{"text": "DNA polymerases \u03b1 and \u03b4 play essential roles in the replication of chromosomal DNA in eukaryotic cells. DNA polymerase \u03b1 (Pol \u03b1)-primase is required to prime synthesis of the leading strand and each Okazaki fragment on the lagging strand, whereas DNA polymerase \u03b4 (Pol \u03b4) is required for the elongation stages of replication, a function it appears capable of performing on both leading and lagging strands, at least in the absence of DNA polymerase \u03b5 (Pol \u03b5).in vivo and in vitro. Pol1 interacts with the C-terminal domain of Cdc27, at a site distinct from the previously identified binding sites for Cdc1 and PCNA. Comparative protein sequence analysis identifies a protein sequence motif, called the DNA polymerase interaction motif (DPIM), in Cdc27 orthologues from a wide variety of eukaryotic species, including mammals. Mutational analysis shows that the DPIM in fission yeast Cdc27 is not required for effective DNA replication, repair or checkpoint function.Here it is shown that the catalytic subunit of Pol \u03b1, Pol1, interacts with Cdc27, one of three non-catalytic subunits of fission yeast Pol \u03b4, both The absence of any detectable phenotypic consequences arising from mutation of the DPIM suggests that despite its evolutionary conservation, the interaction between the two polymerases mediated by this motif is a non-essential one. Three conserved DNA polymerase enzymes whose activities are essential for complete chromosomal DNA replication have been identified through biochemical studies in mammalian systems  and combSchizosaccharomyces pombe, the Pol \u03b1-primase and Pol \u03b4 complexes are both heterotetrameric in structure [Each of the three essential polymerases is a multi-subunit entity, comprising a large catalytic subunit and a number of smaller subunits that are presumed to play either regulatory or structural roles . Little tructure . The cattructure . Both cotructure ,10, althtructure ,12, and tructure . Ortholotructure ,15.Perhaps surprisingly, there have been few reports of physical interactions between the various polymerase enzymes believed to be present at the eukaryotic replication fork. One exception to this comes from large-scale functional analysis of the budding yeast proteome where an interaction was uncovered between the catalytic subunit of the Pol \u03b1-primase complex, Pol1, and the C-subunit of the Pol \u03b4 complex in budding yeast, Pol32 . Interacin vitro, using purified recombinant proteins and peptides. Interaction is also seen between the human Cdc27 and Pol1 homologues, p66 and p180. The binding site for Pol1 maps to the extended C-terminal domain of the Cdc27 protein and requires the presence of a short protein sequence motif, which we have designated the DPIM, for DNA polymerase interaction motif. This short sequence is conserved in Cdc27 orthologues from a wide variety of eukaryotic species. Despite this evolutionary conservation, mutational inactivation of the Pol1 binding motif does not affect Cdc27 function in vivo. The implications of these results are discussed.In this paper, it is shown that the orthologues of the budding yeast Pol1 and Pol32 proteins in fission yeast, Pol1 and Cdc27 respectively, also interact in the two-hybrid system. It is also shown that these proteins are capable of interacting directly with one another, To test for interaction between fission yeast Pol1 and Cdc27, the two-hybrid system was used. Full-length Cdc27 fused to the activation domain (AD) of the yeast Gal4 protein was tested for its ability to interact with amino acids 278\u2013527 of fission yeast Pol1 fused to the DNA binding domain of the bacterial transcription factor LexA . Amino acids 278\u2013527 correspond to the smallest region of budding yeast Pol1 shown to interact with Pol32 . ReporteCip1-like PCNA binding sequence, the PIP box. To map the Pol1 binding site, a series of thirteen truncated Cdc27 proteins fused to the Gal4 AD were tested against LexA-Pol1 in the two-hybrid system. The results of this analysis are shown in Figure Previously, minimal Cdc1 and PCNA binding regions on Cdc27 have been mapped ,12,18. Cin vitro. Purified GST-Cdc27-273-352 fusion protein [In order to test whether the interaction between Pol1 and Cdc27 was a direct one, purified recombinant Cdc27 and Pol1 proteins were assayed for their ability to interact  protein  was testXenopus [DNA polymerase interaction motif (or DPIM) with the consensus sequence D(D/E)-G -- (V/I)(T/S). The sequences flanking the DPIM are generally highly charged in character and some sequence conservation (particularly of charged amino acids) is apparent in these regions. Mutagenesis and peptide binding studies (described below) suggest that, in addition to the DPIM, some of these sequences may also play a role in binding Pol1 (see Discussion).Previously, Cdc27 homologues from fission yeast ,18, buddXenopus  have beeXenopus  and \u03c8-BLXenopus ,24 were To examine whether the Pol1-Cdc27 (Pol1-Pol32) interaction observed in the yeasts was also conserved in higher eukaryotes, the catalytic subunit of human Pol \u03b1 and the human Cdc27 orthologue p66/KIA00039 were assayed for interaction using the two-hybrid system. Amino acids 291\u2013540 of the human Pol \u03b1 catalytic subunit, corresponding to the minimum Cdc27 binding region (amino acids 278\u2013527) in fission yeast Pol1, were expressed as a LexA fusion alongside Gal4 activation domain fusions of either the entire C-terminal domain of human p66 (amino acids 253\u2013466) or the C-terminal 111 amino acids only (356\u2013466). Interactions were tested by \u03b2-galactosidase assay. Both p66 constructs bound to Pol \u03b1 Table , indicatin vivo by Cdc27. Similar reductions were seen with the Cdc27-P4 and Cdc27-P6 mutants, where the mutated residues are located N-terminal and C-terminal to the DPIM respectively. The conserved amino acids of the DPIM are therefore essential for Pol1 binding by Cdc27, although sequences flanking the conserved motif also play a role. Only three of the eight mutant proteins  were able to interact with LexA-Pol1 (278\u2013527), though the strength of the interaction was reduced to 30\u201340% of the wild-type value for Cdc27-P3 and Cdc27-P5 , and to ~ 10% of wild-type for Cdc27-P7 . Immunoblotting showed that all the mutant proteins were present in yeast protein extracts at the same level as the wild-type Gal4-Cdc27 fusion protein (data not shown).Next, the importance for Pol1 binding of the conserved amino acids in the DPIM was examined. Eight mutant Cdc27 proteins  were constructed and tested as LexA fusions in the two-hybrid system . Removal of fifty amino acids from the N-terminus, or twenty amino acids from the C-terminus, of the Pol1 (278\u2013527) protein was found to abolish the interaction with Cdc27 altogether Table .pol1 allele, pol1-ts13, had been reported [pol1+ by deletion of 9 bp from the ORF, resulting in loss of three amino acids  from within the minimal Cdc27 binding domain defined above. In this study, the ability of a Pol1-TS13(278\u2013527) bait to bind to Cdc27 was tested using the two-hybrid system. No interaction could be detected at a range of growth temperatures . Indeed, no suppression was observed of any of three pol1 alleles that were analysed in this way, the others being pol1-1 [pol1-H4 [Previously, the isolation of a temperature-sensitive mutant reported . Sequenc3X-Cdc27  and trang pol1-1  and pol1in vivo role of the DPIM in Cdc27, four of the eight DPIM mutant alleles (cdc27-P1 through cdc27-P4) were cloned into plasmid pREP3X, 3' to the repressible nmt1 promoter [cdc27+/cdc27::his7+ diploid strain. Transformant colonies were then induced to sporulate and the spores plated on media containing thiamine, to repress the nmt1 promoter. Under these conditions, residual low level expression from the nmt1 promoter ensures that the level of Cdc27 protein present in the cell is comparable to that seen in wild-type cells [cdc27\u0394 haploid cells; indeed, no phenotypic defects were apparent (data not shown).To assay the promoter ,29, and pe cells . Analysicdc27+ gene was precisely replaced with the cdc27-Q1 mutant allele. In the Cdc27-Q1 mutant protein, the central five amino acids of the DPIM are replaced with alanine, resulting in loss of Cdc27-Pol1 interaction in the two-hybrid system . PCR analysis of genomic DNA using primers specific for wild-type cdc27+ and cdc27-Q1 sequences , with a generation time indistinguishable from wild-type (110 minutes at 32\u00b0C in YE medium). At 32\u00b0C, cdc27-Q1 cells underwent division at ~ 14.1 \u03bcm (compared to wild-type at ~ 14.4 \u03bcm). Further analysis showed that the cdc27-Q1 cells were indistinguishable from wild-type in all respects examined, including responses to the DNA replication inhibitor hydroxyurea (HU) and the DNA damaging agents methylmethane sulphonate (MMS), camptothecin (CPT), bleomycin sulphate (BMS) and UV light . The kinetics of cell division arrest in response to HU were also examined, but again no difference was detectable between cdc27-Q1 and wild-type strains (data not shown). That cell number increase is arrested in cdc27-Q1 cultures following treatment with HU, and that both wild-type and cdc27-Q1 cells become highly elongated under these conditions, is indicative of the presence of a functional DNA replication checkpoint in these cells. Taken together, these results strongly suggest that the Pol1-Cdc27 interaction does not play an essential role either during S-phase or in various DNA repair pathways in fission yeast.Phenotypic analysis of cdc27-Q1 background were also investigated. cdc27-Q1 was crossed to strains carrying mutations in the other three subunits of Pol \u03b4  and in the helicase-endonuclease Dna2 and its associated protein Cdc24 (dna2-C2 and cdc24-M38). [cdc27-Q1 were indistinguishable from the single mutant. The cdc27-Q1 mutation was also combined with rad3\u0394 [cds1\u0394 [cdc27-Q1 rad3\u0394 and cdc27-Q1 cds1\u0394 double mutants, both of which were viable. The Rad3 and Cds1 proteins are key components of various DNA structure checkpoints in fission yeast [cdc27-Q1 double mutants were viable indicates that cdc27-Q1 cells do not require the presence of a functional checkpoint for viability. When wild-type cells are treated with hydroxyurea, activation of Cds1 results in cell cycle arrest and replication fork stabilisation. In the absence of Cds1, however, replication forks are believed to collapse, resulting in loss of viability [rad3\u0394 and cds1\u0394 double mutants were tested for their sensitivity to HU and CPT, but as before, no differences were observed between single and double mutants with cdc27-Q1 (data not shown).The consequences of introducing additional mutations into the 24-M38). ,30-33. Tth rad3\u0394  and cds1on yeast . That thiability . The radIn fission yeast, DNA polymerase \u03b4 is a multisubunit complex comprising a large catalytic subunit that is required for chromosomal replication as well as three smaller subunits, two of which are also essential for cell viability ,18,36. Uin vivo and in vitro with Pol1, the catalytic subunit of Pol \u03b1. The Pol1 binding site on Cdc27 has been mapped by in vivo and in vitro approaches and a region of 40 amino acids, from amino acids 293 \u2013 332, has been shown to be sufficient for binding. Protein sequence alignments of Cdc27 homologues across this 40 amino acid region identify a short protein sequence motif (D -- G --VT) that is highly conserved and which is essential for Pol1 binding. This DNA polymerase interaction motif (DPIM) is flanked by relatively highly charged sequences. Ten basic amino acids are found flanking the DPIM in the fission yeast Cdc27 protein sequence, nine of which are located N-terminal to the central conserved motif. Similarly, there are ten acidic amino acids, all of which lie either within the conserved DPIM or C-terminal to it. Our mutagenesis data clearly implicates several of these charged groups in the binding to Pol1 .The Cdc27 protein has an elongated shape, with a frictional ratio of 1.85 . The samRecently, the results of a deletion analysis of Pol32, the budding yeast orthologue of Cdc27, were reported , includiS. pombe cdc27-Q1 cells were indistinguishable from wild-type. No genetic interactions were observed between cdc27-Q1 and various other DNA replication or checkpoint mutants, including the key checkpoint kinase Rad3.In this paper, cells expressing the DPIM mutant protein Cdc27-Q1 were shown to be no more sensitive then wild-type to HU, MMS, CPT, UV and BMS (see Results), while analysis of budding yeast cells expressing Pol32 lacking the DPIM (270\u2013309 deletion) showed them to be no more sensitive than wild-type to HU and UV, and to show normal rates of mutagenesis following UV exposure . Indeed,cdc27-Q1 mutation might be expected to be synthetically lethal or sick with a mutant that disrupted the overlapping redundant function. With the genetic tools available in yeast, this is a hypothesis that is readily testable.In conclusion, while the interaction between Pol \u03b1-primase and Pol \u03b4 mediated via Cdc27 could play an important role in coordinating the events of lagging strand synthesis, we have yet to obtain any evidence that this is the case. This raises two possibilities. First, that the observed interaction does not play an important role in chromosomal replication. We believe that this is unlikely to be the case, given the high degree of conservation of the DPIM sequence across evolution, in a region of the Cdc27 protein that is very poorly conserved at the primary sequence level. The second possibility is that there are multiple redundant interactions within the lagging strand machinery. In this case, an important role for the Cdc27-Pol1 interaction might only be uncovered when another protein-protein interaction is perturbed, in which case, the in vivo.In fission yeast, interaction between Pol \u03b1 and Pol \u03b4 is mediated, at least in part, by direct binding of the Pol \u03b4 C-subunit Cdc27 to the Pol \u03b1 catalytic subunit Pol1, and requires the presence of a short sequence motif (DPIM) in the C-terminal region of Cdc27. The DPIM is conserved in all known Cdc27 orthologues. Despite this, it has not been possible to identify any phenotypic consequences associated with deletion of the DPIM sequence, raising the possibility that the observed interaction does not play a crucial role pol1-H4 [pol1-1 [pol1-ts13 [pol\u03b1-ts13 but is correctly renamed here to bring it in line with accepted nomenclature standards (see  for further details). S. pombe media and techniques were essentially as described [S. pombe was carried out by electroporation [S. cerevisiae CTY10-5d  was used [S. cerevisiae was cultured in YPDA and SD medium.All fission yeast strains were as described previously, except for pol1-H4  and pol1 [pol1-1 , which wol1-ts13 , which wescribed , with thporation , whereasporation . For twowas used . S. cereS. cerevisiae lexA op-lacZ strain CTY10-5d, as described previously [Two-hybrid interactions were monitored using the Gal4 transcription activation domain (prey) plasmid pACT2 (Clontech), the LexA DNA binding domain (bait) plasmid pBTM116, and eviously .pol1+ gene from S. pombe cosmid SPAC3H5, see , into plasmid pTZ19R) using oligonucleotides POL15 (5'-GTGTGGTTTGGGATCCCCCTATCACCAATGACACCTTTA-3') and POL13-2 (5'-GTGTGGTTTGGGATCCTACATCACCGTCATTGGAGGCGT-3'), restricting the PCR product with BamHI (sites underlined), cloning to pTZ19R (Fermentas) and sequencing to confirm the absence of errors. The 763 bp BamHI fragment was then transferred to pBTM116, to generate pBTM116-Pol1(278\u2013527). Plasmid pBTM116-Pol1-TS13(278\u2013527) was produced in a similar manner, except that the starting PCR template was genomic DNA prepared from pol1-ts13 cells [pol1+ ORF, resulting in the loss of coding capacity for amino acids L470, S471 and R472. Plasmids expressing C-terminally truncated Pol1(278\u2013527) proteins were constructed by PCR amplification using oligo POL15 in conjunction with POL25-3 (5'-GTGTGGTTTGGGATCCTAAGGACCCATAACTCTTCTACT-3'), POL13-487 (5'-GTGTGGTTTGGGATCCTAAAAATTTGGTTGTTGTATTTT-3'), POL1-497 (5'-GTGTGGTTTGGGATCCTACCGGCACCAACTAGCATTTTT-3') or POL1-507 (5'-GTGTGGTTTGGGATCCTAGTTCTGAGGTGACGAACATCC-3'), cloning directly to pBTM116 following BamHI cleavage of the PCR product, and sequencing. The resulting constructs encoded the following proteins as Lex A fusions: Pol1(278\u2013477), Pol1(278\u2013487), Pol1(278\u2013497) and Pol1(278\u2013507). A construct expressing an N-terminally truncated Pol1(278-527) protein, designated Pol1(328\u2013527), was generated by amplification using POL15-2 (5'-GTGTGGTTTGGGATCCCCGGCTCATTGTGTCTATTTGGC-3') with POL13-2 (above). Amplification with POL15-2 and POL25-3 generated a construct with the potential to express a LexA-Pol1 protein truncated at both ends: LexA-Pol1(328\u2013477).The Pol1 bait plasmid pBTM116-Pol1-(278\u2013527) was constructed by amplifying sequences encoding amino acids 278\u2013527 from plasmid pTZ19R-Pol1 (prepared by subcloning a 5925 bp SmaI-PstI fragment encompassing the entire GGATCCCCTCAGAACAAGCAGTGAAAGAA-3') or P66-52 (5'-GTGTGGTTTGGGATCCCGTCTCCACCTCTTGAACCAGTG-3') with P66-3 (5'-GTGTGGTTTGGGATCCTTGGTCTTCACCCTTGACCACTC-3'). The PCR products were then restricted with BamHI, cloned to pACT2 and sequenced. The resulting plasmids encode, as Gal4 AD fusions, either the entire C-terminal domain of p66/KIAA0039  or a shorter region . Sequences encoding the interacting domain of the catalytic domain of human Pol \u03b1 were amplified from plasmid pBR322-Pol \u03b1  using oligos HPOL1-5 (5'-GTGTGGTTTGGGATCCCCAAAGGGACCGTGTCCTACTTA-3') and HPOL1-3 (5'-GTGTGGTTTGGGATCCTACATCACGACAAGCGGTGGTGG-3'), restricted with BamHI, cloned to pBTM116 and sequenced. The resulting plasmid encodes amino acids 291\u2013540 of the human protein as a LexA fusion.Sequences encoding the C-terminal region from human p66/KIAA0039 were amplified by PCR from plasmid pET19b-p66  using either oligo