of aquifers. Using Equation 1 Figure , the are3 for more than 10 years doubles the risk. The total loss for these 11 countries is 23,000 YLD and 18,000 YLL. Although this loss is modest, it represents a total social cost of 1.0 billion euro per year or 2.9 euro year per person averaged over the entire population , and to 150 euro per year for a person exposed to drinking water exceeding 25 mg/L NO3. Low values (less than one euro/capita) are found for the UK, Finland and Ireland and in part could be viewed as benefits of investments in a good drinking water infrastructure. The highest values (3-7 euro/capita) are found for Denmark, Italy, France and Germany, in part due to lower levels of connection to or availability of large high quality drinking water infrastructure, in combination with high nitrate leaching. Finally the unit cost is obtained by dividing the health cost by the total quantity of NO3-N leaching in each country. Unit damage cost for the 11 countries ranges between 0.1 and 2.4 euro per kg of N leaching, with an average of 0.7 euro/kg.In Table The results for social cost and unit cost of health loss due to nitrate in drinking water should be viewed as tentative values for comparative use against social costs or benefits of impacts for other nitrogen pollutants or against cost of measures. In fact, our assessment is based on just one epidemiological study in Iowa using a number of educated assumptions and guesses about exposure in the EU. The main sources of data uncertainty are discussed in Table In view of the uncertainty about the health impact itself, the lower limit of the health cost is zero, and in line with the lower limit of the 95% confidence interval of the risk increase inferred from DeRoos et al. . Using tAnother source of bias is that our analysis is based on data for 11 \"old\" EU member states with relatively high GDP and levels of implementation of environmental and drinking water policies. For the new central and east EU member states the social cost per capita is expected to be higher.Typical measures to prevent nitrate exceedance in drinking water are blending polluted water with clean water, biochemical water treatment and installing deeper extraction wells. Data on costs of these measures are scarce but the costs are expected to decrease with increasing scale of the drinking water production. Illustrative annual cost values are 0.5 euro/capita/yr for water treatment and mixing for the UK and the Netherlands where large aquifers are available ,33, 3 euAreas with aquifers suitable for groundwater extraction for drinking water production often are also areas suitable for agriculture. For this reason use of fertiliser or manures is a major source of nitrate pollution, and reduction of this use is a typical measure to prevent nitrate pollution of aquifers. Agricultural production clearly benefits from additional nitrogen input, but there is an optimum and for some crops  the yield diminishes when the nitrogen input is further increased (see for example Lord and Mitchell ). Althou2O, NO2 and NH3 to the atmosphere [x  and 9.5 euro/kg of ammonia . In ExternE the exposure-response functions for health are assumed to be linear without threshold. Health impacts of these compounds are mainly indirect and mediated through several steps, where NOx, and NH3 act as precursors for ozone and/or airborne particulate matter. The health impacts for airborne NH3-compounds are very uncertain and unit costs could be much smaller. Using typical emission factors [x-N from fertilizer (0.2-0.6%) and NH3-N  mean damage costs were derived for the EU per kg applied fertilizer N (Table 3 (0.7 euro/kg of N) is much lower than for NOx and NH3, health damage values expressed per kg of added fertilizer-N are comparable because of the relatively high emission factor for nitrate. Consideration of the health cost of nitrate leaching from fertilizer and manure in agriculture, is therefore a relevant N-related externality that needs to be considered when defining the socially optimal input level of nitrogen in agriculture [Since part of the fertilizer or manure nitrogen ends up as emission of Nmosphere , the dammosphere  and CAFEmosphere , in the mosphere , and by mosphere . These a factors  for NOx- N Table . This reiculture , in addi3-N leaching. The cost of water treatment to abate exceedance of 25 mg/L ranges between 0.5 and 3 euro/capita/yr, indicating that these measures are beneficial for society. Average costs to prevent nitrate exceedance by reduced fertilizer use range between 0.6 and 2.7 euro/kg of N-fertilizer, and tend to be lower in regions with intensive fertilizer use. These values indicate that in these regions, reduction of fertilizer use will also likely create net benefits for society, particularly when drinking water production is vulnerable to nitrate leaching.Health loss due to nitrate in drinking water is an issue under debate both in the scientific and policy arena. Estimates of associated health loss and potential welfare effects can help to evaluate current nitrate policies and measures. We derived a first and tentative estimate of a 3% increase of incidence of colon cancer for 11 EU member states due to nitrate in drinking water exceeding 25 mg/L, being half the legal US and EU limit of 50 mg/L. This health impact corresponds to an economic loss of 2.9 euro/capita/yr and of 0.7 euro per kg of NOHowever, the epidemiological evidence for increased risk of colon cancer is weak or absent. Clearer negative or positive answers about associations between nitrate in drinking water and disease are reasonably to be expected from prospective case-control studies. In view of the magnitude of the potential health gain (2.9 euro/capita/year) improved epidemiological studies would certainly be worthwhile. Then, integrated cost-benefit assessment of nitrogen management, including all relevant impacts and measures, including those debated for nitrate in drinking water, may help to further improve current EU nitrogen policies from a precautionary approach.CAFE: EU programme Clean Air for Europe; CBA: Cost Benefit Assessment; DALY: Disability Adjusted Life Year); ExternE: EU programme Externalities of Energy generation; EU: European Union ; GDP: Gross Domestic Product; NDMA: nitrosodimethylamine; QALY: Quality Adjusted Life Year; VYLD: economic Value of Life Year with Disability ; US EPA: USA Environmental Protection Agency; VOLY: economic Value Of a Life Year; YLD: number of Years Lived with Disability per cancer case; YLL: number of Years of Life Lost.The authors declare that they have no competing interests.HJMG is an agro-environmental scientist and did the actual assessment. AR is one of the lead scientists in ExternE and contributed to the social cost approach. TMK is a toxicologist and provided input on medical and physiological aspects of colon cancer incidence. All authors read and approved the final manuscript."}
{"text": "Monocytes have long been considered a heterogeneous group of cells both in terms of morphology and function. In humans, three distinct subsets have been described based on their differential expression of the cell surface markers CD14 and CD16. However, the relationship between these subsets and the production of cytokines has for the most part been based on ELISA measurements, making it difficult to draw conclusions as to their functional profile on the cellular level. In this study, we have investigated lipoteichoic acid (LTA)- and lipopolysaccharide (LPS)-induced cytokine secretion by monocytes using the FluoroSpot technique. This method measures the number of cytokine-secreting cells on the single-cell level and uses fluorescent detection, allowing for the simultaneous analysis of two cytokines from the same population of isolated cells. By this approach, human monocytes from healthy volunteers could be divided into several subgroups as IL-1\u03b2, IL-6, TNF-\u03b1 and MIP-1\u03b2 were secreted by larger populations of responding cells (25.9\u201339.2%) compared with the smaller populations of GM-CSF (9.1%), IL-10 (1.3%) and IL-12p40 (1.2%). Furthermore, when studying co-secretion in FluoroSpot, an intricate relationship between the monocytes secreting IL-1\u03b2 and/or IL-6 and those secreting TNF-\u03b1, MIP-1\u03b2, GM-CSF, IL-10 and IL-12p40 was revealed. In this way, dissecting the secretion pattern of the monocytes in response to TLR-2 or TLR-4 stimulation, several subpopulations with distinct cytokine-secreting profiles could be identified. Monocytes and macrophages are key cells of the innate immune system. Here, they fulfil a series of important functions relating to their phagocytic capacity, their role as antigen-presenting cells and their ability to produce and secrete a large number of signalling molecules including pro- and anti-inflammatory cytokines . DevelophighCD16\u2212) represent the great majority (90\u201395%) of all monocytes and are referred to as \u2018classical\u2019 monocytes. The remaining, \u2018non-classical\u2019 monocytes are CD16+ and have been further divided into two subsets based on their level of CD14 expression, CD14dimCD16+ and CD14highCD16+. These two minor subpopulations of cells are thought to represent more mature macrophage-like monocytes  and TLR-4 [ultrapure lipopolysaccharide (LPS) from E. coli K12] were all from InvivoGen . Red blood cell (RBC) lysis buffer was purchased from BioLegend . Anti-cytokine monoclonal antibodies (mAb) for ELISpot and FluoroSpot were obtained from Mabtech  for the detection of the following cytokines: IL-1\u03b2, IL-6, TNF-\u03b1, MIP-1\u03b2, GM-CSF, IL-10 and IL-12p40. Based on their reactivity with the p40 chain common to both IL-12 and IL-23, the IL-12p40 reagents also detected IL-23-secreting cells. Streptavidin-alkaline phosphatase (SA-ALP) and BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitro-blue tetrazolium) substrate were both from Mabtech as were anti-FITC-Green, Streptavidin-Red and fluorescence enhancer. The CD16+ monocyte isolation kit was from Miltenyi Biotec . For flow cytometry, Phycoerythrin (PE)-conjugated anti-CD3 (clone HIT3a), anti-CD19 (clone HIB19), anti-CD56 (clone MEM-188) and Alexa Fluor 488-conjugated anti-CD16 (clone 3G8) mAb (including recommended isotype controls) were purchased from BioLegend. PE-conjugated anti-CD14 (clone M5E2) mAb and the recommended isotype control were from BD Biosciences  as were the BD Vacutainer\u00ae blood collection tubes containing sodium citrate.RPMI1640, penicillin/streptomycin, HEPES and low-endotoxin (<1 EU/ml) FCS were all purchased from Invitrogen Life Technologies . Ficoll-Paque\u2122 PLUS was obtained from GE Healthcare Life-Sciences . The RosetteSep\u00ae Monocyte enrichment cocktail was purchased from Stemcell Technologies . Ligands for TLR-2 [purified lipoteichoic acid (LTA) from m EDTA (PBS/FCS/EDTA) and layered on top of 15 ml Ficoll-Paque\u2122 PLUS. After centrifugation at 1200 g for 20 min, the enriched monocytes were collected, washed twice in PBS/FCS/EDTA and suspended in cell culture medium . The enriched monocytes, comprising the whole population of classical (CD14highCD16\u2212), non-classical (CD14dimCD16+) and intermediate (CD14highCD16+) monocytes, were then counted and analysed for viability  using the Guava ViaCount assay and the EasyCyte Mini System . With this protocol, the average proportion of CD14-positive cells was 79%  including an average of 9% CD16+ monocytes. The level of contaminating T cells, B cells and NK cells in these monocyte preparations was found to be below 2% as assessed by flow cytometry.Blood was obtained from healthy volunteers after informed consent and with approval from the ethics committee at the Karolinska Institute, Stockholm, Sweden. The blood was collected in sodium citrate, and monocytes were enriched according to the manufacturer\u2019s instructions using RosetteSep\u00ae (Monocyte enrichment cocktail). Briefly, 750 \u03bcl of RosetteSep cocktail was mixed with 15 ml of EDTA-treated whole blood and incubated for 20 min at room temperature (RT). The sample was then diluted 1:1 in PBS containing 2% FCS with 1 m+ monocytes were isolated using magnetic beads. For this purpose, one volume of blood was mixed with one volume of PBS and layered on top of Ficoll-Paque\u2122 PLUS. After centrifugation at 400 g for 30 min at 22 \u00b0C, the peripheral blood mononuclear cells (PBMC) fraction was collected, washed twice and suspended in cell culture medium. Following depletion of granulocytes and NK cells, the CD16+ monocytes were then isolated using anti-human CD16 microbeads according to the manufacturer\u2019s instructions . The average purity of the CD16+ monocyte preparations was 88% as assessed by flow cytometry.For one set of FluoroSpot experiments, CD162O. Capture anti-cytokine antibodies were diluted with sterile PBS to 15 \u03bcg/ml, and 100 \u03bcl was added to each well. After incubation overnight at +4 \u00b0C, the coated wells were washed five times with 200 \u03bcl/well of sterile PBS followed by blocking of the membrane for 30 min with 200 \u03bcl/well of cell culture medium. The medium was then removed, and 50 \u03bcl/well of the same culture medium with or without stimuli (LTA 1000 ng/ml or LPS 100 ng/ml) was added followed by the addition of 50 \u03bcl/well of cells (1000 or 3000 cells/well). Each sample was analysed in quadruplicates or triplicates. The plates were thereafter transferred to a 5%-CO2 incubator and incubated for 20 h at 37 \u00b0C. After incubation, cells were removed by washing five times with 200 \u03bcl/well of PBS using an automated ELISA washer . Detection antibodies conjugated with biotin or FITC were diluted with PBS with 0.5% FCS (PBS/FCS) to 1 \u03bcg/ml, and 100 \u03bcl was added to each well. After incubation for 2 h at RT, plates were washed as mentioned previously and wells with biotinylated detection antibodies were incubated for 1 h at RT with 100 \u03bcl/well of Streptavidin (SA) conjugated either with alkaline phosphatase (ALP) diluted 1:1000 in PBS/FCS for ELISpot or with red fluorophore, diluted to 0.5 \u03bcg/ml in PBS/FCS for FluoroSpot. At the same time, wells with FITC-labelled detection antibodies were incubated with anti-FITC-Green mAb (0.5 \u03bcg/ml in PBS/FCS). After incubation for 1 h at RT, plates were again washed five times with 200 \u03bcl/well of PBS. At this stage, the plastic underdrain of the FluoroSpot plates was removed (not for ELISpot) and the plates were incubated with either 100 \u03bcl/well of the substrate BCIP/NBT (ELISpot) or fluorescence enhancer (FluoroSpot). In ELISpot, the substrate reaction was stopped after 10 min by extensive washing in tap water and the plates were left to dry at RT. In FluoroSpot, the fluorescence enhancer was discarded after 10 min and plates were left to dry protected from light. Analysis and counting of spots were made in an ELISpot/FluoroSpot reader system  where fluorescent spots were counted utilizing separate filters for FITC and Cy3. Double-secreting cells were determined as spots having the same position (centre point) in an image overlay of FITC and Cy3 images (FITC+Cy3).Low-fluorescent 96-well PVDF membrane plates  were prewet with 20 \u03bcl 35% ethanol/well for 1 min and washed five times with 200 \u03bcl sterile H3 and 0.5% FCS (FACS buffer). Cells were then stained for expression of CD3, CD14, CD19, CD56 and CD16 by incubating 4 \u00d7 105 cells with anti-CD3-PE (10 \u03bcl), anti-CD14-PE (20 \u03bcl), anti-CD19-PE (20 \u03bcl), anti-CD56-PE (10 \u03bcl) and anti-CD16-Alexa488 (5 \u03bcl) for 15 min at 4\u00b0C in a total volume of 50 \u03bcl. After incubation, cells were washed twice in FACS buffer and analysed by flow cytometry in a Guava EasyCyte Mini System. Matched isotype controls were used to establish the background level of non-specific staining. Guava ExpressPro software (Guava Technologies) was used for data acquisition and analysis.Prior to examining the purity of our isolated monocytes, erythrocytes were lysed according to the manufacturer\u2019s recommendations using RBC lysis buffer and suspended in cold PBS with 0.02% NaNspss 16.0 software . Differences were considered significant for *P < 0.05.Data are presented as boxplots or as means \u00b1 range. The number of individuals assessed is indicated in each figure legend. Statistical analysis was performed by applying the Wilcoxon signed-rank test using We have previously investigated monocyte-derived cytokine secretion in ELISpot using PBMC as the source of cells . In thisTo assure that the FluoroSpot assay was comparable in performance and sensitivity to the ELISpot method, enriched monocytes (1000 or 3000 cells per well) were incubated for 20 h with or without LPS (50 ng/ml) and the frequencies of cytokine-secreting cells were determined using the two methods in parallel. In the FluoroSpot assay, detection was performed either using FITC-labelled detection antibody  in combination with anti-FITC-Green or with biotinylated detection antibody  in combination with Streptavidin-Red. Both assays were performed in low-fluorescent PVDF membrane plates to allow optimal detection of fluorescent spots. As shown in To investigate the numbers of cytokine-secreting cells after TLR-2 and TLR-4 stimulation, enriched monocytes from six healthy donors were incubated for 20 h in the absence or presence of LTA (500 ng/ml) or LPS (50 ng/ml) and analysed in FluoroSpot for the secretion of seven monocyte-derived cytokines . As prevAfter having established the number of secreting cells for each cytokine and stimulus, we went on to investigate co-secretion among the most frequent cytokines secreted, that is IL-1\u03b2, IL-6, TNF-\u03b1 and MIP-1\u03b2. For this purpose, plates were coated with anti-IL-1\u03b2 or anti-IL-6 antibodies in combination with antibodies to either TNF-\u03b1 or MIP-1\u03b2, and detection was performed using secondary reagents coupled with green fluorophore (IL-1\u03b2 and IL-6) or red fluorophore . By this approach, three distinct subpopulations could potentially be revealed: FITC \u2013 single-secreting cells, FITC + Cy3 \u2013 double-secreting cells and Cy3 \u2013 single-secreting cells.As shown in GM-CSF-secreting monocytes, when combined with IL-1\u03b2, displayed a limited degree of co-secretion . ConsequCompared with the high frequencies of monocytes secreting IL-1\u03b2, IL-6, TNF-\u03b1 and MIP-1\u03b2, (25.9\u201339.2%) only a minority secreted IL-10 and IL-12p40 (<2%). Lacking suitable reagents for the double staining, we could not establish to what extent IL-10 and IL-12p40 were produced by the same or different populations of cells. However, simultaneous staining for IL-12p40 and IL-6 showed that a majority of the IL-12p40-secreting monocytes were also positive for IL-6 (78% with LTA and 87% with LPS), and a similar but slightly lower overlap was observed for IL-10 and IL-6 . In cont+ monocytes are recognized as key producers of TNF-\u03b1, their production of other cytokines is less clear, and contradicting data exist as to their secretion of IL-10 [+ non-classical and intermediate monocytes (CD14dimCD16+ and CD14highCD16+) were separated from PBMC using anti-CD16 magnetic beads and analysed in FluoroSpot in the absence or presence of LPS (1000 cells per well).Although CD16of IL-10 \u201316. To e+ monocytes secreted TNF-\u03b1 and of this population, approximately half co-secreted IL-6  . Apart fFor example, cytokine determinations based on ELISA and RT-PCR have only resulted in crude characterizations as neither assay permits resolution at the cellular level \u201316. FurtBy this approach, we were able to determine the numbers of monocytes secreting IL-1\u03b2, IL-6, TNF-\u03b1, MIP-1\u03b2, GM-CSF, IL-10 and IL-12p40 in response to stimulation. Of these, the first four were secreted by larger populations of the cells (25.9\u201339.2%), whereas GM-CSF was produced by a smaller population (9.1%) and IL-10 and IL-12p40 only by a few per cent (1.2\u20131.3%) of the monocytes. This pattern of secretion was surprisingly consistent between different donors and, apart from IL-1\u03b2 and IL-12p40, very similar for both LTA and LPS stimulation .Given the similar and high numbers of monocytes secreting IL-1\u03b2, IL-6, TNF-\u03b1 and MIP-1\u03b2, it was natural to assume that these cytokines were, in fact, all secreted by the same population of cells. However, once we were able to combine these cytokines in two-colour FluoroSpot, the results revealed a much more intricate, but consistent pattern of co-secretion. Thus, while the two cytokines IL-6 and MIP-1\u03b2 showed a high degree of secretory overlap, co-secretion of IL-1\u03b2 and MIP-1\u03b2 was only observed in a minority of the cells . This loWhile our results provide further support for the heterogeneous nature of monocytes, they also demonstrate the possibility of dividing these cells into several subsets based on differences in cytokine-secreting capacity. A similar division of T cells into subpopulations, each with their own unique cytokine profile, has proven very useful and has allowed for the characterization of a number of T cell subsets with distinct functional properties . Althoug+ monocytes have been claimed to be the major source of TNF-\u03b1 [+ population when compared to the number of cells secreting IL-6 or MIP-1\u03b2 . Furthermore, it has been claimed that the monocytes secreting IL-10 are primarily found in the CD14highCD16+ subpopulation [dimCD16+ subset. However, in line with previous investigators [+ population (Differences in cytokine production by monocytes have been reported previously, and CD16of TNF-\u03b1 \u201315. In lr MIP-1\u03b2 . Howevertigators \u201315, we wpulation .Finally, while the results of this study add a further level of complexity to monocytes, we believe that they also provide a meaningful basis for further characterization of these cells from a functional perspective and may therefore serve as an important complement to the currently accepted subclassification of monocytes. We also think that the same approach may be used to study cytokine secretion by other members of the MPS, including macrophages, dendritic cells and bone marrow\u2013derived precursors and that such characterization may offer new insights into their functional/developmental relationships."}
{"text": "A new variant of Creutzfeldt Jacob Disease (vCJD) was identified in humans and linked to the consumption of Bovine Spongiform Encephalopathy (BSE)-infected meat products. Recycling of ruminant tissue in meat and bone meal (MBM) has been proposed as origin of the BSE epidemic. During this epidemic, sheep and goats have been exposed to BSE-contaminated MBM. It is well known that sheep can be experimentally infected with BSE and two field BSE-like cases have been reported in goats. In this work we evaluated the human susceptibility to small ruminants-passaged BSE prions by inoculating two different transgenic mouse lines expressing the methionine (Met) allele of human PrP at codon 129 (tg650 and tg340) with several sheep and goat BSE isolates and compared their transmission characteristics with those of cattle BSE. While the molecular and neuropathological transmission features were undistinguishable and similar to those obtained after transmission of vCJD in both transgenic mouse lines, sheep and goat BSE isolates showed higher transmission efficiency on serial passaging compared to cattle BSE. We found that this higher transmission efficiency was strongly influenced by the ovine PrP sequence, rather than by other host species-specific factors. Although extrapolation of results from prion transmission studies by using transgenic mice has to be done very carefully, especially when human susceptibility to prions is analyzed, our results clearly indicate that Met129 homozygous individuals might be susceptible to a sheep or goat BSE agent at a higher degree than to cattle BSE, and that these agents might transmit with molecular and neuropathological properties indistinguishable from those of vCJD. Our results suggest that the possibility of a small ruminant BSE prion as vCJD causal agent could not be ruled out, and that the risk for humans of a potential goat and/or sheep BSE agent should not be underestimated. Prion diseases, also referred as transmissible spongiform encephalopathies, are fatal neurodegenerative diseases caused by proteinaceous infectious particles denominated \u201cprions.\u201d Prion diseases acquired their first real public relevance with the outbreak of bovine spongiform encephalopathy (BSE) (\u201cmad cow disease\u201d) in the United Kingdom in the 80s and its link with the appearance of a new, variant form of Creutzfeldt-Jakob disease in humans. Recycling of ruminant tissues in meat and bone meal has been proposed as origin of the BSE epidemic. During this episode, sheep and goats have also been exposed to BSE-contaminated meal, so transmission to this species may have occurred. We analyzed the human susceptibility to sheep and goat passaged-BSE prions by using transgenic mice expressing human prion protein (PrP). When different sheep and goat BSE isolates were inoculated in these transgenic mice, higher susceptibility than that observed for cattle BSE was detected and the disease manifestation was similar to that observed in mice inoculated with the new variant of Creutzfeldt-Jakob disease. Our findings suggest that humans are at least equally, and might be even more, susceptible to a sheep or goat BSE agent compared to a cattle BSE one. Sc) of the cellular prion protein (PrPC) Sc is widely distributed in lymphoid tissues of experimentally BSE-infected sheep Transmissible Spongiform Encephalopathies (TSEs) are fatal neurodegenerative diseases which include Scrapie in sheep and goats, Bovine Spongiform Encephalopathy (BSE) and Creutzfeldt-Jakob disease (CJD) in humans. Prions, the causal agents of these diseases are thought to be infectious protein particles essentially composed of a misfolded isoform  without clear clinical signs. The remaining inoculated mice failed to develop a clinical disease or to accumulate detectable levels of PrPres in the brain up to \u223c700 days after inoculation. On second passage performed with brain homogenate from a PrPres-negative mouse (succumbed at 576 dpi) from the first passage (BSE2 isolate), 3 out of 4 inoculated tg340 mice tested positive for brain PrPres by western blot with a survival time of 572\u00b137 d.p.i. It is important to note that all the cattle BSE isolates tested in this study were transmitted as efficiently as vCJD isolates or other BSE-related sources to bovine PrP transgenic mice , respectively. These features were stable upon subpassaging, suggesting an absence of transmission barrier for this agent  and 3. Inic mice  and 3, tres detection in the brain) with almost all the sheep and goat BSE isolates used  contained higher PrPres levels in their brains than the sheep and goat BSE isolates  and prominent diglycosylated species was consistently observed in the challenged, PrPres-positive mice. This signature clearly differed from that observed after inoculation of mice with sporadic CJD (89WGQGG93 according to the human PrP sequence) is known to be poorly protected from proteinase K digestion 2) in tg340 mice, one of the three positive mice presented a brain PrPres profile clearly distinct from PrPvCJD, that was comparable to that of typeI sCJD-inoculated tg340 mice with predominantly monoglycosylated and higher size fragments (\u223c21 kDa for the aglycosyl band) and preserved detection by 12B2 antibody  and on 3rd passage in tg650. As illustrated in The regional distribution of PrPAt microscopic level, abundant amyloid-like plaques were present , as sugg2) was passaged into bovine (tg110) and ovine PrP transgenic mice  2/TgBov and Ca-BSE2/TgOv, 2/TgBov isolate did not induce a clinical disease nor PrPres accumulation in tg340 mice while an intermediate passage on the ovine PrPARQ sequence (Ca-BSE2/TgOv) restored the disease susceptibility, with survival times, biochemical and neuropathological features similar to those obtained with experimental sheep BSE isolates  produced the shortest disease in bovine PrP transgenic mice (0/TgOv isolate (which maintains its PrP ovine sequence) showed a full transmission rate in human transgenic mice with similar survival times as those of the original Sh-BSE0 isolate  in bovine PrP transgenic mice  in two different laboratories. In general, the transmission results obtained in both human-PrP transgenic mouse lines were very comparable. Some shortening in survival times was observed in tg650 mice (compared to the tg340 mice line), which was probably due to higher PrP expression levels in this line. Worryingly, our results support the view that an intermediate passage of BSE agent in small ruminants accelerates the appearance of a vCJD-like disease in human PrP mice or markedly increases its transmission efficiency. Because the apparent phenotype of cattle and sheep/goat BSE prions is conserved, these data also unravel an important role of PrPThe transmission efficiency of cattle BSE isolates in both human-PrP transgenic mouse models was apparently low. With all BSE isolates, whose high infectivity has been demonstrated in bovine-PrP transgenic mice  and 3, vSc type of cattle and sheep/goat BSE agents appeared indistinguishable from the vCJD agent propagated in these mice, as previously demonstrated in bovine transgenic mice res appeared similar in human-PrP transgenic mice, other assays are currently performed to further compare the biochemical or biophysical properties of the respective proteins are ongoing.Remarkably, a different picture emerged when the sheep and goat BSE isolates were inoculated to human PrP transgenic mouse models. Attack rates approaching 100% were observed from the primary passage onwards and mean incubation times were more consistent with those measured after transmission of vCJD. On further passaging, the neuropathological phenotype and PrPres content of these isolates. In addition, the data from inoculation to BoPrP-Tg reporter mice suggest that cattle BSE and sheep and goat-BSE isolates could have similar transmission efficiency , suggesting no infection, in accordance with the lack of epidemiological evidence linking scrapie with human TSE. Moreover, the low transmission efficiency observed for the cattle BSE agent is not exclusively linked to the bovine PrP sequence since other uncommon BSE strains (BSE-L) are efficiently transmitted to human-PrP mice C prefers a BSE PrPSc with conformational characteristics templated by the ovine sequence, to a bovine BSE PrPSc. Because a similar increased transmission efficiency of sheep/goat BSE has been reported in wild type mice Sc sequence may not be limited to human PrPC. One explanation might be an alteration in the quaternary structure (after passage into sheep/goat) generating PrPSc polymers less degraded or more rapidly/easily amplified favouring or enhancing the initial conversion. This question is currently being addressed by sedimentation velocity The PrP primary sequence influence seems to depend strongly on the strain involved, since no PrPAlthough extrapolation of results from prion transmission studies by using transgenic mice has to be done very carefully, especially when human susceptibility to prions is analyzed, our results clearly indicate that Met129 homozygous individuals might be susceptible to a sheep or goat BSE agent at a higher degree than to cattle BSE, and that these agents might transmit with molecular and neuropathological properties indistinguishable from those of vCJD. Although no vCJD cases have been described in Val129 homozygous individuals so far it is relevant to analyze if similar results will be observed in this genotype. This issue is currently being addressed in transmission experiments using transgenic mice expressing Val129 human PrP.res detected in brains of our sheep and goat BSE-inoculated mice seem to be indistinguishable from that observed in vCJD. Considering the similarity in clinical manifestation of BSE- and scrapie-affected sheep Sc have been detected in many peripheral organs, small ruminant-passaged BSE prions might be a more widespread source of BSE infectivity compared to cattle Taken all together, our results suggest that the possibility of a small ruminant BSE prion as vCJD causal agent could not be ruled out, which has important implications on public and animal health policies. On one hand, although the exact magnitude and characteristic of the vCJD epidemic is still unclear, its link with cattle BSE is supported by strong epidemiological ground and several experimental data. On the other hand, the molecular typing performed in our studies, indicates that the biochemical characteristics of the PrPAnimal experiments were carried out in strict accordance with the recommendations in the guidelines of the Code for Methods and Welfare Considerations in Behavioural Research with Animals (Directive 86/609EC) and all efforts were made to minimize suffering. Experiments were approved by the Committee on the Ethics of Animal Experiments of the author's institutions (INRA and INIA); Permit Number: RTA06-091 and CT05-036353.The isolates used in this study are described in The tg650 transgenic mouse line over expresses human PrP M129 at a 6-fold level on a mouse PrP null background res) by immunohistochemistry (IHQ) or histoblotting and the other was frozen at \u221220\u00b0C to determine presence of PrPres by Western blot (WB). In all cases, survival time and attack rate were calculated for each isolate. Survival time was expressed as the mean of the survival days post inoculation (d.p.i.) of all the mice scored positive for PrPres, with its correspondent standard error. Attack rate was determined as the proportion of mice scored positive for PrPres from all the mice inoculated. When all mice were scored negative for PrPres, the survival time range was shown. Brain homogenates from PrPres positive mice, when available, were used for further passaging. When all mice were scored negative for PrPres on primary passage, PrPres-negative brain homogenates were used for second passage.All inocula were prepared from brain tissues as 10% (w/v) homogenates. Individually identified 6\u201310 week-old mice were anesthetized and inoculated with 2 mg of brain homogenate in the right parietal lobe using a 25-gauge disposable hypodermic needle. Mice were observed daily and the neurological status was assessed weekly. When progression of a TSE disease was evident or at the end of lifespan, animals were euthanized because of ethical reasons. Once euthanized, necropsy was performed and brain was taken. A part of the brain was fixed by immersion in 10% formol to quantify spongiform degeneration by histopathology and PK resistant PrP accumulation . 10\u201350 \u00b5l of a 10% (w/v) brain homogenate were diluted in a 10% (w/v) negative sheep brain homogenate, to obtain a 200 \u00b5l final volume. Homogenates were incubated for 10 min at 37\u00b0C with 200 \u00b5l of a 2% proteinase K solution (in buffer A). PrPres was recovered as a pellet after addition of 200 \u00b5l of buffer B and a centrifugation at 15,000\u00d7 g for 7 min at 20\u00b0C. Supernatants were discarded and pellets were dried inverted over absorbent paper for 5 min. Pellets were solubilised in Laemmli buffer and samples were incubated for 5 min at room temperature, solubilised, and heated at 100\u00b0C for 5 min. Samples were centrifuged at 20,000\u00d7 g for 15 min at 20\u00b0C and supernatants were recovered and loaded on a 12% Bis-Tris Gel . Proteins were electrophoretically transferred onto PVDF or nitrocellulose membranes (Millipore). Membranes were blocked O/N with 2% BSA blocking buffer. For immunoblotting, membranes were incubated with either Sha 31 175\u00b120 mg of frozen brain tissue were homogenized in 5% glucose in distilled water in grinding tubes (Bio-Rad) adjusted to 10% (w/v) using a TeSeE\u2122 Precess 48\u2122 homogenizer (Bio-Rad) following manufacturer instructions. Presence of PrPAll procedures involving mice brains were performed as previously described nd and 3rd passage, using the 3F4 anti-PrP antibody as previously described Brains were rapidly removed from euthanised mice and frozen on dry ice. Thick 8\u201310 \u00b5m cryostat sections were cut, transferred onto Superfrost slides and kept at \u221220\u00b0C until use. Histoblot analyses were performed on 3 brains per infection at 2XhoI restriction enzyme site adjacent to the translation start and stop sites of the human PrP ORF . The PCR fragments obtained were sub cloned into a pGEM-T Easy Vector System (Promega) following manufacturer instructions, and inserts were sequenced to confirm no differences in the inferred amino acid sequence with respect to previously sequenced human PrP genes (GenBank accession number NM_183079) and to confirm the presence of the consequent codon 129 nucleotide variant (MetATG). The human PrP ORF was excised from the cloning vector using the restriction enzyme XhoI and inserted into the expression vector MoPrP.Xho XhoI restriction sites but could be distinguished from the wild type murine PrP gene because of the absence of intron 2. The vector was also digested with XhoI to excise the murine PrP ORF and the correspondent human PrP ORF were inserted by ligation, obtaining the plasmid pMo-huPrP129M.Xho.Tg340 mouse line expressing about 4-fold level of human PrP M129 on a mouse PrP null background has been generated following a similar procedure previously describe for the generation of other transgenic mouse line expressing different species PrP Not I leading to DNA fragments of approximately 12 Kb. Finally, the DNAs were purified and dissolved in TE at a final concentration of 2 to 6 \u00b5g/ml and microinjected into pronuclear stage ova collected from super-ovulated B6CBAf1 females mated with 129/Ola males carrying a null mutation in endogenous PrP The human transgene was excised from the plasmid vector using the restriction endonuclease 5\u2032- TAGATGTCAAGGACCTTCAGCC- 3\u2032 and 5\u2032- GTTCCACTGATTATGGGTACC -3\u2032.DNA from founders' tails biopsies was extracted using a Extract-N-Amp Tissue PCR kit (Sigma-Aldrich) following manufacturer instructions. The presence of the human transgene in these founders was identified by PCR amplification using specific primers for the mouse PrP exon 2 and human PrP open reading frame. The absence of the murine PrP ORF in the transgenic mice generated was confirmed by PCR amplification using the primers: C (huPrP) and murine PrPC (muPrP) heterozygous transgenic mice (PrP mu+/\u2212 hu+/\u2212) were obtained. The expression of human PrPC in brain of these mouse lines was analyzed and compared with PrPC content in human brain homogenate by western blot using mAb 3F4 which recognizes the 109MKHM112 epitope (numbered according to the human PrP sequence). Human PrPC was detected in 100% of the tested lines (data not shown). From the initial 8 different mouse lines heterozygous for both murine and human PrP genes (PrP mu+/\u2212 hu+/\u2212), the mouse line named as tg340 was selected for further experiments on the basis of the level of PrPC expression.Eight different lines (founders) of human PrP\u2212/\u2212 (Prnp\u2212/\u2212) to obtain a null murine PrP background (PrP mu\u2212/\u2212 hu+/\u2212). Interbreeding within these animals was performed to obtain homozygosis for the human PrP transgen within a murine PrP background (PrP mu\u2212/\u2212 hu+/+). The absence of murine PrP gene was determined by PCR using specific primers. Human PrPC expression levels, determined more accurately in brain from homozygous tg340 animals was about 4-fold higher than PrPC levels in human brain homogenates as determined by dilution experiments in western blot (Homozygous Tg340 mouse line was established backcrossing these animals with homozygous null animals MuPrPern blot .Prnp gene used in this paper is NM_183079.The GenBank accession number for the human"}
{"text": "BSE can infect small ruminants and could be misdiagnosed as scrapie. Transmissible spongiform encephalopathies are fatal neurodegenerative diseases that include variant Creutzfeldt-Jakob disease in humans, scrapie in small ruminants, and bovine spongiform encephalopathy (BSE) in cattle. Scrapie is not considered a public health risk, but BSE has been linked to variant Creutzfeldt-Jakob disease. Small ruminants are susceptible to BSE, and in 2005 BSE was identified in a farmed goat in France. We confirm another BSE case in a goat in which scrapie was originally diagnosed and retrospectively identified as suspected BSE. The prion strain in this case was further characterized by mouse bioassay after extraction from formaldehyde-fixed brain tissue embedded in paraffin blocks. Our data show that BSE can infect small ruminants under natural conditions and could be misdiagnosed as scrapie. Surveillance should continue so that another outbreak of this zoonotic transmissible spongiform encephalopathy can be prevented and public health safeguarded. Sc) of a naturally occurring host-encoded protein (PrPC)  are fatal diseases characterized by neurodegenerative changes in the central nervous system that include vacuolation, gliosis, and accumulation of an abnormal isoform , a TSE of cattle, was first detected in 1986  before homogenization. Unfixed samples were kept frozen at \u221280\u00b0C. After thawing, they were suspended in normal saline (10% wt/vol) before homogenization. All homogenates were examined microbiologically and treated with antimicrobial drugs as required. Only microbiologically cleared inocula were used to challenge animals.,The only tissue available from the 1990 suspected UK case . ParaffiSc distribution, which was verified by IHC analysis of the adjacent rostral and caudal coronal levels of the selected sample, we assumed that titer did not vary substantially on either side of the midline. Therefore, the obex was cut sagitally in half. Half was processed histologically and was subsequently recovered and rehydrated to replicate the process applied in the fixed samples; the other half was kept frozen. Each half was homogenized and inoculated into mice.Additional controls of fixed and frozen brain tissues from the same source were used to assess the effect of fixation, processing, and retrieval on the biological properties of the TSE agents present. All samples included in this study were from animals showing clinical signs of TSE. These came from animals with confirmed TSE sourced through passive surveillance schemes, with the exception of an ovine BSE case that was produced experimentally  and a transgenic mouse line . C57/BL6 and RIII mice share the same PrP sequence (PrP-a), but it is believed that RIII alone could be used to discriminate BSE from other TSEs on the basis of lesion profile (LP) data on first passage  were performed  of 4 different coronal levels  were stained with hematoxylin and eosin according to standard methods  according to established methods  and12B2 , epitope 93WGQGG97 (0.2 \u00b5g/mL) and 12% BisS/Tris (Criterion) acrylamide gels (Bio-Rad Laboratories) in 3-(N-morpholino)propanesulfonic acid buffer. Relative band mass was measured by using Quantity One software (Bio-Rad Laboratories).Western blotting (WB) was applied only for PrP-a mice (C57/BL6 and RIII) because PrP-b mice inoculated with either scrapie or BSE produce similar banding profiles and cannot be distinguished by this approach .Clinical-stage TSE  did not Sc bands that were indistinguishable from those of mice inoculated with the various BSE sources .After 1 serial passage in PrP-b (VM) mice, the sample from the goat with suspected BSE generated IP of 128 \u00b1 4 (mean \u00b1 SD) days postinoculation similar to serially passaged ovine BSE (109 \u00b1 4) and the 301V mouse-adapted BSE strain (107 \u00b1 6). The comparatively longer IP generated by that goat sample relative to these mouse-adapted BSE isolates is a common observation at second passage; for example, the IP of the serially passaged ovine BSE at second passage was 148 \u00b1 3 days postinoculation. In these mice, the LPs were indistinguishable from those produced by serially passaged experimental ovine BSE and similar to the 301V strain . After sSc mapping in the brain, and WB of PrPSc with those of mice inoculated with BSE from various ovine, caprine, and bovine sources.We confirmed that the agent responsible for TSE in a UK goat, which was initially reported as scrapie in 1990 and subsequently as suspected BSE in 2006 (Sc deposits can be identified, and the distribution of each deposit in the brain can be mapped (,,From a method perspective, the data suggest that AR, IP, and LP are not optimal bioassay parameters for differentiating TSE sources during first passage because they represent mean values derived from a group of animals that have been inoculated with a specific source. Therefore, a substantial number of animals must die of clinical TSE for these parameters to be meaningful. This finding is a limiting factor in instances in which TSE is diagnosed in only a few animals because of low titer, restricted permissiveness of specific TSE strains in certain laboratory animals, or both. These limitations can be overcome by application of IHC and WB to differentiate BSE from scrapie confidently in individual mice on first passage. Use of IHC has shown that different PrPSc patterning, WB can also be applied to diagnose BSE. In contrast, its application in PrP-b mice is less informative (The data show that the TSE agents in this study were not altered by the adverse conditions applied to them during histologic procedures. However, titer may decrease, suggesting that the effect of histologic processing is quantitative not qualitative. Therefore, bioassay is a valid approach for identifying BSE in archived histologic material when other techniques are not applicable, as in the current study. Regarding the suitability of different mouse lines for confirming BSE, our data show that any mouse line in which the agent can propagate sufficiently is suitable. An additional requirement at a practical level is the ability to characterize the agent on first passage. In this respect, use of PrP-a mice is preferable because in addition to AR, IP, histopathologic analysis, and PrP,These methods can also be applied to analyze bioassay data derived from validated transgenic mouse lines that offer the advantage of higher AR and decreased IP, provided that appropriate transgenic lines are selected and the TSE source and the donor species under investigation are taken into consideration. In this particular instance, our first choices would have been the use of a mouse line overexpressing a bovine transgene in combination with 1 that overexpresses a caprine transgene. At initiation of the study, an established bovinised line was not available to us, and the data generated from the wild-type mice were considered sufficient to identify unequivocally the agent strain. Caprine transgenic mouse lines are still under development and not characterized or widely available. Instead, we used tg338 mice although they show <100% AR and extended IP when inoculated with BSE (The 2 cases of naturally occurring BSE in small ruminants\u2014the 1 reported here and the 1 identified in France (,,,The BSE case we have confirmed was 1 of 26 historic goat samples examined in the United Kingdom collected during 1984\u20132002 (Because TSEs in goats are still a problem, particularly in Mediterranean countries, our data suggest that extensive surveillance and breeding schemes must remain in place to prevent a BSE outbreak in small ruminants and to safeguard public health. This report also highlights several issues regarding the use of mouse bioassay to identify TSE strains. As governing bodies seek confirmation of equivocal cases that are identified worldwide, they must be aware of the limitations, cost, and timescale demands of confirming such cases."}
{"text": "We compared transmission characteristics for prions from L-type bovine spongiform encephalopathy and MM2-cortical sporadic Creutzfeldt-Jakob disease in the Syrian golden hamster and an ovine prion protein\u2013transgenic mouse line and isolated distinct prion strains. Our findings suggest the absence of a causal relationship between these diseases, but further investigation is warranted.  Microcebus murinus) , the L-type bovine spongiform encephalopathy (L-BSE) in cattle requires particular attention for public health. L-BSE is transmitted more efficiently than is classical BSE among primates  expressing ovine PrP . Both of these species are susceptible to L-BSE prions from cattle ; a lemur injected intracerebrally (i.c.) with the 02-2528 L-BSE cattle isolate (res). At the terminal stage of the disease, animals were euthanized, and their brains and spleens were collected for PrPres analyses by Western blot and for histopathologic studies  brain homogenates in 5% sterile glucose. Serial passages were performed in TgOvPrP4 mice by i.c. inoculation of 1% (wt/vol) homogenates from mice positive for protease-resistant PrP (PrPd) in brain samples was not detected by paraffin-embedded tissue blot (PET-blot)  , and disET-blot) , panel AET-blot) , panel Cern blot . res distribution in the brain; immunohistochemical analysis  associated with a lack of reactivity toward the N terminal 12B2 antibody, in contrast to that for the control animal with scrapie  . PET-bloanalysis , panel Din lemur . Brain Pd accumulation in the mouse brains   compared with L-BSE\u2013infected mice . PrPres was readily identified in the spleens of TgOvPrP4 mice at the second passage for sCJD and L-BSE from cattle and at the first passage for L-BSE from lemur  , panel Achloride . Howevernd L-BSE , panel Com lemur . No sign spleens , panel Dres occurred in the frontal parts of the brain, but the intensity and appearance of PrPres in the cortex, thalamus, and hippocampus were distinctly different. Immunohistochemical analyses of the hippocampus showed PrPd deposition in the dentate gyrus in sCJD-infected mice, in contrast to a lack of deposition in lemur-passaged L-BSE\u2013infected mice.Histopathologic analysis showed severe vacuolar lesions in TgOvPrP4 mice infected at second passage with sCJD and lemur-passaged L-BSE . Howeverres electrophoretic mobility and the conformational stability of PrPd, sCJD and L-BSE differed in PrPres glycosylation for the mouse brains and gel migrations for the mouse spleens. Mice infected with MM2-cortical sCJD versus those infected with L-BSE also showed distinct lesion profiles and PrPd distribution, which confirms clear biologic differences between these diseases.We report the isolation of 2 prion strains derived from L-BSE and MM2-cortical sCJD after transmission in Syrian hamsters and ovine PrP\u2013transgenic mice. In hamsters, we did not transmit any disease with sCJD, but the transmission of L-BSE from lemur was efficient, as previously reported for L-BSE from cattle , L-type bovine spongiform encephalopathy (L-BSE) from lemur, L-BSE from cattle, and classical BSE; conformational stability assay of disease-associated prion protein in brains of TgOvPrP4 mice at second passage; and histopathological features of MM2-cortical sporadic sCJD and L-BSE from lemur transmitted to ovine prion protein\u2013transgenic mice at second passage."}
{"text": "C) in comparison with other non-BSE related prions from the same species. After these passages, most features of the BSE agent remained unchanged. BSE-derived agents only showed slight modifications in the biochemical properties of the accumulated PrPSc, which were demonstrated to be reversible upon re-inoculation into transgenic mice expressing bovine-PrPC. Transmission experiments in transgenic mice expressing bovine, porcine or human-PrP revealed that all BSE-derived agents were transmitted with no or a weak transmission barrier. In contrast, a high species barrier was observed for the non-BSE related prions that harboured an identical PrP amino acid sequence, supporting the theory that the prion transmission barrier is modulated by strain properties (presumably conformation-dependent) rather than by PrP amino acid sequence differences between host and donor.The specific characteristics of Transmissible Spongiform Encephalopathy (TSE) strains may be altered during passage across a species barrier. In this study we investigated the biochemical and biological characteristics of Bovine Spongiform Encephalopathy (BSE) after transmission in both natural host species  and in transgenic mice overexpressing the corresponding cellular prion protein (PrPC sequence and not influenced by other host genetic factors. The results presented herein reinforce the idea that the BSE agent is highly promiscuous, infecting other species, maintaining its properties in the new species, and even increasing its capabilities to jump to other species including humans. These data are essential for the development of an accurate risk assessment for BSE.As identical results were observed with prions propagated either in natural hosts or in transgenic mouse models, we postulate that the species barrier and its passage consequences are uniquely governed by the host PrP C, which is encoded by the prnp gene) into an abnormal disease-associated isoform (PrPSc) in tissues of infected individuals. Conversion of PrPC into PrPSc is a post-translational process involving structural modifications of the protein and resulting in a higher \u03b2-sheet content C is completely degraded after controlled digestion with proteinase K (PK) in the presence of detergents. In contrast, PrPSc is N-terminally truncated under such conditions, resulting in a PK resistant core, termed PrPresres, also named PrP 27\u201330, is a disease marker for TSE and the presence of PrPSc seems to associate with infectivity Sc represents the infectious TSE agent itself Bovine spongiform encephalopathy (BSE) in cattle, like scrapie in sheep and goats, is a transmissible spongiform encephalopathy (TSE). The key event in TSE infection is the conversion of the normal cellular prion protein  Interestingly, after passage in different host species, the BSE agent conserved its strain specific signature as assessed by bioassay in RIII mice C amino acid sequences. The properties of these BSE-derived prions were characterized in comparison with other non-BSE related prions with the aim of gaining a better understanding of the species barrier phenomenon and the consequences of passage across a species barrier.In this study we investigated the biochemical and biological characteristics of BSE after transmission in both natural host species  and in transgenic mice overexpressing the corresponding PrPInstituto Nacional de Investigaci\u00f3n y Tecnolog\u00eda Agrar\u00eda y Alimentaria (INIA); Permit Number: CEEA2012/024 and CEEA2009/004.Animal experiments were carried out in strict accordance with the recommendations in the guidelines of the Code for Methods and Welfare Considerations in Behavioural Research with Animals (Directive 86/609EC) and all efforts were made to minimize suffering. Experiments were approved by the Committee on the Ethics of Animal Experiments (CEEA) of the Spanish Cattle-BSE material was obtained from the brainstem of one BSE-affected cow (RQ 225:PG817/00), and supplied by the Animal Health and Veterinary Laboratories Agency (AHVLA), New Haw, Addlestone, Surrey, UK.BoTg-BSE was obtained from the brain of terminally ill BSE-inoculated transgenic mice expressing bovine PrP (BoPrP-Tg110) Sheep-BSE was obtained from the brain of a terminally ill ARQ/ARQ sheep intracerebrally inoculated with BSE, and provided by the French National Institute for Agricultural Research (INRA), Nouzilly, France.OvTg-BSE was obtained from the brain of terminally diseased BSE-inoculated transgenic mice expressing ARQ-ovine PrP (Tg IX) Pig-BSE was obtained from the brain of one BSE-affected pig (PG 33/03) intracerebrally inoculated with BSE as previously described PoTg-BSE was obtained from the brain of terminally diseased BSE-inoculated transgenic mice expressing porcine PrP (PoPrP-Tg001) Mouse-BSE was obtained from the brain of terminally diseased BSE-inoculated C57/Bl6 mice.MoTga20-BSE was obtained from the brain of terminally diseased BSE-inoculated transgenic mice expressing mouse PrP (Tga20) Human-vCJD (met 129) isolate (Ref.: NHBY0/0014) was obtained from the National Institute for Biological Standards and Control, Potters Bar, United Kingdom.HuTg-BSE was obtained from the brain of terminally diseased BSE-inoculated transgenic mice expressing M129-Human PrP (HuPrP-Tg340) Atypical Cattle-BSE H isolate was obtained from the brainstem of one naturally affected cow, diagnosed as atypical H-type BSE (French case 03-2095), and provided by the Agence Fran\u00e7aise de S\u00e9curit\u00e9 Sanitaire des Aliments (AFSSA-France).Sheep-scrapie isolate SC-UCD-99 was obtained from the brain of an Irish ARQ/ARQ sheep naturally infected with scrapie .Mouse-RML scrapie was obtained from the brain of terminally diseased C57/Bl6 mice inoculated with Rocky Mountain Laboratory (RML) scrapie.Human-sCJD (met 129) isolate (Ref.: NHBX0/0001) was obtained from the National Institute for Biological Standards and Control, Potters Bar, United Kingdom.All inocula were prepared from brain tissues as 10% (w/v) homogenates in 5% glucose. To minimize the risk of bacterial infection, inocula were preheated for 10 min at 70\u00b0C before inoculation in mice.C at a 8-fold level C at a 4-fold level C at a 4-fold level All the isolates were inoculated in three different mouse models: i) BoPrP-Tg110 transgenic mouse line expressing bovine PrPIndividually identified 6\u201310 weeks-old mice were anesthetized with isoflurane and inoculated with 2 mg of brain homogenate in the right parietal lobe using a 25-gauge disposable hypodermic needle. Mice were examined twice weekly for neurological signs of prion disease and were euthanized by cervical dislocation when progression of the disease was evident or at the end of the study (650\u2013700 dpi). The animals were humanely euthanized once a definitive diagnosis had been made or earlier if showing signs of distress or loss of up to 20% of body weight. A mouse was considered positive for prion disease when it showed two or three of 10 signs of neurological dysfunction previously described res) by immunohistochemistry (IHC) or histoblotting and the rest was frozen at \u221220\u00b0C before determining the presence of PrPres by Western blot (WB). In all cases, survival time and attack rate were calculated for each isolate. Survival time was expressed as the mean of the survival days post inoculation (dpi) of all the mice scored positive for PrPres, with its correspondent standard error. Attack rate was determined as the proportion of mice scored positive for PrPres from all the mice inoculated. Brain homogenates from PrPres positive mice, when available, were used for further passaging. When all mice were scored negative for PrPres on primary passage, PrPres-negative brain homogenates were used for second passage.Once euthanized, a necropsy was performed and the brain was taken. A part of the brain was fixed by immersion in neutral-buffered 10% formalin  to quantify spongiform degeneration by histopathology and PK resistant PrP accumulation . 10\u2013100 \u00b5l of a 10% (w/v) brain homogenate were diluted in a 10% (w/v) negative sheep brain homogenate, to obtain a 200 \u00b5l final volume. Homogenates were incubated for 10 min at 37\u00b0C with 200 \u00b5l of a 2% proteinase K solution (in buffer A). PrPres was recovered as a pellet after addition of 200 \u00b5l of buffer B and centrifugation at 15,000\u00d7 g for 7 min at 20\u00b0C. Supernatants were discarded and pellets were dried inverted over absorbent paper for 5 min. Pellets were solubilised in Laemmli buffer and samples were incubated for 5 min at room temperature, solubilised, and heated at 100\u00b0C for 5 min. Samples were centrifuged at 20,000\u00d7 g for 15 min at 20\u00b0C and supernatants were recovered and loaded on a 12% Bis-Tris Gel . Proteins were electrophoretically transferred onto PVDF or nitrocellulose membranes (Millipore). Membranes were blocked O/N with 2% BSA blocking buffer. For immunoblotting, monoclonal antibodies Sha31 156YEDRYYRE163 epitope of the bovine-PrP sequence while 12B2 recognizes the 101WGQGG105 epitope of the bovine-PrP sequence. Immunocomplexes were detected by incubating the membranes for 1 hour with horseradish peroxidase conjugated anti mouse IgG (Amersham Pharmacia Biotech). Immunoblots were developed with enhanced chemiluminescence using ECL Plus reagent .175\u00b120 mg of frozen brain tissue were homogenized in 5% glucose in distilled water in grinding tubes (Bio-Rad) adjusted to 10% (w/v) using a TeSeE Precess 48 homogenizer (Bio-Rad) following the manufacturer's instructions. The presence of PrPSc detection was carried out using two sandwich ELISA tests  following the manufacturer's instructions. The assay protocol includes a purification of PrPSc (TeSeE purification kit) consisting of (i) digestion of PrPC with PK, (ii) precipitation of PrPSc by centrifugation and (iii) denaturation of PrPSc at 100\u00b0C, before immuno-enzymatic detection. In this ELISA, the capture antibody recognizes the octarepeat region of PrP PrPSc portion recognized in the ELISA test was determined by measurement of the ELISA specific signal recovered after digestion with different concentrations of PK in \u2018buffer A\u2019 reagent . Each sample was first diluted in normal brain homogenate (between 100 and 10 000 fold) until a signal between 1.5 and 2 absorbance units was obtained after digestion with 50 \u00b5g/ml of PK. Triplicates of equilibrated samples were then submitted to a PK digestion with concentrations ranging from 50 to 300 \u00b5g/ml, before PrPSc precipitation and ELISA detection. Results were expressed as the percentage of residual signal as compared with the signal after 50 \u00b5g/ml PK digestion (lowest PK concentration). In each assay, two standardized controls (scrapie and BSE from sheep) were used as an internal standard.PK resistance of the PrPAll analyses of mouse brains were performed as previously described The PK resistance profiles were compared by Wilcoxon matched-pairs signed-rank test. Two-tailed P-values <0.05 were considered statistically significant.Nonparametric Mann-Whitney-U test was applied to establish statistically significant differences in survival times of the different mouse models inoculated with the different BSE-derived prions. A difference of P<0.05 was considered significant. Statistical analysis was performed using PAST software .C amino acid sequences. These BSE-derived prions have been characterized in comparison with the original cattle-BSE prions, as well as with other non-BSE related prion strains as controls. Human-vCJD was included as another BSE-derived prion In this work we investigated the biochemical and biological characteristics of a panel of BSE-derived prions corresponding to BSE passaged in both natural host species  and in transgenic mice overexpressing the corresponding PrPres was analysed using Sha31 mAb (res electromobility of cattle-BSE compared to the different BSE-derived prion isolates (res glycoforms was observed in the different BSE-derived prion isolates (res fraction (>50%) and a weak unglycolysated PrPres fraction (<20%). In contrast, PoTg-BSE showed a profile dominated by the monoglycosylated PrPres fraction (\u223c40%). In all cases, the glycoprofiles observed in the natural hosts were similar to those observed in the corresponding transgenic mouse models.The Western blot pattern of BSE-derived PrPha31 mAb  binding isolates . In all isolates . A certaisolates . BoTg-BSres from atypical cattle-BSE H, sheep-scrapie, mouse-RML and human-sCJD isolates was recognized equally well by both Sha31 and 12B2 mAbs. Conversely, PrPres from BSE in all investigated hosts was not recognized by 12B2 mAb  expressing bovine, porcine or human PrP, respectively In BoPrP-Tg110 mice, the different BSE-derived prions were fully transmitted (with a 100% attack rate) in primary passage, irrespective of their producing host . Either C. For BSE prions propagated in bovine, porcine, murine or human-PrP hosts, the transmission efficiency in both mouse models was similar to that observed for the cattle-BSE isolate. However, the OvTg-BSE isolate showed higher transmission efficiency on primary passage , as compared to the cattle-BSE isolate, in the three mouse models used. Similar increased transmission efficiency was previously reported for sheep-BSE in these mouse models C sequences , a low infectivity titer for these isolates cannot be considered to be the cause of their impaired transmission.A different scenario was observed when non-BSE related prions were inoculated into the same three mouse models. While all BSE-derived prions were transmitted with a 100% attack rate irrespective of their producing host, the sheep-scrapie SC-UCD-99 and the mouse-RML isolates showed prolonged incubation times and reduced attack rates on primary passage to BoPrP-Tg110 mice; and the human-sCJD isolate was not transmitted to BoPrP-Tg110 . Moreoveres biochemical signatures  in the brains of infected mice  were indistinguishable from those previously reported for both cattle-BSE and sheep-BSE isolates in this porcine-PrP mouse model Similarly, in PoPrP-Tg001 we found a similar and unique neuropathological phenotype for all BSE-derived agents irrespective of their producing host. In all cases, the vacuolation profile and the PET blot PrPC amino acid sequence or to other host factors. Through the biochemical and biological characterization of the BSE-derived prions tested herein  in comparison to other non-BSE related prions sharing the same PrPSc amino acid sequences, we can try to determine the role of these elements  in either the species barrier phenomenon or the species barrier passage consequences.Once the species barrier is crossed, both biochemical and biological properties of prion strains can change Sc variability Sc depending on the host PrP sequence in which the BSE agent was propagated. The only biochemical feature that was apparently conserved in all BSE-derived prions after passage in the different species was the lack of reactivity of PrPres to the N-terminal binding antibody 12B2 . These results support the statement that the alteration of the PrPSc biochemical features induced by trans-species transmission is only dependent on the host PrPC amino acid sequence and not influenced by the PrPC expression level or other host genetic factors.Similar changes of the abnormal PrPSc sequence. In contrast, a clear transmission barrier was observed with non-BSE related isolates propagated in hosts with an identical PrPC sequence. Moreover, these prion isolates, sharing identical PrPSc but from different strains, also showed a different transmission ability in the other two mouse models (PoPrP-Tg001 and HuPrP-Tg340) tested herein  increased its transmission efficiency in the three mouse models tested herein  compared to other species-PrPBSE including the bovine, murine or porcine one. Nevertheless, the PrPSc primary sequence influence seems to depend strongly on the strain involved, since the sheep-scrapie isolate was not transmitted to HuPrP-Tg340 or PoPrP-Tg001 mice and it was poorly transmitted to BoPrP-Tg110 mice  their transmission efficiency to several species could impact on the trans-species transmission risk under natural exposure conditions. This should always be kept in mind for risk assessment of the potential spread of non-bovine BSE in field cases, since there is a risk that species other than cows with no, or a low, transmission barrier will propagate BSE infection in several other species, including humans."}
{"text": "TOC Summary: An epidemic agent could have originated from such a cattle prion. res), named high-type (BSE-H) and low-type (BSE-L), that also differed from classical BSE. We characterized 5 atypical BSE-H isolates by analyzing their molecular and neuropathologic properties during transmission in transgenic mice expressing homologous bovine prion protein. Unexpectedly, in several inoculated animals, strain features emerged that were highly similar to those of classical BSE agent. These findings demonstrate the capability of an atypical bovine prion to acquire classical BSE\u2013like properties during propagation in a homologous bovine prion protein context and support the view that the epidemic BSE agent could have originated from such a cattle prion.Bovine spongiform encephalopathy (BSE) and BSE-related disorders have been associated with a single major prion strain. Recently, 2 atypical, presumably sporadic forms of BSE have been associated with 2 distinct prion strains that are characterized mainly by distinct Western blot profiles of abnormal protease-resistant prion protein (PrP Sc) of the host-encoded physiologic prion protein (PrPC) in the central nervous system. PrPSc but not PrPC is partially resistant to digestion by proteinase K, resulting in an N terminally truncated prion protein termed PrPres that can be detected by Western blot and showing a characteristic banding pattern that reflects the 3 PrPres glycoforms. The apparent molecular masses and relative quantities of these glycoforms are used in biochemical PrPres typing as the criteria to differentiate between prion diseases.Transmissible spongiform encephalopathies, or prion diseases, are a group of neurodegenerative disorders that include Creutzfeldt-Jakob disease (CJD) in humans, scrapie in sheep and goats, and bovine spongiform encephalopaty (BSE) in cattle. Prion diseases are characterized by specific histopathologic lesions and deposits of an abnormal conformational isoform  and low-type (L-type) according to the electrophoretic migration of the unglycosylated PrPres, which is higher (BSE-H) or lower (BSE-L) than classical BSE (BSE-C)  PrPres, more obvious in L-type BSE  led to emergence of a clearly distinct prion with strain features similar to those of the BSE-C agent and that such similarities were maintained on subsequent passages. These observations provide new insights into the nature of the events that could have led to the BSE epizootic.Tg110 transgenic mice in all inoculation experiments. This mouse line expresses bovine PrPC (\u22488\u00d7 that of the level of PrPC in cattle brain) under the control of the mouse prnp gene promoter in a mouse PrP0/0 background  were inoculated with 20 \u00b5L of the appropriate sample in the right parietal lobe by using 25-gauge disposable hypodermic syringes. UNO MICRO ID-8 ISO transponders  were used for individual identification of mice. After inoculation, mice were observed daily and their neurologic status were assessed 2\u00d7/wk. When progression of the disease was evident, animals were euthanized. All animals were housed in accordance with guidelines of the Code for Methods and Welfare Considerations in Behavioral Research with Animals of the European Union directive 86/609EC). Necropsy was performed, and brain and spleen were taken. Part of the sample was frozen at \u221220\u00b0C for biochemical analysis, and the remaining part was fixed for histopathologic studies.Survival times were calculated for each inoculum as the time between inoculation and euthanasia in days and expressed as the mean of the survival days postinoculation (dpi) of all the inoculated mice with its correspondent standard error of the mean. Data were processed by using SigmaPlot 2001 software .156YEDRYYRE163 epitope, and Saf84 recognizes 171QVYYRPVDQYS181 epitope and 12B2 recognizes 101WGQGG105 epitope of the bovine PrP sequence. Immunocomplexes were detected by horseradish peroxidase\u2013conjugated antimouse immunoglobulin G . Immunoreactivity was visualized by chemiluminescence (Amersham Pharmacia Biotech) and obtained after exposition with medical radiographic film .Frozen mouse brain samples were prepared as 10% (wt/vol) homogenates in 5% glucose in distilled water in grinding tubes  by using a TeSeE Precess 48 homogenizer (Bio-Rad) following the manufacturer\u2019s instructions. All samples were analyzed by Western blot by using the kit TeSeE Western Blot 355 1169 (Bio-Rad) but with some adjustments for the different amounts of samples used. To achieve the volume proposed in the manufacturer\u2019s recommendations, 100 \u03bcL of the brain homogenates to be tested were supplemented with 100 \u03bcL of a 10% brain homogenate from PrP null mice  induced a typical neurologic disease on primary transmission, with a 100% attack rate . Moreover, the survival time of mice infected with these 2 isolates was reduced on subpassage, approaching that for BSE-C or BSE-H isolates of presumably higher titer .The transmission dynamic of BSE-H agent into ack rate . Remarkares by Western blot analysis with Sha31 mAb. Consistent with the efficient transmission observed, PrPres was readily detected from the first passage in all Tg110 mice inoculated with the different BSE-H isolates. In 3 BSE-H isolates , the totality (100%) of the inoculated Tg110 mice produced a PrPres profile similar to that in cattle (H-type PrPres) but clearly distinct from that produced by BSE-C agent (C-type PrPres) in cattle  apparent molecular mass of the 3 PrPres glycoforms, which was indistinguishable from that produced by BSE-C agent in these mice (res with other antibodies showed that the PrPres produced by these mice was not recognized by 12B2 mAb (res produced by other mice (inoculated at the same time with the same isolates) remains essentially similar to that in cattle BSE-H  of cattle BSE-H but showed a PrPres profile (3 bands) similar to that of BSE-C in Tg110 mice (We observed a different situation for the other 2 BSE-H isolates (02-2695 from France and 45 from Poland), where 3 and 2, respectively, of infected mice  showed an cattle , panel B12B2 mAb . Howeverle BSE-H . Further110 mice .res increased in comparison with the mice with H-type features, as shown by using Sha31 mAb  PrPres molecular profile to obtain equivalent PrPres signals  or when compared with second passages of BSE-C in these mice. All the mice inoculated with the H-type brain homogenates showed H-type PrPres features, whereas all the mice inoculated with the C-like brain homogenates exhibited C-type PrPres molecular features indistinguishable from that of BSE-C (data not shown).For these 2 isolates, a second passage was performed in e PrPres . SurvivaSc distribution in the brain, which are known to vary by strain  apparent molecular mass of PrPres, 2) PrPres glycosylation pattern, 3) immunoreactivity with 12B2 mAb, and 4) pattern of labeling with Saf84 antibody. Second, the vacuolation profile essentially overlapped that in mice infected with BSE-C, with slight differences only in the mesencephalic tegmentum area. Third, the spatial distribution of PrPres in the brain was clearly similar to that of mice infected with BSE-C. Fourth, PrPSc was consistently detected in the spleen, similar to mice infected with BSE-C. These similarities with BSE-C were fully retained after a second passage by using brain homogenate from mice with C-like features, whereas a BSE-H strain phenotype was maintained in mice inoculated with mouse brains homogenates containing H-type PrPres.Although all BSE-H\u2013inoculated mice showed homogeneous survival times, a phenotypic divergence was observed in a few animals infected with 2 of the BSE-H isolates. Surprisingly, these few mice showed phenotypic features clearly distinct from those in most of the BSE-H\u2013infected mice but similar to those of BSE-C propagated onto the same mice, according to various criteria. First, a PrPres profiles of >100 Tg110 mice inoculated with 4 different BSE-C isolates , the lack of such observation in the other 3 isolates, and in 2 other independent studies of 3 BSE-H isolates in different bovine transgenic mouse lines  amount or regions of cattle brain tissue taken for inoculum preparation, 2) physicochemical treatment during inoculum preparation , 3) the precise site of mouse inoculation, 4) the infectious titer of the inoculum, and 5) others unknown mouse factor affecting prion propagation and disease evolution. Because samples used in this study were prepared from the same region (brainstem) following the same precise protocol and under identical conditions, differences in inoculum preparation and conditions are unlikely. However, the possibility that the observations might be influenced by the precise neuroanatomic origin of the inoculated bovine brainstem homogenate or by other mouse bioassay\u2013related factors cannot be excluded.Sc in the BSE-H inocula used for transmissions as deduced by Western blot analysis; and 3) 2 independent transmission experiments, involving separate batches of both incriminated isolates, all produced consistent results.The possible cross-contamination of the BSE-H isolates material (02-2695 and 45 from 2 laboratories in different countries) by a BSE-C infectious source was judged highly improbable for several reasons. These reasons are 1) the strict biosafety procedures followed for sample collection, preparation of the inocula, inoculation scheme, and care of mice; 2) the absence of C-type PrPTg110 mice. Second, a new strain component has been generated during propagation of BSE-H agent in Tg110. In both instances, emergence of the new strain, either in the original cattle or during propagation in Tg110 mice, could be promoted by specific propagation conditions or by physicochemical treatment of the inoculum. In this regard, acquisition of novel properties by a sporadic cattle transmissible spongiform encephalopathy agent by a physicochemical treatment, such as that applied to carcass-derived products, has been invoked as a possible origin for the BSE epidemic (Together, these observations support 2 possible hypotheses. First, a minor strain component might be present in BSE-H isolates that could emerge on subsequent transmission in \u2013Contrary to BSE-H, the atypical BSE-L agent retained unique and distinct phenotypic features, compared with BSE-C agent, on transmission to both bovine and human PrP transgenic mice (In contrast, our results suggest that prion strain divergence might occur on propagation of atypical BSE-H in a homologous bovine PrP context and that this strain divergence could result from a permanent strain shift of the BSE-H agent toward a C-like agent that is stable in subsequent passages. These findings emphasize the potential capacity of prion diversification during propagation, even in the absence of any species barrier, and represent an experimental demonstration of the capability of an atypical, presumably sporadic, bovine prion to acquire C-like properties during propagation in a homologous bovine PrP context.Results in transgenic mouse models cannot be directly extrapolated to the natural host. However, our observations are consistent with the view that the BSE agent could have originated from a cattle prion, such as BSE-H, and provide new insights into the nature of the events that could have led to the appearance of this agent."}
{"text": "Public and animal health controls to limit human exposure to animal prions are focused on bovine spongiform encephalopathy (BSE), but other prion strains in ruminants may also have zoonotic potential. One example is atypical/Nor98 scrapie, which evaded statutory diagnostic methods worldwide until the early 2000s. To investigate whether sheep infected with scrapie prions could be another source of infection, we inoculated transgenic mice that overexpressed human prion protein with brain tissue from sheep with natural field cases of classical and atypical scrapie, sheep with experimental BSE, and cattle with BSE. We found that these mice were susceptible to BSE prions, but disease did not develop after prolonged postinoculation periods when mice were inoculated with classical or atypical scrapie prions. These data are consistent with the conclusion that prion disease is less likely to develop in humans after exposure to naturally occurring prions of sheep than after exposure to epizootic BSE prions of ruminants. Bovine spongiform encephalopathy (BSE) is the transmissible spongiform encephalopathy (TSE) or prion disease of domestic cattle. The BSE prion is an epizootic agent and causes variant Creutzfeldt-Jakob disease (vCJD) in humans after dietary exposure  in number of confirmed cases of classical scrapie in the national flock. However, atypical scrapie continues to affect sheep bred for their relative resistance to the classical form of this prion disease, and the proportion of sheep with resistant genotypes in the national flock is likely to have increased over the past decade because of the National Scrapie Plan for Great Britain. This increase has rekindled speculation that atypical scrapie in small ruminants might be a source of human prion disease  on a mouse PrP null background (2+ and Mg2+ ions (D-PBS) by extrusion through syringe needles of decreasing diameter. Brains from cattle with neuropathologically confirmed cases of BSE  were provided by the UK Central Veterinary Laboratory (now AHVLA). We used 10% (w/v) homogenates prepared from the brainstems of 5 cattle with natural BSE to generate pooled inocula, designated I038, which was previously shown to transmit prion disease to wild-type FVB/N and C57Bl/6 mice, and to transgenic mice overexpressing human PrP , we obtained 10% (w/v) brain homogenates prepared in sterile saline from sheep with neuropathologically confirmed prion disease and demonstrated ability to transmit prion disease to transgenic mice expressing ovine PrP or to wild-type mice . We obtao/oPrnp), designated Tg(HuPrP129V+/+o/oPrnp)-152 mice (129VV Tg152 mice), or homozygous for a human PrP 129M transgene array and murine PrP null alleles (o/oPrnp), designated Tg(HuPrP129M+/+o/oPrnp)-35 mice (129MM Tg35 mice), have been described  by using 84 FVB-specific PCR microsatellite markers covering 19 chromosomes at \u224820-cM intervals, to select breeding pairs positive for 100% of the FVB-specific markers. Selected congenic pairs were interbred to remove the endogenous murine PrP gene and to establish homozygosity of the human PrP transgene array. The resulting congenic lines, designated 129MM Tg35c and 129VV Tg152c, overexpress human PrP in brain at levels of 2\u00d7 and 6\u00d7 that of pooled human brain, respectively.Transgenic mice homozygous for a human PrP 129V transgene array and murine PrP null alleles . Brain homogenates (10% w/v) were diluted to 1% (w/v) in sterile D-PBS and passed through a 25-gauge needle. Each mouse was inoculated with 30-\u03bcL of 1% (w/v) brain homogenate because this avoids excessive animal losses within the first 48 hours postinoculation  were pretreated by boiling for 10 min in a low ionic strength buffer  before exposure to 98% formic acid for 5 min. Abnormal PrP accumulation was examined by using monoclonal antibody ICSM 35 against PrP  on an automated IHC staining machine  by using proprietary secondary detection reagents  before development with 3\u20323-diaminobenzedine tetrachloride as the chromogen (Sc) after analysis of 10 \u03bcL 10% (w/v) brain homogenate were reanalyzed by sodium phosphotungstic acid (NaPTA) precipitation of PrPSc (Proteinase K (PK) digestion , electrophoresis, and immunoblotting of 10% (w/v) transgenic mouse brain homogenates or 10% (w/v) brain homogenates from sheep with classical scrapie (prepared in D-PBS) were performed as described  sodium lauroylsarcosine (sarkosyl) in D-PBS. After incubation at 37\u00b0C for 30 min with constant agitation and centrifugation at 500 \u00d7 g for 5 min, 150 \u03bcL of the supernatant was transferred to a new tube. The supernatant fraction was treated with 2 \u03bcL of Benzonase  for 30 min at 37\u00b0C with agitation and adjusted to a final concentration of 50 \u03bcg/mL PK (by adding 8 \u03bcL of a 1 mg/mL PK stock solution) and incubated at 37\u00b0C for 60 min with agitation. Samples were treated with 4 \u03bcL 100 mmol/L 4-(2-aminoethyl)-benzene sulfonyl fluoride, heated at 100\u00b0C for 5 min, adjusted with an equal volume of 2% (w/v) sarkosyl in D-PBS and 3 \u03bcL of Benzonase; they were then incubated for 30 min at 37\u00b0C with agitation before addition of 4% (w/v) NaPTA containing 170 mmol/L MgCl2, pH 7.4, to give a final concentration in the sample of 0.3% (w/v) NaPTA. After incubation for 60 min at 37\u00b0C, with constant agitation, samples were centrifuged at 16,100 \u00d7 g for 30 min, and the supernatant fraction was discarded. The pellet fraction was resuspended to a final volume of 10 \u03bcL in D-PBS containing 0.1% (w/v) sarkosyl and analyzed by electrophoresis, immunoblotting, and high sensitivity chemiluminescence  that contain PK-resistant ovine PrPvine PrP , togethevine PrP . All natvine PrP . Consistent with the inability of IHC or high sensitivity immunoblotting to detect pathologic PrP in the brains of inoculated mice, neuropathologic examination of the brain showed no difference in spongiform change or gliosis from that observed in the brains of age-matched control mice (data not shown). From these findings, we conclude that both methionine and valine residue 129 variants of human PrP are refractory to pathologic conversion by these ovine prion strains in transgenic mice.Brain isolates from sheep with classical and atypical scrapie (including those with demonstrated prion infectivity in transgenic mice expressing ovine PrP) did not transmit prion disease to transgenic mice that were overexpressing human PrP. This fact contrasts markedly with the known susceptibility of these mice to transmission of multiple cattle BSE isolates  to type 4 PrPSc seen in vCJD brain (In the transgenic mice expressing human PrP, clinical prion disease was not produced by either of the 2 experimental sheep BSE isolates after postinoculation intervals >600 days . ExaminaJD brain , panel BJD brain , panel CWhy the efficiency of transmission of experimental sheep BSE prions to 129MM Tg35c mice is low compared with that reported in different lines of human PrP 129 methionine\u2013expressing mice . TherefoIn this study, we have shown that disease does not develop in transgenic mice overexpressing human PrP when mice are inoculated with ovine prions from sheep with natural cases of classical scrapie and atypical scrapie from Great Britain and Germany. These transgenic mice are susceptible to infection, and clinical disease develops when mice are challenged with brain tissue from cattle affected by classical BSE (Our findings complement those of other recent studies that have investigated the zoonotic potential of ruminant prion strains using other lines of human PrP\u2013expressing mice. Gene-targeted human PrP\u2013expressing mice have been shown to be resistant to infection with classical and atypical scrapie prions from sheep (Although we found evidence for transmission of experimental ovine BSE to transgenic mice expressing human PrP 129 methionine, the relative attack rate was lower than observed in the other lines of mice (No strain variation has been found so far in the transmission, biochemical, or histopathologic characteristics of atypical scrapie prions ("}
{"text": "Spinal cord homogenates prepared from BSE-infected cows were treated with SCW at 230\u2013280\u00b0C for 5\u20137.5 min and used to intracerebrally inoculate transgenic mice overexpressing bovine prion protein. Serial protein misfolding cyclic amplification (sPMCA) analysis detected no PrPSc in the SCW-treated homogenates, and the mice treated with these samples survived for more than 700 days without any signs of disease. However, sPMCA analyses detected PrPSc accumulation in the brains of all inoculated mice. Furthermore, secondary passage mice, which inoculated with brain homogenates derived from a western blotting (WB)-positive primary passage mouse, died after an average of 240 days, similar to mice inoculated with untreated BSE-infected spinal cord homogenates. The PrPSc accumulation and vacuolation typically observed in the brains of BSE-infected mice were confirmed in these secondary passage mice, suggesting that the BSE prions maintained their infectivity after SCW treatment. One late-onset case, as well as asymptomatic but sPMCA-positive cases, were also recognized in secondary passage mice inoculated with brain homogenates from WB-negative but sPMCA-positive primary passage mice. These results indicated that SCW-mediated hydrolysis was insufficient to eliminate the infectivity of BSE prions under the conditions tested.The global outbreak of bovine spongiform encephalopathy (BSE) has been attributed to the recycling of contaminated meat and bone meals (MBMs) as feed supplements. The use of MBMs has been prohibited in many countries; however, the development of a method for inactivating BSE prions could enable the efficient and safe use of these products as an organic resource. Subcritical water (SCW), which is water heated under pressure to maintain a liquid state at temperatures below the critical temperature (374\u00b0C), exhibits strong hydrolytic activity against organic compounds. In this study, we examined the residual  Sc) comprise the infectious agents that cause prion diseases such as Creutzfeldt-Jacob disease (CJD) in humans, scrapie in sheep and goats, chronic wasting disease (CWD) in deer and elk, and bovine spongiform encephalopathy (BSE) in cattle  was performed in quadruplicate. For serial PMCA analysis, 1:5 dilution of the amplified product and subsequent amplification was repeated 3 times.In a previous study, we developed an ultrasensitive method for BSE PrPte (DSP) . The PMCc levels , 17. Brievels [C , and PrPPMCA samples (10 \u03bcl) were incubated with 10 \u03bcl proteinase K solution (100 \u03bcg/ml) at 37\u00b0C for 1 h, and then mixed with 20 \u03bcl of 2\u00d7 sodium dodecyl sulfate (SDS) sample buffer and incubated at 100\u00b0C for 5 min. The samples were separated by SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to polyvinylidene fluoride (PVDF) membranes . After blocking, the membranes were incubated for 30 min with a horseradish peroxidase (HRP)-conjugated T2 monoclonal antibody , which rSc present in the primary passage mice, 10% BH of several western blot (WB)-positive or sPMCA-positive mice were subsequently injected intracerebrally into four to seven TgBoPrP mice (20 \u03bcl per mouse). After inoculation, the mice were evaluated daily for signs of disease.The SCW-treated bovine spinal cord samples were injected intracerebrally into five or six TgBoPrP mice (20 \u03bcl per mouse). To examine the infectivity of the PrPThe left hemispheres of mouse brains were fixed in 10% buffered formalin for subsequent neuropathological analyses. Coronal slices of the brain were immersed in 98% formic acid to reduce the infectivity, and embedded in paraffin wax. Sections (4 \u03bcm thickness) were cut and stained with hematoxylin and eosin, and subjected to immunohistochemical analysis using with SAF84 monoclonal antibody , as described previously .Sc present in the SCH samples subjected to the SCW treatments listed in Sc signal was detected by conventional WB analysis in any of the SCW-treated samples (Sc derived from BSE-infected cattle could be efficiently amplified by sPMCA in the presence of DSP [Sc in the SCW-treated SCH samples. PrPSc were amplified from the untreated BSE-infected SCH (10%) samples diluted up to 10\u22126 and10-9 after one and two rounds of amplification, respectively  after two or three rounds of sPMCA, the ratio of positive tests in the quadruplicate samples varied among these mice (50\u2013100%) after four rounds of sPMCA. Additionally, PrPSc were detected in each of the mice inoculated with SCH treated at 250\u00b0C for 5 min  used for inactivation of BSE-SCH. While relatively higher levels of PrPSc accumulation were detected in three primary passage mice . Such undecomposed BSE PrPIn conclusion, we demonstrated that SCW treatments suitable for recycle use of MBM failed to completely inactivate BSE prions. Although prion inactivation may proceed more effectively at higher temperature regions around supercritical water or in the presence of longer heating times, such harsh treatments would cause severe damage to the valuable organic materials present in the MBM, resulting in reduced economic merits.S1 Fig(SCH) were treated with SCW at 250\u00b0C for 7.5 min, and serially amplified by PMCA. After each round (R1\u2013R4) of amplification, 80 samples (lane 1\u201380) were digested with proteinase K and subjected to western blot analysis. The lanes labeled \u201cPC\u201d indicate the positive control samples, which contained untreated BSE-SCH diluted from 10\u22126 to 10\u22129. The lanes labeled \u201cNs\u201d indicate samples in which only the PrPC substrate was treated in the same manner.Bovine spongiform encephalopathy (BSE)-infected spinal cord homogenates (TIF)Click here for additional data file.S2 Fig(SCH) (10%) were diluted to 10\u22124, and amplified in the presence of 1\u20138 \u03bcl of BSE-SCH treated with SCW at 250\u00b0C for 7.5 min or PBS. After amplification, the samples were digested with proteinase K and analyzed by western blot. Densitometric analysis indicated a reduction in the PrPSc signal intensity to 84% (1 \u03bcl), 72% (2 \u03bcl), 68% (4 \u03bcl), and 62% (8 \u03bcl) of that of the respective PBS-added samples after the addition of the SCW-treated product.Bovine spongiform encephalopathy (BSE)-infected spinal cord homogenates (TIF)Click here for additional data file."}
{"text": "The infectious agent responsible for the bovine spongiform encephalopathy (BSE) epidemic in Great Britain is a transmissible spongiform encephalopathy (TSE) strain with uniform properties but the origin of this strain remains unknown. Based on the hypothesis that classical BSE may have been caused by a TSE strain present in sheep, cattle were inoculated intracerebrally with two different pools of brains from scrapie-affected sheep sourced prior to and during the BSE epidemic to investigate resulting disease phenotypes and characterise their causal agents by transmission to rodents.As reported in 2006, intracerebral inoculation of cattle with pre-1975 and post-1990 scrapie brain pools produced two distinct disease phenotypes, which were unlike classical BSE. Subsequent to that report none of the remaining cattle, culled at 10\u00a0years post inoculation, developed a TSE. Retrospective Western immunoblot examination of the brains from TSE cases inoculated with the pre-1975 scrapie pool revealed a molecular profile similar to L-type BSE. The inoculation of transgenic mice expressing the bovine, ovine, porcine, murine or human prion protein gene and bank voles with brains from scrapie-affected cattle did not detect classical or atypical BSE strains but identified two previously characterised scrapie strains of sheep.Characterisation of the causal agents of disease resulting from exposure of cattle to naturally occurring scrapie agents sourced in Great Britain did not reveal evidence of classical or atypical BSE, but did identify two distinct previously recognised strains of scrapie. Although scrapie was still recognizable upon cattle passage there were irreconcilable discrepancies between the results of biological strain typing approaches and molecular profiling methods, suggesting that the latter may not be appropriate for the identification and differentiation of atypical, particularly L-type, BSE agents from cattle experimentally infected with a potential mixture of classical scrapie strains from sheep sources.The online version of this article (doi:10.1186/s13104-015-1260-3) contains supplementary material, which is available to authorized users. Epidemiological studies indicated that the bovine spongiform encephalopathy (BSE) epidemic in the United Kingdom (UK) was caused by food-borne exposure of cattle to a transmissible spongiform encephalopathy (TSE) agent , but thePrP) gene  and five cattle inoculated intracerebrally with saline solution. The study was terminated at 120\u00a0months post inoculation (mpi), and all remaining cattle  were euthanased with pentobarbitone. Pathological examinations were carried out as described previously [PrP sequence. In addition, mAb SAF84  was used because of its particular usefulness in identifying H-type BSE by specific downward molecular mass shift [Briefly, two groups of cattle were inoculated intracerebrally with brain homogenate from pathologically confirmed scrapie cases sourced prior to 1975 (ten cattle) and after 1990 (ten cattle). Both inocula were characterised by biochemical (Western immunoblot (WB) hybrid technique ) and bioeviously . These mres) is detected as three protein bands that relate to diglycosylated, monoglycosylated and unglycosylated forms of the abnormal protein, and the migration as well as the relative intensity (expressed as glycoform ratio) of the protein bands of PrPres enables differentiation of scrapie from BSE. Discrimination is also possible by parallel testing with the two specific mAbs: mAb Sha31 detects PrPres in both cattle and sheep, while mAb P4 is more selective for scrapie PrPres under the test conditions, as reported previously [res bands detected using mAbs Sha31, 6H4 and P4. Stringent digestion was undertaken with 500\u00a0\u03bcg/ml PK at pH 8.0, and mild digestion with 50\u00a0\u03bcg/ml PK at pH 6.5. The PK susceptibility ratio was obtained by comparing the optical density of the signal strengths of the PrPres bands produced by mild and stringent digestion, which is >0.7 for C-type BSE and <0.6 for L-type BSE cases [With this WB technique proteinase-resistant prion protein  from either blood  or brain  according to methods described previously [Determination of the bovine eviously .The original study design included strain characterisation only in wild-type mice but brain tissue was subsequently distributed to other research institutes to further characterise bovine passaged scrapie in additional rodent lines. This was carried out independent of the original study and selection of material was restricted by availability.Myodes glareolus) were inoculated with brain tissue  from steers P75-7\u00a0(inoculated with the pre-1975 pool) and P90-4\u00a0(inoculated with the post-1990 pool), both positive for PrPSc in brain. Both inocula were further tested by WB for presence of PrPres as described previously using mAb SAF84  and mAb P4  [Bank voles  .PrP gene) were inoculated with 20\u00a0\u03bcl of brain homogenate (as 10% w/v in PBS) derived from each of the two steers. Inoculation procedure, clinical monitoring and euthanasia at terminal stage of disease were as described previously [res characterisation and lesion profiling. Brains were examined by WB with mAb SAF84 targeting PrP aa residues 163\u2013173 of the bank vole PrP sequence and 12B2  [Each of two groups of 15 bank voles (homozygous for methionine at codon 109 of the eviously . Brains equence) , and lesThe disease phenotypes observed in voles after transmission of P75-7 and P90-4 brain samples were compared with those previously derived from different scrapie sources, including natural ovine scrapie isolates SS-UK6 (10 brains) and SCR6 (single brain)  and the Sc) from the clinically affected steers P75-7 (as above) and P90-1\u00a0(inoculated with the post-1990 pool). Both of the original inocula and the brain of steer P90-1 had previously been inoculated into conventional mice , resulting in successful transmission with lesion profile features uncharacteristic of BSE (pre-1975 pool), or transmissions with low attack rates, insufficient to establish a lesion profile in RIII mice (post-1990 pool and P90-1) [Inocula comprised the original two scrapie brain pools (pre-1975 and post-1990) and brain tissue  ; see alsPrP gene of various species as follows: tg338 mice , tg110 PrP gene ), tg001 PrP gene ), tga20 PrP gene ) and tg3PrP gene ).Groups of 6\u201312 mice were inoculated intracerebrally with 20\u00a0\u03bcl of either 2% homogenate of the original ovine brain pools or 10% homogenate of the bovine brain tissue (prepared in sterile 5% glucose). The former inoculum dilution was determined by restricted availability of source tissue. The procedures for inoculation, clinical monitoring and cull of affected mice were as described previously .res by WB with mAb Sha31 (BioRad Laboratories) [res positive mice, where available, were used for further passages. When, on primary passage, all mice of an inoculum group were negative for PrPres a second passage of the pooled brain homogenates was carried out. For second passages, mice were inoculated intracerebrally with 20\u00a0\u03bcl of a 10%\u00a0w/v brain homogenates (prepared in sterile 5% glucose).Disease in mice was confirmed according to previously published protocols for detection of PrPatories)  or parafatories) . Brain hData were compared to those derived from mice inoculated with classical BSE bovine and ovine brain homogenates and with L-type and H-type BSE bovine brain homogenates, some of which were obtained from separate studies , 28\u201331.Sc or PrPres could not be detected on examination of the brain by postmortem tests [From the time of publication of interim results  to termiem tests \u201334 and cThe brainstem samples of the nine positive cases inoculated with the pre-1975 pool, where the initial WB results resembled classical BSE, but with some differences regarding lower molecular mass migration and glycoform ratio, produced a WB profile with similarities to the L-type BSE control sample see Fig.\u00a0.Fig.\u00a01DiThe brain samples of the seven positive cattle inoculated with the post-1990 scrapie pool, the molecular profile of which previously resembled classical scrapie, maintained the classical scrapie profile with the WB protocol adapted for the detection of atypical BSE cases. They also exhibited variation in the molecular mass migration as reported previously . After aNone of the samples from the pre-1975 or the post-1990 scrapie pools resembled an H-type BSE-like profile using mAbs Sha31 or P4 (no higher unglycosylated band) or showed the distinctive molecular mass downward shift and sharp band at 14\u00a0kDa, as illustrated by the H-type BSE control when SAF 84 was applied  of animal P90-5 was not found in any other steer, the genotype of P90-4 was identical to that of P90-2 despite having a different molecular mass profile. The inoculation of cattle with a pool of scrapie brain material, containing possibly multiple strains, remains the most likely reason for the observed diversity in the molecular profiles as hypothesised previously [PrP gene polymorphism did not appear to be responsible for the lack of transmission in some animals since the same polymorphism was found in inoculated cattle with or without PrPSc accumulation in the brain (see Table\u00a0Sc in the brain were heterozygous carriers of the 12 base pair (bp) deletion allele, which is associated with a higher risk of having BSE [We previously reported phenotype diversity in cattle inoculated with the post-1990 scrapie pool: two cattle [P90-4 (inoculated into bank voles) and P90-5, see Table\u00a0ving BSE .res were detectable by WB with mAb SAF84 in the inoculum from P75-7, whilst PrPres was not detected in the inoculum from P90-4 , were detected in the inoculum from P90-4. These findings were consistent with those made by separate WB analysis of the bovine brainstems (see above), which indicated that the molecular profile was maintained within different brain areas regardless of the choice of antibodies Sha31 or SAF84.Prior to inoculation the bovine donor brain samples were subject to molecular analyses. Low levels of PrPres pattern in infected vole brains analysed by WB was not uniform  or low molecular mass unglycosylated PrPres fragment . This partial similarity with classical BSE was confirmed by discriminatory WB, which showed that the 17\u00a0kDa PrPres fragment in voles infected with P75-7 was poorly detected by mAb 12B2, the epitope of which (aa 93WGQGG97) is near the N-terminus of the PrPres fragment  and a low attack rate (7/12). The PrPres fragment. The survival times and attack rates are displayed in Table\u00a0Second and third passages were made using donor voles displaying either the 18 or 17\u00a0kDa PrPres fragments after primary transmission . Also, the vole-adapted \u201csub-strains\u201d derived from CH1641 gave survival times of ~110 dpi for the 17K sub-strain and of ~140 dpi for the 18K sub-strain  and an attack rate of 11/15 although, based on the low level of PrP9\u00a0dpi andSecond and third passages gave short and consistent survival times .Lesion profiles of vole-adapted P90-4 were different from those observed in P75-7 Fig.\u00a0. The surIn summary the findings in bank voles suggest that the prion strains isolated from the cattle inoculated with the pre-1975 and the post-1990 scrapie brain pools were different and distinct from classical BSE and L-type BSE, but similar, or identical, to scrapie strains previously isolated from European natural sheep scrapie cases.Table\u00a0Neither of the ovine scrapie pools or inocula from P75-7 or P90-1 transmitted to tg001 mice on first or second passage Table\u00a0. Lack ofVRQ PrP transgenic mouse line) inoculated with VRQ/VRQ scrapie sheep isolates, whereas longer survival times have been observed in tg338 mice inoculated with ARQ/ARQ scrapie sheep isolates [VRQ/VRQ, ARQ/VRQ and ARQ/ARQ sheep in similar proportions . It is more likely that the post-1990 brain pool contained isolates which have been shown not to propagate in wild-type mice but transmit to tg338 mice with similar long incubation periods regardless of genotype of the sheep (VRQ/VRQ or ARQ/ARQ) source [Although both original scrapie pools transmitted to tg338 mice, survival times were almost seven times shorter in mice inoculated with the pre-1975 scrapie pool. As both inocula produced disease in cattle with similar survival time ranges, it seems unlikely that this finding is due to a lower infectious titre in the post-1990 scrapie pool. Short survival periods are observed in tg338 mice (a isolates . Both po) source . In fact) source , and his) source ; J FosteThe survival times in tg338 mice inoculated with the inoculum from P75-7 were more than three times shorter than with inocula from ovine or bovine BSE sources. By contrast, the inoculum from P90-1 failed to transmit at primary passage but transmitted weakly on second passage; a phenomenon, which has not previously been documented for any isolate from naturally infected cattle with TSEs in this mouse line.Sc distribution in the brain of tg110 mice was different to L-type BSE and as reported for CH1641 [PrP transgenic mice (tg340) (Table\u00a0PrP gene (Tg540 mouse line) [None of the WB profiles obtained after passage in tg110 mice resembled classical BSE. The profile in mice inoculated with the pre-1975 pool and P75-7 inoculum showed an unglycosylated band of 19\u00a0kDa, which was maintained after passage in all tg110 inoculated with this inoculum  . Indeed,se line) .Fig.\u00a07WeThe WB profile obtained after inoculation of tg110 mice with the inoculum from P90-1 gave an unglycosylated 21\u00a0kDa band that has also been observed in tg110 mice inoculated with some sources of classical scrapie . A WB profile with an unglycosylated band of 19\u00a0kDa (L-type BSE-like) was also obtained after inoculation of tg110 mice with the post-1990 scrapie brain pool but the profiles obtained from the brain of steer P90-1 and tg110 mice inoculated with the inoculum from P90-1 were different (unglycosylated band of 21\u00a0kDa, in Fig.\u00a0Two different disease phenotypes were produced after intracerebral inoculation of cattle with scrapie brain pools sourced pre-1975 and post-1990 in GB, which were not readily explained by any differences in PrP genotype of the cattle. Based on pathological and molecular characteristics and biological characterisation in bank voles and transgenic mice there was no clear evidence of an agent derived from the cattle resembling classical or atypical forms of BSE. Transmissions in bank voles identified previously isolated scrapie strains and some similarities to the experimental isolate CH1641. Contrary to the transmission results in rodents, the results for the molecular techniques, which have been adopted for the detection of atypical BSE cases, suggest that they may not be appropriate for differentiating WB profiles in cattle following infection from an ovine scrapie source."}
{"text": "Sc). H-BSE is transmissible to wild-type mice\u2014with infected mice showing a long survival period that is close to their normal lifespan\u2014but not to hamsters. Therefore, rodent-adapted H-BSE with a short survival period would be useful for analyzing H-BSE characteristics. In this study, we investigated the transmissibility of H-BSE to hamster prion protein transgenic (TgHaNSE) mice with long survival periods. Although none of the TgHaNSE mice manifested the disease during their lifespan, PrPSc accumulation was observed in some areas of the brain after the first passage. With subsequent passages, TgHaNSE mice developed the disease with a mean survival period of 220 days. The molecular characteristics of proteinase K-resistant PrPSc (PrPres) in the brain were identical to those observed in first-passage mice. The distribution of immunolabeled PrPSc in the brains of TgHaNSE mice differed between those infected with H-BSE as compared to C-BSE or L-BSE, and the molecular properties of PrPres in TgHaNSE mice infected with H-BSE differed from those of the original isolate. The strain-specific electromobility, glycoform profiles, and proteolytic cleavage sites of H-BSE in TgHaNSE mice were indistinguishable from those of C-BSE, in which the diglycosylated form was predominant. These findings indicate that strain-specific pathogenic characteristics and molecular features of PrPres in the brain are altered during cross-species transmission. Typical H-BSE features were restored after back passage from TgHaNSE to bovinized transgenic mice, indicating that the H-BSE strain was propagated in TgHaNSE mice. This could result from the overexpression of the hamster prion protein.Two distinct forms of atypical bovine spongiform encephalopathies (H-BSE and L-BSE) can be distinguished from classical (C-) BSE found in cattle based on biochemical signatures of disease-associated prion protein (PrP Sc) that is thought to harbor a post-translational conformational change of the normal, host-encoded cellular prion protein (PrPC) in the CNS of affected hosts [Sc (PrPres) identified by western blotting (WB) [Bovine spongiform encephalopathy (BSE), a type of prion disease or transmissible spongiform encephalopathy, is a fatal and progressive degenerative central nervous system (CNS) disorder in cattle. BSE was first identified in the United Kingdom in 1986 [ed hosts . BSE in ing (WB) \u20136. The oing (WB) , 8. Arou136R154Q171 allele of ovine PrP [136R154Q171 allele [BSE is transmissible in a wide range of host species. The transmission of H-BSE to cattle \u201315, tranvine PrP , and wilvine PrP \u201320 has b1 allele  and to S1 allele , suggest1 allele \u201320. Ther1 allele , 24. On 1 allele , 23, 25.Animal experiments were carried out in strict accordance with the regulations outlined in the Guide for the Care and Use of Laboratory Animals of the National Institute of Animal Health and the Guidelines for Proper Conduct of Animal Experiments, 2006 by the Science Council of Japan. Procedures involving animals were approved by the Institutional Animal Care and Use Committee at the National Institute of Animal Health , with all possible effort made to minimize the pain and discomfort of each animal in accordance with the Guidelines for Animal Transmissible Spongiform Encephalopathy Experiments of the Ministry of Agriculture, Forestry, and Fisheries of Japan. All intracerebral inoculations were performed under sevoflurane anesthesia.n = 5; 3 weeks old) were intracerebrally inoculated with 20 \u03bcl of 10% brainstem homogenate (weight/volume) from cattle experimentally infected with H-BSE [Sc-positive brains of first-passage TgHaNSE mice were used for subsequent passages to obtain the TgHaNSE mouse-adapted H-BSE prion. The expression level of hamster PrP in the brain of TgHaNSE mice (provided by Dr. B. Chesebro) was approximately 4\u20135 times higher than that of Syrian hamsters [Female TgHaNSE mice  from National Institute of Infectious Diseases   were injCharacteristics of the five primary antibodies used in this study are summarized in Sc immunohistochemistry (IHC).At necropsy, the left hemisphere and selected tissues\u2014including lymphoid organs\u2014were fixed in 10% buffered formalin containing 10% methanol. Formalin-fixed tissue specimens were immersed in 98% formic acid for 60 min to reduce the infectivity, then embedded in paraffin, sectioned, and stained with hematoxylin and eosin (HE) for histological evaluation or processed for PrPAfter appropriate epitope retrieval by hydrate autoclaving in 10 mM citrate buffer (pH 6.0) at 121\u00b0C for 3 min or with a combination of enzymatic and chemical treatments , sectionres was detected with mAbs 3F4, 4E10, T2, 6H4, or SAF84 and a chemiluminescent substrate  as previously described [The right half of each brain was digested with 40 \u03bcg/ml PK . Tissue samples were dissolved in sodium dodecyl sulfate polyacrylamide gel electrophoresis sample buffer and assayed using standard WB procedures. PrPescribed . After PTo compare disease phenotypes and molecular characteristics of the H-BSE inoculum before and after passage in TgHaNSE mice, brain homogenates from diseased first-passage TgHaNSE mice were intracerebrally injected back into TgBoPrP mice. The susceptibility of these mice (kindly provided by Dr. S.B. Prusiner ) to H-BSNone of the TgHaNSE mice injected with the H-BSE prion exhibited typical signs of the disease at first passage . Four ofAfter one passage of H-BSE from cattle in TgHaNSE mice, subsequent transmission to the mice resulted in shortened mean survival periods, with mice showing signs of prion disease. A third passage did not further reduce the survival period .Lesion profiles based on average scores for histological vacuolation in nine neuroanatomical regions of coronal HE-stained brain sections  from TgHSc immunoreactivity at first and subsequent passages by IHC with the mAb 3F4, which reacts with hamster PrP , and muscle bundles or skeletal muscle fibers  was similar to that of H-BSE from cattle   [Sc distribution patterns, and molecular features of PrPres in the brains of TgBoPrP mice inoculated with H-BSE from TgHaNSE mice were identical to those in TgBoPrP mice inoculated with H-BSE from cattle  . Patholom cattle . The mosAb SAF84 .Sc of H-BSE from cattle was propagated with hamster PrPC substrate in TgHaNSE mouse brains, as determined by WB and IHC analyses. These results demonstrate the transmissibility of H-BSE across a species barrier. Adaptation of prions to a new host requires several sequential passages. Third-passage mice showed the same shortened survival periods, characteristics of prion disease, and pathological and molecular features of PrPSc in the brain as second-passage mice. These data indicate that the infectivity and virulence of H-BSE increased in the new species during adaptation [PrPaptation . This waaptation . After aaptation .C and PrPSc may create a species barrier that influences interspecies transmission [Sc is converted by hamster PrPC and may explain the species barrier with respect to C-BSE prion transmission [C expression level, host genetic factors, or the host microenvironment, which may contribute to the adaptation of heterologous prions and their propagation [Sc aggregation before primary passage TgHaNSE mice reach the end of their lifespan [Differences in amino acid sequence between host PrPsmission . Only eismission . Plausibpagation , 39, 40.lifespan .res from different species cannot be directly compared for strain characterization, the WB analysis revealed different molecular features for PrPres in TgHaNSE mice as compared to the original H-BSE isolate from cattle, including differences in PK cleavage sites, glycoform patterns, and molecular weight. Interestingly, H-BSE-infected TgHaNSE mice did not show an additional 10\u201312-kDa band when analyzed using C-terminal-specific antibodies such as SAF84, which is typical in cattle and bovine transgenic or wild-type mice infected with H-BSE [res glycoform in TgHaNSE mice were altered relative to those in the original cattle inoculum. Although the glycoprofiles of TgHaNSE mice infected with H-BSE as compared to C- or L-BSE were similar, the unglycosylated molecular mass of PrPres from L-BSE was less than that of PrPres from H- and C-BSE. In addition, immunolabeled PrPSc distribution patterns in the brain differed for the three BSE agents in TgHaNSE mice. However, alterations in neuropathological phenotype and biochemical characteristics may be a general phenomenon in interspecies transmission [res in TgHaNSE mice may be influenced by characteristics of the host species rather than those of the prion strain [res has been reported in the transmission from sporadic Creutzfeldt-Jakob disease (CJD) to humanized transgenic mice [C and/or selection of a PrPSc subpopulation from heterogeneous PrPSc, resulting in the emergence of a new prion strain [Although PrPth H-BSE , 20, 35.smission , 43. Then strain , 44, 45.nic mice , variantnic mice , and hamnic mice . These cn strain .The origin of prions that emerged in TgHaNSE mice inoculated with H-BSE was investigated in reverse transmission studies of H-BSE inoculum after passage from TgHaNSE to TgBoPrP mice, which revealed H-BSE-like phenotypes, a phenomenon known as traceback . This inSc under artificial conditions, that is, by overexpressing transgenes in a heterogeneous environment. Nonetheless, our results provide a better understanding of how interspecies transmission of prion agents contributes to PrPSc diversity in prion pathogenesis. Additional studies are needed to clarify the transmissibility of H-BSE from TgHaNSE mice to hamsters and to examine PrPSc of H-BSE in TgHaNSE mice, as well as the influence of environment on its propagation in hamster brains.In this study, we investigated PrPSc in the brain as well as several peripheral tissues. Furthermore, H-BSE adapted and was stabilized after the third passage. The pathogenic features of H-BSE in TgHaNSE mice differed from those of C- and L-BSE. This mouse model is a useful tool for further investigations of the mechanisms underlying the species barrier of BSE prions.In conclusion, H-BSE from cattle was efficiently transmitted to TgHaNSE mice, as determined by the accumulation of PrPS1 FigSc mainly accumulated in the gray matter of the spinal cord. (B) Fine punctate to coarse particulate PrPSc deposits were present in the ganglion cell layer, inner nucleus layer, and inner and outer plexiform layers of the retina. NFL, nerve fiber layer; GCL, ganglion cell layer; IPL, inner plexiform layer; INL, inner nucleus layer; OPL, outer plexiform layer; ONL, outer nucleus layer; PL, photoreceptor layer; RPE, retinal pigment epithelium.  Granular PrPSc immunoreactivity was observed in ganglionic cells (arrows) of the trigeminal ganglion (C) and dorsal root ganglion (D). (E) Granular PrPSc immunoreactivity was detected in the intrafusal myofibers of muscle spindles of skeletal muscle. (F) Serial section of (E) with HE staining.(A) Coarse particulate PrP(PDF)Click here for additional data file."}
{"text": "Successful transmission of Transmissible Mink Encephalopathy (TME) to cattle supports the bovine hypothesis for the still controversial origin of TME outbreaks. Human and primate susceptibility to classical Bovine Spongiform Encephalopathy (c-BSE) and the transmissibility of L-type BSE to macaques indicate a low cattle-to-primate species barrier. We therefore evaluated the zoonotic potential of cattle-adapted TME. In less than two years, this strain induced in cynomolgus macaques a neurological disease similar to L-BSE but distinct from c-BSE. TME derived from another donor species (raccoon) induced a similar disease with even shorter incubation periods. L-BSE and cattle-adapted TME were also transmissible to transgenic mice expressing human prion protein (PrP). Secondary transmissions to transgenic mice expressing bovine PrP maintained the features of the three tested bovine strains  regardless of intermediate host. Thus, TME is the third animal prion strain transmissible to both macaques and humanized transgenic mice, suggesting zoonotic potentials that should be considered in the risk analysis of animal prion diseases for human health. Moreover, the similarities between TME and L-BSE are highly suggestive of a link between these strains, and therefore the possible presence of L-BSE for many decades prior to its identification in USA and Europe. Transmissible Mink Encephalopathy (TME) is a rare prion disease affecting ranch-reared mink that was reported in four isolated outbreaks in the USA in 1947, 1961, 1963 and 1985 . EpidemiSeveral experimental exposures of mink to ruminant prions were performed to identify the exact origin of TME. Low efficiency and rate of transmission were observed after inoculation of mink with sheep scrapie  and elk-Currently, classical BSE is the only animal transmissible spongiform encephalopathy (TSE) considered as a zoonotic disease, since it induces a variant of Creutzfeldt-Jakob disease (CJD) in humans ,14,15. WWe chose to assess the risk for human health linked to TME-related prion strains by evaluating the transmissibility of cattle-adapted TME in this cynomolgus macaque model, in comparison to raccoon TME as a non-ruminant source of the same prion strain. In parallel, we used transgenic mice overexpressing human or bovine prion protein (PrP) to assess the relevance of our results for human situation.A primate intracerebrally inoculated with the equivalent of 40 mg of a TME-infected cattle brain (second passage) developed the first neurological signs of disease after less than twenty months of incubation . It firsIn parallel, several but not all the transgenic mice overexpressing human (Met/Met) PrP (tg650 mice) intracerebrally inoculated with cattle-adapted TME inoculum exhibited cerebral PrPres: partial transmission (75 %) occurred in humanized mice that died after about 18 months of incubation .From these results, cattle-adapted TME represents the third cattle prion strain (together with c-BSE and L-BSE) experimentally demonstrated to be transmissible to non-human primates. We confirmed in this study the previously described transmissibility of both L-BSE and c-BSE in both experimental primates ,21 and tIn the primate model, exposure to L-BSE-infected cattle brain induced a clinical picture with incubation time and duration of illness that are similar to those observed after exposure to cattle-adapted TME, even after exposure to as little as 2.5 mg of brain tissue . ConversA comparison of incubation periods confirmed and magnified the higher virulence of L-BSE for macaque compared to c-BSE, which we had previously observed . Moreoveet al., in this transgenic model [In the model of transgenic mice overexpressing human (Met/Met) PrP (tg650 mice), an incomplete transmission rate of 25% of L-BSE was observed after an incubation period of similar duration (18 months) to those from cattle TME-exposed animals, while a 100% transmission rate was observed with c-BSE, but with longer incubations . These observations are consistent with the results obtained with L-BSE strain by Beringue ic model  and by KThe overexpression of PrP in transgenic mice is often criticized as an element helping to force the way through the species barrier and extrapolation of our results in this model to the human situation should be taken with caution, since transgenic mice expressing physiological levels of human PrP are resistant to L-BSE . NeverthThe macaque inoculated with cattle-adapted TME showed widespread cortical spongiosis similar to that in both primates exposed to L-BSE . The spoPrimates inoculated with L-BSE or cattle TME exhibited a similar diffuse laminar synaptic pattern of PrPres depositions (either fine and sandy or roughly granular) but no evidence of plaques, even when stained with thioflavine T (data not shown), whereas c-BSE-infected animals had weak diffuse synaptic labeling but multiple intensely-stained PrPres aggregates and characteristic plaques . We previously demonstrated that the technique that we developed for typing and classifying prion strains in small ruminants might also be used to discriminate L-BSE from c-BSE in experimentally infected macaques . BrieflyUnder these experimental conditions, PrPres in both primates and Tg650 exposed to cattle-adapted TME behaved like PrPres derived from corresponding animals infected with L-BSE  Figure . A 19 kDStrain signatures were also assessed in bioassays in transgenic mice overexpressing bovine PrP (tg110). Those mice were intracerebrally inoculated with cattle-adapted TME, L-BSE or c-BSE isolates issued from cattle, macaque or tg650 recipients  . All theThis biochemical strain typing protocol was adapted  and applied to Tg110 mice . The resPrimates and mice were housed and handled in accordance with the European Directive 2010/63 related to animal protection and welfare in research, under the constant internal surveillance of veterinarians. Animals were handled under anesthesia to limit stress, and euthanasia was performed for ethical reasons when animals lost autonomy. Macaca fascicularis) were provided by Noveprim (Mauritius), checked for the absence of common primate pathogens before importation, and handled in accordance to national guidelines. Transgenic mice overexpressing human  or bovin (tg650 ) PrP werThe TME inocula were derived from a second passage in cattle  or the Tissues were fixed in formalin 4% for histological examination. Neuropathology and immunohistochemical detection of protease-resistant prion protein (PrPres) were performed on brain sections as previously described . PrP was purified according to the TeSeE purification protocol (Bio-Rad), in adapted conditions of proteolysis for strain discrimination as previously described , using BWe have shown that cattle-adapted TME is the third cattle prion strain  to be transmissible both to non-human primates and transgenic mice overexpressing human PrP. However, the successful transmission of raccoon TME to primate, inducing a disease with similar features as cattle TME, extends this notion to TME-related strains independent of host origin. Pathological, biochemical and bioassay investigations converged to demonstrate the similarity between cattle-adapted TME and L-BSE. Together with previous experiments performed in ovinized and bovinized transgenic mice and hamsters ,9 indica"}
{"text": "The H-type of atypical bovine spongiform encephalopathy (H-BSE) was serially passaged in bovinized transgenic (TgBoPrP) mice. At the fourth passage, most challenged mice showed a typical H-BSE phenotype with incubation periods of 223\u2009\u00b1\u20097.8 days. However, a different phenotype of BSE prion with shorter incubation periods of 109\u2009\u00b1\u20094 days emerged in a minor subset of the inoculated mice. The latter showed distinct clinical signs, brain pathology, and abnormal prion protein profiles as compared to H-BSE and other known BSE strains in mice. This novel prion was transmitted intracerebrally to cattle, with incubation periods of 14.8\u2009\u00b1\u20091.5 months, with phenotypes that differed from those of other bovine prion strains. These data suggest that intraspecies transmission of H-BSE in cattle allows the emergence of a novel BSE strain. Therefore, the continuation of feed ban programs may be necessary to exclude the recycling of H-BSE prions, which appear to arise spontaneously, in livestock. Such measures should help to reduce the risks from both novel and known strains of BSE. Sc). PrPSc is a disease-associated isoform of the host-encoded prion proteinC) to PrPSc is thought represent a central event in prion pathogenesis. PrPSc has been recognized as the major component of prionsSc are associated with different prion strains that, in turn, cause distinct disease phenotypesPrions cause transmissible spongiform encephalopathies (TSEs), which are characterized by a spongiform change in the central nervous system and the accumulation of an abnormal prion protein  is a TSE of cattle. Most BSE cases show a unique phenotype that is thought to be caused by a single prion strain55The worldwide occurrence of BSE is declining, primarily because of effective feed ban programsC, respectively1516H-BSE was first reported in France59101113Serial passages of H-BSE in wild type18Sc, and histopathological features from the primary to third passage mice. At the fourth passage, mice from a single experimental group (#3), out of eight experiments, showed shorter incubation periods (108.8\u2009\u00b1\u20094.0 days) than the other groups. This group was challenged with brain homogenates of a mouse with 221-day incubation period. Group #3 animals showed weight loss, but no constant chewing of the bedding. This short incubation-type of BSE was designed BSE-SW (short incubation with weight loss) strain. BSE-SW was transmitted to TgBoPrP mice with 97.3\u2009\u00b1\u20093.7 day incubation periods, and their clinical signs were identical to those of mice in the experimental group #3. The other mice in the fourth passage groups showed the symptomatic chewing of the bedding, and their incubation periods were 223.3\u2009\u00b1\u20097.8 days  of BSE-SW was lower than that of H-BSE, but similar to C-BSE  were observed for H-BSE and BSE-SW (14) was detected in C-BSE and BSE-SW, whereas a slightly higher molecular weight (approximately 19\u2009kDa) of PrPcore #1 was detected in H-BSE. Unglycosylated PrPcore with a molecular weight of 12\u2009kDa (PrPcore #214) was observed in H-BSE and BSE-SW  6H4 revealed that the molecular mass of proteinase K (PK) digested PrPto C-BSE . MAb P4,to C-BSE . This red BSE-SW . Deglycod BSE-SW . On the d BSE-SW . These bSc in TgBoPrP mice with BSE-SW were different from H-BSE and C-BSE  for PrPSc denaturation in the H-BSE and BSE-SW brains were 3.8\u2009\u00b1\u20090.4\u2009M and 3.0\u2009\u00b1\u20090.2\u2009M, respectively , which included disturbance, mild fear or anxiety, mild gait changes, and, occasionally, low head carriage. After one to two months of the initial clinical signs, the animals were leaning towards the floor and rested their heads against the wall, which was followed by ataxia of the hind limbs that progressed to difficulty in getting up without assistance at the clinically terminal stage of the disease. The bodily condition gradually worsened because of a loss of weight during the two to three month clinical duration. None of the animals exhibited anorexia, nervousness, or aggression, and responded to visual, acoustic, and tactile stimuli throughout the course of the disease. The cattle were eventually culled at 13.3 mpi, 15 mpi, and 16.2 mpi before astasia, in accordance with the welfare guidelines for animal experiments. The incubation periods of cattle infected with BSE-SW (14.8\u2009\u00b1\u20091.5\u2009mpi) were shorter than those for H-BSE, C-BSE, and L-BSE . Obex saSc with mAb F99/97.6.1 resulted in intraneuronal and intraglial patterns throughout the obex , the solitary nucleus, the nucleus of trigeminal nerve spinal tract, and the olivary nucleus in all animals. No intraneuronal vacuolation was seen. Spongy changes were not prominent in the gray matter of medulla oblongata at the obex . Immunolthe obex . IntraneSc from the obex tissue of the challenged cattle. The molecular features of PrPcore of BSE-SW-affected cattle were distinctly different from C-BSE, L-BSE, and H-BSE . PrPSc of BSE-SW has some similarity to H-BSE on the account of the presence of truncated 12-kDa fragments (PrPcore #2). Sc from BSE-SW, as assessed by immunoreactivity with mAbs P4, 6H4, and SAF84. These results argue against the possibility that the BSE-SW prion resulted from a contamination of other laboratory prion strains.Our previous reports have revealed the usefulness of TgBoPrP mice for characterizing BSE prions16211621It is known that sheep scrapie comprises different prion strains241819Sc are involved in the prion strain diversitySc from a uniform conformation causes the emergence of new host-adapted PrPSc\u2009Sc of BSE-SW exhibited different conformational stability from H-BSE. It is also known that strain \u201cmutation or transformation\u201d may occur upon intraspecies transmission, where the PrP amino acid sequences of the host and the donor are identicalSc of BSE-SW has a different conformation than H-BSE.It has been suggested that different conformations of PrPSc accumulation in the obex, and the challenged cattle fulfilled BSE criteria . Animal experiments were performed in accordance with the Guidelines for Animal Transmissible Spongiform Encephalopathy Experiments of the Ministry of Agriculture, Forestry, and Fisheries of Japan.PrP gene (encoding BoPrP) in a mouse PrP deficient background were used. These mice harbored the cattle PrP gene containing six copies of the octarepeat sequence , and produced approximately eight times more BoPrP per gram of protein than found in the cattle brainTgBoPrP mice overexpressing the bovine Brain samples of Canadian H-BSE cattle, courteously provided by Dr. S. Czub, were used in this study211032g for 5\u2009min at room temperature (RT). Three-week-old female TgBoPrP mice were inoculated intracerebrally with 20\u2009\u03bcl supernatant. Following inoculation, clinical status of the mice was monitored daily to assess the onset of neurological signs. The brains of diseased mice were removed and stored at -80\u2009\u00b0C for biochemical analysis or fixed for histopathology. For the fourth passage, eight diseased mice brains from the third passage were used to independently challenge to TgBoPrP mice.Brain tissues from BSE-affected animals were homogenized in nine volumes of phosphate buffered saline (PBS) using a multi-bead shocker (Yasui Kikai) and centrifuged at 1,000\u2009\u00d7\u2009Three female 3-4-month-old Holstein calves were challenged intracerebrally with 1\u2009ml of 10% brain homogenate of BSE-SW-affected TgBoPrP mice, as described previouslySc fragments (PrPcore). PK digestion was terminated with 2\u2009mM 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride . The samples were mixed with equal volumes of 2-butanol:methanol mixture (5:1) and centrifuged at 20,000\u2009\u00d7\u2009g for 10\u2009min. The pellets were resuspended in gel-loading buffer containing 2% (w/v) SDS, and were then boiled for 10\u2009min before western blotting. After PK treatment, some samples were deglycosylated with N-glycosidase F , following the manufacturer\u2019s instruction.Brain tissues were homogenized in PBS  using a multi-bead shocker. The brain homogenate (125\u2009\u03bcl) was mixed with an equal volume of buffer containing 4% (w/v) Zwittergent 3\u201314 , 1% (w/v) Sarkosyl, 100\u2009mM NaCl, and 50\u2009mM Tris-HCl (pH 7.6), and incubated with 6.25\u2009\u03bcl of 40\u2009mg/ml collagenase solution. The samples  were then subjected to PK (Roche Diagnostic) digestion at 37\u2009\u00b0C for 1\u2009h to detect PK-resistant PrPThe following monoclonal antibodies (mAbs) against PrP were used in this study: P4 (R-Biopharm), 6H4 (Prionics), SAF84 (SPI-bio), and F99/97.6.1 (VMRD). MAb P4 recognizes amino acid residues 101\u2013107 of bovine PrP sequenceSamples were separated by SDS-PAGE and blotted electrically onto a PVDF membrane (Millipore). The blotted membrane was incubated with mAbs P4, 6H4, and SAF84 at RT for 1\u2009h. MAb binding was detected by horseradish peroxidase-conjugated anti-mouse IgG. Signals were developed with a chemiluminescent substrate .Sc immunohistochemistry (IHC), sections were incubated with mAbs SAF84 or F99/97.61, followed by incubation with anti-mouse universal immunoperoxidase polymer (Histofine Simple Stain MAX-PO (M), Nichirei) as the secondary antibody, and visualized using 3,3\u2032-diaminobenzidine tetrachloride as the chromogen. Finally, the sections were counterstained with hematoxylin. Paraffin embedded tissue (PET) blot was performed as described previouslyHistopathological analysis of TgBoPrP mice and cattle was performed according to a previously described method1016Sc concentration and western blot analysis were carried out as described above. Conformational stability was examined using mAbs 6H4 and SAF84. Denaturation curves were obtained by densitometric analysis using Fluorochem software (Alpha Innotech Co.). GdnHCl concentration at half maximal denaturation ([GdnHCl]1/2) was used as a measure of the relative conformational stability of PrPSc. [GdnHCl]1/2 was calculated based on the denaturation curves.Conformation stability assay was performed according to a previously described method with minor modificationHow to cite this article: Masujin, K. et al. Emergence of a novel bovine spongiform encephalopathy (BSE) prion from an atypical H-type BSE. Sci. Rep.6, 22753; doi: 10.1038/srep22753 (2016)."}
{"text": "Sc) was detected in the brain and/or lymphoid tissues during the lifespan of mice that were asymptomatic subclinical carriers, indicating that wild-type mice were susceptible to sheep-passaged L-BSE. The morphological characteristics of the PrPSc of sheep-passaged L-BSE included florid plaques that were distributed mainly in the cerebral cortex and hippocampus of subsequent passaged mice. The PrPSc glycoform profiles of wild-type mice infected with sheep-passaged L-BSE were similar to those of the original isolate. The data indicate that sheep-passaged L-BSE has an altered host range and acquired transmissibility to wild-type mice.L-type bovine spongiform encephalopathy (L-BSE) is an atypical form of BSE that is transmissible to cattle and several lines of prion protein (PrP) transgenic mice, but not to wild-type mice. In this study, we examined the transmissibility of sheep-passaged L-BSE prions to wild-type mice. Disease-associated prion protein (PrP Sc) has higher (H-BSE) or lower (L-BSE) molecular mass than that of classical (C-) BSE [Bovine spongiform encephalopathy (BSE) was originally thought to be caused by a single prion strain, based on analysis of its biological and biochemical characteristics. However, since 2003, different pathological and molecular phenotypes of BSE  have been reported in approximately 90 cases worldwide, mainly in aged cattle. Currently, atypical BSE is classified into two groups depending on whether the proteinase K (PK)-resistant abnormal, disease-associated form of the prion protein (PrP(C-) BSE . The oriExperimentally, L-BSE prions have shown transmissibility by intracerebral challenge to cattle -6; bovinAll the experiments involving animals were performed with the approval of the Animal Ethics Committee and the Animal Care and Use Committee of the National Institute of Animal Health . Fifteen 3-week-old outbred ICR (CD-1) mice  were inoculated intracerebrally with 20\u00a0\u03bcL of 10% brain homogenates of Japanese L-BSE  passagedSc immunohistochemistry (IHC). Selected sections were stained with phenol Congo red and examined under a polarizing microscope, and the presence of amyloid was confirmed by observation of its characteristic dichroism [At necropsy, the left hemisphere and selected tissues including the lymphoid organs were removed and fixed in 10% buffered formalin containing 10% methanol. Formalin-fixed tissues were immersed in 98% formic acid for 60\u00a0min to reduce the infectivity, embedded in paraffin, and sectioned for histological evaluation by staining with hematoxylin and eosin (HE), and using PrPichroism .After appropriate epitope retrieval with either hydrate autoclaving or a combination of enzymatic and chemical treatment, IHC was carried out using the monoclonal antibodies (mAbs) 2G11, 12F10, or SAF84  followed by an anti-mouse, universal horseradish peroxidase (HRP)-conjugated polymer (Nichirei Histofine Simple Stain MAX-PO (M); Nichirei Biosciences Inc., Tokyo, Japan) as the secondary antibody, and visualized with 3,3\u2032-diaminobenzedine tetrachloride as the chromogen, as previously described . Finallyg for 10\u00a0min. The pellets were mixed with a gel-loading buffer containing 2% sodium dodecyl sulfate, boiled for 5\u00a0min before electrophoresis, and loaded onto a 12% polyacrylamide gel. The separated proteins were transferred onto an Immobilon-P polyvinylidene fluoride membrane (EMD Millipore). The blotted membranes were incubated with the mAbs SAF84 and T2 [The right hemisphere and spleen were removed and stored at \u221280\u00a0\u00b0C until use. The tissues (200\u2009\u00b1\u200910\u00a0mg) were homogenized at 20% concentration (w/v) in a buffer containing 100\u00a0mM NaCl and 50\u00a0mM Tris\u2013HCl (pH\u00a07.6). The homogenates (250\u00a0\u03bcL) were mixed with an equal volume of detergent buffer containing 4% (w/v) Zwittergent 3\u201314 , 1% (w/v) Sarkosyl, 100\u00a0mM NaCl, and 50\u00a0mM Tris\u2013HCl (pH\u00a07.6), and treated with 6.25\u00a0\u03bcL of 40\u00a0mg/mL collagenase. The sample was then digested with 40\u00a0\u03bcg/mL proteinase K  and the digestion was terminated using 2\u00a0mM 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride . After PK treatment, the samples were mixed with a 2-butanol: methanol mixture (5:1) and centrifuged at 20000\u2009\u00d7\u20094 and T2  followedSc in wild-type mice inoculated with L-BSE/sheep, the brains of wild-type mice [To compare the molecular features of PrPype mice ,23, cattype mice ,9, or shype mice  inoculatThe mAbs 2G11, SAF84, and T2 were found to react with bovine, ovine, and mouse PrP; the mAb 12F10 reacts with both bovine and ovine, but not mouse PrP.To compare the phenotypic features of L-BSE inoculum before and after passage in sheep, reverse transmission to bovinized PrP expressing transgenic (TgBoPrP) mice was carried out to examine whether the L-BSE/sheep would maintain its specific strain properties in bovids. TgBoPrP mice were kindly provided by Dr Prusiner . The susSc bands were analyzed using Instat3 software  and ImageReader software  after background subtraction, respectively; p values <0.05 were considered statistically significant.Incubation periods expressed as mean\u2009\u00b1\u2009standard deviation of the mean (SD) and signal intensities of PK-resistant PrPSc signal was detected by WB, IHC, or both techniques in the brain from 1 case at 710 dpi, and in lymphoid tissues  from 9 of 15 mice after 200 dpi after the first passage. Positive IHC results in a mouse were typically composed of sparse granular deposits in some areas of the brain such as the vestibular nucleus or dorsal motor nucleus of the vagal nerve, midbrain tegmentum, hypothalamus, medial preoptic nucleus, and habenular nucleus  (Table\u00a0Sc-positive spleens of mice was used for subsequent second passages in ICR mice (Table\u00a0n\u2009=\u20096) was statistically unchanged on second passage, without any clinical signs and a 100% transmission rate. Histopathological examination showed prominent florid and non-florid plaques with large confluent vacuoles in the cerebral cortex and hippocampus of all inoculated mice  and 152\u2009\u00b1\u20092\u00a0days (n\u2009=\u200924) at primary and secondary passage, respectively. In contrast, the mean incubation period of L-BSE/sheep to TgBoPrP mice was 249\u2009\u00b1\u200928 (n\u2009=\u20095) and 269\u2009\u00b1\u200917\u00a0days (n\u2009=\u200913) at primary and secondary passage, respectively, which indicated a significantly longer incubation period compared to L-BSE/cattle, the original isolate  showed a lack of any evidence of transmission during their lifespan by both WB and IHC tests  that are affected by L-BSE/sheep [Sc accumulation has not been detected in cattle [Sc in lymphoid tissues does not necessarily result in neuroinvasion [Sc deposits accumulated in the brain. This result indicates that L-BSE/sheep may not have pathogenicity and virulence towards wild-type mice. The discrimination and typing of prion strains are dependent on biological characteristics that include clinical signs, incubation times, histopathological vacuolar lesion profiles, PrPSc deposition patterns in the brain, and the biochemical features of PrPSc over several mouse passages [A transmission study performed on experimental animals is a useful approach for the isolation and characterization of prion strains. In the present study, we were able to demonstrate the transmissibility of L-BSE/sheep to wild-type mice across a species barrier during their lifespans, in the absence of clinical signs of the disease. According to the protein-only hypothesis, PrPhenotype . The PrPE prions . Since t passage . Interesn cattle ,28 or shn cattle  affectedn cattle . In addin cattle . Thus, sn cattle ,31. Conspassages ,33.Sc has been reported in cross-species transmission of sporadic Creutzfeldt-Jakob disease (CJD) to humanized transgenic mice [Sc, but gained the transmissibility to wild-type mice. Although the key event that determines the shift in the size of PK-resistant PrPSc remains unknown, it seems likely that the molecular characteristics may be influenced by the host-environment factors rather than the nature of the prion strain. The specific strain features of L-BSE observed in TgBoPrP mice affected with L-BSE/cattle [In the results of WB tests, a strain-specific molecular signature such as the glycoform pattern was conserved in the transmitted wild-type mice. The occurrence of size shifts in PK-digested PrPnic mice , variantnic mice , and hamnic mice . The traE/cattle ,37 or L-Sc in the brain. The first two possibilities were completely ruled out by the authors [Sc was undetectable in the brain of these mice, a faint positive signal was identified in one RIII mouse that showed biochemical characteristics of PrPSc identical to those of C-BSE-infected mice by WB analyses.To the best of our knowledge, the transmission of L-BSE/cattle to wild-type mice has only been reported in one study, and even in this case the L-BSE prions were converted to a C-BSE-like prion using serial passages, and had indistinguishable phenotypic traits compared with mouse-passaged C-BSE . A pheno authors . The las authors , should  authors . No tranFour L-BSE isolates from Japan , GermanyC and the PrPSc of inocula result in species barriers to the cross-species transmission of prions [Finally, the results indicate that L-BSE/sheep is transmissible to wild-type mice and it results in low virulence compared with C-BSE . In contf prions . In this"}
{"text": "Bovine spongiform encephalopathy (BSE) in cattle and variant Creutzfeldt\u2013Jakob disease in humans have previously been shown to be caused by the same strain of transmissible spongiform encephalopathy agent. It is hypothesized that the agent spread to humans following consumption of food products prepared from infected cattle. Despite evidence supporting zoonotic transmission, mouse models expressing human prion protein (HuTg) have consistently shown poor transmission rates when inoculated with cattle BSE. Higher rates of transmission have however been observed when these mice are exposed to BSE that has been experimentally transmitted through sheep or goats, indicating that humans may potentially be more susceptible to BSE from small ruminants. Here we demonstrate that increased transmissibility of small ruminant BSE to HuTg mice was not due to replication of higher levels of infectivity in sheep brain tissue, and is instead due to other specific changes in the infectious agent. C (Sc) is present in infected tissues of the central nervous system (CNS) and lymphoreticular system, and propagates via a templated seeding mechanism, where the abnormal protein binds to and converts normal PrPC into the abnormal conformation  diseases  are fatal, infectious neurodegenerative diseases of animals, and include bovine spongiform encephalopathy (BSE) in cattle, scrapie in sheep and Creutzfeldt\u2013Jakob disease (CJD) in humans. TSEs are unusual diseases, as the infectious agent is thought to be composed solely of a misfolded conformer of the normal host glycoprotein PrPC . The abnormation .Ruminant TSEs were for many years thought to be of low risk to humans due to the lack of association between incidence of natural scrapie in sheep and CJD in humans. However, in 1996, a new variant of CJD (vCJD) was identified in humans that presented with a different clinical and pathological phenotype (n\u200a=\u200a177) compared with the size of the UK population that may have been exposed to the agent in the 1980s and 1990s, and the predicted number of possible silent carriers in the general population, evaluated from analysis of anonymized lymphoid tissue  in the presence of human PrP, and it was hoped these models would provide evidence on routes and risks of exposure of humans to caBSE. Considerable variation in susceptibility was observed between different transgenic lines with various constructs and protein expression levels. However, in general, transmission rates in mice overexpressing human 129M-PrP were found to be low (0\u201330\u200a%) (Although sheep and goats were exposed to the same sources of contaminated feed (but in lower quantities) as cattle during the BSE epidemic  into groups of 12 Bov6 transgenic mice. The 10\u22121 homogenate was also inoculated into control 129/Ola mice and HuMM transgenic mice, to ensure the exp-shBSE inoculum used was able to cause the same TSE pathology in HuMM transgenic mice as observed previously. All animals were monitored daily and scored weekly for signs of clinical disease and culled either due to intercurrent illness or at a pre-defined clinical end point. Tissue from each mouse was analysed post-mortem for presence of TSE-associated vacuolation  for caBSE  and 105.0 ID50 g\u22121 tissue for exp-shBSE . The difference of less than half a log between titres was not statistically significant . Several survivors were found to show TSE pathology (vacuolation and/or PrP deposition) when culled due to intercurrent illness after the last clinical positive animal in each group. Titre calculations based on TSE pathology alone also showed no significant difference between caBSE and exp-shBSE titres . While no signs of disease were observed in HuMM mice inoculated with caBSE  and Romney sheep (105.4 ID50 g\u22121) in the study by Gonzalez et al. (2009) were equivalent to those measured here in Bov6 mice (105.0 ID50 g\u22121). Incubation times for 10\u22121 dilution in RIII mice (389 days)  more efficiently than sheep scrapie   were sim89 days) . More regh sheep , indicatTogether, these data show that the increased transmissibility of exp-shBSE and exp-gtBSE to mice expressing human 129M PrP is not due solely to PrP sequence, infectivity level or the convertibility of human 129M-PrP by ovine/caprine prions. The increased transmissibility of exp-shBSE in HuTg mice must therefore be due to other specific changes in the agent and its ability to interact with the host. These may include differences in cellular factors such as routing of the inoculum and trafficking of PrP-res, or the composition and interaction of specific conformers of abnormal PrP in the inoculum. The identification of such factors that are critical for zoonosis may aid in the assessment of future TSE agent outbreaks and the associated risk to humans from these isolates. As long as TSE agents remain in the environment, the opportunity for cross-species transmission to occur remains. Our data have shown that such cross-species transmission events can have major effects on the host range and transmissibility of different TSE agents. In particular we have established that the emergence or re-emergence of BSE in small ruminants could have serious public health implications. There is therefore a strong requirement to continue surveillance for new emerging TSE strains, or for the appearance of old strains in new hosts, and quickly assess the risks of zoonosis."}
{"text": "PRNP). A proline to leucine substitution at PrP residue 102 (P102L) is classically associated with Gerstmann-Str\u00e4ussler-Scheinker (GSS) disease but shows marked clinical and neuropathological variability within kindreds that may be caused by variable propagation of distinct prion strains generated from either PrP 102L or wild type PrP. To-date the transmission properties of prions propagated in P102L patients remain ill-defined. Multiple mouse models of GSS have focused on mutating the corresponding residue of murine PrP (P101L), however murine PrP 101L, a novel PrP primary structure, may not have the repertoire of pathogenic prion conformations necessary to accurately model the human disease. Here we describe the transmission properties of prions generated in human PrP 102L expressing transgenic mice that were generated after primary challenge with ex vivo human GSS P102L or classical CJD prions. We show that distinct strains of prions were generated in these mice dependent upon source of the inoculum (either GSS P102L or CJD brain) and have designated these GSS-102L and CJD-102L prions, respectively. GSS-102L prions have transmission properties distinct from all prion strains seen in sporadic and acquired human prion disease. Significantly, GSS-102L prions appear incapable of transmitting disease to conventional mice expressing wild type mouse PrP, which contrasts strikingly with the reported transmission properties of prions generated in GSS P102L-challenged mice expressing mouse PrP 101L. We conclude that future transgenic modeling of IPDs should focus exclusively on expression of mutant human PrP, as other approaches may generate novel experimental prion strains that are unrelated to human disease.Inherited prion disease (IPD) is caused by autosomal-dominant pathogenic mutations in the human prion protein (PrP) gene ( Inherited prion disease (IPD) is caused by pathogenic mutations in the human prion protein (PrP) gene leading to the formation of lethal prions in the brain. To-date the properties of prions causing IPD and their similarities to prions causing other forms of human prion disease remain ill-defined. In the present study we have investigated the properties of prions seen in patients with Gerstmann-Str\u00e4ussler-Scheinker (GSS) disease associated with the substitution of leucine for proline at amino acid position 102 (GSS P102L). We examined the ability of these prions to infect transgenic mice expressing human mutant 102L PrP, human wild-type PrP or wild-type mice. We found that GSS-102L prions have properties distinct from other types of human prions by showing that they can only infect transgenic mice expressing human PrP carrying the same mutation. Mice expressing wild-type human PrP or wild-type mouse PrP were entirely resistant to infection with GSS-102L prions. We conclude that accurate modeling of inherited prion disease requires the expression of authentic mutant human PrP in transgenic models, as other approaches may generate results that do not mirror the human disease. Prion diseases are a closely related group of neurodegenerative conditions which affect both humans and animals ,2. They C) to alternative isoforms designated PrPSc  sugtant PrP ,27. Herer clone) \u201350 minorutations \u201356.www.nc3rs.org.uk/ARRIVE/).Storage and biochemical analyses of post-mortem human brain samples and transmission studies to mice were performed with written informed consent from patients with capacity to give consent. Where patients were unable to give informed consent, assent was obtained from their relatives in accordance with UK legislation and Codes of Practice. Samples were stored and used in accordance with the Human Tissue Authority Codes of Practice and in line with the requirements of the Human Tissue Authority licence held by UCL Institute of Neurology. This study was performed with approval from the National Hospital for Neurology and Neurosurgery and the UCL Institute of Neurology Joint Research Ethics Committee \u2014REC references: 03/N036, 03/N038 and 03/N133. Work with mice was performed under approval and licence granted by the UK Home Office  Act 1986; Project Licence number 70/6454) and conformed to University College London institutional and ARRIVE guidelines  designated Tg(HuPrP102L 129M+/+Prnpo/o)-27 mice (102LL Tg27) [129M transgene array and murine PrP null alleles (Prnpo/o) designated Tg(HuPrP129M+/+Prnpo/o)-35 congenic (129MM Tg35c) were derived by subjecting previously described 129MM Tg35 mice [129V transgene array and murine PrP null alleles (Prnpo/o) designated Tg(HuPrP129V+/+Prnpo/o)-152 congenic (129VV Tg152c) were derived by subjecting previously described 129VV Tg152 mice [Transgenic mice homozygous for a human PrPLL Tg27)  have beeg35 mice ,57 to co152 mice ,39,42 to2, and intra-cerebrally inoculated into the right parietal lobe with 30 \u03bcl of 1% (w/v) brain homogenate prepared in Dulbecco\u2019s phosphate buffered saline lacking Ca2+ or Mg2+ ions (D-PBS). All mice were thereafter examined daily for clinical signs of prion disease. Mice were killed if they exhibited any signs of distress or once a diagnosis of prion disease was established. At post-mortem brains from inoculated mice were removed, divided sagittally with half frozen and half fixed in 10% buffered formol saline.Strict bio-safety protocols were followed. Inocula were prepared, using disposable equipment for each inoculum, in a microbiological containment level 3 laboratory and inoculations performed within a class 1 microbiological safety cabinet. Ten mice per group from three transgenic lines, 102LL Tg27, 129MM Tg35c, 129VV Tg152c and FVB/N wild type mice were inoculated with a panel of prion isolates, all previously passaged in 102LL Tg27 transgenic mice and therefore adapted to human 102L PrP. The primary inocula comprised human brain homogenates from three IPD P102L patients, one sporadic CJD patient and three iatrogenic CJD patients. Diagnosis of all cases had been neuropathologically confirmed. The genotype of each mouse was confirmed by PCR of DNA prior to inclusion and all mice were uniquely identified by sub-cutaneous transponders. Disposable cages were used and all cage lids and water bottles were also uniquely identified by transponder and remained with each cage of mice throughout the incubation period. Care of the mice was according to institutional and ARRIVE guidelines. Mice were anaesthetised with a mixture of halothane and OPrnpo/o mice against \u03b1 or \u03b2 PrP as described elsewhere [1 with an epitope spanning residues 142\u2013153 of human PrP [2b with an epitope spanning residues 93\u2013105 of human PrP [Anti-PrP monoclonal antibodies ICSM 18 and ICSM 35 were supplied by D-Gen Ltd, London, UK. ICSM antibodies were raised in lsewhere . ICSM 18uman PrP . ICSM 35uman PrP ,59. ICSMuman PrP .Brain homogenates (10% (w/v)) were prepared in D-PBS and aliquots analysed in duplicate with or without proteinase K digestion  by electrophoresis and immunoblotting as described previously ,61. Duplwww.ventana.com). Visualization was accomplished with diaminobenzidine staining. Bright field photographs were taken on an ImageView digital camera (www.soft-imaging.de) and composed with Adobe Photoshop.Fixed brain was immersed in 98% formic acid for 1 h and paraffin wax embedded. Serial sections of 4 \u03bcm nominal thickness were pre-treated with Tris-Citrate EDTA buffer for antigen retrieval . PrP dep"}