P66-51 (5'-GTGTGGTTTGGGATCCCCACCGAAGCAAAATCTGCTGCA-3') and PMUT3 (5'-GTTGTGGGTGGGATCCTACTTCTTAGTTGCAATGTTTAC-3'). Mutant Q1 was generated by PCR amplification with same primers but using pHBLA-Cdc27-Q1 (below) as template. Plasmids expressing mutants P5-P7 were generated by overlap extension PCR using PMUT5 and PMUT3 together with the following mutagenic oligonucleotides (shown with mutated sequence underlined in top strand oligo): CDC27-P5F (5'-AAAGAAAAGTTGCAGCGTACGCGACAACGAAAG-3'), CDC27-P5R (5'-CTTTCGTTGTCGCGTACGCTGCAACTTTTCTTT-3'), CDC27-P6F (5'-TTGGTTACTAAGGCAGCAGCAGTCTGGGAATCA-3'), CDC27-P6R (5'-TGATTCCCAGACTGCTGCTGCCTTAGTAACCAA-3'), CDC27-P7F (5'-GAATCATTTTCTGCAGCTGCAAACATCTCAACT-3'), CDC27-P7R (5'-AGTTGAGATGTTTGCAGCTGCAGAAAATGATTC-3').The Cdc27 prey plasmids were constructed in pACT2 (Clontech) and have been previously described, with the exception of mutants Cdc27-273-352-P1 through -P7, and Cdc27-273-352-Q1. The first four of these (P1-P4) were generated by PCR amplification from the pREP3X-Cdc27-P1 to -Cdc27-P4 plasmids described below. Oligonucleotides for PCR, with BamHI sites underlined: PMUT5 -encoding BamHI fragment described above was cloned into pQE32 (Qiagen). The resulting plasmid, pQE32-Pol1 (278\u2013527), was transformed into E. coli M15 (pREP4) and recombinant protein expression induced in 500 ml cultures (OD600 nm of 0.6) by addition of IPTG to a final concentration of 1 mM. Following incubation for 4 hours at 37\u00b0C, the cells were pelleted and the pellet resuspended in 40 ml of ice-cold buffer A  containing EDTA-free Complete\u2122 inhibitors (Roche Applied Science) and 1 mM PMSF. The cells were lysed by sonication, then centrifuged at 25000 g for 15 minute at 4\u00b0C. The soluble supernatant was added to 4 ml of 50% (v/v) Ni-NTA agarose (Qiagen) in buffer A, mixed on a wheel at 4\u00b0C for one hour, then packed into a disposable chromatography column at 4\u00b0C. The column was drained of the flow-through and subsequently washed with 100 ml of buffer B  containing Complete\u2122 inhibitors and PMSF, then 100 ml of buffer A containing Complete\u2122 inhibitors and PMSF, before the bound H6-Pol1 protein was eluted using 4 ml of buffer C . Following elution, samples were analysed by SDS-PAGE and the peak fractions pooled and dialysed overnight in PBS at 4\u00b0C. Protein concentration was determined by BCA assay (Pierce) versus BSA standards.The Pol1 (278\u2013527) domain was expressed in GST and GST-Cdc27-273-352 fusion proteins were prepared as described previously  from plapol1+ locus in an otherwise wild-type leu1-32 ura4-D18 h- strain with sequences encoding thirteen copies of the 9E10 (c-myc) mAb epitope, such that the encoded Pol1 protein (termed Pol1-13Myc) carries the 9E10 epitopes at its C-terminus. Oligonucleotides for amplification from pFA6a-13Myc-kanMX6 [CGGATCCCCGGGTTAATTAA-3', with plasmid-specific sequence underlined) and POL1-13MYC-3 (5'-GGCAATTCCCAAGTCTTTGAAACAGGTATTCCCATCAACATTTCTTGTACTGCATGAGCAAATATCTGTTCGAGGTGTCGAATTCGAGCTCGTTTAAAC-3'). Following transformation of ~ 10 \u03bcg of PCR product, correct G418-resistant integrants were identified by PCR amplification of genomic DNA using primer FCGPOL1-5 (5'-ATGTCGTGGAAGCGTTCATT-3') within the pol1+ ORF and KAN269R (5'-GATCGCAGTGGTGAGTAACCATGCATCATC-3') within the kanMX6 cassette, and by Western blotting using the mouse anti-Myc mAb 9E10 (Roche).PCR-based gene targeting was used to tag the chromosomal c-kanMX6  were as 7 cells in mid-exponential growth in EMM medium. Cells were harvested, washed once in STOP buffer  and disrupted in buffer A  supplemented with Complete\u2122 protease inhibitors (Roche), using a bead beater (Hybaid Ribolyser). Protein concentrations were determined at 595 nm using the BioRad protein assay reagent according to the manufacturer's instructions, with BSA as standard.Peptides were synthesized by Mimotopes . All peptides were synthesized to contain the sequence biotin-SGSG at the N-terminus. Peptide sequences: SpA AAPDEPQEIIKSVSGGKRRG; SpB PQEIIKSVSGGKRRGKRKVK; SpC KSVSGGKRRGKRKVKKYATT; SpD GKRRGKRKVKKYATTKDEEG: SpE KRKVKKYATTKDEEGFLVTK; HsA PKTEPEPPSVKSSSGENKRK; HsB EPPSVKSSSGENKRKRKRVL; HsC KSSSGENKRKRKRVLKSKTY; HsD ENKRKRKRVLKSKTYLDGEG; HsE RKRVLKSKTYLDGEGCIVTE. For binding assays, the peptides were initially bound to 10 \u03bcl Streptavidin-agarose beads in PBS in a final volume of 100 \u03bcl at room temperature for 1 hour with gentle agitation. After binding, the beads were washed 3 times with 100 \u03bcl PBS. Protein extracts (100 \u03bcg of fission yeast extract) were added to the beads, and incubated at 4\u00b0C for 1 hr with gentle agitation. The beads were pelleted by centrifugation at 2000 rpm for 3 minutes, and subsequently washed extensively with NP40 buffer  NP-40), prior to final resuspension with 20 \u03bcl of SDS loading buffer. Following SDS-PAGE, Pol1-13Myc was visualised by immunoblotting with the mouse anti-Myc mAb 9E10 (Roche). Fission yeast protein extracts were prepared from 8 \u00d7 10cdc27+ cDNAs  from pTZ19R-Cdc27-cDNA [GCCGCAGCAGGATTCTTGGTTACTAAGG-3'), CDC27-P2 (5'-CGACAACGAAAGATGAAGAAGCCGCCTTGGTTACTAAGGAAGAAG-3'), CDC27-P3 (5'-TCAAATCCGTATCCGGTGGAGCCGCAGCAGGGAAAAGAAAAGTTAAAAAG-3'), CDC27-P4 (5'-CCGGTGGAAAGAGACGTGGGGCCGCAGCAGTTAAAAAGTACGCGACAAC-3'). The resulting mutant alleles were tested for function by transforming a cdc27+/cdc27::his7+leu1-32/leu1-32 ura4-D18/ura4-D18 his7-366/his7-366 ade6-M210/ade6-M216 h-/h+ diploid [Plasmids pREP3X-Cdc27-P1 to -Cdc27-P4 were constructed by cloning mutagenised c27-cDNA  into pRE diploid , transfecdc27+ gene was first cloned into pTZ19R to make pHB-Cdc27. This vector was then modified by addition of the S. cerevisiae LEU2 gene and S. pombe ars1, to make pHBLA-Cdc27. The cdc27+ gene was then subjected to oligonucleotide-directed in vitro mutagenesis using the QuikChange method (Stratagene) with oligonucleotides CDC27-QC1  and CDC27-QC2 (5'-CTTCTTCCTTAGTAACCAAGgcggccgcTGCAGCTTTCGTTGTCGCGTAC-3'), to create plasmid pHBLA-Cdc27-Q1. This was then was transformed into a cdc27+/cdc27::ura4+ diploid, and cdc27::ura4+ (pHBLA-Cdc27-Q1) haploids obtained following sporulation and regrowth. These were then plated on YE plates containing 1 mg/ml 5-FOA. 5-FOA resistant colonies were identified, purified and characterised by PCR amplification of genomic DNA ; CDC27-Q1M-DIAG2 ; CDC27-H (5'-ACTGGTAGAATTGCGTTCGCGCTC-3'); CDC27-B (5'-TCTAGGATCAGAGTGAACTGATTG-3'); CDC27-SEQ2005 (5'-AGGTTGTACTAACATTAACAG-3'). The resulting strain, cdc27-Q1 leu1-32 ura4-D18 his7-366 ade6-M216 h- was then analysed alongside the wild-type leu1-32 ura4-D18 his7-366 ade6-M216 h-, as described below.A 3.1 kb HindIII-BamHI genomic DNA fragment carrying the oworkers ), to ens6 cells/ml) in YE medium and ~ 2000 cells plated on YE medium supplemented with varying concentrations of hydroxyurea , methylmethanesulphonate , bleomycin sulphate , or camptothecin . Cells were also plated on plates containing sub-lethal doses of both HU and CPT, specifically 7.5 mM HU with either 5.5 or 6 \u03bcM CPT, or 10 mM HU with either 5.5 or 6 \u03bcM CPT. To analyse the effects of HU treatment in liquid culture, HU was added to EMM medium to a final concentration of 12 mM. Cell number per ml of culture was monitored using a Coulter Z1 electronic particle counterTo test sensitivity to UV, 1000 cells were plated on EMM plates, allowed to dry for 20 minutes, then irradiated using either a Stratalinker UV source (Stratagene) over the range 0 \u2013 250 J/m2. Following UV treatment, plates were placed immediately in the dark to avoid photoreversal. For all treatments, the efficiency of colony formation was determined after 4 days growth at 32\u00b0C. Growth rate  was determined by cell counting using a particle counter. Cell length at cell division was determined using a graduated eyepiece.Cells were grown to mid-exponential phase ; PCNA (proliferating cell nuclear antigen).In Edinburgh, SM conceived of the study, performed some of the experimental work and prepared and revised the final manuscript, while FG performed the remainder of the experimental work. In Dundee, EW and JRGP designed and carried out the peptide binding studies. All four authors read and approved the manuscript."}
{"text": "Bisdioxopiperazine anti-cancer agents are inhibitors of eukaryotic DNA topoisomerase II, sequestering this protein as a non-covalent protein clamp on DNA. It has been suggested that such complexes on DNA represents a novel form of DNA damage to cells. In this report, we characterise the cytotoxicity and DNA damage induced by the bisdioxopiperazine ICRF-187 by a combination of genetic and molecular approaches. In addition, the well-established topoisomerase II poison m-AMSA is used for comparison.Saccharomyces cerevisiae single-gene deletion strains, homologous recombination was identified as the most important DNA repair pathway determining the sensitivity towards ICRF-187. However, sensitivity towards m-AMSA depended much more on this pathway. In contrast, disrupting the post replication repair pathway only affected sensitivity towards m-AMSA. Homologous recombination (HR) defective irs1SF chinese hamster ovary (CHO) cells showed increased sensitivity towards ICRF-187, while their sensitivity towards m-AMSA was increased even more. Furthermore, complementation of the XRCC3 deficiency in irs1SF cells fully abrogated hypersensitivity towards both drugs. DNA-PKcs deficient V3-3 CHO cells having reduced levels of non-homologous end joining (NHEJ) showed slightly increased sensitivity to both drugs. While exposure of human small cell lung cancer (SCLC) OC-NYH cells to m-AMSA strongly induced \u03b3H2AX, exposure to ICRF-187 resulted in much less induction, showing that ICRF-187 generates fewer DNA double strand breaks than m-AMSA. Accordingly, when yeast cells were exposed to equitoxic concentrations of ICRF-187 and m-AMSA, the expression of DNA damage-inducible genes showed higher levels of induction after exposure to m-AMSA as compared to ICRF-187. Most importantly, ICRF-187 stimulated homologous recombination in SPD8 hamster lung fibroblast cells to lower levels than m-AMSA at all cytotoxicity levels tested, showing that the mechanism of action of bisdioxopiperazines differs from that of classical topoisomerase II poisons in mammalian cells.By utilizing a panel of Our results point to important differences in the mechanism of cytotoxicity induced by bisdioxopiperazines and topoisomerase II poisons, and suggest that bisdioxopiperazines kill cells by a combination of DNA break-related and DNA break-unrelated mechanisms. Type II topoisomerases are essential nuclear enzymes found in all living organisms . Their bTopoisomerase II is also a major drug target in human cancer therapy, where a number of clinically active drugs such as the epipodophyllotoxins VP-16 and VM-26, the aminoacridine m-AMSA, and antracyclines such as doxorubicin, daunorubicin and epirubicin are widely used. These drugs have collectively been called topoisomerase II poisons due to their mechanism of action on topoisomerase II. Rather than inhibiting the basic catalytic activity of the enzyme, these drugs perturb the topoisomerase II catalytic cycle resulting in an increase in the level of a transient reaction intermediate, where DNA is cleaved and covalently attached to DNA .Catalytic inhibitors of topoisomerase II have a different mode of action. These drugs exemplified by merbarone, aclarubicin, F11782 and the bisdioxopiperazines work by inhibiting topoisomerase II at other stages in the reaction cycle where DNA is not cleaved as reviewed in ,6. Amongi) Expression of bisdioxopiperazine-sensitive topoisomerase II in cells also expressing bisdioxopiperazine-resistant topoisomerase II confers dominant sensitivity to these drugs methanesulphonanilide); MMR, Mismatch Repair; NER, Nucleotide Excision Repair; NHEJ, Non-Homologous End Joining; PCR, Polymerase Chain Reaction; PRR, Post Replication Repair; SCLC, Small Cell Lung Cancer; SC-URA, Synthetic medium lacking uracil; SSA, Single Strand Anealing; YPD, Medium containing Yeast extract, Peptone and Dextrose.Lars H. Jensen: Participated in planning the experiments, performed yeast transformations and clonogenic assays, and prepared the manuscript. Marielle Dejligbjerg: Performed \u03b3H2AX western blots, primer design, real-time PCR experiments, and data quantitation. Lasse T. Hansen: Performed mammalian clonogenic assays and recombination assays. Morten Grauslund: Performed RNA purification and microarray analysis. Peter B. Jensen: Participated in planning and monitoring the study. Maxwell Sehested: Participated in the initiation and conduction of the study. All authors read and approved the final manuscript.Clonogenic sensitivity of mutant single-gene deletion yeast strains towards ICRF-187 and m-AMSA. Clonogenic sensitivity of a panel of human topoisomerase II \u03b1-transformed haploid yeast deletion strains towards equitoxic (to wt cells) concentrations of ICRF-187 and m-AMSA. Error-bars represent SEM of 3 \u2013 10 independent experiments.Click here for filet2\u20134 cells were inoculated into YPD medium and grown overnight at 34\u00b0C, 150 rpm. The cultures were then diluted into 50 ml YPD medium to obtain an OD600 of 0.2. After growing the cells for 2 hours to assure exponential growth, equitoxic concentrations of ICRF-187 and m-AMSA were applied and the cells were grown for an additional 2 hours before RNA was isolated. The figure depicts the clonogenecity of drug treated and untreated cells. Exposure of the cells to the two drugs resulted in a reduction of their clonogenecity of approx. 50 %. Error bars-represent SEM of three independent experiments.Level of killing of yeast cells used in transcriptional profiling experiments. Fresh colonies of pMJ1-transformed JN362AClick here for fileTranscriptional response towards ICRF-187. A list of yeast genes whose average expression in two independent experiments is induced or repressed more than 1.5 fold by exposure to ICRF-187.Click here for fileTranscriptional response towards m-AMSA. A list of yeast genes whose average expression in two independent experiments is induced or repressed more than 1.5 fold by exposure to m-AMSA.Click here for fileTopoisomerase II activity levels in hamster cell lines. The levels of topoisomerase II catalytic activity in crude extracts from wt and recombination defective hamster cell lines. Error-bars represent SEM of two independent experiments. No difference in the level of topoisomerase II catalytic (DNA strand passage activity) is observed.Click here for file"}
{"text": "K562 leukaemia cells were selected for resistance using 0.5 microM etoposide (VP-16). Cloned K/VP.5 cells were 30-fold resistant to growth inhibition by VP-16 and 5- to 13-fold resistant to m-AMSA, adriamycin and mitoxantrone. K/VP.5 cells did not overexpress P-glycoprotein; VP-16 accumulation was similar to that in K562 cells. VP-16-induced DNA damage was reduced in cells and nuclei from K/VP.5 cells compared with K562 cells. Topoisomerase II protein was reduced 3- to 7-fold and topoisomerase II alpha and topoisomerase II beta mRNAs were each reduced 3-fold in resistant cells. After drug removal, VP-16-induced DNA damage disappeared 1.7 times more rapidly and VP-16-induced DNA-topoisomerase II adducts dissociated 1.5 times more rapidly in K/VP.5 cells than in K562 cells. ATP (1 mM) was more effective in enhancing VP-16-induced DNA damage in nuclei isolated from sensitive cells than in nuclei from resistant cells. In addition, ATP (0.3-5 mM) stimulated VP-16-induced DNA-topoisomerase II adducts to a greater extent in K562 nuclei than in K/VP.5 nuclei. Taken together, these results indicate that resistance to VP-16 in a K562 subline is associated with a quantitative reduction in topoisomerase II protein and, in addition, a distinct qualitative alteration in topoisomerase II affecting the stability of drug-induced DNA-topoisomerase II complexes."}
{"text": "We have studied the genetic alterations acquired during selection of a cloned human leukaemic cell line (CEM/VP-1) that is 15-fold more resistant to the anticancer topoisomerase II-inhibitor etoposide than parental CCRF-CEM cells. CEM/VP-1 cells exhibit an 'atypical MDR' phenotype: cross resistance to other topo II inhibitors  and expression of a drug-resistant topo II activity. Cytogenetic and molecular studies revealed that the cell line carried multiple genetic changes affecting TOP2 genes encoding both topo II alpha and beta isoforms. CEM/VP-1 was diploid, 47,XX,+20, and appears to have been preferentially selected from a 1% diploid subpopulation present in the tetraploid parental cells. The same chromosomal abnormalities were present in resistant and sensitive cells except for an acquired 3p- change most likely deleting one TOP2 beta allele. PCR/DNA sequence analysis and allele-specific hybridisation showed that one of two TOP2 alpha alleles expressed in CEM/VP-1 cells had acquired a Lys-797-->Asn codon change. This mutation lies close to the catalytic Tyr-804 residue of the protein and may interfere with drug-induced trapping of the cleavable complex. Alternatively, it could exert a loss of function phenotype. CEM/VP-1 cells did not exhibit codon 449 or 486 TOP2 alpha mutations in the ATP binding domain reported in two other resistant cell lines. Diploid selection and multiple changes observed in CEM/VP-1 cells appear to be consequences of the recessive phenotype of at-MDR. These results may be useful in approaching the mechanisms of clinical resistance."}