{"text": "However, small ruminants, which are susceptible to BSE under experimental conditions, have been exposed to the same or similar contaminated food additives as cattle. To date two natural cases of BSE in small ruminants have been reported. As a result surveillance projects, combined with appropriate control measures, have been established throughout the European Union (EU) to minimize the overall incidence of small ruminant TSEs. Although BSE can be differentiated from classical scrapie (subsequently referred to as scrapie) if appropriate discriminatory tests are applied, the value of these tests in BSE/scrapie co-infection scenarios has not been evaluated fully. Mouse bioassay is regarded as the gold standard regarding differentiation of distinct TSE strains and has been used as to resolve TSE cases were laboratory tests produced equivocal results. However, the ability of this method to discriminate TSE strains when they co-exist has not been examined systematically. To address this issue we prepared Disease phenotype analysis in all three mouse lines indicated that most phenotypic parameters  were compatible with scrapie phenotypes as were immunohistochemistry (IHC) data from RIII and C57BL/6 mice. However, in VM mice that were challenged with BSE/scrapie mixtures a single BSE-associated IHC feature was identified, indicating the existence of BSE in animals where the scrapie phenotype was dominant.We conclude that wild type mouse bioassay is of limited value in detecting BSE in the presence of scrapie particularly if the latter is in relative excess.The online version of this article (doi:10.1186/s40478-015-0194-2) contains supplementary material, which is available to authorized users. Sc or prion) of a cellular protein (PrPC), spongiosis and gliosis. Even though scrapie has been endemic in sheep and goats for centuries it is believed not to have represented a risk for human health [Classical scrapie (subsequently referred to as scrapie) and Bovine Spongiform Encephalopathy (BSE) are transmissible spongiform encephalopathies (TSEs), a group of fatal neurodegenerative disorders of animals and man which are characterised by the deposition of a misfolded isoform  and Western blot.The AR and HR of all isolates are presented in Table\u00a0The IP data are expressed as days post inoculation (dpi) and are based on TSE positive mice that exhibited clinical signs of neurological disease Table\u00a0. GeneralBoth 100% scrapie and 100% BSE generated high AR. Compared to other inocula of the same TSEs prepared from terminally ill animals and bioassayed in our laboratory the IP values observed in this study were similar to the lower end of the IP data range indicating that that each source represented an origin of high infectivity ,31.Due to the high infectivity of all inocula there were at least five clinically and pathologically positive mice in each mouse group. Therefore it was feasible to construct LP from each mouse group Figure\u00a0.Figure 2In the RIII mice the LP from mixtures appear to be more akin to the LP of the 100% scrapie source Figure\u00a0a. HoweveThe LP differences between the 100% BSE and 100% scrapie sources were more profound in C57BL/6 and VM mice, where they resulted in different LPs. The LPs that were generated from the various mixtures in these two mouse lines aligned more closely to the LP from the 100% scrapie control than the 100% BSE isolate.In addition application of cluster analysis based on the lesion scores, showed that in all three mouse lines the BSE/scrapie mixtures grouped together with the 100% scrapie control which was distinct from the 100% BSE control  were indistinguishable from those that were challenged with the scrapie control, showing a high molecular weight unglycosylated band compared to the BSE control  in different neuroanatomical areas, located at four coronal levels  in all BSE/scrapie challenged mice. This assessment, which was performed blind, revealed that this pattern was more abundant in mice that were challenged with mixtures with a higher BSE concentration, both in terms of quantity in the different neuroanatomical areas . The presence of BSE-associated punctate deposits in specific neuroanatomical areas allocated in the four coronal levels was recorded. At each coronal level the number of neuroanatomical areas affected by BSE-associated punctate deposits was used to predict the presence and percentage of BSE in the original inoculum. The test predictions were compared to the actual values and the associations between test and true status were not random (p < 0.0001 by Fisher\u2019s exact test). The sensitivity, specificity and accuracy of the approach were 78% (62\u201389), 91% (75\u201398) and 84% (73\u201391); values in brackets denote 95% confidence intervals. The predictions were more accurate in the high BSE content inocula (50% and 10%) whilst the low BSE content mixtures (2% and 1%) proved more difficult to predict accurately.Based on the previous finding that the BSE-associated punctate PrPin vitro and used them as a substitute to co-infected tissue. Both BSE and scrapie inocula were prepared from animals at the terminal stage of the disease to ensure maximum infectivity. However, measurement of PrPSc levels indicated that the concentration of PrPSc in the scrapie source was at least two logs higher compared to the BSE material. Conversely, it has been shown the TSE infectivity cannot be accurately predicted from quantitative laboratory test results [Despite the significant progress and development of tests that can discriminate BSE from scrapie in a single infection scenario, limited studies have been conducted that address the performance of the discriminatory tests in cases where BSE and scrapie exist in the same animal. Ideally, the best possible experimental materials should derive from sheep co-infected experimentally with natural scrapie and BSE sources via natural routes of inoculation i.e. under conditions that would reflect most closely a naturally occurring co-infection. To the best of our knowledge, however, materials from such experiments are not widely available. Therefore we used the best possible alternative i.e. we produced BSE and scrapie mixtures  results . A simil results . In thatBased on AR, IP and LP our data suggest that all three mouse lines that were challenged with BSE/scrapie mixtures exhibited a scrapie phenotype, and it was not possible to identify any BSE attributes in the mixtures. However, AR, IP and LP data are considered to be less reliable parameters with lower discriminatory power since they are based on average values derived from a group of animals ,38.Each mouse that was challenged with either a BSE/scrapie mixture or 100% scrapie control in the current study, exhibited a stable scrapie IHC pattern which is usually isolated from ARQ/ARQ scrapie cases ,31,38 alSc levels between the scrapie and BSE sources could be a possible explanation of this result.The Western blots from C57BL/6 and RIII mice that were challenged with BSE/scrapie mixtures showed that even with the highest BSE fraction (50%) the scrapie characteristics dominated and any BSE signal was undetectable within the resolution limits of this method. Using IHC it was not feasible to identify any BSE characteristics in either C57BL/6 or RIII mice that were challenged with BSE/scrapie mixtures so there is complete agreement between IHC and Western blot data regarding these two mouse lines. The difference in the PrPCollectively the above data indicate that in the C57BL/6 and RIII mice that were challenged with BSE/scrapie mixtures only scrapie phenotypic traits were identified, suggesting that either scrapie propagated preferentially at the expense of BSE or, that although BSE also propagated, it had a recessive phenotype that was not observed in the mice. The similarity of results obtained from C57BL/6 and RIII mice is likely explained by the fact that these two mouse lines share the same PrP sequence (Prnp-a), that influences the phenotypic features of TSE strains -40.Propagation of a mixture of strains is supported by the data from the VM mice where, while the overall IHC characteristics of scrapie prevailed, a subtle but distinct BSE feature was observed in mice challenged with BSE/scrapie mixtures, and that feature was more prominent in the mice that were exposed to high content of BSE (10% or 50%) compared to those that received a low content of BSE (1% or 2%). Although we were able to identify a BSE associated trait that could potentially be used to detect BSE in the presence of scrapie using VM mice, the current study shows that overall scrapie can dominate the phenotype of the disease even if BSE prions propagate in the background, while some phenotypic aspects of BSE may be evident. This disparity in the properties of different mouse lines could be attributed to the different PrP sequences between VM and C57BL/6 or RIII mice. However, the VM data show evidence that BSE and scrapie can co-exist in the same animal, although the presence of BSE may be masked by a dominant scrapie phenotype.Sc concentration. However, the content of PrPSc in an inoculum may not always correlate directly with infectivity [Sc levels in ovine BSE can be lower compared to cattle BSE infectivity titres between the two samples can be similar [Great care must be taken, however, when attempting to make any generalizations from this data. Firstly the infectious titre of each of the two sources that were used to produce the mixtures was not evaluated therefore the mixtures did not reflect titre ratios but simply volumetric fractions. Although, according to some researchers, it would have been preferable to use titrated material this would have prolonged the length of the study by at least another two years. In addition, titres are the function of the strain/ host combination used  and cross reading between different strain/host systems is not always informative or appropriate. Therefore it is questionable whether titre matching provides an optimal approach to co-infection experiments. It could also be argued that the mixtures could have been based on PrPectivity . Further similar -43. Neve similar ,32. The  similar ,38,44. Iin vitro [Sc within brain mixes with 100% specificity and 97% sensitivity when BSE agent was diluted into scrapie-infected brain homogenates at 1% (vol/vol) [Since the initiation of the current study transgenic mouse lines which are more sensitive to specific animal TSEs have been introduced and validated. Such lines are relatively new, but promising, as intermediate phenotypes have been identified after challenge with BSE/scrapie mixtures prepared in vitro ,46. Howevol/vol) . CompareThe fact that we were able to identify a marker to detect BSE against a specific scrapie strain background in VM mice does not mean that this is an acceptable test for BSE detection in co-infected material. It does, however, give further understanding of the potential and limitations of such an approach, which is relevant to the retrospective interpretation of historical data in this field, in particular to prevent the over-interpretation of \u2018absence of BSE\u2019 conclusions. It must be noted that the selected marker is subtle and only an experienced observer could interpret it correctly and consistently in the high content BSE inocula (10% or 50%), as in the low content BSE mixtures (1% and 2%) the levels of the marker dropped appreciably. Therefore, even using this IHC model, low BSE levels on a scrapie background may remain undetected. Theoretically similar caveats may apply to the natural host ie small ruminants, where there is a range of strain and host genotype combinations. Consequently, the diagnostic methodology applied in surveillance schemes may fail to identify co-infection cases where BSE is present. In the view of the authors, under these circumstances, the current policy of eradicating or minimizing scrapie rather than attempting to detect and manage BSE separately remains, scientifically and financially, the most feasible option to prevent BSE from entering the food chain via small ruminants.In conclusion, our data suggest that by applying immunohistochemistry to detect different PrPSc types in the brains of mice challenged with BSE/scrapie mixtures it is possible to detect BSE in a BSE/Scrapie co-infection scenario. We also provide evidence that in principle co-infection of BSE and scrapie cannot be excluded at least in an experimental model.All animal procedures were performed in compliance with the Animal  Act 1986 under license issued by the UK Home Office (license number PPL70/5155), and were approved by the local ethics committee.Initially a scrapie and an ovine BSE homogenate were prepared. The scrapie inoculum, hereafter referred to as 100% scrapie, was made using a pool of brains collected between 1996 and 1999 from confirmed cases of natural scrapie representing the most frequent PrP genotypes affected by scrapie Table\u00a0. The oviEach inoculum was administered into three panels of wild type mice namely C57BL/6, RIII and VM. Each panel consisted of 20 mice and each mouse received 20 \u03bcl of homogenate intracerebrally and 100 \u03bcl intraperitonially. Intracerebral inoculations were performed under general anaesthesia using a 25 G hypodermic needle attached to a 0.5 ml insulin syringe. A plastic sheath was inserted along the needle allowing approximately 5 mm of free end of the needle to be exposed to ensure that the inoculum was deposited at similar depth in each animal and to minimize tissue injury. The point of entry was approximately 3 mm dorsal to a point lying halfway between the eye and the base of the ear. Insertion into the CNS was achieved by gently rotating the syringe along its axis at a right angle with respect to the skull surface.Mice were housed in standard mouse cages and were monitored for clinical signs of disease by experienced animal attendants. Mice were euthanized after exhibiting clinical signs of TSE for two consecutive weeks or having received scores of \u201cdefinitely affected\u201d in 2 out of 3 consecutive weeks unless the clinical progression of the disease was so rapid that animals had to be euthanized on welfare grounds. Mice that did not show clinical signs of TSE were allowed to live until they were euthanized on welfare grounds due to other conditions (intercurrent deaths).At postmortem the brain of each mouse was removed sectioned along a parasagittal plane into two parts. One third of the brain was stored at \u221280\u00b0C for further bioassay or biochemical studies and two thirds were immersed in buffered formalin for 72 hours at room temperature.After fixation was completed each brain was cut at 4 different coronal points at the level of medulla (including the cerebellum), midbrain, thalamus (including hippocampus and overlying cortex) and frontal cortex . Each coronal segment was embedded in paraffin wax and histological sections (3 \u03bcm thick) from each level were mounted on the same positively charged slide for interpretation.Slides were stained with haematoxylin and eosin according to standard methodology . TSE diaSc was achieved using 3,3\u2032,5,5\u2032-tetramethylbenzidine (TMB) substrate for 20 minutes at RT and measuring colour development at 450 nm using a reference filter at 620 nm (Perkin Elmer Envision 2104 multi-label reader).Inocula samples were analysed using a modified version of the IDEXX Herdchek BSE \u2013 Scrapie EIA kit . Inocula samples were serially diluted in equal volumes of TSE negative ovine brain homogenate (10% (w/v)) prepared in IDEXX kit homogenisation buffer. Diluted samples were treated as if they were normal test homogenates ) and assayed following manufacturer\u2019s instructions. Briefly, diluted samples were mixed 4:5 with kit plate diluent, distributed (100 \u03bcl) to the test plate and incubated for 180 minutes at ambient room temperature (RT). After washing, bound sample was incubated with conditioning buffer for 10 minutes at RT, washed a second time and incubated with horseradish peroxidase conjugated anti-PrP antibody (SRB-CC) for 90 minutes at RT. After final wash visualisation of bound PrPAll samples, solid tissue and inocula, were analysed using the Bio-Rad TeSeE\u2122 Western blot .Sheep and mouse brain (solid) tissues were analysed according to manufacturer\u2019s instructions. Briefly, 20% (w/v) tissue homogenates were treated with proteinase K before alcohol precipitation. After centrifugation, pellets were solubilised in Laemmli buffer. Following extraction proteins were separated on 12% Bis/Tris gels then electrotransferred to PVDF membrane. After blocking the membrane with 5% bovine serum albumin (BSA) proteins were labelled with anti-prion antibodies Sha31 (epitope: ovine amino acid sequence 145\u2013152) and 12B2 (epitope: ovine amino acid sequence 97\u2013115). Visualisation was achieved using enhanced chemiluminesence (ECL) reagents .Prior to biochemical analysis of inoculum samples by Bio-Rad TeSeE\u2122 Western blot, aliquots of finalised inocula were centrifuged at 350000 g for 30 minutes. The resulting pellet was re-homogenised at 20% (w/v) in Bio-Rad kit homogenisation buffer and the resultant homogenate treated as described above.Prior to biochemical analysis of inoculum samples by Bio-Rad TeSeE\u2122 Western blot, aliquots of finalised inocula were centrifuged at 350000\u2009g for 30 minutes. The resulting pellet was re-homogenised at 20% (w/v) in Bio-Rad kit homogenisation buffer and the resultant homogenate treated as described above.Sc was detected using the rabbit polyclonal anti-PrP antibody Rb486 according to standard methodology [Samples from clinically and histopathologically positive mice were further analysed with IHC as described previously ,31. PrPSCluster analysis was performed using Statistica (Version 10). For all other statistical analyses the STATA (Version 10) or the Graph Pad Prism (Version 6.04) programmes were used."}
{"text": "To date, all clinical and neuropathologically confirmed vCJD cases have been Met129 homozygous, with the exception of 1 recently reported Met/Val heterozygous case. Here, we found that transgenic mice homozygous for Val129 Hu-PrP show severely restricted propagation of the BSE prion strain, but this constraint can be partially overcome by adaptation of the BSE agent to the Met129 Hu-PrP. In addition, the transmission of vCJD to transgenic mice homozygous for Val129 Hu-PrP resulted in a prion with distinct strain features. These observations may indicate increased risk for vCJD secondary transmission in Val129 Hu-PrP\u2013positive humans with the emergence of new strain features.Bovine spongiform encephalopathy (BSE) is the only known zoonotic prion that causes variant Creutzfeldt-Jakob disease (vCJD) in humans. The major risk determinant for this disease is the polymorphic codon 129 of the human prion protein (Hu-PrP), where either methionine (Met Sc) of prion protein (PrP), which is converted from the normal cellular isoform (PrPC)  is considered by strong epidemiologic, pathologic, and molecular evidence to be a likely consequence of human dietary exposure to the bovine spongiform encephalopathy (BSE) agent , where methionine (Met) or valine  can be encoded, strongly affects susceptibility to human prion diseases , and all efforts were made to minimize suffering. Experiments were approved by the Committee on the Ethics of Animal Experiments of the Instituto Nacional de Investigaci\u00f3n y Tecnolog\u00eda Agraria y Alimentaria .\u2013We used 11 isolates from different sources in this study (129 (TgMet129) mouse line expressing human Met129-PrPC variant  mouse line expressing human Val129-PrPC variant  transgenic mouse line obtained by mating TgMet129 and TgVal129 mice (C (around 4-fold the level of expression in the human brain) on a mouse PrP null background. We performed additional inoculations in HuPrP-Tg362-Val129, a transgenic mouse line expressing 8-fold the level of PrPC expression in human brain   HuPrP-Tg340-Metres) by Western blot. We anesthetized individually identified mice, 6\u20137 weeks of age, with isoflurane and inoculated them with a 2-mg equivalent of brain homogenate in the right parietal lobe by using a 25-gauge disposable hypodermic needle. We observed mice daily and assessed neurologic status 2 times per week. When progression of a TSE disease was evident or at the established experimental endpoint (700 days postinoculation [dpi]), we euthanized the animal for ethical reasons and performed necropsy, excising the brain. We then fixed part of the brain by immersion in neutral-buffered 10% formalin  and used the tissue for quantifying spongiform degeneration by histopathology. We froze the remaining tissue at \u221220\u00b0C and used it to determine the presence of disease-associated proteinase K (PK)\u2013resistant PrP . Based on a previously described protocol . Immunoblots were developed with enhanced chemiluminiscence ECL Select . Images were captured using the ChemiDoc WRS+ System (Bio-Rad) and processed using Image Lab 5.2.1 software (Bio-Rad).We homogenized frozen brain tissues (175 \u00b1 20 mg) in 5% glucose in distilled water in grinding tubes  adjusted to 10% (wt/vol) by using a TeSeE Precess 48TM homogenizer (Bio-Rad), according to the manufacturer\u2019s instructions. We determined presence of PrPWe performed procedures for the histopathological analysis of mouse brains as previously described  or Val  at codon 129 of human PrP or were their F1 cross . These mouse models expressed similar human PrP levels, \u22484-fold more than that seen in uninfected human brain tissue (res accumulation in control mice inoculated with TSE-free control brain homogenate. The 3 human transgenic mouse models were readily infected when inoculated with sporadic CJD (sCJD) (129 type 1 (Hu-sCJD MM1) and Val129 type 2 (Hu-sCJD VV2)  . The 2 s129 mice  mouse line (129 (8\u00d7) mice showed any evidence of infection after challenge with the different BSE isolates . On first passage, 100% of the TgMet129 mice developed clinical disease in response to all inocula in the panel  blots in the mouse brains  analysis (129 mice inoculated with Hu-vCJD2 (that remained apparently uninfected) to BoPrP-Tg110 mice showed evidence of subclinical infection. These subpassages led to a mean incubation time of 371 \u00b1 5 dpi and to propagation of PrPres that was detectable by WB in 100% of animals , characterized by low size fragments (19-kDa fragment for the aglycosyl band) and prominent diglycosylated species on WB  and our vCJD-TgVal129 PrPSc, we performed a biochemical characterization by WB and found no molecular profile differences in PrPres from the various mouse lines   , lane 8.PRNP codon 129 genotypes. Because a high expression level of PrP in transgenic mice directly influences prion disease susceptibility and incubation time, these transgenic mice have an advantage over knock-in mice for evaluating these features in the different human PrP genotypes. In addition, the 3 mouse models used in our study have equivalent PrP expression levels, making them suitable for studying comparative susceptibilities across the different PRNP codon 129 genotypes.We report a detailed comparison of the transmission properties of BSE and vCJD prions among humanized transgenic mice with different 129 homozygous individuals might be susceptible to a sheep or goat BSE agent to a higher degree than to cattle BSE and that these agents might transmit with molecular and neuropathological properties indistinguishable from those of vCJD  was clinically transmitted to 1 of 10 TgMet/Val129 mice directly, adaptation of the BSE agent to human PrP Met129 sequence and subsequent inoculation of the resultant vCJD prions to TgMet/Val129 mice produced a 100% attack rate. However, we did not detect clinical prion disease, supporting a slower rate of vCJD conversion compared with that among TgMet129 mice. This slow but potential conversion rate in TgMet/Val129 mice correlates well with the single vCJD case of a human carrying the PrP Met/Val129 genotype  might be caused by differences in prion titer between inocula. This assessment was strengthened after the transmission of both vCJDs to TgMet129 mice, in which a shorter incubation period was observed in animals inoculated with Hu-vCJD2. A certain variability in subclinical transmissibility and incubation time between different vCJD isolates is not uncommon, as has been previously reported  prions, and the propagated agents might transmit with molecular and neuropathological properties distinguishable from those of type 4 PrPres. Although the resultant type 5 PrPSc shares the same fragment sizes as those of type 2 PrPSc, the 2 PrPSc types can be distinguished by the predominance of the diglycosylated glycoform associated with type 5 PrPSc. Overall, our results indicate that human Val129-PrP polymorphic variant is a strong molecular protector against BSE zoonotic transmission but fails to prevent human-to-human vCJD transmission. Because potential late-onset vCJD cases could appear in the population  mice.Transmission of Ca-BSE bovine spongiform encephalopathy\u2013derived isolates adapted in different human prion protein polymorphic variants to BoPrP-Tg110 mice and"}
{"text": "The transmission of classical bovine spongiform encephalopathy (C-BSE) through contaminated meat product consumption is responsible for variant Creutzfeldt-Jakob disease (vCJD) in humans. More recent and atypical forms of BSE (L-BSE and H-BSE) have been identified in cattle since the C-BSE epidemic. Their low incidence and advanced age of onset are compatible with a sporadic origin, as are most cases of Creutzfeldt-Jakob disease (CJD) in humans. Transmissions studies in primates and transgenic mice expressing a human prion protein (PrP) indicated that atypical forms of BSE may be associated with a higher zoonotic potential than classical BSE, and require particular attention for public health. Recently, methods designed to amplify misfolded forms of PrP have emerged as promising tools to detect prion strains and to study their diversity. Here, we validated real-time quaking-induced conversion assay for the discrimination of atypical and classical BSE strains using a large series of bovine samples encompassing all the atypical BSE cases detected by the French Centre of Reference during 10 years of exhaustive active surveillance. We obtained a 100% sensitivity and specificity for atypical BSE detection. In addition, the assay was able to discriminate atypical and classical BSE in non-human primates, and also sporadic CJD and vCJD in humans. The RT-QuIC assay appears as a practical means for a reliable detection of atypical BSE strains in a homologous or heterologous PrP context. Sc, an abnormal isoform of the host-encoded cellular prion protein (PrPc). The infectious agent is mainly, if not solely, composed of abnormal PrPSc and is capable of converting cellular PrPc into PrPSc in an autocatalytical manner [Sc, molecular features of the protease resistant fragment (PrPres) can be evidenced by Western blot.Prion diseases are fatal transmissible disorders affecting humans and animals. These neurodegenerative diseases are characterized by brain vacuolization, neuronal loss and accumulation of PrPl manner . After pres observed in Western blot [res molecular changes could be observed in some conditions [Among animals, the classical bovine spongiform encephalopathy (C-BSE) affects cattle. The C-BSE epidemic in the 1980s became a major matter of concern for human health when the variant of Creutzfeldt-Jakob disease (vCJD) appeared as the result of a C-BSE foodborne transmission to humans \u20134. Sinceern blot . The annern blot . When trern blot \u20139 and trern blot , 11, L-Bern blot , 12. Wheern blot  and tranern blot , 15, spenditions . Taken tAmong recent methods developed to amplify prions in vitro, the real-time quaking-induced conversion (RT-QuIC) assay allows the sensitive detection of prion seeding activity in numerous tissues of animal and human origins \u201326. The In two recent studies, this test was used successfully for the discrimination of a few C-BSE and L-BSE samples of cattle , and forA written informed consent for autopsy and research use was provided by patient\u2019s relatives, according to the French regulation . The brain tissues with the corresponding written informed consent are referred for postmortem diagnosis and research to the French National Neuropathological Network for CJD (funded by the French Government) and to the French National Centre of Reference for prions . No approval by local ethics committee is required during this procedure.Agence Nationale de S\u00e9curit\u00e9 Sanitaire de l\u2019Alimentation, de l\u2019Environnement et du Travail . In this study, 13 H-BSE and 14 L- BSE isolates, encompassing all the atypical BSE cases collected during the period 2000\u20132010, were analyzed by RT-QuIC. Fifteen C-BSE cases collected during this period were also included. Among samples collected from fallen stock or after several freeze-and-thaw cycles, autolysis was often observed, affecting 10 out of 13 H-BSE samples, 11 out of 14 L-BSE samples and 6 out of 15 C-BSE samples , their PrPres type (type 1 or 2), and according to the migration pattern of PrPres on Western blot. Patients were referred to the French National Reference Center for Unconventional Transmissible Agents for CJD, and the diagnosis was confirmed biochemically and neuropathologically. Brain samples from cynomolgus macaques previously inoculated via intracerebral and oral routes with classical and atypical L-BSE isolates [Samples from primates and cattle existed before the study began. BSE brainstem samples were collected during the active surveillance in France and confirmed by discriminatory western blot by the  samples . Brainstisolates , 30 wereHuman recombinant full length PrP (codon 129M)  and bovine recombinant full length PrP  were purified according to the protocol published previously [\u00ae 24 instrument  for 45 s at speed 6.5. Gross cellular debris were removed from brain homogenates (BH) after a centrifugation at 2000 g for 2 min. Supernatants were collected and stored at -80\u00b0C until use.The tissues were prepared in PBS (Sigma-Aldrich) containing 150 mM NaCl, 1 mM EDTA, 0.5% Triton X-100, and Complete Protease Inhibitor Cocktail (Roche) to give a final tissue concentration of 10% (w/v). The homogenization was performed in 2ml centrifuge tubes containing ceramic beads using a FastPrepSc, brain homogenates (BH) from CJD patients were normalized using known concentrations of recHuPrP. The samples containing PrPres were digested with PK 100\u03bcg/ml for 1h at 37\u00b0C and loaded onto Novex 4\u201312% Bis-Tris acrylamide gels (Life Technologies), alongside dilutions of recHuPrP (ranging from 10 to 1.25 ng). To compare the detection of the studied prion strains in the different groups of affected individuals , brain homogenates were analyzed by Western blot (WB) as previously described [res in samples was adjusted with a further dilution to match the amount detected in the sample with the lowest PrPres signal at the determined dilution.To assess the analytical sensitivity of our RT-QuIC assay for the detection of sCJD and determine the minimal amount of detectable PrPescribed . The amores. To obtain an estimated amount of PrPres in 2 \u03bcl equivalent to 100 fg of recHuPrP, the corresponding 100% brain tissue dilutions varied from 10\u22126  to 5x10-7 . For BSE isolates, all the samples were tested by RT-QuIC at the same dilution (10\u22124), regardless of the PrPres level in the sample. A Western blot analysis with TeSeE confirmatory Western blot kit (Bio-Rad) was done to compare relative quantity of PrPres between groups  and to confirm the presence of PrPres when no seeding activity was detected by RT-QuIC.After electrophoresis, the separated proteins were transferred to nitrocellulose membrane and immunoblotted with anti-PrP mAb 3F4 (Eurogentec) for human samples. It was followed by an incubation with a secondary antibody coupled with horseradish peroxidase (HRP). The HRP activity was revealed using ECL (GE Biosciences), and the blots were exposed to ECL Hyperfilms (GE Biosciences). The films were scanned using a Bio-Rad GS800 densitometer and analyzed using Bio-Rad Quantity One software. The densities of the single Western blot band corresponding to recHuPrP were compared with the combined densities of the 3 bands corresponding to PrPThe RT-QuIC assay was prepared as described previously , 33. SamAll RT-QuIC experiments were performed at least three times and produced comparable results. At pertinent time points, the statistical significance of the difference between mean fluorescence or lag phases of analyzed groups was assessed using the non-parametric, unpaired t- test with unequal variance (Welch correction), using GraphPad Prism software v6.0 .res Western blot results for each BSE group are illustrated in res level was observed in C-BSE samples. A typical run was performed using 2 plates, in which were included the 8 negative samples and a half of each BSE group. In our conditions, negative and classical BSE samples could not be differentiated using recHuPrP  to ascertain that the lack of C-BSE amplification we observed was not due to the use of recHuPrP. Similar results were obtained with recBovPrP. While C-BSE and negative samples remained undistinguishable  used to seed the reaction, vCJD brain homogenates proved less efficient to initiate RT-QuIC reactions, and only a sensitivity down to a 10\u22127 brain dilution  could usually be achieved in our conditions  .res content. Thus, our study confirms previous results obtained with 5 L-BSE and 4 C-BSE natural cases by Orru et al [In this study, we assessed the power of discrimination of BSE strains from cattle using RT-QuIC. Indeed, in two recent studies, this assay was used successfully for the discrimination of a few C-BSE and L-BSE samples from cattle , and forru et al  and withru et al , using lsc glycotypes, neuropathology and PrPsc deposition different from those observed in classical BSE [Atypical cases of BSE putatively represent sporadic forms of prion disease in cattle, with PrPical BSE , 12. In ical BSE . Using sical BSE  or humanical BSE , withoutical BSE . Likewisical BSE . In our res formation [in vitro formation of PrPres [sc assemblies and therefore on the related seeding activity. For example, the H187R mutation in the human PrP has a dramatic effect on the protein folding, resulting in a markedly increased propensity to oligomerize [RT-QuIC discrimination may rely on differences in abnormal PrP assemblies sustaining distinct seeding activities that may vary with several factors . We were able to discriminate brain samples from macaques inoculated with C-BSE and with L-BSE. Surprisingly, in macaques, C-BSE showed the most efficient seeding activity while it was relatively inefficient in humans. Differences in PrP amino acid sequence might contribute to this discrepancy. Mature forms of bovine and human PrP share 91.3% of amino acid sequence, and bovine and cynomolgus macaques PrP only 88.7%. Different regions of PrP have been proposed as key domains for fibrillization, such as the S1H1S2 region , 35 or tormation  and becaf PrPres . Other vgomerize .However, the unpredictable manner of the biological changes of prion strain properties during interspecies transmission has been extensively described \u201344. In mSc fibers which could modulate the seeding activity of these tissues. However, plaques are also observed in the brain of vCJD patients, and vCJD brain homogenates show a poor seeding activity. Another characteristic of C-BSE in macaques is the high proportion of diglycosylated PrPres, but C-BSE or vCJD PrPres share the same feature, and yet are not associated with an efficient seeding activity. Likewise, the Western blot type of PrPres as defined by the molecular mass of the unglycosylated PrPres after proteinase K digestion cannot account for these different seeding activities, since PrPres type 2 is distributed in both groups with efficient  and inefficient (vCJD) seeding properties. It was intriguing that PrPsc from all the studied natural diseases with a sporadic or presumably sporadic origin  showed a high level of seeding activity, unlike peripherally acquired diseases due to the C-BSE agent . To investigate the role of the peripheral route on the selection of PrPSc species with seeding activity, we analyzed brain homogenates from iatrogenic CJD cases secondary to growth hormone treatment, which are acquired prion diseases and result from a human-to-human CJD transmission. We found similar and efficient seeding activities for sCJD MM1 and iCJD-hGH cases using RT-QuIC. Moreover, we also found similar and efficient seeding activities in brain homogenates from non-human primates inoculated intracerebrally and via the oral route with C-BSE or L-BSE. Altogether, our data do not support the peripheral route as a main factor influencing the selection of PrPsc species with low seeding activity. In our hands, it appears that this poorly efficient RT-QuIC profile was limited to the C-BSE agent, which propagated in cattle and humans.A main feature of C-BSE-infected brain tissue from various animal models including macaques is the presence of amyloid plaques \u201352 compoSc from a large series of 27 atypical BSE isolates within hours, and provides a promising tool for the diagnosis of these natural diseases and for their discrimination from C-BSE in a homologous and heterologous PrP context.To conclude, we showed that RT-QuIC detects PrPS1 Fig\u22124 dilutions of bovine tissue (brainstem), using human recombinant protein. (A) and (D), classical BSE and uninfected bovine tissues. (B) and (E), classical BSE and atypical H-BSE. (C) and (F), classical BSE and atypical L-BSE. Each point represents the mean value of 3 replicate relative fluorescence unit readings.RT-QuIC reactions were seeded with 10(PDF)Click here for additional data file.S2 FigA), classical BSE isolates and uninfected bovine samples. (B), classical BSE and atypical H-BSE isolates. (C), classical BSE and atypical L-BSE isolates. Each point represents the mean value of 3 replicate relative fluorescence unit readings, which were averaged over the number of animals in each group. Error bars represent the mean standard deviation (SD). Vertical dashed lines indicate a statistically significant difference of signal between the test groups. *, p<0,05; ****, p<0,0001.Average data and statistical significance of the individual results presented in (PDF)Click here for additional data file.S3 Fig\u22124 dilutions of bovine tissue (brainstem), using bovine recombinant protein. (A) and (D), classical BSE isolates and uninfected bovine samples. (B) and (E), classical BSE and atypical H-BSE isolates. (C) and (F), classical BSE and atypical L-BSE isolates. Each point represents the mean value of 3 replicate relative fluorescence unit readings.RT-QuIC reactions were seeded with 10(PDF)Click here for additional data file.S4 FigHomogenates were subjected to proteinase K digestion and serial dilutions were detected by immunoblotting using Sha31 (primates) or 3F4 (CJD patients) monoclonal antibodies.(PDF)Click here for additional data file."}
{"text": "Pre- and post-natal factors can affect brain development and function, impacting health outcomes with particular relevance to neurodevelopmental diseases, such as autism spectrum disorders (ASDs). Maternal obesity and its associated complications have been related to the increased risk of ASDs in offspring. Indeed, animals exposed to maternal obesity or high fat diets are prone to social communication impairment and repetitive behavior, the hallmarks of autism. During development, fatty acids and sugars, as well as satiety hormones, like insulin and leptin, and inflammatory factors related to obesity-induced low grade inflammation, could play a role in the impairment of neuroendocrine system and brain neuronal circuits regulating behavior in offspring. On the other side, post-natal factors, such as mode of delivery, stress, diet, or antibiotic treatment are associated to a modification of gut microbiota composition, perturbing microbiota-gut-brain axis. Indeed, the interplay between the gastrointestinal tract and the central nervous system not only occurs through neural, hormonal, and immune pathways, but also through microbe-derived metabolic products. The modification of unhealthy perinatal and postnatal environment, manipulation of gut microbiota, nutritional, and dietary interventions could represent possible strategies in preventing or limiting ASDs, through targeting inflammatory process and gut microbiota. Over the past decades, the frequency of autism diagnoses has been steadily climbing and has increased the interest of the scientific community  ailments and changes in microbiota composition  and hormones (leptin and insulin) occurring in obese mothers are possible events involved in the impaired development of offspring , the autonomic nervous system (both sympathetic and parasympathetic branches), the neuroendocrine and neuroimmune systems, the enteric nervous system (ENS), and the gut microbiota. All these components intercommunicate via the immune system, the vagus nerve, and other host microbe interactions, and influence each other, constituting a complex network. The main neuroendocrine pathway is the hypothalamic-pituitary-adrenal (HPA) axis, activated in response to various physical and psychological stressors. A crucial player in this communication between peripheral signals and the CNS is the gut microbiota (GM), therefore, this interplay was re-named microbiota-gut-brain axis, viewed as a bidirectional communication system between gut microbes and CNS , a mild stress lead to a higher release of corticosterone and adrenocorticotrophic hormone (ACTH) compared to mice with common and no pathogen bacteria (specific pathogen free mice). Moreover, the administration of GM capability to influence the brain activity is based on the production of neuroendocrine hormones and neuroactive compounds that play a pivotal role in shaping cognitive networks underlying social cognition, emotion, and behavior  exposure, gut inflammation, altered microbiota, and ASD-like behavioral abnormalities in male offspring were reported  proved to be a key treatment to ameliorate alterations in commensal microbiota, to restore intestinal permeability and cytokine production and to improve behavioral abnormalities , free amino acids (FAAs), and phenol compounds , in neuropsychological disorders has been deeply clarified  is associated with less incidence of numerous GI disorders. On the other hand, several studies show that nutritional deficiencies of autistic patients are filled with the supplementation of vitamins and minerals, fatty acids \u03c9-3, probiotics, in combination with pharmacological and psychological interventions, even if supplementation interventions show contrasting, but promising results.A typical strategy to decrease food related effects in ASD is a gluten-free and casein-free (GFCF) diet.GFCF diet consists in the elimination of food containing gluten, and products containing gluten trace amounts. This diet also eliminates casein, a protein present in cow milk and dairy products. The absence in this diet of milk and dairy products leads, however, to calcium, phosphate, and vitamin D deficiency. Therefore, nutrition specialists usually recommend soy or rice milk as substitutes for cheese  possibly due to peptidase deficiencies. This alteration may result in excessive opioid activity in the CNS, altering its function. In particular, gluten- or casein-derived peptides are suspected to be involved in ASD, resembling opioid-like molecules , introduced by Gotschall , represeThis diet largely recommends monosaccharides, whose origin is fruit, vegetables, and honey, whereas it removes complex carbohydrates. The formulation of this diet is based on the evidence that autistic patients have an abnormality in carbohydrate digestion and adsorption, causing residual food accumulation that represents a breeding ground for pathogenic intestinal flora , eicosapentaenoic acid , and docosahexaenoic acid , are crucial for brain development and cognitive and memory functions Das, .Maternal intake of PUFAs improved memory in the progeny, suggesting that, supplementation of PUFAs needs to start during pregnancy and continue after delivery until brain development is complete in adolescence. In agreement, breastfeeding improves brain growth and development and memory, since breast milk is richer in AA and DHA compared with formula . On the basis of microbiota involvement in ASD etiology, probiotics have been considered as a therapeutic tool able to impact brain development, and behavior. Therefore, the rationale of the use of probiotics, has been to re-establish the healthy equilibrium of GM altered in ASDs. One of the first evidence showing the impact of GM on ASDs has been demonstrated by Sandler et al.  plantarum WCFS1 for the following 3 weeks, and the other receiving first the probiotic and then the placebo  for 3 weeks and L. reuteri or L. rhamnosus in order to prevent GI colonization by Candida species, the authors reported the reduction of Candida in stool from treated infants with both probiotics, as well as GI symptoms by L. rhamnosus administration; notably, all treated newborns showed lower incidence of poor neurological outcomes compared to untreated control group, evaluated up to 12 months by the Hammersmith Infant Neurological examination  is a procedure through which patients receive the fecal microbiota from healthy donors. Generally, this practice is beneficial in ailments where dysbiosis plays a pivotal role, since it aims to restore GM homeostasis. Obviously, GI disorders, such as inflammatory bowel diseases and irritable bowel syndrome, are the most common ailments suggested for this intervention, even if also other disorders, like autoimmune disease and obesity has been tested with beneficial effects , in order to correct dysbiosis and restore a healthy conversation between gut and brain. This would partially lessen both gastrointestinal and neurobehavioral symptoms.CC, AL, FL, MPM, AC, and GM wrote the paper. CC, MPM, and GM supervised the review editing. GM decided the overall structure of the review, coordinating the working group.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Anacyclus pyrethrum (L.) is a plant widely used in Moroccan traditional medicine to treat inflammatory and painful diseases. The objective of the present study was to evaluate the antinociceptive, anti-inflammatory and antioxidant activities of aqueous and methanol extracts of Anacyclus pyrethrum roots (AEAPR and MEAPR). The anti-inflammatory effect of AEAPR and MEAPR was determined in xylene\u2013induced ear edema and Complete Freund\u2019s Adjuvant (CFA)-induced paw edema. The antinociceptive activity of AEAPR and MEAPR  administered by gavage was examined in mice by using acetic acid-induced writhing, hot plate, and formalin tests, and the mechanical allodynia were assessed in CFA-induced paw edema. In addition, the in vitro antioxidant activities of the extracts were determined by using 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging method, ferric reducing power and \u03b2-carotene-linoleic acid assay systems. AEAPR and MEAPR produced significant reductions in CFA-induced paw edema and xylene-induced ear edema. A single oral administration of these extracts at 250 and 500 mg/kg significantly reduced mechanical hypersensitivity induced by CFA, which had begun 1 h 30 after the treatment, and was maintained till 7 h. Chronic treatment with both extracts significantly reduced mechanical hypersensitivity in persistent pain conditions induced by CFA. Acute pretreatment with AEAPR or MEAPR at high dose caused a significant decrease in the number of abdominal writhes induced by acetic acid injection , a marked increase of the paw withdrawal latency in the hot plate test, and also a significant inhibition of both phases of the formalin test. This antinociceptive effect was partially reversed by naloxone pretreatment in the hot plate and formalin tests. Additionally, a significant scavenging activity in DPPH, reducing power and protection capacity of \u03b2-carotene was observed in testing antioxidant assays. The present study suggests that AEAPR and MEAPR possess potent anti-inflammatory, antinociceptive and antioxidant effects which could be related to the presence of alkaloids and phenols in the plant. In addition, the antinociceptive effect of APR extracts seems to partly involve the opioid system. Taken together, these results suggest that Anacylcus pyrethrum may indeed be useful in the treatment of pain and inflammatory disorders in humans. Chronic pain is a serious problem globally. Pain affects one in five adults, while an estimated one in ten suffers from chronic pain each year . BecauseAnacylcus pyrethrum (L.) Link (Asteraceae) is a native plant of North Africa  using appropriate models in mice. In addition, as inflammation is a process linked to oxidative stress and to the over-production of the reactive oxygen species (ROS), the antioxidant capacity of both extracts was also evaluated.Although some tivities , no scieAnacylcus pyrethrum (L.) Link (Asteraceae) was collected in June 2014, from Ouka\u00efmeden (74 km from Marrakech) at 2,600 m of altitude in the High-Atlas Mountains (Morocco). The plant was identified by Professor A. Ouhammou, a taxonomist in the department of Biology, Faculty of Sciences Semlalia, Cadi Ayyad University. A voucher specimen was deposited at the Faculty\u2019s Herbarium (Mark 8258).The roots were separated from the aerial parts of the plant and dried under shade. They were ground to a fine powder using a grinder apparatus. Root powder (1 g) was stirred with distilled water (20 ml) for 24 h at room temperature. The aqueous macerate was centrifuged (1200 rpm) for 15 min. The supernatant was lyophilized (yield = 20% w/w) then stored in a freezer at -20\u00b0C until experimental use. For methanol extract preparation, the powder of APR (400 g) was exhaustively extracted with methanol in a Soxhlet apparatus. The methanol extract was concentrated to dryness under vacuum. The residue (21.8% w/w) was stored at -20\u00b0C for several months, until the experimental use.Aqueous and methanol extracts of APR were screened for the presence of flavonoids, alkaloids, terpenoids, tannins and saponins. The qualitative determination of these phytochemicals was conducted using previously reported methods .1. Test for flavonoids: 2 ml of APR extract was evaporated and the residue was taken up in 5 ml of alcohol (50%) and 1 ml of concentrated hydrochloric acid. After addition of a few magnesium chips, the presence of flavonoids was indicated by the apparition of a red color.2. Test for terpenoids: 1 mg of APR extract was dissolved in a few drops of acetic acid in 3 ml of the mixture (acetic anhydride-concentrated sulfuric acid 50:1 v/v). The development of a green color indicated the presence of terpenoids.3.3; 9%). Test for tannins: APR extract (5 mg) was dissolved in 20 ml of distilled water and heated to boiling on a hot plate. Tannins were detected by the apparition of a green color after the addition of a few drops of an aqueous solution of ferric chloride (FeCl4. Test for saponins: APR extract (500 mg) was dissolved in 10 ml of distilled water in a test tube. The tube was shaken vigorously for 15 s and then allowed to stand for 15 min. The presence of stable foam indicated the presence of saponins.5.vacuum of the organic layer, the residue was dissolved in 1 ml of methanol. A few drops of Dragendorff reagent were added to the solution; the formation of a precipitate was taken as a hint for the presence of the alkaloids. Test for alkaloids: APR extract (500 mg) was stirred in 50 ml of sulfuric acid (0.1 N) for 15 min. After filtration, a concentrated ammonia solution (5 ml) was added to the solution. The alkaloids were then extracted with 50 ml of dichloromethane. After evaporation under in vivo bioassays. The animals were provided by the Animal Care Facility of the Faculty of Sciences Semlalia, Cadi Ayyad University, Marrakech, Morocco. The mice were kept under constant conditions of ambient temperature (22 \u00b1 2\u00b0C) under a 12 h light/12 h dark cycle, with ad libitum access to food and water. All animal procedures were in strict accordance with the guidelines of the European Council Directive (EU2010/63). Care was taken to minimize the number of animals used for the experiments. All efforts were made to minimize any animal suffering, and the study met the ethical standards and approvals of the Council Committee of the research laboratories of the Faculty of Sciences, Cadi Ayyad University of Marrakech.Adult Swiss male mice (25\u201335 g) were used for Indomethacin was purchased from Laprophan (Morroco) and naloxone from Hospira (United States). Acetic acid, formalin, xylene, xylazine, ketamine and CFA  were obtained from Sigma\u2013Aldrich (France).The acute toxicity study was conducted according to the Organization for Economic Cooperation and Development (OECD) guideline no. 423 , where tThe xylene-induced ear edema test was performed as previously described . BrieflyEight groups of animals (six mice per group) were assigned to this test. Mice were anesthetized with a mixture of ketamine (50 mg/kg) and xylazine (2 mg/kg) cocktail. All groups, except vehicle control group, received 20 \u03bcl of CFA by a subcutaneous injection in the plantar surface of the right hind paw . Twenty To measure the nociceptive reactivity to the application of mechanical stimuli to the hind pad, each mouse was placed in an individual observation cage (12 cm \u00d7 12 cm \u00d7 12 cm) with a mesh floor allowing access to the ventral surface of the hind pads. The animals were accustomed to the cage and the experiment room for at least 10\u201315 min or at the end of the exploratory behavior. Then mechanical hypersensitivity was assessed as described by To investigate the effect of chronic treatment on paw withdrawal, and the possible development of tolerance, mice  were treated with AEAPR, MEAPR , indomethacin (10 mg/kg), or vehicle (10 ml/kg) once a day for 5 days successively. In order to investigate the possible development of tolerance, the treatment was interrupted for 3 days (from day 6 to day 8) and reinitiated for 2 days again (day 9 and day 10). The mechanical hypersensitivity was assessed 3 h after each daily treatment . For the days 6\u20138 (without treatment), the test was performed at exactly the same time as the previous days.In this test, animals were individually placed on a hot plate with an adjustable temperature (to 55 \u00b1 1\u00b0C) . The reaThis test was performed in mice, according to the method described by Formalin test was carried out as previously reported . Ten groTo evaluate any coordination disruption, non-specific muscle-relaxant or sedative effects of APR extracts, mice were subjected to the rotarod task and open-field test. The motor coordination of the mice was evaluated on the rotarod apparatus at a constant speed of 12 rotations per minute. Twenty-four hours prior the drug testing, animals were tested and those who remained at the rotating bar for the full 300 s during three consecutive trials were used for the subsequent experiments. The selected animals were randomly distributed into groups of six mice and received AEAPR or MEAPR orally at a dose of 125, 250, or 500 mg/kg. The control group received the same volume of vehicle (10 ml/kg). An additional group received indomethacin (10 mg/kg) and served as a positive control. Rotarod tests were performed prior to drug administration  and at 30, 60, and 120 min after administration. Latency to fall off was measured for each session (up to 300 s).In order to evaluate eventual motor impairment induced by plant extract, the mice were placed individually in an observation chamber 60 min after oral treatment with vehicle, indomethacin or APR extracts. The open field apparatus used was a 50 \u00d7 50 cm square arena with 30 cm high black walls. The animal was placed in the center of the arena and distance traveled was scored during 10 min, using the videotracking EthoVision XT8.5 software . The animal was returned to its home cage, and the apparatus cleaned with ethanol 70% to remove any odor.b \u2013 Aa)/Ab] \u00d7 100, where Ab is the absorbance of DPPH alone in methanol (control) and Aa is the absorbance of DPPH in the presence of the test substance. Quercetin and butylated-hydroxyl-toluene (BHT) were used as positive controls.The hydrogen or electron donation ability of APR extracts  was measured using the stable radical 1, 1diphenyl-2-picryl hydrazyl (DPPH) assay . Various\u03b2-caroteneafter2hassay/Ainitial\u03b2-carotene) \u00d7 100, where A\u03b2-caroteneafter2hassay is the absorbance of \u03b2-carotene remaining in the sample after 2 h and Ainitial\u03b2-carotene is the absorbance of \u03b2-carotene at the beginning of the experiment.The \u03b2-carotene/linoleic acid test evaluates the lipoperoxydation inhibitory effect of a compound or a mixture of compounds. The method described by +3 to Fe+2 was investigated using the method of 3 , and the absorbance was measured at 700 nm in a spectrophotometer. BHT and Quercetin were used as positive controls.The ability of APR extracts to reduce Fepost hoc analysis was used to examine the time-courses of mechanical, thermal and anti-edema effects after various treatments. Kruskal\u2013Wallis ANOVA or one-way ANOVA followed by post hoc testing with the Student-Newman\u2013Keuls test for multiple comparisons were used to measure variance of mouse behavior between groups. The significance of the differences between the means in the antioxidant activity was assessed by Student\u2019s t-test. The significance threshold was set at p < 0.05.Statistical analysis was performed using SigmaPlot 11.0 software. All data were presented as mean \u00b1 SEM for six mice per group. A two-way analysis of variance (ANOVA) with repeated measures followed by Holm\u2013Sidak The qualitative phytochemical screening of AEAPR and MEAPR showed the presence of alkaloids, flavonoids, tannins, saponins, and terpenoids in both extracts.p > 0.05) or in organ weights (p > 0.05) were observed at 14 days after AEAPR or MEAPR administration (Table 1).The oral administration of AEAPR or MEAPR at doses up to 5000 mg/kg did not produce any visible signs or symptoms of toxicity in mice. No mortality and no significant changes in body weights (p < 0.001). Indomethacin, as well as both APR extracts at tested doses, reduced xylene-induced ear edema compared to the vehicle-treated control group . Indeed, Kruskal\u2013Wallis one-way analysis of variance confirmed a high significant difference between all groups . The post hoc analysis showed that the pretreated groups with APR extracts or indomethacin decreased significantly (p < 0.001) the edema induced by xylene in comparison with vehicle-treated group. In the group treated with indomethacin, the inhibition of ear edema induced by xylene was significantly higher than that of the group treated with 125 mg/kg of MEAPR or AEAPR , whereas the oral administration of the two extracts at a dose of 500 mg/kg exhibited a very strong anti-edema effect compared to the indomethacin group  . However, we observed no significant difference in ear edema between AEAPR and MEAPR at a dose of 250 mg/kg vs. indomethacin  nor between AEAPR vs. MEAPR groups . The positive control, indomethacin, inhibited edema by 49%, whereas MEAPR and AEAPR at a dose of 500 mg/kg inhibited it respectively by 65% and 62% compared to the group treated with the vehicle.Topical application of xylene caused a significant increase in the right ear section\u2019s weight (11.68 \u00b1 0.49 mg) when compared to the vehicle-treated left ear (5.22 \u00b1 0.29 mg)  in paw volume after 24 h (from 4.50 \u00b1 0.08 mm to 5.10 \u00b1 0.05 mm). The paw thickness was reduced respectively by MEAPR, AEAPR and indomethacin after 30, 60, and 120 min of oral administration  . This reduction was statistically different between experimental groups , and also between different post-treatments\u2019 times . Both APR extracts showed dose- and time-dependent anti-inflammatory effects. At higher doses (250 and 500 mg/kg), this effect became significant, starting from the third hour after AEAPR administration  and starting from the second hour for MEAPR . It does not become significant until the fourth and fifth hour after the administration of the low dose (125 mg/kg) of MEAPR or AEAPR . In addition, at a higher dose, AEAPR and MEAPR exhibited a greater reduction effect in paw thickness than indomethacin from time points 3 h , to 7 h .Complete Freund\u2019s Adjuvant injection caused a significant increase , 24 h after CFA injection . The single oral administration of AEAPR or MEAPR, at 250 and 500 mg/kg, reduced the mechanical hypersensitivity induced by CFA. The paw withdrawal threshold increased significantly from point time 1 h 30 to 3 h and remained high up to 7 h . Two-way repeated measures ANOVA revealed that the withdrawal threshold was significantly different between groups  and varied significantly with time . The post-hoc analysis showed a significant increase of withdrawal threshold at time point of 1h30 in mice treated with AEAPR or MEAPR (250 and 500 mg/kg) and indomethacin compared to the CFA group . The CFA group did no differ at 125 mg/kg of both extracts, except for MEAPR at the time point 3 h . Moreover, no significant difference was observed between indomethacin and MEAPR or AEAPR at 500 mg/kg .The intraplantar injection of CFA produced noticeable mechanical hypersensitivity . The results demonstrated that the threshold responses of animals after AEAPR or MEAPR treatments were increased during the observation period compared to CFA group. When the treatments were interrupted for 3 days, mechanical allodynia was re-established. On the 9th day, the treatments were restarted and it was observed that both extracts of APR once again reduced mechanical allodynia.To investigate the effects of repeated treatment, mice received daily MEAPR or AEAPR , indomethacin, or vehicle for 5 days, interrupted for 3 days, then given daily for 2 more days  = 171.13, p < 0.001] and time . On the first day of treatment (day 1), except for the dose of 125 mg/kg of both extracts, the post hoc analysis showed significant differences between CFA group and MEAPR , AEAPR  and indomethacin  treated groups. In addition, there was no significant difference, neither between MEAPR and AEAPR groups at 500 mg/kg nor between MEAPR and indomethacin groups (p > 0.05), whereas a significant difference between AEAPR and indomethacin groups  was shown. During the first treatment period (from day 1 to day 5) with MEAPR, AEAPR and indomethacin, the withdrawal thresholds were significantly increased (p < 0.001) compared to the day before the treatment (day 0). The interruption of the treatment induced a reduction in paw withdrawal threshold of animals treated with APR extracts at all doses. However, this weakening of the antinociception reaction after the treatment interruption was not significant at the higher dose. The significant increase of threshold responses reappeared with the resumption of treatment .A two-way repeated measures ANOVA (treatment and day) revealed a significant effect of treatment . In fact, post hoc analysis showed that the extent of induced writhing at doses of 250 and 500 mg/kg of AEAPR or of MEAPR was significantly reduced compared to the vehicle group ; whereas both extracts of APR at 125 mg/kg, did not produce an antinociceptive effect (p > 0.05). In addition, the number of mouse abdominal constrictions induced by acetic acid in MEAPR treated group did not differ from that of the AEAPR treated group (p > 0.05) at high doses. Moreover, the test revealed that both extracts, at a dose of 125 mg/kg, reduced the number of writhes but to a lesser degree than that observed with indomethacin , unlike the effect of the two higher doses (250 and 500 mg/kg), which did not significantly differ from indomethacin\u2019s one (p > 0.05). APR extracts treatments at 125, 250, and 500 mg / kg induced contraction inhibition of 19.2, 30.9, and 52.2% respectively for AEAPR and 22.3, 31.6, and 56.7%, respectively, for MEAPR, while the standard drug (indomethacin) had an inhibition rate of 46.4%.The oral administration of AEAPR or MEAPR at a dose of 250 and 500 mg/kg reduced the number of writhes compared to the vehicle group . This effect began 60 min after oral administration of high doses and then disappeared after 240 min. At a lower dose of APR extracts (125 mg/kg), the paw withdrawal latency started to increase significantly after 90 min of treatment with MEAPR and only after 120 min of treatment with AEAPR ; two-way repeated measures ANOVA (group and time effect) confirmed these findings . Compared to baseline, the post hoc analysis showed that the treatment with indomethacin, MEAPR or AEAPR at higher doses (250 and 500 mg/kg) increased significantly the paw withdrawal latency, starting from 60 to 180 min (p < 0.001). In addition, naloxone (an opioid antagonist), which showed any significant effect on thermal sensitivity , partially reversed the effect induced by AEAPR or MEAPR at 500 mg/kg in the hot plate test. In fact, we observed a decrease of the paw withdrawal latency of 33.68 or 38.77%, respectively, in comparison with both AEAPR and MEAPR at time point 120 min.In the hot plate test, the oral administration of indomethacin, MEAPR or AEAPR significantly increased the paw withdrawal latency compared to the vehicle-treated group , and one-way ANOVA confirmed these differences . The post hoc analysis showed a significant difference between treated groups with 250 and 500 mg/kg of MEAPR or AEAPR and vehicle-treated group (p < 0.05). In addition, the analysis showed a significant difference between AEAPR at 125 mg/kg and indomethacin (p < 0.05), whereas there was no significant difference between indomethacin and MEAPR treated groups (p > 0.05). Concerning the second phase, all treatments markedly reduced the licking time of the injected paw in comparison with the group treated with vehicle . The one-way ANOVA indicated that all treatments induced significant differences of the mean paw licking time in comparison to vehicle-treated group . The post hoc analysis showed that the licking times at all doses of each APR extract and indomethacin were significantly (p < 0.001) less than that of the vehicle group. In contrast to the first phase, the effect of MEAPR and AEAPR at 500 mg/kg scored higher (p < 0.05) than indomethacin in the second phase with percentages of inhibition of 66, 64, and 43%, respectively. The pre-treatment with naloxone (1 mg/kg) reversed the antinociceptive activity of AEAPR and MEAPR at a dose of 500 mg/kg, i.e., an increase in the licking time of the first phase  and the second phase  in the formalin test. While the effect of naloxone treatment alone, did not differ from that of the vehicle (p > 0.05).In the formalin test, pain responses such as licking of the right hind paw were expressed in the first and second phases. The licking time of the first phase was reduced when the mice were treated with 125, 250, and 500 mg/kg of MEAPR , did not significantly reduce locomotion in the open field , and produced no difference in latency to fall off the bar in the rotarod test .Anacylcus pyrethrum root was assessed by three complementary in vitro antioxidant assays: the DPPH, the FRAP and the BCB assays. The concentrations that led to 50% inhibition (IC50) are given in Table 2. Note that low IC50 values reflect better protective action. The results showed that both Anacylcus pyrethrum extracts (MEAPR and AEAPR) exhibited similar and interesting antioxidant activity, especially in DPPH test with IC50 values of 12.38 \u00b1 0.28 \u03bcg/ml and 13.41 \u00b1 0.67 \u03bcg/ml respectively. The antioxidant potencies of both extracts were significantly less than those of the reference antioxidants butylated hydroxytoluene (BHT) and quercetin (Table 2). No significant difference was observed between AEAPR and MEAPR in any of the three antioxidant assays (p > 0.05). Recorded results showed that among the used bio-assays, the antioxidant activities of MEAPR and AEAPR were significantly higher, with DPPH than with other assays (p < 0.001).The antioxidant activity of 50 higher than 5000 mg/kg. According to the chemical labeling and classification of acute systemic toxicity recommended by OECD, AEAPR and MEAPR were assigned to the lowest toxicity class  than that of indomethacin (49%). This model is widely used to evaluate anti-inflammatory topical steroids and non-steroidal anti-inflammatory agents, especially those that inhibit phospholipase A2 . In addiIn addition, to investigate the effects of APR in a sustained inflammation model, we evaluated the effect of AEAPR and MEAPR on inflammation induced by intraplantar injection of CFA. Our results showed for the first time that acute or chronic oral treatments of animals with MEAPR or AEAPR were effective in preventing not only paw edema caused by CFA injection, but also mechanical hypersensitivity. Moreover, the anti-edematogenic and antinociceptive actions of APR extracts were evident from an early stage (1 h30) and maintained up to 7 h.It has been reported that CFA induces persistent pain that results mainly from the involvement of macrophages and T lymphocytes in the injected rat paw, followed by a paw swelling and leukocyte infiltration of the synovium and surrounding tissue, which contribute to chronic inflammation and osteolytic lesions . In addiEchinacea purpurea roots exerted immuno-modulatory effects, especially with a decrease of plasma protein levels of certain pro-inflammatory cytokines (IL-8 and IL-6) and inversely an increased expression of anti-inflammatory molecules such as IL-10. Thus, although we didn\u2019t quantify the levels of the cytokines, we may predict that APR extract may act via the same product  to blunt the induced inflammation.Since the antinociceptive effect of AEAPR and MEAPR is associated with anti-inflammatory action, its continuing antinociceptive effect in the chronic pain model may be due to a reduction in the cytokine and prostanoid release which reduced sensitization of the nociceptors. It should be noted that Assessment of AEAPR and MEAPR effects on the abdominal constrictions elicited by acetic acid showed a marked suppression of writhing response in the visceral pain model. This test is mainly used to screen antinociceptive activity . It has The central antinociceptive activity of MEAPR and AEAPR was evaluated in the hot plate test. This test is a widely used model for acute thermal nociception to evaluate specifically central nociception . ThroughTo discriminate between the peripheral and central antinociceptive effects of APR extracts, the formalin test was used. Our results revealed that both AEAPR and MEAPR have acted effectively in both phases of the formalin test. It is known that the intraplantar injection of formalin induces two phases of pain sensitivity . The firMoreover, in this study, we demonstrated that the antinociceptive action of AEAPR and MEAPR was partially antagonized by naloxone in the hot plate, and in the formalin test (first and the second phase). These results suggest that the APR extracts mechanism involves in part opioid receptors.In addition to this, we did not detect any disturbances in the locomotor activity or motor performance in animals treated by AEAPR or MEAPR up to 500 mg/kg. This suggests that both extracts at the highest effective dose, have no muscle-relaxant or central depressant action in models of nociception used in our study. Our result is in opposition of the study of Anacyclus pyrethrum root were investigated for their antioxidant action against free radicals using diverse methods . The results showed that APR extracts, according to DPPH method, have a strong scavenging activity, but with the capacity to protect against lipid peroxidation (BCB test). Indeed, Anacyclus pyrethrum effectively inhibits oxidative stress, which is in accordance with previous studies (Inflammation is a process that involves a series of phenomena that may be due to several agents. It is usually associated with pain which is a secondary phase resulting from the release of analgesic mediators . The inf studies .in vitro, are able to scavenge a wide range of ROS like superoxide and nitric oxide radicals (The antioxidant potential of APR extracts may be due to their phytochemical constituents. In fact, phytochemical screening has proved the occurrence of alkaloids, flavonoids, saponins, tannins, triterpenes and sterols. Detection of these phytochemicals in APR agrees with earlier findings . The pheradicals . In addiAnacyclus pyrethrum roots are non-toxic substances, with good central and peripheral antinociceptive effects, which is beneficial and researched in traditional medicine. The qualitative phytochemical analysis and the antioxidant activity in vitro have revealed the presence of several antioxidant phytoconstituants such as flavonoids, alkamides, saponins and tannins in Anacyclus pyrethrum root extracts.Our study demonstrated that aqueous and methanol extracts of Many mechanisms of specific action to those phytochemical compounds could be responsible for anti-inflammatory and antinociceptive activities observed in the present work. However, further studies are needed to isolate the pharmacologically active compounds and elucidate their exact molecular mechanism in the anti-inflammatory and antinociceptive process of APR.HM, MB, ZS, and SB designed the experiments; HM and OB performed the experiments, HM, SB, MB, and ACG performed the analysis of the data; HM And SB assembled the figures. HM, SB, MB, and ACG wrote and edited the manuscript. All authors validated it.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Evidence is emerging that the interaction between male seminal fluid and female tissues promotes fertility, pregnancy, and health of offspring. This includes the acceleration of ovulation in a species known as a spontaneous ovulator, the domestic pig. Earlier studies revealed that seminal plasma acts by a local mechanism in the female pig. The aim of the present study was to examine local short-term and mid-term effects of seminal plasma (SP) on mRNA expression of immunoregulatory genes and transcripts associated with follicle- and oocyte maturation. In the porcine animal model, effects on mRNA expression in the female tract and preovulatory follicles were examined. SP suppressed mRNA expression of Prostaglandin-Endoperoxide Synthase 2 (PTGS2) ipsilateral to the infused uterine horn which was associated with a lower presence of immune cells in the uterine epithelium and lower PTGS2 immunoreaction. Depending on the sampling time (2 h vs. 17 h) and hormonal status, SP altered significant correlative relations of mRNA expression between PTGS2 and the transcripts Tumor Necrosis Factor Alpha, Tumor Necrosis Factor Alpha-Induced Protein 6 and Pentraxin 3 in uterus, granulosa and cumulus cells. A modulatory effect of SP on the oocyte gene network comprising eight oocyte transcripts was observed: uterine exposure to SP induced positive correlations  of maturation promoting factors among each other and with cumulus cells on the side of the treated horn. In conclusion, SP orchestrates the gene network regulating the bidirectional communication between oocytes and surrounding somatic cells. The modulation of the immune-cytokine network of the female reproductive system could contribute to the previously reported SP-induced acceleration of ovulation in the porcine species. Although it seems a little surprising that in vivo insemination as commonly used in human and animal assisted reproduction can give satisfying results with only residual seminal plasma (SP), there is now no doubt that the interaction of SP components with the female reproductive tract enhances the likelihood of successful establishment of pregnancy. Exposure of the uterus to SP triggers endometrial cells and resident leukocytes to synthesize chemokines and other mediators . The While there has been substantial work on the uterine reaction to seminal fluid, until recently there has been only sparse information on ovarian responses. In a non-primate species also classified as a spontaneous ovulator, the domestic pig, seminal fluid contact accelerate ovulation , possiblBeyond this background, we expand previous studies on the local effect using a porcine animal model allowing the unicornually application of SP whilst the contralateral horn served as control. The unique benefit of this model is having an animal as essentially its own control even though a systemic effect additionally to the previously described predominant local SP-effect ,11 cannoUnless otherwise stated all chemicals were obtained from Sigma .Sixteen hybrid gilts, aged 7\u201313 months, weighing between 140 and 180 kg were used in this study. All animals had experienced at least one spontaneous cycle prior to the experiment. They were housed in groups of two to three on straw in covered barns at the Unit of Reproductive Medicine, University of Veterinary Medicine Hannover. The gilts were fed a standard commercial diet of pellets and given free access to drinking water. The study was approved by the independent ethics committee of the Lower Saxony Federal State Office for Consumer Protection and Food Safety, Oldenburg, Germany (research permit number 33.12-42502-04-07/1261).th day onwards, the ovaries were examined by transcutaneous sonography  once daily, from the 18th day on four times daily  to determine the follicle size.Studies were performed during spontaneous oestrus. Oestrus detection started at day 16 p.ov. by visual examination of the vulva and backpressure test in the presence of four different boars at intervals of four to six hours. The beginning of oestrus was set at the middle of the time interval between the last rejection and the first tolerance. From the 16Semen samples of ten mature boars with known fertility were collected over two months. The single ejaculates were centrifuged three times at 3.370 x g for ten minutes and the cell free plasma was stored frozen at -27 \u00b0C. The plasma pool was prepared by thawing the frozen samples, mixing and aliquoting in 100 ml bottles. Bottles were stored at -27 \u00b0C until use.\u00ae sol. 1 vol%, Eifelfango, Bad Neuenahr; 0.02 mg/kg KGW i.m.) and a combination of ketamine\u2013/ azaperone  were administered for premedication. Approximately 30 min later, anaesthesia was progressively deeper obtained by intravenous injection of ketamine (Ursotamin\u00ae) via an indwelling ear vein catheter. After endotracheal intubation, anaesthesia was maintained using a mixture of isoflurane, nitrous oxide, and oxygen. Throughout surgery, animals received an intravenous infusion of electrolytes  and fundamental physiological variables were recorded using an anaesthesia monitor .Uterine infusion of SP and phosphate buffered saline (PBS) were performed between 3 and 15 h after the calculated onset of oestrus under general anaesthesia. An intramuscular injection of atropine  were positioned around each uterine horn approximately 10 cm distal to the uterine body. 100 ml of the 37 \u00b0C warm SP were slowly injected into one uterus horn and 100 ml 37 \u00b0C warm PBS into the contralateral horn using disposable sterile syringes, polyethylene extension and needle. An ovario-hysterectomy and a partial hysterectomy of 40 cm of the cranial uterine horns including the uterotubal junction was performed after 2 h  during the same surgical approach or after 17 h  at a second surgery. The mid-ventral incision was closed with three separate layers. Animal were returned to straw-bedded recovery boxes and received analgesic  and antibiotic  treatment.Following aseptic procedures, the reproductive tract was exposed via a mid-ventral incision and, with the minimum handling of tissues, the number of mature pre-ovulatory Graafian follicles was recorded for each ovary. Double ligatures of an absorbable filament  immediately before treatment and immediately before ovariohysterectomy. Immediately after collection, blood samples were centrifuged at 3000 x g for 10 minutes and the plasma was stored at -27 \u00b0C until hormone analysis. Progesterone was measured by means of the competitive chemiluminescence-enzyme-immunoassay IMMULITE\u00ae system  according to the manufacturer\u2019s instructions. The intra-assay coefficient of variance was 6.3%. Oestradiol was measured with an enzyme-immunoassay as described earlier , 100 mg BSA). 350 \u03bcl PBS was added and samples were centrifuged at 1000 x g for 10 min. Afterwards, the supernatant was discarded and the cell pellet was frozen at -80 \u00b0C.Immediately after ovario-ectomy, ovaries were placed in 37 \u00b0C warm PBS supplemented with 1% BSA and were transferred to the lab. Within 5 min after collection, granulosa cells, cumulus cells, and oocytes were separately collected from Graafian follicles with diameters > 5 mm: follicles were punctured individually with an insulin syringe and a small needle (22 G). The aspirated fluid was transferred into Tissue Culture Medium 199 (TCM 199) and granulosa cells and COC were isolated under a stereo microscope using two 22 G needles. The oocytes with residual cumulus cells were denudated with a stripper-pipette  in several steps using three pipette tips (Mid Atlantic Diagnostics) of different diameter . To ensure a good oocyte quality, denudation had to be finished within 30 minutes. Denudated oocytes were washed three times in 37 \u00b0C PBS with 1% PVA, transferred with a maximum of 1.5 \u03bcl PBS + PVA into a RNase and DNase free Eppendorf cup  and stored at -80 \u00b0C until analyses. In parallel with oocyte preparation, isolated granulosa and isolated cumulus cells of single follicles/oocytes were transferred into 50 \u03bcl TCM Air , 70% alcohol (2 min) and a rinsing step in PBS (3 x 5 min). Then a pretreatment with TEC-buffer  was performed for PTGS2. Antibody MAC387 required treatment with Proteinase K solution . For all antibodies this was followed by rinsing in PBS (5 min) and incubation with 20% normal goat serum for 20 min. The primary antibody was diluted with PBS (+1% BSA) to a concentration determined in advance  and incubated in a moist chamber at 4\u00b0C overnight. After rinsing the sections with PBS (3 x 5 min) they were incubated with secondary antibodies (goat-anti-mouse or goat-anti-rabbit 1:200 in PBS for 45 min at RT in a moist chamber). Another rinsing step in PBS followed (3 x 5min). Then the sections were subjected to the ABC system (ABC Vectastain Elite Kit) for 30 min at RT in a moist chamber and rinsed again in PBS (3x5min) before they were treated with the chromogen . After stopping the colour development by a rinsing step in PBS (1 x 5min) and running tap water (10 min), the sections were counterstained with hemalum for 5 sec. Finally, the sections were rinsed in running tap water for 15 min and dehydrated in graded alcohols . They were mounted with Eukitt\u00ae after immersion in Xylol (2 x 5min). Negative controls were performed by replacing primary antibodies with either PBS or rabbit or mouse IgG which were diluted like the primary antibodies.Sections of 3\u20134 \u03bcm were produced from the paraffin embedded tissue and subjected to routine haematoxylin-eosin staining for general evaluation. Additionally, immunohistochemistry was performed with antibodies against neutrophil granulocytes and macrophages  and PTGS2 . Briefly, sections were deparaffinized in xylol (2 x 10 min) and then rehydrated in a series of alcohols . This was followed by incubation in a HFrom each animal one section from each localization was analysed in a blinded fashion.Evaluation of the immunoreaction of the MAC387 antibody was conducted by light microscopy (Leica LMD 7000) at a magnification of x400 in two ways. For both, ten fields of view per section were analysed. For the locations subepithelial stroma, stratum compactum and reticulare, endometrial and perimetrial blood vessels, myometrium and perimetrium the amount of cells was assessed semiquantitatively  because counting was impossible due to high cell numbers.For the PTGS2 antibody, in ten fields of view the staining intensity was classified in four categories (negative (= 0), weak reaction (= 1), positive (= 2) and strongly positive (= 3)) for the locations uterine epithelium, stratum compactum and reticulare, glandular epithelium, endometrial blood vessels and myometrial and perimetrial immune cells.PTGS2, Interleukin 6 (IL6), Pentraxin 3 (PTX3), Peroxisome Proliferator-Activated Receptor-Gamma 1 (PPARG1), Tumor Necrosis Factor Alpha (TNFA), Tumor Necrosis Factor Alpha-Induced Protein 6 (TNFAIP6) and Ubiquitin B (UBB) was analysed in epithelium of the uterine horn, the utero-tubal junction, granulosa cells and cumulus cells. To isolate RNA from the laser microdissected epithelium and the granulosa and cumulus cells stored at -80 \u00b0C, lysis buffer was added to the samples and RNA was extracted with the RNeasy\u00ae plus micro Kit (Qiagen) according to the manufactures instructions. To ensure RNA quality and quantity, every single RNA sample was analysed with the Experion\u00ae RNA Standard Sense Chips and the Experion\u00ae RNA Standard Sense Analysis Kit\u00ae  in the Experion\u00ae Automated Electrophoresis System\u00ae . To obtain same amounts of cDNA from each sample, RNA was diluted to 15 ng of total RNA/\u03bcl (epithelium of uterus and UTJ), 17 ng of total RNA/\u03bcl (granulosa cells) or 4.5 ng of total RNA/\u03bcl (cumulus cells).The mRNA expression of six immunoregulatory transcripts, \u2122 Recombinant RNase Inhibitor and the reverse transcriptase Superscript\u00ae III  were added. The RT reaction was carried out for 5 min at 25 \u00b0C, 60 min at 50 \u00b0C and 70 \u00b0C for 15 min according to manufacturer\u2019s instructions.Immediately thereafter, cDNA was generated by adding random primers and dnTPs , water was added to a total volume of 13 \u03bcl. After incubation at 65 \u00b0C for 5 min, 5x First-Strand Buffer, 0.1 DTT, RNaseOUT6\u2212100 copies) of the respective cDNA sub clones. Subsequently a melting curve was performed starting at 60 \u00b0C increasing the temperature every 15 sec for 0.3 \u00b0C to verify the amplified fragments.Messenger RNA copies were quantified with a Step One Plus real time PCR system . One microliter of the cDNA preparation representing 15 ng , 17 ng (granulosa cells) or 4.5 ng (cumulus cells) were distributed to individual wells. Gene specific primer and the SYBR Green PCR Master Mix  were added. Primer sequences, product sizes (bp) and accession numbers are available . Water wc-Mos, CCNB1, Mitogen-Activated Protein Kinase 1 (MAPK1), Cyclin-dependent Kinase 1 (CDK1), Proliferating Cell Nuclear Antigen (PCNA), Growth/Differentiation Factor 9 (GDF9), Bone Morphogenetic Protein 15 (BMP15) and Zygote Arrest 1 (ZAR1), were analysed in denuded and cryopreserved oocytes. Poly (A)+RNA was extracted as described by Stinshoff et al. [\u00ae mRNA DIRECT\u2122 Micro Kit  and directly used for reverse transcription (RT). RT was carried out in a total volume of 20 \u03bcl. The reaction mix contained 1x PCR Buffer , 5 mM MgCl2 , 1 mM dNTPs , 2.5 \u03bcM random hexamers , 20 U RNase inhibitor and 50 U murine leukaemia virus (MuLV) reverse transcriptase . The RT reaction was carried out at 25 \u00b0C for 10 min, 42 \u00b0C for 60 min followed by denaturation at 99 \u00b0C for 5 min and was then stored on ice.Prior to RNA isolation, 1 pg of rabbit globin RNA was added as external control. Eight developmentally important transcripts, f et al.  with the2, SYBR\u00ae Green, stabilizer, fluoreszin), 0.2 \u03bcM primer forward and reverse each for the gene of interest and the external reference gene . The PCR reaction mix contained 10 \u03bcl Mastermix . A gene was only considered for statistical analysis if its mRNA expression levels were above detection level (> 100 copies) in samples from both sides of the genital tract in more than 50% of the animals c.f. . Data weThe mRNA copy numbers in samples from the uterus, the utero-tubal junction, granulosa cells, and cumulus cells showed high variations between animals for any given gene. In order to reduce the bias of the high inter-animal variations and achieve a more standardized comparison, coefficients of relative differences in mRNA expression were calculated, when testing for differences in mRNA levels between e.g. the SP-treated and PBS-treated side or between locations within the SP-treated or PBS-treated side of the genital tract.An exemplary calculation is given in The coefficient from the example is used for comparing the mRNA expression level at a given location (e.g. uterus) between the SP-treated side and the PBS-treated side of the genital tract. The coefficients were entered into the calculations for the statistical tests (Student\u2019s t-test and Wilcoxon\u2019s signed rank test) instead of the commonly used differences (deltas) in mRNA copy numbers. Both, Student\u2019s t-test and Wilcoxon\u2019s signed rank test are testing the hypothesis that no significant deviation from zero exists for a given set of numbers. If the hypothesis was accepted, no significant difference in mRNA expression levels was assumed. If the hypothesis was rejected, a significant difference in mRNA expression levels was assumed. Data are reported as original mRNA copy numbers in all tables and figures.Correlations between mRNA copy numbers of selected transcripts within a location or between locations were calculated with Spearman\u2019s rank correlation coefficient (PROC CORR). Data of neutrophils in the uterine epithelium were analysed using Wilcoxon signed-rank test .Differences were considered statistically significant if P < 0.05.All animals exhibited signs of oestrus including hyperaemic, oedematous vulvae and had normally developed reproductive tracts. Ovarian follicles ranged between 7 and 11 mm in diameter and residual corpora lutea were present from the previous cycle. The median of the relation between oestradiol and progesterone at the time of treatment was 15.9 . In Group 2, the hormonal status was additionally examined at the time of tissue sampling, i.e. 17 h after treatment: the median of oestradiol and progesterone was 11.5 (range: 9.2 to 20.8).The number of neutrophils in the uterine epithelium was statistically significantly lower (p< 0.05) in the SP treated side when compared to PBS infused sides . SemiquaPTGS2 immunoreaction was higher in luminal epithelium of uterine horns compared to glandular epithelium . AdditioIL6, TNFA and TNFAIP, of the receptor proteins PPARG1 and PTX 3, and of the enzyme PTGS2 and of UBB as reference at the different location of the female tract both on treated and control sides is shown in PTGS2, TNFAIP6 and UBB was consistently expressed in all tissue samples in most animals. IL6 mRNA expression was found in the majority of gilts in the uterine epithelium in both groups of gilts and in granulosa cells of most animals in Group 2. No gene expression of IL 6 was detected in cumulus cells. Messenger RNA of TNFA was expressed in both epithelium of uterine horns and UTJ, but not in granulosa and cumulus cells. PPARG1 mRNA was expressed in all animals in granulosa cells only. Expression of the transcript PTX3 was consistently found in granulosa and cumulus cells, but only irregularly in uterine samples. Gene expression levels varied between animals. In Group 1 (sampling 2 h after treatment), expression levels in granulosa cells were related to the hormonal status  had significantly lower oestradiol/progesterone ratios compared to animals with low expression of these transcripts . Time or type of treatment did not influence the distribution of gene expression in the different tissue samples  of the cytokine genes l status . AnimalsPTGS2 in the epithelial cell layer of uterine horns treated with SP compared to control horns  in the epithelium of uterine horns compared to the uterine part of the UTJ. Differences were observed on both treated and control sides. Data are presented for animals in Group 1 in UBB did not differ between the two locations.In both groups of gilts, mRNA expression of PTGS2 , TNFA  and TNFAIP6  on the sides treated with SP, but not on contralateral sides. At 17 h after treatment (Group 2), no significant correlations were found.At 2 h after treatment (Group 1), mRNA expression was highly correlated between uterine horns and adjacent UTJ for the transcripts TNFA in the UTJ correlated significantly with expression of PTGS2  and PTX3  in granulosa cells ipsilateral to uterine horns treated with SP, but not on control sides  and cumulus cells  on both sides of the female tract. Data for both groups of gilts are presented in In animals of Group 1, gene expression of ol sides . Such coPTGS2 in cumulus cells and that of three oocyte transcripts PCNA, GDF9 and BMP15 as well as between PTX3 mRNA expression in cumulus cells and six oocyte transcripts PCNA, GDF9 and BMP15, c-Mos and CCNB1, were found on the sides of SP-treated uterine horns  between treated and control sides for all genes of interest, except for ZAR1. The relative mRNA expression levels did not differ between treated and control sides . At 2 h ne horns ; no corrnscripts . No signMAPK1 were positively correlated with mRNA\u2013expression of CDK1, BMP 15 and ZAR1, and relative expression levels of c-Mos were positively correlated to those of CCNB1, PCNA, CDK1 .At 2 h after treatment (Group 1), relative mRNA expression levels of most transcripts were highly correlated  to each other on ovaries from both control and treated sides. Only on the side of the treated uterine horn, relative expression levels of NA, CDK1 . At 17 hNA, CDK1 . On the GDF9 and c-Mos as key factors showing most correlative relations with other transcripts. At 2 h after treatment, the interaction network between the transcripts of the eight studied oocyte factors seems to be denser regardless of the treatment. At this early time, the modulatory influence of SP induces positive correlations of maturation promoting factors including MAPK1 among each other and with other oocyte factors. The presence of high positive correlation of mRNA expression of the two oocyte-secreted growth factors GDF9 and BMP15 with mRNA molecule concentrations of both PTGS2 and PTX3 in cumulus cells only on the side of SP-treated uterine horns indicates that SP modulates the interaction of the different cell types in antral follicles. There is strong evidence that fine gene dosage mechanisms involving GDF9 and BMP15 play an important role in the regulation of ovulation across mammalian species including human [BMP15, GDF9, CCNB1, CDK1, PCNA and low expression levels of TNAIP6 in granulosa cells indicate an advanced oestrous stage approaching ovulation. The observed unilateral negative correlation between TNFAIP6 in granulosa cells and maturation associated oocyte transcripts at 17 h after treatment indicates that SP advances the synchronization of mRNA expression between the different cell types in the preovulatory follicle. Thus, we suggest that SP facilitates ovulation by influencing the oocyte-CC regulatory loop, at least in porcine species where large amounts of SP enter the female tract and spontaneous ovulation would only occur in the last third of the oestrus period. The effect of male genital fluids will inevitably enhance fertilization chances by preventing loss of sperm quality associated with ageing in the female tract. Whether exposure to SP also would affect oocyte quality is as yet unknown. The observation that SP induces a correlative relationship between PTX3 in cumulus cells and mRNA expression of regulators of oocyte maturation c-Mos, CCNB1 CDK1 in addition to BMP15 and GDF9 supports this hypothesis because these maternal transcripts as well as relative abundance of PTX3 mRNA in cumulus cells are considered as markers for development competence of female germ cells in human, pig and mouse [The identification of relationship among genes, proteins or molecules in biological pathways is critical for understanding complex biological activities and biological functions . The preng human ,27. In tnd mouse ,29.PTX3 mRNA in granulosa cells was ipsilateral highly positively correlated with mRNA expression of PTGS2 in cumulus cells. Cumulus cells similar to granulosa cells express numerous immune cell-related genes and are very sensitive to changes in the immediate environment [PTGS2, PTX3 and TNFAIP6 in granulosa cells were associated with different oestradiol/progesterone ratios thus explaining the inter-individual variations of mRNA expression. Animals with low oestradiol/progesterone ratios indicating an oestrus stage closer to ovulation exhibited higher expression of PTGS2 mRNA. This result corresponds with kinetic changes of pre-ovulatory gene expression in granulosa and cumulus cells of sows primed with hCG [At 2 h after single uterine horn infusion of SP, expression of ironment . Since cironment . Systemiwith hCG .PTGS2 mRNA is predominantly controlled by LH and steroid hormones [PTGS2 in the uterine epithelium was observed at 17 h after SP infusion compared to control which could be explained by the concomitant lower number of neutrophils. Resident immune cell and their interaction with epithelial cells are most likely to mediate local immune effects. In line with the present results, it was reported that porcine SP inhibits neutrophil immigration, accelerates PMN clearance from the uterus and suppresses chemotaxis of PMN Click here for additional data file.S1 Table(DOCX)Click here for additional data file.S2 Table(DOCX)Click here for additional data file.S3 Table(DOCX)Click here for additional data file.S4 Table(DOCX)Click here for additional data file.S5 Table(DOCX)Click here for additional data file."}
{"text": "Homologous recombination (HR) is a complex biological process and is central to meiosis and for repair of DNA double-strand breaks. Although the HR process has been the subject of intensive study for more than three decades, the complex protein\u2013protein and protein\u2013DNA interactions during HR present a significant challenge for determining the molecular mechanism(s) of the process. This knowledge gap is largely because of the dynamic interactions between HR proteins and DNA which is difficult to capture by routine biochemical or structural biology methods. In recent years, single-molecule fluorescence microscopy has been a popular method in the field of HR to visualize these complex and dynamic interactions at high spatiotemporal resolution, revealing mechanistic insights of the process. In this review, we describe recent efforts that employ single-molecule fluorescence microscopy to investigate protein\u2013protein and protein\u2013DNA interactions operating on three key DNA-substrates: single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), and four-way DNA called Holliday junction (HJ). We also outline the technological advances and several key insights revealed by these studies in terms of protein assembly on these DNA substrates and highlight the foreseeable promise of single-molecule fluorescence microscopy in advancing our understanding of homologous recombination. Homologous recombination (HR) is a well-conserved and essential biological process for both genetic exchange and the repair of double-stranded DNA (dsDNA) breaks ,2,3,4. TRepairing dsDNA breaks involves three phases\u2014pre-synaptic, synaptic, and post-synaptic\u2014corresponding to the trimming of the dsDNA backbone creating single-stranded DNA (ssDNA) overhangs, formation of a homologous exchange intermediate called a Holliday junction (HJ), and, finally, the resolution of the junction back into dsDNA ,7. A numThe groundwork towards unraveling complex pathways of the HR process have been laid out initially through a number of biochemical studies. The protein\u2013DNA complexes that form during the HR process have been revisited more recently via single-molecule approaches and have significantly improved our understanding of the process ,23,24,25Various protein systems that are involved in the repair of dsDNA breaks via the HR pathway have several members, some of which act on both the dsDNA and ssDNA substrates. For instance, RecBCD is a complex of three enzymes which cuts and separates an ssDNA from genomic dsDNA at the chi sequence, leaving in its wake a trail of RecA protein bound to the ssDNA. The creation, protection, and repairing of the ssDNA segments is essential in the dsDNA break repair pathway. Typically, the ssDNA segments are protected by single-stranded DNA binding proteins (SSBs), where the SSBs wrap around the ssDNA portions to protect them from other cellular processes  and faciThe ssDNA-binding HR proteins have largely been explored using single-molecule FRET (smFRET) or DNA curtain platforms. The DNA constructs used in smFRET studies generally follow a simple design as shown in Single-strand DNA binding proteins (SSBs) and their analogs are essential in protecting ssDNA regions in various biological processes such as preventing the formation of ssDNA secondary structures and assisting in recruiting certain RecA mediators . The disThe properties and functions of RecA filaments have been the subject of major interest for single-molecule fluorescence studies in various stages of the HR process . In 2012The Rad51 nucleation was studied using an ssDNA construct with a FRET pair on the single-stranded region by Lu et al. . This stIn addition, the ssDNA platform has also been used to study other HR proteins. For example, in 2017, De Tullio et al.  used ssDInvestigation of dsDNA-binding HR proteins has been an area of considerable work in the fluorescence microscopy field. These proteins are critical to the presynaptic and synaptic stages of HR and often work in concert. Therefore, bulk methods have difficulty analyzing these complex interactions. Studies investigating and visualizing the binding of these HR proteins are by large performed on some linearized piece of dsDNA molecules hold in place under a fluorescence microscope. The mechanism by which the dsDNA molecules are held in place can be a \u201cDNA curtain\u201d approach, where the dsDNA molecules are bound to a functionalized slide surface on one end with continuous buffer flow to hold the DNA linear or are bound on both ends. Another method for holding a dsDNA molecule linear is binding the DNA to a functionalized polystyrene bead which is then held in a moveable optical trap, using a flow to keep the DNA extended. Exposure of DNA to different buffers is facilitated by physically moving the bead into various areas of a flow cell with buffers separated by laminar flow.The RecA filament formation was studied in 2006 by Galletto et al.  using ds\u22121 until this protein complex dissociates [In 2001, Bianco et al.  publishesociates . This wosociates . In 2012sociates  studied sociates . In thissociates . In 2013sociates  used optsociates .The essential HR protein, Rad51\u2019s, filament-forming behavior was studied in 2006 by Prasad et al.  using a \u22121 [The double-bound ssDNA curtain  provided\u22121 .Studying proteins that bind to the HJ using single-molecule microscopy presents interesting challenges and opportunities due to the inherent conformational changes that occur in the HJ ,65,66. T2+-rich buffer to determine the energy landscape which governs the switching of the HJ between its stacked conformers. They concluded that the conformational switch must occur during many intermediate stages of HR [2+ increased, the HJ switched to its stacked conformation more often, stalling the branch migration [Single-molecule studies of the HJ have determined the structural dynamics of the HJ, particularly the shape that the junction adopts and the circumstances (primarily ionic environment and nucleotide composition at the core of the junction) under which it would switch from one stacked conformer to another. In 2003, McKiney et al.  used an es of HR . The stees of HR  in 2005.igration . The religration . They aligration . The conigration  using a igration . The binigration ,71 in 20igration ,71.2+ and Na+ showed a strong relationship between the ion concentration and RuvA binding activity (2+, suggesting that the RuvA\u2013HJ interaction is primarily electrostatic in nature [Overall, the direct visualization of HJ-binding proteins is an ongoing research effort with only a few HR proteins having been studied. In 2015, Iwasa et al.  investigactivity B, with an nature .In 2019, Zhou et al.  used FREIn this review, we discussed recent work in the area of homologous recombination focusing on single-molecule fluorescence microscopy which has propelled our understanding of how HR proteins repair DNA breaks. More specifically, we described recent efforts to visualize how HR proteins operate on various DNA substrates\u2014ssDNA, dsDNA, and Holliday junctions. We provided an overview of the methods used in these studies including FRET-based single-stranded DNA constructs, both single- and double-stranded DNA curtains, optical tweezers, and FRET-based analysis of Holliday junction analogs. These studies provided insights into the mechanism of protein binding, determined the kinetics of filament formation by various ssDNA-binding proteins, and revealed regulatory effects of protein\u2013protein interactions on filament formation. More recent studies on HJ-binding proteins have revealed binding modes and effects of ionic environments on the binding interaction. These studies, along with bulk biochemical studies, have also started to decipher how these HR proteins contribute to the formation of branch migration complex and HJ-resolving machinery ,74,75,76In summary, using fluorescence microscopy, significant progress has been made in understanding the roles individual HR proteins play in the overall HR process. Some inroads have been made in determining the exact roles the HR proteins play on various stages of HR. However, an understanding of the synergistic effect that multiple HR proteins have on the HR process has not yet been fully achieved. Again, more work needs to be done to characterize the way different HR proteins work together to execute the entire HR process. Particularly, the steps and proteins involved in the transition from the synaptic to post-synaptic phases in human HR need more attention. To address these knowledge gaps, several labs around the world are using fluorescence microscopy and other forms of single-molecule techniques to dissect the HR process in detail. Combining the bulk biochemical work along with the molecular-level mechanistic insights obtained from single molecule work, we envision that we will have a complete picture of HR in the near future. Once this complete picture is established, it will significantly enhance our understanding of the HR process in the context of DNA break repair, and, in the long-term, it will become possible to intelligently target HR proteins for therapies."}
{"text": "The design, fabrication, and use of a hotspot-producing and temperature-sensing resistance thermometer for evaluating the thermal properties of low-dimensional materials are described in this paper. The materials that are characterized include one-dimensional (1D) carbon nanotubes, and two-dimensional (2D) graphene and boron nitride films. The excellent thermal performance of these materials shows great potential for cooling electronic devices and systems such as in three-dimensional (3D) integrated chip-stacks, power amplifiers, and light-emitting diodes. The thermometers are designed to be serpentine-shaped platinum resistors serving both as hotspots and temperature sensors. By using these thermometers, the thermal performance of the abovementioned emerging low-dimensional materials was evaluated with high accuracy. The semiconductor industry is pursuing electronic systems with higher integration density, more functions, higher power and frequency, and smaller footprint and volume, with lower cost. When the performance increases, the power density in electronics systems becomes higher and higher; thus, heat dissipation becomes a critical issue. In addition, the increase of hotspots and packaging complexity, such as in three-dimensional 3D) stacking of processor and memory chips, makes thermal management an even more difficult task in microsystems. Various advanced materials and technologies were proposed and demonstrated to improve thermal management in electronics, for instance, nanoparticles and graphene-enhanced thermal interface materials (TIMs) , carbon D stackinVarious methods were developed to characterize the thermal performance of nanomaterials. For instance, the thermal bridge method can be used to measure the in-plane thermal conductivity of extremely small structures down to a single atom layer ; the e-bThe principle of a resistance thermometer is to use temperature-sensitive materials to detect temperature by monitoring the change in electrical resistance of the material. Among all the materials, platinum (Pt) is one of the most used due to its highly linear temperature\u2013resistance relationship. Fu et al. fabricated a resistance thermometer using e-beam evaporated Pt thin films on silicon chips , as show2. The thickness of the platinum thermometers is 40 nm. Prior to the deposition of the platinum resistors, a 20-nm-thick titanium layer was deposited as an adhesion layer. The thickness of the insulating silicon dioxide (SiO2) layer on the silicon substrate was 300 nm. Balandin et al. used a similar structure to model the heat spreading from metal\u2013oxide\u2013semiconductor (MOS) field-effect transistors on silicon-on-insulator (SOI) substrates with and without graphene heat spreaders [The thermal test chip fabricated by Fu et al.  shown inpreaders . In this paper, the thermal test chip shown in 2sp hybridized C\u2013C bonding, CNTs exhibit excellent thermal properties. Therefore, they were proposed as a candidate for thermal interface material development and many results were reported [2 insulating layer on the hotspot circuit. More details about the transfer process can be found elsewhere [Owing to the very strong reported ,17,18,19reported ,21 and creported . They grreported , as showlsewhere ,24. PrioAfter transfer, the on-chip CNT-based micro heat sink was mounted onto a supporting circuit board as shown in In order to examine the cooling performance of the CNT-based micro heat sink, air and water were used as coolant, and they were pumped to flow through the micro channels between the CNT fins. Some results of the experiments are shown in 2, the hotspot temperature decreased by almost 50 \u00b0C (from 116 to 68 \u00b0C) upon using water at a flow rate of 0.32 m/s, compared to when air was used as the coolant, even though the air flow rate was ten times larger (3.2 m/s). However, more interesting is the unfortunate fact that the CNT cooling fins seemed to have a minimal influence when air was used as coolant. This is believed to be a combination of the thermal contact resistance to the hotspot being too high due to the interface layers, and that macro-scale cooling may not be directly scalable to a micro-scale environment.As expected, water is a much more effective coolant than air. For a heat flux of 3000 W/cmThe experiments showed that, when the chip was cooled by water at a flow rate of 0.32 m/s, the hotspot temperature on the chip with the CNT cooling fin structure was about 8\u201310 \u00b0C lower than on the test chip without the CNT fins. Interestingly enough, beyond a certain flow rate of the water coolant, the cooling effect seems to be more or less independent of the flow rate, as shown in Finally, Similar to CNTs, graphene also possesses excellent thermal and mechanical properties due to its special crystalline structure . In elecBalandin et al. showed that a few-layer graphene-based heat spreader connected to the drain of gallium nitride (GaN) high-power field-effect transistors considerably reduced the device temperature . Using mTo evaluate the graphene-based heat spreaders, a new version of the resistance thermometer was designed and fabricated. Based on the lessons learnt from the CNT-based micro heat sink, the wires connecting the hotspot resistor and the I/O pads were redesigned to minimize the power dissipation via interconnect circuit. Two examples of such redesigned resistance thermometers are shown in 2, and its resistance was about 80 \u03a9 at room temperature. monolayer graphene grown by chemical vapor deposition (CVD) was placed on the thermal test chip as heat spreader via the transfer method [2 protective layer. 2. Thick graphene-based films fabricated from the liquid-phase exfoliation method [2 layer was reduced to one-tenth of the thickness that was used in the CNT cooling fin experiments. The detailed process of transferring and placing the monolayer and multilayer graphene heat spreader onto the hotspot structure is described elsewhere [These hotspot test structures were used in a series of experiments to investigate the thermal performance of 2D materials with high thermal conductivity, such as monolayer and multilayer graphene, and BN-based heat spreaders. By using such 2D materials as heat spreaders to dissipate the Joule heat generated from the hotspot laterally across the chip surface, both the hotspot temperature and the average temperature across the chip can be lowered. The area of the hotspot resistor used in these experiments was 390 \u00d7 400 \u03bcmr method ,35. The n method ,37 were lsewhere . In another investigation, an infrared camera was used to monitor the temperature on the thermal test chip to evaluate the cooling performance of a graphene-based heat spreader . The theA recent study showed that the cooling performance of a graphene-based heat spreader (fabricated via the vacuum filtration method) can be further improved by interfacial functionalization . In a se2. By placing a graphene film without functionalization on the surface of the test structure and repeating the measurements, the hotspot temperature was found to decrease to 140 \u00b0C (\u2206T = 6 \u00b0C). The estimated accuracy was \u00b10.5 \u00b0C. If, instead, the functionalized graphene-based heat spreader was used, where the thermal contact resistance between the graphene-based film and the test structure was reduced by the addition of a functionalized graphene oxide (FGO) interfacial layer, the hotspot temperature was found to decrease to 134 \u00b0C (\u2206T = 12 \u00b0C). The resulting thermal performance of the graphene-based heat spreader before and after functionalization is shown in In this paper, we also summarize the use of hotspot test structures for the evaluation of the performance of 2D hexagonal boron nitride (hBN) films as heat spreaders. The advantage of BN films over graphene is that they are electrically insulating and yet good thermal conductors . In scen2) insulators. For hBN monolayers, the thermal conductivity value can be even higher [2 layers, which will significantly decrease the total thermal resistance along the heat conduction path and, therefore, greatly improve the cooling performance. For thermal management applications, 2D hBN was used to develop both thermal composites [Bulk hBN has a typical thermal conductivity of 390 W/mK, which is 280 times higher than the thermal conductivity of silicon dioxide  . In thisIt should be noted that there is larger variation in thermal performance between different hBN films (multilayer hBN films) as compared to variations between different monolayer hBN films. This is explained by the difficulties in maintaining the same properties between samples obtained by drop-coating of LPE hBN solutions. As shown in Reference , studies2).A few emerging low-dimensional materials exhibit excellent thermal properties that could be used for thermal management of high-power electronics. In this paper, we reviewed a number of serpentine hotspot-producing and temperature-sensing test structures that can be used to evaluate the thermal performance of these 1D and 2D materials. The performances of both CNT-based micro heat sinks and two-dimensional films of graphene and hBN-based heat spreaders were summarized. For the CNT-based heat sink, air did not show much cooling effect, while water cooling could lower the hotspot temperature by 50 \u00b0C at high heat flux densities. Furthermore, several studies using monolayer graphene and hBN as a heat spreader were summarized. The monolayer graphene heat spreader was shown to be much more efficient in spreading the heat, thereby lowering the hotspot temperature, than the monolayer hBN heat spreader. Concerning few-layer graphene heat spreaders, it was shown that their performance could be improved considerably by functionalization using APTES, which can minimize the thermal contact resistance between the chip and the heat spreader. Few-layer hBN heat spreaders were shown to have similar heat spreading performance to few-layer graphene without functionalization (~5\u00b0C at 1000 W/cmThese 1D and 2D materials show great potential as heat dissipation materials in electronics. However, challenges need to be addressed before the low-dimensional materials can be pushed onto the market. For the CNT-based micro heat sink, a CNT transfer process which can be upscaled to industry level and be compatible with the current semiconductor processes needs to be approved. For graphene-based heat spreaders, the thick graphene films are more favorable than the CVD-grown mono- to few-layer graphene films from the processability perspective. Lastly, hBN-based heat spreaders are easier to integrate into electronic systems than graphene-based heat spreaders because hBN films are electrically insulating; however, the mechanical strength of the hBN films needs to be improved."}
{"text": "We investigated the relationship of plasma amyloid beta (A\u03b2) with cerebral deposition of A\u03b2 and tau on positron emission tomography (PET).18F]flortaucipir scan. Scans were preprocessed by standard techniques, and mean global and regional amyloid and tau values were extracted. Free A\u03b242/A\u03b240 (A\u03b2 F42:F40) and total A\u03b242/A\u03b240 (A\u03b2 T42:T40) were evaluated for differences by diagnosis and relation to PET A\u03b2 positivity. Relationships between these measures and cerebral A\u03b2 and tau on both regional and voxel-wise basis were also evaluated.Forty-four participants  underwent amyloid PET and a blood draw. Free and total plasma A\u03b240 and A\u03b242 were assessed using a validated assay. Thirty-seven participants  also underwent a [Lower A\u03b2 T42:T40 was associated with diagnosis and PET A\u03b2 positivity. Lower plasma A\u03b2 T42:T40 ratios predicted cerebral A\u03b2 positivity, both across the full sample and in CN only. Finally, lower plasma A\u03b2 T42:T40 ratios were associated with increased cortical A\u03b2 and tau in AD-related regions on both regional and voxel-wise analyses.Plasma A\u03b2 measures may be useful biomarkers for predicting cerebral A\u03b2 and tau. Additional studies in larger samples are warranted. AD affects 5.7 million individuals in the United States, a number that is expected to rise to nearly 14 million by 2050 APOE) Recent advances in blood-based assays have suggested that levels of amyloid beta (A\u03b2) can be precisely measured and are associated with levels of A\u03b2 in the brain, making them good potential biomarkers for AD-risk screening and early detection. Specifically, previous studies have suggested that plasma levels of A\u03b2, tau, and other target proteins, such as neurofilament light, amyloid precursor protein, and others, are altered in patients with AD and those in the prodromal stage of AD, mild cognitive impairment (MCI). A number of studies have suggested that plasma A\u03b242 and A\u03b240 measures, as well as the ratio of A\u03b242/A\u03b240 are reduced in patients with AD and MCI and that these plasma biomarkers can predict the presence of AD and MCI and progression from normal to impaired cognition The goal of the present study was to investigate a measure of plasma A\u03b242 and A\u03b240 in a cohort of participants who are CN or are diagnosed with MCI or AD. Our initial goal is to replicate previous studies showing that plasma A\u03b2 measures are linked to the presence of cerebral A\u03b2 on PET. Furthermore, we extend these analyses to also investigate whether plasma A\u03b242 and A\u03b240 are associated with cerebral tau deposition on PET. The overall purpose of this study is to establish whether this plasma A\u03b2 measure represents a promising biomarker for potential screening and early diagnosis of those at risk for AD.22.118F]florbetapir or [18F]florbetaben, cognitive and clinical assessment, and a blood sample. Thirty-seven participants also were studied with tau PET using [18F]flortaucipir. Diagnoses were made by clinician consensus using standard criteria. Briefly, participants with MCI had a significant complaint about their cognition from themselves and/or an informant or clinician, as well as a significant deficit  in either memory or another cognitive domain, but with no significant decline in daily functioning. Patients with AD showed significant impairment on cognitive measures and a decline in daily functioning and met criteria for an AD diagnosis according to the updated National Institute of Neurological and Communicative Disorders and Stroke and the Alzheimer's Disease and Related Disorders Association criteria Forty-four participants  from the Indiana Memory and Aging Study (IMAS) at the Indiana Alzheimer Disease Center were included in this study. All participants underwent an amyloid PET scan with either Florbetapir  or [18F]florbetaben  were acquired on all participants. Briefly, [18F]florbetapir scans were initiated by an intravenous injection of approximately 10\u00a0mCi of [18F]florbetapir. After a 50-minute uptake period, participants were imaged on a Siemens mCT for 20\u00a0minutes (50\u201370\u00a0minutes) using continuous list mode data acquisition. [18F]Florbetaben scans involved the intravenous administration of approximately 8\u00a0mCi of [18F]florbetaben. After a 90-minute uptake period, PET data were acquired for 20\u00a0minutes (90\u2013110\u00a0minutes) using continuous list mode acquisition on a Siemens mCT. A computed tomography scan was acquired for both scans for scatter and attenuation correction. List mode data were subsequently rebinned into four 5-minute frames for both types of amyloid PET scans and reconstructed using parameters from the Alzheimer's Disease Neuroimaging Initiative protocol (http://adni.loni.usc.edu), with corrections for scatter and random coincidence events, attenuation, and radionuclide decay. The four 5-minute frames for each type of amyloid PET scan were spatially aligned to each subject's T1-weighted structural magnetic resonance imaging, motion corrected, and normalized to Montreal Neurologic Institute space, using Statistical Parametric Mapping 8 (SPM8). For [18F]florbetapir, the frames were averaged to create a 50-70 minute static image, while for [18F]florbetaben, the frames were averaged to create a 90\u2013110\u00a0minute static image. Finally, static images were intensity normalized to the whole cerebellum to create standardized uptake value ratio (SUVR) images and smoothed with an 8-mm full-width half maximum Gaussian kernel. The whole cerebellum region of interest (ROI) was taken from the Centiloid project  were extracted from target ROIs, including the global cortex, lateral parietal lobe, and precuneus, generated using FreeSurfer version 5.1  and extracted using MarsBaR [2.418F]flortaucipir PET was initiated by intravenous injection of approximately 10\u00a0mCi of [18F]flortaucipir. After a 75-minute uptake, participants are imaged for 30\u00a0minutes by continuous list mode data acquisition on a Siemens mCT, which is subsequently rebinned into six 5-minute frames. Scans were again reconstructed using a standard scanner software program  and according to the Alzheimer's Disease Neuroimaging Initiative protocol (http://adni.loni.usc.edu). Using SPM8, the middle four 5-minute frames (80\u2013100\u00a0minutes) were motion corrected, normalized to Montreal Neurologic Institute space using the subject-specific T1-weighted structural magnetic resonance imaging, averaged to create an 80\u2013100\u00a0minute static image, intensity normalized to the cerebellar crus to create SUVR images, and smoothed with an 8-mm full-width half-maximum Gaussian kernel.The ). A larger area of amyloid deposition encompassing nearly the entire cortex was significantly associated with plasma A\u03b2 T42:T40 (P\u00a0<\u00a0.05 [FWE]).Plasma A\u03b2 F42:F40 was significantly associated with amyloid deposition in the left frontal lobe on voxel-wise analysis (P\u00a0<\u00a0.05 [FWE]). Plasma A\u03b2 T42:T40 was significantly associated with tau deposition in the temporal and parietal lobes (P\u00a0<\u00a0.05 [FWE]).Cerebral tau deposition in the bilateral medial and lateral temporal lobes was significantly associated with plasma A\u03b2 F42:F40 on voxel-wise analysis  that may alter the relationship between plasma A\u03b2 and cortical amyloid and tau. Additional studies to investigate the impact of comorbidities on this relationship are crucial for ultimately establishing this assay as a clinical tool. In addition, the CN group in this study had a high prevalence of APOE \u03b54 positivity, suggesting that they represent a higher risk group. Thus, the findings in this study may not accurately generalize to the normal older adult population as a whole. Future epidemiologic studies in community-based samples are needed to explore plasma amyloid measures in the general older adult population. Finally, this is a cross-sectional study, and thus, we could not assess outcome data or whether the assay predicted future cognitive decline. Future studies will allow us to fully assess the outcome of these participants. In addition, future studies should investigate genetic associations and potential genetic modulators of plasma amyloid levels.1.Systematic review: To investigate associations between plasma amyloid biomarkers and neuroimaging measures of cerebral amyloid and tau, we searched for combinations of \u201cplasma,\u201d \u201cblood,\u201d \u201camyloid,\u201d \u201cPET,\u201d and \u201cAlzheimer's.\u201d We then combined the returned articles to generate a summary of the current literature evaluating blood-based biomarkers of AD in predicting diagnosis and abnormal neuroimaging and cerebrospinal fluid biomarkers.2.Interpretation: Our results provide new evidence that plasma amyloid measures accurately reflect cerebral amyloid deposition and can predict the presence of amyloid in cognitively normal older adults with high accuracy. Furthermore, these results suggest a relationship of plasma amyloid with cerebral tau, which is mediated by cerebral amyloid.3.Future directions: To confirm the current findings, additional analyses with larger samples would be beneficial. In addition, longitudinal follow-up studies with repeated plasma samples, neuroimaging, and cognitive testing would help determine whether the plasma amyloid measure can predict and monitor clinical decline over time.In sum, plasma A\u03b2 measures were reduced in patients with MCI and AD, predicted cerebral A\u03b2 positivity on PET, even in CN individuals, and were associated with cerebral amyloid and tau load. These preliminary findings suggest that these plasma measures of A\u03b2 may be a potential screening tool for detecting AD-related neuropathology in at-risk individuals in clinical settings or pharmaceutical trials. As AD therapeutics are developed, these assays may be helpful in providing an initial determination of which individuals may benefit from follow-on cerebrospinal fluid and/or PET investigations before treatment."}
{"text": "Phenomics provides new technologies and platforms as a systematic phenome-genome approach. However, few studies have reported on the systematic mining of shared genetics among clinical biochemical indices based on phenomics methods, especially in China. This study aimed to apply phenomics to systematically explore shared genetics among 29 biochemical indices based on the Fangchenggang Area Male Health and Examination Survey cohort.P\u2009<\u200910\u2212\u20094) were associated with three or more traits. After integrating the SNPs related to two or more traits with the GWAS catalogue, 31 SNPs were found to be associated with several diseases (P\u2009<\u200910\u2212\u20098). Using ALDH2 as an example to preliminarily explore its biological function, we also confirmed that the rs671 (ALDH2) polymorphism affected multiple traits of osteogenesis and adipogenesis differentiation in 3\u2009T3-L1 preadipocytes.A total of 1999 subjects with 29 biochemical indices and 709,211 single nucleotide polymorphisms (SNPs) were subjected to phenomics analysis. Three bioinformatics methods, namely, Pearson\u2019s test, Jaccard\u2019s index, and linkage disequilibrium score regression, were used. The results showed that 29 biochemical indices were from a network. IgA, IgG, IgE, IgM, HCY, AFP and B12 were in the central community of 29 biochemical indices. Key genes and loci associated with metabolism traits were further identified, and shared genetics analysis showed that 29 SNPs (All these findings indicated a network of shared genetics and 29 biochemical indices, which will help fully understand the genetics participating in biochemical metabolism. Complex traits are the product of various biological signals and some intermediate traits may be affected either directly or indirectly by these signals . A phenoPleiotropy, which is a DNA variant or mutation that can affect multiple traits, is a common phenomenon in genetics . For exathe ALDH2 rs671 polymorphism affected serum TG levels [The Fangchenggang Area Male Health and Examination (FAMHES) cohort was initiated in 2009 in Fangchenggang City, Guangxi, China. It is a comprehensive demographic and health survey that focuses on investigating the interaction between the environment and genetic factors on men\u2019s health. In a previous study, we reported that biochemical indices are closely associated with disease. For example, higher complement 3 (C3) and complement 4 (C4) were associated with an increase in metabolic syndrome (MetS) . Low serG levels . AlthougThe aim of this study was to identify the shared genetics responsible for 29 biochemical indices in the FAMHES cohort using a phenomics approach. Our findings shed light on the relationships between these 29 biochemical indices, including their shared genetic basis and genetic risk loci.P value was less than 0.01) , suggesting that the stratification correlation worked well  associated with all 29 biochemical indices were obtained and then annotated using the SNP function database with default parameters and the south Asian population option [For each trait, we used a linear mixed model estimate fixed value, adjusted with PC1 and PC2 of population stratification and age, respectively, to perform a GWAS. A total of 86,556 SNPs  were found  were the first top factors in the network of these 29 traits and were related to more than 20 traits. Additionally, IgM, CRP, C4, BUN, TG, creatinine and FSH were the second top factors and connected with more than 15\u201320 traits, and OSTEOC, oestradiol, glucose, FOL, TE, SHBG, FERR, BMI, ALT and HDL were the third top traits, which correlated with more than 10 traits  were correlated with more than 5 traits. After filtering the genes with SNPs (P\u2009<\u200910\u2212\u20094), there were 71 genes correlated with more than or equal to 3 traits, especially aldehyde dehydrogenase 2 family member (ALDH2), BRCA1 associated protein (BRAP), cadherin 13 (CDH13) and CUB and Sushi multiple domains 1 (CSMD1), which was related to more than 5 traits. In these 71 genes, 38 genes were found to connect more than 5 other genes in the interactional network annotated from the BioGRID database [We selected SNPs with  central . After idatabase  (AdditioP\u2009<\u20091\u271510\u2212\u20093) were associated with three or more clinical biochemical quantitative traits, and 13 of these 481 SNPs were related to more than 5 traits. In these SNPs, rs12229654 (near cut like homeobox\u00a02 (CUX2)), rs2188380 (located in CUX2), rs3809297 (located in CUX2) and rs3782886 (located in BRAP) were related to more than 10 traits. Six SNPs in CUX2 were correlated with more than 5 traits, which indicates that CUX2 should play an important role on this net. In addition, for all the SNPs with P\u2009<\u20091\u2009\u00d7\u200910\u2212\u20094, 29 SNPs were related to three or more biochemical indices  with the GWAS catalogue [ALDH2 was related to 21 traits, six SNPs  in or near CYP19A1 were mainly associated with hormone measurements. This finding supports the idea that shared genetics for traits can produce correlations among these traits.After integrating the SNPs associated with more than 2 traits, osteocalcin, RUNX family transcription factor 2 (Runx2), and collagen type I (Col1), was significantly higher in ALDH2-WT cells than in ALDH2-G504\u2009L-mut or control cells , C/EBP\u03b2, adipocyte fatty acid-binding protein (Fabp4), and Ppar\u03b3 (peroxisome proliferator-activated receptor), were much higher in ALDH2-WT cells than in ALDH2-G504\u2009L-mut or control cells  in  studies , 25; howA network of shared genetics and 29 biochemical indices were found in this research study. Not only did one intermediate phenotype have multiple associated SNPs, interestingly, one SNP associating with multiple intermediate phenotypes was also common. The phenomenon of some genes or loci having the ability to affect multiple distinct phenotypic traits is called pleiotropy. Increasing attention has been paid to pleiotropy. In 2011, according to the data of the NIH GWAS website, Sivakumaran found that nearly 5% of SNPS and 17% of genes or gene regions were related to two or more diseases or traits . In 2018Immunoglobulin is produced by plasma cells and lymphocytes and is characteristic of these types of cells and plays an essential role in the body\u2019s immune system. In this study, we found that IgG, IgA, IgE and IgM were the central traits in the biochemical indices network, and these traits could be linked to 19 or more traits. HCY, a naturally occurring amino acid found in blood plasma, plays a central role in biochemical indices by connecting with 23 traits. High levels of HCY have been associated with several body dysfunctions, such as vasculature  and endoALDH2 and BRAP can be related to 9 traits and are connected with 19 and 13 genes, respectively. ALDH2 belongs to the aldehyde dehydrogenase family of proteins, which is the second enzyme of the major oxidative pathway of alcohol metabolism. ALDH2 dysfunction will lead to several diseases, such as cancer [BRAP is a cytoplasmic protein, which can bind to the nuclear localization signal of BRCA1 and other proteins [CSMD1 was related to 8 traits. CSMD1 is a large (~\u2009390\u2009kDa) membrane-bound complement inhibitor [Pleiotropy refers that some genes or loci that have the ability to affect multiple distinct phenotypic traits. After integrating all the related genes among 29 biochemical indices, surprisingly, s cancer , 37, alcs cancer , and cars cancer . BRAP isproteins . The polproteins  and metaproteins . Additionhibitor . Mutationhibitor . These tP\u2009<\u200910\u20134) were associated with three or more traits and correlated with each other. These results revealed that the shared regulatory genetics are most likely to drive association signals and play important roles in clinical biological function. This phenomenon may provide important \u201cscaffolding\u201d to support a framework to explore the basic mechanism of biochemical indices.If the SNPs located in sites related to promoter DNase binding, enhancer histone binding and transcript binding, the marginally significant SNPs play regulatory roles affecting protein binding or the presence of eQTL , 46. In Shared genetics are commonly used to build disease-diseased relationship and mine the common disorder of diseases , 48. An P value of correlation analysis, a great deal of potential information was lost while significant loci were obtained. Some loci did not achieve a P cut-off value but itself, but if these loci were located in a short range or were involved in similar functions, these lower p value loci may also affect biological function [P\u2009<\u20091\u2009\u00d7\u200910\u2212\u20093, and three gene regions in CD28, PRDM1 and CD2/CD58 were identified that were closely related to rheumatoid arthritis [\u2212\u20098 to 10\u2212\u20093, and performed a meta-analysis on genetic variation and blood indexes and environmental exposure histories [With the emergence of GWAS, a large number of loci and disease-related information were elucidated. However, due to its strict restriction on the function . Furtherrthritis . To asseistories . Kostem istories .Because there are no mature methods of research on the genetic relationship between traits at the level of genome-wide summary statistics, we set a lower threshold value for obtaining more SNPs for analysis, and then analysed the association of these candidate SNPs by three different methods: Pearson correlation coefficient, LDSC or Jaccard correlation. As we show, even with three different calculation methods, most of the top important traits are similar. Of these, IgA, IgG, HCY, AFP, IgE and B12 were the first top factors in the network. Our research is an experimental attempt to assess the network of shared genetics and 29 biochemical indices.P\u2009<\u200910\u2212\u20094) were associated with more than 3 traits. Thirty-one SNPs were associated with several diseases (P\u2009<\u200910\u2212\u20098) by integrating the SNPs related with 2 or more traits with the GWAS catalogue. Third, using ALDH2 as an example to preliminarily explore its biological function, we found that the rs671 (ALDH2) polymorphism could affect the osteogenic and adipogenic differentiation of 3\u2009T3-L1 preadipocytes. We clarified that 29 biochemical indices were from a network and that hub variations/genes played a vital role in biological processes. These findings highlight a network of shared genetics and 29 biochemical indices.We investigated the correlations among 29 biochemical indices through three biological information methods. First, we found that IgA, IgG, IgE, IgM, HCY, AFP and B12 were in the central community of 29 biochemical indices. Second, the shared genetics analysis showed that 29 SNPs  fasting venous blood specimens were obtained between 7:00\u2009am and 10:00\u2009am, and serum samples were extracted and stored at \u2212\u200980\u2009\u00b0C. Triglyceride, cholesterol, HDL-C, LDL-C, glucose, ALT, BUN, uric acid and creatinine were measured enzymatically on a Dimension-RxL Chemistry Analyzer  in the Department of Clinical Laboratory Science at the Fangchenggang First People\u2019s Hospital. CRP, C3, C4, IgA, IgE, IgG, IgM, and ASO were measured with immunoturbidimetric methods on a HITACHI 7600 Biochemistry Analyzer . Ferritin, folate and vitamin B12, TE, oestradiol, FSH, SHBG, insulin, AFP and OSTEOC were measured with the same batch of reagents by electrochemiluminescence immunoassay and HCY assayed by enzyme cycle method using a COBAS 6000 system E601 (Elecsys module) Immunoassay Analyzer .P value for the Hardy-Weinberg equilibrium (HWE) test was greater than 1\u2009\u00d7\u200910\u2212\u20093, the minor allele frequency (MAF) was greater than 0.01, and the genotype call rate was greater than 95%. The inferred genotypes of SNPs in the genome that were not directly genotyped were computed by the IMPUTE program [Genome-wide SNP genotyping was performed with an Illumina Omni 1\u2009M chip . Among 2012 genotyped subjects, 1999 passed the QC call rate of 95% and were included in the final data analysis. A total of 709,211 SNPs in these subjects passed the QC criteria as follows: the  program   tool to identify the genes containing all of the SNPs for which the P value for the GWAS was less than 1\u2009\u00d7\u200910\u2212\u20093. The human interactome was obtained by combining protein-protein interaction (PPI) information from the BioGRID database [Phenotypes are linked if they share alterations in genetics. The pathobiology of human diseases might be understood by creating molecular and phenotypic networks , 66. We database .We built correlations among 29 clinical phenomes based on the common genes/proteins between two traits. To minimize the bias in estimating the correlation between two given traits, we calculated the molecular comorbidity index (MCI) by adapting the formula from Grosdidier S  to furthproteinstrait1 and proteinstrait2 are the proteins related to clinical traits 1 and 2, respectively. proteinstrait1\u2009\u2192\u2009trait2 are those proteins related to trait 1 that interact with the proteins associated with trait 2 (and vice versa proteinstrait2\u2009\u2192\u2009trait1). The two operators \u2229 and \u222a denote the intersection and union between the two sets of elements .Where The genetic correlations derived from the summary statistics were evaluated by the GWAS effect size for a given SNP and integrated the effects of all SNPs that were in linkage disequilibrium (LD) with that SNP. The LDSC (which targets genetic correlation) uses variants across the whole genome and is a symmetrical  analysis for the risk factor and the outcomes . In shor2. The osteoblast-inducing medium used was \u03b1-MEM (\u03b1-minimum Eagle\u2019s medium) containing 10% FBS , 100\u2009nM dexamethasone, 5\u2009mM \u03b2-phosphoglyceride and 5\u2009\u03bcg/mL vitamin C. The adipogenesis-inducing medium included A and B medium. The A medium was DMEM containing 10% FBS, 100\u2009nM dexamethasone, 0.5\u2009mM 3-isobutyl-1-methylxanthine and 5\u2009\u03bcg/mL insulin. The B medium was DMEM containing 10% FBS and 5\u2009\u03bcg/mL insulin. For adipocyte induction, cells were cultured for two cycles of A medium for 2\u2009days and then B medium for 1\u2009day. Cell proliferation was measured by a CCK-8 assay according to the manufacturer\u2019s instructions . Cell apoptosis was examined by Annexin V-APC/7-AAD staining followed by flow cytometry detection. For Oil Red O or Alizarin Red S staining, cells were fixed with 4% paraformaldehyde for 30\u2009min and stained with 4% Oil Red O solution or 0.4% Alizarin Red S. Lipid droplets and calcium nodules were quantified using ImageJ software. Cellular RNA was extracted using an RNA extraction kit . Reverse transcription was performed with the Transcriptor Reverse Transcriptase Kit . Quantitative reverse transcriptase-PCR was performed using a Roche Light Cycler 480 and KANGWEI qPCR Kit . Per-primer sequences are listed in Additional\u00a0file\u00a0Full-length ALDH2-WT and ALDH2-G504\u2009L-mut cDNA were cloned into the pTSBOE-CMV-MSC-3flag-EF1-tRFP-F2A-Puro lentivirus vector . The 3\u2009T3-L1 preadipocytes were cultured in Dulbecco\u2019s modified Eagle\u2019s medium (DMEM) with 10% foetal bovine serum (FBS) at 37\u2009\u00b0C in a humidified atmosphere with 5% COThe correlations among the 29 biochemical indices were computed by the CORR procedure using SAS 9.0 and defined as the Pearson correlation coefficient between the rank variables. With the exception of BUN, HCY, B12, FERR, OSTEOC, creatinine, uric acid, cholesterol, HDL, LDL, TE and C3, 17 traits without normal distribution were logarithmically transformed to normalize the distribution. The association of the SNPs with 29 clinical quantitative traits was evaluated using a linear regression adjusted for population stratification factors (PC1 and PC2) and age. Population stratification was evaluated by a principal component approach with EIGENSTRAT software .The datasets generated and analysed during the current study are available in the Genome variation Map (GVM) of National Genomics Data Center (NGDC) (Accession Number: GVM000052).Additional file 1: Fig. S1. The cluster dendrogram for the 29 biochemical indices from the FAMHES cohort created with the hclust win R package. In this analysis, two main clusters were produced among these 29 traits. FERR (ferritin), CRP (C-reactive protein), C3 (complement 3), C4 (complement 4), AFP , TG (triglycerides), LDL (low density lipoprotein), ALT , BMI (body mass index), ASO (anti streptolysin) (anti-streptolysin \u201cO\u201d), IgG (immunoglobulin G), IgA (immunoglobulin A), IgM (immunoglobulin M), BUN (blood urea nitrogen), FSH (follicle-stimulating hormone), HDL (high-density lipoprotein), TE (testosterone), SHBG (sex hormone binding globulin), IgE (immunoglobulin E), B12 (vitamin B12), HCY (homocysteine).Additional file 2: Fig. S2. Network characteristics of 5313 associated genes for 29 biochemical indices in individuals from the FAMHES cohort were analysed by Cytoscape. (A) Topological coefficient, (B) degree, (C) clustering coefficient, and (D) closeness centrality.Additional file 3: Fig. S3. The integration of correlated traits from three methods. (A) Venn diagram of the integration of correlated traits from three methods. (B) The related traits were integrated if they fulfilled the following conditions: the Pearson coefficient was greater than 0.3, the P value was less than 0.01, the Jaccard coefficient was greater than 0.6, or the LDSC p value was less than 0.05. Each testing method was denoted by a specific colour: green for Jaccard, and blue for LDSC.Additional file 4: Fig. S4. A lentiviral vector was used to overexpress ALDH2-WT or ALDH2-G504\u2009L-mut in 3\u2009T3-L1 preadipocytes. (A) Localization of the Glu504Lys substitution mutation in ALDH2. Ex: exon. (B) The plasmid used to express the ALDH2-Gluc504Lys mutant protein in 3\u2009T3-L1, ALDH2-WT was expressed using the same plasmid backbone. (C) Sequencing analysis of the ALDH2 gene exogenously expressed in 3\u2009T3-L1 cells infected with ALDH2-WT (top) or ALDH2-G504\u2009L-mut (bottom). (D) Expression of the transfected ALDH2 protein in 3\u2009T3-L1 cells was indirectly assessed by the detection of RFP expression from the lentiviral vector. An RFP signal was detected by fluorescence microscopy at 48\u2009h after infection in both 3\u2009T3-L1 cells infected with ALDH2-WT and ALDH2-G504\u2009L-mut. RFP control means 3\u2009T3-L1 cells infected with plasmid backbone.Additional file 5: Table S1. Information on the 27 clinical quantitative traits from 1999 populations.Additional file 6: Table S2. Genetic correlation estimates, standard errors and P values for selected pairs of traits.Additional file 7: Table S3. The information on essential genes correlated with more than 3 traits.Additional file 8: Table S4. Twenty-nine SNPs (P\u2009<\u20091\u2009\u00d7\u200910\u2212\u20094) related to more than 3 traits were annotated in the HaploReg database.Additional file 9: Table S5. The annotation of 31 (P\u2009<\u20091\u2009\u00d7\u200910\u2212\u20094) SNPs was associated with more than 1 trait.Additional file 10: Table S6. The primer sequences of osteogenic and adipogenic differentiation in 3\u2009T3-L1 cells."}
{"text": "Within the mitotic spindle, kinesin motors cross-link and slide overlapping microtubules. Some of these motors exhibit off-axis power strokes, but their impact on motility and force generation in microtubule overlaps has not been investigated. Here, we develop and utilize a three-dimensional in vitro motility assay to explore kinesin-14, Ncd, driven sliding of cross-linked microtubules. We observe that free microtubules, sliding on suspended microtubules, not only rotate around their own axis but also move around the suspended microtubules with right-handed helical trajectories. Importantly, the associated torque is large enough to cause microtubule twisting and coiling. Further, our technique allows us to measure the in situ spatial extension of the motors between cross-linked microtubules to be about 20\u2009nm. We argue that the capability of microtubule-crosslinking kinesins to cause helical motion of overlapping microtubules around each other allows for flexible filament organization, roadblock circumvention and torque generation in the mitotic spindle. Some kinesins exhibit off-axis power strokes but their impact on motility and force generation in microtubule overlaps has not been investigated so far. Here authors use a 3D in vitro motility assay and find that Ndc\u2019s off-axis motor forces generate torque in antiparallel microtubules which causes microtubule twisting and coiling. However, the spindle is a three-dimensional (3D) structure and interesting mechanical details may emerge in the third dimension, which are not just intuitive extensions of the 2D model. For instance, previous studies have shown that the mitotic spindle is twisted with a distinct left-handed chirality6.The mitotic spindle is a complex subcellular machinery that segregates chromosomes during eukaryotic cell division. Several in vivo and in vitro studies provide us with a consolidated two-dimensional (2D) model, detailing the mechanisms employed by dynamic microtubules, kinesins and microtubule-associated proteins (MAPs) to assemble, maintain and disassemble the spindle in order to coordinate chromosome segregation7, kinesin-89 and kinesin-1411, have been shown to exhibit off-axis components in their stepping behavior, i.e., they do not move strictly parallel to the longitudinal microtubule axis. These mitotic kinesins are microtubule cross-linkers involved in connecting and sliding microtubules14. To address if their off-axis  motion translates to cross-linked microtubules, we explore the 3D motion of microtubules propelled along each other by the kinesin-14. Kinesin-14 is a non-processive, minus-end directed motor with an additional diffusive microtubule-interaction site in its N-terminal tail domain that enables the motor to cross-link and slide antiparallel microtubules12. Specifically, we suspend long microtubules on nano-fabricated ridges15 and track the motion of cross-linked, shorter microtubules along the long ones. Besides being able to measure the in situ spatial extension of the motors between the cross-linked microtubules, we discover that antiparallel microtubules both rotate around their own axis and helically move around each other in a right-handed manner. Importantly, the torque resulting from the underlying off-axis motor forces is large enough to cause microtubule twisting and coiling.Interestingly several mitotic kinesins, like kinesin-5Drosophila melanogaster kinesin-14 motors, Ncd, we suspended parts of long \u201ctemplate\u201d microtubules such that short cross-linked \u201ctransport\u201d microtubules could access the entire lattice of the suspended template microtubules. As illustrated in Fig.\u00a015. Atto647n-labeled transport microtubules were cross-linked to the template microtubules via full length GFP-Ncd (4\u2009nM if not otherwise noted), hereafter referred to as Ncd, in ADP. After the addition of ATP, antiparallel transport microtubules started to slide along the template microtubules while parallel transport microtubules remained locked in their position. To observe the position of the transport microtubules with respect to the template microtubules, the microtubule positions were tracked in 2D individually in the rhodamine and Atto647n fluorescence channels using FIESTA16 and the distance of the center points of the transport microtubules from the tracked center line of the template microtubules, referred to as the sideways distance, were obtained  of the template microtubules and zero when the transport microtubules are on top (or bottom) of the template microtubules.To study the uninhibited sliding motion of cross-linked microtubules driven by ned Fig.\u00a0. Since tN\u2009=\u20097 complete rotations). When the transport microtubule encountered the ridge, its helical motion was blocked without significant impediment to the longitudinal motion, and it stayed at the right-hand side of the template microtubule. The transport microtubule only resumed its helical motion after the entire microtubule (1.8\u2009\u03bcm long) had left the ridge. This indicates that surface immobilization of the template microtubule on the ridge hindered the helical motion of the transport microtubule. Since the helical motion of the transport microtubule on the ridge was locked on the right-hand side of the template microtubule, we infer that the helical motion is right-handed (or clockwise in the direction of motion).To interpret the 3D motion of antiparallel transport microtubules, the sideways distance was plotted with respect to the distance traveled in the longitudinal direction of the template microtubules. Figure\u00a0N\u2009=\u200963). This clearly indicates that the helical motion induced by Ncd is right-handed. Only in a couple of events the transport microtubules moved around the surface-immobilized template microtubules, presumably at locations of statistically low densities of anti-rhodamine antibodies. These observations are consistent with 2D sliding motility assays performed on unstructured glass coverslips  and upon removing the flip events became \u221245.5\u2009\u00b1\u20090.1\u2009nm (N\u2009=\u200983). At low Ncd concentration (0.02\u2009nM), the sideways motion of transport microtubules became erratic. However, there was still a bias to the right-hand side with a mean sideways distance of \u221226.8\u2009\u00b1\u20090.7\u2009nm (N\u2009=\u200924). Parallel transport microtubules (31 events) were found to be locked, both in their longitudinal and axial direction, and did not exhibit any preference for which side of the template microtubule they were bound to  exhibited robust helical trajectories in the valley regions along suspended template microtubules  for all 3D sliding events with at least two complete helical turns. We obtained a mean value of 86.2\u2009\u00b1\u20094.4\u2009nm  is high enough to twist and coil microtubules.Having shown that transport microtubules rotate around their own axis and move helically around the suspended template microtubules, we asked if the underlying off-axis motor forces would generate a torque that was high enough to cause twisting deformations of microtubules. Towards this end, we performed 2D sliding motility assays (Ncd concentration of 4\u2009nM) on unstructured glass surfaces with long transport microtubules and short, surface-immobilized template microtubules. We focused on events, where the leading end of a transport microtubule was locked in a parallel configuration on one template microtubule and the trailing end of the same transport microtubule was sliding in an antiparallel configuration on another template microtubule Fig.\u00a0. We foun20. This also became evident in our experiments where individual transport microtubules could helically move around the suspended parts of template microtubules, but were held on the right-hand side of the surface-immobilized parts of the template microtubules . The vast majority (about 96%21) of these microtubules are expected to comprise 14 protofilaments, which provide a left-handed supertwist of about 8\u2009\u00b5m23. Conceivably, the origin of the right-handed helical motion is related to the off-axis component in the power stroke of Ncd , elucidated in previous studies exploring the rotational motion of microtubules gliding on surface-bound Ncd motors11. However, the geometry in which the motors perform their power strokes is crucially different. In previous studies, motors were bound rigidly to a planar surface . In our current study, microtubules are linked to each other by motors diffusively coupled to one microtubule via their tail domains and interacting with the other microtubule via their motor domains (microtubule\u2013microtubule sliding geometry). Strikingly, in this geometry (where motor force in the forward direction goes down significantly18), transport microtubules still rotate around their own longitudinal axis but additionally also move helically around the template microtubules. For parallel transport microtubules, the motors facing opposite directions between the cross-linked microtubules antagonize each other, locking the microtubules longitudinally as well as axially  where a similar decrease in the sliding velocity was attributed to steric  hindrance between the motors24. At the same time, we observed that the rotational frequency stayed constant upon variation of the motor density  on the total number and length of template microtubules bound to the surfaces, (ii) on the total number and length of transport microtubules in solution, as well as (iii) on the history of events .The sizeable variation in the observed helical pitches and velocities of transport microtubules in the 3D sliding assays cannot be entirely attributed to motor stochasticity as microtubule sliding involves multiple motors. In addition, we did not observe any correlation of the helical pitches and velocities with the lengths of the transport microtubules, suggesting that the absolute number of motors in the overlaps between template and transport microtubules alone does not influence helical pitch or velocity. Because it was difficult to systematically investigate the influence of the motor density in 3D sliding motility assays with suspended microtubules, we employed FLIC-based 2D gliding and sliding motility assays. We found that an increase in the Ncd motor density decreased the microtubule velocity . This may be achieved by numerically analyzing the dynamics of the microtubule shapes in assays similar to the experiments presented here or by extending our assay to enable direct torque measurements, for example by using 3D optical tweezers15. Most importantly, based on our observations we conjecture that Ncd can generate torques, likely high enough to be relevant in vivo, for example in the mitotic spindle.While we showed that Ncd motors in the sliding geometry cause an intricate axial motion of short transport microtubules, it is not evident that the torque generated by the motors is large enough to be important for intracellular, mechanical events. Both on structured and unstructured glass surfaces  while the other one is free  one microtubules is fixed at some point  of different cross-linking motors and MAPs in their active states\u2014in correlation with their functional behavior as generators of longitudinal as well as axial motility and force.In addition to resolving the 3D trajectories of microtubules sliding around each other, our experimental approach provides a compelling means to measure the extension of motors in their active state while cross-linking and sliding microtubules. For Ncd, we find an in situ extension of 18\u201321\u2009nm which is in the same range as estimated in earlier electron-microscopy studies for microtubule cross-linker mixtures in yeast cells, including the homolog kinesin-14, klp27. In microtubule overlaps where kinesin-5 and kinesin-14 co-exist, the two motors antagonize each other in the longitudinal direction25 but the torques generated by them are expected to add up  of the evolutionarily conserved motor domains of kinesin motors or if there is any particular function associated with it.In summary, this study elucidates that Ncd motors induce a helical motion of antiparallelly cross-linked microtubules around each other as well as a rotational motion around their own axis. In vivo, such motion (as opposed to a strict linear motion) might be useful to circumnavigate obstacles on microtubule lattices or in the surrounding environment. While minus-end directed kinesin-14 induces a right-handed rotational motion, other plus-end directed cross-linking kinesins, like kinesin-5, have been shown to induce left-handed rotational motion up Fig.\u00a0. Therefo6-tagged D. melanogaster full length GFP-Ncd expressed in SF9 insect cells (cell line IPLB-Sf-21-AE) using a baculovirus expression system36. Cells were lysed in 25\u2009mM Tris, 300\u2009mM NaCl, 5\u2009mM imidazole, 5\u2009mM MgCl2, 0.2% (v/v) Tween-20, 10% (v/v) glycerol, 1\u00d7 protease inhibitor cocktail, 10\u2009mM dithiothreitol (DTT), 1\u2009mM ATP, pH 7.4 and proteins were bound to Ni-NTA resin. Proteins were eluted by cleavage of the His6-tag with His-tagged PreScission protease18. For FLIC-based sliding motility assays, a different batch of full length GFP-Ncd expressed in Escherichia coli a was used12. Cells were lysed \u00a0Tween-20, 300\u2009mM NaCl, 20\u2009mM imidazole, 1\u00d7 protease inhibitor cocktail, pH 7.2 and proteins were bound to a Talon cobalt-affinity resin. After elution with 300\u2009mM imidazole, proteins were further purified with size exclusion chromatography.Most experiments were performed with recombinant His2 glass coverslips  were imprinted with a UV curable resin, EVG NIL UV/A 200\u2009nm (EV Group) using UV nanoimprint lithography (UV-NIL) as described in Mitra et al.9. The structure imprinted on the glass coverslips was characterized by repeated pattern of relief lines (that form the ridges) with a height of 370\u2009nm  and a width of 2\u2009\u03bcm (or 5\u2009\u03bcm), separated by 10\u2009\u03bcm wide valleys between the ridges.Cleaned 22\u2009\u00d7\u200922\u2009mm\u03b1,\u03b2)-methylene-diphosphonate (GMP-CPP) grown, taxol-stabilized (referred to as double stabilized). Template microtubules were long (average length\u2009>\u200915\u2009\u03bcm) and rhodamine-labeled, while transport microtubules were short (average length 1\u20132\u2009\u03bcm) and Atto647n-labeled. Totally, 4.6\u2009\u03bcM rhodamine-labeled porcine tubulin was added to a polymerization solution, comprising of BRB80  supplemented with 1\u2009mM GMP-CPP  and 4\u2009mM MgCl2, incubated on ice for 5\u2009min followed by 30\u2009min at 37\u2009\u00b0C, to grow short microtubule seeds. The solution was centrifuged at 17,000\u00d7g for 15\u2009min at 25\u2009\u00b0C to remove free tubulin and the pellet was resuspended in a new polymerization solution supplemented with 0.4\u2009\u03bcM of rhodamine-labeled tubulin. This solution was incubated overnight at 37\u2009\u00b0C with low tubulin concentration allowing microtubule seeds to anneal and form long microtubules. The solution was then centrifuged at 17,000\u00d7g for 15\u2009min at 25\u2009\u00b0C and the pellet was resuspended in BRB80T solution (BRB80 supplemented with 10\u2009\u03bcM taxol). Transport microtubules were grown as short Atto647n-labeled microtubule seeds in the same way as described for the first cycle of polymerization for template microtubules.Both, template and transport microtubules, were guanylyl-(17) were used. For the FLIC-based gliding motility assays, rhodamine-speckled microtubules were used.For the FLIC-based sliding motility assays, Cy5-labeled template microtubules (grown as described above) and rhodamine-speckled transport microtubule . Microtubules were sedimented as described above, resuspended in BRB80T and allowed to anneal for 48\u2009h.For the microtubule coiling assays, taxol-stabilized Atto647n-labeled transport microtubules were grown at 37\u2009\u00b0C for 2.5\u2009h in BRB80 supplemented with 30\u2009\u00b5M Atto647n-labeled tubulin, 4.8% (v/v) dimethyl sulfoxide, 4\u2009mM MgCl2, 75\u2009mM KCl, 10\u2009\u00b5M taxol, 200\u2009\u00b5g\u2009mL\u22121 casein, 10\u2009mM DTT, 0.1% (v/v)\u00a0Tween-20, 20\u2009mM d-glucose, 100\u2009\u00b5g\u2009mL\u22121 glucose oxidase, 10\u2009\u00b5g\u2009mL\u22121 catalase and either 1\u2009mM ATP (MB-ATP) or 1\u2009mM ADP (MB-ADP). 3D sliding motility assays on suspended template microtubule were performed in microfluidic flow cells constructed on 22\u2009\u00d7\u200922\u2009mm2 glass coverslips patterned with UV-NIL polymer resin and 18\u2009\u00d7\u200918\u2009mm2 unpatterned glass coverslips, both dichlorodimethylsilane (DDS)-coated to make the surface hydrophobic37. Before silanization, the patterned coverslips were cleaned mildly (using 5% mucasol and then 70% ethanol) to avoid corrosion of the structure. 2D sliding motility assays on surface-immobilized microtubules were performed on unpatterned silanized coverslips or silicon wafers (10\u2009\u00d7\u200910\u2009mm2) with a 30\u2009nm thermally grown oxide layer . In both, 2D and 3D sliding assays, flow cells were flushed with the following sequence of solutions: (i) Bead solution consisting of 2% (v/v)\u00a0200\u2009nm Tetraspeck beads . (ii) Antibody solution consisting of 20\u2013200\u2009\u00b5g\u2009mL\u22121 anti-rhodamine antibody  in phosphate-buffered saline (PBS) for unspecific binding of antibodies to the surface (incubation time 5\u2009min). (iii) 1% pluronic F-127 in PBS (Sigma) in order to block the surface from unspecific protein adsorption (incubation time >60\u2009min). (iv) BRB80 washing step to remove unbound F-127 and exchange buffers. (v) Rhodamine-labeled template microtubule solution in BRB80T, followed by an immediate washing step with MB, in order to immobilize microtubules perpendicular to the ridges. (vi) MB-ADP solution containing Ncd (concentration ranging between 0.02 and 40\u2009nM) for the motors to bind to the template microtubules. (vii) MB-ADP solution containing Atto647n-labeled transport microtubules, followed by immediate washing step with MB-ADP, in order to cross-link few transport microtubules to the template microtubules and wash away the unbound ones. (viii) MB-ATP solution at the microscope after finding a suitable field of view. For FLIC-based sliding motility assays, Cy5-labeled template microtubules were immobilized on the surface using anti-Cy5 antibodies  and rhodamine-speckled transport microtubules were used.Motility buffer (MB), used in all motility assays, consisted of 20\u2009mM Hepes at pH 7.2, 1\u2009mM EGTA, 2\u2009mM MgCl17 with replacement of BRB80 based motility buffer with MB-ATP.For 2D FLIC-based gliding motility assays on Fab-fragment  and mouse anti-GFP antibody-coated surfaces , the assay was performed in flow cells constructed from DDS-coated silicon wafers and glass coverslips as described in Mitra et al.38. For sliding motility assays, a field of view was selected when there were three (or more) Tetraspeck beads bound to the surface and several trackable template microtubules suspended between ridges. Template microtubules were imaged in the TRITC channel (for 50\u2013100 frames at 3\u201310\u2009fps with exposure time 100\u2013300\u2009ms) before and after imaging the transport microtubules in the Atto647n channel (for 5\u201315\u2009min at 3\u201310\u2009fps with exposure time 100\u2013300\u2009ms) to confirm that the template microtubules do not move while imaging the transport microtubules. For FLIC-based motility assays, a 63\u00d7 water immersion 1.2NA objective (Zeiss) was used (higher working distance) in order to image rhodamine-speckled microtubule (for 5\u201315\u2009min at 1 fps in the TRITC channel with exposure time 400\u2009ms) on the silicon wafer surfaces on the far side of the flow cells.Optical imaging was performed using an inverted fluorescence microscope  with a 63\u00d7 oil immersion 1.46NA objective (Zeiss) in combination with an EMCDD camera  controlled by Metamorph (Molecular Devices Corporation). A LED white light lamp  in combination with a TRITC filterset  and an Atto647n filterset , corresponding to rhodamine-labeled microtubules and Atto647n/Cy5-labeled microtubules, respectively, were used for epifluorescence imaging. The imaging temperature was maintained at 24\u2009\u00b0C by fitting a custom-made hollow brass ring around the body of the objective and connecting it to a water bath with a cooling/heating unit 16 (version 1.6.0). First, the Tetraspeck beads, that serve as fiducial markers, were tracked in both channels to obtain the color offset correction  between the two channels as well as the image drift correction in the corresponding channels. Template microtubules with relevant sliding events were tracked. Since template microtubules were immobilized, the filament position (tracked over 50\u2013100 frames) was averaged to obtain the filament position. Sliding transport microtubules  and locked transport microtubules  on template microtubules with sliding events (to know the microtubule orientation) were tracked. After color and drift correction, the sideways distance was obtained as the perpendicular distance of the center point of the tracked transport microtubule from the averaged center line (tracked over the recorded 50\u2013100 frames) corresponding to the template microtubule  and sliding transport microtubules (Atto647n channel) were analyzed using FIESTARotational pitch, end-to-end velocity and the diameter of the helical path corresponding to each rotation of a helical sliding event was determined by manual computer-aided measurement of the sideways distance versus forward distance plots. For a given sliding event, measurements from individual rotations were averaged to obtain the mean pitch, velocity and diameter of helical path. Accounting for the helicity of the path traversed by the sliding microtubule, the actual velocity along the path . The kymographs were then analyzed with MATLAB  using the speckle analysis method17.The rotational pitch of the gliding or sliding microtubules in the FLIC-based motility assays was obtained from their kymographs, which were generated in Fiji41. Here, the distribution (N number of measurements) was resampled by randomly picking N measurements from the measured distribution (with replacement) and calculating the median of the resampled distribution. This was repeated 1000 times. The resulting bootstrapping distribution was used to estimate the parameter (mean of the bootstrapping distribution \u03bc) and its error (standard deviation of the bootstrapping distribution \u03c3). All values and errors as well as error bars in this paper use \u03bc\u2009\u00b1\u20093\u03c3 , unless otherwise noted.For estimating parameters from any given distribution  we used a bootstrapping approachData for the microtubule coiling experiments were acquired from five independent experiments. Data for all other experiments were acquired during at least three independent experimental days, performed over several months.In boxplots Fig.\u00a0 midline Supplementary InformationPeer Review FileDescription of Additional Supplementary FilesSupplementary Movie 1Supplementary Movie 2Supplementary Movie 3Supplementary Movie 4Reporting\u00a0Summary"}