{"text": "The cytoxicity of both intercalating (m-AMSA) and non-intercalating  topoisomerase II-targeting drugs is thought to occur via trapping DNA topoisomerase II on DNA in the form of cleavable complexes. First, analysis of cleavable complexes (detected as DNA double-strand breaks) by pulsed-field gel electrophoresis confirmed the correlation between cleavable complex formation and cytotoxicity of three topoisomerase-targeting drugs in HeLa S3 cells (the order of effects being VM26 > m-AMSA > VP16). In contrast to many antineoplastic agents, hyperthermic treatments were found to protect cells against the toxicity of all three topoisomerase II drugs. Hyperthermia treatment does not alter drug accumulation but reduces the ability of the drug-topoisomerase II complex to form the cleavable complexes. Nuclear protein aggregation induced by heat at the sites of topoisomerase II-DNA interaction may explain such an effect. In thermotolerant cells, the toxic effects of VP16 but not m-AMSA were reduced. For both drugs, however, the status of thermotolerance did not affect cleavable complex formation by the drugs. Thus, protection against VP-16 toxicity seems not to be associated with heat-induced activation of the P-gp 170 pump or altered topoisomerase II-DNA interactions. Rather, a protective (heat shock protein mediated?) mechanism against non-intercalating topoisomerase II drugs seems to occur at a stage after DNA-drug interaction. Finally, heat treatment before topoisomerase II drug treatment reduced toxicity and cleavable complex formation in thermotolerant cells to about the same extent as in non-tolerant cells, consistent with the presumption of nuclear protein aggregation being responsible for this effect."}
{"text": "Camptothecins are DNA topoisomerase I-directed anti-tumour drugs with a novel mechanism of action. Topotecan (TPT), a hydrophilic derivative of camptothecin, is currently undergoing phase II clinical trials in small-cell lung cancer (SCLC). Human SCLC OC-NYH cells were made more than 6-fold resistant to topotecan by stepwise drug exposure and resistance was stable for 70 passages without drug. NYH/TPT cells had half the topoisomerase I level and activity of wild-type cells. However, no difference in camptothecin or topotecan inhibition of topoisomerase I-mediated DNA relaxation was found, indicating that the enzyme itself was unchanged in the resistant cell. In NYH/TPT cells, topoisomerase II alpha and beta levels were increased approximately 2-fold. Accordingly, the topoisomerase II-directed drug etoposide (VP-16) induced an increased number of DNA single-strand breaks in NYH/TPT cells. However, sensitivity to different topoisomerase II-targeting agents in NYH/TPT cells varied from increased to decreased, indicating a role for as yet unidentified factors acting on the pathway to cell death after topoisomerase II-induced DNA damage has occurred. Of 20 anti-cancer agents tested, only hydroxyurea showed marked collateral hypersensitivity in NYH/TPT cells."}
{"text": "Multidrug-resistant (MDR) cell lines often have a compound phenotype, combining reduced drug accumulation with a decrease in topoisomerase II. We have analysed alterations in topoisomerase II in MDR derivatives of the human lung cancer cell line SW-1573. Selection with doxorubicin frequently resulted in reduced topo II alpha mRNA and protein levels, whereas clones selected with vincristine showed normal levels of topo II alpha. No alterations of topo II beta levels were detected. To determine the contribution of topo II alterations to drug resistance, topo II activity was analysed by the determination of DNA breaks induced by the topo II-inhibiting drug 4'-(9-acridinylamino)methane-sulphon-m-anisidide (m-AMSA) in living cells, as m-AMSA is not affected by the drug efflux mechanism in the SW-1573 cells. The number of m-AMSA-induced DNA breaks correlated well (r = 0.96) with in vitro m-AMSA sensitivity. Drug sensitivity, however, did not always correlate with reduced topo II mRNA or protein levels. In one of the five doxorubicin-selected clones m-AMSA resistance and a reduction in m-AMSA-induced DNA breaks were found in the absence of reduced topo II protein levels. Therefore, we assume that post-translational modifications of topo II also contribute to drug resistance in SW-1573 cells. These results suggest that methods that detect quantitative as well as qualitative alterations of topo II should be used to predict the responsiveness of tumours to cytotoxic agents. The assay we used, which measures DNA breaks as an end point of topo II activity, could be a good candidate."}
{"text": "These agents were observed to inhibit HeLa DNA topoisomerase II activity ~ 200 \u03bcM and L1210 topoisomerase II activity \u2265 100 \u03bcM. These agents did not cause DNA protein linked breaks themselves, but upon incubation for 14-24 hr did enhance the ability of VP-16 to cause cleavable complexes. The heterocyclic amineboranes inhibited DNA synthesis and caused DNA strand scission. They were additive with VP-16 in affording these results as well as inhibiting colony growth of L1210 cells after co-incubation for 1 hr. The agents inhibited"}
{"text": "The objective of this study was to determine whether arachidonate metabolites are involved in the vasoconstrictive effects of angiotensin II in rats. In the isolated perfused heart, dexamethasone (4 mg/kg) significantly suppressed the maximal decreases in coronary flow induced by angiotensin II and vasopressin (reference drug). In the heart, the nonselective lipoxygenase inhibitor nordihydroguaiaretic acid  markedly suppressed the angiotensin II-induced decreases in coronary flow. NDGA (10 \u03bcM) inhibited both angiotensin II- and methoxamine- (reference drug) induced contractions in aortic rings with (in the presence of L-NAME) and without endothelium. In the heart, the leukotriene synthesis inhibitor MK-886 (0.3 \u03bcM) significantly reduced the maximal effects to angiotensin II, but the leukotriene antagonist FPL 55712 (0.1 and 0.3 \u03bcM) had no effect. We conclude that in the isolated perfused rat heart angiotensin II-induced decreases in coronary flow are in part mediated by Hpoxygenase products, which might be derived from the 5-Hpoxygenase pathway, but are probably not leukotrienes. Furthermore, endothelium independent Hpoxygenase products mediate part of the contractile responses to angiotensin II in the isolated rat aorta."}
{"text": "Drug resistance to anti-tumour agents often coincides with mutations in the gene encoding DNA topoisomerase II alpha. To examine how inactive forms of topoisomerase II can influence resistance to the chemotherapeutic agent VP-16 (etoposide) in the presence of a wild-type allele, we have expressed point mutations and carboxy-terminal truncations of yeast topoisomerase II from a plasmid in budding yeast. Truncations that terminate the coding region of topoisomerase II at amino acid (aa) 750, aa 951 and aa 1044 are localised to both the cytosol and the nucleus and fail to complement a temperature-sensitive top2-1 allele at non-permissive temperature. In contrast, the plasmid-borne wild-type TOP2 allele and a truncation at aa 1236 are nuclear localised and complement the top2-1 mutation. At low levels of expression, truncated forms of topoisomerase II render yeast resistant to levels of etoposide 2- and 3-fold above that tolerated by cells expressing the full-length enzyme. Maximal resistance is conferred by the full-length enzyme carrying a mutated active site (Y783F) or a truncation at aa 1044. The level of phosphorylation of topoisomerase II was previously shown to correlate with drug resistance in cultured cells, hence we tested mutants in the major casein kinase II acceptor sites in the C-terminal domain of yeast topoisomerase II for changes in drug sensitivity. Neither ectopic expression of the C-terminal domain alone nor phosphoacceptor site mutants significantly alter the host cell's sensitivity to etoposide."}
{"text": "Complexes of the diuretic benzothiadiazine derivative chlorothiazide  with V(IV); Fe(II); Co(II); Ni(II); Cu(II), Ag(I) and U(VI) wereprepared and characterized by elemental analysis, spectroscopic, thermogravimetric, magnetic andconductimetric measurements. The complexes behave as effective inhibitors for two isozymes (I and II) ofcarbonic anhydrase (CA)."}
{"text": "In order to evaluate the effect of metal ions upon chelation, eephradine and its complexes have been screened for their antibacterial activity against bacterial strains, Escherichia coli, Staphylococcus aureus, and Pseudomonas aeruginosa.Some Co(II), Cu(II), Ni(II) and Zn(II) complexes of antibacterial drug cephradine have been prepared and characterized by their physical, spectral and analytical data. Cephradine acts as bidentate and the complexes have compositions, [M(L)"}
{"text": "These three structures are defined by metal to proteinstoichiometric ratios, which we believe specifically determine the coordination geometry adoptedby the metal in the metal binding site at that metal to protein molar ratio. Tetrahedral geometry isassociated with the thiolate coordination of the metals in the M7-MT species, for M = Zn(II), Cd(II),and possibly also Hg(II), trigonal coordination is proposed in the M11-12-MT species, for M = Ag(I),Cu(I), and possibly also Hg(II), and digonal coordination is proposed for the metal in the M17-18-MTspecies for M = Hg(II), and Ag(I). The M7-MT species has been completely characterized for M =Cd(II) and Zn(II). 113Cd NMR spectroscopic and x-ray crystallographic data show that mammalianCd7-MT and Zn7-MT have a two domain structure, with metal-thiolate clusters of the form M4(Scys)11 (the \u03b1 domain) and M3(Scys)9 (the \u03b2 domain). A similar two domain structure involving Cu6(Scys)11 (\u03b1) and Cu6(Scys)9 (\u03b2) copper-thiolate clusters has been proposed for the Cu12-MT species.Copper-, silver- and gold-containing metallothioneins luminesce in the 500-600 nm region fromexcited triplet, metal-based states that are populated by absorption into the 260-300 nm region ofthe metal-thiolate charge transfer states. The luminescence spectrum provides a very sensitiveprobe of the metal-thiolate cluster structures that form when Ag(I), Au(I), and Cu(I) are added tometallothionein. CD spectroscopy has been used in our laboratory to probe the formation ofspecies that exhibit well-defined three-dimensional structures. Saturation of the optical signalsduring titrations of MT with Cu(I) or Ag(I) clearly show formation of unique metal-thiolate structuresat specific metal:protein ratios. However, we have proposed that these M=7, 12 and 18 structuresform within a continuum of stoichiometries. Compounds prepared at these specific molar ratioshave been examined by X-ray Absorption Spectroscopy (XAS) and bond lengths have beendetermined for the metal-thiolate clusters through the EXAFS technique. The stoichiometric ratiodata from the optical experiments and the bond lengths from the XAS experiments are used topropose structures for the metal-thiolate binding site with reference to known inorganicmetal-thiolate compounds.Metallothionein is a ubiquitous protein with a wide range of proposed physiological roles, includingthe transport, storage and detoxification of essential and nonessential trace metals. The aminoacid sequence of isoform 2a of rabbit liver metallothionein, the isoform used in our spectroscopicstudies, includes 20 cysteinyl groups out of 62 amino acids. Metallothioneins in general representan impressive chelating agent for a wide range of metals. Structural studies carried out by anumber of research groups (using"}
{"text": "Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus and Klebsiella pneumonae. The activity data show the metal complexes to be more active than the parent freeligands against one or more bacterial species.Biologically active complexes of Co(II), Ni(II), Cu(II) and Zn(II) with novel ONO, NNO andSNO donor pyrazinoylhydrazine-derived compounds have been prepared and characterized on the basis ofanalytical data and various physicochemical studies. Distorted octahedral structures for all the complexeshave been proposed. The synthesized ligands and their complexes have been screened for their antibacterialactivity against bacterial species"}
{"text": "Escherichia coli, Staphylococcus aureus and Pseudomonas aeruginosa and the results are reported.Some acylhydrazine derived ONO donor Schiff bases and their Co(II) and Ni(II) complexes have been prepared having the same metal ion (cation) but different anions. These synthesized metal(II) complexes have been characterized on the basis of their elemental analyses, magnetic moment, molar conductance, and IR and electronic spectral data. All of the Schiff base ligands function as tridentates and the deprotonated enolic form is preferred for coordination. In order to evaluate the effect of anions on the bactericidal activity, these synthesized complexes, in comparison to the uncomplexed Schiff bases have been screened against bacterial species.,"}
{"text": "The cytotoxicity of the complexes under investigation decreases in theorder 3 > 2 > 1 which is in accord with structure-activity relationships with other platinum(II) and platinum(IV) complexes: Both trans complexes (2 and 3) display a higher in vitropotency than the corresponding cis isomer (I), with the trans-R,R isomer (3) being the most active in thisseries. In comparison to the analogous platinum(II) complexes withbis(phosphonomethyl)aminoacetic acid as osteotropic carrier ligand, the cytotoxicity of 1-3 was found to be1.5 \u2013 2 fold higher, which is explainable by a different coordination mode of the phosphonic acid ligands(acetato versus phosphonato).In order to develop platinum complexes with selective activity in primary and secondary bonemalignancies and with the aim to optimize antitumor activity, platinum(II) complexes withaminotris(methylenephosphonic acid) as bone-seeking (osteotropic) ligand have been synthesized,characterized and tested in the cisplatin-sensitive ovarian carcinoma cell line CH1. As non-leaving diamineligands, which are decisive for the cellular processing of DNA adducts,"}
{"text": "The agents blocked L1210 leukemic cell DNA and RNA syntheses by inhibitingmultiple enzyme activities for nucleic acid synthesis, e.g. PRPP amido transferase, IMP dehydrogenase, DNApolymerase \u03b1, thymidine kinase, and TMP kinase. The copper (II) complex 3 demonstrated improved abilityto inhibit L1210 partially purified DNA topoisomerase II compared to the parent compound while the sodiumsalt was inactive at 100 \u03bcM.Sodium N-[(trimethylamineboryl)-carbonyl]-L-phenylalanine"}
{"text": "Organotin(IV) complexes were more active than tin(II) complexes.Some organotin(IV) and tin(II) complexes of composition R"}
{"text": "Complexes containing the anions of 5-benzoylamido-1,3,4-thiadiazole-2-sulfonamide and 5-(3-nitro-benzoylamido)-1,3,4-thiadiazole-2-sulfonamid as ligands, and V(IV); Cr(III); Fe(III); Co(II); Ni(II); Cu(II) and Ag(I) were synthesized and characterized by standard procedures . The original sulfonamides and their metal complexes are strong inhibitors of two carbonic anhydrase (CA) isozymes, CA I and II."}
{"text": "Male SHR and Wistar Kyoto rats (WKY) aged 16\u201318\u00a0weeks were given l-arginine (10\u00a0g/L in drinking water) for 1\u00a0week. Separate control groups received no supplementation. The SHR control had a significantly lower plasma l-arginine than WKY control, but this was increased to a comparable level following l-arginine. Atrial cGMP was lower in the SHR control compared with the WKY control , but increased to 4.1\u00a0\u00b1\u00a00.5\u00a0pmol/mg protein  with l-arginine. Evoked [3H]norepinephrine release in isolated spontaneously beating right atria from the SHR control  was 28% higher than the WKY control , but was reduced to 258\u00a0\u00b1\u00a011% with l-arginine feeding . Soluble guanylyl cyclase (sGC) inhibition caused a greater increase of evoked norepinephrine release in the l-arginine fed SHR compared with the non-fed SHR. l-arginine feeding did not reduce evoked norepinephrine release in the WKY. In-vitro heart rate response to exogenous norepinephrine (0.1\u20135\u00a0\u03bcmol/L) was similar between l-arginine fed (n\u00a0=\u00a013) and non-fed SHR (n\u00a0=\u00a010), suggesting that l-arginine supplementation worked pre-synaptically. Myocardial tyrosine hydroxylase protein was decreased in SHR following l-arginine supplementation, providing a link to reduced synthesis of norepinephrine. In conclusion, l-arginine supplementation corrects local cardiac noradrenergic hyperactivity in the SHR, probably via increased pre-synaptic substrate availability of NOS\u2013sGC\u2013cGMP pathway and reduced tyrosine hydroxylase levels.Spontaneously hypertensive rats (SHR) are known to have cardiac noradrenergic hyperactivity due to an impaired nitric oxide (NO)\u2013cGMP pathway. We hypothesized that dietary  Its presence is associated with adverse clinical outcome, even in apparently normal subjects l-arginine (l-arg) is the sole substrate of the enzyme NOS in the synthesis of NO l-arg normally greatly exceed the level that is required for maximal enzyme kinetics of NOS; the Michaelis constant (Km) of l-arg for NOS is 2.9\u00a0\u03bcmol/L whereas the intracellular level of l-arg in-vivo is 0.8\u20132\u00a0mmol/L, with plasma concentration in the region of 60\u2013350\u00a0\u03bcmol/L l-arg supplementation has been shown to improve endothelial function, reduce atherosclerosis progression, and alter autonomic function; all consistent with enhanced NO synthesis l-arginine paradox, and can probably be best explained by compartmentalisation of NOS and a relative l-arg deficiency rather than an absolute one.l-arg supplementation could reduce local cardiac noradrenergic hyperactivity in the SHR by increasing pre-synaptic substrate availability of the NOS\u2013sGC\u2013cGMP pathway, and provided further mechanistic link with demonstration of reduction in cardiac tyrosine hydroxylase levels.In the present study, we showed that oral 22.1l-arg supplemented groups were given l-arg  in drinking water (10\u00a0g/L water) for 1\u00a0week. Control groups received no supplementation but otherwise have free access to water and rat chow. The experiments conformed to the Animals (Scientific Procedures) Act 1986 (UK) and the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health .Male SHR aged 16\u201318\u00a0weeks and Wistar Kyoto rats (WKY) were sourced from Harlan, UK, and kept under standard laboratory conditions. 