{"text": "In view of the deficiency of the split grouting theory for the filling area, a 3D simulated grouting test system was designed to explore the slurry diffusion law, reinforcement mechanism of split grouting in a filling soil, and effect of grouting reinforcement. The test system included an experiment bench system, grouting system, and information monitoring system, using which experimental research on split grouting in a filling soil was conducted. The grouting model experiment procedure was introduced first, following which the diffusion rule of slurry in the filling medium and the reinforcement mechanism of split grouting were analyzed according to the properties and distribution characteristics of grouting veins after grouting reinforcement. Finally, a uniaxial compression test, light dynamic contact test, permeability test, and laboratory geotechnical test were conducted on the soil before and after grouting. The relationship between the zoning characteristics of different properties of veins and the mechanical properties of filling soil were discussed. The results showed that there were three types of grouting veins: trunk grouting, branch grouting, and permeable grouting. The injected soil body was strengthened by the three-stage grouting vein network of the mentioned vein types and the compaction between soils. After the grouting, the uniaxial compressive strength of the filling soil increased by an average of 186%, and the permeability coefficient decreased by an average of 47 times. The cohesion and internal friction angle increased by 45.3% and 44.9%, respectively. Additionally, density, water content, and other indicators of filling were improved. The bearing characteristics reflected by a dynamic contact test were consistent with the distribution of grouting veins. The research results offer significant guidance for the reinforcement mechanism of split grouting and the evaluation of the grouting effect. Grouting reinforcement technology manipulates slurry penetration, compaction, and splitting into rock cracks or soil layers. Soil with cracks and a loose structure is consolidated, forming a certain strength or impermeability of the \u201cstone body\u201d . GroutinAt present, many scholars have done substantial research on grouting reinforcement mechanisms . In termIn terms of experimental research, Li et al.  carried However, in the above studies, other scholars have only studied the slurry diffusion rules from the theoretical perspective or carried out laboratory model tests on sand or clay. Owing to the particularity of grouting engineering, the randomness and uncertainty of the grouting process was ignored when only theoretical derivation and numerical simulation were used. In addition, many assumptions were needed, so it was difficult to truly reflect the grout diffusion law and reinforcement mechanism of compaction grouting and splitting grouting ,17. FurtIn addition, inaccurate evaluation of the grouting effect can lead to serious safety accidents, making reasonable evaluation of the grouting effect a major problem after the grouting . At presIn summary, to investigate the slurry diffusion law and reinforcement mechanism under the condition of split grouting in the filling area and to better evaluate the effect of grouting reinforcement, a 3D grouting model test system was developed. A model test was conducted with excavated filling under the surface of the construction site of a project in Changsha, Hunan Province, China. The distribution characteristics of slurry veins were obtained, and the diffusion law and reinforcement mechanism of grouting in filling soil were studied. Through a uniaxial compression test, light dynamic penetration test, and indoor penetration test of the reinforcement bodies in different reinforcement areas after grouting, the grouting effect of the filling soil was tested. On the basis of the weighted average method, the overall improvement of filling soil performance was obtained. This study can truly reflect the process of the split grouting of the filling medium and summarize its reinforcement mechanism and performance improvement. This study offers inspiration and reference to practitioners who wish to conduct similar experiments related to the design and construction of split grouting in the fill area.In view of the weak bearing capacity of the foundation and the poor effect of grouting reinforcement in the filling area, a 3D grouting model test system was designed to explore the slurry diffusion law and reinforcement characteristics under the condition of the split grouting of filling soil. The system can simulate the compaction grouting and splitting grouting of various soils. After the grouting, the injected medium was excavated to obtain the distribution characteristics of grouting veins, and then the slurry diffusion law and reinforcement mechanism were revealed. As the grouting process is unable to be viewed to completion in engineering applications, it is difficult to directly judge whether the grouting effect meets the needs of the project. The indoor model test can not only reflect the splitting grouting process of the filling medium, but also facilitate the sampling of the filling soil after the grouting. The in situ and indoor tests of the filled soil before and after grouting were carried out, and the test results were compared and analyzed. Combined with the characteristics of the exposed pulping veins, the improvement effect of split grouting on soil filling performance can be analyzed qualitatively and quantitatively. The structure diagram of the test system is shown in To facilitate installation, disassembly, observation, and sampling, a layered combination method was used to design the model test bench. Its structural diagram and schematic diagram are shown in The grouting system mainly included the grouting pump and grouting material. The grouting pump consisted of a ZB-HG-60/8 double-fluid grouting machine with a rated flow of 60 L/min and a rated pressure of 8 MPa. The rate of grouting could be controlled by adjusting the expansion and contraction frequency of the cylinder piston. The grouting material was cement\u2013sodium silicate (C\u2013S) slurry commonly used in engineering. The cement was P.O42.5 ordinary Portland cement purchased from Hunan Kangda company, and the sodium silicate was ordinary sodium silicate solution from Hunan Hetang chemical company, with a modulus of 3.2 and a concentration of 25\u00b0Be. Before grouting, the cement slurry and sodium silicate solution were stored in the slurry storage bucket. In addition, the grouting system also included a mud mixer, sieve , transparent pulp suction pipe, high-pressure pipe, and grouting steel pipe , among others. Under the grouting pressure, the slurry was injected into the soil layer through the bottom of the grouting pipe, as shown in The monitoring system included both image acquisition and data acquisition. The data acquisition portion was composed of a CJ-G3P grouting recorder, supporting a PCM400 pressure sensor, JDK-300 electromagnetic flowmeter, and computer. The experimental results were recorded via an HD camera to provide a guarantee for the smooth progress of the test. In the experiment, the electromagnetic flowmeter was connected to the grouting line after the grouting pump in series. Both ends of the flowmeter were connected to the grouting line with matching flanges and steel pipes. The direction of the arrow on the electromagnetic flowmeter must be consistent with the direction of the slurry flow. When grouting, the grouting recorder was connected to the interface corresponding to the electromagnetic flowmeter, and the power line was connected to intervene the 220 V alternating current. During the grouting process, the grouting recorder\u2019s pressure sensor automatically acquired the grouting pressure, flow, as well as process parameters such as density, grouting quantity, and the electrical signal. The collected data were displayed on the recorder and eventually routed to an external computer and printed out. The element of the pressure transmitter was a resistance strain gauge. The detection system was composed of a light dynamic penetrator , soil sampler, standard ring cutter, universal testing machine, and TST-55 penetrator. They were used to detect the differences in the physical and mechanical properties of the soil before and after grouting. The information monitoring equipment is shown in (1)The spatial distribution characteristics of grouting veins along the direction of slurry migration under the condition of split grouting in filling medium were obtained, and the reinforcement mechanism of split grouting was discussed.(2)The physical and mechanical parameters, bearing capacity, and permeability coefficient of the injected medium before and after grouting were tested, and the improvement effect of splitting grouting on the filling strength was comprehensively evaluated.The grouting material adopted the C\u2013S double slurry commonly used in engineering. The cement is P.O42.5 ordinary Portland cement. The cement slurry water\u2013cement ratio was m(W)/m(C) = 1:1. The sodium silicate solution used was of module 3.2 and concentration 25\u00b0Be. The volume ratio of the double slurry is V(C)/V(S) = 2:1.The soil used in the experiment was plain fill with a uniform texture, which was located 1\u20133 m below the construction site surface in the town of Datuo, Changsha city, Hunan province, China. The basic parameters of the soil are listed in The nonuniform coefficient of soil Carry out simple sieving of the filling soil retrieved from the construction site. Remove the large particles of stones, plants, and garbage; then, mix the soil to make it uniform in texture, and take soil samples at random to determine its particle size distribution.Connect the pieces of equipment into a whole system as shown in The filling process is carried out in layers, with the filling height of each layer not exceeding 0.3 m. After reserving a gap in the grouting pipe, the soil is shoveled into the model cavity, and the soil is evenly tamped from the center outwards with the tamping machine. Then, the soil samples of each layer are collected randomly at four locations with a standard ring cutter to test their compactness. Ensure a soil sample density difference of less than 10%. At the same time, the average density error of the soil samples in different layers should be less than 10%. If it fails to meet the requirements, the soil should be rammed again. After meeting the requirements, the next layer of soil should be filled and rammed until the four layers of soil with a total height of 1.2 m are filled.Carry out light dynamic preliminary tests on the soil before grouting; the test points should be evenly and randomly distributed. Record the times that the hammer falls when the penetration instrument enters 300 mm into the soil . After the light dynamic penetration test is completed, the orifices generated during the test should be backfilled and compacted.Prepare the cement slurry and sodium silicate solution. The water\u2013cement ratio of the cement slurry should be 1:1; the same quality of water and cement should be mixed evenly through a 5 mm sieve into the slurry bucket. The sodium silicate solution is to be prepared as 25\u00b0Be and stored in another slurry bucket.Conduct pre-grouting. A hole with a diameter of 70 mm and a depth of 1 m is drilled using a hydro-electric drill on the flat ground near the testbed. Lower the 1 m long grouting pipe for pre-grouting to ensure the normal use of the pressure gauge, flow meter, and grouting system. Clean the grouting pipe after the completion of pre-grouting. A 61.8 mm diameter sampler is used to sample in the center of the model barrel with a total sampling depth of 1050 mm. Then laboratory tests are carried out on the soil samples to determine their density, water content, permeability coefficient, shear strength, and compressive strength.Conduct grouting. Before the grouting, drain the water from the pipeline. When thick slurry appears at the pressure relief hole, close the pressure relief hole, and then start grouting and observe the changes of the injected soil surface, slurry flow, grouting pressure, and other parameters.Seven days after the grouting, a light dynamic preliminary test should be conducted again at the corresponding position.Remove the shell of the test cavity, excavate the reinforced soil layer by layer from top to bottom, and observe the properties and distribution of grouting veins. Soil samples should be collected in different grouting areas, with no less than six samples in each area; then, the soil density test, water content test, permeability test, direct shear test, and uniaxial compression test should be carried out.The experiment flow chart is shown in A single-pipe/single-hole grouting method was adopted in the experiment. The grouting pressure range was 0\u20130.5 MPa, and the grouting rate was 0\u201310 L/min. Take the grouting volume of 100 kg as the control standard for the end of the experiment. During the grouting process, the grouting should be stopped when the slurry appears on the top surface of the injected soil or the pressure exceeds 1 MPa.The experimental results were analyzed from two aspects: the properties and the distribution characteristics of grouting veins and the reinforcement effect of split grouting. After the excavation of the injected soil, it was found that the slurry was mainly retained and distributed in the form of veins and slurry soil combination. The diffusion rule and reinforcement mechanism of split grouting slurry in the filling medium were studied by analyzing the properties and distribution characteristics of the slurry veins. In the evaluation of the grouting reinforcement effect, the uniaxial compression test, light dynamic touchdown test, indoor geotechnical test, and permeability test were carried out to compare and analyze the physical and mechanical properties of the injected soil before and after grouting. The improvement of the filling performance of the split grouting was obtained, and the experimental results were systematically analyzed from both qualitative and quantitative perspectives.The distribution of exposed veins is shown in The trunk grouting veins were generally distributed in a horizontal plate-shape, with the grouting hole as the center. The grouting veins continued to expand further along the direction of slurry migration, forming a planar plate-shaped structure with varying thickness. The thickness of the grouting veins near the grouting hole was larger, and the thickness of the grouting veins decreased gradually as they expand further outward. In general, the trunk grouting veins of the first layer did not run through the entire filling layer, while the second and third slurry veins did run through the entire filling layer, which extended to the lateral wall of the model cavity. The planar distribution of trunk grouting veins is shown in Between the trunk grouting veins, the intersecting branch grouting veins extend to form an intersecting network. After the trunk splitting cracks were formed, the slurry was injected into the cracks and the surrounding soil was compressed. As a result, the soil around the trunk veins was continuously compressed and its strength increased. As the pressure continued to increase, splitting would occur again on the surface of least resistance. In general, the second split plane would be perpendicular to the first split plane. With the grouting, the subsequent split plane would continue to be generated on the weak surface in the soil, and would eventually form crisscrossed branch veins that would envelop the filling structure. The branch grouting veins embedded in the filling played the role of anchorage, which was mainly distributed near the grouting hole. As shown in For the permeable filling areas, the slurry penetrated the filling pores and continuously compacted the pores, so the physical and mechanical properties of the soil body were improved. The slurry appeared as irregular and discontinuous fine grouting veins, which were mainly positioned away from the grouting hole and the trunk grouting veins, near the top and bottom of the model cavity. These tiny grouting veins were less dense and lighter in color. Compared with branch grouting veins, their size and width were smaller, in the range of 0.5\u20132 mm, as shown in From the characteristics and distribution of the grouting veins, the reinforcement effect of split grouting on the filling was mainly reflected in two aspects. On one hand, the trunk grouting veins replaced the filling in corresponding parts, playing the role of a supporting skeleton of the injected medium. The cross of the branch grouting veins formed a network structure, which acted as a type of reinforcement for the soil, and the branch grouting veins were embedded into the filling to play the role of anchoring. On the other hand, the slurry had significant compaction and permeation effects on the filling. The expansion of the slurry splitting channel forced the pore water pressure in the surrounding soil to rise. After grouting, the pore pressure would gradually dissipate, effective stress would increase, soil would be consolidated and compacted, and shear strength of the soil would increase accordingly.According to the distribution of grouting veins after the grouting, in order to simplify the calculation, the thickness of the trunk grouting veins was assumed to be unchanged along the expansion direction, and the areas between the trunk grouting veins were all assumed to be branch grouting veins, while the other areas were considered to be the permeable filling areas. The distribution law of the filled soil slurry veins after excavation was observed, and the map of the filled soil partition was created with the same scale, as shown in The compressive strength test of the filling samples was carried out, and the grouting stone body was cured for seven days at room temperature. A uniaxial compression test of the samples in each partition was conducted with the CB-WAW-1000 universal testing machine. Then, the equivalent elastic modulus of the injected soil was determined by the coefficient weighted average of the volume of each grouting reinforcement area in the whole fill volume. The uniaxial compressive strength test results of the filling samples are listed in The average compression modulus of the grouting reinforcement range is as follows:According to Equations (3) and (4), the average compressive strength of the filling before grouting reinforcement was 6.65 MPa, and the average compressive strength of the trunk grouting vein area after grouting was 35.58 MPa; this indicates an increase of 431% after grouting reinforcement. The average compressive strength of the branch grouting vein reinforcement area was 23.18 MPa, which was 248% higher than that of the area before reinforcement. The average compressive strength of the permeable filling area was 10.7 MPa and the equivalent elastic modulus of the injected soil was 19.02 MPa, which were 61% and 186% higher than that of the area before grouting, respectively. This indicated that the three-stage grouting vein network of trunk vein-branch, vein-permeable filling veins could significantly improve the strength of the injected soil.The in situ test could well reflect the true stress\u2013strain state of the soil under undisturbed conditions. The research used a light dynamic preliminary test to quantitatively understand the change of mechanical properties of the soil before grouting. Before and after grouting, six points were selected for the dynamic penetration test. The arrangement of penetration points is shown in The physical and mechanical parameters of soil samples from different areas before and after grouting were measured via indoor geotechnical tests, as shown in The permeability coefficient of soil samples was measured by a TST-55 permeameter. To avoid disturbance, a large block was cut out first during sampling; then, a cutting tool was used to cut along the edge of the ring knife. After the ring knife was embedded in the sample, the sample was truncated and leveled with the top and bottom of the ring tool as the boundary. The sample was put into the sleeve of the permeameter, and molten wax was poured into the gap between the sample and the sleeve. After the wax liquid condensed, the sample and sleeve were placed on the base for the penetration test. As the grouting veins of different characters were distributed roughly in layers in the filling after grouting, the permeability coefficient of the filling was also expected to show obvious stratification characteristics. When Darcy\u2019s law was used to calculate the permeability coefficient of the injected soil within the grouting range, the permeability coefficient in the horizontal direction and vertical direction was calculated separately. The calculation model is shown in According to the principle of seepage mechanics, the equivalent permeability coefficient of a layered foundation along the direction of parallel planes The equivalent permeability coefficients in the horizontal and vertical directions of the injected soil were calculated according to Equations (5) and (6), respectively. The results showed that A model experiment system for simulating split grouting in filling soil was developed. The equipment could also meet the splitting grouting process of other soils and can be easily disassembled to support the observation and sampling analysis of the excavation of the grouting reinforcement body.In the experiment, three types of grouting veins were formed by the split grouting of filling soil, namely, trunk grouting veins, branch grouting veins, and permeable filling grouting veins. The trunk grouting veins were centered on the grouting holes and distributed in a roughly horizontal plate shape. The intersecting branch grouting veins extended between the trunk grouting veins, and the penetration filling phenomenon occurred in the area away from the grouting hole and trunk grouting vein. The thickness of grouting veins near the grouting hole was larger and gradually decreased as it expanded further.The filling soil was strengthened by the three-stage grouting vein network of trunk vein-branch, vein-permeation filling veins, and the compaction between soils, in which the trunk grouting veins contribute significantly towards strength improvement.The results of the uniaxial compression test, dynamic preliminary test, and indoor geotechnical test showed that the equivalent compressive strength of filling increased by 186%; equivalent cohesion and internal friction angle increased by 45.3% and 44.9%, respectively; and equivalent permeability coefficient decreased by 47 times. The bearing capacity of the foundation was increased by 2\u20133 times.The filling medium in this study was filling soil below the construction site. Owing to the split grouting in different types of media, the characteristics of the veins, reinforcement effect, and reinforcement mechanism were quite different. Thus, the conclusions obtained in this study could provide a solid reference for the design and theoretical research of grouting reinforcement in the filled soil layer and the detection of grouting effect. The applicability of other types of soil is still uncertain, and relevant research on other types of soil will be carried out in the future.Grouting technology is a changing and complex process, and model tests are an effective means to study the grouting reinforcement law and mechanism. This study introduced in detail the experimental process of simulated filling splitting grouting in the laboratory, and the grouting effect detection and evaluation methods were also provided. Tests of the soil filling performance after grouting were conducted. The following conclusions were drawn:"}
{"text": "This study aimed to identify factors associated with health-related quality of life (HRQoL) and the burden on the relatives of older people with multi-morbidity.A secondary analysis of baseline data from 296 dyads, including older patients with multimorbidity and their relatives, which were previously collected in a randomized study.The analysis was conducted to select correlated independent variables to enter a final linear regression analysis of two models with different endpoints: the relatives\u2019 HRQoL (EQ5D index) and burden .Sixteen variables correlated with the relatives\u2019 HRQoL, and 15 with the relatives\u2019 burden. Both the HRQoL and burden correlated with both patient and relative variables. A high HRQoL was associated with relatives\u2019 working/studying. A high burden was associated with caring for an older person with changed behaviour. A low burden was associated with the relatives\u2019 high scores on positive values of caring, quality of support and HRQoL.Older persons and their relatives should be considered as a unit in the development of support of older people in order to increase the health and quality of life of both groups. To support and protect relatives from a high burden, potential measures could include improving the relative\u2019s HRQoL and strengthening their ability to find positive values in care and strengthening reliable and good support from others. The relatives\u2019 HRQoL explained the variation in the burden. However, the burden did not explain the variation in the HRQoL, which suggests that the relatives\u2019 HRQoL is not so readily affected by their burden, whereas the relatives\u2019 HRQoL can influence their burden. The variables used in the regression analyses where chosen to reflect important aspects of the relatives\u2019 and older persons\u2019 situations. The final models explained 38% of the variation in the relatives\u2019 burden but only 10% of the variation in their HRQoL. This could be important to consider when choosing outcome assessments in future studies. Relatives play an important role in the caring of older people. A consequence of the increase in the proportion of older people in the global population \u20133 is thaThe question of how to properly assess the situation of the informal carer and the person being cared for concerns not only the design but also the choice of outcome variables that can reveal vital information about the dyadic situation. Burden is a frequently used outcome variable in studies on the relatives of older people. Although burden is an important aspect of caring, it only assesses the situation of relatives and we do not know how it refers to an older person\u2019s situation. However, generic assessments of HRQoL, which are also frequently used, allow comparisons between different groups and interventions despite their different characteristics, and can also be used in cost-effective analyses. Thus, HRQoL has also been suggested as an outcome measure for informal carers in order to aggregate the effect on the HRQoL of both patients and relatives. However, these types of HRQoL assessments are constructed for evaluating interventions for patients. Thus, more research is required on generic HRQoL assessments when used on relatives . We therOur aim was to identify factors associated with HRQoL and with the burden of relatives of older people with multi-morbidity.This study is based on a secondary analysis of existing dyadic baseline data on older patients with multimorbidity and their relatives, previously collected in a randomized controlled study designed to evaluate an ambulatory geriatric unit. Two statistical regression models were developed to examine the explanatory factors for relatives\u2019 perceived A) HRQoL and B) burden.Data were collected in a municipality in South-Eastern Sweden with a combined rural and urban population of approximately 130,000. Most health care was provided at 10 primary centres and one hospital with a total of around 300 beds, 12 specialist departments and 24-h admittance for surgical and medical emergencies. The municipality provided home health and social care when needed. In Sweden, county councils and municipalities are responsible for providing health and social care, funded mainly by income taxes.Inclusion criteria for older people with multi-morbidity were age\u2009\u2265\u200975\u2009years, living in their regular home in a city in South-Eastern Sweden, having at least three concomitant medical diagnoses and having received inpatient hospital care at least three times in the previous 12\u2009months. Out of a random sample of 844 eligible older people, 325 declined to participate, 79 had moved to an institution, 26 had died and 32 were unavailable. The remaining 382 older persons and 296 of their relatives took part in a baseline assessment. There were no additional inclusion or exclusion criteria for the relatives. Thus, the present analysis includes dyadic data from 296 older people with multi-morbidity and 296 relatives who were their closest caring relatives  or took part in a structured telephone interview (50%). The data collectors were trained care professionals but were not engaged in caring for the older participants. Both the older people and their participating relatives were informed of their right to withdraw from the study and were assured that their confidentiality would be maintained.To ensure coverage of important aspects of the caring situation, we consulted previous research to choose appropriate questions, instruments and scales. All the selected instruments and set of questions have been used in other studies of older people and relatives, in both Sweden and in other countries, and have demonstrated proper validity and reliability. Age, sex, civil status, educational level, occupation.-EQ-5D index (Dependent variable in regression model A): Self-reported health status in five domains  and transformed into an index based on the public\u2019s valuation of quality of life related to different health states  .-Negative impact scale in COPE index (Dependent variable in regression model B): A summary of seven questions on: emotional well-being, physical health, overly demanding caring, difficulties in relationships with family, with friends, feeling trapped, financial difficulties\u00a0 .-Hours of care per week provided by the relative of the older person.-Positive value in caring: Positive value scale (4 item) in COPE index: questions on coping with caring, finding caring worthwhile, experiencing a good relationship with the person, cared for, and being appreciated for providing care  .-Attachment security profile: Experiences in close relationships (ECR-16) contains two subscales: Anxiety scale, a measure of fear of rejection and abandonment (8 item) and Avoidance scale, a measure of discomfort with closeness and dependence on close others (8 item),  .-Sense of security in care \u2013 Relatives\u2019 evaluation (SEC-R) contains threes subscales: Care interaction scale (7 item), Mastery scale (5 item), Patient situation scale (5 item)  .-Quality of support scale (4 item) in COPE index: questions on support received from friends and neighbours, from family, and from health and social services, and perceived overall support  .-Relatives\u2019 perceptions of weather the older person has changed behaviour that affects the interaction with the relatives and make them sad or upset: a single question from the EUROFAMCARE Comprehensive Assessment Tool  , based o-Relatives\u2019 expectation of the older person\u2019s future health development over the next year: a single question from the Patient Perspective on Care and Rehabilitation\u00a0Process instrument (POCR)  .Geriatric Depression Scale 15-item (GDS)  .-Sense of security in care \u2013 Patient\u2019 evaluation (SEC-P) contains threes subscales: Care interaction scale (8 item); Identity scale (4 item), Mastery scale (3 item),  .-Quality of support scale (4 item) in COPE index: questions on support received from friends and neighbours, from family, and from health and social services, and perceived overall support  .We conducted uni-, bi- and multivariate analyses, including a commonality analysis, to select unique impacts of correlated independent variables to enter in a final linear regression analysis of two models. The EQ5D\u00a0index was the dependent variable in model A (HRQoL) and the negative impact scale of the COPE index was the dependent variable in model B (burden). We used a Pearson\u2019s correlation in the parametric bivariate analysis for the continuous variables with normal distribution and a non-parametric Spearman\u2019s Rho correlation analysis for the categorical data. Independent variables were selected for use in an initial forward stepwise regression Table\u00a0. VariablAges ranged from 31 to 91\u2009years in the relatives and from 75 to 96\u2009years in the older people. Table p\u2009<\u20090.05) between the two concepts under investigation and other variables. The HRQoL correlated with 16 out of 19 variables and burden with 15 out of 19 variables  by 0.139 on the scale. This variable had a direct influence of 28% on the variance of HRQoL and the whole model explained 10% of the variance in HRQoL when adjusted for multiple variables , positive value in caring (31%), quality of support (17%) and relatives\u2019 HRQoL (11%). When adjusted for multiple variables, the whole model explained 38% of the variance in the burden  and B (burden). Most of the examined variables have significant bivariate associations with HRQoL (16 out of 19) and burden (15 out of 19), and some of them demonstrate the dyadic aspect of caring, such as the older people\u2019s sense of security, perceived quality of support, and mental health. Of the four selected variables in model A, only one \u2013 working/studying \u2013 explained the variation in relatives\u2019 HRQoL, whereas, all four of the four selected variables in model B explained variations in the relatives\u2019 burden: relatives\u2019 perceptions of changed behaviour in the older person, positive value in caring, quality of support and the relatives\u2019 HRQoL.The results indicate that the relatives\u2019 involvement in work or study is associated with a higher HRQoL. Other researchers have found that relatives who can balance work and family life with a caring situation also report higher levels of life satisfaction and well-being . Having The four explanatory factors of burden demonstrate that the relatives\u2019 caring situation is embedded in their total life situation, which also embraces the older persons\u2019 situation. The relatives\u2019 HRQoL is one of the explanatory factors of burden and it shows an association pattern of higher burden \u2013 lower HRQoL, and vice versa. This is a pattern that has been described in other studies on relatives of older people , 5, 30. In our results, caring for an older person with changed behaviour is related to higher burden. This result is in line with other studies on the relatives of persons with cognitive impairment, for example, from dementia or stroke , 32\u201334. When considering ways of improving a relative\u2019s situation, there are important findings to consider, such as the relationship between a lower burden and higher scores on relatives\u2019 positive value in caring and on quality of support. Strengthening family carers\u2019 perceptions of positive values as a coping strategy to decrease their burden and strain has been suggested in other studies , 19, 36.There are some circumstances that may have implications for the interpretations of the results. This study drew on a randomized sample of older people. In order to obtain paired data, only those who were dyads, i.e. older persons who had a participating relative, could be included. However, the relatives in our sample were demographically similar to those in other Swedish studies of the relatives of older people  and, likThe results indicate that older persons and relatives should be considered as a unit in the development of support of older people in order to increase health and quality of life for both, as well as in evaluations. In particular, relatives of older people with multi-morbidity and a deteriorating mental state (depression and changed behaviour) and relatives with a lower HRQoL are at risk of a high burden. In order to support and protect relatives from a high burden, potential measures could be improving relatives\u2019 HRQoL and strengthening their ability to find positive values in care, strengthening reliable and good support from others, as well as strengthening support for the older person. The results call for further investigation of the interplay between the situation of elderly persons and their caring relatives, through dyadic studies.The regression models explained more of the variation in the burden (38%) than in the HRQoL (10%). Consequently, there are aspects other than the variables that were selected in the present analysis that influence a relatives\u2019 situation, particularly their HRQoL. Furthermore, the relatives\u2019 HRQoL explained the variation in the burden, although the burden did not explain the variation in the HRQoL. These findings suggest that the relatives\u2019 HRQoL is not so easily affected by their burden, whereas the relatives\u2019 HRQoL can influence their perceived burden. Our study also highlights the risk that assessments of HRQoL (EQ5D index) can underestimate the effect of the caring situation, particularly on younger carers (who are working), because young people generally have better health that can mask the effects more readily seen in older carers. This highlights the need for HRQoL instruments that also capture social interaction as this has shown to be an important aspect of being a relative caring for a family member, as well as being an older person in need of support from others. These results should be considered when deciding on interventions and choosing outcome assessments in future studies on the relatives\u2019 of older people with multi-morbidity."}
{"text": "Despite global efforts, stunting remains a public health problem in several developing countries. The prevalence of stunting among 0- to 5-year-old children in Armenia has increased from 17% in 2000 to 19% in 2010. A baseline study was conducted among preschool children in Berd, a region near the northeastern border of Armenia that has experienced intermittent military tension for over 20\u00a0years.We conducted a cross-sectional study including 594 children aged 6-month- 6\u00a0years old and their caregivers in our analysis, to assess the prevalence and determinants of stunting. We calculated the anthropometric measurements and hemoglobin levels of children; analyzed children\u2019s stool and conducted a survey with children\u2019s caregivers. We employed the hierarchical logistic regression model to explore the predictors of stunting among 25\u201372\u00a0months old children and multivariable logistic regression models to investigate the predictors of stunting among 6\u201324\u00a0months old children. Individual and residence level variables were included in the models including anemia, minimum dietary diversity, mothers\u2019 height, the overall duration of breastfeeding, birthweight, child\u2019s history of diarrhea and mean socio-economic score.p\u2009<\u20090.05). Each kilogram increase in birthweight was associated with 76% lower odds of being stunted . Mother\u2019s height significantly decreased the odds of stunting among the children 25\u201372- months old . BMI was also a significant predictor of stunting among both age-groups.The prevalence of stunting was significantly higher among the 6\u201324\u00a0months old children (13.3%) compared to the children aged 25\u201372\u00a0months old (7.8%). We did not find any differences in the prevalence of stunting by place of residence in either age group. The 6\u201324\u00a0months old children who consumed at least four food groups during the previous day (minimum dietary diversity) had 72% lower odds of being stunted (The study results highlight the significance of mother\u2019s height, birthweight, and adequate complementary feeding to reduce stunting. Further studies are needed to determine the possible association of anemia and stunting with the ongoing conflict in the region, as well as socioeconomic conditions and food insecurity in the region. Several studies have found that protracted conflicts have an adverse impact on health \u20133. CurreAccording to the World Health Organization (WHO), 54% of all child deaths are associated with undernutrition . DespiteSeveral factors influence stunting, including the socioeconomic status of the household, parents\u2019 education, anemia, soil-transmitted helminths (STH) infections, diarrheal infections, dietary intake and complementary feeding \u201322. ShorIn a study conducted in Sri Lanka, maternal height was inversely related to the prevalence of stunting . Low birThere are limited data regarding infant and child nutrition status in the Republic of Armenia. The Armenian Demographic and Health Survey (ADHS), conducted every 5\u00a0years, is the primary source of information regarding nutrition and child growth patterns. According to the 2010 ADHS, the prevalence of stunting among 0- to 5-year-old children increased to 19% from 17% in 2000 . A recenAccording to the ADHS, the prevalence of stunting in 2010 was 16.1% in the Tavush province \u201333, resuThe growing trend of stunting in Armenia necessitates a thorough investigation to understand its risk factors to inform policies and interventions to reverse the trend. Although the determinants of stunting have been well investigated in several studies, the specific precursors of stunting might vary among different countries and regions . This diThe main aim of this study was to determine the prevalence and determinants of stunting among preschool children in Berd city and its seven surrounding rural communities, a vulnerable border region in the Tavush province in the Republic of Armenia, which is itself a low-middle income country. We specifically explored if there are significant differences in the prevalence of stunting among the children 6\u201324\u00a0months and 25\u201372\u00a0months old. We also examined if the prevalence of stunting in each age group was different by place of residence. We further investigated the influence of anemia, soil-transmitted helminths, feeding practices, dietary intake, maternal and household characteristics and birth outcomes on stunting among children 6\u201324\u00a0months and 25\u201372\u00a0months old.This cross-sectional study included anthropometric  measurements, blood tests to measure hemoglobin (HgB) levels of 6-month to 6-year-old children, and stool analysis for intestinal STH in 12-months to 6-year-old children. The survey also included a questionnaire for caregivers (mainly mothers) to understand the determinants of malnutrition in the target communities. The study was designed and conducted from September 2013 to March 2014.The study population for the anemia analysis and anthropometric measurements included all 6-month to 6\u00a0year-old children living in the city of Berd and seven surrounding rural communities . The only exclusion criteria were if the child was diagnosed with a blood coagulation or neurological disease; however, no child in our sample met the exclusion criteria.n\u2009=\u2009352). Study participants were chosen from a sample frame consisting of all children living in Berd city, as registered in the Tavush province\u2019s administrative records. The children from Berd were selected based on a stratified random sampling strategy. We chose age groups (year) as the strata. The number of the samples within each age group (stratum) were calculated separately based on n\u2009=\u2009491).A representative sample of children from Berd city aged 6\u00a0months to 6\u00a0years old was randomly selected to participate in the study  were trained in the study protocols and assigned as study coordinators in their regions. The adherence to study protocols by coordinators and staff was monitored through frequent spot-checks. The anthropometric measurements, blood and stool analysis, and surveys with the parents/caregivers took place in the primary healthcare facilities in Berd and the local rural communities. The study coordinators obtained a written informed consent from the caregivers of all participants. After collecting the child\u2019s anthropometric measurements, the caregiver participated in a survey administered by the physician or nurse. The survey questionnaire included questions about maternal and child characteristics, infant feeding practices, birth outcomes and child\u2019s dietary intake, measured by 24-h recall.The HgB levels of the children were measured using HemoCue\u00ae HB 301, a U.S. Food and Drug Administration (FDA)-approved device designed for quick analysis of HgB in capillary, venous, or arterial blood \u201341. As rAscaris lumbricoides, and Trichuris trichiura, in stool samples [The Kato-Katz method was used to perform the stool analyses . This te samples . We provWe adapted the WHO, and UNICEF Infant and Young Child Feeding (IYCF) practices questionnaire to assess feeding practices as well as maternal and child characteristics in the target region , 44. TheChildren\u2019s weight was measured using electronic scales. The children\u2019s height (length in recumbent status for children younger than 24\u00a0months) was measured with appropriate measuring boards or stadiometers by the trained primary health care providers in the study sites.The primary outcome variable was stunting, analyzed as a dichotomous outcome. Stunting was considered positive for all the children whose height-for-age was below -2SD compared to the median height-for-age of the WHO growth standards .Anemia, one of the explanatory variables, was considered positive for the children with blood HgB levels lower than 110\u00a0g/L. Altitude adjustments were made to the HgB values of the children living in areas more than 1000\u00a0m above sea level . The preThe survey questionnaire administered to caregivers asked about child\u2019s birth weight and birth length; child\u2019s age; any breastfeeding; exclusive breastfeeding; breastfeeding duration; residence; mother\u2019s height; mother\u2019s participation in community training about child nutrition; accessibility of printed materials about child nutrition; any history of prolonged diarrhea or STH reported by the caregiver; and a detailed dietary intake assessment of the child during the last 24\u00a0h.We used a standardized socio-economic score as a composite of (a)mothers\u2019 education; (b) the financial status of the family compared to neighboring households; (c)food insecurity. Further, we calculated the mean socioeconomic status score based on the place of residence. The information about birth weight, birth length and birthdate were confirmed based on administrative records.To assess the effect of conflict on stunting, we created a variable based on the geographical distance from the border and front lines of the conflict zone. The two villages closest to the front line were considered positive for being exposed to violence.Minimum dietary diversity, another explanatory variable, was created based on the scoring system of the WHO and UNICEF indicators  for the The data were double entered using SPSS 21.0 and analyzed using SAS 9.4 statistical software. We calculated frequencies and proportions to describe categorical variables and computed means and standard deviations for continuous variables. We used Chi-Square and ANOVA to assess the intergroup comparison for children 6\u201324\u00a0months and 25\u201372\u00a0months old separately. We further examined whether the association between stunting and main predictor variables was modified by place of residence using Breslow-Day test.p\u2009<\u20090.25 as well as the clinically significant variables to fit the multivariable logistic regression and hierarchical models  and Akaike\u2019s Information Criterion (AIC) we compared the hierarchical models to estimate the predictors of stunting among 25\u201372\u00a0months old children and to examine the improvement in model fit.Model A was the multivariable logistic regression model including all the individual level predictors adjusted by age and gender of the child. Model B was the multilevel logistic regression model assuming variance components (VC) G matrix for all the residence groups and including only the random intercept to estimate the effect of a typical residence place level effect. In model C, we included only the individual level variables to account for the crude effects of these variables in the presence of random intercept. Model D included anemia as another individual level predictor. Subsequently, we included the residence-level mean socio-economic composite score variable in model E to explain the residence level variation in stunting. However, we did not observe a significant association between stunting and the residence level mean socio-economic composite score, and the inclusion of the variable did not improve the model fit. Model F included all the variables in model D, adjusted for age and gender. Finally, model G included all the variables in model E, adjusted for age and gender. We refrained from including random slope since it did not significantly improve the model fit when comparing to model F using LRT test.2. The multivariable logistic regression analysis resulted in six consecutive models. The final model included all the statistically and clinically significant variables that had the highest Hosmer\u2013Lemeshow test score and pseudo R2 to predict the prevalence of stunting. Model A includes crude unadjusted predictors of stunting including birthweight, child\u2019s history of any diarrhea reported by the caregiver, and minimum dietary diversity. Model B included all the individual level variables in model A adjusting for age of the child by months and gender of the child. We included anemia, standardized socio-economic score, and presence of soil-transmitted helminth infection in each of the three consecutive models subsequently. However, including the variables did not contribute to the model fit.The multivariable logistic regression models to estimate the predictors of stunting among 6\u201324\u00a0months old children were tested and compared by the Hosmer\u2013Lemeshow goodness-of-fit test, AIC and LRT and Nagelkerke\u2019s Rn\u2009=\u2009674). We did not include children who were older than 6\u00a0years or younger than 6\u00a0months in the analysis. The final analysis included 594 children and their caregivers after excluding missing observations. Of the total number of children included in the study, 46.52% were girls, and 53.48% were boys; 34.43% were from Berd city, and 65.57% were from the rural communities named in methods above. Most of the caregivers included in the study (61.2%) had at least a high school level of education (\u226510\u00a0years of education). More than 66.22% considered the financial status of their household to be average or above average compared to their neighbors. The prevalence of low birth weight, stunting, and anemia was significantly higher among the children aged 6\u201324\u00a0months compared to the children 25\u201372\u00a0months old. The prevalence of minimum dietary diversity was significantly higher among 25\u201372\u00a0months old compared to the 6\u201324\u00a0months old children. There were no significant differences in the prevalence of STH among younger and older children . However, when this variable was adjusted for age and gender of the child in model B, the effect estimate significance was reduced (OR\u2009=\u20092.83 p\u2009<\u20090.10). In model B, the children who had consumed at least four food groups (minimum dietary diversity) during the previous day of the investigation had significantly lower odds of stunting .As previously described in data management and statistical analysis, we fitted a multivariable logistic regression model among children between 6 and 24\u00a0months to identify the determinants of stunting among this age group (Table\u00a0p\u2009<\u20090.01). BMI also appeared to be a significant predictor of stunting in model B. The odds of stunting increased by 55% with each unit increase in BMI score (OR\u2009=\u20091.55 p\u2009<\u2009001). Finally, with each increasing month of age, the children had higher odds of being stunted . Therefore, significant predictors of stunting in children age 6\u201324\u00a0months were minimum dietary diversity, birthweight, BMI, and age.Also in model B, each kilogram increase in birth weight was associated with 76% lower odds of being stunted  and maternal height appeared to be protective against stunting. The odds of stunting seemed to decrease by 13% with each centimeter increase in maternal height . Finally, with each unit increase in the child\u2019s BMI the odds of stunting were increased by 26%  , the lower the odds of stunting among 6\u201324\u00a0months -old children, which is consistent with the literature , 52\u201354. The association between BMI and stunting among children was one of the novel findings of our study. We found that the odds of stunting increased significantly among children in both age-groups with each unit increase in BMI adjusting for other predictors in our models Tables\u00a0 and 5. TWe found that, with each centimeter increase in the mother\u2019s height, the odds of stunting among all children aged 25\u201372\u00a0months old decreased by 13%. This finding, which is consistent with the literature, indicates the possible role of genetics and the intergenerational effect of malnutrition on the development of stunting , 60.We also found that the odds of stunting among boys were 2.36 times the odds of stunting among girls in the 25\u201372\u00a0months old. Several studies conducted predominantly in Sub-Saharan Africa have found similar results \u201363. ThisThe overall prevalence of anemia was high in our study population. However, anemia was not significantly associated with stunting in univariable and multivariable models among any of the age groups. The prevalence of anemia was significantly higher among the 6\u201324\u00a0months old children compared to 25\u201372\u00a0months old children in both the rural and urban areas. A possible explanation for this finding could be the lower dietary diversity among 6\u201324\u00a0months old children compared to children aged 25\u201372\u00a0months Table\u00a0.A history of long episodes of diarrhea was only associated with stunting among the 6\u201324\u00a0months old children in the multivariable logistic regression. However, the association faded away after adjusting for age and gender and in hierarchical models. In fact, diarrhea was found to be associated with stunting in similar studies \u201369. DuriThe positive effect of overall duration of breastfeeding (months) on the development of stunting among 25\u201372\u00a0months old children, although very small (OR\u2009=\u20091.05), may indicate inadequate complementary feeding, which is also supported by the finding of low minimum dietary diversity. It could also indicate the inadequate frequency of breastfeeding during the day; however, the frequency of breastfeeding was not measured in this study.This is the first study in this restive border region assessing the trends and determinants of stunting. The study included the entire community in the rural areas (census), which indicates that the statistical inferences were accurate for the rural regions and the representative random sample from the Berd region also increases the generalizability of the results. The authors pretested the questionnaire along with study coordinators in the region to minimize the possibility of measurement errors.Nevertheless, there were several limitations in this study. The questionnaire utilized for the survey with mothers lacked questions regarding the water and sanitation situation of the respondents\u2019 households. Although our instrument assessed the diet of the children based on 24-h recall questions, we do not exclude the possibility of recall bias. Recall bias may also have affected responses to other subjective questions like those related to diarrhea and breastfeeding duration. The stool analysis was also only conducted once and not in a modern laboratory. However, this misclassification would be non-differential. We also did not include a separate question to assess the frequency and level of border conflict in each study site in our survey. We did not find a significant association between residence-level mean socioeconomic score and stunting in our hierarchical models. We acknowledge that our questionnaire did not capture accurate information to calculate the socio-economic score for individuals. Only three variables were measuring the socioeconomic status of the study participants\u2019 households. Furthermore, our questionnaire did not assess the family income and father\u2019s occupation accurately, which could help us to determine the family\u2019s socio-economic position better.This study identified several risk factors that are associated with the development of stunting among children in the conflict-ridden border regions of Armenia. Factors such as minimum dietary diversity and history of previous episodes of diarrhea indicate the necessity of adequately feeding children as well as the management of the diarrheal disease. The findings of this study will contribute to the development of appropriate interventions targeting timely complementary feeding in vulnerable regions to reduce stunting. Although anemia was not associated with stunting, the prevalence of anemia was very high among the 6\u201324\u00a0months old children and should be a focus of dietary intake interventions to promote optimal growth patterns among children in the region. Further research should consider a more thorough questionnaire to capture the socioeconomic status of the study participants, to determine the association between anemia and stunting, and to further assess the effect of the ongoing conflict in the region. The findings of this study can inform public health programmers and policymakers to focus on promoting appropriate complementary feeding, dietary diversity, and management of diarrhea for optimal growth among young children in this region."}
{"text": "Insults to the axons in the optic nerve head are the primary cause of loss of retinal ganglion cells (RGCs) in traumatic, ischemic nerve injury or degenerative ocular diseases. The central nervous system\u2013specific leucine\u2010rich repeat protein, LINGO\u20101, negatively regulates axon regeneration and neuronal survival after injury. However, the upstream molecular mechanisms that regulate LINGO\u20101 signaling and contribute to LINGO\u20101\u2013mediated death of RGCs are unclear.The expression of SP1 was profiled in optic nerve crush (ONC)\u2013injured RGCs. LINGO\u20101 level was examined after SP1 overexpression by qRT\u2010PCR. Luciferase assay was used to examine the binding of SP1 to the promoter regions of LINGO\u20101. Primary RGCs from rat retina were isolated by immunopanning and RGCs apoptosis were determined by Tunnel. SP1 and LINGO\u20101 expression was investigated using immunohistochemistry and Western bolting. Neuroprotection was assessed by RGC counts, RNFL thickness, and VEP tests after inhibition of SP1 shRNA.We demonstrate that SP1 was upregulated in ONC\u2010injured RGCs. SP1 was bound to the LINGO\u20101 promoter, which led to increased expression of LINGO\u20101. Treatment with recombinant Nogo\u201066 or LINGO\u20101 promoted apoptosis of RGCs cultured under serum\u2010deprivation conditions, while silencing of SP1 promoted the survival of RGCs. SP1 and LINGO\u20101 colocalized and were upregulated in ONC\u2010injured retinas. Silencing of SP1 in vivo reduced LINGO\u20101 expression and protected the structure of RGCs from ONC\u2010induced injury, but there was no sign of recovery in VEP.Our findings imply that SP1 regulates LINGO\u20101 expression in RGCs in the injured retina and provide insight into mechanisms underlying LINGO\u20101\u2013mediated RGC death in optic nerve injury. Under many traumatic, ischemic nerve injury or degenerative ocular conditions, such as glaucoma, the dysfunction and/or loss of RGC is the primary determinant of visual field loss and are the measurable endpoints in current research into experimental therapies.The lack of cellular and axonal regeneration in the event of neuronal injuries is due to myelin\u2010associated inhibitory factors.Upon axonal injury, transcription factors in neurons are activated, resulting in a cascade of changes in the transcriptome and priming of the degeneration and regeneration pathways.22.1A total of 52 male Sprague Dawley rats  and 40 newborn rats  were maintained in the Ophthalmic Animal Laboratory of Zhongshan Ophthalmic Center. All procedures involving animals were conducted in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. All experimental procedures were approved by the institutional animal care and use committee of Zhongshan Ophthalmic Center (Permit SYXK 2018\u2010025). All manipulations were performed with rats under general anesthesia with 2%\u20103% inhaled isoflurane, and the eyes of the rats were administered topical 0.5% Alcaine eye drops (Alcon) prior to surgery, experimentation, and electrophysiology examination.2.2Optic nerve crush injury was performed as described previously.2.3XhoI/HindIII restriction enzyme sites in the pGL3\u2010Basic plasmid. For dual\u2010luciferase reporter assays, cells were cotransfected with 1\u00a0\u00b5g firefly luciferase plasmid harboring the promoter fragments and 100\u00a0ng of the Renilla luciferase reporter plasmid pRL\u2010TK. The cells were harvested at 36\u00a0hours after transfection, and Firefly activity and Renilla luciferase activity were measured using the Dual\u2010Glo Luciferase Reporter Assay System (Promega). Firefly luciferase activity was normalized to that of Renilla luciferase and is presented as relative luciferase units.The LINGO\u20101 promoter fragment, comprising nucleotides \u22122104 to +121\u00a0bp of the LINGO\u20101 5\u2032\u2010flanking region relative to the transcription start site, was amplified by PCR  and fused upstream of the luciferase reporter in the pGL3\u2010Basic vector to generate the LINGO\u2010luciferase (Luc) reporter. Deletion reporter constructs of the 5\u2032\u2010flanking region were generated by PCR using LINGO\u20101\u2013Luc as the template and a common reverse primer. The forward primers were as follows: 5\u2032\u2010GAAGGCGAACAAGGCACTG\u20103\u2032 for LINGO\u20101 (\u22121268 to +121)\u2013Luc, 5\u2032\u2010AGCTGAGCCCAGACTAAG\u20103\u2032 for LINGO\u20101 (\u2212789 to +121)\u2013Luc, 5\u2032\u2010ATGGCAGTGTGCAGTGAC\u20103\u2032 for LINGO\u20101 (\u2212383 to +121)\u2013Luc, 5\u2032\u2010CTCCCTGGCTCGCTGCTC\u20103\u2032 for LINGO\u20101 (\u2212122 to +121)\u2013Luc. All PCR products were subcloned into the 2.44/mm2 and cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS), BDNF , CNTF , and forskolin  in culture slides precoated with poly d\u2010lysine and laminin (Sigma\u2010Aldrich). For survival assays, SP1\u2010shRNA was transfected into cells using Lipofectamine RNAiMAX as recommended by the manufacturer. At 48\u00a0hours after transfection, the cells were treated with or without recombinant Nogo\u201066  or LINGO\u20101  in the presence of absence of SP1\u2010shRNA. After incubation for 12\u00a0hours, complete medium was replaced with DMEM without serum to induce apoptosis. Cell cultures with serum were performed in parallel as controls.Primary RGCs were isolated and purified by immunopanning.2.5Total RNA was extracted from retina tissues using TRIzol reagent (Invitrogen). RT\u2010qPCR was performed using PrimeScript RT Master Mix and SYBR Premix Ex Taq II  according to the manufacturer's instructions. The sequences of the primers used for qPCR were as follows: LINGO\u20101, 5\u2032\u2010CTTCCCCTTCGACATCAAGAC\u20103\u2032 and 5\u2032\u2010AAGACGGACCACGACGAC\u20103\u2032; \u03b2\u2010actin, 5\u2032\u2010TCACCCACACTGTGCCCAT\u20103\u2032 and 5\u2032\u2010TCTTTAATGTCACGCACGATT\u20103\u2032; SP1, 5\u2032\u2010TCCAGACCATTAACCTCAGTGC\u20103\u2032, and 5\u2032\u2010ACCACCAGATCCATGAAGACC\u20103\u2032.2.6Retinas were homogenized, and total protein was extracted using a Protein Extraction Kit (Beyotime Biotechnology). The total protein samples were separated by sodium dodecyl sulfate\u2010polyacrylamide gel electrophoresis, electro\u2010transferred to a nitrocellulose membrane, and exposed to anti\u2010SP1  and anti\u2010LINGO\u20101  antibodies. Next, the membrane was incubated with a horseradish peroxidase\u2013conjugated secondary anti\u2010rabbit antibody (CST); \u03b2\u2010actin served as the loading control. The protein bands were detected by enhanced chemiluminescence (Pierce).2.7After cardiac perfusion with 0.9% saline, the eyes of the rats were collected, fixed in 4% paraformaldehyde for 12\u00a0hours, and cryoprotected in 30% sucrose for 12\u00a0hours at 4\u00b0C. The eyes were next embedded in optimal cutting temperature medium and sectioned (10\u00a0\u03bcm thickness). The sections were permeabilized with 0.3% Triton X\u2010100 and blocked with 10% goat serum for 45\u00a0minutes. The slides were incubated with an anti\u2010Sp1  or anti\u2010LINGO\u20101  primary antibody overnight at 4\u00b0C, washed three times, and incubated with the secondary antibodies  for 1\u00a0hours at room temperature. Nuclei were stained with 4\u2032, 6\u2010diamidino\u20102\u2010phenylindole, and the slides were mounted and visualized under a confocal microscope .2.8Terminal deoxynucleotidyl transferase dUTP nick\u2010end labeling (TUNEL) staining was performed using an in situ cell detection kit according to the manufacturer's instructions (Roche). Briefly, cultured RGCs were fixed in 4% PFA for 15\u00a0minutes at 4\u00b0C, blocked using 1% donkey serum, and permeabilized with 0.1% Triton at room temperature for 20\u00a0minutes. TUNEL detection solution was added, and the samples were incubated for 50\u00a0minutes at 37\u00b0C and costained with DAPI. TUNEL\u2010positive nuclei were quantified using ImageJ software. Finally, TUNEL\u2010positive cells were enumerated in high\u2010power fields of view of three wells per treatment, and the mean was calculated.2.912 GC/mL; GeneChem) was injected into the vitreous cavity of the rats in the experimental group at 14\u00a0days before ONC injury, avoiding damaging the lens and fundus hemorrhage and ensuring that the intraocular pressure did not increase markedly. The sequence of the SP1 shRNA was 5\u2032\u2010GCAACAUGGGAAUUAUGAATT\u20103\u2032.After general anesthesia and ocular surface anesthesia, intravitreal injections were performed 2\u00a0mm behind the limbus using a Hamilton micro\u2010injector with a 30\u2010gauge needle. Five microliters of AAV2\u2010SP1 shRNA (1\u00a0\u00d7\u00a0102.102) were evaluated at 1.5, 2.5, and 3.5\u00a0mm from the optic nerve head across the five petals for each retina. For each petal, images of three regions representing the peripheral, medial, and central parts of the retina were acquired.Rats were sacrificed and eyes were collected, fixed with 4% PFA for 2\u00a0hours. The intact retinas were separated, and five radial incisions were made to create a petal shape. The retinas were permeabilized with 2% Triton X\u2010100, blocked with 5% goat serum for 4\u00a0hours, and incubated with an anti\u2010RBPMS antibody  at 4\u00b0C in a shaker overnight. After three times of washes, the retinas were incubated with a secondary antibody conjugated to Alexa Fluor 488  for 4\u00a0hours. The retinas were transferred to glass slides using an enlarged open\u2010pad tube, flattened, blotted dry, stained with DAPI, mounted, and RBPMS\u2010positive RGCs were visualized under a confocal microscope . RGCs were enumerated as described previously.2.112), the stimulation frequency was 1.0\u00a0Hz, the passband was 0.5\u201050\u00a0Hz, and the stimulation frequency was 100. For quantitative analyses, the VEP system detection index was the N1 wave, P1 wave latency (ms), and N1\u2010P1 wave amplitude (\u03bcv). A visual stimulus of 1\u00a0Hz white light (9.49\u00a0c\u00a0\u00d7\u00a0s/m2) was generated by a full\u2010field Ganzfeld stimulator under dark\u2010adapted conditions. The amplitude of N1\u2010P1 and the latency of the N1 and P1 peaks were measured using Roland software (Roland Consult). The amplitude of N1\u2010P1 was determined as the interval from the trough of the first negative peak after light onset (N1) to the peak of the first positive wave (P1). The latency of the N1 and P1 waves was measured from light onset to the peak of N1 or P1.Before assessment of visual evoked potentials (VEPs), the rats were dark\u2010adapted for >\u00a02\u00a0hours. The rats were anesthetized by intraperitoneal injection of 10% chloral hydrate. VEPs were evaluated using a Roland RETI\u2010scan system (Roland Consult) for a full\u2010field flash stimulator. The stimulus intensity was 5\u00a0dB , we performed volume scans using a noninvasive high\u2010resolution SD\u2010optical coherence tomography (OCT) instrument  at baseline and 2, 7, 14, and 21\u00a0days after surgery as described previously.2.13P value <.05 was considered indicative of significance. Kolmogorov\u2010Smirnov tests were used to assess data distribution for normality. The Student t test, one\u2010way analysis of variance (ANOVA), two\u2010way ANOVA, or repeated measure ANOVA was used to compare differences between groups.All experiments were performed in at least triplicate biological repeats. Data are presented as means\u00a0\u00b1\u00a0standard deviations (SDs). Statistics was performed using the statistical package for the social sciences (SPSS) software. A 33.1To determine the transcriptional control responsible for increased LINGO\u20101 expression in RGCs, we used a gene\u2010expression microarray to identify genes that mediated RGC death. The efficacy of RGCs isolation was verified by cell morphology and flow cytometry with CD90.1 and CD48 labeling Figure\u00a0A,B. The Next, we determined the region responsible for transcriptional regulation of LINGO\u20101 and the related transcriptional factors. A series of fragments of luciferase reporter constructs containing deletions of the LINGO\u20101 5\u2032\u2010flanking region were transfected into cells, and luciferase activity was assayed. One deletion fragment (\u2212789 to +121\u00a0bp) showed dramatically higher promoter activity than pGL3\u2010Basic, similar to the activity of the full\u2010length fragment (\u22122104 to +121\u00a0bp). By contrast, luciferase activity was almost completely abolished by a different fragment (\u2212383 to +121\u00a0bp). Thus, the region responsible for transcriptional control of LINGO\u20101 was located at nucleotides \u2212789 to \u2212383 Figure\u00a0. Computa3.2To investigate the role of SP1 in the regulation of LINGO\u20101 expression, we transfected HEK293 cells with pCGN\u2010SP1 or control vector and quantified the LINGO\u20101 mRNA level by qRT\u2010PCR. SP1 overexpression resulted in a significantly higher LINGO\u20101 mRNA level compared to the control Figure\u00a0. To detein trans,Because LINGO\u20101 is implicated in potentiating neuronal apoptosis under serum\u2010deprivation conditions,3.3To examine the association between LINGO\u20101 and SP1 in the ONC\u2010injured retina further, double immunofluorescence staining of LINGO\u20101 and SP1 was performed. The control RGCs exhibited low LINGO\u20101 and SP1 expression; in contrast, LINGO\u20101 and SP1 expression was considerably higher in ONC\u2010injured RGCs. In addition, LINGO\u20101 and SP1 were colocalized in the RGCs Figure\u00a0. Western3.4Inhibition of LINGO\u20101 promotes the survival of RGCs following ONC,3.5To examine the neuroprotective effects of inhibition of SP1, we monitored changes in RNFLT by OCT, a noninvasive method of assessing degenerative changes in converging axons of RGCs. The average RNFLT was 1.5\u00a0mm from the center of the optic nerve head Figure\u00a0. The RNF2)  Figure\u00a0 encompas) Figure\u00a0. Therefo3.6The preservation of RGC structure motivated us to evaluate the functional recovery of the visual circuits after injury to the optic nerve by assessing the VEP at 1\u2010day pre\u2010ONC (baseline) and at 7, 14, and 28\u00a0days post\u2010ONC. Impairment of visual function after ONC was evidenced by reduced amplitude of N1\u2010P1 waves and prolonged latency of N1 waves Figure\u00a0. However4Death of, and axonal injury to, RGCs is important in retinal neuropathy. Similar to CNS neurons in other neurodegenerative diseases, death of RGCs is irreversible and can directly disturb visual pathway signal transmission, resulting in impaired visual function. Glaucoma is a retinal neurodegenerative disease characterized by the loss of, and axonal injury to, RGCs. Therefore, protection of RGCs is important in the treatment of retinal neuropathies such as glaucoma. In this study, we used the ONC model to explore the mechanism(s) underlying the loss of RGCs that occurs during the development of glaucoma.During the course of nerve injury, the myelin\u2010associated inhibitory protein LINGO\u20101 mediates neuronal survival and axonal regeneration, thus contributing to neurodegeneration.syt11,In view of the important pathophysiological role of LINGO\u20101 in mediating the death of RGCs, we investigated the upstream regulatory factors. In microarray analyses, we found that SP1 was upregulated in the RGCs of ONC\u2010injured retinas, and LINGO\u20101 promoter analyses revealed that SP1 increased the expression of LINGO\u20101 by binding to its promoter region. Furthermore, SP1 knockdown antagonized LINGO\u20101\u2013induced apoptosis of RGCs under serum\u2010deprivation conditions. In addition, SP1 and LINGO\u20101 were simultaneously upregulated in injured RGCs. These data imply that SP1 regulates LINGO\u20101 expression at the transcriptional level and that upregulation of SP1 is implicated in LINGO\u20101\u2013mediated death of RGCs. Indeed, SP1 has been reported to play important pathophysiological roles in a variety of neurodegenerative diseases, including Alzheimer's, Huntington, and Parkinson's diseases, and to regulate disease\u2010related pathogenic genes such as APOE, LRRK2, and P16INK4A.We evaluated the role of SP1 in the LINGO\u20101\u2013mediated death of RGCs. Intravitreous injection of AAV2\u2010SP1 shRNA was performed at 2\u00a0weeks before ONC to knock\u00a0down SP1 expression in RGCs; this resulted in reduced expression of LINGO\u20101. To investigate the neuroprotective effects of inhibition of SP1, we used OCT to monitor RNFLT and assess the axons of RGCs. Inhibition of SP1 promoted survival of RGCs and increased RNFLT, consistent with our previous report of the neuroprotective effects of LINGO\u20101 antagonism.We then evaluated the protective effects of inhibition of SP1 on visual function. Surprisingly, inhibition of SP1 did not significantly modulate N1\u2010P1 amplitude or N1 latency. The two major possible explanations for these conflicting findings are that inhibition of SP1 preserved the structure of RGCs but did not restore visual function. First, inhibition of SP1 may not protect the subcellular organelles of RGC axons from damage such as disintegration of the synaptic assembly or may fail to promote synapse repair after damage. BDNF, CTNF, and NT3, among other factors, promote neuronal survival and synaptic regeneration after injury.We report the upregulation of SP1 and LINGO\u20101 expression in RGCs in the ONC\u2010injured retina. In vitro, SP1 regulated LINGO\u20101 expression at the transcriptional level and promoted the LINGO\u20101\u2013mediated death of RGCs. Furthermore, SP1 knockdown had a neuroprotective effect in vivo. Our results provide important insight into the mechanism of LINGO\u20101\u2013mediated death of RGCs in patients with glaucoma. Further studies are required to increase our understanding of the mechanism(s) of RGC\u2010related synaptic damage and formulate a neuroprotective strategy for glaucoma involving stimulation of the visual system.The authors declare no conflict of interest.Fig S1Click here for additional data file."}
{"text": "Pink1, Parkin and Fbxo7, three autosomal recessive familial genes of Parkinson\u2019s disease (PD), have been implicated in mitophagy pathways for quality control and clearance of damaged mitochondria, but the interplay of these three genes still remains unclear. Here we present that Fbxo7 and Pink1 play a reciprocal role in the regulation of their protein levels. Regardless of the genotypes of Fbxo7, the wild type and the PD familial mutants of Fbxo7 stabilize the processed form of Pink1, supporting the prior study that none of the PD familial mutations in Fbxo7 have an effect on the interaction with Pink1. On the other hand, the interaction of Fbxo7 with Bag2 further facilitates its capability to stabilize Pink1. Intriguingly, the stabilization of Fbxo7 by Pink1 is specifically observed in substantial nigra pars compacta but striatum and cerebral cortex. Taken together, our findings support the notion that Fbxo7 as a scaffold protein has a chaperon activity in the stabilization of proteins. Parkinson\u2019s disease (PD) is the second most common progressive neurodegenerative disease after Alzheimer\u2019s disease, characterized by tremor, rigidity and bradykinesia due to dopaminergic (DA) loss in substantial nigra pars compacta (SNc) , 2. It iPink1, a mitochondrially localized serine/threonine kinase gene, acts as an important upstream regulator of Parkin in control of mitophagy \u201318. As aPink1 is processed by multiple proteases in the inner mitochondrial membrane \u201321. The Although previous study demonstrated that Fbxo7 and its PD familial mutants directly interact with Pink1 , the effDue to the lack of specificity and efficiency of commercialized Pink1 antibodies to detect the endogenous Pink1, we decided to create a knockin (KI) HEK 293A cell line, in which a cassette containing 3XFlag, a P2A motif and a neomycin resistant gene was integrated into the Pink1 locus in chromosome 1 for the expression of Pink1 fused with 3XFlag at the c-terminus of Pink1and a cleaved form of neomycin driven by P2A. To do this, we constructed a donor plasmid carrying a cassette with 3XFlag, P2A, neomycin, and two arms homologous to target the regions of the Pink1 locus on Chromosome 1, and a plasmid carrying genes for CRSPR/Cas9, tracer RNA and sgRNA specific for creating a break near the stop codon of Pink1 . 24 hourFbxo7, as a subunit of SCF E3 ubiquitin ligase, is involved in the regulation of proteasomal activity by recruiting its substrates . To testWe have demonstrated that Bag2 is capable of inhibiting the ubiquitination of Pink1 and stabilizing the endogenous PF-Pink1. We then asked whether Bag2 directly interacts with Fbxo7 and the PD familial forms of Fbxo7. To this end, we carried out an in vitro binding assay using the recombinant proteins purified from E. coli. The in vitro binding assay revealed that Bag2 directly interacted with Fbxo7 and the PD familial forms of Fbxo7 . LikewisBurchell et. al. reported that the expression of Fbxo7 is unable to rescue the phenotype caused by Pink1 mutant in a Drosophila model of PD and pinpointed that Pink1 kinase activity is inevitable for functional regulation of Fbxo7 in Pink1-Parkin signaling cascade . We thenThe work of the past few years has documented that mutations in Fbxo7 are associated with a severe form of autosomal recessive PD , 9, 34. The growing lines of evidence demonstrate that Fbxo7 is a subunit of the SCF E3 ligase that promotes proteasomal activity via facilitating the recognition of substrates , 33, 36.Previously, it has been reported that Bag2 has a critical role in the stabilization of Pink1 through inhibiting the ubiquitination of Pink1 , 27. In In addition to the effect of Fbxo7 on Pink1, we found that the loss of Pink1 causes a decrease of Fbxo7 in SNc rather than other brain tissues such as striatum and cortex, raising a question as to whether the expression of Pink1 has a positive effect on the protein level of Fbxo7. Burchell et. al. reported that the expression of Fbxo7 fails to rescue the phenotype caused by Pink1 mutant in drosophila and suggested the importance of Pink1 kinase activity in Fbxo7 mediated mitophagy . To exteem1Smoc, NM-KO-191011) were purchased from Shanghai Model Organisms, China. All animal procedures were approved by the Institutional Animal Care and Use Committee of Fujian Medical University. Animals were maintained in strict accordance with the Guidelines for the Use and Treatment of Animals put forth by the NIH\u2019s Guidelines for the care and use of Laboratory Animals.Pink1 KO mice , mouse anti-GAPDH , mouse anti-Flag , mouse anti-\u03b2-Actin , mouse anti-Myc , mouse anti-V5 , mouse anti-Ubiquitin , rabbit anti-Bag2 , mouse anti-HA , anti-mouse horseradish peroxidase-conjugated secondary antibody  and anti-rabbit horseradish peroxidase-conjugated secondary antibody  for IP Western blots, anti-mouse horse radish peroxidase-conjugated secondary antibodies  and anti-rabbit horse radish peroxidase-conjugated secondary antibodies  for regular Western blots. All primary antibodies were used at 1:5000 dilution, except anti- \u03b2-Actin, which was diluted 1:50,000 for Western blot analyses. The secondary antibodies for IP were diluted 1:5000. The secondary antibodies for Western blots were diluted 1:10,000.Pink1 sgRNA sequences: 5\u2019-CACCGGTGATGTCCCTGCATGGAGCTGG-3\u2019and 5\u2019-AAACCCAGCTCCATGCAGGGACATCACC-3\u2019; Pink1 Hom1 primers: 5\u2019-TCCCCGACCTGCAGCCCAGCTCATCTCCTGAGAGCAGATCTG-3\u2019 and 5\u2019-CCGGAACCTCCTCCGCTCCCCAGGGCTGCCCTCCATGAGCA-3\u2019; Pink1 Hom2 primers: 5\u2019-AGTTCTTCTGATTCGAACATCGAACATGGCATCCTCTGTGTC-3\u2019 and 5\u2019-TGGAGAGGACTTTCCAAGCCTTTACTGCATGTTGACGCT-3\u2019; siRNAs for human Fbxo7 were purchased from Santa Cruz Biotechnology (sc-75010).Myc-Bag2 construct was a gift from Dr. Suneil K. Kalia. Pink1-V5 was a gift from Dr. Mark Cookson. Pink1-Flag was inserted into the pAdTrack vector by using NotI and HindIII. pFETCh_donor (EMMM0021) was a gift from Eric Mendenhall and Richard M. Myers  [http://n2t.net/addgene:48138; RRID: Addgene_48138) [Fbxo7 was cloned into pCI-neo with 2xMyc at its C-terminus. The e_63934) . pSpCas9e_48138) .HEK293A, SH-SY5Y and HeLa cells were cultured with 10% fetal bovine serum  in Dulbecco's modified Eagle's medium .The assays were carried out as previously described .The KI HEK 293A cell were generated as previously described , 44. BriStatistical significance was determined via Prism 8.0. All data presented as mean \u00b1 SD."}
{"text": "CircRNAs recently have shown critical roles in tumor biology. However, their roles in prostate cancer (PCa) remains largely unclear.via qRT-PCR and FISH. Sanger sequencing, actinomycin D, gDNA, and cDNA, RNase R assays were used to assess the circular characteristics of circNOLC1. CCK-8, colony formation, transwell migration assays, and mice xenograft models were conducted to evaluate the functions of PCa cells after circNOLC1 knockdown and overexpression. RNA pulldown, luciferase reporter assay, FISH (fluorescence in situ hybridization), and CHIP were utilized to illustrate the further mechanisms of circNOLC1.CircRNA microarrays were performed in immortal prostate cell line RWPE1 and PCa cell lines as DU145, PC3, LNCaP, C4-2, and 22RV1. Combined with upregulated circRNAs in PCa tissues, circNOLC1 expression was validated in PCa cells and tissues in vitro and vivo. Additionally, we found that circNOLC1 could upregulate PAQR4 expression by sponging miR-647, leading to the activation of PI3K/Akt pathway. Moreover, NF-kappaB was identified to bind to the NOLC1 promoter sites and upregulated both NOLC1 and circNOLC1 expression.Our research indicated that circNOLC1 was overexpressed in PCa cells and tissues, and circNOLC1 was more stable than linear NOLC1 mRNA. CircNOLC1 promoted PCa cells proliferation and migration via a miR-647/PAQR4 axis, and circNOLC1 is a potential biomarker and target for PCa treatment.CircNOLC1, elevated by transcription factor NF-kappaB, promotes PCa progression  Prostate cancer (PCa) is currently the first and second leading cause of new diagnosis and mortality, accounting for 21% of all new cancer cases and 10% of all death cases in men . AlthougCircular RNA (CircRNA), a novel type of non-coding RNA, is formed by covalently closed loop structures without free terminal ends . Due to in vitro assays and in vivo mouse model. Finally, the underlying mechanism of circNOLC1 were also evaluated. In summary, our works revealed that circNOLC1 could act as a oncogene in the progression of PCa, and may provide a novel target for the diagnosis and treatment of PCa.In this study, circRNA microarray in five common PCa cells combined with the published microarray data for PCa tissues, we identified 22 different circRNAs. Subsequently, circNOLC1 (circBase ID: has_circ_0000257) were chosen for further study to explore its role in the PCa proliferation and progression by using a series of Eighty prostate tissues and sixteen adjacent tissues were obtained from patients who underwent radical prostatectomy (RP) at Zhujiang Hospital of Southern Medical University from 2016 to 2018, and then the paraffin specimens were constructed as a tissue microarray (TMA). The clinical details of patients were collected from the medical records. All experimental procedures were approved by the Ethics Committee of the Southern Medical University Zhujiang Hospital. The median age of the enrolled patients was 67.5 years and average age was 65.1 (range: 20\u201397 years). Clinical TNM staging and Gleason scores of patient specimens were based on the American Joint Committee on Cancer (AJCC) Eighth Edition (2017) and the 2016 World Health Organization (WHO) classification of genitourinary tumors. The detailed clinicopathological information of all samples was presented in t-test (P: 0.05). Quantile normalization and subsequent data processing was performed through the R 4.0.2 software limma package. Differentially expressed circRNAs were identified via Fold Change filtering. Hierarchical Clustering was used to perform the distinguishable circRNAs expression pattern among the samples.Arraystar Human circRNA Array v2  was applied to analysis circRNA microarray. Total RNA from each sample was quantified with the NanoDrop ND-1000. Sample preparation and microarray hybridization were performed as outlined in the standard protocols stipulated by Arraystar, as described previously . Normali1 and circinteractome2. Overlapping candidates were considered as putative miRNA targets. Two algorithms (TargetScan and miRpathDB) were used to predict the potential miRNAs targeting the 3\u2019-UTR of PAQR4. Data from The Cancer Genome Atlas (TCGA) was analyzed by Starbase 2.03.The circRNA-miRNA interactome was drawn by circBank2. Small interfering RNAs (siRNAs) of circNOLC1 and NF-kappaB, and miR-647 inhibitor or mimics were purchased from RiboBio Company . Lentivirus vectors  were utilized to establish cell lines stably overexpressing circNOLC1, and the transfected cells were selected in puromycin (2 \u03bcg/ml) for 1 week. All the target sequences were shown in DU145, PC3, C4-2, LNCaP, 22RV1 (PCa cell lines), RWPE1 , and HEK-293T cells were obtained from Cell Bank of Chinese Academy of Sciences, grown with RPMI-1640 medium  supplemented with 10% FBS  and incubated at 37\u00b0C in 5% CONuclear and Cytoplasmic Extraction Reagents  were used to separate nuclear and cytoplasm of cultured cells following the manufacturer\u2019s protocol. And RNA extraction was described as followed.Total RNA was obtained from cells with TRIzol , while the cDNA was reverse-transcribed via utilizing PrimeScript RT reagent Kit (TaKaRa) following the manufacturer\u2019s instructions. The genome DNA was isolated by special extraction kit . SYBR Green PCR Master Mix (TaKaRa) and Applied Bio-systems 7500 Fast Real-Time RCR System  were used for RT-qPCR analysis. Data were acquired from three independent experiments and normalized to GAPDH. All the primers were shown in To compare the stability of linear RNA and circRNA, Actinomycin D  was added into medium to block RNA transcription and the solvent dimethyl sulfoxide  was applied as a negative control. Cells were treated with actinomycin D or DMSO in a final concentration of 1 \u03bcg/mL for 0, 4, 8, 12, and 24 h, and then the RNA was extracted for RT-qPCR detection, using 18S as an internal reference. For RNase R treatment, 2 mg total RNA was incubated for 15 min at 37\u00b0C with or without 3 U/mg RNase R , and followed by RT-qPCR analysis.in situ Hybridization Kit , according to the official guidelines. DAPI was utilized to stain the nuclei. Subsequently, circNOLC1 and miR-647 were observed through a confocal microscope .CircNOLC1 and miR-647 were captured by Cy3-labeled probes  and Alexa 488-labeled probes . FISH experiment was conducted using Fluorescent Cell proliferation was measured by CCK-8 kit . 2,000 PCa cells were planted into 96-well plates. Then medium with 10%CCK-8 was added into each well, and incubated for 2 h. Subsequently, the absorbance values at 450 nm were detected by a microplate reader .PCa cells were seeded into 6-well plates and cultured with complete medium for 2 weeks. The formed cells were fixed with 4% paraformaldehyde for 10 min and stained with Giemsa  for 5 min. Each experiment was performed with three replicates.4) were resuspended in 300 \u03bcl serum-free medium and seeded into the upper chamber of the insert. Subsequently, the lower chamber was filled with 500 \u03bcl complete medium. After 24 h, the cells were fixed with 4% paraformaldehyde for 10 min and stained with Giemsa . Five randomly selected fields were photographed using an invert microscope at 200\u00d7 magnification. The cell numbers of each image were counted by Image J software. Experiments were performed in triplicate.Cell migration assay was performed using transwell inserts  in 24-well plates. PCa cells , following the manufacturer\u2019s instructions. Equal amounts of proteins were separated in 10% SDS-PAGE gels and transferred to PVDF membranes . The membranes were then blocked for 1 h with 5% no fat milk and incubated overnight at 4\u00b0C with the following primary antibodies: EMT marker , anti-PAQR4 , anti-\u03b2-actin . Subsequently, the membranes were immersed in the anti-rabbit or anti-mouse secondary antibodies  for 1.5 h at room temperature. Enhanced chemiluminescence (ECL) kit  was used to detect and visualize the protein.TM Magnetic RNA-Protein Pull-Down Kit , all procedures were followed as manufacturer\u2019s instructions. Then the final RNA was extracted by TRIzol  and analyzed by RT-qPCR.CircRNA pulldown assay was carried out using Pierce5) were seeded into each well of a 12-well plate for 24 h. Then, a mixture of luciferase reporter vectors and miRNA mimics was transfected into cells. The relative luciferase activity was measured utilizing Luc-PairTM Duo-Luciferase HS Assay Kit . Each group was confirmed in triplicate.The sequences of circNOLC1 and its mutant types without miR-647 binding sites were designed and packaged into pEZX-MT06 vector , termed as circNOLC1-WT and circNOLC1-MUT. The miRNA mimics were purchased from RiboBio Company . HEK-293T cells (5 \u00d7 106 du145 cells stably transfected with circNOCL1 or Vector were subcutaneously injected into the mice axillae (n = 6 per group). Tumor volume was measured every 4\u20135 days and volumes were calculated using the formula: length \u00d7 width2 \u00d7 0.5.All experimental animal procedures were authorized by the Animal Care and Use Committee of Southern Medical University and Specific Pathogen Free (SPF) conditions were used to raise animals. BALB/c nude mice were obtained from the Animal Center of Southern Medical University, Guangzhou, China. A total of 2 \u00d7 10Detection of Ki-67 and CD31 was performed on 3 \u03bcm thick paraffin sections with the indicated antibodies. Briefly, sections were incubated with primary antibodies Ki-67  or CD31  antibodies at 4\u00b0C overnight. Subsequently, Horseradish peroxidase (HRP)-conjugated secondary antibodies  were further incubated at 37\u00b0C for 30 min. Finally, the sections were stained with 3,3\u2019-diaminobenzidine  for 5 min and examined with a microscope.\u00ae Plus Enzymatic Chromatin IP Kit , according to the manufacturer\u2019s protocols. Anti-NF-kappaB antibody for CHIP was obtained from Cell Signaling Technology (#8242). The detailed binding sites between the promoter sites of NOLC1 and NF-kappaB were predicted by Consite4, as: GGGAAGTCCC. The specific primers for binding sites were shown in CHIP assay was performed using SimpleChIPSD. Two-tailed Student\u2019s t-test or ANOVA was conducted to analyze the significance between variables. The relation between circNOLC1 expression and clinicopathological properties was analyzed using a \u03c72 test. P < 0.05 was considered as statistically significant.All statistical analysis was performed using GraphPad Prism 8 . The data were presented as mean \u00b1 To investigate the differential expressed circRNAs in PCa, we performed a microarray of the PCa cell lines, DU145, PC3, LNCaP, C4-2, and 22RV1 cells . We founCircNOLC1 is generated by head-to-tail splicing of NOLC1 exon 2\u20135 and contains 487 nucleotides . Actinomin vitro.To discover the function of circNOL1 in PCa, we randomly chose DU145 and C4-2 cell lines for silencing, PC3 and C4-2 for overexpression. We constructed three siRNAs targeting circNOLC1 to silence its expression. Finally, si-circ#02 exhibited the highest silencing efficiency measured by qRT-PCR and was chosen for the following experiments , left. MPlenty of reports have revealed that circRNAs mainly function as miRNA sponges in various cancers . To figuDue to previous reports, miR-647 could retard tumor progression via inhibiting downstream oncogenes . We subsConsite, and found that NF-kappaB scores ranked the most . We discovered 110 upregulated circRNAs both in five PCa cells, and 22 were overlapped overexpressing in PCa tissues. Among them, top five upregulated circRNAs were chosen for further validation, and circNOLC1 was significantly elevated in PCa cells and tissues. Meanwhile, circNOLC1 exhibited stronger stability than its linear mRNA. Through Nucleolar and coiled-body phosphoprotein 1 (NOLC1), the host gene of circNOLC1, was firstly discovered as a nuclear localization signal binding protein, which functions as a chaperone that shuttles between the nucleolus and cytoplasm , 1992. Pvia knockdown and overexpression of miR-647, and PAQR4 was confirmed to be the most likely downstream target gene. Further immunoblot validated that PAQR4 was negatively regulated by miR-647. These findings supported that circNOLC1 sponges with miR-647 promoted PCa progression via upregulating PAQR4 expression.Previous studies indicated that circRNAs exert their functions by various biological processes, such as miRNA sponges, protein-binding, and transcriptional and translational regulation . The ceRvia a miR-647/PAQR4 axis.Progestin and adipoQ receptor family member 4 (PAQR4) was reported to be high expression in PCa cells and tissues, and significantly improve PCa malignant phenotype by activating PI3K/Akt pathway . BesidesThe mechanism of circRNAs biogenesis is a remarkably complicated process . PreviouIn summary, we discovered a novel circRNA (circNOLC1) remarkably upregulated in PCa cells and tissues. Our results indicated that circNOLC1 participate in the malignant progression in PCa, mainly by sponging miR-647 to upregulate PAQR4 expression, thus activating the PI3K/Akt pathway. Also, NOLC1 and circNOLC1 can be regulated by NF-kappaB via binding to NOLC1 promoter sites. Our studies suggested that circNOLC1/PAQR4 axis could serve as a novel biomarker and therapeutic target for PCa .The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.The studies involving human participants were reviewed and approved by the ethics committee of Zhujiang Hospital, Southern Medical University. The patients/participants provided their written informed consent to participate in this study. The animal study was reviewed and approved by the ethics committee of Zhujiang Hospital, Southern Medical University. Written informed consent was obtained from the individual(s) for the publication of any potentially identifiable images or data included in this article.XM, DL, and CL conceived and designed the study. WC and SC carried out the experiments. TY, KW, and LZ collected and analyzed the clinical data. JL and XZ analyzed and interpreted the data. WC and DL wrote the manuscript. XM and DL executed the funding acquisition. All authors have reviewed and approved the final version of the manuscript.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Streptomysis felleus (S. felleus) strain. This isolate was submitted to gene bank NCBI with accession number MH553077. In addition, physiological studies such as utilization of carbon, nitrogen, amino acid sources of potential isolated were studied. Further, optimization, purification and characterization of the novel compound producing strain may be helpful for discovering the new therapeutic microbial agent.In the current study, twenty-eight soil samples were collected from coalmine sites of Telangana, India. The isolates were purified and identified based on their culture characterization on oatmeal agar, glycerol asparagine agar, yeast extract-malt extract agar, inorganic salt starch agar, and starch casein agar medium. Further, the supernatant of all the isolates were tested for antimicrobial and antifungal activities. The biochemical and microscopic studies of isolated strains results indicates the potential isolate strains belongs to Streptomyces genus. Among all the strains the biological activity of BHPL-KSKU5 showed higher anti-bacterial and anti-funagal activity. The molecular characterization of BHPL-KSKU5 16s rDNA gene sequence and phylogenetic tree showed that is mostly related to the  A broad spectrum of antibiotic products like macrolides, \u03b2-lactams, polyenes, aminoglycosides, tetracyclines, peptides, and polyethers are produced by most of the Streptomyces sp  19\u00b002'44.3''N 79\u00b030'46.2''E, Bhupalpally (BHPL) 18\u00b027'05.0''N 79\u00b051''14.0''E, Godavarikhani (GDK) 18\u00b042'45.0''N 79\u00b031'48.4''E, Kothagudem (KGDM) 17\u00b028'51.3''N 80\u00b040'19.4''E, Sathupally (SPL) 17\u00b012'18.2''N 80\u00b047'39.6''E, Madhamari-Kalyankhani (MM-KK) 19\u00b000'20.7''N 79\u00b028'08.1''E, and Ravindhrakhani (RK) 18\u00b053'17.9''N 79\u00b030'04.9''E,Telangana, India, during 2019 using an open-end soil borer (10\u00a0cm in depth and 25\u00a0cm in diameter), then air-dried for 24 hr . The soi2.2Samples were allowed to 10 fold serial dilution with one gram of soil dissolved in sterile water and were inoculated on starch casein agar. Streptomycin (30\u00a0\u00b5g/L) and amphotericin B (50\u00a0\u00b5g/L) were added to the medium to retard bacteria and fungi growth, respectively. Later all the plates were incubated at 28\u00a0\u00b1\u00a02\u00a0\u00b0C for 4 to 10\u00a0days. The suspected colonies structures isolates with brown and white colonies were purified. The pure cultures were streaked on to respective medium plates.2.3The pure isolates were prepared for actinomycetes plates and placed 3 to 4 sterile coverslips. The plates were incubated at 28\u00a0\u00b1\u00a02\u00a0\u00b0C for 4 to 7\u00a0days. The coverslips were removed at 3\u00a0days of interval and observed under the high power magnification. The arrangement of conidiospores on aerial and substrate mycelia was observed and compared with the Bergeys Manual of Determinative Bacteriology.Cultural characteristics were conducted by growing the organism on oatmeal agar, glycerol asparagine agar, yeast extract-malt extract agar, inorganic salt starch agar, and starch casein agar media after 14\u00a0days of culturing at 28\u00a0\u00b0C. Morphological characteristics of aerial hyphae, spore chain, spore mass, spore surface, the colour of aerial and substrate mycelia, and diffusible pigments production were conducted by growing the organism on ISP-4 medium for 7-days and accessed via light microscope.The culture plates containing actinomycetes were prepared, and coverslips were placed at an angle of 45\u00a0\u00b0C and allowed to incubate at 28\u00a0\u00b0C for 7\u00a0days, later coverslips were carefully removed and examined under a microscope. The aerial and substrate of conidiospores' mycelial structure have been attributed to the Bergeys Manual of Determinative Bacteriology , Baciilus cereus (B. cereus), Streptococcus pneumonia (S. pneumonia), Bacillus subtilis (B. subtilis) and Micrococcus luteus (M. luteus) and five gram-negative bacteria Enterobacter aerogenes (E. aerogenes), Klebseilla pneumonia (K. pneumonia), Escherichia coli (E. coli), Salmonella paratyphi (S. paratyphi) Pseudomonas aeruginosa (P. aeruginosa) and Candida albicans  were screened against antimicrobial compound produced by actinomycetes isolates. The tested bacteria were obtained from the department of Botany and Microbiology, King Saud University, Riyadh, Saudi Arabia and Microbiology laboratory, Kakatiya Medical College, Warangal, India.Five different gram-positive bacteria 2.8B. subtilis, B. cereus, S. aureus, S. pneumoniae, M. luteus, E. coli, E.aerogenes, K. pneumoniae, S. paratyphi and P.aeruginosa. Muller Hinton agar plates were prepared and lawn culture of bacteria was made. The nutrient broth was cultivated on bacterial sample organisms for 24hr. For the preparation of the bacterial lawn, a 100\u00a0mg cultivation of each bacterial species was used (1\u00a0\u00d7\u00a010-5 CFU/mL). Agar wells of 6\u00a0mm diameter were prepared with the help of a sterile cork borer. The wells were loaded with crude extract 900 \u00b5g/mL, negative control (DMSO), along with 30 \u00b5g/mL of streptomycin as a positive control. The plates were incubated 24 hr at 37\u00a0\u00b0C and the zone of inhibition was calculated  was tested by employing agar well diffusion assay, the crude obtained from all the isolates was carried on against the test pathogens namely lculated .C. albican testing fungus was conducted in a saline solution (0.85%), NaCl medium, and customized to 0.5 Mc Farland and (10-8 CFU/mL) turbidity. A sterilized spreader was used to spread 1\u00a0mL of the sample culture into PDA plates. Agar wells of 6\u00a0mm diameter were prepared. The wells were loaded with crude extracr (900\u00a0\u00b5g/mL), negative and positive control after the plates were incubated for 48 hr. The inhibition zone diameter was measured in millimetre. Based on the size of the zone of inhibition, the potent antibacterial compound contains isolate were selected.Approximately 50\u00a0mL of potato dextrose agar was poured onto the sterilized petri plate utilizing the agar well diffusion assay to assay the anti-candidal activity . The C. 2.9The data were evaluated using (SPSS V.10.0) and Excel. All the data expressed as mean\u00a0\u00b1\u00a0standard deviation (SD) for each test for triplicate.3A total 28 soil samples were obtained from various coalmine soil samples of Telangana, India. From these actinomycetes colonies  were purified by sub-cultured and stored at 4\u00a0\u00b0C and used for further studies. The isolates aerial spore mass colour was categorized into 3 groups grey, ash, and white series . Most of3.1The fermented broth containing antimicrobial compounds of selected potential Streptomyces was extracted by centrifugation. All the crude extracts were used for antimicrobial activity.3.2-KSKU5 isolate showed a broad range of antimicrobial activity, which showed higher zone of inhibition against S. paratyphi and C. albicans (18\u00a0\u00b1\u00a00.4\u00a0mm and 16.\u00a0\u00b1\u00a00.4\u00a0mm) hence, the BHPL-KSKU5 was selected for further investigations.All the isolates exhibited antimicrobial and anti fungal activity  against 3.3-KSKU5 with broad-spectrum antimicrobial activities was selected for further characterization based on morphological, physiological, and molecular identification by 16S rDNA molecular analysis.The actinomycetes isolate BHPL-KSKU5 formed a flexuous spore chain on aerial mycelium  was performed by PCR amplification. The 16S rDNA gene sequence was used for BLAST analysis. Based on the maximum similarity score, the first 10 sequences were used and aligned with multiple alignment ClusalW software. Using the MEGA 7 the distance matrix phylogenetic tree was developed. It revealed that BHPL-KSKU5 found 98% similarity with the existing species of S. felleus based on nucleotide homology and phylogenetic analysis (c). The sequence was submitted to Genebank and obtained accession number MH553077.The molecular characterization a, b was analysis c. The se4Actinomycins produce the different types of bioactive compounds, which contain antibiotic, anticancer, and antimicrobial activities . ActinomActinomycetes have a significant property in digestion and production of certain components such as proteins in the form of keratin and certain vitamins . A largeS. felleus (BHPL-KSKU5) was found to develop a flexuous spore chain with a smooth surface, this is the main characteristic feature of Streptomyces, these study was supported by In the current study, actinomycetes isolate namely S. felleus (BHPL-KSKU5) showed positive results in carbon utilization to dextrose, L-arabinose, maltose, starch, D-arabinose, fructose, mannose, and lactose but it unable to utilize mannitol, sucrose, xylose, and D-galactose. The utilization of different nitrogen sources in strain BHPL-KSKU5 showed positive results to sodium nitrate and asparagine, whereas it did not utilize ammonium sulphate, ammonium nitrate but utilized potassium nitrate, and calcium nitrate. The utilization of amino acids was also tested. Among the tested amino acids, namely DL-2 amino-N-butric acid, L-tyrosine, DL-tryptophan, DL-ornithine, L-lysine, DL-leucine, L-arginine, DL-alanine and L-leucine were utilized. Whereas it did not utilize L-glutamic acid, L-cystine, and DL-aspartic acid, these results could be utilized as a taxonomic criterion at genus level identification.For the characterization of actinomycetes isolates metabolites, various physiological tests were carried out . In the -KSKU5) was studied, and it was found that Streptomyces sp, which is found 98% similarity with the existing species of Streptomyces felleus.In identifying actinomycetes 16S rDNA gene sequence played a vital role which is evident by many workers . In currS. felleus (BHPL-KSKU5) could produce antimicrobial compounds in starch casein broth. Antimicrobial compounds normally produced from plant ingrediants, but nowadays which also produced from soil microbes such as Actinomycetes; it was great intrest due to which acting as a potent alternative antibacterial agents . The preS. felleus was done. Hence, coalmine soil is the best suitable source for the isolation of diverse actinomycetes.Further, studies need to be done to purify, charecterize the antimicrobial compound and its optimization for large-scale production. Therefore, the present study suggests that the diversity of antimicrobial producing actinomycetes in coalmine soils of Telangana were predominantly more. The phenotypic, genotypic characterization of the antimicrobial compound from 5S. felleus, which contain more antibacterial and antifungal activity. Further, this study may be helpful to develop potential antibacterial and antifungal agents against different pathogens.Actinomycetes are the highest microorganisms with the potential to produce novel antibiotics as industrially important secondary metabolites. Actinomycetes could be found in different environments such as soil, husk, and other than the source and our preferred site of coalmine soils are more tolerant of their growing and novel antibiotics and significant secondary metabolites. In present study totally 28 coalmine soil samples were collected from different districts in Telangana. The novel strain BHPL-KSKU5 was identified and characterized as The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper."}
{"text": "SARS-CoV-2 (the causative agent of COVID-19) is a major public health threat and one of two related coronaviruses that have caused epidemics in modern history. A method of screening potential infectible hosts for preemergent and future emergent coronaviruses would aid in mounting rapid response and intervention strategies during future emergence events. in vitro validation, we identified 5\u2009key amino acid differences between murine and human ACE2 that mediate SARS-CoV-2 infection, generating a chimeric humanized murine ACE2. Additionally, we examined the ability of the humanized murine ACE2 receptor to permit infection by an additional preemergent group 2B coronavirus, WIV-1, providing evidence for the potential pan-virus capabilities of this chimeric receptor. Finally, we predicted the ability of these determinants to inform host range identification of preemergent coronaviruses by evaluating hot spot contacts between SARS-CoV-2 and additional potential host receptors. Our results identify residue determinants that mediate coronavirus receptor usage and host range for application in SARS-CoV-2 and emerging coronavirus animal model development.The angiotensin-converting enzyme 2 (ACE2) receptor is a major severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) host range determinant, and understanding SARS-CoV-2-ACE2 interactions will provide important insights into COVID-19 pathogenesis and animal model development. SARS-CoV-2 cannot infect mice due to incompatibility between its receptor binding domain and the murine ACE2 receptor. Through molecular modeling and empirical  Since its emergence in December 2019, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has infected tens of millions, leading to over 2 million deaths worldwide , and othIn addition to providing new insights into coronavirus receptor interactions and host range, characterizing determinants of ACE2 species restriction also has implications for SARS-CoV-2 animal model development. Mouse models have been essential for understanding the pathogenesis of coronaviruses and have been key resources for the preclinical development of vaccines and antiviral therapies \u20137. Howev\u20139\u201314\u2013Based on previous SARS-CoV research and published structures , 18, we In order to evaluate the impact of mACE2 humanization at each of these interaction hot spots, we first modeled the interaction between SARS-CoV-2 RBD and mACE2 . From thTo experimentally test these models, a panel of hmACE2 receptors was generated to directly evaluate whether these predicted contact residues are essential for SARS-CoV-2 infection. The receptors were introduced into mouse delayed brain tumor astrocytoma (DBT-9) cells , 20, norGiven the importance of the three ACE2 interaction hot spots for SARS-CoV-2 infection, we asked whether these same determinants were important for infection by other preepidemic group 2B coronaviruses. We modeled interactions between hmACE2.3 and two related group 2B CoVs, preepidemic SARS-like bat CoV WIV-1  and pang10.1128/mBio.03149-20.3FIG\u00a0S3FIG\u00a0S3, TIF file, 1.6 MB.Structure-based multiple sequence alignment of the RBD from SARS-CoV, SARS-CoV-2, WIV-1, and P5L. Download Copyright \u00a9 2021 Adams et al.2021Adams et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the in vitro  as well as those from species reported to support little to no infection    25, 27), 27in vichicken) , providi, ferrets (Mustela putorius), mink (Mustela lutreola), domestic cats (Felis catus), pigs (Sus scrofa), guinea pigs (Cavia porcellus), dogs (Canis lupus), mice (Mus musculus), and chickens . (b to h) Predicted hotspot contacts between SARS-CoV-2 RBD and the ACE2 molecule from humans (b), macaques (c), ferrets (d), mink (e), cats (f), pig (g), guinea pig (h), dog (i), mouse (j), and chicken (k). (l and m) Predicted hotspot contacts between SARS-CoV-2 variant Y453F and mink (l) and human (m) ACE2. (n) Predicted hotspot contacts between SARS-CoV-2 variant N501Y and human ACE2. Download FIG\u00a0S1, TIF file, 1.2 MB.ACE2 hotspot contacts are predictive of SARS-CoV-2 host range. (a) Aligned hotspot residues of the ACE2 molecule from humans, macaques , pig (b), guinea pig (c), dog (d), chicken (e), and mouse (f). Download Copyright \u00a9 2021 Adams et al.2021Adams et al.https://creativecommons.org/licenses/by/4.0/Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the in vivo by gene editing  and SARS-CoV RBD hACE2 complex (PDB ID 2AJF). WIV-1 RBD was modeled using the reference sequence, GenPept accession no. AGZ48828.1, and P5L RBD was modeled using GenBank accession no. MT040335.1. Additional receptor interactions were modeled from the following translated reference sequences: chicken, GenBank accession no. XM_416822.5; guinea pig, GenBank accession no. XM_023562040.1; ferret, GenBank accession no. XM_004758886.2; pig, GenBank accession no. EU518378.1; dog, GenBank accession no. NM_001165260.1; macaque, GenBank accession no. NM_001135696.1; and mink, GenBank accession no. MT560518.1. Contacts were identified and visualized in the PyMOL molecular graphics system (Schr\u00f6dinger LLC). Structure-based multiple sequence alignment was generated with UCSF Chimera.The ACE2 panel was aligned using Geneious Prime (version 2020.0.5). The hACE2 sequence is found under GenBank accession no. MT461669), icSARS-CoV-2-nLuc (GenBank accession no. MT461671) (KF367457.1). Mouse delayed brain tumor astrocytoma (DBT-9)  , and icW (DBT-9) , 20 cellEach mouse, human, and chimeric ACE2 was expressed in pCDNA3.1 vector that conjugates a C-terminal 6\u00d7-His tag to the end of the expressed protein. The hmACE2 panel was generated with a combination of site-directed mutagenesis and custom double-stranded gBlocks gene fragments (IDT). DBT-9 cells were transfected using Lipofectamine 2000 transfection reagent (Invitrogen). Expression of each receptor was verified via staining against a 6\u00d7-His epitope  and Western blotting.CT) method and fold change over viral RNA in empty vector-transfected cells. SARS-CoV-2 genome equivalents were calculated against a standard curve with a diagnostic genomic assay primer set against Nsp4  of 1 for 1\u2009h. Inoculum was removed, cells were washed with Dulbecco's phosphate-buffered saline (DPBS), and medium was replaced. Receptor usage was analyzed 24\u2009h postinfection. RNA was collected via TRIzol (Invitrogen) and extracted using Direct-zol RNA MiniPrep kit (Zymo Research). Viral RNA was quantified in duplicate via reverse transcriptase quantitative PCR (qRT-PCR) using TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher Scientific) on a QuantStudio 3 (Applied Biosystems). Viral RNA was quantified with a subgenomic diagnostic assay primer set . Host 18nst Nsp4 . ReceptoAll relevant data sets generated or analyzed in this study have been included in the article. Additional information, including replicates, is available upon request."}
{"text": "Friendship plays a crucial role in maintaining social connectedness in late life. Volunteering helps older adults to stay socially engaged and often times provides the opportunity to meet and make new friends. A small literature suggests that volunteering may be associated with friendship, but many studies are limited by reliance on small, non-probability samples and simplistic analytic approaches. The literature is also unclear on how volunteering behaviors relate to specific characteristics of friendships and whether there are gender differences that condition these relationships. Using the 2014 and 2018 waves of the Health and Retirement Study , we investigate whether volunteer status and hours volunteered in 2014 are associated with friendship characteristics in 2018  among community-dwelling adults aged 50 years and above . We also examine whether gender moderated these relationships. Volunteer status and hours in 2014 were positively associated with the number of close friends and contact frequency in 2018. Only those who volunteered 200 hours or more in 2014 were positively associated with friendship quality in 2018. Regarding gender differences, men who volunteered 200 hours or more in 2014 had higher friendship quality in 2018 than women, while women who volunteered 100-199 hours in 2014 had greater contact frequency in 2018 than men. Hence, our results suggest volunteering is integral in shaping late-life friendships and volunteering might be more critical for understanding friendship characteristics among older men and women."}
{"text": "V\u2010raf murine sarcoma viral oncogene homologue B1 (BRAF) is a proto\u2010oncogene that regulates cell proliferation and survival. BRAF V600E\u2010mutated lung cancer has aggressive characteristics and is resistant to chemotherapies. Combination of BRAF\u2010specific inhibitor dabrafenib and mitogen\u2010activated protein kinase kinase (MEK) inhibitor trametinib is the standard treatment for BRAF V600E\u2010mutated lung cancer. We report a case of BRAF V600E\u2010mutated lung adenocarcinoma, which presented with respiratory distress due to deterioration of advanced cancer. The tumour responded rapidly and significantly to BRAF/MEK inhibitors, and the patient's symptoms improved within 2\u2009weeks. BRAF/MEK inhibitors are effective treatment in BRAF\u2010mutated lung cancer even under critical conditions. Combination of BRAF \u2010specific inhibitor dabrafenib and MEK inhibitor trametinib is the standard treatment for BRAF V600E\u2010mutated lung cancer. We report a case of BRAF V600E\u2010mutated lung adenocarcinoma, which presented with respiratory distress due to deterioration of advanced cancer. The tumour responded rapidly and significantly to BRAF/MEK inhibitors, and the patient's symptoms improved within 2\u2009weeks. V\u2010raf murine sarcoma viral oncogene homologue B1 (BRAF) is a proto\u2010oncogene that encodes a serine/threonine kinase, which is a component of the mitogen\u2010activated protein (MAP) kinase pathway that regulates cell proliferation and survival. BRAF mutations are common in a wide variety of cancers. The incidence of BRAF mutations in non\u2010small cell lung cancer (NSCLC) is 1%\u20133%, including in Japan.In February 2020, a 70\u2010year\u2010old woman with no smoking history underwent a chest x\u2010ray at a yearly medical check\u2010up, which showed no abnormalities. In September 2020, she noticed a low degree of fever, fatigue and cough. In October 2020, she was diagnosed with advanced lung adenocarcinoma. The patient was referred to the Department of Medical Oncology for treatment. Due to the worsening of her general condition, she was not eligible for conventional chemotherapy. While waiting for the results of molecular testing and programmed death\u2010ligand 1 (PD\u2010L1) expression analysis of biopsy tissue, in November 2020, the patient presented at our emergency department with respiratory distress. Her oxygen saturation was 88% with supplemental oxygen at 5\u00a0L/min via a cannula. A simple chest x\u2010ray showed bilateral hazy opacities, and a computed tomography (CT) scan showed multiple lung metastases with severe lymphangitis carcinomatosa and multiple liver metastases , has been approved which examines BRAF V600E mutation, in addition to the most common EGFR mutations, and ALK and ROS1 rearrangements.The BRAF V600E mutation leads to the constitutive activation of MAP kinase, which increases its oncogenic properties. The BRAF V600E mutation in NSCLC leads to adenocarcinoma with micropapillary features, indicating the aggressive behaviour of the tumours. The BRAF V600E mutation is associated with poor prognosis and lower response rates to platinum\u2010based chemotherapies in NSCLC.Targeted therapies against the BRAF V600E mutant protein are designed to inactivate the catalytic activities of BRAF and have been approved for patients with BRAF\u2010mutated NSCLC. In a phase 2 clinical trial, combination therapy with dabrafenib and trametinib in V600E\u2010mutated NSCLC showed efficacy.In summary, we describe a case of BRAF\u2010mutated lung adenocarcinoma, which recovered quickly with BRAF/MEK inhibitors. The case illustrates it is worth attempting BRAF/MEK inhibitors in BRAF\u2010mutated lung adenocarcinoma even under critical conditions.None declared.Takayo Ota drafted the original manuscript. All authors were involved in patient management, and read, critically reviewed and approved the manuscript.Appropriate written informed consent was obtained for publication of this case report and accompanying images."}
{"text": "Science in 2005, where it was asked \u2018Where and why does liquid end and glass begin?\u2019. This question continues to attract considerable interest of scientists.The glass transition is the most striking dynamic feature of glass-forming liquids and rigid glass, manifest in the following two scenarios . First, 5\u00a0K/s) glasses including metallic [gT peak in HQ glass that has undergone a certain duration of annealing below gT. The reheating and the subsequent cooling are conducted at the standard rate of 20\u00a0K/min. The glass cooled at this rate is usually defined as the \u2018standard\u2019 glass. The cooling rate for a HQ glass is more than six orders of magnitude higher than the standard rate. The magnitude of the SGT peak is quantified by the difference in isobaric heat capacity (pC) between the annealed HQ glass and the standard glass in the temperature range of the SGT peak, and it is expressed as \u0394pC@Tg,shadow. To distinguish from the real reversible glass transition peak, the endothermic pre-peak was expressed as the shadow glass transition (SGT) by Yue and Angell [As a crucial contribution to understanding of the calorimetric glass transition, several groups of scientists independently observed a striking pre-endothermic event, that is an endothermic pre-peak before the real glass transition starts. This phenomenon occurs in annealed hyperquenched (HQ)  using the chip-based fast scanning calorimetry (FSC) without performing annealing [40Ni40-xCuxP20 glass, a crystallization peak appears subsequent to the glass transition. As illustrated in Fig. pC@Tg,shadow and \u0394pC@Tg, respectively. Figure gT. This implies a bridge between the dynamics and the thermodynamics of \u03b2 relaxation. Interestingly, Yang et al. also discovered that the SGT temperature  first decreases with quenching rate, and then remains unchanged when the quenching rate exceeds 106\u00a0K/s. This indicates that a critical g,shadowT value exists, below which the glass structural domains with the lowest potential energy cannot be rejuvenated to the average energy level of the standard glass.As a significant step towards understanding of SGT, Yang nnealing . In doinet al. provides a great advancement in revealing the nature of the shadow glass transition. Their findings have implications for the connection between the shadow and real glass transitions, as well as for correlation of the shadow glass transition with both \u03b2 relaxation and physical properties of hyperquenched glasses [In summary, the work by Yang  glasses . Their wConflict of interest statement. None declared."}
{"text": "We sought to evaluate androgen receptor (AR) and PI3K pathway activity in ovarian cancer cell lines and tissue and determine if either pathway was correlated with growth of ovarian cancers. AR expression and activity were quantified using immunohistochemistry (IHC) and RT-qPCR in six ovarian cancer cell lines and 51 tissue samples. Phospho-mTOR and AKT expression were quantified by IHC as well. Cell growth was assessed in the presence of AR modulating drugs and metformin. We found that despite robust AR expression and activity, no cell line was dependent on androgen for growth. However, metformin inhibited activity in five of the six cell lines. Patient tissues had large variation in AR expression and activity, as well as in expression of phospho-mTOR and AKT, but none of these variables correlated with progression-free survival (PFS). AR expression and activity did not predict the dependence of ovarian cancer cell lines on androgens for growth, and AR expression and activity did not correlate with PFS. This result suggests that AR expression as a criterion for patient selection for clinical trials evaluating molecules targeting AR may not predict response for ovarian cancer patients. NCT01974765) evaluating single agent enzalutamide, an AR antagonist, in AR-positive ovarian cancers (defined as \u22655 % positivity by IHC), regardless of histological subtype.Epithelial ovarian cancer (EOC) is the most lethal gynecologic malignancy with 22,530 new cases and 13,980 deaths expected in 2019 . These aSeveral observational studies have reported improved survival in cancer patients taking metformin in several malignancies including ovarian cancer . The antIn this study, we quantified the expression and activity of AR and PI3K/AKT pathways in ovarian cancer cell lines and tumor tissue samples and examined the sensitivity of the cell lines to enzalutamide and metformin. Our findings have important implications for ongoing trials with these agents.Cells were provided by collaborators but were originally obtained from the ATCC. SKOV3 cells were maintained in McCoy's 5a Medium Modified with 10% FBS. A2780 cells were maintained in RPMI-1640 with 10% FBS. OV-90 cells were maintained in a 1:1 mixture of MCDB 105 medium containing a final concentration of 1.5 g/L sodium bicarbonate and Medium 199 containing a final concentration of 2.2 g/L sodium bicarbonate, with 15% FBS. OVCAR3 cells were maintained in RPMI-1640 supplemented with 20% FBS and 0.01mg/ml insulin. OVCAR8 cells were maintained in DMEM with 10% FBS. COV362.4 cells were maintained in DMEM with L-glutamine (300mg/L) and 10% heat inactivated fetal bovine serum. For some studies, cells were transferred to media containing charcoal dextran treated (C/S) FBS. Luciferase assays: Cells were transfected using Lipofectamine LTX & Plus (Thermofisher) with PSA-luciferase  and pRL-AR and a 20-gene panel that has been previously used to define an \u201cAR activity score;\u201d [FKBP5, MED28, ELL2, KLK2, PMEPA1, CENPN, C1ORF116, NKX3.1, KLK3, EAF2, TMPRSS2, HERC3) were robustly expressed and androgen-induced in the six ovarian cancer cell lines. The transcript levels, relative to housekeeping genes, were compared to those from LNCaP cells, a prototypical prostate cancer cell line with robust AR activity, and the mean percent of LNCaP transcript levels was reported as the AR activity score.RNA was isolated from cultured cells or from cancerous and benign tissue sections, as marked by the study pathologist, of an unbaked FFPE slide using the FFPR RNA easy kit (Qiagen), as we have done previously . RNA was score;\u201d  this 20  score;\u201d ,16. We fFor growth curves, cells were transferred to C/S medium three days before they were divided and plated at a density of approximately 20,000 cells/well in 48 well plates, in quadruplicate. The following day, vehicle or drugs were added to the cells. Proliferation was determined by measuring the DNA content of the cells in each well. Cells were fixed in 2% PFA, followed by staining for 5min at RT with 0.2ng/mL 4',6-diamidino-2-phenylindole (DAPI) in PBS. The cells were washed with PBS, then read on a fluorescence plate reader (FPR) using 365/439 excitation/emission wavelengths. A Student\u2019s t test was used to determine significant differences among populations.Cell lysates were resolved via SDS-PAGE and transferred to nitrocellulose membranes. Membranes were blocked in 5% milk and probed overnight with antibodies including AR , phospho-Ser473 AKT (GeneTex), phospho-Ser2448 mTOR (GeneTex), or controls: p84, actin, or GAPDH (GeneTex).Patient slides and clinical data were collected under City of Hope IRB16430. IHC was performed using the same antibodies as used for Western blotting. The \u201cIHC score\u201d was determined by taking the average percentage of positively staining cells x the staining intensity (0-3) across eight 40x-fields within the marked cancerous area. Example images were obtained using an Aperio Digital Pathology Slide Scanner.Data were analyzed using a Student\u2019s t test. All analyses were performed at a significance level of *P<0.05. Experimental data are presented as the mean plus or minus standard error.The AR is widely expressed in the normal ovarian epithelium  and alsoAs metformin has shown activity in ovarian cancer patients, growth in the panel of ovarian cancer cell lines was examined in the presence of this drug. All cell lines examined, except OV90, were extremely sensitive to metformin . The OV9There is a well-documented inverse relationship between AR and PI3K activity in prostate cancer; when AR is inhibited, it increases PI3K activity and vice-versa . To inveWe performed IHC for AR in 51 primary ovarian cancer tissue samples representing 48 patients (some with mixed histologies), including low and high grade serous, endometroid, clear cell, and mucinous subtypes, the majority of which were high grade serous . Using aWe also performed IHC for phospho-mTOR and phospho-AKT, another key downstream marker of PI3K activation, on slides of high-grade serous ovarian cancer tissue and scored them using the same system as for AR IHC. Again, we found a wide range of expression among the high-grade serous samples for both phospho-mTOR  and phospho-AKT . To determine if an inverse relationship existed between the PI3K and AR pathways in the high-grade serous cancer tissues, we looked for correlations between AR IHC or AR activity scores and IHC scores for the phosphoproteins. There were no significant correlations. We next investigated the relationship between the IHC and qPCR scores and clinical variables in 38 high-grade serous patients. None of our markers correlated with PFS. However, the AR activity score was lower tumors of patients assessed after neoadjuvant therapy (n=7) than in tumors of patients assessed prior to receiving any chemotherapy (n=31)  . This suFurthermore, we found that AR expression was associated with BRCA1 and BRCA2 status. The mean AR expression in patients with peathogenic BRCA mutations (n=6) was higher compared to the mean AR expression in non-BRCA mutation patients (n=29) .The AR is known to be expressed in ovarian cancer cells, but little is known about the impact of AR expression and activity on the natural history of the disease. In this study, AR expression and degrees of increased signaling activity in response to an androgen agonist, DHT, varied among the six ovarian cancer cell lines. A more comprehensive assessment of AR signaling, the AR activity score, also was evaluated and correlated with AR expression. However, hormonal manipulation of the cell lines suggested that AR stimulation alone was not sufficient to promote growth of these cell lines.We also evaluated whether AR expression or AR activity of their tissue correlated with PFS in 38 patients. Neither AR expression nor the AR activity score was correlated with PFS. The patient samples examined were high-grade serous adenocarcinoma histology, which limits the application of our findings to other ovarian cancer histologic subtypes. Unlike the cell lines, AR expression did not correlate strongly with the AR activity score in tissue samples. This may simply reflect differences in the techniques, or it may imply the existence of cancers with incongruous AR expression and activity, analogous to \u201cAR indifferent\u201d prostate cancers that arise more frequently in highly-treated patients .It is possible that the genes used to define the AR activity score are less relevant in ovarian cancer than they are in prostate cancer. One or several of these genes may be more strongly regulated by transcription factors other than AR in ovarian cancer. This may explain why several samples that had little AR expression detected by IHC still had high AR activity scores. Our results from the cell line experiments suggest caution should be used when using AR expression or activity as eligibility criteria for patient selection on clinical trials that are evaluating molecules targeting AR in ovarian cancer. AR expression or activity may not reflect cancer cell dependency on the androgen pathway and therefore may not predict response to AR antagonists or AR modulators.BRCA1 and BRCA2-mutated high-grade serous ovarian tumors compared to non-mutated BRCA tumors. This is consistent with published data suggesting that BRCA1 status correlated with AR expression in TNBC. Decreased expression of AR has been measured in BRCA1-wild type TNBC cells [BRCA1-mutated malignant cells may have up-regulated AR.In breast cancer, AR expression is associated with improved overall survival regardless of subtype of breast cancer or co-expression of ER. In triple negative breast cancer (TNBC), AR expression is seen in 12-55% of cases and is being evaluated as a therapeutic target in this patient population; in a recent phase II trial of TNBC with AR expression, there was a clinical benefit rate of 35% at 16 weeks and a median PFS of 14.7 weeks with enzalutamide . The resBC cells  and suggNCT02122185). The beneficial effects of metformin extend to other tumors as well. In a colorectal cancer patient population, patients with diabetes treated with metformin had superior overall survival [Other evaluations using the ovarian cancer cell lines included assessing their sensitivity to metformin. All cell lines were sensitive to inhibition by metformin, except for OV90. The OV90 cell line has a BRAF mutation that causes increased PI3K activity, effectively bypassing metformin. These results are consistent with a growing body of literature on the anti-tumor effects of metformin. Metformin has been shown to inhibit ovarian cancer growth and increases sensitivity to paclitaxel in mouse models . In 341 survival .Finally, we investigated the interaction between the PI3K/AKT and AR pathways in ovarian cancer cell lines treated with metformin and enzalutamide. Increased activation of the PI3K/AKT pathway conferred cisplatin resistance in an ovarian cancer cell line, implicatWe evaluated 6 ovarian cancer cell lines and 51 tumor samples from patients with ovarian cancer of various histologies, predominantly high-grade serous adenocarcinoma which comprises more than 70% of ovarian cancers. Although the AR activity score increased to varying degrees in all cell lines exposed to metformin, the activity of the PI3K pathway, as measured by phospho-mTOR, was not increased by the addition of enzalutamide, an AR antagonist. Although there appeared to be some interaction between AR and PI3K signaling in the ovarian cancer cell lines, it was not reciprocal as it is in prostate cancer. Assessment of additional markers of AR and PI3K signaling, and use of PI3K inhibitors that are more selective than metformin, would be useful to clarify the relationship between these pathways in ovarian cancer.The limitations of our study include the small sample size and limited representation of other histologic subtypes except for high-grade serous adenocarcinoma in patient samples. While our study did not support robust reciprocal feedback between AR and PI3K/AKT pathway activity in ovarian cancer, the small sample may prevent this finding from being extrapolated and further studies are warranted in different ovarian cancer histologies. Other limitations include some inherent subjectivity in quantifying immunohistochemistry and technical difficulties in performing and interpreting phospho-proteins by IHC in FFPE tissue.In summary, in our evaluation of 6 ovarian cancer cell lines and 51 ovarian cancer patient tissue samples, AR expression and AR activity did not consistently correlate with each other, growth of cancer cells, or PFS. Caution must be exercised when using AR expression as a selection criterion for clinical trial participation as a way to predict response to AR antagonists. Our study corroborates growing literature supporting metformin as an anti-tumor agent in ovarian cancer. A reciprocal relationship between the AR and PI3K pathway in ovarian cancer is not yet confirmed as it is in prostate cancer."}
{"text": "Biogenic hydroxyapatite (BHAp) is a widely used material in the biomedical area due to its similarities with the bone tissue mineral phase. Several works have been spotlighted on the thermal behavior of bone. However, little research has focused on determining the influence of calcination temperature in the physicochemical and bioactive properties of BHAp. In this work, a study of the physicochemical properties\u2019 changes and bioactive response of BHAp produced from porcine femur bones using calcination temperatures between 900 to 1200 \u00b0C was conducted. The samples\u2019 structural, morphological, and compositional changes were determined using XRD, SEM, and FTIR techniques. XRD results identified three temperature ranges, in which there are structural changes in BHAp samples and the presence of additional phases. Moreover, FTIR results corroborated that B-type substitution is promoted by increasing the heat treatment temperature. Likewise, samples were immersed in a simulated biological fluid (SBF), following the methodology described by Kokubo and using ISO 23317:2014 standard, for 3 and 7 days. FTIR and SEM results determined that the highest reaction velocity was reached for samples above 1000 \u00b0C, due to intensity increasing of phosphate and carbonate bands and bone-like apatite morphologies, compared to other temperatures evaluated. Moreover, HAp exhibits bioactive behavior, biocompatibility, non-toxicity, and osteoconductive properties, necessary for healthcare applications2. HAp is usually used in its stoichiometric form (SHAp: Ca10(PO4)6(OH)2 and Ca/P\u2009=\u20091.67); nevertheless, trying to resemble its natural composition and inspired by it, its non-stoichiometric form can also be used, and commonly called BHAp3.During the last decades, the bioceramics field has generated particular interest due to the increasing demand to develop materials for dental and orthopedic applications. In this context, the hydroxyapatite (HAp) is one of the most widely used bioceramics materials in treating different diseases related to the musculoskeletal system because its composition is very similar to the mineral component of hard connective tissue10\u2212x(PO4)6\u2212y(OH)2\u2212(y+z)4, where x, y, and z correspond to the different cations such as Na+, Mg2+, and Sr2+ and anions like SiO2\u2212 and CO32\u2212, which can occupy calcium, phosphate or hydroxyl ions position in the lattice6. Any ion substitutions can modify the physical\u2013chemical, biochemical, and physiological properties of the HAp and are feasible due to the HAp lattice flexibility and its structural stability7. According to Siddiqui et al.8, the SiO2\u2212, Mg2+, and CO32\u2212 substitutions can enhance the rate of bone growth, bone remodeling and present a better resorption rate, respectively.The BHAp formula can be represented by CaCO32\u2212 substitutions are common in the natural bone, which can replace either hydroxyl  or phosphate 8. Likewise, it has been observed that the B-type substitution is related to a decrease in the a-axis and an increase in the c-axis in the HAp lattice. Besides, Siddiqui et al.8 report that the formula is modified in this way Ca10\u2212x(PO4)6\u2212x(CO3)x(OH)2\u2212x, where 0\u2009<\u2009x\u2009<\u20092 for this type of substitution. It is believed that when BHAp is implanted, the native tissue growth toward the implant is stimulated, establishing a physical\u2013chemical bond with the adjacent tissue. This behavior can improve its application in dental, maxillofacial, and implants devices11.The 15. Each treatment promotes differences in BHAp properties like the degree of crystallinity, Ca/P ratio related to the solubility, ionic substitution, traces of impurities, and particle sizes or shapes, which impact the biological response16. The thermal process is usually involved during BHAp extraction from bones; hence, the temperature plays an important role in eliminating the organic and hazardous biological remnants and generating HAp lattice transformations.Animal bones  are among the most common sources to prepare BHAp, using calcination or a combination of chemical and thermal treatments17 describe that, depending on the heating rate, some of the calcium oxide (CaO), tricalcium phosphates (TCP\u2019s), and tetracalcium phosphates (TTCP) thermal phases can be favored or not as the heating rate increases20.The HAp lattice transformations, the phases, and properties of the BHAp obtained from animal sources are dependent on the temperature and heating and cooling rates and are also related to the trace minerals present in sources. Ellingham et al.21. This kind of test is usually performed following the protocol established by Kokubo et al.22. Briefly, samples are immersed in an inorganic solution with an ionic concentration close to the human blood plasma, known as simulated body fluid (SBF), and the bone-like apatite layer formation as a function of the time is evaluated23.Furthermore, the features of the BHAp can influence its response in a biological environment since some phases are more soluble than others, and the surface reactivity can enhance or harm its behavior. Bioactivity is the way to evaluate the capability of the biomaterial to form a bone-apatite layer. The velocity of layer formation is related to how bioactive the material is. It can be correlated with the BHAp source extraction, processing temperature, and ion substitution in the HAp lattice24. The bioactivity test was performed following Kokubo\u2019s methodology and using ISO 23317: 2014 standard25. The structural and microstructural changes of the BHAp samples were followed using X-ray Diffraction (XRD), Fourier Transform Infrared Spectroscopy (FTIR), and Scanning Electron Microscopy (SEM) results.Although the bioactive behavior of stoichiometric HAp and that of BHAp has been studied in different works, few studies have been found that present the evaluation of samples\u2019 bioactive behavior, obtained from porcine bone as a function of the calcination temperature. Thus, this work aims to study the temperature treatment effect (from 900 to 1200 \u00b0C) on the BHAp samples in the bioactive response24. Briefly, the porcine bones were firstly hydrothermally treated to remove soft tissue and lipids. The samples were then exposed to microwave radiation at 700 W of power and rinsed using a ratio of 1:2 crushed bones/oxalic acid commercial-grade  to soften the peptides bonds. Later, bones were ground in a gravitational miller until the powder achieved particle sizes lower than 38 \u03bcm. The miller conditions used for this method were ball powder ratios 10:1 at 100 rpm. Finally, the resulting powders were subjected to heat treatment between 900 and 1200 \u00b0C, at a 5 \u00b0C/min heating rate and inertial cooling. The temperature was kept for 24 h to promote the HAp phase formation.The BHAp powders were obtained according to the method reported elsewhere\u03b1 radiation (\u03bb\u2009=\u20091.5406 \u00c5) operating at 30 kV and 20 mA. Diffractograms were taken from 10\u00b0 to 70\u00b0 in a 2\u03b8 scale and using a resolution of 0.02\u00b0. The structural changes, the phase fraction, and the Ca/P ratio in each sample after thermal treatments were determined using Rietveld analysis of the XRD patterns by GSAS. The Ca/P ratio was calculated using Eq.  phase (PDF # 47-1743) was found at 29.40\u00b0 in 2\u03b828. In samples thermally treated between 1000 and 1050 \u00b0C, a small contribution at 37.48\u00b0 was found associated with the calcium oxide (CaO) phase (PDF # 37-1497), in addition to the calcite peak29. Finally, the samples treated at temperatures higher than 1100 \u00b0C present \u03b1-TCP (PDF # 29-0359) and \u03b2-TCP (PDF # 09-0169) as additional phases31 . The weight percentages of the phases found in the samples, the changes in the volume of the HAp cell, and the Ca/P ratio calculated using the atoms\u2019 occupancies in the cell obtained by Rietveld refinement through Eq. , 462 cm\u22121 (\u03c52), 1021 and 1087 cm\u22121 (\u03c53), 561 and 598 cm\u22121 (\u03c54)35. The bands at 1044 and 1415 cm\u22121 were also identified, corresponding to the incorporation of CO32\u2212 in the PO43\u2212 sites in the HAp cell38. This change is typical of the B-type substitution in the lattice. Particularly, the shoulder at 1044 cm\u22121 is not observed in the samples with treatments of 900 and 950 \u00b0C, which may be associated with a lower B-type substitution in the HAp cell for these calcination temperatures. This behavior will be reviewed in the discussion section39. Additionally, the bands at 629 and 3570 cm\u22121, corresponding to the hydroxyl group were also identified; these bands are characteristic of the HAp phase40. Finally, Fig. 3 at 1021 cm\u22121, carbonate at 1415 cm\u22121, and hydroxyl at 3570 cm\u22121 as a function of the calcination temperature. In particular, the phosphate group\u2019s intensity for the range of temperatures from 1050 to 1200 \u00b0C decreases with respect to the other calcination temperatures19. On the other hand, the functional groups\u2019 intensities of the carbonate and hydroxyl ions do not significantly change in the range of studied temperatures41.Figure 87 cm\u22121 \u03c5, 561 and\u22121 the vibrations at 1411 and 1456 cm\u22121 associated with the B- and A-type substitution were identified. Besides, the contribution at 1415 cm\u22121 increases its intensity compared to the samples before SBF exposure. Likewise, the shoulder at 1044 cm\u22121 is not observed in the samples treated at 900 and 950 \u00b0C, regardless of the immersion time. In Fig. 3 of the phosphate group shows a slight increase with increasing immersion time in SBF42.Figure 43. Particularly, in the samples treated at 1050 \u00b0C after 3 days of immersion, cracks on the material\u2019s surface and agglomerated spheres of micrometer size are observed , whose enthalpy of formation is favorable compared to Mg(OH)2 (\u25b3Hf\u2009=\u2009\u2212\u2009924.7 kJ/mol), which would be the other compound that could be formed. Hence, MgO is the most thermodynamically stable compound48. Likewise, the presence of CaCO3 in the treated samples in the range of 900 to 950 \u00b0C is attributed to the biogenic source of HAp50, since this range of heat treatment temperature is not sufficient to promote the dissociation of CaCO3 into CaO and CO2 yet51.The behavior of bone powder without heat treatment, observed in the diffraction patterns in Fig. 3 and CaO phases were identified. The total decomposition of calcite depends on the working atmosphere and can occur above 900 \u00b0C, where CaO is obtained, as reported by Gal\u00e1n et al.51. Subsequently, in the samples obtained at temperatures in the range of 1100 to 1200 \u00b0C, CaO and CaCO3 presence was not evidenced. However, the \u03b1- and \u03b2-TCP phases were identified. The CaO and CaCO3 phases\u2019 disappearance, together with the formation of tricalcium phosphates, could be related to a possible reaction of CaCO3 with the phosphate ions released from the HAp lattice due to the CO32\u2212 incorporation. The incorporation of carbonate ions into the HAp lattice would lead to the release of phosphate ions from the cell, resulting in the formula Ca10\u2212x(PO4)6\u2212x(CO3)x(OH)2\u2212x reported by Siddiqui et al.8. Likewise, it has also been reported that tricalcium phosphates can be obtained from the reaction between calcium carbonate and phosphate ions at temperatures around 1150 \u00b0C, according to Chabchoub et al. and Bohner et al.54. Furthermore, the lattice in the BHAp samples is expanded, compared to the stoichiometric one, according to the cell volumes\u2019 values obtained and reported in Table 55.In the samples treated above 1000 \u00b0C, the CaCO40, the coalescence effect occurs in this range of temperature for calcined bovine bone powders. Additionally, Londo\u00f1o-Restrepo et al.18 reported coalescence phenomena in the porcine bone powders associated with crystal growth due to the calcination temperature. They also mentioned that, as the calcination temperature increases, the crystal growth continues, and it is observed on the c-axis.The morphologies for samples prepared at temperatures of 900 and 950 \u00b0C observed in Fig. 57. This growth generates intergranular voids of greater size than those observed in the samples\u2019 images obtained with lower temperatures. Finally, the images show sub-micrometric spherical grains associated with the MgO phase observed in XRD. Ramirez-Gutierrez et al.14 and Forero-Sossa et al.20 have also reported these formations in previous works.In this work, the growth of grains occurs in the c-axis in the samples treated at temperatures higher than 1000 \u00b0C, which agrees with previous reports for the growth of HAp crystals40 and Asadollahzadeh et al.44 mentioned the reduction of the intensities of the carbonate groups at these calcination temperatures. However, these authors did not carry out thermal treatments above this temperature. In particular, Sroka et al.36 studied the influence of the carbonate ions in HAp, finding that when this ion enters the cell and replaces the phosphate ion, the shoulder\u2019s presence at 1044 cm\u22121 is observed in the FTIR spectra using the ATR mode36. In this work, this shoulder is observed for samples with heat treatment above 1050 \u00b0C. Likewise, a decrease in the phosphate group\u2019s intensity was observed, which could be associated with incorporating the carbonate ion for these samples in this temperature range.Regarding the functional groups\u2019 behavior obtained by FTIR for the range of 900 and 950 \u00b0C, some authors such as Sofronia et al.8. On the other hand, Kokubo\u2019s solution in a static environment has been widely criticized due to its low reaction rate compared to other simulated biological solutions. Using these characteristics is possible to obtain false negatives, such as the \u03b2-TCP phase, since this does not show bone-like apatite growth on the surface when immersed in SBF. However, it is a biomaterial known for its biological response in in-vivo assays58. Based on this, it is possible that in other simulated media, such as Hank\u2019s solution, the formation of different phases can be observed due to the ionic interaction between the ceramic and the fluid, as mentioned by Forero-Sossa et al.20.Furthermore, based on the SEM and FTIR results, the non-formation of bone-like apatite in the samples at 900 and 950 \u00b0C could be associated with no carbonate substitution in the HAp cell at these temperatures61. Some authors have also reported that the solubility of TCP in physiological environments is greater than that of HAp, which would increase the reaction speed of samples that present these phases. Those results agree with the findings observed in this work54.Moreover, the samples with calcination temperatures above 1000 \u00b0C showed significant changes in the functional groups\u2019 intensities and the samples\u2019 surface morphology. These results determined that bone-like apatite forms on the samples\u2019 surface were obtained in the temperature range of 1000 to 1200 \u00b0C when exposed to SBF in this temperature range. Particularly, the samples treated with temperatures higher than 1100 \u00b0C show the growth of morphologies associated with bone-like apatite. This group of samples\u2019 higher bioactivity could be related to incorporating the carbonate ion in the HAp lattice and the combination of phases (HAp\u2009+\u2009TCP). According to various works, the phase combination presents improved bioactivity compared to individual ones3 phase was found. Likewise, between 1000 and 1050 \u00b0C, the CaO phase and CaCO3 coexist. Finally, , between 1100 and 1200 \u00b0C, the formation of TCP\u2019s was identified. This result could be associated with the reaction between CaCO3 and phosphate ions released from the HAp cell due to the carbonate ions incorporation on it. High calcination temperatures mediate the proposed mechanism.The effect of the calcination temperature on the physicochemical properties and the bioactive response of BHAp from the porcine source was determined. It was found that the HAp and MgO phases are present in all the samples with the different calcination temperatures studied. Additionally, between 900 and 950 \u00b0C, the CaCOUsing the FTIR results, it was determined that the replacement of the phosphate ions by carbonate ones is greater in the samples prepared at high temperatures. Then, the B-type substitution is promoted at calcination temperatures between 1150 and 1200 \u00b0C, likewise, the A- and B-type substitutions were favored after the bioactivity test.The samples thermally treated at 900 and 950 \u00b0C did not show changes in the spectra and the micrographs during the bioactivity test. However, for the samples treated at temperatures above 1000 \u00b0C, there were changes related to bone-like apatite formation on the samples\u2019 surface. Finally, for the samples with a calcination temperature between 1100 and 1200 \u00b0C, tricalcium phosphates\u2019 presence generates a higher reaction speed than the other samples that did not present these additional phases.Supplementary Information."}