2.2The heart rate and arterial blood pressure were measured invasively as a terminal procedure  on some rats. Briefly the rat was ventilated under anaesthesia (3% isoflurane and 100% oxygen) and its left carotid artery was cannulated with a 3F portex cannula. The cannula was then connected to a pressure transducer and data was acquired using a Biopac M100 system connected to a Dell P4 computer and run on the AcqKnowledge 3.7.3 software. After an equilibration period of at least 10\u00a0min at lower isoflurane concentration (1.5%), the heart rate and blood pressure readings were taken. Following completion of the hemodynamic measurement, the animals were euthanised with intraperitoneal injection of pentobarbitone. Blood samples were taken via intraventricular puncture and the whole heart removed. Blood samples were immediately spun at 5000\u00a0rpm for 10\u00a0min. Red blood cell and plasma (in heparinised tube) were separated and stored, as was serum. These were snapped frozen in liquid nitrogen before being stored at \u2212\u00a080\u00a0\u00b0C for long term.2.32), water-jacketed organ bath containing 3\u00a0ml Tyrode solution  where the atrium was pinned flat on a silver stimulating electrode. The method for determining the local NE release was based on one previously described with modification 3H] NE  and ascorbic acid . To facilitate the uptake and exchange of [3H] NE into the transmitter store in pre-synaptic terminal, the atrium was stimulated at 5\u00a0Hz  for 10\u00a0s every 30\u00a0s, for 30\u00a0min. After that, excess radioactive NE was washed from the preparation by superfusion with Tyrode solution for 45\u00a0min at a rate of 3\u00a0ml/min. Superfusion was then stopped and the bath solution was replaced every 3\u00a0min. 0.5\u00a0ml sample from each solution change was added to 4.5\u00a0ml scintillation liquid  and the amount of radioactivity  was measured using a liquid scintillation counter . At the 16th minute, the atrium was stimulated at 5\u00a0Hz for 1\u00a0min . The solution was changed at the 27th minute to one containing a drug . A second stimulation was applied at the 49th minute for 1\u00a0min . At the end of the experiment, the atrium was immersed overnight in 4\u00a0U/ml papain (Sigma) and the radioactivity contained in the extract was determined (z). [3H]NE outflow was expressed as a proportional increase using the formula below:The spontaneously beating right atrium (RA) was isolated and transferred to a preheated (37\u00a0\u00b1\u00a00.2\u00a0\u00b0C), continuously oxygenated  was used as denominator. However this newer method appears to be more accurate as it takes into account the reduction of radioactivity content during the course of the experiment, and obviates the variability introduced by overnight digestion and subsequent measurement of radioactivity in the tissue extract.This method of calculating the  radioimmunoassay kit from Amersham Biosciences as previously described 125I] by employing similar method.Atrial cGMP level was determined using the Biotrak cGMP 2.7Left ventricles were cut into small pieces on ice and put into a tube containing 200\u00a0\u03bcl of buffer  and 1\u00a0mm glass beads (Biospec). The tissues were homogenised for 90\u00a0s  and centrifuged  for 10\u00a0min at 4\u00a0\u00b0C. The supernatants were recovered and used for protein analysis and Western blotting.15\u00a0\u03bcg of denatured protein from each sample was loaded into each well of a Bio-Rad Criterion XT 4\u201312% polyacrylamide gel. Molecular weight marker , positive control and standards (where available) were also loaded. The proteins were separated by electrophoresis and transferred to a polyvinylidene fluoride membrane . The non-specific binding sites were blocked with 5% non-fat skim milk in phosphate buffered saline (Fisher) containing 0.05% Tween-20 (Sigma) (PBST). The membrane was then probed with a primary antibody  overnight at 4\u00a0\u00b0C. On the following day, the membrane was rinsed twice and then washed 3 times with PBST (10\u00a0min each wash) before incubation with a suitable secondary antibody conjugated with horseradish peroxidase for 1\u00a0h at room temperature. The membrane was rinsed twice again and washed 3 times with PBST (10\u00a0min each wash). The relevant protein signal was amplified with luminol based chemiluminescence  and detected using light-sensitive film . The film was digitised and the relative densities were determined with a computer software . The results were normalised to \u03b2-actin that served as loading control .2.8detect\u00ae assay kit and protocol from Stratagene. This assay is based on the conversion of l-arg to l-citrulline by NOS in a stoichiometric way. l-citrulline can be separated from l-arg using an ion exchange column/resin. By using a radiolabelled l-arg , the rate of its conversion to l-citrulline was determined by measuring the radioactivity of the separated labelled fraction of l-citrulline. By performing the assay in the absence and presence of nNOS inhibitor (N-[(4S)-4-amino-5-[(2-aminoethyl)amino]pentyl]N\u2032-nitroguanidine, 20\u00a0\u03bcmol/L, Sigma), the activities of nNOS could be estimated. The assay was carried out in the presence of 5\u00a0\u03bcmol/L arginase inhibitor, N-hydroxy-nor-l-arginine  as l-arg can be converted to l-citrulline via alternative pathway involving arginase The activity of NOS in left ventricles was determined using NOS2.9t test was used to compare the results before (S1) and after application of inhibitor (S2) in the evoked NE release experiments. Statistical significance was accepted at p\u00a0<\u00a00.05.Data are presented as mean\u00a0\u00b1\u00a0S.E.M. For comparisons among more than 2 groups, one way analysis of variance (ANOVA) was used to compare the means with post-hoc Tukey's HSD test to assess individual significance. Paired 33.1l-arg feeding (n\u00a0=\u00a013) and non-supplemented SHR  was observed. Plasma l-arg level was significantly lower (p\u00a0<\u00a00.01) in the SHR/not-sup group  compared with the WKY/not-sup group  but it increased to a comparable level following l-arg supplementation  following l-arg oral supplementation , but increased to 4.1\u00a0\u00b1\u00a00.5\u00a0pmol/mg protein  was 28% higher than the non-supplemented WKY , but was reduced with l-arg feeding  (t change B. Propor\u00a0<\u00a00.01) .3.43H]NE release in the l-arg fed SHR (n\u00a0=\u00a06) compared with the non-fed SHR (n\u00a0=\u00a07) (p\u00a0<\u00a00.01 when compared with respective S1 in paired t test) such that the two became no longer significantly different (Addition of a soluble guanylyl cyclase (sGC) inhibitor, 1H-oxadiazoloquinoxaline-1-one , to the organ bath suffusate prior to second stimulation (S2) caused a greater increase of evoked [ifferent .3.53H]NE release (S2) significantly in supplemented SHR , supplemented  and non-supplemented WKY  (p\u00a0<\u00a00.05 when compared with respective S1 in paired t test), but not in non-supplemented SHR .Highly selective nNOS inhibitor, N-[(4S)-4-amino-5-[(2-aminoethyl)amino]pentyl]N\u2032 nitroguanidine , increased proportional evoked [3.6l-arg fed (n\u00a0=\u00a013) and non-fed SHR (n\u00a0=\u00a010), and was not affected by 20\u00a0min incubation with ODQ (10\u00a0\u03bcmol/L)  was similar between \u00a0\u03bcmol/L) .3.7p\u00a0<\u00a00.05, n\u00a0=\u00a06 in each). l-arg feeding reduced the tyrosine hydroxylase in SHR (p\u00a0<\u00a00.05) but not in WKY (n\u00a0=\u00a06 in each) . The nNOS activity measured in-vitro based on l-citrulline conversion was similar between non-supplemented WKY , non-supplemented SHR  and supplemented SHR  (p\u00a0=\u00a0NS).We found that non-supplemented SHR had a significantly higher myocardial tyrosine hydroxylase protein compared with non-supplemented WKY (in each) . We did 4l-arg supplementation reduced the peripheral sympathetic hyperactivity in the SHR by attenuating evoked NE release from the right atria. Secondly, this effect is mediated at least in part via an increase in the l-arg\u2013NO\u2013cGMP signalling (by augmenting l-arg availability), and the associated reduction in myocardial tyrosine hydroxylase protein levels. Finally, the effect of l-arg supplementation on peripheral cardiac noradrenergic neurotransmission is a pre-synaptic one, as evidenced by lack of differences between treated and untreated SHR in in-vitro heart rate responses to exogenous norepinephrine.There are three novel findings from this present study. First, we demonstrated that l-arg studies have examined the effect on platelet aggregation, endothelial function and atheroma formation l-arg concentration. Dietary l-arg supplementation circumvented these potential issues as the increase in plasma l-arg level is relatively lower in the physiological range where this non-NO effect has not been reported to occur. In this study, we showed that oral l-arg supplementation could decrease the peripheral cardiac sympathetic hyperactivity in the SHR to a comparable level seen in the WKY. In addition, l-arg supplementation increased atrial cGMP to levels similar to that of the WKY. l-arg is the sole substrate of the enzyme NOS, with NO as the immediate but labile product. NO in turn activates sGC to synthesise cGMP, the key secondary messenger of this signalling system l-arg\u2013NO\u2013cGMP pathway plays an important neuromodulatory role in cardiac autonomic nervous system; augmenting the vagal arm and inhibiting the sympathetic counterpart l-arg treated SHR than non treated SHR, suggesting that this pathway had been augmented by l-arg supplementation. Similarly, the highly selective nNOS inhibitor increased the evoked NE release (S2) in the supplemented SHR but not in the non-supplemented SHR when compared with S1. Although the possibility of a non-NO effect could not be excluded completely, taken together, these results support the notion that l-arg feeding had augmented the l-arg\u2013NO\u2013cGMP pathway with a resultant decrease in evoked NE release. We cannot however, rule out the possibility that the reduction in evoked NE release may be an indirect result of enhanced parasympathetic neurotransmission by the augmented NOS\u2013cGMP pathway. In addition, the conclusion arrived here is based on ex-vivo data, and therefore it remains to be established whether this is applicable to the in-vivo setting.Most published l-arg supplementation. To our knowledge, this is the first study to demonstrate this feature, although it is known that the SHR has higher tyrosine hydroxylase contents in key organs when compared with normotensive controls l-arg supplementation in the SHR. One possible explanation is cGMP activating phosphodiesterase-2 (PDE-2) resulting in increased hydrolysis of cAMP l-arg supplementation in either WKY or SHR groups. This would suggest that modulation of cAMP levels was not involved. Nonetheless, we cannot completely rule this out because localised changes of compartmentalised cAMP, a feature which has been well described One of the most intriguing and significant findings in this study is the reduction of myocardial tyrosine hydroxylase level in the SHR following l-arg levels should not be rate limiting to NO synthesis based on its pharmacokinetics l-arg supplementation has been shown to improve endothelial function, reduce atherosclerosis progression, and augment cardiac vagal function; all consistent with enhanced NO synthesis l-arg), and a relative l-arg deficiency in diseased states from elevated endogenous NOS inhibitor such as asymmetric dimethylarginine (ADMA), rather than an absolute one l-arg level was lower in the SHR when compared with the WKY, but this was increased to a comparable level following l-arg supplementation. In addition, we also found that l-arg supplementation had little effect on the WKY (either evoked NE release or cGMP levels). This was in keeping with other studies that showed that negative results were more likely to be obtained when healthy subjects were fed l-arg l-arg in the WKY following supplementation. Increased breakdown by hepatic arginase (whose activity is dependent on l-arg concentration) and increased renal excretion  may prevent further increase in plasma l-arg level beyond a certain set point l-arg in WKY, although neither this nor other studies have looked at this pharmacokinetic question specifically in rats.l-arg supplementation did not alter myocardial nNOS, eNOS or sGC protein levels in the SHR which may seem inconsistent with the increase in the cGMP brought about by l-arg supplementation. However, l-arg supplementation served only to provide additional substrate for NO production which in turn stimulated sGC to generate more cGMP. nNOS activity was also unchanged in the l-arg treated SHR, when measured in-vitro; consistent with the overall concept on the role of l-arg supplementation. We did not measure the amount of NO produced in-vivo because of its labile nature, but had shown that l-arg feeding increased the more stable secondary messenger cGMP in the SHR.l-arg supplementation did not affect the heart rate response to exogenous NE in the SHR. In other words, the effect of l-arg supplementation on cardiac noradrenergic neurotransmission is a pre-synaptic one and did not appear to change the post-synaptic beta adrenergic receptor driven excitability. Gene transfer of nNOS with an adenovirus to the heart has been found to attenuate evoked NE release, a pre-synaptic feature, via upregulation of NOS\u2013sGC pathway In the double atrial experiments, we observed that l-arg, through the NO\u2013cGMP pathway, probably plays a modulatory role during sympathetic nerve stimulation rather than under basal resting condition.Basal heart rate or arterial blood pressure did not differ between supplemented and non-supplemented SHR when measured under anaesthesia. From published literatures 4.1l-arg has been used widely as a potential therapeutic tool in both human and animal studies. Two recent clinical trials on patients with myocardial infarction have yielded conflicting results l-arg following supplementation and did not measure markers of NO production. This raised the question whether any effects observed could be confidently attributed to the l-arg treatment. Our study of l-arg supplementation on the SHR is significantly different, because it demonstrates both an increase in plasma l-arg as well as augmentation of nNOS\u2013sGC\u2013cGMP pathway with a reduction in evoked NE release. Moreover the SHR is from a homogenous population; the same is unlikely for the human subjects. Whether this intervention could restore autonomic balance and thus improve outcome in patients with hypertension will require a randomised clinical trial in a well controlled well selected clinical population. Accumulating evidence suggest that certain groups such as those with elevated endogenous NOS inhibitor ADMA and impaired l-arg\u2013NO metabolism may be more likely to benefit from l-arg supplementation"}
{"text": "N-(2-furanylmethylene)-2-aminothiadiazole have been prepared and characterized by their physical, spectral and analytical data. The synthesized Schiff-bases act as tridentate ligands during the complexation reaction with Co(II) and Ni2]Xn (where M=Co(II) or Ni(II), L=, X=NO3\u2212, SO42\u2212, C2O42\u2212 or CH3CO2\u2212 and n=1 or 2) andshow an octahedral geometry. In order to evaluate the effect of anions upon chelation, the Schiff-base and itscomplexes have been screened for antibacterial activity against bacterial strains e.g., Escherichia coli, Staphylococcus aureus, and Pseudomonas aeruginosa.Co(II) and Ni(II) complexes with a Schiff base,"}
{"text": "Ternary Ni(II) complexes of hydrazine and eight heterocyclic sulfonamides possessing carbonicanhydrase (CA) inhibitory properties, were prepared and characterized by elemental analysis, spectroscopic,magnetic, thermogravimetric, and conductimetric measurements. The complexes behave as strong inhibitorsfor two isozymes (I and II) of carbonic anhydrase."}
{"text": "Some of them inhibited the growth of several fungi species (Aspergillus and Candida spp.)Complexes containing 1,3,5-tris-(8-hydroxyquinolino)-trichlorocyclotriphosphazatriene, a newcyclophosphazene ligand, and Co(II), Cu(II) and Ni(II) were prepared. The new complexes, having the generalformula [MLCl"}
{"text": "The effect of insulin-like growth factor II (IGF-II) on tumour development in the mouse mammary gland was studied. To promote extra IGF-II expression in the mammary gland, sheep beta-lactoglobulin regulatory elements were attached to the coding regions of the mouse Igf-2 gene and injected into the pronuclei of mouse zygotes. Mammary tumours developed in each of the four independent lines of mice which expressed transgene IGF-II in the gland. Tumours from two of the lines grew after transplantation to both male and female hosts. Primary tumours contained stromal and epithelial regions, but the tumours were dominated by mammary adenocarcinoma after transplantation. The tumours expressed high levels of Igf-2 mRNA transcribed from the integrated transgenes."}