{"text": "Transarterial radioembolization (TARE) is increasingly used as an alternative to transarterial chemoembolization (TACE) for the treatment of hepatocellular carcinoma (HCC). We aimed to perform an overall and individual patient data (IPD) meta\u2010analysis of studies comparing TACE and TARE.We performed a systematic literature search using pre\u2010specified keywords with the aid of an informationist for articles from inception to 3/2020. The primary endpoint was overall survival (OS), and the secondary endpoint was time to progression (TTP).Seventeen studies met inclusion criteria with 2465 unique patients, with one randomized trial, 4 prospective studies and 12 retrospective studies. Barcelona Clinic Liver Cancer (BCLC) stage B (42.8%) was the most common stage followed by BCLC A (30.3%) and BCLC C (29.0%). There was no difference in OS between the two modalities . In three studies with available TTP data, TARE resulted in a longer TTP than TACE . IPD\u2010level meta\u2010analysis of 311 patients from three studies showed no difference in overall OS between the two modalities including among subgroups stratified by tumor stage and liver function. Limitations of the current literature include inconsistent length of follow\u2010up, inconsistency in response criteria, and safety reporting.Current data suggest TARE provides significantly longer TTP than TACE, although the two treatments do not significantly differ in terms of OS. Given limitations of the current data, there is rationale for prospective studies comparing these modalities. In this overall and individual level meta\u2010analysis, patients with hepatocellular carcinoma treated with transarterial chemoembolization and transarterial radioembolization (TARE) showed similar survival. Patients treated with TARE however, had a longer time to tumor progression. The search strategy was included in Appendix\u00a0The Preferred Reporting Items for Systematic Reviews and Meta\u2010Analyses (PRIMSA) guidelines were used to guide study selection and data collection.2.2The search yielded 1784 unique articles that were screened for inclusion by two independent reviewers (AB and IK). Conflicts were resolved with the assistance of a third reviewer (NP). Studies to be included were more closely analyzed by the authors and selected for appropriateness for data extraction. Data were extracted by each reviewer using standardized forms. Forms collected demographic, liver function, cancer staging, unadjusted survival, time to progression data, and adverse events when available. Study quality assessment was performed with Newcastle\u2010Ottawa Scale (NOS).2.3The primary endpoint was overall survival (OS), and the secondary endpoint was time to progression (TTP).2.4Authors of all included studies were contacted for data sharing to include patient\u2010level data to allow IPD meta\u2010analysis, with the authors of three studies responding. These studies included papers by Moreno\u2010Luna et al.,2.5SD=SE*n. For (3), we estimated mean as TQ1+Tmed+TQ33 and standard deviation as TQ3\u2212TQ12\u03a6\u221210.75n\u22120.125n+0.25, where T represents time (OS or TTP), Q1 represents the 25th percentile time, med the median time, Q3 the 75th percentile time, \u03a6\u22121x the upper x\u2010th percentile, and n the number of patients receiving that specific treatment. For (4), we estimated mean as TL+2*Tmed+TH4 and standard deviation as TH\u2212TL3.92, where T represents time, either OS or TTP, L represents the lower bound of the confidence interval, med the median time, and H the upper bound of confidence interval.OS and TTP were reported in four different ways: (1) mean and standard deviation, (2) mean and standard error, (3) median and interquartile range, or (4) median and 95% confidence interval. To facilitate meta\u2010analysis, we harmonized all outcome reporting into mean and standard deviation per (1). For (2), we used reported mean and calculated Overall meta\u2010analysis was performed comparing TACE and TARE using a random effects model incorporating mean OS/TTP, standard deviation, and n for TACE and TARE recipients. We evaluated mean difference of both OS and TTP. Preplanned subgroup analyses stratifying studies by study quality. We assessed publication bias visually using a funnel plot and numerically with an Egger test.IPD meta\u2010analysis was performed using data from three studies. The primary outcome was OS, as data on TTP were not available in the studies in which IPD were available. We generated Cox proportional hazard survival models rather than comparing difference in mean survival as these models are more informative. We conducted pre\u2010specified subgroup analyses based on BCLC stage and CP class, in which we separately evaluated hazard ratio for OS in each study and subgroup, and then meta\u2010analyzed across studies and within each subgroup  using a random effects meta\u2010analysis similar to as described above. Finally, we generated in each cohort a multivariable Cox proportional hazard survival model with outcome of OS and predictor of treatment type (TARE vs. TACE), adjusting for age, sex, CP class, and BCLC stage, and meta\u2010analyzed across the three cohorts as above.p\u2009<\u20090.05 was used for significance in all analyses. All analyses were performed in R version 3.5.1.33.1In total, our initial search revealed 1784 studies, 17 of which met inclusion criteria including 2465 unique patients Figure\u00a0. Twelve p\u00a0=\u00a00.008), but otherwise there were no differences between the groups.Patients receiving TARE were significantly more likely to have chronic hepatitis C as the etiology of their liver disease  was the most commonly used modality in the included studies (8/17). Five of the studies used drug\u2010eluting bead transarterial chemoembolization (DEB\u2010TACE), while three studies used both cTACE and DEB\u2010TACE. One study used TACE with degradable starch microspheres (DSM). Each study had a mix of lobar treatment and segmental treatments.With regard to TARE, the majority of the studies (10/17) used TheraSphere while six studies used SIR\u2010sphere, and one study used both Table\u00a0. Notably3.3I2 97.5%; p\u2009<\u20090.001). In the three studies with available TTP data, TARE resulted in a significantly longer TTP than TACE  .There was no difference in OS between the two modalities with absolute difference \u22120.55\u2009months, 95% CI \u22121.95 to 3.05 (for TARE relative to TACE) . Overall hazard ratio showed no difference in OS between TARE and TACE . The results were consistent in key subgroups stratified by BCLC and CP class   were high quality (NOS\u2009\u2265\u20097) while one study was medium quality (NOS\u2009<7) Table\u00a0. There w) Figure\u00a0.3.6The included studies featured a wide range of adverse events (AE) data. Only four studies reported data on AEs; however, there was significant heterogeneity in the reporting. Any AE associated with TACE patients was 10.8\u201373%, while any AE for TARE patients was 10%\u201344%.4In our updated meta\u2010analysis, we have demonstrated lack of a difference in overall survival in patients receiving TACE versus TARE; however, time to HCC progression was significantly longer in patients receiving TARE therapy. These findings are concordant with the only randomized data comparing TACE and TARE.In the subgroup analyses, there was no difference in overall survival in patients regardless of the modality received. In studies stratifying TACE or TARE by BCLC class, there is consistent decrements in survival with advancing stages. Similarly, several studies have shown the significant decrements in TACE and TARE effectiveness and safety in CP B and C disease. TARE has also been compared to sorafenib in BCLB B and C disease in two randomized trials and was not associated with a survival benefit,Nevertheless, TACE and TARE remain primary treatment options for a significant proportion of patients with HCC and our analysis supports the efficacy of both. TARE was associated with an increased TTP compared to TARE in a subset of the included studies; however, there are notable deficiencies in radiographic interpretation of tumor progression after radiation therapy that may have contributed to this finding.Our study had several strengths and limitations. First, TACE and TARE technique for administration and patient selection were not standardized across the studies. Most of the studies included were retrospective in design, thus bias such as confounding by indication, differences in imaging interpretation, or unmeasured confounders may have contributed to the results of the analysis. Furthermore, treatment with TARE has evolved with several recent studies including personalized dosimetry as the most effective method for TARE delivery; however, most of the included studies utilized lobar treatment or standardized dosimetry.5Current data suggest TARE can provide significantly longer TTP than TACE, although the two treatments do not significantly differ in terms of overall survival in both our overall and individual patient level meta\u2010analysis. Safety profiles appeared to favor TARE; however, these data deserve further prospective confirmation. Given the limitations of the current data, there is rationale for comparing these modalities in larger prospective analyses to allow granular comparison of survival, progression, and safety data.Parikh is the guarantor of this article. Roles: (a) Concept: Parikh; (b) Analysis: Parikh, Chen; (c) Data acquisition: All authors; (d) Writing: Parikh, Brown, Kassab, Singal; (e) Critical revision: All authors.Dr. Singal's research is conducted with support from National Institutes of Health U01 CA230694, R01 MD12565. Dr. Parikh's research is conducted with support from National Institutes of Health U01 CA230669. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. The funding agencies had no role in design and conduct of the study; collection, management, analysis, and interpretation of the data; or preparation of the manuscript.Brown: None. Kassab: None. Massani: None. Townsend: None. Singal: Served as a consultant or on advisory boards for Bayer, FujiFilm Wako Diagnostics, Exact Sciences, Roche, Glycotest, and GRAIL. Soydal: None. Moreno\u2010Luna: None. Roberts: Consults for AstraZeneca, MJH Life Sciences, and Clinical care options; he advises and received grants from Bayer, Exact Sciences, and Gilead; he advises GRAIL, Tavec, QED Therapeutics, Genentech, Envision, and Eisai and received grants from Ariad, BTG International, GylcoTest, RedHill, Ltd Pharma, and Wako Diagnostics. Chen: None. Parikh: Served as a consultant for Bristol Myers\u2010Squibb, Exact Sciences, Eli Lilly, and Freenome; has served on advisory boards of Genentech, Eisai, Bayer, Exelixis, Wako/Fujifilm; and has received research funding from Bayer, Target RWE, Exact Sciences, Genentech and Glycotest.The data included in this study were either publicly available or completely de\u2010identified and were exempt from Institutional Review Board approval.Appendix S1Click here for additional data file."}
{"text": "Poor knowledge, negative attitude, and poor practices were observed among most of the participants. Sensitization and training on AMR and antimicrobial stewardship are recommended to address the KAP score gaps and the observed determinants among veterinary drug dispensers.Antimicrobial resistance (AMR) is an emerging challenge to global public health. The use of antibiotics in the veterinary field is one of the contributing factors to AMR mostly due to poor knowledge, attitudes, and practices (KAP) of dispensers. Veterinary drug dispensers are expected to guide clients on indications, contraindications, and withdrawal periods of veterinary drugs. This study assessed veterinary drug dispensers\u2019 KAP toward AMR and associated potential contributing factors. A cross-sectional study, using a structured questionnaire, was conducted in three main cities of Malawi, namely Mzuzu, Lilongwe, and Blantyre. A total of 68 agrovet shops were selected using a simple random sampling technique. The KAP level was presented descriptively. Bivariate and multivariable analyses were run to investigate the relationships between the independent and outcome variable. Overall, the KAP score for knowledge, attitude, and practices was 46.7%, 49.2%, and 41.6%, respectively. The significant determinants of the knowledge were the practice of asking for a written prescription  ( Antimicrobial resistance (AMR), an emerging public health challenge is increasing worldwide ,2,3,4. GIn the wake of AMR burdens, several sub-Saharan African countries developed AMR preparedness plans, and East African countries reported the strongest AMR response ,11. In cEscherichia coli and from 11.8% to 90.5% for Klebsiella species. Kumwenda et al. [Klebsiella species was , Staphylococcus aureus , Proteus species , and Streptococcus pneumoniae . Furthermore, Musicha et al. [Malawi has the most comprehensive data sets for AMR burden in sub-Saharan Africa, which depicts the growing trend of AMR burden in humans ,16,17,18a et al.  also repa et al.  reporteda et al. ,21, whica et al. ,23.Malawi has unclear AMR surveillance in animals and the environment, despite having less stringent regulations on accessing veterinary drugs ,22,23. VThe prudent use of veterinary drugs depends on the knowledge of the veterinary drug dispensers as well as on the awareness and knowledge of the livestock farmers ,27. MostThe study recruited 68 respondents from agrovet shops. The geographical distribution of the participants included 24 from Blantyre, 32 from Lilongwe, and 12 from Mzuzu. Of the participants, 30.9% (21/68) were female and 69.1% (47/68) were males. The general agrovet shops were the majority 94.1% (64/68) compared to poultry drugs only and feed shops 5.9% (4/68). More than half of agrovet shops 82.4% (56/68) were located within the town centers, while 17.6% (12/68) were located within the residential areas .The overall frequency . The study found a higher frequency of oxytetracycline brands 27.9% (12/43) among the available antibiotic brands. The concentrations of oxytetracycline among the brand names varied a lot which included 2%, 5%, 8%, 10%, 12.5%, and 20%. Other antibiotic brands were sulfa-333 20.9% (9/43), penstrep 9.3% (4/43), gentaject 6.9% (3/43), and colistin 4.6% (2/43), and among least was aliseryl 2.3% (1/43). Aliseryl was observed in all poultry-drugs-only veterinary product shops that participated in the study.p = 0.037). About three-quarters of participants, 76.5% (52/68), knew about AMR and its occurrence in livestock and humans. Furthermore, the majority of the participants knew about the national AMR strategic plan, although the distribution of the KAP score was significantly different across the cities (p = 0.046) (The majority of the participants 75.0% (51/68) were aware of the uses of antibiotics, and 48.5% (33/68) knew that antibiotics could not cure all diseases that affect the livestock. Lilongwe city had a higher KAP score of 90.6% (29/32) compared to the other two cities for knowledge of the curative effects of antimicrobials (= 0.046) .p = 0.028). However, only 10.3% (7/68%) of participants claimed that they asked for written prescriptions from the clients, and very few participants, about 7.3% (5/68), were guided by written prescriptions. About half of the participants 52.9% (36/68) had an interest in knowing whether the person administering the drugs was competent (The majority of the participants 98.5% (67/68) provided information on the use of veterinary drugs, and about 82.4% (56/68) informed the clients about the withdrawal period. Participants in Lilongwe had higher KAP scores for the practice of providing information for the use of veterinary drugs than participants in the Blantyre and Mzuzu cities (ompetent .p = 0.021). A higher proportion of participants 83.8% (57/68) considered that antibiotics should be prescribed only by veterinarians and the distribution of scores was different among the cities (p = 0.011) (The study found that 70.6% (48/68) of participants considered that the occurrence of AMR in livestock was severe, and 89.7% (61/68) of the participants considered drug residue was responsible for AMR in livestock and humans. In addition, 67.7% (46/68) considered careless use of drugs contributed to AMR in livestock, although the distribution of KAP scores was significantly different among the cities\u201416 for Blantyre, 22 for Lilongwe, and 8 for Mzuzu (= 0.011) .p-0.022, p-0.015, and p-0.039, respectively. Mean scores for the 18\u201335 age group were higher 29.6 \u00b1 8.1, 27.2 \u00b1 14.3, and 31.3 \u00b1 5.2 than the \u226535 age group for knowledge, attitude, and practices, p-0.017, p-0.022, and p-0.024, respectively  but different for attitude , .p = 0.015); sex (p = 0.001), location of shop (p = 0.001), work experience (p = 0.001), knowledge of the occurrence of AMR in livestock and humans (p = 0.001), the practice of asking for a written prescription (p = 0.001), and the practice of informing customers on withdrawal period (p = 0.001). Thereafter, the variables were screened for multicollinearity using univariate linear regression  had a high-level KAP score for AMR at a cutoff point of 50% and above. Pearson chi-square was run to assess the association between the potential determinants and AMR knowledge. There was an association between high level and the potential determinants such as age (gression .p = 0.024). Female participants were OR: 0.609 (95% CI: 0.3\u20130.9) times less likely to be knowledgeable about AMR than male participants that knew AMR (p = 0.001), and older participants (\u226535) were OR: 0.227 (95% CI: 0.1\u20130.5) times less likely to be knowledgeable about AMR than participants that knew AMR (p = 0.004).The significant determinants of AMR KAP were sex, age, and the practice of asking for a written prescription. Odds ratios (OR) are presented in This is the first report on the assessment of KAP of veterinary drug dispensers regarding AMR in Malawi. The results of this study demonstrated that there was poor knowledge, negative attitudes, and poor practices among most of the veterinary drug dispensers toward AMR in the three cities that were sampled. The most dispensed class of antibiotics was tetracycline. The following were the observed determinants: the practice of asking for a written prescription, female, and old age of the veterinary drug dispensers.The current study\u2019s finding that the overall mean KAP score for knowledge, attitude, and practice is suboptimal is similar to results in Nigeria, Myanmar, and Morocco ,29,30. TIn addition, the study observed that aliseryl, a brand of antibiotics composed of tetracycline, erythromycin, streptomycin, colistin, and vitamins, is used for noneffective dose as a growth promoter, feed efficiency booster, and production booster on a daily basis in livestock as previously reported in more than seven countries ,35. ThisFurthermore, our findings suggested insufficient knowledge about antimicrobial usage, residue, and resistance among veterinary drug dispensers similar to what was reported in Morocco . MoreoveLike pharmacists in the medical field, veterinary drug dispensers have a role in controlling antibiotic abuse and the spread of AMR ,46. In oThe participants\u2019 attitude was suboptimal, despite obtaining good scores on some questions. Participants\u2019 perception toward specific areas was encouraging and could be used as a cornerstone for the improvement of AMR stewardships . Most paThe study was conducted in three main cities of Malawi, namely, Blantyre, Lilongwe, and Mzuzu . These tA cross-section study was conducted in three main cities of Malawi, namely, Blantyre, Lilongwe, and Mzuzu because of the presence of main agrovet shops . The citA structured questionnaire was developed principally based on questionnaires used in previous similar studies ,51,52,53Questionnaires were prevalidated for relevance, accuracy, clarity, simplicity, and understandability and Cronbach\u2019s alpha coefficient of 0.74, 0.76, and 0.72 for knowledge, practice, and attitude, respectively, indicating the internal consistency and reliability of the study questionnaires . The queData for the five most antibiotics on demand were grouped according to the class of active ingredients. The frequency of the antibiotic classes was calculated based on the number of responses.t-test and the chi-square test [Scores for knowledge, attitude, and practice were calculated by adding correct/positive responses  as previously reported by ,55. Goodare test .\u00ae2019. Data analysis was conducted using SPSS Ver. 21  statistical software. Before data analysis, every correct response was accorded a value of 1 and otherwise, and the response was accorded a 0 value. The normality test was done graphically using QQ-plots and Shapiro\u2013Wilk test; thereafter, the Student t-test or One-Way ANOVA was used to compare the mean differences across explanatory variables for knowledge, attitude, and practice scores. The Chi-square test was used to assess the association between AMR knowledge, attitude, and practice and independent variables. Multicollinearity was checked using Variance Inflation Factors (VIF)  and Tolerance . Thereafter, a multivariable linear regression model was fitted, which included variables that retained significance (p < 0.05) at univariate analysis [p-value less than 0.05 were considered significant predictors of AMR knowledge, attitude, and practice.The response alternatives for knowledge, practice, and attitude were mostly dichotomous, presented as \u201cyes\u201d or \u201cno\u201d, meaning \u201ctrue\u201d or \u201cfalse\u201d, respectively. Data were cleaned and validated in Microsoft\u2122 Excel Spreadsheet (Microsoft Office Excelanalysis ,55. The This study found poor knowledge, negative attitudes, and poor practices concerning AMR among most of the participants. Sensitization and antimicrobial stewardship training are recommended to address the KAP score gaps and the observed determinants among veterinary drug dispensers. The government should consider ways to scale up its regulations on veterinary drug dispensers. It is imperative to conduct a similar future study among veterinarians to ascertain the reported results. Subsequently, it is critical to strengthen antimicrobial stewardship programmers in the veterinary sector in Malawi."}
{"text": "Rapid and accurate pathogen diagnosis is an urgent unmet clinical need for recurrent urinary tract infection (RUTI) in kidney transplant recipients (KTRs). Metagenomic next-generation sequencing (mNGS) may offer another strategy for diagnosing uropathogens but remains to be studied.Nineteen KTRs with RUTI were collected in this study. The uropathogens were detected and compared by mNGS and urine culture, respectively. Modifications of the anti-infection strategy were also assessed.p < 0.01) and in identification rates for bacteria , for viruses , and for fungi , respectively. mNGS identified a significantly higher proportion of mixed infections than culture . The anti-infection therapies were adjusted in two (33.3%) and 12 (76.9%) cases guided by culture and mNGS, respectively.Rich and diverse pathogens were revealed by mNGS. mNGS was significantly higher than culture in total positive rate (100.0% vs. 31.6%; mNGS has more remarkable etiological diagnostic performance compared with urine culture for KTRs with RUTI to guide anti-infection strategies and, in turn, protect the graft. Kidney transplant confers profound survival benefits for the treatment of end-stage kidney disease. With the widespread application of potent immunosuppressive agents and improved organ preservation techniques recently, the 1-year survival rate of kidney transplants has increased to more than 90% . The perCurrently, conventional urine culture is recommended as an economical and convenient method to detect uropathogens for RUTI in clinical testing and can also be used for drug susceptibility testing (DST). However, this method is time consuming, prone to contamination, and difficult to identify multiple infections, and its sensitivity and specificity are unsatisfactory. Therefore, there is an urgent need to develop rapid and reliable diagnostic techniques for RUTI pathogens to address this problem in clinical practice.Metagenomic next-generation sequencing (mNGS) is an emerging method for the identification of pathogens. Since its successful use in 2008 for detecting new pathogenic infections , mNGS haThis study aimed to evaluate and compare the diagnostic performance of these two methods: urine culture and mNGS, for the rapid and accurate identification of pathogens in KTRs with RUTI.This study was conducted in Henan Provincial People's Hospital, a tertiary teaching hospital in Zhengzhou, China, from July 2019 to May 2021. A total of 19 KTRs diagnosed with post-transplant RUTI were screened and eventually investigated in the present study . The incThe collection of all samples followed the standard operating procedures conforming to the rules of the aseptic technique and was transported to the sequencing laboratory by the cold chain in time.According to the manufacturer's operational guidebook, TIANamp Micro DNA Kit  was used for DNA extraction. DNA extraction was conducted for each sample, while RNA extraction and reverse transcription were applied according to the patient's manifestations at the discretion of the physician's clinical decisions, particularly if a viral infection was suspected.\u00ae dsDNA HS Assay Kit . Agilent 2100 Bioanalyzer  was used to evaluate the DNA concentration and fragment size in the library to be sequenced for the quality control of the DNA libraries. DNA nanospheres were prepared by one-step DNB kit . The MGISEQ-200 platform sequenced quality-qualified libraries.The total DNA or cDNA was subjected to library construction through an end-repair method. A specific tag sequence was introduced at the end of each library. The library concentration was determined by Qubit 4.0 nucleic acid fluorescence quantitative analyzer  and Qubitftp://ftp.ncbi.nlm.nih.gov/genomes/) and other public databases.After removing low-quality (<35 bp) and low-complexity reads according to PRINSEQ (version 0.20.4) and computational subtracting human host sequences mapped to the human reference genome (hg38) from the sequencing data by Burrows\u2013Wheeler Alignment (0.7.10-r789), high-quality sequences were generated. The remaining non-host sequences were matched and classified with four self-constructed genome databases of pathogenic microorganisms consisting of bacteria, fungi, parasites, and viruses, which were downloaded from the National Center for Biotechnology Information  and MacConkey agar plate (BD BBL prepared plated media) were used for culture of bacteria at 37\u00b0C under aerobic, microaerophilic, or anaerobic conditions for 24 h. If pinpoint growth was seen at 24 h, the agars were held for another 24 h under the same conditions. Each distinct colony morphology was subcultured at 48 h to obtain pure culture for microbial identification. The fungi were cultured on Sabouraud dextrose agar plates at 37 or 27\u00b0C for 1\u20135 days. A positive urine culture is defined as \u226510,000 colony-forming units of a potential uropathogenic per mL of urine . All othP < 0.05.Continuous data conforming to a normal distribution were reported as the mean \u00b1 standard deviation value; continuous data outside the normal distribution were presented as median and interquartile range (IQR). Categorical data were presented as the number of cases and percentage (%). The McNemar Chi-square test was conducted to compare the results of mNGS and traditional culture to determine the differences. Fisher's exact probability test was used to compare the proportion of patients with negative and positive cultures who changed the antibiotic treatment based on the mNGS results. Our data, prior literature, and power calculation determined sample sizes. Data analyses were performed using Statistical Package for the Social Sciences (SPSS) version 24.0 statistical software . All P-values were two-sided, and statistical significance was defined as All kidney transplants in this study were performed in Henan Provincial People's Hospital. No organs were procured from prisoners or other institutionalized persons, and all organ donations were contributed voluntarily. Participants provided written informed consent before the collection of samples. The study was conducted following the Declaration of Helsinki. Ethical approval was provided by the Clinical Research Ethics Committee of Henan Provincial People's Hospital.Details of the clinical characteristics of the 19 KTRs with RUTI enrolled in this study are presented in All KTRs received anti-thymocyte globulin induction to prevent renal allograft rejection before surgery. After the transplant, they were initially treated with the standard immunosuppressive regimen, consisting of tacrolimus, mycophenolate mofetil (MMF), and prednisone. The tacrolimus dosage was weight-based and then adjusted according to close monitoring to maintain tacrolimus blood concentrations within the therapeutic range to ensure efficacy and safety.Escherichia coli , Klebsiella pneumonia , Staphylococcus epidermidis , Micrococcus luteus , and Lactobacillus iners . The positive rate of viruses was 57.9% (11/19) by mNGS, of which JC polyomavirus , Cytomegalovirus , and Torque ateno virus  were the most commonly seen. The positive rate of fungi was 42.1% (8/19) by mNGS, of which Malassezia restricta  and Aspergillus flavus  were the most commonly seen.A total of 19 samples were tested by mNGS. A total of 19 bacterial species were detected in 17 samples (89.5%), six viruses in 11 samples (57.9%), and six fungal species in eight samples (42.1%). Escherichia coli , Enterococcus faecium , Klebsiella pneumoniae , and Staphylococcus epidermidis . No fungus was found in all urine cultures.Colony growth was observed in six cases  by urine culture . Speciesp < 0.001). In comparison with culture, better performance of mNGS in detecting viruses and fungi  was evident in these results.All samples underwent both mNGS and urine culture methods. Enterococcus faecium and Staphylococcus epidermidis was detected positive by culture but failed to be reported by mNGS in patient P8. mNGS missed two bacteria that tested positive by culture, which may be related to the patient's antibiotic treatment before mNGS. Among the 13 culture-negative cases, mNGS results were all positive, of which 11 cases were bacterial positive, seven cases virtual positive, and eight cases fungal positive. Notably, of these fungi, none were detected by culture according to the positive criteria. It is noteworthy that mNGS has tremendous advantages in detecting viruses that traditional culture methods do not, indicating mNGS' potency in detecting unexpected viruses. In addition, using mNGS, the diagnostic speed can be nearly two times faster than the traditional culture method (2\u20133 vs. 3\u20136 days).The six positive cases found in the urine culture were a subset of the positive cases in mNGS, while the corresponding pathogens detected by the two methods were not identical. Most of the pathogens found by mNGS were not detected by urine culture. However, most of the pathogens detected by urine culture can be detected by mNGS. Nevertheless, the infection of p < 0.001).In the multipathogen infection cases, mNGS detected a mixture of bacteria in 13 cases (68.4%), a dual virus infection in four cases (21.1%), and a dual fungi infection in two cases (10.5%). Mixed infections of bacteria and viruses were detected in six cases (31.6%). Mixed fungal and bacterial infections were detected in two cases (10.5%). Mixed infection of viruses and fungi was detected in one case (5.3%). Mixed infections of bacteria, fungi, and viruses were detected in four cases (21.1%). By comparison, mNGS showed a significantly higher proportion of multipathogen infections identified than culture -Ia, CTX-M-50, KPC-12, SHV-110, AAC(6')-Ib7, mdtN, mdtF, efrB, and tet(C), which cause resistance to cephalosporins, carbapenems, macrolides, aminoglycoside, tetracyclines, or nucleoside antibiotics.Genes encoding antimicrobial resistance were determined from bacterial genome sequences using mNGS. Antibiotic resistance genes were detected in five  patients. Three kinds of bacteria are involved: p = 0.129). Meanwhile, 69.2% (9/13) of the solely mNGS-positive cases and 66.7% (4/6) of culture-positive cases showed no RUTI at 6 months of follow-up . The cure rate was 68.4% (13/19).All patients were empirically given antibiotics for anti-infection treatment after admission, and the degree of immunosuppression was reduced. Antibiotics were adjusted in time according to the results of mNGS or urine culture and DST . In cultFor KTRs, urinary tract infections present recurrent and refractory characteristics because of the long-term application of immunosuppressants, the anatomical changes of the urinary system, and the repeated dialysis before transplant, which may result in impaired kidney function, and graft failure, or even death , 4. HoweEnterococcus faecalis infection in the urine, which was quickly controlled with the appropriate antibiotics. Mouraviev and Mcdonald . We found that the urinary tract in KTRs with RUTI harbored a rich and complex microbiota by mNGS, in which the dominant groups of bacteria were Escherichia coli, Klebsiella pneumoniae, Staphylococcus epidermidis, Micrococcus luteus, Lactobacillus iners, and Enterococcus. Previous studies showed that Escherichia coli, Klebsiella pneumoniae, Proteus mirabilis, Enterococcus, and Staphylococcus putrefaciens were the most common pathogenic microorganisms in general urinary tract infections . The identification of infections of multiple pathogens can guide effective anti-infection treatment. Additionally, the information on antibiotic resistance provided by mNGS from urine samples of KTRs with RUTI can help evaluate the infection risk. We analyzed the antibiotic resistance genes of the bacteria detected in the mNGS test. Five patients detected three drug-resistant bacteria, including Klebsiella pneumoniae, Escherichia coli, and Enterococcus faecalis, suggesting that these three bacteria are common drug-resistant bacteria in KTRs with RUTI. Among them, Klebsiella pneumoniae was detected with various drug-resistant genes, which brought difficulties to the treatment. Nevertheless, we achieved an excellent curative effect after the adjustment of antibiotics in time according to mNGS, demonstrating the advantages of mNGS in treating KTRs with RUTI.Apart from this, we also found that every patient after transplant diagnosed with RUTI could carry a variety of pathogens in the urethra. mNGS showed a significantly higher proportion of poly-microbial infections identified than culture  can be found at: The study involving human participants was reviewed and approved by the Clinical Research Ethics Committee of Henan Provincial People's Hospital. The patients/participants provided their written informed consent to participate in this study. Written informed consent was obtained from the individual(s) for the publication of any potentially identifiable images or data included in this article.WD and XT contributed to the study conception, design, and drafting of the manuscript. WD, YY, and JZ contributed to the acquisition, analysis, interpretation of data, and performed statistical analyses. XT and TY provided administrative, technical, material support, and study supervision. All authors contributed to the article and approved the submitted version.This work was supported by the Project of Science and Technology of Henan Province (Nos. 202102310438 and 222102310264), the 23456 Talent Project Foundation of Henan Provincial People's Hospital (No. ZC20200327), the Joint Construction Project of Henan Medical Science and Technology Research Plan (Nos. LHGJ20210042 and LHGJ20210068), and the Foundation of Henan Educational Committee (No. 22A320012).The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "Various neurotrauma and neurodegenerative disorders alter the communication between the brain and the regions of the spinal cord that control movement. The consequences are permanent motor deficits or even complete paralysis.The neurons responsible for the production of leg and arm movements are located in the lumbar and cervical regions of the spinal cord, respectively. Epidural electrical stimulation (EES) applied over these regions of the spinal cord can reactivate these neurons . EvidencThis understanding translates into stimulation protocols that target the individual dorsal roots with a timing that reproduces the natural spatio-temporal activation patterns of motor neurons underlying the intended movement ,3. SpatiWe reasoned that a brain\u2013spine interface (BSI) could remedy these limitations. The underlying idea was to establish a natural link between the brain and spinal cord to enable patients to exert direct control over the protocols of stimulation Fig. .The implementation of this digital bridge involves several neurotechnological challenges, including the capability to decode motor intentions from neural recordings of the cerebral cortex. Various strategies have been tested to operate neuroprosthetic systems with neural recordings, from non-invasive to highly invasive neurotechnologies . For exaWe concluded that validating the concept of BSI in preclinical models would benefit from the highest possible resolution. We therefore selected intracortical microelectrodes to record neural activity from the cerebral cortex. We implanted an intracortical 96-electrode array into the primary motor cortex of nonhuman primates and interfaced this array with an upgraded clinical implantable pulse generator (IPG) enabling real-time control of EES through a wireless bridge. This technology was critical since walking requires the use of untethered systems to enable unconstrained mobility. We thus pioneered a BSI whereby the detection of gait events triggered electrical spinal-cord stimulation protocols that aimed to elicit these events. This BSI restored voluntary control of movements from a paralysed leg in a nonhuman primate model of SCI . We receThese studies have provided critical proofs of concept on the ability of BSIs to restore some degree of control over leg and arm movements after paralysis. Our next objective is to test these concepts clinically. For these applications, we believe that electrocorticographic (ECoG) signals offer the best compromise between invasiveness and spatial resolution. ECoG recordings have been shown to provide sufficient temporal and spatial resolution to decode motor intentions from both leg and arm regions, to remain stable over extensive periods of time, and to withstand movement-related artifacts . MoreoveThe second key neurotechnology for the design of a clinically viable BSI is an IPG with ultrafast control over multiple stimulation waveforms via wireless links . This IPG must be interfaced with a surgical paddle lead that integrates an appropriate density and distribution of electrodes to recruit the individual dorsal roots projecting to the spinal segments embedding the targeted motor neurons. The topology of the dorsal roots differs significantly across the human population, suggesting that a library of paddle leads may be necessary for large-scale deployment of a clinically viable BSI.The choice of EES technology and epidural electrocorticographic recording will enable long-term use of the BSI system. Indeed, EES has been routinely used to treat chronic pain for >50 years. Stimulation remains stable over decades, only requiring surgical replacements in a minority of cases . The lonThe therapeutic impact of BSI technologies may not be limited to the immediate restoration of movements. Evidence suggests that this type of neuroprosthetic system triggers neuroplasticity of residual nerve connections, which may augment neurological recovery even when the BSI is turned off . For exaBSI technologies are amongst the most promising solutions to restore some degree of control over leg and arm movements in people with paralysis. Recent technological breakthroughs in neuroelectronics, signal processing, machine learning, and computational modeling have opened a realistic path to design fully implantable clinical BSIs that could have a real medical, societal and economic impact."}
{"text": "The effect of laparoscopic gastrectomy (LG) for the treatment of advanced gastric cancer (AGC) is still controversial. The aim of this meta-analysis was to contrast the short- and long-term outcomes of laparoscopic versus conventional open gastrectomy (OG) for patients with AGC.Databases including PubMed, Embase, Scopus, and Cochrane Library were systematically searched until December 2021 for randomized controlled trial-enrolled patients undergoing LG or OG for the treatment of AGC. Short-term outcomes were overall postoperative complications, anastomotic leakage, number of retrieved lymph node, surgical time, blood loss, length of hospital stay, and short-term mortality. Long-term outcomes were survival rates at 1, 3, and 5 years.2 = 34%) and anastomotic leakage  was found. Compared with the open approach, patients receiving LG had fewer blood loss  and shorter length of hospital stay . However, the LG was associated with a lower number of retrieved lymph nodes  and longer surgical time . Furthermore, there were no differences between LG and OG groups in short-term mortality and survival rate at 1, 3, and 5 years.A total of 12 trials involving 4,101 patients  were included. No effect on overall postoperative complications . Gastric cancer is one of the most common cancers and a main economic burden worldwide . AccordiNowadays, the LG has gained growing popularity in the treatment of EGC since this minimally invasive technique has some definite benefits including lower postoperative complications, faster recovery, shortened postoperative length of stay, and better quality of life. Previously, several well-designed randomized controlled trials (RCTs) from China, Korea, and Japan demonstrated the beneficial short-term outcomes of laparoscopic distal gastrectomy (LDG) including less blood loss and postoperative pain, faster recovery, and shorter hospital stay, and similar oncologic safety to the open approach \u201310. HoweRecently, the CLASS-01  and KLASWe conducted this meta-analysis according to the updated PRISRMA statement  (SuppleThe inclusion criteria were as follows: 1) population: adult patients (older than 18 years) with AGC; 2) intervention: laparoscopic surgery for gastrectomy; 3) comparison: open surgery for gastrectomy; 4) outcomes: short-term outcomes including postoperative complication, number of retrieved lymph nodes, surgical time, blood loss, length of hospital stay, and short-term mortality . Long-term outcomes were survival rate at 1, 3, and 5 years, including OS rate and disease-free survival (DFS) rate; 5) design: RCT.The data from included trials were independently extracted by two reviewers (JJ and SW). The characteristics of included studies  are recorded in For the methodological quality of including studies, two authors (JJ and SW) independently assessed the quality by using the Cochrane risk-of-bias tool .2) statistics  with 95% confidence interval (CI) for dichotomous outcomes, and continuous outcomes were pooled as mean difference (MD) with 95% CI. The meta-analysis of OS and DFS used the hazard ratio (HR) with 95% CI reported in the primary studies. If the primary studies did not provide the HR data, we obtained the HR data by digitizing the Kaplan\u2013Meier survival curves . The hetatistics . Substanion bias .A predefined subgroup analysis was performed based on the extent of resection  and tumor stage . In addition, a sensitivity analysis by omitting each one trial at a time was performed to explore the effect of individual trials.The initial search identified 1,567 articles , 802 were duplications, and 708 studies were excluded through title and abstract screening. In the full-text assessments, 45 studies were further excluded with reasons and a total of 12 trials with 17 articles , 15\u201328 wIn addition, the number of retrieved lymph nodes, length of hospital stay, and blood loss in two trials , 20 wereThe quality assessment results are presented in 2 = 91%) and similar 5-year survival rate .The funnel plot and Egger\u2019s test were used to evaluate the publication bias  and tumor stage  were performed to explore the potential discrepant treatment effect of different subgroups , we diviThe extent of resection had no effect on the overall postoperative complications, anastomotic leakage, short-term mortality, and long-term outcomes. Similarly, there was no significant difference in minor and major complications between the LG and OG groups. The beneficial effect of LG in reducing the length of hospital stay and blood loss was more significant after total gastrectomy than partial gastrectomy. Moreover, compared with total gastrectomy, patients receiving partial gastrectomy by a laparoscopic route was associated with more significantly longer surgical time and lower number of retrieved lymph nodes than open surgery.Regarding tumor stage, five trials , 21, 25 In the sensitivity analysis, the LG was relevant to the obvious decrease in postoperative complications  after omitting the CLASS-01 trial, indicating the poor robustness. Furthermore, other short- and long-term outcomes showed no significant differences with primary results , difficulty , efficiency , and its long-term oncologic results (OS and DFS rates). The results of our meta-analysis indicate that the short-term outcomes consisting of blood loss and length of hospital stay are in favor of a laparoscopic approach, especially for total gastrectomy. Since the advanced laparoscopic approach provides a magnified surgical view while minimizing the length of the incision, a more delicate surgical manipulation of the organs, vessels, and nerves could be achieved during operation . In addiThe overall postoperative complications, including minor and major complications, were similar between the two surgical procedures in our study. However, a recent meta-analysis of data from 6 RCTs and 18 non-randomized trials found that LG was associated with a lower postoperative complication rate, with a significantly lower incidence of medical and minor surgical complications . The difBased on the updated studies, LG requires a longer surgical time, which is in line with the results of all included trials. Compared with open approaches, laparoscopic techniques are more complex and less flexible. Frequently cleaning cameras and changing instruments during operation can also extend the surgical time , 43. In Although the result of our meta-analysis indicates that the number of retrieved lymph nodes was lower in the LG group, the mean number of retrieved lymph nodes in the LG group was 32.45 (95% CI 29.01 to 35.89). Based on the American Joint Committee on Cancer, an adequate dissection should include at least 15 lymph nodes for patients with gastric cancer to ensure accurate and robust N staging . A recenFurthermore, the learning curve was proved to have significant effects on most of the important surgical and short-term recovery outcome parameters . Yoo et\u00a0However, some limitations of our meta-analysis must be acknowledged. First of all, the sample size of some included trials was relatively small, which may decrease the credibility of the results in our study or lead to small study effect bias . SecondlLast but not least, there was significant heterogeneity in some pooled estimates, which might be explained by differences in sample sizes, surgeons\u2019 experience, perioperative care protocols, surgical technique, pre- and postoperative chemotherapy, and other factors. Variations in sample size among studies were large, and some studies enrolled patients during a wide study interval, which may have introduced biases due to a progression in mastering the surgical skills and improvements in surgical instruments.Our findings, which are contingent on rigorous meta-analyses of high-quality RCTs, suggest that LG offers improved short-term outcomes including shorter hospital stays and fewer blood loss, with comparable postoperative complications, short-term mortality, and long-term survival rates when compared to the open approach. However, considering the significant heterogeneity, more RCTs are needed to further evaluate the clinical outcomes of LG versus OG for patients with AGC. Furthermore, this updated meta-analysis could be the basis of future meta-analyses, as the inclusion criteria, statistical analysis, and short- and long-term outcomes were clearly defined and meticulously analyzed.The original contributions presented in the study are included in the article/JJ and SW conceived the idea, performed the analysis, and drafted the initial draft writing of this paper. GY, JW, and XX contributed to the collection and interpretation of data. KZ helped to frame the idea of the study and provided technical support. SW contributed to the revision of this paper and the final approval of the version to be published. All authors contributed to the article and approved the submitted version.The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher."}
{"text": "The strains Bifidobacterium adolescentis ATCC 15703 and Bacillus cereus ATCC 9634 were chosen as the model probiotic and pathogen. Oligofructose Orafti P95 (OF) was used as the prebiotic at concentrations of 2, 5, 7, 10, 12, and 15 g/L of the medium. In the first stage, the system was inoculated with Bifidobacterium, and a dynamic equilibrium  was achieved. Then, the system was contaminated with a 3-day Bacillus suspension (spores). The microbial count, as well as the concentration of acids and residual carbohydrates, was measured. A Bacillus monoculture was studied as a control. The stationary count of Bacillus in monoculture was markedly higher. An increase (up to 8 h) in the lag phase was observed for higher prebiotic concentrations. The specific growth rate in the exponential phase varied at different OF concentrations. Thus, the OF concentration influenced two key events of bacterial infection, which together determine when the maximal pathogen count will be reached. The mathematical models were developed, and their accuracies were acceptable for Bifidobacterium (relative errors ranging from 1.00% to 2.58%) and Bacillus (relative errors ranging from 0.74% to 2.78%) count prediction.The diversity and the stability of the microbial community are associated with microecological interactions between its members. Antagonism is one type of interaction, which particularly determines the benefits that probiotics bring to host health by suppressing opportunistic pathogens and microbial contaminants in food. Mathematical models allow for quantitatively predicting intrapopulation relationships. The aim of this study was to create predictive models for bacterial contamination outcomes depending on the probiotic antagonism and prebiotic concentration. This should allow an improvement in the screening of synbiotic composition for preventing gut microbial infections. The functional model (fermentation) was based on a three-stage continuous system, and the distal colon section (N The study of interactions between members of the microbial community is a rather complicated but extremely important task, since most microorganisms naturally enter these systems. The intestinal microbial community has the most significant impact on the health of the host, and the possibility of its modulation by probiotics , prebiotThe main advantage of functional intestine models in vitro is the ability to obtain highly reproducible results due to the exclusion of a number of external factors, as well as the ability to strictly control the parameters. From an ethical point of view, the use of models does not practically require such hard restrictions as trials on humans, and it is much more humane than trials on animals. Moreover, since pharmaceutical procedures and dietary studies usually take a long time, representative models in vitro can significantly speed up the result. Lastly, such studies are less expensive ,6.Currently, models are used that simulate not only the conditions of the gastrointestinal tract such as pH, temperature, and atmospheric composition, but also the relationship of the microbiota with cells of the host intestinal epithelium and mucin, as well as the immune reactions. Examples include (1) the Transwell \u201capical anaerobic model of the intestinal epithelial barrier\u201d, (2) the host\u2013microbiota interaction (HMI) model, (3) the \u201cHuman oxygen\u2013Bacteria anaerobic\u201d (HoxBan) system, (4) the human gut on a chip, and (5) the HuMiX model . HoweverStaphylococcus aureus contamination of the gut microbiota [The three-stage continuous model was firstly proposed by Gibson et al. in 1988 . Later, crobiota . Furthercrobiota .Bifidobacterium and Lactobacillus. It was also shown that human indigestible fungal polyphenols (proanthocyanidins) were metabolized by the microbial community members, resulting in an antioxidant effect [One modification of the model consisting of a fermenter  is intent effect .Listeria monocytogenes, Staphylococcus aureus, Escherichia coli) and lactic acid bacteria (LAB) in artificial media or foods [There are various types of interactions in microbial communities: resource competition, metabolic interactions , allelopathy , etc. . It is por foods ,22,23,24or foods . In thesor foods . It takeor foods . The kinor foods . The advor foods . It shouBifidobacterium  and Bacillus cereus (as a pathogen). The proximal intestine was considered as representative for compiling a mathematical model; accordingly, the cultivation was carried out in one fermenter.Previously, we proposed and tested, under the conditions of static coculture, a model of the inhibition of pathogen growth by probiotics, in which the measure of interaction (antagonism) is expressed through the production of organic acids (lactic and acetic acids). Such a model allowed us to evaluate the effect of prebiotics ,31. HoweBifidobacterium adolescentis VKPM AC1662 (corresponding to ATCC 15703) was considered a model probiotic with high \u03b2-fructofuranosidase activity [Bacillus cereus VKPM B8076 (corresponding to ATCC 9634) was used as a model foodborne pathogen. The freeze-dried samples were purchased from the Russian National Collection of Industrial Microorganisms  and stored at temperatures not exceeding 8 \u00b0C until use.The strain activity ,32. The 4)2SO4, 5; MgSO4\u00b77H2O, 0.2; FeSO4\u00b77H2O, 0.01; MnSO4\u00b77H2O, 0.007; NaCl, 0.01; cysteine , 0.5; Tween-80, 1; ascorbic acid , 1. The pH was adjusted to 7.0. Oligofructose  was used as a standard prebiotic. A concentrated OF solution in distilled water was prepared. The sterilization was carried out at 115 \u00b0C for 30 min.A carbohydrate-free medium and carbohydrate solution were prepared, sterilized separately, and mixed before inoculation. The carbohydrate-free medium (according to  with somBifidobacterium or Bacillus was performed in the vessels with immediate sparging by N2 (extra pure) through a vent branch which reached the bottom. The inoculates were incubated at 37 \u00b0C with shaking (180 rpm) overnight.The strain samples were restored in sterile phosphate-buffered saline (PBS), transferred into tubes with a sterile culture medium, and incubated at 37 \u00b0C. The sealed vessels with two branches were supplied with membrane autoclavable vent filters , and clamps were applied for the inoculate preparation. The vessels were sterilized with a carbohydrate-free medium. The OF solutions were aseptically added to the vessel before inoculation to obtain the same concentration as in the fermentation (see below). Then, the inoculation of the daily culture of 2  sensors. The control block of the bioreactor was provided with four peristaltic pumps, applied for the inflow of carbohydrate-free medium and carbohydrate solution, the outflow of cultural fluid, and the adjustment of pH. The continuous fermentations were carried out at two stages; the monoculture of Bifidobacterium was maintained until dynamic equilibrium was reached at the first stage, and the contamination with Bacillus spores was performed at the second stage. The bioreactor was sterilized with carbohydrate-free medium. All connections and open-volume manipulations were performed aseptically to avoid contamination. The additives were introduced through a flask in a laminar flow cabinet located in the immediate vicinity of the unit. Since the strains used in the study were not biohazardous (biosafety level 1), the unit was installed on a standard open laboratory bench without the use of special containment equipment. The sterile OF solution was introduced aseptically through the inoculation flask. The concentrations of OF were varied for Bifidobacterium monoculture experiments  and coculture experiments . The culture medium was sparged with nitrogen (pO2 < 0.5). The fermentation conditions corresponding to the descending colon were a temperature of 37 \u00b0C, pH of 6.8, and anaerobic atmosphere.The fermentations were carried out in a unit  based onBifidobacterium strain was inoculated, and the fermenter was bubbled repeatedly. One hour after inoculation, the sterile carbohydrate-free medium (from bottle 11) and OF solution (from bottle 10) were continuously supplied to the bioreactor in a volume ratio of 2:1, and the cultural fluid was supplied to the bottle for biosuspension collection (8) in an equal volume. The dilution rate was 0.04 h\u22121. The pH was maintained at 6.8 by adding a 20% w/w solution of sodium hydroxide. The level of dissolved oxygen was controlled by a pO2 sensor (<0.5%). To create anaerobic conditions, the fermenter was bubbled with nitrogen (extra pure) at least twice a day. These conditions were considered as close as possible to those of the descending colon [Bacillus cereus ATCC 9634. In the control experiment, only the monoculture of B. cereus ATCC 9634 was inoculated.An overnight culture (approximately 16 h) of the llection  in an eqBacillus cereus and Bifidobacterium adolescentis. The dilutions were plated on MRS agar [Bacillus counting. BFM agar [Bifidobacterium enumeration. The pH was adjusted to 5.5 by adding propionic acid (5 mL per 1 L of the medium) immediately after sterilization . Sterile polystyrene Petri dishes with vents  containing BFM agar were plated and placed in BD GasPak\u2122 anaerobic containers . The incubation was carried out at 37 \u00b0C. The measurements were performed in triplicate. The specific growth rate was calculated as the slope of the log10 bacterial count.Tenfold serial dilutions in sterile PBS were made and plated on the appropriate medium, and the incubation was carried out at selective conditions for separate enumeration of MRS agar  and incuBFM agar  was appl2SO4 (mobile phase) with an injection volume of 3 \u00b5L. The organic acids were diluted in 0.002 M H2SO4 to concentrations of 1, 5, and 10 mg/mL to prepare the organic acid calibration solution. The qualitative identification was carried out according to the retention time, and the external standard method and the chromatographic peak squares were applied for quantification.High-performance liquid chromatography (HPLC) was applied for organic (lactic and acetic) acid detection and quantification as described previously , with so\u00ae, Saint Petersburg, Russia) with a quartz capillary . The supernatants of the samples after centrifugation  were additionally purified to remove protein impurities on a centrifugal filter unit  by centrifugation at 5500 rpm at 10 \u00b0C for 20 min. A solution of 0.5 mM tetradecyltrimethylammonium bromide and 25 mM pyridine-2,6-dicarboxylic acid  in 170 mM NaOH was used as the background electrolyte. The temperature was 20 \u00b0C and the wavelength was 230 nm for indirect photometric detection of carbohydrates.The OF monomers (glucose and fructose) and homologs with different degrees of polymerization were detected using capillary electrophoresis (HPCE) as described previously ,37, withBifidobacterium during continuous cultivation, several factors were taken into account. Firstly, at low flow rate, some of the cells will die due to suppressing conditions. Therefore, at each moment, there will be a dynamic balance between the total number of cells  cells according to the following expression:To describe the growth kinetics of \u22121) and death rate (\u22121). Moreover, both living and dead cells will be washed out according to the dilution rate (D). This state can be described by the following system of equations:Secondly, the population dynamics of each subpopulation will be determined by the following rate constants : specifiBifidobacterium will be limited by the carbon substrate (S), which can be described by the Monod equation [Bifidobacterium (h\u22121); Bifidobacterium by lactic and acetic acids, respectively (mg/mL).Thirdly, the growth of equation . The groequation . Then, tBifidobacterium death (h\u22121), and Bifidobacterium by lactic and acetic acids, respectively (mg/mL), with a similar biological meaning to the saturation constant in the Monod equation.Fourthly, it was assumed that the rate of death will also be determined by the concentrations of metabolic products. Since it was difficult to find the corresponding equation in the literature, the following expression is proposed:Lastly, the concentrations of the substrate and products in the fermenter will not immediately reach a steady state, and their change can be described by standard equations .(5){\u2212dSBifidobacterium) (mg/CFU), Here, Bifidobacterium under conditions simulating the intestine (at a low dilution rate) can be described by the following system of equations:Thus, the growth of The dilution rate is a constant, and the economic coefficients for the formation of lactic and acetic acids can be found directly from experimental data. However, the analytical solution of Equation (6) is difficult; therefore, to search for a numerical solution, the system was transformed into the integral form of sequentially calculated equations.Here, The bee colony method was used to determine the equation constants ,42.RMSE) was selected as the criterion for the determination of the optimal values of constants.The root-mean-square error .Taking into account the nature of the growth curves of Bacillus is based on the formation of metabolites by Bifidobacterium, which reduces the specific growth rate. In contrast to static fermentation, in continuous cultivation at a low flow rate, substrate limitation cannot be ruled out, as in the case of Bifidobacterium. Previously, the absence of \u03b2-fructofuranosidase in the strain Bacillus cereus ATCC 9634 was shown [Bifidobacterium. It is known that representatives of the species Bacillus cereus are capable of degradation of a number of amino acids  [\u03b1(t)). Thus, to calculate the specific growth rate of Bacillus, the following formula is proposed:Bacillus, \u03b1(t) is the coefficient for taking into account the lag phase, Bacillus (mg/mL), Bacillus growth-limiting amino acids (mg/mL), and Bacillus growth-limiting amino acids (mg/mL).As in a previous static model , it was as shown , excludie, etc.) , which cA and B are empirical constants that determine the steepness of the sigmoid, and To calculate the lag phase coefficient, it is proposed to use a sigmoidal empirical functionBacillus growth in a mixed culture and the patterns presented above, it can be assumed that the duration of the lag phase depends on the concentration of lactic and acetic acids at the time of contamination (see in the results). However, it is difficult to determine the explicit nature of this dependence, and the literature data on this issue are extremely scarce. Therefore, the below polynomial quadratic equation is proposed. The calculation of the coefficients of this equation based on experimental data using the least squares method allowed obtaining the following equation:Taking into account the characteristics of t = 0.1 h, as highlighted before.The solution of the equations and determination of the constants were carried out using an iteration method with \u0394Bifidobacterium count, LA concentration, and AA concentration in the monoculture model and Bacillus count in the coculture model were calculated to demonstrate the accuracy of the predictions as follows:Bifidobacterium count , and The mean relative errors for p < 0.05) among the steady states (stationary phases) two-way ANOVA (for time and experiment conditions factors) with post hoc Tukey honestly significant difference (HSD) test was performed. The samples (subsets) of means log(CFU/mL) for stationary phase points of Bacillus monoculture and Bacillus coculture with Bifidobacterium as well as for the Bifidobacterium monoculture were compared. The MatLab software was applied.Each experimental point is presented as the mean \u00b1 SD of three repetitions. Changes in data were assessed among different experiments using one-way repeated measure analysis of variance (ANOVA). Additionally, to assess the significant differences  lower than that at a concentration of 7 g/L or more . This made it possible to calculate the values of the yields of metabolite production from the consumed substrate. Moreover, the sum of the yields was close to 1. Thus, the OF was completely spent on the energy needs of Bifidobacterium.In all experiments, the complete consumption of the carbohydrate substrate was observed by the stationary stage. The residual concentrations of OF homologs  for feed concentrations of 7 and 12 g/L are given in Bifidobacterium in the microbial community with acceptable accuracy  difference was noted in the stationary count of Bacillus in the control experiment (monoculture) and in the experiments with the inhibitory effect of Bacillus (p < 0.05) for all OF concentrations in culture experiments. Thus, the influence of Bifidobacterium on the stationary value of Bacillus count is obvious.A significant (Bacillus . At the Bacillus inoculation) to reaching a steady state of Bacillus cell count due to differences in the growth lag duration and specific growth rate in the log phase ) were first determined to calculate the growth delay time.p < 0.05). Other parameters of the model (Equations (9)\u2013(11)) were determined numerically, enabling predictions with low error for all coculture experiments , since their combination determines the duration before the pathogen reaches the maximal count. It can be assumed that a longer time interval increases the chances for the microbiota and the host organism to prevent the disease.A correction factor for modeling the lag phase was previously introduced by Baranyi and Roberts . They alBifidobacterium longum and Lactobacillus fermentum) and prebiotics  on the elderly fecal microbiota [The effect of probiotics (crobiota , as wellcrobiota , was preBifidobacterium and the outcome of bacterial infection under conditions simulating the distal intestine at various doses of the prebiotic substance administered. The concentration of carbohydrates strictly determined the production of metabolites, but the limitation of Bifidobacterium growth was observed only at extremely low values. Significant differences in the growth delay time and specific growth rate of Bacillus were established depending on the concentration of lactic and acetic acids at the contamination time. Mathematical models based on kinetic laws were developed to predict the behavior of individual members of the intestinal microbial community. Although the considered model cannot give definitive answers regarding the outcome of intestinal infection in vivo, a number of the obtained patterns are important for understanding key events. In the future, it seems promising to test the model in a three-stage continuous system with fecal culture.The study determined the main patterns of development of"}
{"text": "Satisfactory brain relaxation is essential in neurosurgery. Desflurane anesthesia and propofol-based total intravenous anesthesia (TIVA) have different effects on cerebral hemodynamics, potentially contributing to discrepant brain relaxation. The purpose of this study was to compare the effects of desflurane and TIVA on brain relaxation in patients undergoing craniotomy for supratentorial tumors.In this randomized, controlled study, we enrolled patients aged 18\u201360\u00a0years, with ASA I\u2013III, who were scheduled to undergo elective craniotomy for supratentorial tumors. Patients were randomly assigned in a 1:1 ratio to receive desflurane anesthesia or TIVA. The primary outcome was the proportion of satisfactory brain relaxation. Secondary outcomes included emergence and extubation times, recovery of cognitive function and postoperative complications.P\u2009=\u20090.675). Patients assigned to the desflurane group had shorter emergence  and extubation times , and better recovery of cognitive function at 15\u00a0min after extubation , but experienced increased postoperative nausea and vomiting (PONV) (16 [29%] vs. 6 [11%] P\u2009=\u20090.017) and tachycardia  during recovery.Of 369 patients who were assessed for eligibility, 111 were randomized and 110 were included in the modified intention-to-treat analysis (55 in the desflurane group and 55 in the TIVA group). The proportion of satisfactory brain relaxation was similar between the two groups: 69% in the desflurane group and 73% in the TIVA group . Date of registration: December 31, 2020.The online version contains supplementary material available at 10.1186/s12871-023-01970-z. Satisfactory brain relaxation is essential in neurosurgery for sufficient surgical exposure and minimizing the damage to normal brain tissue . IntravePropofol-based total intravenous anesthesia (TIVA) has been widely accepted in neurosurgery due to the capacity of decreasing intracranial pressure (ICP) by reducing cerebral blood flow (CBF) and cerebral blood volume (CBV) . On the To our knowledge, there are few clinical trials designed to evaluate desflurane anesthesia and TIVA on brain relaxation during craniotomy. Most did not take brain relaxation as a primary endpoint and failed to fully address various factors that may influence brain relaxation, such as the use of mannitol , 11. AlsTherefore, we conducted this randomized controlled trial to test the difference between desflurane anesthesia and TIVA in providing brain relaxation in patients undergoing elective craniotomy without severe intracranial hypertension.This was a single-center, randomized, controlled, patient and outcome assessor-blinded trial. Patients were consecutively recruited from Beijing Tiantan Hospital, Capital Medical University from January 2021 to August 2021. Ethical approval for this study (KY2020-150\u201302) was provided by the Institutional Review Board of Beijing Tiantan Hospital, Capital Medical University, Beijing, China on January 17, 2021, and written informed consent was obtained from all patients. The trial was registered before patient enrollment at clinicaltrials.gov . The report follows the guideline for reporting parallel group randomized Consolidated Standards of Reporting Trials (CONSORT) 2010.2; patients scheduled for retaining tracheal intubation in postoperative; and patients who were unable to comprehend and cooperate with the examination.We enrolled patients between 18 and 60\u00a0years of age who had an American Society of Anesthesiologists (ASA) physical status of I to III and were scheduled to undergo craniotomy for supratentorial tumors with general anesthesia. Exclusion criteria were as follows: patients with preoperative brain imaging  with midline shifts over 5\u00a0mm ; patientWe randomly assigned patients in a 1:1 ratio to the desflurane group or TIVA group. The randomization sequence was previously computer-generated and preserved in sealed opaque envelopes. The allocation was concealed until the day of surgery. Patients, the outcome assessors and the nursing team were blinded to group assignments. The attending anesthesiologists were aware of group assignments owing to the nature of the intervention.2), the bispectral index (BIS), nasopharyngeal temperature and urine output. An artery catheter was inserted for invasive blood pressure monitoring and blood sampling.After entering the operating room, all patients received standard ASA monitors. Intraoperative monitoring included electrocardiography (ECG), noninvasive blood pressure, pulse oxygen saturation, end-tidal carbon dioxide (ETCO2: 30\u201335\u00a0mmHg). Dexamethasone (5\u00a0mg) and ondansetron (8\u00a0mg) were administered after induction to prevent postoperative nausea and vomiting (PONV).All patients were premedicated with 0.05\u00a0mg/kg of midazolam intravenously 15\u00a0min before anesthesia induction in the operating room. After preoxygenation, anesthesia was induced with 0.3\u20130.5\u00a0\u00b5g/kg of sufentanil, 1\u20133\u00a0mg/kg of propofol, and 0.2\u00a0mg/kg of cisatracurium. After tracheal intubation, mechanical ventilation was established with a tidal volume of 6\u20138\u00a0ml/kg, a fraction of inhaled oxygen of 60%, a fresh flow of 1 L/min in a semi-closed circuit, and the ventilatory frequency was adjusted between 12\u201315/min to maintain mild hyperventilation  was given to alleviate potential stress responses when the headpins were placed and a scalp incision was performed. The last sufentanil bolus (0.1\u00a0\u00b5g/kg) was added when suturing dura mater . Total remifentanil consumption was significantly lower in the desflurane group .Intraoperative factors that may affect brain relaxation were well balanced between the two groups except for MAP Table . PatientP\u2009=\u20090.675) (Table P\u2009=\u20090.619). Univariate and multivariate analysis did not show a significant effect of the anesthesia regimen on brain relaxation (Table P\u2009=\u20090.002) and occipital tumors  were independent predictors for unsatisfactory brain relaxation , . In addition, patients assigned to the desflurane group had higher median scores of SOMCT at 15\u00a0min after extubation  During the recovery period, patients assigned to the desflurane group experienced more tachycardia  and PONV  The incidence of hypertension and agitation did not differ between the two groups.The emergence time and extubation time in the desflurane group were shorter than those in the TIVA group  is a powerful modulator of cerebral vasomotor tone, and hypocapnia leads to cerebral vasoconstriction [2 of 30 to 35\u00a0mmHg) was maintained during surgery following the clinical management routine. Consequently, cerebral vasoconstriction secondary to hypocapnia may mask the direct vasodilatation effect of desflurane. Moreover, in our study, the cerebral hemodynamic effect of desflurane was further complicated by the significant decrease in MAP. It cannot be ignored that similar brain relaxation may occur as a consequence of a decrease in cerebral perfusion pressure. Lastly, fluid balance is a crucial factor affecting brain relaxation, and fluid overload can exacerbate cerebral edema. Our study used uniform fluid management criteria, and the results showed that the fluid input and output were comparable between the two groups at dural opening. Therefore, the interference of fluid balance on brain relaxation assessment was well controlled in our study.Multiple factors may account for our major finding. First, the cerebral vasodilation effect of desflurane is dose-dependent. Low-dose desflurane decreases global CBF by suppressing cerebral metabolism. As the concentration increases, the direct vasodilation effect begins to dominate and may increase CBF, while these effects were mainly observed at concentrations of 1.0 MAC and above . In our triction . In our The multivariate analysis revealed that peritumoral edema is associated with unsatisfactory brain relaxation, which is consistent with previous findings , 23. MorThe present study also found that, compared with TIVA, desflurane anesthesia provides patients with faster emergence and better recovery of cognitive function. In clinical practice, rapid recovery is desirable in neurosurgery because it allows for early neurological assessment and prompt detection of potential complications, such as hematoma formation, acute cerebral infarction, and neurological deficits. This contributes to rapid diagnosis and intervention and may improve patients\u2019 clinical outcomes .Recovery complications were similar between the two groups, except for PONV and tachycardia. Patients assigned to the desflurane group experienced more PONV than those in the TIVA group even though we administered 5\u00a0mg of dexamethasone combined with 8\u00a0mg of ondansetron to prevent PONV. A recent review suggested that 8\u00a0mg of dexamethasone may significantly enhance the antiemetic effect, which could be tested in future studies . In addiOur study has several limitations. First, we did not supplement any objective measures to evaluate brain relaxation, such as subdural pressure and cerebrospinal fluid pressure monitoring, but only a subjective evaluation by the neurosurgeons. However, the standardized 4-point scale is the most practical and accessible measurement to evaluate brain relaxation, and it has been widely applied in many clinical studies , 26\u201329. In conclusion, among patients undergoing elective craniotomy without severe intracranial hypertension, desflurane anesthesia and TIVA provide similar brain relaxation assessed by the neurosurgeons using a 4-point scale. Desflurane anesthesia provides faster recovery but is associated with increased PONV and tachycardia during the recovery period. Therefore, we should fully balance the strengths and weaknesses of desflurane in clinical practice and optimize the management strategy to benefit patients undergoing neurosurgery.Additional file 1:Figure 1.\u00a0Jpg Intraoperative Mean Arterial Pressure. Differences in the intraoperative MAP values between the groups were evaluated using RM-ANOVA (P = 0.012). T0, before anesthesia induction; T1, 1 hour after anesthesia induction; T2, dura opening; T3, 2 hours after anesthesia induction; T4, at the end of surgery; T5, emergence. Abbreviations: MAP, mean arterial pressure; RM-ANOVA, repeated-measures analysis of varianceAdditional file 2:Table 1. Steinhoff classification.Additional file 3:Table 2. Brain relaxation 4-point scale.Additional file 4:Table 3. Short Orientation Memory Concentration Test.Additional file 5: Table 4. Univariate Logistic Regression Analysis of Satisfactory Brain Relaxation."}