{"text": "To identify the causative mutation of canine progressive retinal atrophy (PRA) segregating as an adult onset autosomal recessive disorder in the Basenji breed of dog.Basenji dogs were ascertained for the PRA phenotype by clinical ophthalmoscopic examination. Blood samples from six affected cases and three nonaffected controls were collected, and DNA extraction was used for a genome-wide association study using the canine HD Illumina single nucleotide polymorphism (SNP) array and PLINK. Positional candidate genes identified within the peak association signal region were evaluated.10(P) value of 4.65 was obtained for 12 single nucleotide polymorphisms on three chromosomes. Homozygosity and linkage disequilibrium analyses favored one chromosome, CFA25, and screening of the S-antigen (SAG) gene identified a non-stop mutation (c.1216T>C), which would result in the addition of 25 amino acids (p.*405Rext*25).The highest -LogSAG mutation in dogs affected with retinal degeneration establishes this canine disease as orthologous to Oguchi disease and SAG-associated retinitis pigmentosa in humans, and offers opportunities for genetic therapeutic intervention.Identification of this non-stop  SAG), also known as arrestin, encodes a major soluble rod outer segment protein that exemplifies a family of inhibitory proteins that bind tyrosine-phosphorylated receptors to block their interaction with specific G-proteins to terminate a signal chain. In the retina, arrestin binds to activated rhodopsin [HGMD). This disease has an unusual but characteristic clinical feature, the Mizuo-Nakamura phenomenon, in which an unusual golden-yellow discoloration of the fundus disappears in the dark-adapted condition and reappears shortly after exposure to light [The gene S-antigen  comprises a group of genetically inherited diseases affecting dogs of various breeds. Similar to RP in humans, PRA is characterized by photoreceptor degeneration causing progressive vision loss, culminating in blindness. This is a highly heterogeneous group of diseases with more than 12 different causative gene mutations already identified in canine populations, causing either early or late onset disease, and inherited as autosomal dominant, autosomal recessive, or X-linked [for a review, see prcd), late onset retinal degeneration affecting multiple breeds caused by a point mutation in the PRCD gene [prcd excluded allelism between these two similar diseases [PRCD genotyping. Complicating this broadly recognizable clinical phenotype has been considerable heterogeneity in the disease manifestation, and uncertainty about whether this clinical heterogeneity represented a single protean disorder or an underlying genetic heterogeneity. This problem has been further complicated by the extremely small gene pool of Basenjis in the American breeding population and the multiple inbreeding loops apparent in pedigree analysis.In the Basenji breed, the adult onset of PRA was observed, with initial visual loss in dim light (night blindness), which gradually progressed to total blindness. Initial visual loss affects the peripheral visual field, but unless the dog is used for high visual performance tasks such as agility work, the reduction in the visual field (tunnel vision) may not be apparent.Despite tunnel vision and night blindness, many Basenjis affected with PRA retain adequate forward daylight vision for many years, sometimes for their entire natural life. This phenotype highly resembles progressive rod-cone degeneration  enables genome-wide association mapping in populations even when the extended pedigree information normally required for linkage analysis is either incomplete or missing entirely. Furthermore, the development of genome-wide single nucleotide polymorphism (SNP) chip arrays has made such mapping widely available for humans and several other species, including the dog. In humans, mapping has been particularly successful in isolated populations -20. In tSAG that cosegregated with the disease phenotype and caused the disease. This creates an opportunity to study the molecular basis of SAG-associated retinal diseases, and a model for evaluating potential therapeutic approaches for Oguchi disease and SAG-associated RP in humans.In this study, we report a genome-wide association study (GWAS) to map a specific form of PRA in the Basenji breed of dog, using six affected dogs and three control dogs. Together with homozygosity analysis and consideration of the mode of inheritance, we identified a non-stop mutation in tentatively affected with PRA, 18 nonaffected controls beyond the assumed age of risk (at least 6 years of age), and 37 with no assigned phenotype either because they were younger than the assumed age of risk or due to lack of information. Blood was stored at 4 \u00b0C or -20 \u00b0C until DNA extraction. DNA was similarly extracted from blood samples of 110 purebred dogs from 22 different breeds not known to segregate this disease (Appendix 1).All procedures involving animals were conducted following the guidelines of the Institute for Laboratory Animal Research , the U.S. Public Health Service , and the Association for Research in Vision and Ophthalmology (ARVO) Statement for the Use of Animals in Ophthalmic and Vision Research. Blood samples were collected by cephalic or jugular venepuncture into vacutainer tubes containing ethylenediaminetetraacetic acid (EDTA) anticoagulant from 80 purebred Basenji dogs: 19 diagnosed clinically as affected with PRA, six diagnosed clinically as Ascertainment of disease phenotype was based entirely on indirect ophthalmoscopic examination by board-certified veterinary ophthalmologists. In the minority of cases, the ophthalmoscopic diagnosis was confirmed with clinical electroretinography. The cases studied in the present report include only dogs examined and diagnosed by either or both of two of the authors , although in several cases the initial diagnostic examination was previously performed by other veterinarians.Of the 19 purebred Basenji dogs diagnosed clinically as affected with PRA, six were selected as cases for association analysis, based on confidence in the disease ascertainment (dogs affected with stage II PRA), consistency of the disease phenotype among the selected dogs, pedigree information supporting autosomal recessive inheritance identical by descent (IBD), and choosing the least closely related set of dogs affected with PRA available (four dogs had no parents or grandparents in common).Among 43 Basenji dogs not expressing PRA symptoms, three dogs not affected with PRA were selected for the control group based on having no parents or grandparents in common with each other, being clinically diagnosed as nonaffected with PRA at an age beyond the apparent age of risk for onset of the disease , being free of other ocular abnormalities that might obscure or confuse the presence of PRA, and being close relatives of the affected dogs chosen as cases. The unaffected dog at age 6, although borderline for the age of onset, was a sibling of an affected dog, and was chosen to accomplish the fourth criterion.PLINK) [Samples were genotyped using the Illumina Canine SNP chip (HD Canine SNP Chip), which comprises 173,662 SNP loci, following the manufacturer's standard protocol. Genotypes were called using GenomeStudio . Genotype calls were converted into Plink-format files, and association was tested using the association command without pedigree or sex information (PLINK) . The genHomozygous block analysis was performed on affected dogs only (n=6) using Plink, under the following criteria: sliding window criteria: 1,000 Kb, 150 SNPs, five missing calls, one heterozygous call, 0.05 threshold; homozygous segment criteria: length 1,000 Kb, 150 SNPs, 50 density (Kb/SNP). The output was then filtered for those chromosomes where all six cases showed a minimum of one homozygous segment anywhere in the chromosome. The segments then were aligned within each chromosome, to identify those where all six dogs shared the same homozygous block. For all such regions, genotype calls were retrieved to determine whether all homozygous blocks were homozygous for the same haplotype. If so, then the \u201caffected haplotype\u201d was compared to haplotypes observed in the control group.SAG), which has been associated with Oguchi disease, as well as retinitis pigmentosa [KCNJ13), which has been associated with snowflake vitreoretinal degeneration and Leber congenital amaurosis [Within a homozygous block on chromosome 25 (CFA25), two genes were considered candidates: S-antigen, arrestin . KCNJ13 gene screening was conducted on six dogs: two affected Basenji dogs, three unaffected Basenjis, and one normal Boxer dog. Nine primer pairs were designed to amplify the three exons of the gene (Appendix 2B). PCR products of both genes were sequenced, and sequences aligned using Sequencher 4.2.2 Software .SAG non-stop mutation was genotyped on the complete set of Basenji dogs available (N=80) with PCR using primer pairs flanking the mutation , followed by sequencing. An allele-specific extension test was then designed to screen 110 dogs from 22 breeds (Appendix 1). One primer pair, containing a forward primer specific to the wild-type allele, amplifies a 259 bp fragment, and a separate primer pair, containing a forward primer specific to the mutant allele, amplifies a 531 bp product (Appendix 2C). Both forward primers contain a mismatch in the 3\u2032 penultimate base.The identified . Basenjis affected with PRA typically exhibited evidence of stage I PRA at about 5 years of age. These dogs when reexamined ophthalmoscopically at a later age typically showed progression of disease by thinning (attenuation) of the retinal vasculature, which usually became ophthalmoscopically evident by 6 or 7 years of age. This phenomenon, taken as evidence of reduced blood flow through the retinal vasculature, is referred to as stage II or mid-stage PRA. In all of these respects, Basenjis affected by PRA closely resemble dogs of other breeds affected by the prcd form of PRA.PRA as a clinical disease in the Basenji was, in broad terms, typical adult onset canine retinal degeneration. The first ophthalmoscopically observed evidence of disease was irregular hypo- and hyperreflectivity of the tapetal fundus. This phenomenon, taken as evidence of retinal thinning, is referred to as stage I or early stage PRAClinical diagnosis of PRA in the Basenji was complicated by several factors, however. These included a common prevalence of conus in dogs affected with PRA and nonaffected dogs. Conus refers to a roughly triangular region immediately superior to the optic nerve head in which the tapetum is yellow (and may be hyperreflective) compared to the surrounding green tapetal region. This phenomenon is seen, though less frequently, in normal dogs of other breeds, but also is seen in dogs of other breeds as one of the earliest signs of retinal thinning. In the fundus of Basenjis affected with PRA, this area of conus is sometimes observed to expand and become hyperreflective. Second, the optic nerve head is typically less myelinated and thus less extensive over the fundus than is typical of other breeds of dog. Also seen repeatedly in Basenjis affected with PRA and nonaffected Basenjis was a strange mottled golden-yellow-brown discoloration of the tapetal fundus that obscured the tapetal reflection in a patchy manner, and gave the fundus a beaten bronze appearance. This fundus change, termed bronzing, could either mask the earliest signs of retinal degeneration in some Basenjis affected with PRA or produce a mottled variation in tapetal reflectivity that to some extent mimicked the earliest signs of retinal degeneration in Basenjis that eventually proved to be not affected with PRA.Finally, the fundus appearance in Basenjis affected with PRA was often patchy, or non-uniform, within a given eye, between the two eyes of a given affected dog, and among affected dogs. To some extent, this fundus appearance is observed in other forms of canine PRA, but was particularly evident in the eyes of Basenjis affected with PRA .The breeding population of Basenjis in the United States of America  descends from a small number of founders, and has a complicated pedigree structure with multiple inbreeding loops and overlapping generations. In combination with the late age of onset, and the heterogeneous clinical nature of the disease, this made pedigree analysis more uncertain than usual in terms of establishing the likely mode of inheritance. A subset of six affected dogs were thus chosen for the genome-wide association study with criteria (see the Methods) intended to maximize the likelihood that all six dogs were affected with a single autosomal recessive disease inherited from a common ancestor, and thus identical by descent .10(P) value of 4.65 was obtained for 12 SNPs: one SNP on CFA4, seven on CFA13, and four SNPs on CFA25  spanning these seven SNPs in affected dogs showed five homozygous blocks containing one or two of these seven significant SNPs, with distances ranging from 45 Kb to 929 Kb . AlthougThe four SNPs on CFA25 were all within one 2.09 Mb homozygosity block , in which all affected dogs were homozygous for one allele for each SNP, and the three unaffected dogs were homozygous for the complementary allele. One SNP at position 48,147,815 appeared to break this homozygosity block into two blocks of 1.25 Mb and 0.83 Mb, but this was considered unreliable as all genotype calls for this SNP were either heterozygous or no call (Appendix 3).Genotype calls from the affected dogs only (n=6) were analyzed for homozygosity blocks greater than 1.0 Mb, excluding sex chromosomes. Five hundred and thirty-nine such blocks were identified. After sorting by chromosome and aligning homozygous regions within each chromosome, five loci were identified where all six dogs shared a homozygous segment : CFA 6, KCNJ13 and SAG. Primer pairs were designed to amplify all exons of both genes, including flanking sequences from the 5\u2032 untranslated region (UTR), introns, and 3\u2032 UTR , and used to generate amplicons from DNA samples representing six dogs: two affected Basenji dogs, three non-affected Basenjis, and one normal Boxer dog.From association and homozygosity analyses, the association peak on chromosome 25 was considered the best potential candidate region to investigate further. Within the 2.09 Mb homozygosity block encompassing all four SNPs with the maximum p value, two genes were evaluated as positional candidates: KCNJ13, previously associated with snowflake vitreoretinal degeneration and Leber congenital amaurosis in humans [KCNJ13 was not further investigated as a candidate.n humans ,31, was SAG, as identified in the Canfam2 genome sequence at chr25:47,814,602\u201347,845,820, comprised 16 exons, 15 of which are coding. Eighteen amplicons were generated encompassing all exons and their flanking 5\u2032 and 3\u2032 UTRs and intronic sequence using primers flanking each exon (Appendix 2A), and sequenced. Ten exonic variations were identified (Appendix 4B). Two (Nos.1 and 2) were in the 5\u2032 UTR in exons 1 and 2, respectively; five (Nos. 3\u20137) were in exonic coding sequence but all represented synonymous third-base codon changes and two (No. 9 and 10) were in the 3\u2032 UTR.SAG variations, all Basenjis  were homozygous for one allele that differed from the allele in the boxer and the reference sequence. The two exceptions were variations 8 and 9, which segregated informatively. Since SNP number 9 was located in the 3\u2032 UTR of the gene, it seemed unlikely to represent a causative mutation.Furthermore, for eight of these ten Variation number 8 (Appendix 4B), however, was a much more significant tyrosine to cysteine transition mutation at position CFA25:47,845,680 .The OMIA) currently lists 614 traits and disorders in dogs, of which 238 are Mendelian. For 164 of those, the causative mutation is known. More pertinently, 24 mutations have currently been reported in 18 genes as causatively associated with retinal diseases in at least 58 dog breeds. Approximately 12 genes result in a PRA phenotype while the rest affect other retinal cells or structures [The online Mendelian inheritance in the animal database , and from pedigree analysis demonstrated probable IBD recessive inheritance; and controls were selected that were free of retinal disease at an age likely to be beyond the apparent age of risk (at least 6 years of age) and were appropriately related to the dogs selected as cases. This reduced the number of \u201chigh confidence dogs\u201d selected to just six affected dogs and three controls.GWAS initially identified three potentially significant loci associated with the disease phenotype, on CFA4, CFA13, and CFA25. Haplotype analysis, assuming recessive inheritance, excluded the CFA4 locus. Although homozygosity blocks were observed on CFA13 and CFA25 in affected dogs, the LD expected from the Basenji breed structure strongly favored CFA25 over CFA13. The success of association mapping combined with homozygosity analysis to map the disease to a single locus using fewer than ten dogs confirms that the minimum number of dogs needed for GWAS is breed dependent, and can be low in breeds where LD blocks are large. However, the extensive LD (in this case 2.09 Mb) presents a potentially frustrating tradeoff. If either no obviously appealing candidate genes had been present within the homozygosity block, or many were, a much larger number of affected dogs would have been needed to reduce the LD, the number of potential causative genes, and the genomic region to be sequenced and further evaluated.MERTK [THAP1 [C8orf37 [A parallel approach using homozygosity analysis to directly identify candidate regions was also undertaken. This method has successfully mapped autosomal recessive diseases in humans, especially in consanguineous families. Examples include mapping of a severe autosomal recessive RP to subsequently identify a causative mutation in MERTK ; mappingK [THAP1 ; and hom[C8orf37 . BecauseSAG mutation in all six dogs affected with PRA in the study set. Non-stop mutations are point mutations that convert the stop codon to code for an amino acid, resulting in a deduced elongation of the C-terminus of the protein since the translation continues into the  3\u2032 UTR. In one human study, such non-stop mutations represented about 0.2% of the codon-changing mutations (119 examples in 87 genes) [SAG sequence, the first alternative in-frame stop codon is 72 bases after the mutated stop codon and 37 bp upstream from the polyadenylation signal, suggesting that the mutated protein, if translated, would be extended by a further 25 amino acids  . These mno acids . This ape et al.  and no oexpasy) indicates that the additional 25 amino acids would change the isoelectric point to 6.78 (from 6.0 in the wild-type) and would add four positively charged residues, for a total of 56 in the mutant versus 52 in the wild-type. Although the estimated half-life, predicted localization, and instability index would not change, it is not certain that the mutant protein would fold correctly. If it does, then the mutant protein's ability to bind appropriately to its G-protein-coupled receptor, rhodopsin, would likely be impaired, and this would likely lead to the retinal degeneration phenotype. SAG (arrestin) is critically involved in quenching the photoactivated phosphorylated rhodopsin apoprotein (P-Rh*), a process that involves conformational changes in rhodopsin and SAG [SAG protein were produced, an elongation of its C-tail by 25 amino acids would likely impair its ability to be anchored in its N-domain and to respond accurately, appropriately and in a timely manner to changes in its receptor.Computational protein analysis of the deduced protein  and more than ten non-refseq genes. Because the present studies were undertaken in a patient population for which only phenotypic data and DNA were available, ongoing and future studies in purpose-bred dogs will provide tissues, previously and currently unavailable, for functional, molecular, transcriptomic, proteomic, and cytologic studies to address critical questions that arise from the present investigations, particularly the effect of the non-stop mutation on the pathology of the disease, and the involvement of other genes within the LD interval on the course of the disease. Basenji dogs affected with PRA can thus serve as a novel large animal model of SAG-associated retinal degeneration, offering investigational opportunities to better understand the primary disease mechanism, explore causes for the wide variation of disease as observed in humans and Basenji dogs, investigate the effect of the non-stop mutation on residual function of the protein, test the potential role of light-exposure on the phenotype, and evaluate potential therapeutic approaches.Within the 2.09 Mb LD-homozygous interval identified as the disease locus, four refseq genes are located ("}
{"text": "Although altruism is a key principle in our current organ donation and transplantation system, the meanings and implications of the term have been widely debated. Recently, a new type of living organ donation--anonymous and non-directed, also called living altruistic donation (LAD)--has brought the issue into sharper focus. Transplant physicians' views on altruism might influence their attitudes and actions toward living altruistic donors. This study aimed to explore such views among transplant physicians in France and Quebec.A total of 27 French and 19 Quebec transplant physicians participated in individual, semi-structured interviews between October 2004 and December 2005. The majority of these participants associated altruism with gratuitousness and saw altruistic acts as multiple and varied, ranging from showing consideration to saving a person's life.The transplant physicians' discourses on altruism were quite diverse, leading us to question the relevance of the concept in organ transplantation and the appropriateness of the term \"living altruistic donation.\" Altruism and gift-giving have been an integral part of organ transplantation from the outset: the gift of science to humanity; grieving family members who offer to donate the organ of a deceased loved one; recipients who agree to participate in research. Although organ transplantation has become a routine procedure in the past decade, altruism remains a key principle. Indeed, many organ procurement organizations (OPOs) and medical associations such as United Network for Organ Sharing (UNOS) and the American Society of Transplantation (AST) explicitly state that organ donation and transplantation should be based on altruism -4. The WAs this citation suggests, altruism, in the context of organ donation, is often narrowly defined as an absence of monetary exchange and commercialization. The concept of altruism has been studied and debated since the very beginnings of organ transplantation. In the case of living organ donation, many of these studies have examined living organ donors' motivations and psychosocial profiles ,7. Over Healy has shown that altruistic practices are embedded in socio-organizational structures ,13. TranIn this study, we adopted an empirical ethics approach, allowing the facts gathered to inform normative considerations (the \"is\" contributing to the \"ought\") -19. ThisThe study was conducted between October 2004 and December 2005. Respondents in both settings were nephrologists or surgeons involved in the field of renal transplantation. In Quebec, the participants were sampled purposively. A total of 22 physicians (nephrologists and transplant surgeons) from all seven hospitals (adult and pediatric) conducting renal transplantation were contacted; 19 agreed to participate. In France, the transplant directors of seven hospitals located in five cities were contacted  . The resInterview transcripts were analyzed using the content and thematic analysis method described by Miles and Huberman . The comA fundamental characteristic of altruism noted by most of the respondents was gratuitousness . The imperative of gratuitousness also emerged in the transplant physicians' opposition to any form of payment for organs. Donors should not intend to benefit from the donation and should not expect any kind of reward. However, four of the physicians in France and one in Quebec felt that gratuitousness--and, by extension, altruism--were impossible. Rather, these physicians believed in psychological egoism  . In otheRelated to gratuitousness is the pleasure associated with giving or with an altruistic act. Opinions were also divided as to whether this pleasure may be reconciled with altruism or whether it constitutes a reward or an incentive. For some respondents, pleasure makes the act of giving egoistic:\"I would say that an altruistic person is not altruistic, but egoistic .... This person derives pleasure from donating; therefore he is not so generous, because he benefits from donating.\" (Quebec physician)Other respondents acknowledged that the pleasure associated with giving might be an acceptable reward for the donor  if it was not expected and was not the key motivating factor.A second feature of altruism described by many of the physicians was its outward or other-focused nature. By definition, an altruistic gesture is directed toward, and involves helping, others. One respondent remarked on the lack of altruism in our society, referring to the many seniors who died during the 2003 heat wave in France, partly as a result of family members' and neighbours' indifference or neglect.Thirdly, for many respondents, altruism involved gift-giving or charity. In the words of one French physician, \"[Altruism] is, above all, a gift--an impressive show of generosity.\"A few respondents said that to be considered altruistic, an act should involve some risk or sacrifice on the part of the giver. Altruistic acts should not be easy and are therefore not common:\"Essentially, altruism means giving a part of ourselves, not giving $50 to an organization. Anyone can do that.\" (Quebec physician)\" ... [to be altruistic] is to be prepared to take risks for others.\" (Quebec physician)Taking risks does not mean going so far as to risk one's life. Many physicians found the idea of dying to save someone else--for example, a person who is unable to swim trying to stop someone from drowning--to be unacceptable.\"There is always a cost associated with altruism, but this cost shouldn't be too great. It shouldn't involve sacrificing your life.\" (French physician)Also mentioned with regard to altruistic acts was their voluntary and beneficial nature. Finally, one French transplant physician associated altruism with love. For him, the degree of war and conflict in the world proves that altruism does not exist.During the interviews, respondents were asked to list altruistic actions. At one end of the spectrum were acts of common courtesy such as giving up one's seat on the bus; at the other were heroic acts like rescuing someone. In between were actions such as donating money or goods to a charity; volunteer work; deceased organ donation; the donation of blood, sperm, eggs and tissue; humanitarian aid ; and living organ donation. However, not all respondents considered living organ donation to be altruistic under all circumstances. Wanting to donate one's heart while still alive, or donating a portion of one's lung or liver would not qualify as altruistic intentions or acts because they would involve sacrificing or risking one's life in order to help another person. Respondents mentioned three other situations they did not consider altruistic: helping someone while harming another person, dying for a cause, and neglecting loved ones in order to save strangers. There was a strong sense that charity begins at home.In his seminal essay on gift exchange in traditional societies, Marcel Mauss argued that gift-giving is governed by three obligations: to give, to receive and to repay. The paradox of a gift exchange, according to Mauss, is that it is free but obligatory. To refuse to participate in a gift exchange is to refuse the other and create a rupture that could lead to war. Gift-giving serves to forge ties and alliances among groups and therefore has a strong moral component . Ren\u00e9e CThese scholarly works are focused on gift exchange rather than altruism. However, for many, the two are closely linked. This was certainly the case in this study, where many respondents viewed altruism as equivalent to gift-giving. In a recent article, Shaw has shown that for New Zealand intensivists and transplant coordinators, gift-giving was also linked with altruism .A common denominator in the definitions of altruism provided by the transplant physicians in our study was gratuitousness. Some respondents (mainly the French transplant physicians) felt that the pleasure experienced by donors ruled out the possibility of altruism, since the latter implies an absence of reward or reciprocity. This view coincides with Derrida's view on gift-giving. For this French philosopher, to give means to expect absolutely nothing in return from the recipient. The latter should not acknowledge receiving anything and the donor should not recognize his or her gesture of generosity, as this will lead to feelings of gratification . Is thisIt is interesting to consider the relationship between altruism, gratuitousness and gift-giving in light of the cited works by Mauss, Godbout, and Fox and Swazey. A purist stance implies that altruism involves both intent and consequences. How can a gratuitous view of altruism, which excludes any form of return, be reconciled with gift-giving? As seen previously, reciprocity is an integral part of gift-giving. The unclear relationship between gratuitousness, altruism and gift-giving could translate into misunderstandings or uneasiness on the part of transplant physicians. What is the cause of this discomfort? Here, we can only speculate. Are transplant physicians uncomfortable about the thing given, namely an organ? Is it the fact that transplant physicians and institutions are the initial recipients of the gift of an organ? Is it because we use an ethics of gift exchange, generosity and altruism to justify organ procurement and transplantation, and to downplay the associated elements of sacrifice, mutilation and risk of death? Does Western capitalism make us forget that altruism is possible? Further studies are needed to explore these issues.This exploratory study describes views on altruism offered by a sample of French and Quebec transplant physicians. These views are embedded in social, cultural, legal and political contexts, and cannot be extrapolated beyond these settings. Our qualitative methodology allowed us to offer some explanations as to why LAD is not widely performed in France and Quebec. The interview data also shed light on how transplant physicians, in their close and daily involvement with organ donation, see altruism. Their perspectives and discourses on the subject help us better understand their assessments, judgments and expectations regarding living organ donors, which subsequently inform the ethical guidelines adopted by medical or transplant communities. Of course, it is important to bear in mind that these views might differ from those of other transplant stakeholders, such as patients on the waiting list, potential donors and the general public. Further qualitative and quantitative studies are needed to explore these views and their bearing on policies and practices.Altruism plays a central role in transplantation and the promotion of organ donation. However, the concept has multiple meanings for transplant physicians. Our data lead us to question whether altruism is overly simplistic, confused or even useful in the field of organ transplantation. Our study has shown how transplant physicians are uneasy with notions of altruism and gift-giving. Is LAD a misnomer? Shaw has shown that the gift metaphor is useful for the public promotion of organ donation but ambiguous for professionals . Some miIn 2006, Marie-Chantal Fortin received an educational grant from Roche Canada to lead a workshop titled \"Ethical and Juridical Challenges in the Face of the Organ Shortage\" at the World Medical Congress held in Toulouse, France, in August 2006.MCF designed the study, conducted the interviews, analyzed the data and drafted the manuscript. MDL participated in the data analysis and independently coded 10% of the raw data. She also provided input on the draft manuscript. MJH participated in the review of the manuscript. HD supervised the design and the completion of the study. He helped review the draft manuscript. All authors read and approved the final manuscript."}
{"text": "Transparent exopolymer particles (TEP) and the presence of compounds sharing molecular formulae with saturated fatty acids and sugars, as well as dissolved organic matter (DOM) compounds containing nitrogen (N) and phosphorus (P) were higher on Transect 1 than on Transect 2, while oxygen concentrations showed an opposite pattern. N2 fixation rates (up to ~1 nmol N L-1 d-1) were higher in Transect 1 than in Transect 2, and correlated positively with TEP, suggesting a dependence of diazotroph activity on organic matter. The scores of the multivariate ordination of DOM molecular formulae and their relative abundance correlated negatively with bacterial abundances and positively with N2 fixation rates, suggesting an active bacterial exploitation of DOM and its use to sustain diazotrophic activity. Sequences of the nifH gene clustered with Alpha-, Beta-, Gamma- and Deltaproteobacteria, and included representatives from Clusters I, III and IV. A third of the clone library included sequences close to the potentially anaerobic Cluster III, suggesting that N2 fixation was partially supported by presumably particle-attached diazotrophs. Quantitative polymerase chain reaction (qPCR) primer-probe sets were designed for three phylotypes and showed low abundances, with a phylotype within Cluster III at up to 103nifH gene copies L-1. These results provide new insights into the ecology of non-cyanobacterial diazotrophs and suggest that organic matter sustains their activity in the mesopelagic ocean.Dinitrogen (N Although our data cannot confirm that the heterotrophic diazotrophs detected actively take up the DOM compounds observed, the differential distribution of organic matter observed between the two transects surveyed, in parallel with distinct patterns of N2 fixation, suggests that these microorganisms benefit from in situ DOM pools, which provide them with energy to support their N2 fixation activity. These results are a step towards a better understanding of mesopelagic diazotrophy, a process which could potentially increase global N inputs to the ocean.The interactions between organic matter and microbes can only be revealed by integrative approaches where equal efforts are made on chemical compound characterization and functional and molecular microbial diversity . To the S1 Fig(A) Transect 1, and (B) Transect 2, and the same order for each transect with variables (C-D) salinity,  NOx , and (G-H) PO43- (\u03bcM). Measurement points are shown with dots.(a) temperature (\u00b0C) for (TIFF)Click here for additional data file.S2 Fig(A) Total bacterial abundance (cells mL-1) in Transect 1, and (B) Transect 2.(TIFF)Click here for additional data file.S3 Fig(A) the first and (B) the second coordinate PCoA scores with the intensity of all molecular formulae.The color code is the correlation coefficient of (TIFF)Click here for additional data file.S1 Methods(DOCX)Click here for additional data file.S1 Results(DOCX)Click here for additional data file.S1 Table(DOCX)Click here for additional data file.S2 Table(DOCX)Click here for additional data file.S3 Table(DOCX)Click here for additional data file.S4 Table(DOCX)Click here for additional data file."}