{"text": "Ab) and GPC3 aptamer (GPC3Apt), an \u201cH-rGO-Pd NPs-GPC3Apt/GPC3/GPC3Ab\u201d sandwich complex was formed with peroxidase-like properties which enhanced H2O2 to reduce the silver (Ag) ions in solution to metallic Ag, resulting in the deposition of silver nanoparticles (Ag NPs) on the surface of the biosensor. The amount of deposited Ag, which was derived from the amount of GPC3, was quantified by the differential pulse voltammetry (DPV) method. Under ideal circumstances, the response value was linearly correlated with GPC3 concentration at 10.0\u2013100.0 \u03bcg/mL with R2 of 0.9715. When the GPC3 concentration was in the range from 0.01 to 10.0 \u03bcg/mL, the response value was logarithmically linear with the GPC3 concentration with R2 of 0.9941. The limit of detection was 3.30 ng/mL at a signal-to-noise ratio of three and the sensitivity was 1.535 \u03bcA\u03bcM\u22121cm\u22122. Furthermore, the electrochemical biosensor detected the GPC3 level in actual serum samples with good recoveries (103.78\u2013106.52%) and satisfactory relative standard deviations (RSDs) (1.89\u20138.81%), which confirmed the applicability of the sensor in practical applications. This study provides a new analytical method for measuring the level of GPC3 in the early diagnosis of HCC.Glypican-3 (GPC3), as an emerging biomarker, has been shown to be beneficial for the early diagnosis and treatment of hepatocellular carcinoma (HCC). In this study, an ultrasensitive electrochemical biosensor for GPC3 detection has been constructed based on the hemin-reduced graphene oxide-palladium nanoparticles (H-rGO-Pd NPs) nanozyme-enhanced silver deposition signal amplification strategy. When GPC3 specifically interacted with GPC3 antibody (GPC3 Globally, hepatocellular carcinoma (HCC) has been evaluated as one of the most common malignant malignancies with high prevalence and fatality rates . The surImmunoassay detection of serum biomarkers including enzyme-linked immunoassay (ELISA) and bioluminescence enzyme immunoassay (BLIEA) has been widely used in clinical practice for the diagnosis of HCC ,5,6. GlyELISA serum kits are widely used to detect antigens or antibodies in clinical practice by using double antibodies and labeled-horseradish peroxidase (HRP) to form sandwich-type structures . On the In recent years, electrochemical detection has alternatively been used as a powerful technique for many point-of-care (POC) sensors due to its inherent advantages of low cost, portability, and fast response ,16. For Nanozymes are simulated enzymes composed of nanomaterials, which have two characteristics of nanomaterials and enzyme-like activities. Nanozymes can solve the shortcomings of the natural enzyme such as high cost and variability, but the activity is slightly lower than that of the natural enzyme. Nanozymes and reaction substrates are accompanied by electron transfer and valence changes, showing REDOX enzyme activities. Compared with ordinary bio-signal, the electrochemical signal generated by nanozyme-catalyzed amplification technique can be enhanced by the reaction of the chromogenic substrate ,20. AmonApt) and GPC3 antibody (GPC3Ab) as recognition elements. GPC3Apt was labelled on the binding sites of H-rGO-Pd NPs nanozyme through \u03c0-\u03c0 action and Pd-N coordination interaction. The H-rGO-Pd NPs-GPC3Apt signal probe not only improves the electron transfer rate but also enhances the number of fixed biomolecules. GPC3Ab, as a capture probe, was adsorbed on the surface of a Au NPs@rGO-modified screen-printed electrode (SPE). In the presence of GPC3, an \u201cH-rGO-Pd NPs-GPC3Apt-GPC3-GPC3Ab\u201d sandwich-structure complex with peroxide properties was formed by specific binding, and further catalyzed the reaction of H2O2 with AgNO3 to deposit Ag NPs on the sensor surface. The dissolution current of Ag NPs could be measured using differential pulse voltammetry (DPV). The analytical performance in terms of working curve, linear range, sensitivity, specificity, reproducibility, and stability of the proposed GPC3 electrochemical nanobiosensor was discussed. Given the above considerations, our study aimed to generate a novel sandwich-structure electrochemical biosensor for GPC3 detection based on hemin-reduced graphene oxide-palladium nanoparticles (H-rGO-Pd NPs) nanozyme peroxidase-like catalytic silver deposition for signal amplification, combining GPC3 aptamer (GPC3Apt) and the GPC3 antibody (GPC3Ab) as recognition elements. Firstly, the H-rGO-Pd NPs nanozyme with good peroxidase-like catalytic properties was prepared by a two-step reduction method, and the H-rGO-Pd NPs-GPC3Apt detection probe was prepared through \u03c0-\u03c0 action, and Pd-N coordination interaction. Then, the Au NPs@rGO was modified on the surface of pretreated SPE by electrodeposition, leading to the formation of Au NPs@rGO/SPE. After that, GPC3Ab was immobilized on Au NPs@rGO/SPE by Au-N bonding as well as physical adsorption. When the GPC3 was added, the specific recognition reaction between the GPC3Ab and GPC3 produced an antibody\u2013antigen complex and arranged on the electrode surface. Next, the H-rGO-Pd NPs-GPC3Apt detection probe was fixed on the electrode surface by \u03c0-\u03c0 bond and electrostatic adsorption. Both GPC3Ab and H-rGO-Pd NPs-GPC3Apt specifically bonded with GPC3 to form the H-rGO-Pd NPs-GPC3Apt/GPC3/GPC3Ab sandwich-structure complex with a stable spatial structure as well as catalytic performance, which could induce the reduction in the Ag ions in the solution containing H2O2 and AgNO3 solution for the deposition of Ag NPs on the surface of Au NPs@rGO/SPE. The metallic Ag NPs deposited on Au NPs@rGO/SPE could produce detectable anodic stripping signals, which can be determined by DPV. Since the amount of H-rGO-Pd NPs-GPC3Apt/GPC3/GPC3Ab affects the Ag NPs deposition which further leads to the change of the sensor response current, the standard curve was determined by studying the relationship between the sensor response current and GPC3 concentration.Herein, H-rGO-Pd NPs revealed good conductivity, nontoxicity, and high peroxidase-like catalytic properties because of the peroxidase properties of Hemin, good catalyst-supporting material of rGO, and the efficient catalytic synergies of Pt NPs.2O2 was able to react with AgNO3 slowly without catalytic substances, which left a small amount of deposited Ag on the electrode surface. Under the catalysis of H-rGO-Pd NPs peroxidase-like activity, the GPC3 nanobiosensor detected a significant current response (curve c and curve d). Moreover, the current response significantly increased when the concentration of GPC3 went up from 10.0 to 50.0 \u03bcg/mL. It was positively correlated with GPC3 concentrations. The feasibility analysis suggested that the \u201cH-rGO-Pd NPs-GPC3Apt/GPC3/GPC3Ab\u201d sandwich complex can effectively catalyze the reaction of H2O2 and AgNO3 on the surface of electrodes. Being heavily coated with Ag NPs amplified the current signal of the sensor, further indicating that the electrochemical nanobiosensor was capable of detecting GPC3.By using the DPV method, the feasibility of the GPC3 electrochemical nanobiosensor was determined under the potential voltage range of (\u22120.2\u20130.4 V) B. In theThe UV-vis spectra of rGO, hemin, and H-rGO-Pd NPs were shown in \u22121, a constriction vibration peak of C-H at 2918 cm\u22121, a vibration peak of C=O at 1630 cm\u22121, and a vibration peak of C-O at 1384 cm\u22121. H-rGO-Pd NPs and hemin have a common asymmetric stretching peak at 850 cm\u22121 which is from the formation of Fe-O bond in hemin 3\u2212/4\u2212, derived from Randles\u2013Sevcik\u2019s formula 3\u2212/4\u2212 (6.70 \u00d7 10\u22126 cm2 s\u22121), n is the number of electrons involved ([Fe(CN)6]3\u2212/4\u2212, n = 1), v represents the scanning rate (0.1 V/s), and C represents the concentration of redox medium (5 mM/L). The surface area of different electrodes was calculated in square measure and placed in the following order: SPE (0.0555 cm2) < H-rGO-Pd NPs-GPC3Apt/GPC3/GPC3Ab/Au NPs@rGO/SPE (0.1006 cm2) < GPC3/GPC3Ab/Au NPs@rGO/SPE (0.1085 cm2) < GPC3Ab/Au NPs@rGO/SPE (0.1088 cm2) < Au NPs@rGO/SPE (0.1187 cm2) < Ag NPs/H-rGO-Pd NPs-GPC3Apt/GPC3/GPC3Ab/Au NPs@rGO/SPE (0.1670 cm2). These results confirmed that both H-rGO-Pd NPs nanozyme-catalyzed silver deposition and SPE deposition of Au NPs@rGO significantly increased the conductivity of the electrode, further facilitating electron transfer. In this formula, 6]3\u2212/4\u2212 solution mixed with 1 M of KCl as the electrolyte solution, every electrode in the sensor construction process underwent an EIS scan at a constant voltage of 5 mV. As shown in Ab hindered electron transfer, and the impedance became larger . After GPC3 was incubated, the binding of GPC3 and GPC3Ab hindered electron transfer , H-rGO-Pd NPs-GPC3Apt was dropped on the electrode, the impedance increased  because of the presence of the aptamer hindering the electron transfer. Finally, after silver particles were deposited on the surface of the sensor, the electrode impedance decreased sharply , indicating that H-rGO-Pd NPs effectively catalyzed the reaction of H2O2 and AgNO3. It was concluded that the electrode impedance was significantly reduced by depositing a large amount of Ag NPs on its surface.EIS could be an effective tool for characterizing the properties of electron switches in a range of electrode modifications. Thus, 5 mM of [Fe(CN)Ab, the GPC3Ab/Au NPs@rGO/SPE , or a mixture  was mixed with GPC3 in a 1:1 ratio with the same concentration (1.0 \u03bcg/mL), for which the results are shown in To detect the GPC3 protein (1.0 \u00b5g/mL) and analyze its stability by using the DPV technique, the GPC3 electrochemical nanobiosensor was kept at 4 \u00b0C in a refrigerator, and would be taken out at various intervals  D. The reTo verify that the nanobiosensor would be applied in actual serum detection, GPC3 in human serum samples was detected by standard addition methods under optimal conditions. The approval was first received from the Ethics Committee of the Guangxi Key Laboratory of Metabolic Disease Research of the 924th Hospital of the Chinese People\u2019s Liberation Army Joint Logistic Support Force . Three kinds of serum samples were prepared and detected with the same process instead of GPC3 standard solution and the results are shown in 2PdCl4), chloroauric acid (HAuCl4\u00b74H2O), silver nitrate (AgNO3), Sodium chloride (NaCl), hydrogen peroxide (H2O2), ascorbic acid (AA), and ethylene glycol (EG) were obtained from Xilong Scientific Co., Ltd. . Human serum albumin (HSA), Sodium hydroxide (NaOH), and bovine serum albumin (BSA) were obtained from Macklin Biochemical Co., Ltd. . GPC3 antibody (GPC3Ab) and GPC3 aptamer  [Graphene oxide (GO) was obtained from Xianfeng Nano Co., Ltd. . Hemin, GPC3, Sodium tetrachloropalladate (NaCC A-3\u2019) , Polydia2, \u03a6 = 3 mm), and the reference electrode was Ag/AgCl inert.All electrochemical experiments were conducted on the electrochemical workstation  at room temperature. Electrochemical measurements were performed with conventional screen-printed electrodes , one of the carbon paste electrodes served as an auxiliary electrode, the other as a working electrode . A DXR Raman microscope  was used to measure Raman spectra between 200 and 3500 cm\u22121. The wavelength range of the ultraviolet-visible spectroscopy (UV-vis)  was 200\u2013600 nm.Transmission electron microscopy (TEM) was performed with a JEM-2100F electron microscope  at 100 kV accelerating voltage. A Quanta 200 Fifield scanning electron microscope  was used for scanning electron microscopy (SEM). It was measured at 400\u20134000 cm3\u00b7H2O) and 100.0 \u03bcL hydrazine hydrate (NH2-NH2) were added. After mixing, the solution was centrifugally cleaned in a water bath at 60 \u00b0C for 4 h to obtain the H-rGO solution. Second, 2.0 mL of PDDA (\u03c9 = 0.2%) and 5.0 mL of NaCl (0.2 M) were added into the 10.0 mL of H-rGO solution (0.5 mg/mL) and stirred for 12 h to form PDDA-modified H-rGO solution. Then, 2.0 mL of Na2PdCl4 (20 mM) and 10.0 mL of EG were added into the PDDA-modified H-rGO solution. After being stirred overnight, the pH of the solution was adjusted to 12 with 1.0 M of NaOH. Furthermore, the above solution was refluxed for 4 h at 140 \u00b0C. Finally, the H-rGO-Pd NPs were obtained by centrifuging and drying.H-rGO-Pd NPs nanozymes were prepared by a two-step reduction method. First, well-dispersed hemin-reduced graphene oxide (H-rGO) solution was prepared as described in our earlier study . BrieflyApt detection probe was prepared through \u03c0-\u03c0 action and Pd-N coordination interaction. A total of 100.0 \u03bcL of GPC3Apt solution (5 \u03bcM) and 200.0 \u03bcL of H-rGO-Pd NPs (0.5 mg/mL) were sonically mixed overnight at room temperature. Then, the solution was centrifuged at 12,000 rpm for 20 min to remove free aptamers. Thereafter, the H-rGO-Pd NPs-GPC3Apt detection probe (1.0 mg/mL) was obtained after the residue was dispersed in Tris-EDTA buffer.H-rGO-Pd NPs-GPC32SO4 solution (0.5 M) and activated by an electrochemical cyclic scanning method with a scanning speed of 0.5 V/s and a scanning voltage between 0.4 and 1.2 V for 20 cycles. Secondly, the activated SPE was placed in a 5 mL mixed aqueous solution of HAuCl4  solution and GO solution , and electrodeposited under cyclic voltammetry (CV) strategy for 120 s under magnetic stirring in the voltage range of \u22120.5\u20131.0 V. The scanning rate was 0.4 V/s and the scanning period was 10 cycles. After electrodeposition, the SPE was rinsed with water several times and dried to get Au NPs@rGO/SPE [Ab was dropped on the surface of Au NPs@rGO/SPE electrode and incubated for 30 min at 25 \u00b0C. Lastly, 6.0 \u03bcL of 1% BSA solution was added dropwise to GPC3Ab/AuNPs@rGO/SPE and incubated for 30 min at 25 \u00b0C to block non-specific active sites [Firstly, the SPE was immersed in 5 mL of H@rGO/SPE ,39,40,41ve sites , After eAb/AuNPs@rGO/SPE surface and incubated at 25 \u00b0C for 30 min. Secondly, 4.0 \u03bcL of H-rGO-Pd NPs-GPC3Apt (1.0 mg/mL) solution was added dropwise onto the surface of GPC3/GPC3Ab/AuNPs@rGO/SPE and incubated at 25 \u00b0C for 60 min. Thirdly, 6.0 \u03bcL of H2O2 (100 mmol/L) and 3.0 \u03bcL of AgNO3 (6.0 mmol/L) solution were added dropwise onto the surface of H-rGO-Pd NPs-GPC3Apt/GPC3/GPC3Ab/Au NPs@rGO/SPE and kept in the dark at 25 \u00b0C for 30 min. The electrode was rinsed three times with water. Lastly, the electrode was inserted into a 4.0 mL glycine-NaOH buffer solution  containing 0.1 M HNO3 and 0.6 M KNO3 solution and recorded the electrochemical responses with differential pulse voltammetry (DPV) method with scanning range from \u22120.4 to 1.0 V with a 0.1 V/s scanning rate. Each sample was detected three times, and the results were calculated as mean \u00b1 RSD.Firstly, 1.0 \u03bcL GPC3 standard solution (different concentration) was added dropwise onto the GPC3To verify that the developed electrochemical nanobiosensor would be applied in serum detection, GPC3 in human serum samples was detected by standard addition methods under optimal conditions. Firstly, the human serum samples were obtained after approval from the Ethics Committee of Guangxi Key Laboratory of Metabolic Disease Research, 924th Hospital of the People\u2019s Liberation Army Joint Logistics Support Force . Three kinds of serum samples were prepared for determination by mixing 1.5 \u03bcL of normal serum with 1.5 \u03bcL of GPC3 solution . The serum samples were detected as the above process instead of the GPC3 standard solution. The DPV of the electrochemical workstation was used for the determination. The measured concentration of GPC3 in human serum samples was calculated by the calibration line. Each sample was detected three times, and the results were calculated as mean \u00b1 RSD. Apt and GPC3Ab as recognition elements. In the presence of GPC3, both GPC3Ab and H-rGO-Pd NPs-GPC3Apt specifically bonded with GPC3 to form the H-rGO-Pd NPs-GPC3Apt/GPC3/GPC3Ab sandwich-structure complex with a stable spatial structure as well as catalytic performance, which could enhance H2O2 to reduce the Ag ions in solution to metallic Ag, resulting in the deposition of Ag NPs on the surface of the biosensor. The amount of deposited Ag, which was derived from the amount of GPC3, was quantified by the DPV method. The developed nanobiosensor was able to determine GPC3 with the LOD of 3.30 ng/mL and showed good specificity, short-term stability, and recovery rates. Although the LOD value of the designed sensor was slightly higher, the GPC3 nanobiosensor can be an ideal solution for designing high-sensitivity clinical tests. We believe that this method may be an effective strategy for the determination of GPC3 with potential clinical applications and can be used to build accurate and simple sensors for other biomarkers. In this study, one novel electrochemical nanobiosensor was constructed for the quantitative analysis of GPC3 based on H-rGO-Pd NPs nanozyme for signal amplification, combining GPC3"}
{"text": "Reliable tools for prognosis prediction are crucially needed by oncologists so they can tailor individual treatments. However, the wide spectrum of histologies and prognostic behaviors of sarcomas challenges their development. In this field, nomograms could definitely better account for their granularity compared to the more widely used AJCC/UICC TNM staging system. Nomograms are predictive tools that incorporate multiple risk factors and return a numerical probability of a clinical event. Since the development of the first nomogram in 2002, several other nomograms have been built, either general, site-specific, histology-specific, or both. Recently, some new \u201cdynamic\u201d nomograms and prognostic tools have been developed, allowing doctors to \u201crecalculate\u201d a patient\u2019s prognosis by taking into account the time since primary surgery, the event history, and the potential time-dependent effect of covariates. Due to these new tools, prognosis prediction is no longer limited to the time of the first computation but can be adapted and recalculated based on the occurrence (or not) of any event as time passes from the first computation. In this review, we aimed to give an overview of the available nomograms for STS and to help clinicians in the process of selecting the best tool for each patient. Reliable tools for prognosis prediction in cancer patients are used by clinicians to set up adequate management of the disease. The more accurate the prediction, the more specific and tailored the treatment we might propose. Furthermore, these tools might help healthcare professionals address the need for awareness that cancer patients might express, possibly reducing the stress related to the unpredictability of their condition.Soft tissue sarcomas constitute a heterogeneous family of tumors comprised of >70 histological types arising in nearly any site of the body and with a wide spectrum of prognostic behaviors that goes from indolent entities, such as dermatofibrosarcoma protuberans, to extremely aggressive tumors with a high risk of relapse and death, such as leiomyosarcoma (LMS) or pleomorphic sarcomas.The American Joint Committee on Cancer/Union for International Cancer Control (AJCC/UICC) TNM staging system, based on tumor size, nodal involvement, and presence of metastases, represents the most widely used tool for prognosis prediction in several cancers. However, as will be later discussed, even the recently updated version  carries important limitations in the field of sarcomas. To overcome the limitations of the AJCC/UICC TNM staging system, newer tools for individualized prognosis prediction were developed, i.e., nomograms. The 8th edition of the AJCC manual system endorsed a validated nomogram for retroperitoneal sarcoma that met all 16 AJCC inclusion/exclusion criteria listed by the AJCC Precision Medicine Core to identify reliable and valid prognostic tools . NomograWith this review, we aim to review the recent 8th edition of the AJCC/UICC staging system and give an overview of the available nomograms for STS, helping clinicians in the process of selecting the best tool for each patient.The 7th edition of the AJCC/UICC TNM staging system (2010) classified STS patients into four stages of disease according to malignancy grade, tumor dimension, tumor depth, lymph node involvement, and distant metastasis . AlthougFor these reasons, a new version of the AJCC/UICC TNM staging system was released in 2017 (8th edition) and includes four different site-specific staging systems for STS: trunk and extremities, retroperitoneum, head and neck, and abdomen and thoracic visceral organs. Other changes were also introduced: 1. in light of the correlation between size and the risk of distant relapse observed by some authors, tumor dimension (T) is considered a 4-tier categorical variable (compared to > vs. \u22645 cmused in the previous edition), ; 2. giveDespite these changes, several studies demonstrated the suboptimal performance of the 8th edition of the AJCC/UICC TNM staging system both for sarcomas of the retroperitoneum and the extremities. The prognostic performance of the 8th edition of the AJCC/UICC TNM staging system in RPS and ESTS was evaluated by Cates using data extracted from the Surveillance, Epidemiology, and End Results (SEER) database and by Fisher et al. using the National Cancer Database (NCDB) ,8,9.For RPS, both authors found that size was a weaker prognostic factor compared with grade, histology, and incomplete resection ,8. IndeeIn light of these observations, Cates proposed two new staging systems (Vanderbilt staging systems), one for RPS using size , histologic grade, histologic type, and presence of distant non-nodal metastasis, and one for ESTS based on histologic grade, tumor size, and depth. The Vanderbilt staging systems were compared to the 8th and 7th editions of the AJCC Cancer Staging Manual. At the internal validation, Vanderbilt staging systems performed better than both editions of the AJCC Cancer Staging Manual, and the 8th edition showed a worse discriminative ability compared to the 7th in RPS, while it was not better than the 7th in ESTS.The prognostication ability of the TNM staging system remains limited by the disproportioned importance attributed to anatomic variables and the penalization of pathological or patient-related variables. Furthermore, in the AJCC/UICC TNM staging system, patients are forced into a limited number of stages that are supposed to reflect their risk of recurrence or relapse, even though this risk would be better expressed as a continuous one.Nomograms are predictive tools that incorporate multiple risk factors and return a numerical probability of a clinical event. The computation might be performed through a simple graphical representation or, when available, through web-based calculators. Of note, risk calculation through nomograms accounts for the mutual influence of each prognostic variable on the others. In this way, the relative weight of every variable is not static, as in TNM, but changes according to the case, with the resulting computation giving a more accurate estimation of the real risk.In addition, nomograms find an application in the field of clinical research and were used to perform risk stratification of patients ,11.Still, some limitations do exist and are mainly related to the fact that the prognosis can change over time, thus making the prediction less reliable as one moves away from the time it was computed, usually after surgery. In fact, the risk of recurrence or of tumor-related death can change over time, generally being higher in the first years of follow-up and decreasing as time goes by after surgery. Furthermore, the occurrence of an event or the lack of events does affect prognosis, e.g., DM affects prognosis unfavorably, and vice versa, the lack of events affects prognosis favorably. Moreover, some prognostic factors might have a time-dependent effect . For these reasons, some new \u201cdynamic\u201d nomograms and prognostic tools were developed ,13,14, aNomograms can be site-specific, histology-specific, or both. According to this classification, we aimed to give an overview of the available nomograms for STS.https://www.mskcc.org/nomograms/sarcoma) (accessed on 9 March 2023), sarcoma-specific death predictions are also computed at 4 and 8 years. Nomogram predictor variables include age at diagnosis, tumor size , histologic grade (high or low), histologic type (seven categories), depth , and site . Among the strengths of the model are the large development cohort (2163 patients) and the extensive external validation that always showed good calibration and discrimination . Si. Si34]. In addition to prognostication, the Sarculator was shown to be a very important predictor of anthracycline plus ifosfamide (AI) chemotherapy efficacy in high-risk STS of the extremities and trunk wall. Indeed, a study analyzing data from ISG-STS 1001\u2014a randomized study that tested AI chemotherapy versus histology-tailored chemotherapy in STS\u2014showed that neoadjuvant AI benefits patients with a Sarculator 10-yr predicted OS < 60%, while this was not true for patients with a lesser risk . The useIn 2017, van Praag et al. used an international multicentric cohort to develop a model (not a nomogram) that predicts the cumulative incidence of LR and OS for patients with high-grade eSTS . In contIn 2018, Rueten-Budde et al., expanding the cohort of PERSARC, developed the first dynamic model to predict 5-year OS during the first 5 years of FU in patients operated on for primary high-grade eSTS . VariablMore recently, INT guided an international multicentric collaboration to develop and externally validate a dynamic nomogram (available on the Sarculator app) that predicts 5-year OS during the first 3 years of follow-up in pts operated on for primary eSTS . It is wSarcomas arising in the retroperitoneum represent approximately one fifth of all STS. Although virtually any STS may arise at this site, four main histological types account for nearly 90% of tumors in the retroperitoneum, each showing a peculiar pattern of recurrence . Well-diTogether with histology, tumor size, grade, and multifocality are the tumor related factors significantly affecting the risk of recurrence ,43,46,47Nomograms for RPS are shown in The first two nomograms for RPS were developed in 2010 by Anaya et al.  and ArdoIn 2013, Gronchi et al. used the merged data of three referral centers  to develop a nomogram to predict OS after curative intent surgery for RPS and DFS after macroscopically complete surgical resection .In 2016, Tan et al. used the MSKCC cohort of patients surgically treated for RPS to develop 3 separate nomograms to predict disease-specific death, LR, and DM incidence at 10 years.While age was included only in the nomogram by Gronchi et al. (as a continuous variable), size was included in both models, as a categorical  in the model by Tan et al., and as a continuous variable in the model by Gronchi et al. As previously in the nomogram by Ardoino et al. . Of. Of49]. Of note, this nomogram is not applicable to unresectable cases, which account for almost half of the patients with recurrent RPS. The decision to offer surgery to patients with LR should always be validated by a multidisciplinary tumor board, aiming at balancing the risks related to the planned surgical procedure with the expected oncologic outcomes . In thisIn 2021, Callegaro et al. collaborated to develop and externally validate the first dynamic nomogram for RPS . The nomThese instruments might help healthcare professionals tailor the follow-up schedule to the actual, updated, and individualized risk, decreasing the intensity of FU in patients at low risk of disease recurrence/death. Of note, the OS dynamic nomogram also accounts for non-tumor-related causes of death, giving a more comprehensive and realistic picture of patients\u2019 prognosis.Of note, dynamic nomograms find a different application compared to static postoperative nomograms and should be used by experts as complementary tools. In fact, dynamic nomograms can be used anytime during follow-up, either in the absence of events (OS and DFS nomograms) or at the occurrence of an event but before the delivery of any treatment (OS nomogram). Since prognosis computation is performed regardless if the tumor is resectable or not and regardless of the nature of the surgery eventually performed, in the event of a recurrence, the OS dynamic nomogram can guide the decision-making process to select the best treatment. In contrast, the static nomograms for recurrent patients can only be applied after the occurrence of the local relapse and after its surgical treatment, since the completeness of the resection at the time of recurrence is one of the prognostic variables. Of note, once a LR has occurred, DFS can only be estimated by a static nomogram because the dynamic DFS nomogram can only be used in patients with uneventful follow-up. In addition, only static nomograms are able to factor in some important prognostic variables, such as tumor multifocality and the number of organs resected at primary surgery.Nonetheless, all the available nomograms for RPS still share some important limitations. First, none of them can be used in the preoperative setting because some of the variables included are not available before surgery. Second, none of them is designed or applicable to patients with metastatic or unresectable disease at diagnosis. Only the dynamic nomogram developed by Callegaro et al. can be applied to patients who develop metastases after surgery for a resectable localized RPS . Third, With the hypothesis that neoadjuvant RT might interfere with the applicability of existing RPS-specific nomograms ,10,24,48Liposarcoma (LS) is the most common soft tissue sarcoma (STS), accounting for 20% of all sarcomas in adults. There are four main histological subtypes of liposarcoma, with dedifferentiated liposarcoma and well-differentiated liposarcoma arising mainly in the retroperitoneum and myxoid liposarcoma and round cell liposarcoma arising mainly in the extremities. Histology, site, and differentiation grade are the most important determinants of prognosis.In 2016, Dalal et al. from the MSKCC developed a nomogram to predict 5- and 12-year disease-specific survival in patients surgically treated for liposarcoma, assuming that the patient does not die of another cause first  Table 3Table 3. Accounting for approximately 8\u201310% of all soft tissue sarcomas, synovial sarcoma typically occurs in adolescents and young adults (mean age of 39 at diagnosis) and shows aggressive behavior with a strong tendency to metastatic spread. The translocation between chromosomes X and 18  is present in more than 95% of patients and is therefore considered pathognomonic. Three main histologic variants do exist: monophasic SS, biphasic, and poorly differentiated. Validated negative prognostic factors are older patient age at diagnosis, male sex, larger tumor size, positive surgical margins, advanced stage, and site (with a worse outcome for tumors arising from anatomic sites other than the extremities). Conversely, the prognostic role of histological subtype and fusion protein status is less clear .In 2008, Canter et al. from the MSKCC group developed a nomogram based on preoperative variables to calculate 3- and 5-year disease-specific survival (DSS) in surgical patients with synovial sarcoma who did not receive preoperative ChT. When applied to a group of patients who pretreated with anthracycline-ifosfamide, the observed DSS for the first 3 years of follow-up was better than expected, supporting a possible role of chemotherapy in survival in these patients . Only tuRhabdomyosarcoma (RMS) is the most common soft tissue sarcoma in children, represents approximately 5% of all childhood cancers, and can arise in nearly any site. According to the WHO classification, there are four main histologic subtypes with different biological behavior and prognosis: embryonal, alveolar, pleomorphic, and spindle cell/sclerosing. In addition, RMS can be classified according to the presence or absence of the PAX-FOXO1 fusion protein in fusion positive or fusion negative RMS. Fusion-negative tumors, embryonal subtype, age 3\u201310, and head and/or neck and genitourinary sites are all favorable prognostic factors, while age > 10 years, tumors arising in the trunk or limbs, alveolar subtype, and the presence of PAX-FOXO1 carry a worse prognosis. Other prognostic factors include TNM stage, local invasion, parameningeal site, and lack of response to induction therapies ,59,60.The first histology-specific nomogram for RMS was developed in 2011 by Chisholm et al. It estimates the probability of curing patients with nonmetastatic RMS who relapsed after achieving complete local control with initial therapy . This tyIn 2014, Yang et al. developed and internally validated a nomogram to predict 5- and 10-year overall survival and median survival time in children and adolescents with RMS using population-based data collected by the Surveillance, Epidemiology, and End Results (SEER) program of the National Cancer Institute. The nomogram relies on easily available tumor and patient-related variables as well as treatment variables, i.e., surgical treatment and RT delivery, and was built on a large series of 1679 patients. Nevertheless, it has some important limitations related to the SEER database. In fact, this public dataset does not include information on ChT delivery, surgical margins, or patients\u2019 comorbidities, all of which are regarded as important prognostic factors in this disease. Furthermore, the SEER program does not provide a central pathology review. In addition, the cohort covers a wide time span (1990\u20132010) during which improvements in the management of these tumors possibly improved the prognosis of these patients .Two further nomograms were built using the SEER database \u2014and are Desmoid-type fibromatosis is a rare mesenchymal neoplasm with no metastatic potential but unpredictable local behavior, potentially occurring at any site. Typically, patients with desmoid-type fibromatosis present with a mass that has become symptomatic due to local compression symptoms that vary depending on the site of occurrence: pain due to nerve compression or invasion, digestive symptoms in abdominal desmoid-type fibromatosis, functional morbidity in desmoid-type fibromatosis of the extremity. In 5\u201315% of cases, desmoid-type fibromatosis arises in patients with familiar adenomatous polyposis (APC gene mutation), while the rest of cases are sporadic and characterized by a mutation in the CTNNB1 gene. Both mutations result in abnormal \u03b2-catenin accumulation within the cell.Surgery was long considered the standard of care for the initial treatment of resectable disease. However, the unpredictable biological behavior of desmoid tumors, with relatively high rates of spontaneous regression or stabilization, the very high rates of recurrence post-resection, and the significant morbidity of surgery, prompted the international community to re-evaluate non-surgical strategies for their management. In fact, in light of the recent evidence, the ESMO and Desmoid Tumor Working Group (DTWG) guidelines support a wait-and-see frontline approach to observe tumor behavior over time ,63. MediIn 2013, Crago et al. from the MSKCC developed and externally validated a nomogram to predict postoperative 3-year, 5-year, and 7-year LR-free survival . InteresWith this nomogram, patients with a high risk of local recurrence might be easily selected to receive other therapeutic options in the case of disease progression or symptomatic disease. However, the shift towards a non-surgical and wait-and-see approach calls for the development of a nomogram able to predict the chance of disease progression in non-operated patients.Uterine leiomyosarcoma (ULMS) is the most frequent type of uterine sarcoma and accounts for about 5% of all uterine cancers. Though rare, the disease carries a poor prognosis with high rates of local and distant recurrence. Surgical resection  is the mainstay of treatment in all resectable cases. Radiotherapy and/or chemotherapy can be considered according to the stage at time of diagnosis. However, no adjuvant treatment strategy has demonstrated a survival benefit, and high rates of recurrence and progression are registered despite standard therapies.Traditionally, ULMS are classified using the Federation Internationale de Gynecologie et d\u2019Obstetrique (FIGO) staging system developed in 2009 or the AJCC/UICC staging system for STS. The FIGO staging system identifies four stages according to tumor size, extension with respect to the uterus and pelvic organs, and the presence/absence of DM, while the AJCC staging system is based on tumor dimension, regional lymph node involvement, and the presence of DM.In 2012, Zivanovic et al.  from theOf note, it cannot be applied to patients not eligible for surgery  because the development cohort included only surgically treated patients. The nomogram underwent external validation on a series from the Brigham and Women\u2019s Hospital/Dana-Farber Cancer Institute and the European Institute of Oncology, demonstrating good discrimination  and calibration .Breast phyllodes tumors (BFT) are a rare group of mammary fibroepithelial tumors with recurrent and metastatic potential and a wide spectrum of morphologies. The WHO classification stratifies BFT into three categories  on the basis of several histologic features  . Of noteIn 2012, a nomogram based on degree of stromal atypia, stromal mitoses per 10 high-power fields, stromal overgrowth, and surgical resection margins (AMOS criteria) was developed by Tan et al.  from SinWith the aim of improving the accuracy and discriminative ability of available tools for prognosis prediction, recent research focused on the identification of new prognostic markers of outcome, and particular attention was recently put on genomic, radiomic, or immunologic markers.Although FNCLCC grading is one of the best available predictors of oncological outcomes and, as such, is included in several nomograms, it is still limited by its reproducibility from one pathologist to another and by the fact that it forces each tumor into one of three categories.In contrast, the identification of genomic markers of outcome  might potentially give a more granular and accurate picture of the different behaviors of sarcomas, and their integration into outcome prediction tools might improve their prognostic power.In 2010, Chibon et al. identified a gene expression signature composed of 67 genes associated with mitosis and chromosome management\u2014named Complexity Index in SARComas (CINSARC)\u2014able to predict metastatic outcome in non-translocation-related sarcomas . CINSARCOf note, the French Sarcoma Group is running a prospective, randomized, phase 3 trial to explore the potential benefit of chemotherapy in high-risk CINSARC patients and to prospectively validate the prognostic role of CINSARC in FNCLCC grade 1 and 2 STS . HoweverIn the last decade, growing attention has been put on the potential role of radiomic analysis. Radiomics consists in the extraction of a large number of quantitative data from radiologic imaging by the application of sophisticated software with artificial intelligence. These data are intended to reveal tumoral patterns and characteristics that are not visible to the naked eye and may significantly contribute to the diagnosis, management, and prognosis of tumors. The identification of radiomic signatures able to predict prognosis is in its early phases, and while the first studies have been recently reported, none of them has been validated and incorporated into clinical practice. Of note, one of the most important limitations of radiomics is its reproducibility when it comes to the way the exam was performed, the IV contrast medium delivered, etc.Similar to radiology, a shift from traditional pathology toward the use of artificial intelligence-based systems for the analysis of tissue samples is becoming an increasingly likely prospect. With the application of machine learning techniques, digital pathology with whole-slide imaging enables the capture of information far beyond that obtained with traditional pathology. However, although it represents a promising tool for the diagnosis and clinical management of sarcoma patients, its application is just at the very beginning and needs to be further explored in the future ,75.Immunologic markers are also being studied as prognosticators in sarcoma, but we are far from having developed a similar tool, such as the inflammosome in colonic cancer , for sarFinally, the impact of multimodal therapy on outcome is not incorporated in any of the available nomograms, as it has been performed, for example, in breast cancer.This requires data from larger patient data sets than the ones used so far to build the available tools. A large series of patients with sarcoma requires large collaborations. Large collaborations, networks, working groups, and registries have all been critical for advancing knowledge in recent years and will continue to be so, even as access to real-world data makes it easier to collect information and run prognosis and outcome studies.The authors should discuss the results and how they can be interpreted from the perspective of previous studies and the working hypotheses. The findings and their implications should be discussed in the broadest possible context. Future research directions may also be highlighted."}
{"text": "Gopi  RSC Advances article due to concerns with the reliability of the data in the published article.The Royal Society of Chemistry, with the agreement of the named authors, hereby wholly retracts this The optical images presented in Fig. 6a and c are identical. Furthermore, the images in Fig. 6a, c and e have been duplicated in other publications. The panels in Fig. 6a and c have been duplicated as Fig. 9a in Part of the image in Fig. 10c has been duplicated in Fig. 10e.The authors informed the Editor that the characterization of the original samples was outsourced, and they do not have the original raw data for the published results.Given the significance of the concerns about the validity of the data, and the lack of raw data, the findings presented in this paper are not reliable.N. Murugan was contacted but did not respond.Signed: D. Gopi, S. Ramya, E. Shinyjoy and L. KavithaDate: 16th March 2023RSC AdvancesRetraction endorsed by Laura Fisher, Executive Editor, Retractions"}
{"text": "Thyroid cancer is the most common endocrine cancer and is becoming increasingly prevalent. Although its prognosis is generally favorable, bone metastasis is a notable complication that significantly decreases survival rates. Currently, there is no definitive cure as most treatments are palliative to relieve patients of any pain or other symptoms. We assessed the incidence and influence of bone metastasis on thyroid cancer patients to understand the risk factors and outcomes which can improve clinical decision making and research endeavors.Bone is the second most common site of metastasis in patients with thyroid cancer (TC) and dramatically impacts overall survival and quality of life with no definitive cure, yet there is no extensive study of the demographic and clinical risk factors in the recent literature. Data regarding 120,754 TC patients with bone metastasis were retrieved from the Surveillance, Epidemiology, and End Results (SEER) database. Univariate and multivariate analyses were used to identify the risk factors of bone metastasis occurring in various histologies of TC. Cox regression was performed to analyze the influence of bone metastasis on overall survival. Hazard ratios were computed to analyze the association between bone metastasis and the primary outcomes. Of the 120,754 records collected from the SEER database from 2000 to 2019, 976 (0.8%) presented with bone metastasis, with occurrence being the greatest in patients of age \u2265 55 years , males , Blacks  and Asian or Pacific Islanders , and single marital status. TC patients presenting with bone metastasis  or concurrent bone and brain metastases  had a higher mortality risk. Older age, gender, race, and single marital status were associated with bone metastasis and poorer prognosis in TC patients at initial diagnosis. Understanding such risk factors can potentially assist clinicians in making early diagnoses and personalized treatment plans, as well as researchers in developing more therapeutic protocols. Thyroid cancer (TC) is a neoplasm that originates from the follicular cells of the thyroid gland, representing the most prevalent endocrine malignancy. In recent decades, there has been a significant global increase in the incidence of TC, making it the fastest-growing cancer type in both men and women . Despite131I therapy [Bone metastases can develop in various TC histologies. According to the literature, such metastases occur in roughly 7\u201328% of follicular (FTC), 1.4\u20137% of papillary (PTC), and 16\u201319% of medullary (MTC) TC patients during follow-up . The decThis prompts the need to identify risk factors predicting bone metastases in TC patients, as early detection and treatment entail prolonged survival and better patient outcomes . RecentlOur study aims to conduct a comprehensive, population-based analysis of bone metastases in TC, intending to decipher the multifaceted layers of its epidemiological characteristics, risk factors, disease outcomes, and the consequential impact of diverse treatment modalities. Such an analysis will manifest into actionable insights, shedding light on the prevalence, geospatial distribution, and characteristic patterns of bone involvement in TC, which will subsequently direct us toward more strategic prevention and management strategies. Understanding and identifying risk factors will provide a robust platform for risk stratification, aiding in the implementation of personalized treatment plans designed to meet the unique needs and characteristics of individual patients. Furthermore, by meticulously assessing disease outcomes, we seek to offer invaluable prognostic information that will be instrumental in refining treatment decision-making processes. Moreover, evaluating the effects of different treatment modalities is expected to significantly influence clinical practices, elevating the standards of patient care by integrating the most efficient and effective treatment methods. Ultimately, our study enhances the current understanding of the burden of bone metastases in TC. By offering precise and data-driven treatment strategies, we aim to usher in a new era of improved patient outcomes, mitigating the debilitating impact of this disease.We analyzed a retrospective cohort study using \u201cThe Surveillance, Epidemiology, and End Results (SEER)\u201d database (2000\u20132019), with data combined from registries 17 and 22. SEER is a comprehensive source of population-based cancer data in the United States. SEER collects and publishes cancer incidence, prevalence, survival, and mortality data from population-based cancer registries that cover approximately 34.6% of the US population. The database is maintained by the National Cancer Institute (NCI) and is widely used by researchers, clinicians, and policymakers to study cancer trends, outcomes, and disparities over time. This approach offers the advantage of capturing a diverse range of patient demographics and clinical characteristics, which can provide valuable insights into the real-world implications of osseous metastases in TC.Participants were eligible for the study if they were individuals of any age, sex, and race; diagnosed with TC as their first primary tumor; and had bone metastases at the time of diagnosis. Patients were excluded from the study if they had metastasis exclusively in other sites rather than bone or had a history of prior primary cancer before the diagnosis of TC.The study variables for our retrospective cohort analysis include a range of demographic, clinical, and treatment-related factors. Demographic variables include age, gender, race, ethnicity, marital status, metropolitan residence status, and annual household income. Clinical factors encompass histological type, T staging (primary tumor size and extent), N staging (lymph node involvement), extension to nearby structures, and management strategies such as cancer-directed surgery, radiotherapy, radioactive iodine, and systemic therapy. The primary outcomes assessed in this study are overall survival (OS), TC-specific survival (TCSS), recurrence, and subsequent second primary cancer in patients with osseous metastases at diagnosis. These outcomes help to determine the prognostic factors and real-world implications of bone metastases in TC, which can inform clinical decision making and treatment strategies. p-value of less than 0.05 was considered statistically significant for all tests.Descriptive statistics were used to summarize the demographic and clinical characteristics of the study population, including frequencies and percentages for categorical variables and means, medians, and standard deviations for continuous variables. The R packages were used for analysis. Univariate and multivariate analyses were performed to identify potential risk factors associated with osseous metastases. For categorical variables, chi-square or Fisher\u2019s exact tests were used, whereas continuous variables were assessed using the independent t-test or Mann\u2013Whitney U test, depending on the normality of the data distribution. Cox proportional hazards regression models were utilized to assess the impact of osseous metastases on survival outcomes, adjusting for potentially confounding variables such as age, sex, tumor size, histologic subtype, and other relevant factors. Hazard ratios (HRs) with corresponding 95% confidence intervals (CIs) were calculated to quantify the association between osseous metastases and the primary outcomes. Kaplan\u2013Meier survival curves were generated, and the log-rank test was used to compare group differences. A The study analyzed 120,754 records with TC, according to the eligibility criteria. These included 119,778 patients in the M0 stage and 976 (0.8%) patients presenting with bone metastases. Across the studied years, there was generally a higher rate of patients with bone metastases detected at TC presentation .The geographical distribution of TC cases across the US states was predominantly in California (41.2%), followed by New Jersey (14.3%), Georgia (9.9%), and Seattle (58%). However, the highest proportion of bone metastases detected at diagnosis was found in Hawaii (1.2% out of 1999 patients) and Louisiana (1% of 6574 patients) . p < 0.001), males , Black , and widowed .A comparison between TC patients with and without bone metastases is presented in p < 0.001) and lymph node metastasis  (Papillary TC (PTC) was the most common  histology, accounting for 88.8% of the study population, whereas follicular (FTC), anaplastic (ATC), and medullary (MTC) TC represented 4.7% (N = 5718), 0.5% (N = 649), and 1.7% (N = 1993), respectively. The bone metastases group was more likely to have advanced T stage  .Of the 976 (0.8%) who presented with bone metastases, 489 (51.3%) had concomitant metastases in other organs. These included 63 cases with brain metastases, 123 with liver metastases, and 437 with lung metastases .p < 0.001), older than 55 years , Black  or Asian or Pacific Islander , and less likely to be married   .p = 0.89). However, 22,073 patients (18.3%) developed second primary malignancies, and those with bone metastases had a significantly higher incidence of developing these secondary cancers   .p < 0.001; bone metastases: OR = 3.64, p = 0.001). Male patients without bone metastases had a higher risk , while there was no significant association for male patients with bone metastases . Regarding race, Asian or Pacific Islander (API) patients with bone metastases had a lower risk than White patients . Patients who underwent surgery for their TC without bone metastases were less likely to develop second primary cancers , while the opposite was true for those with bone metastases .p < 0.001) (p < 0.001) . Patients with bone metastases had a significantly lower survival rate of 41.7%, compared to 94.3% in the non-metastatic group (< 0.001) . The hig< 0.001) .p < 0.001) or concomitant bone and brain metastases  had a higher risk of mortality. Advanced tumor size and nodal metastasis were also associated with an increased risk of mortality (p < 0.001), while an annual household income of \u2265USD 75K  and residing in an urban area  were linked to a lower risk of mortality. p < 0.001). Those who received radiation therapy had a 34% decreased risk , while patients who received systematic therapy had a 9% decreased risk , as demonstrated in Furthermore, the study found that different treatment modalities were associated with varying degrees of survival benefit. Patients who underwent surgical resection of primary tumors had an 80% decreased mortality risk  such as pathologic fractures and spinal cord compression, dramatically impacting quality of life and morbidity. Farooki et al. found that in a study of 245 DTC patients with bone metastasis, 78% developed a first SRE after a median of 5 months, and 65% of them developed a subsequent SRE after a median of 10.7 months following the first event, with 39% of all TC patients with bone metastasis developing three or more SREs . Matta-CIn this study, a sizable cohort of 120,754 TC patients was examined, and it was discovered that 0.8% of cases presented with bone metastasis at the time of diagnosis, comparable to 0.36% as recently reported by Qi et al. , 0.5% asPatients who had bone metastasis were more likely to be over the age of 55, male, Black or Asian or Pacific Islander, or single . Recent studies corroborate the association of older age ,11,17,18The present study also found that patients recorded in Hawaii and Louisiana had the most significant proportion of bone metastasis detected at diagnosis. Multiple reasons can account for this, including but not limited to a higher density of endocrinologists and orthopedic physicians, explaining increased detection and diagnosis; lower socioeconomic status, implying delayed diagnosis and treatment of TC allowing for metastasis; or environmental factors contributing to this observation. However, this finding warrants further study.p = 0.47), the composition of patients can likely justify the finding of higher bone metastases in PTC as well as the statistically insignificant finding of ATC patients being more at risk. Patient population and referral were also used to potentially justify discrepancies between Wu et al. and Marcocci et al. regarding varying bone metastases rates in PTC [It is well known that bone metastases are present more commonly in aggressive thyroid cancers, such as ATC. Interestingly, the findings revealed that PTC was the most prevalent of all histologies that involved bone metastases, comprising 37.8% of all cases, in contrast to ATC, which comprised 23.7% of all cases. One straightforward explanation for this includes the much larger PTC patients, composed of 88.8% of the present study\u2019s population. Several studies acknowledge this notion and justify that bone metastasis will indeed be higher in PTC cases compared to other TC histologies since there is a larger population in that cohort ,21. Sincs in PTC ,23. NevePatients with bone metastasis had a markedly lower survival rate of 41.7%, compared to 94.3% in the non-metastatic group. Multivariate analysis revealed that patients with bone metastasis or concomitant bone and brain metastases had a higher risk of mortality, while advanced tumor size and nodal metastasis were also associated with an increased risk of mortality. The study also found that different treatment modalities were associated with varying degrees of survival benefit, with surgical resection of primary tumors associated with an 80% decreased mortality risk.The present study\u2019s findings on risk factors predicting bone metastasis at diagnosis are essential for clinicians in identifying patients at higher risk and tailoring treatment plans accordingly. Such prediction as early as the diagnosis has high clinical value as it can prevent metachronous bone metastasis, as Mazziotti et al.  recentlyAdditionally, positron emission tomography (PET), computed tomography (CT), and magnetic resonance imaging (MRI) can provide valuable insights into the presence and extent of bone metastasis. These imaging modalities offer non-invasive approaches to assess bone involvement in TC patients and play a crucial role in the early detection and monitoring of metastatic lesions. In conjunction with imaging modalities, regular follow-up appointments and thorough clinical evaluations are essential to effective screening for bone metastasis in TC. Healthcare providers should maintain a high level of vigilance and carefully monitor patients for any signs or symptoms that may indicate the presence of bone metastases, such as bone pain, fractures, or elevated levels of serum markers like alkaline phosphatase. Combining clinical evaluation with appropriate imaging techniques enhances the likelihood of early detection and enables prompt intervention. Our study uniquely emphasizes the importance of screening for bone metastases. Additionally, it highlights the high incidence of second primary malignancies in patients with bone metastasis and the significant benefits of various treatment options for these patients.Although this population-based study examined the largest TC patient cohort with bone metastasis to date, certain limitations should be acknowledged. Firstly, it is essential to note that the data utilized in this study were obtained from the Surveillance, Epidemiology, and End Results (SEER) database, which primarily represents TC patients in the United States. Therefore, caution must be exercised when generalizing the findings to other populations or regions, as variations in demographics, healthcare systems, and genetic profiles may exist. The applicability of the results to different populations outside the United States should be further investigated in future studies with broader international representation. Moreover, while the SEER database is a comprehensive source of population-based cancer data in the United States, it has inherent limitations. It lacks certain subjective information, such as patient-reported outcomes, including bone pain or fatigue, which are essential factors in evaluating quality-of-life and patient-centered outcomes. The absence of these subjective measures may limit the comprehensive understanding of the impact of bone metastasis on patients\u2019 well-being. Additionally, this study primarily focused on demographic and clinical risk factors associated with bone metastasis in TC patients without explicitly exploring the influence of genetic factors, such as mutations, that may coexist with the examined risk factors. Future research should consider integrating genetic analyses to elucidate the interplay between genetic predispositions and the identified risk factors to better understand the development and progression of bone metastasis in TC patients.Overall, this study provides valuable insights into the characteristics of TC patients with bone metastasis, including their risk factors, the impact of treatment modalities, and disease outcomes. These findings have the potential to enhance patient care and management while identifying avenues for further research and the development of novel treatment options.Understanding the epidemiology and impact of osseous metastases in TC is crucial for informing clinical decision making, prognostication, and the development of targeted therapeutic strategies. By advancing our knowledge of this complication, we aspire to improve the care and outcomes for patients at risk for or already affected by bone metastases in TC.This study significantly contributes to the existing literature on TC by presenting the most extensive population-based analysis of bone metastasis to date, elucidating the associated demographic and clinical risk factors, and examining their impact on patient survival. The findings presented herein will serve as a foundational platform for future research endeavors and have the potential to shape the development of more effective diagnostic and therapeutic strategies for TC patients with bone metastases."}
{"text": "There is an emerging body of knowledge on the lived experiences of parenting a child with autism from a maternal perspective. Mothers\u2019 reactions to their children\u2019s autism diagnoses have been identified as a key factor influencing their children\u2019s long-term outcomes.This qualitative study aimed to explore how South African mothers experience their children\u2019s autism diagnoses.ubuntu, social support, culture, tradition, interpersonal relationships, interconnectedness and continuity and compared to the existing scholarship, employing an Afrocentric theoretical lens.Telephonic interviews were conducted with 12 mothers from KwaZulu-Natal to understand their experiences prior, during and following their children\u2019s autism diagnoses. The data were analysed thematically according to the values of The participants held strong cultural and religious beliefs which influenced the entire diagnosis process. Some, who waited a long time, turned to traditional healers or religious leaders. While some reported feeling relieved after the diagnosis, in the sense of at least having a name for their child\u2019s condition, they also reported feeling overwhelmed by the realisation that there is no cure for autism. Over time, mothers\u2019 feelings of guilt and anxiety declined, and they became increasingly resilient and empowered as their understanding of the meaning of their children\u2019s autism diagnosis deepened, but many continued to pray for a miracle.Future research should focus on how to enhance support for mothers and their children during each of the three phases of autism diagnosis: prior, during and following their children\u2019s autism diagnoses.ubuntu, social support, culture, tradition, interpersonal relationships, interconnectedness and continuity.The study highlighted the crucial role of community-based religious and cultural organisations in providing appropriate support to mothers and their children diagnosed with autism, aligned to the values of  Autism spectrum disorder (ADS), or autism, is a complex, lifelong neurodevelopmental disorder characterised by difficulties related to social understanding and communication, repetitive or restricted behaviours and interests, as well as challenges related to adaptive functioning  there was a shorter time lag between initially seeking help and receiving a diagnosis, (2) diagnosis was received at a young age, (3) quality information on autism accompanied the diagnosis, (4) the professional who communicated the diagnosis framed autism in a positive manner and (5) they perceived intervention and support as accessible  entrenched in culture Baloyi . In addiIn this era of decolonial and post-colonial discourse, how can we Africans allow the American Psychiatric Association to be the final arbiter of our (dis)ability? Is it not time for us to delve into the question of what it means to have a disability in African society? (p. 249)iSangoma  or iNyanga  to understand autism  pandemic, this allowed the authors to adhere to the social distancing regulations in force at the time. The first author called the participants at arranged times, without requiring them to incur any costs.The population of the study was mothers of children diagnosed with autism who were enrolled at a special school near Durban, KwaZulu-Natal. Purposive sampling was employed to obtain rich data related to mothers\u2019 experiences of their children\u2019s autism diagnoses in greater depth (ed. Given With a single exception (Mother 5), all the participants were raising their children without the daily presence or involvement of their fathers. Seven mothers were identified as single, two as divorced, one as married and two as separated. The divorced and separated mothers noted that their marital relationships had \u2018drifted apart\u2019 following their children\u2019s autism diagnoses. All the children spent an extended period on the special school\u2019s waiting list before they were admitted.During data collection, which was conducted in 2021, the authors complied with strict COVID-19 restrictions and protocols. Individual semistructured, in-depth interviews were conducted with the participants in their preferred language, either English or isiZulu, through telephone interviews that were audio-recorded and later transcribed verbatim and translated into English where necessary. The semistructured interviews allowed for an open, in-depth discussion on the 12 mothers\u2019 experiences of the three phases of diagnosis. The first author put the mothers at ease and obtained their consent and trust before proceeding with the interviews, as recommended by Cohen et al. . To ensuThe authors relied on thematic analysis to analyse the data, focusing on recognising, evaluating and identifying patterns within the data according to the six steps proposed by Braun and Clarke . To famiThe study was conducted at a special school for learners with a range of barriers to learning. At the time of data collection, there were 23 learners diagnosed with autism at the school. The mothers of 12 of the learners with autism participated in the study. It is worth noting that all 12 mothers were dependent on the public health system.Ethics clearance was sought and obtained from the College of Education\u2019s Ethics Review Committee at the University of South Africa (ref. no. 2020/11/11/43638430/33/AM). The authors undertook to protect the participants from harm and ensure their privacy and confidentiality. The authors obtained permission from all 12 mothers to access documents such as their children\u2019s learner profiles and medical records. These documents provided confirmation and detailed information on their diagnoses of autism as well as recommendations for school placement.When inviting the 12 mothers to participate in the study, M.N.M. explained that there was a possibility that their participation in the study could cause distress related to sharing their past experiences of the process of their children\u2019s diagnosis of autism  restrictions in place at the time.Three research themes were generated from the data analysis performed by the authors: (1) mothers\u2019 experiences prior to diagnosis, (2) mothers\u2019 experiences during the diagnosis process and (3) mothers\u2019 experiences following their children\u2019s diagnoses. In the sections below, each theme and related subthemes will be discussed.Analysis revealed that all mothers had experiences prior to the diagnosis that influenced them to be intrinsically and/or extrinsically motivated to seek a diagnosis. At this stage (i.e. prior to the diagnosis), they were uncertain what the diagnosis would be. The following subthemes related to mothers\u2019 experiences prior to their children\u2019s autism diagnoses were: (1) intrinsic factors and (2) extrinsic factors. The intrinsic factors included psychological and emotional factors. The extrinsic factors included the mothers\u2019 experiences of family and community members\u2019 reactions to their children\u2019s behaviour prior to diagnosis.Many of the mothers described feeling \u2018confused\u2019 and \u2018frightened\u2019 by their children\u2019s early behavioural difficulties and developmental delays, as they struggled to reconcile it with their children\u2019s typical appearance. For example, one mother described how her child \u2018stared at objects endlessly\u2019 and \u2018spun around until he was dizzy\u2019. Several mothers said that although they instinctively knew that something was different, their concerns were frequently dismissed by health professionals. Mothers\u2019 instincts were a significant intrinsic factor that motivated them to pursue a diagnosis.Mother 1 described her experiences as \u2018completely chaotic and difficult\u2019, as seen below:\u2018It was completely chaotic because I was still dealing with being a first-time mother to a boy who was not developing at the normal pace. It was difficult, especially when you live far from hospitals and clinics in the location. While we were trying to get a diagnosis, we weren\u2019t doing any therapies.\u2019 Mother 7 described her instinctual awareness of her child\u2019s problems.\u2018There was just no language, but he cried a lot. He was short-tempered and he didn\u2019t do what other kids do at his age. He was staring abnormally at one thing in the house. It looked like he was going to collapse, or he had lost his mind. I just knew \u2026 that something was not right with him.\u2019 The extracts above reveal that the mothers experienced confusion, uncertainty and worry prior to their children\u2019s autism diagnoses. Following the semistructured interview schedule, the mothers were guided to reflect on their emotions prior to their children\u2019s autism diagnoses. They used the words, \u2018disturbed\u2019, \u2018anxious\u2019, \u2018stressed\u2019, \u2018numb\u2019, \u2018frustrated\u2019 and \u2018hopeless\u2019 to describe their emotions. Mother 3 articulated her confusion and uncertainty about her child\u2019s developmental delays:\u2018On the report was written \u201cglobal development delay.\u201d I took him to another hospital to attend speech therapy, physiotherapy, and all that. I received an appointment for three months later. I was not sure what was happening, just that he was delayed.\u2019 Mother 10 blamed herself for \u2018overlooking the signs\u2019, as revealed below:\u2018I personally wish I never just sat hoping that he would get better and overlooking the signs before I had him assessed. I thought maybe it was in his father\u2019s family \u2026 as his uncle is a stutterer.\u2019 These excerpts provide insight into the mothers\u2019 emotions prior to their children\u2019s diagnoses of autism. Mother 10 admitted that she initially ignored the warning signs and tried to find someone in the family with whom to associate her child\u2019s behaviour. In the next section, mothers\u2019 experiences of family and community members\u2019 understanding of their children prior to diagnosis will be presented.As previously mentioned, all 12 mothers recognised that their children\u2019s development was atypical or \u2018delayed\u2019. Mothers\u2019 experiences included the reactions of family and community members to their children\u2019s behaviour, which motivated them to seek a diagnosis. They sought advice from the elders in their families and communities. The feedback they received from the elders constituted a significant extrinsic factor that motivated them to seek a diagnosis. These reactions provide some insight into family and community members\u2019 understanding of disability and difference.Mother 2 shared that she felt \u2018disturbed\u2019 by her child\u2019s father\u2019s comments as well as her child\u2019s atypical behaviour:\u2018I was disturbed in my mind because his father likened him to a puppy because he was jumping on his toes, making funny noises, getting into people\u2019s houses to steal food, and having no speech \u2026 He started making this high pitched \u201ciiiiiiiii\u201d sound.\u2019 Mother 7 also described how she was influenced by the father\u2019s remarks to delay seeking a diagnosis:\u2018His father insisted that he was deaf, but I was not convinced until the audio screening. I took him to the hospital, nine months later. They said that they needed to do further tests because he failed the screening.\u2019 Mothers 1, 3 and 6 discussed the lack of understanding in their respective religious communities:\u2018We travelled by bus and would go to the hospital three times a week, but we weren\u2019t seeing the correct people. My neighbour would take me to church where they did not understand my son.\u2019 Ingane ayilashwe!\u201d [They demanded that the child must be given proper herbs as he carries luck and truths for the family.] They said that I must have caused him to be so.\u2019 \u2018Some family members like his aunt and his uncle never understood what was going on. \u201cfanele kuyohlolwa\u201d [consult a Sangoma] because sometimes he groans like an animal. Maybe, \u201cubiziwe,\u201d he has a calling to be a Sangoma and that has to be respected.\u2019 \u2018My older brother told me that he is noticing something about him and that I should \u201cThese excerpts reveal the crucial role of family and community support. Mother 3 noted that when she turned to her family for support, they blamed her for her child\u2019s difficulties since they believed that \u2018I must have caused him to be so\u2019, while also recognising that the child \u2018carries luck and truths for the family\u2019. Mother 6 was advised by her brother to \u2018consult a Sangoma\u2019, noting \u2018that has to be respected\u2019.When analysing mothers\u2019 experiences during their children\u2019s diagnoses of autism, two sub-themes emerged, namely: (1) diagnosis is a lengthy, stressful process, (2) relief to receive a diagnosis but worried about the future, because of the lack of guidance on intervention and support.Several mothers indicated that they experienced most of the health care practitioners with whom they interacted during the diagnostic process as \u2018unsupportive\u2019 and \u2018lacking in compassion\u2019, which exacerbated their feelings of hopelessness and confusion. Some of the participants characterised their emotional distress as \u2018extreme anxiety\u2019 and \u2018intense worry\u2019, noting that the terminology carelessly used by the professionals intensified their confusion instead of providing clarity about autism and proving support. Some of the health care professionals speculated about the possible causes of the child\u2019s behaviour without providing clear direction. This theme was especially noticeable in the following comments by Mothers 2, 6 and 7:\u2018I was disturbed in my mind. For the whole first year, I was just numb. I did not even have the energy to go up and down for consultations with him. The word \u201cautism\u201d was all over his reports from the hospital. I would just stare at it and cry.\u2019 attention deficit hyperactivity disorder].\u2019 \u2018I waited four months for an appointment. I took him to a so-called therapist, an occupational therapist. She checked him, and said he is fine. She said he can\u2019t sit still and can\u2019t concentrate, which I had also observed. She then said he might have ADHD .\u2019 \u2018I had to attend the specialist though she did not tell us what she was doing with the boy, and I had to help her to calm him down so that he could sit on the table. I don\u2019t know English; neither does the child so we were not following \u2018The doctor told me that he is hyperactive and so because he cannot concentrate, they will have to put him on medication, which I honestly wonder if it works because boy is the same. They gave me appointment dates far from each other. Even when the pills were messing him up, I could not just walk into the hospital, as I only had to go on my appointment dates.\u2019 Indeed, mothers had to turn to unorthodox practices to get help:sisi.\u2019 \u2018You see at the hospital, now you will come with the child, maybe the medication has overturned his stomach, you must wake up at 4 am to be on the queue. Sometimes they tell you that the Risperdal is running out, come back three days later. You just have to know someone that knows someone inside in order to access help at times. You know how public hospitals are, giggles]. One nurse friend of mine organised for me to get his medication straight after bloods. Well, it\u2019s the way it goes.\u2019 \u2018There is a big public hospital in our zone behind the complex where we live. Well, I don\u2019t have a problem saying it here, we live in South Africa ruled by the ruling party, so I would not go on the lines because of connections inside , it clarified some of the signs and then I decided to have my son assessed.\u2019 \u2018Someone mentioned Autism South Africa. I googled them even though I still didn\u2019t comprehend what it was, so I didn\u2019t worry much about it. Then after a while, as I read up on autism, I realised \u201cFor the other participants, the information-seeking phase started after diagnosis:\u2018Your heart is aching, and you wish to gather as much information as you can \u2026 I read all these books on parenting, and I watched a show on TV. The presenter said that when your child is tired, he won\u2019t make eye contact. Besides it is only respectful to teach them to show respect by not making eye contact with the elders.\u2019 \u2018I was committed to getting every single piece of information I possibly could on autism. Gosh, I just sat on the internet every moment after my son went to sleep. I was on my phone using the last money from his government grant. Until four or five in the morning, I was doing research on autism. But it was difficult to understand, and the data was expensive.\u2019 \u2018My boy freaked me out. He would be like a robot, not talking, not smiling \u2026 At the time of the diagnosis, as this was my first child, I was lucky to come across Autism South Africa on the internet. I emailed them and described the challenges I was facing. As a young mother, I took advantage of technology and started reading on the search engines.\u2019 These extracts reveal that following their children\u2019s diagnoses, the mothers searched for the meaning of \u2018autism\u2019. Since quality information did not accompany the diagnosis, they had to find information on their own and were intrinsically motivated to do so. However, there were also extrinsic sources of information, remarks and behaviours of community members, which were largely informed by IKS.Yazi [you know what], it was at the cr\u00e8che where they did not accept my son because he kept messing in his trousers. I felt there was an implication that I didn\u2019t do enough.\u2019 \u2018\u2018In these past weeks my father, a traditional doctor himself, told me that I need to work on my parenting. See, if you ignore a lot of family issues, it manifests through the child. My father said that the elders in the family that have now passed, are living through this child and I should not force the child to speak our language as he is not of this world.\u2019 township] was already helping me to ensure the safety of my son because in a twinkling of an eye he would run into the road or even into another person\u2019s house eating without permission. People accepted him though others took time to understand him.\u2019 \u2018I was devastated, but the small section of my location .\u2019 \u2018I take him to Miracle Sundays. They told us to bring him consistently in the afternoons to claim his miracle. During Sunday School, he gains a lot because he socialises with other kids on the jungle gym. That is the only outing he ever takes with me [at church] he gets prayed for and I receive a lot of counselling for the entire week. It strengthens me.\u2019 \u2018Church is the one place, I tell you, where we are greatly accepted. Social events like weddings, nah forget it. There [kuzohlatshwa\u201d [goat slaughtering] and the older men would speak and report that he is here and alive, that they should let go of him to be a normal child. We still do this to help him from time to time. He does say syllables now. Could I be winning?\u2019 \u2018I decided yes, \u201cukumhlabela\u201d [meaning animal slaughter] and put the wristband around his hand because you know four years ago, he did not say a sound but four years later as I try to sacrifice every year, he is starting to speak a language that nobody understands. He can point at water and say \u201cyuomeme.\u201d I think it\u2019s the language known to the elders as they watch us.\u2019 \u2018I won\u2019t stop \u201ccombined the medical process with IKS and religion by seeking counsel from iSangoma or iNyanga , applies to the crucial role of health care professionals. While this is aligned to Afrocentrism, it is also firmly recommended in the international scholarship , abakhuzis (commanders), izinyangas and ababonayos (seers), since very few sangomas are women and mothers. It would therefore be crucial for these traditional leaders to understand mothers\u2019 support needs, as this understanding would unlock (facilitate) ubuntu. Clearly, patriarchal power relations are a prominent barrier to acceptance. As stated above, the authors intend to explore this more deeply in an upcoming article.When seeking advice from individuals in key positions within their communities, the mothers needed to approach predominantly male When the mothers in this study sought religious support, the focus was placed on \u2018healing\u2019 rather than understanding their children\u2019s challenges and support needs. At the African-initiated Christian churches to which most of the participants belonged, disability was viewed as a condition that required healing (cf. Amanze All 12 mothers became increasingly resilient as they educated themselves on the meaning of their children\u2019s autism diagnoses (cf. Marsh et al. ubuntu, social support, culture, tradition, interpersonal relationships, interconnectedness and continuity (Majoko Although this study was conducted in KwaZulu-Natal and the participants were 12 Zulu mothers of children diagnosed with autism, it has raised awareness about the urgent need for culturally appropriate support for all persons diagnosed with ASD. Autism should be destigmatised through autism awareness programmes, targeting all stakeholders, including health, education, traditional, cultural and religious organisations, with useful information on the nature of autism, as well as how to access educational and therapeutic intervention and support within local communities (Hoogsteen & Woodgate y Majoko .South Africa needs a systemic approach to autism diagnosis (Clasquin-Johnson & Clasquin-Johnson"}