{"text": "The effect of bisacodyl on the treatment of rats with slow transit constipation(STC) was studied. Forty-five female Wister rats were divided into controlgroup, STC group, and STC bisacodyl group. The immunohistochemical method wasused to determine interstitial cells of Cajal (ICC) and the expression of c-Kitprotein. Body mass and the number of defecations were significantly decreased inthe STC group compared with the control group on the 100th day afterdiphenoxylate administration, while dry weight of feces was significantlyincreased and the intestinal transit time was prolonged. There were significantdifferences in the number of defecations, dry weight of feces, and intestinaltransit time among the three groups. The number of defecations was higher, dryweight of feces was lower, and intestinal transit time was shorter in the STCbisacodyl group compared to the STC group. In addition, ICC basement membranedissolution occurred in the colon wall of the STC group. The connection betweenICC and surrounding cells was destroyed, and the nucleus shrunken to differentdegrees. Moreover, c-Kit expression in the STC group was significantly lowerthan the control group. The connection between ICC and surrounding cells in theSTC bisacodyl group was significantly stronger than the STC group, and thenumber of ICC and the expression of c-Kit were increased. Bisacodyl could reducethe severity of STC in rats by increasing the number of ICC and the expressionof c-Kit. Slow transit constipation (STC) is an intractable condition characterized byprolonged transit time of colonic contents that is caused by the decrease of colonicmotility. STC can induce abdominal distention, stomachache, defecation difficulty,perianal diseases, and is related with cardiovascular and cerebrovascular diseasesand colon cancer . The etiBisacodyl is a common drug for the treatment of STC, which was first used in 1985.Later, researchers found that bisacodyl promoted and propagated motor activity inpatients with severe STC . HoweverRats have a mild disposition, good tolerance, and high success rate in experimentalresearch, therefore they are the first choice for the study of STC . The STCIn this study, we established an STC rat model and treated STC rats with bisacodyl.Our aim was to study the relationship between bisacodyl and ICC, and explore thepotential underlying mechanism of STC.Female Wister rats, weighing 120\u2013140 g, were purchased from Shanghai LaboratoryAnimal Center of Chinese Academy of Science (China), and kept in 50\u201370% humidityat room temperature. All procedures were approved by the Ethics Committee of thePudong New Area People's Hospital.Forty-five female Wister rats were kept in separate cages for three days. Thirtyrats were divided into two groups: STC group and STC bisacodyl group. The other15 rats were used as the control group.\u21221\u00b7d\u21221), while rats in the controlgroup were treated with the same amount of physiological saline orally. After100 days of diphenoxylate treatment, rats in the STC bisacodyl group weretreated with bisacodyl (20 mg\u00b7kg\u21221\u00b7d\u21221) for 30 days. Thenumber of defecations, feces dry weight, and body weight of rats were recordedevery day. One week after drug withdrawal, the rats were fasted for 24 h. Therats received 100 g/L activated carbon (2 mL) and then the time from theintragastric administration to the first black stool was recorded. The rats werecaged individually and the number of defecations was measured by the metaboliccage (pellet/day). Feces were dried by natural air at room temperature and thenweighed (mg/pellet).The rats in the STC groups were given diphenoxylate by intragastricadministration  wascut from the colon 5 cm away from ileocecal valve. Then, the intestinal tissuewas washed with PBS and fixed with 4% paraformaldehyde for paraffinembedding.The sections (about 5 \u03bcm) were mounted on slides and baked on a 75\u00b0C bakinginstrument  for 10 min. Xylene solution was usedfor dewaxing. The procedures for hematoxylin-eosin staining were as follows:hydration for 10 s with anhydrous ethanol, 95% ethanol, and 80% ethanol; washwith water for 2 min; hematoxylin staining for 8 min; wash with flowing waterfor 1 min; 1% hydrochloric acid ethanol for 5 s; wash with flowing water for 20s; 1% eosin staining for 2 min; wash with water for 2 min; dehydration ofgradient ethanol for 3 min; dehydration of xylene for 5 min; and seal withneutral gum.The procedures of c-Kit protein immunohistochemical staining were as follows:dewax and dewater the sections; soak with PBS for 5 min; sodium citrate forrestoration; natural cooling for 5 min; wash with cold water for 10 min; soakwith PBS for 5 min; incubate with 3% hydrogen peroxide solution for 15 min; washwith PBS for 2 min; add rabbit anti-mouse c-Kit polyclonal antibody  and incubate for 1.5 h; wash with PBS for 2 min; add enzymelabeled second antibody for 30 min; wash with PBS for 2 min; adddiaminobenzidine (DAB) colored solution for 10 min; wash with distilled water;hematoxylin for counterstaining for 5 min; dehydration of gradient ethanol for 5min; dehydration of xylene for 5 min; wash with PBS for 3 times; and seal withneutral gum.Specimens were observed under a light microscope (\u00d7100). Blue nucleus and browncytoplasm were determined as c-Kit-positive cells (ICC cells). Five highmagnification views (\u00d7100) were randomly selected in each slice, and the numberof ICC cells was calculated in each field. c-Kit expression was proportional tothe area or concentration of the brown cytoplasm. The areas of five highmagnification fields (\u00d7100) were measured by Image-Pro Plus 6.0, and the changeof c-Kit expression is reported as the percentage of area size.t-test, and differencesamong three groups were tested by one-way ANOVA. Non-normally distributed datawere analyzed by non-parametric analyses, with P<0.05 consideredstatistically significant.SPSS, version 20.0, was used for data analysis (USA). Measurement data arereported as means\u00b1SD. For normally distributed data, differences between twogroups were tested using Student's th and 100th day after feeding diphenoxylatesuspension, body mass in STC rats was significantly lower than control rats. These findingsindicated that the STC model was successfully established.As shown in th day after feeding diphenoxylate suspension, the number ofdefecations per day in the STC group was less than that of the control group(P<0.05), while dry weight of feces and intestinal transit time were greaterthan that of the control group (P<0.05) (At the 100(P<0.05) .After one month of bisacodyl treatment, there were significant differences in thenumber of defecations, dry weight of feces, and intestinal transit time amongthe control group, STC group, and STC bisacodyl group (P=0.000). The number ofdefecations in the STC bisacodyl group was greater than that of the STC group(P<0.05), while dry weight of feces and intestinal transit time in the STCbisacodyl group were less than in the STC group (P<0.05) .In the STC group, the ICC basement membrane was dissolved in the colon wall. Theconnection between ICC and surrounding cells was destroyed, and the nucleus wasshrunken to different degrees. In the STC group, the number of ICC in a singlefield of vision was 9.51\u00b12.08, and c-Kit expression was (13.05\u00b13.12%), whichwere significantly lower than the control group (P=0.000).Compared with the STC group, the connection between ICC and surrounding cells inthe STC bisacodyl group was significantly strengthened, and the number of ICCs(19.04\u00b13.51) and the expression of c-Kit (46.28\u00b17.09%) were also increased(P=0.000) .Constipation can severely reduce life quality of the patients and bring financialburden to the patients and their families ,9. RecenBisacodyl is a new drug that increases intestinal motility by the following possiblemechanisms : increasIn the current study, the 100th day, when STC rats had the most pronounced differencein body mass, was selected as the experimental time point to observe the effect ofbisacodyl. The symptoms of STC rats were significantly relieved at the 30th dayafter feeding bisacodyl, because the number of defecations increased, dry weight offeces decreased and the intestinal transit time shortened. These findings indicatedthat bisacodyl improved the constipation of rats and had a good therapeuticeffect.invitro and in vivo (The digestive tract, like the heart, has natural pacemakers . The con in vivo . ReductiThe c-Kit receptor is a transmembrane protein encoded by proto-oncogene c-kit thathas tyrosine kinase activity . It is aAs a limitation, we did not observe the time for reversal of the STC model afterstopping diphenoxylate treatment and there is a possibility that part of theresponse of bisacodyl is due to this time."}
{"text": "Matryoshka-like mazes with nested shells, we show that a circular maze has the best filtration efficiency. Results on the mean first-passage time reveal that ABPs escape faster from the center of the maze, while RTPs reach the center from the rim more easily. According to our simulations and a rate theory, which we developed, ABPs in steady state accumulate in the outermost region of the Matryoshka-like mazes, while RTPs occupy all locations within the maze with nearly equal probability. These results suggest a novel technique for separating different types of self-propelled particles by designing appropriate confining geometries without using chemical or biological agents.A diverse range of natural and artificial self-propelled particles are known and are used nowadays. Among them, active Brownian particles (ABPs) and run-and-tumble particles (RTPs) are two important classes. We numerically study non-interacting ABPs and RTPs strongly confined to different maze geometries in two dimensions. We demonstrate that by means of geometrical confinement alone, ABPs are separable from RTPs. By investigating  Active particle systems have attracted a lot of attention during the last decades124567891011121314161718E. Coli bacteria and Chamydomonas algaeruns, with constant speed v0 and reorient randomly, tumble, with rate \u03b1. On the other hand, active Brownian particles (ABPs) refer to the second class of self-propelled particles with spherical Janus particles and non-tumbling mutant strains of E. Coliv0 but their direction changes gradually due to their rotational diffusivity Dr. Despite their different moving strategies, RTPs and ABPs behave similarly on large length and time scales; like passive Brownian particles (PBP) they exhibit translational diffusion. More precisely, a pure ABP and a pure RTP diffuse with the same translational diffusion constant, if (d\u22121)Dr\u2009=\u2009\u03b1, where d is spatial dimension222324252627With respect to their swimming strategies, self-propelled particles are categorized into two main classes. On the one hand, one considers run-and-tumble particles (RTPs) such as motile i.e., when leaving this regimeSeveral experimental and theoretical studies have demonstrated that after an encounter with a wall microswimmers slide along the wall for some time, before they leave it182930312930313334363738394042434445184247484950Salmonella or other microbes infect host cells with different efficiencies1954Despite of their similar properties in bulk and confinement on large scales, ABPs and RTPs interact differently with obstacles on small scalesi.e., proceeding from the entrance to the exit, has been a challenging problem for many centuries. For example, using chemotaxis, active particles are able to solve mazes and find the shortest path towards the exit5758In this article, we present such a strategy by investigating active particles in suitable geometries analogous to mazes, which are illustrated in We consider a single self-propelled particle that is either an ABP or RTP. We place it at a specific starting point inside the maze and monitor its dynamics until it reaches the target point using two-dimensional Brownian dynamics simulations. To obtain the full statistics for an ensemble of non-interacting active particles, we perform many simulation runs to generate different realizations for the same initial condition.The position vectors of both model particles evolve according to the same over-damped dynamicsv0 is the particle\u2019s self-propulsion speed, which is kept constant during the simulations, and its intrinsic direction of motion is given by the unit vector \u03b8 is the orientation angle with respect to an arbitrarily chosen x axis. The particle interacts with walls by a simple repulsive force . More details about the numerical method are provided in the The unit vector Most importantly, ABP and RTP differ in the dynamics governing their orientation angle. An ABP changes its self-propulsion direction continuously due to rotational diffusion. Thus,Dr is the particle\u2019s rotational diffusion constant and \u03b7 is unbiased (<\u03b7(t)>\u2009=\u20090) and uncorrelated (<\u03b7(t)\u03b7(t\u2032)>\u2009=\u2009\u03b4(t\u2212t\u2032)) white noise. In contrast, an RTP changes its direction abruptly with rate \u03b1 at each time step,where Ti. The tumble angle \u0394\u03b8i is selected with equal probability from the range between 0 and 2\u03c0.The sum runs over all tumble events that stochastically happen at times d\u22121)Dr\u2009=\u2009\u03b1  is fulfilled\u03c4r\u2009=\u20091/Dr is the persistence time of an ABP, on which the particle orientation decorrelates. For an RTP the equivalent time \u03c4r\u2009=\u20091/\u03b1 is the mean run time between two tumble events. To characterize the motion of both particle types, we will use the persistence numberAt long times the motion of ABPs and RTPs becomes diffusive in unconfined space. The respective diffusion constants agree if the equivalence condition  maze. Each maze is characterized as follows.Matryoshka doll. The inner-shell radius is r1\u2009=\u20091.8R and the other ones obey ri\u2212ri\u22121\u2009=\u20092.05R . So the width of each circular annulus (zone) is a little larger than the diameter of the particle. Using these values, the particle effectively moves on one-dimensional circular paths with varying speed depending on particle orientation R and are opposite to each other for neighboring shells.outwards). In the second case, we initially place the particle in the outermost annulus and wait until it reaches the central zone of the maze (inwards). In both cases, the initial particle orientation is along We study the ability of both active-particle types to solve the maze in two cases. In the first case, we initially place the particle in the central zone of the maze and wait until it reaches the outer zones  maze to find out how the absence of regularity of the previous geometries affects the particle behavior. The non-regular maze studied here  is a braPr but it also depends on the type of the self-propelled particle. Pr. However, the ABP (solid symbols) always reaches the openings in the confining walls faster than the RTP (open symbols). Both observations can be understood by carefully analyzing how the self-propelled particles move along the walls. At large persistence number Pr (strong confinement regime), the ABP performs a random walk along convex boundaries. While its mean orientation is aligned with the local boundary normal, the momentary orientation fluctuates about the normal and thereby leads to short drift motionsPr, both particles more often detach from the walls and the exit times increase accordingly.We find that the MFPT not only changes systematically with persistence number Pr. In this case the particle orientation is mostly aligned with the local boundary normal and the orientation angle \u03b8 also describes the location of the ABP in the annulus [see \u03b80 (the position of the previous opening) either to \u03b81 or \u03b82 [see \u03b81 and \u03b82. Using the standard formalism61\u03b80 for reaching one of the absorbing boundaries can be calculated:In case of an ABP, a simple random-walk model describes the asymptotic behavior of the MFPT in the limit of large persistence number ulus see . We can r \u03b82 see . This isi, we choose \u03b80\u2009=\u2009\u03c0. Furthermore, the angles \u03b81 and \u03b82 depend on the shell index, which we summarize in the Pr  needed to reach opening Pr. This is because at large Pr, the velocity vector of the ABP always points radially outward and rotational diffusion typically only allows for small changes in its direction. Thus, when arriving at an opening, it is very unlikely that the ABP fully reverses its orientation Pr since the ABP is faster and therefore spends less time close to the opening. Thus, the MFPT ultimately diverges. In contrast, an RTP always has a finite probability to reverse its direction and thereby to enter the openings towards the inner parts of the maze. We also find a non-monotonic behavior in the MFPT for an ABP entering the 4th opening. At small Pn or small v0 the ABP hardly moves towards the opening. Thus, the time to reach it and thereby the MFPT increases again with decreasing Pn\u2009\u221d\u2009v0. A similar non-monotonic behavior is also reported in recent results on optimal search strategies for an ABP looking for a target at the center of a confining circular domainThe most interesting result arises by initializing the self-propelled particles from the outermost zone of the maze [inwards case in n in the circular maze with probability pn. In pn/n for different Pr, where the zone index n is proportional to the zone radius. Clearly, this probability is constant for PBPs that do not have any internal driving. They spread over the whole maze with uniform density just by thermal diffusion. However, at large Pr, ABPs only accumulate in the outermost zone (index 5), while the inner zones remain unoccupied. This is in agreement with the diverging MFPTs plotted in Pr\u2009\u2248\u20091 do ABPs also reach the center of the maze. In contrast, RTPs with their ability to perform large reorientations also settle in the inner zones even at large Pr. All these findings are nicely illustrated in When we let our simulations run for a sufficiently long time, both in the outwards and the inwards case, the particle distribution reaches the same steady state and the particles occupy zone pn(t) for occupying zone n are elements of the state vector |\u03c8(t)>\u2009=\u2009|p1, p2, p3, p4, p5>, which evolves in time according toWhen generating the steady state distributions, one has to be sure that the system has relaxed to the steady state starting from an initial condition. To estimate the relevant relaxation times, we developed a linear rate theory. The probabilities Q contains the transition or hoping rates kmn between neighboring zones as introduced in Q is given in the Pr, we determined the rates kmn from simulations of the outwards case, which corresponds to the initial condition |\u03c8(t)>\u2009=\u2009|>. The eigenvalues of Q are the relaxation rates of characteristic relaxation modes. One zero eigenvalue belongs to the steady state, which we discussed in \u03c4relax, one generally has to wait before steady state is reached. We plot \u03c4relax versus Pr in The transition matrix Pr for an ABP is more pronounced in the circular maze [see Pr. In addition, while in the circular maze the MFPTs of ABP and RTP at small Pr differ from each other, especially for the innermost opening [see Pr, while they easily leave walls with negative curvature49To find out how wall curvature affects particle separation, we examine the square maze of maze see . Thus, tning see , they arPr\u2009=\u20091.5 all particle types now show a uniform distribution throughout the square maze. In addition, the active particles strongly accumulate in the corners of the square maze, especially at large Pr, which is in line with previous experimental observations on both ABPs19495442433940The steady-state distributions of the square maze plotted in th opening at large Pr, it is more probable for it to return to the outermost zone rather than to enter the 3rd opening, since for most of the time its orientation points radially outwards. Therefore, the nested structure of Matryoshka-like mazes drastically decreases the probability for the ABP to enter the inner regions of the maze and amplifies the difference between the two active-particle types. This feature is missing in the non-regular maze.Finally, we investigated the non-regular maze of Pr. However, corner accumulation is still observable in this maze and it is more pronounced at large Pr. Interestingly, at Pr\u2009=\u20091.5 the particle density increases from the top (starting point) to the bottom (end point), while for large Pr the distribution is more uniform throughout the maze. Finally, we tested whether the size of the maze affected these results by performing simulations with a maze twice as large but with the same structure. Again, no difference was observed between both active-particle types (results not shown).We also determined the spatial probability distribution of both active-particle types in steady state see . It doesIn this article we have explored the behavior of two important and widespread types of active particles inside different mazes. Namely, non-interacting active Brownian particles and run-and-tumble particles strongly confined in Matryoshka-like mazes show large differences both in their mean first-passage times and their stationary probability distributions. In particular, run-and-tumble particles enter the maze and easily move towards the center, while active Brownian particles escape faster towards the rim. In steady state, persistent ABPs accumulate in the outermost region of the maze, while RTPs spread more uniformly in all regions. This peculiar phenomenon is more pronounced in mazes with curved boundaries. Our work suggests Matryoshka-like mazes as excellent devices to separate different types of active particles from each other with potential technological and biomedical applications. In contrast, a random maze is not able to distinguish between both active-particle types.In experiments, regular mazes can be fabricated using microfabrication techniques1929653863How to cite this article: Khatami, M. et al. Active Brownian particles and run-and-tumble particles separate inside a maze. Sci. Rep.6, 37670; doi: 10.1038/srep37670 (2016).Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations."}
{"text": "MLH1, revealed an extremely high rate (77%) of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36%) of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing.Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5\u2032 and 3\u2032 splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene,  MLH1, one of the causal genes of Lynch Syndrome. We found that a high fraction of the MLH1 coding mutations resulted in disrupted splicing. To further investigate a more general role of defective splicing across human disease genes, simulation strategies were used to identify 86 disease genes prone to splice site mutations. In these 86 genes, there was an enrichment of cancer genes including the three main casual genes of Lynch Syndrome . Thus, it appears defective splicing may be the main driver of Lynch Syndrome and other cancers. Genes prone to splicing mutations have certain features that allow for the comprehensive prediction of splicing-prone diseases genes in the human genome. Our findings strongly argue for additional clinical sequencing prioritization in both cancer genes and genes prone to splice site mutations.To understand the extent to which disrupted pre-mRNA splicing causes human disease, we re-analyzed coding mutations in  To kscovered \u20136. Howevpression .MLH1, reveal a high proportion of previously uncharacterized ESM (17 of the 20 or 77%) [The sequences that encode for proteins (exons) and the intervening, noncoding sequences (introns) are known to have an important regulatory role in an RNA processing mechanism known as precursor messenger RNA (pre-mRNA) splicing. Variants that alter the regulatory regions necessary for splicing typically result in the deletion of large portions of the coding sequence and generally result in a non-functional protein . Among t or 77%) . In fact or 77%) .Materials and Methods). Of these 86 SSM-prone genes, three were the main causal genes of Lynch Syndrome , which account for 32%, 39%, and 14% of Lynch Syndrome cases, respectively [Here, we present a comprehensive analysis of splicing mutations in human disease. We report 86 genes enriched for SSM, in patients that present with hereditary disease  altered the splicing of exon 10 [MLH1 exon 10 was indicative of high levels of splicing phenotypes in exonic mutations across all genes, a larger pool of exonic variants  was analyzed using a high-throughput reporter assay, MaPSy [MLH1 exons. Of the 36 pathogenic MLH1 exonic mutations surveyed with MaPSy, 11 (30.5%) affected splicing (S1 Table) in an in vivo minigene assay and in an in vitro splicing assay. On average, disease causing point mutations disrupt splicing 10% of the time  [MLH1 disease alleles was almost three times higher than the background rate of splicing disruption in disease alleles. Mapping potential exonic splicing regulatory sequences (ESRs) [MLH1 exons analyzed in MaPSy revealed exon mutations that altered splicing resulted in a greater difference in wild type (wt)\u2013mutant (mt) ESR scores than mutations not resulting in a splicing defects . MLH1 missense and nonsense mutations were found to frequently disrupt splicing in vitro and in vivo: 6/22 (27%) missense mutations and 5/14 (36%) nonsense mutations. Taken together, this data a) confirms the previous report that exonic mutations in MLH1 frequently disrupt splicing b) exonic mutations that alter ESR signals are more likely to result in a splicing defect, and c) suggests that the rate of splicing disruption is not homogenous across genes (i.e. MLH1 is an outlier).A recent analysis of coding mutations located in exon 10 of  exon 10 . To see MLH1 gene. Of the five exons that were included in this study, three had no ESMs. However, all the exonic mutations in exon 8 (6/6) and 71% (5/7) of the mutations in exon 15 significantly altered splicing . Thus, it appears that certain exons in MLH1 are more prone to splicing disruption. To investigate the possibility that certain exons may be more prone to ESMs, a permutation approach was used to identify exons that exceeded the expected number of ESMs discovered . 11 of the 2,061 exons analyzed using MaPSy were predicted with a P < 0.01 to have more ESM than expected . Remarkably, two of these 11 exons identified in the simulation as being enriched for ESMs were MLH1 exon 8 and exon 15, further confirming the previous finding.Interestingly, ESMs were also disproportionately distributed among the exons within the MLH1 mutations, the representation of MLH1 alleles in the fractions of the in vitro spliceosomal assembly assay was examined . Here, the accumulation of an allele in intermediate complexes was interpreted as an indication that the allele blocked the next stage of spliceosome assembly [MLH1, the disruption occurred later. 63% of exonic splicing mutations were primarily blocked at the A complex in transition to the B complex and 37% were blocked at the B complex . Several mutants reduce more than one step in the assembly . As expected, adjacent mutations that were close enough to fall within the same cis-element shared a similar pattern of disruption. In effect, these clusters of variants mutationally defined a particular cis-elements required for particular spliceosomal transitions .To mechanistically investigate the defective splicing of assembly . In geneassembly , 18, howMLH1 (as shown by the MaPSy 5K panel) may be due to chance or the enrichment for splicing mutations in the gene/disease. To eliminate the null hypothesis, Monte Carlo (MC) simulations were used to generate a distribution of SSM frequencies for each gene given the total number of mutations reported in that gene . Of the ~3,600 disease genes reported in the HGMD, 86 genes, including the three main casual Lynch Syndrome genes , had more SSM than expected based on the distribution of SSM in the HGMD dataset (S2 Table).The surprisingly high fraction of disease-causing splicing mutations both reported in the splice-sites and unreported in exonic positions of P = 1.48 x 10\u22129, Kruskal-Wallis, Fig 3B). These results suggest that the 86 SSM-prone genes are not only prone to SSMs but also to ESMs, with three ESMs in the 86 SSM-prone genes being validated in individual minigene constructs .Although SSM generally have a severe impact on splicing outcome by disrupting the essential interactions with the core spliceosome components, variants located within the exonic sequence can also alter splicing by disrupting the myriad of exonic splicing regulatory (ESR) elements . Using tS2 Table). The initial report of an association between MLH1 and splicing mutations also associated other cancer related genes such as BRCA1, BRCA2, and NF1 with disrupted splicing. Furthermore, Gene Ontology (GO) enrichment analysis [P = 2.53x10-2, S3 Table), a pathway commonly associated with cancer phenotypes [P < 0.01, permutation test, Fig 4A). Not only were cancer genes overrepresented in the SSM-prone genes, but they also contained 1.5-fold more SSM and 1.4-fold more ESM than the rest of the genes in the HGMD . When further dividing the cancer genes into oncogenes and tumor suppressor genes (TSG), it became apparent that TSG have more SSM and ESM than the rest of the genes in the HGMD . However, this enrichment for SSM and ESM was not apparent when comparing oncogenes to the rest of the genes in the HGMD . Thus, it appears that TSG are more prone to splicing dysfunction most likely due to their loss-of-function disease mutational mechanism.We next sought to determine if a certain class of disease genes were overrepresented in the 86 SSM-prone genes  [P = 2.54 x 10\u221214, Kruskal-Wallis, S5 Fig). Thus a trivial explanation for predisposition of the 86 SSM-prone genes is the larger mutational target presented by their higher number of splice sites. To determine if the SSM-prone genes were predisposed due to the number of introns, we repeated the MC simulation normalizing for the number of introns . Surprisingly, this correction did not dramatically alter the result. After normalization, about 74.4% (64/86) of the genes that were significantly enriched for splice site mutations, were present in the recalculated SSM-prone gene list (S5 Table).A number of genomic and sequence features have been implicated in the context of splicing , 22\u201325. 4 Table) , 26\u201328, S5 Fig). To determine the relative contribution of each feature to the classification, several machine learning approaches were trained on the HGMD mutation dataset. Briefly, the Random Forest (RF) [Fig 3A; for feature ranking please see Materials and Methods). The model indicates that HI genes and genes with less structured exons have a higher risk of being frequently affected by SSM . In addition to feature prioritization, the classifier was also used to predict additional genes that may be prone to SSM but had not yet been identified as human disease genes. To test the performance of both classifiers, ROC curve analysis was performed. The mean area under the curve was measured for both machine learning models. The RF model was the most predictive . A control classifier trained to predict genes that were not prone to SSM  was considerably less accurate, presumably because this category is lower confidence with fewer associated mutations overall.In addition to having more introns, the 86 SSM-prone genes are generally more haploinsufficient (HI), have shorter and more structured exons (predicted to have more base-pairing interactions), and less conserved variants found in the exomes of ~60,000 healthy individuals  est (RF)  and a LoAs haploinsufficiency was an important feature in the prediction of SSM predisposition (upper category) and splicing defects generally result in a severe loss of gene function, it is possible that the degree of haploinsufficiency largely determines a genes predisposition to SSM. However, the RF model still performed well with HI removed (AUC = 0.805). Therefore, it does not appear that there is a single dominant feature such as HI or the number of introns that drives the accuracy of the predictor. Instead it is most likely a combination of features that determine a genes predisposition to SSM. This analysis suggests that the prediction of genes predisposed to SSM using a broad spectrum of features is feasible and could potentially be used to identify new disease genes that are prone to splicing mutations.Fig 5C). While the classifier was run at a range of stringencies. Using a probability cutoff of 0.6\u20130.86 returned by the classifier, 499 genes were predicted to be SSM-prone (see S7 Table). It is possible that these 499 genes were not previously identified as disease genes because their function was required for organismal viability. To explore the degree to which variation can be tolerated in these 499 genes, the aggregated exome sequencing data from 60,706 presumably healthy individuals provided by Exome Aggregation Consortium (ExAC) [P = 6.1043e-18, Mann-Whitney). This analysis suggests that the splicing elements in the predicted SSM-prone genes are evolving under a higher level of selective pressure. However, this analysis considers all variations equivalently making no distinction between neutral variants and clear loss of function variants. For the variants that fall within the splice sites, position weight matrix (PWM) models can be used to evaluate whether a variant represents a stronger or weaker match to the splice site consensus. In other words, PWM can potentially distinguish loss of function splicing mutants from neutral variation. In this analysis, variants that greatly weaken the match to a splice site model  and would be expected to result in a loss of function are four fold underrepresented in common single nucleotide polymorphisms (SNPs). This suggests a scenario where loss of function variants are eliminated from the variant pool before the SNP can reach a reasonable frequency in the population. Conversely, variants that fall within the 5\u2032 ss but strengthen the agreement of the site to the consensus tend to accumulate in the high frequency set . The same trend is observed in variants that localize to the 3\u2032 ss . An independent measure of selection can be found in analysis that maps obvious loss-of function variants to the predicted SSM-prone genes. For example, 3,230 genes that were depleted of predicted protein-truncating variants (PTV\u2019s) in the exomes of 60,706 individuals are a gold standard for genes in which loss of function variants are poorly tolerated [S7 Fig, P = 7.53e-98 Fisher\u2019s Exact, S7 Table).In order to identify new disease genes that are prone to splicing mutations, the predictive model was applied to ~13,000 non-disease associated genes (m (ExAC)  was crosolerated . While PP = 2.20e-2) and mitosis (P = 5.08e-5) were the two functions enriched in predicted SSM-prone genes . Since the hallmark of cancer is generally the abnormal growth and division of cells, it is possible that mutations within this set may play some yet undiscovered role in cancer. While a more complete characterization of these genes awaits future study, an online browser has been developed to visualize the splicing results of the exonic mutations assessed in the SSM-prone cancer genes studied using MaPSy (S9 Table).The lower proportion of ExAC variants located in the genomic genes predicted to be SSM-prone and the enrichment of PTV-intolerant genes in the SSM-prone genes suggests that they are intolerant to variation and appear to be functionally important genes. It is therefore more likely that splice disrupting variants that map to these genes will be deleterious. To gain more insight into the uncharacterized set of predicted SSM-prone genes, GO Enrichment analysis was performed. Regulation of cell cycle . The degree to which exonic mutations affect splicing also vary across exons. For example, in MLH1, all of the ESM occurred in two of the five exons tested . Earlier work on spliceosome assembly suggested a mechanism where the spliceosome \u2018commit\u2019 to splice sites early in the process [Fig 2). Overall, the MaPSy assay demonstrated a three-fold increase in likelihood that a missense mutation in MLH1 would result in a splicing defect. This study confirms earlier findings of high frequency of splicing defects in MLH1 mutants, but also suggests that the Lynch Syndrome genes, MLH1, MSH2 and PMS2, and the other tested genes are outliers and are prone to splicing disruption.Recent analysis of mutations in  process . In contFig 3). The discovery of a class of genes prone to splicing mutations, led to an exploration of what features and cellular functions that predisposed splicing genes encode. GO term analysis indicated that many of these genes were involved in cancer initiation and progression. Defining a set of \u2018cancer\u2019 genes at the intersection of the COSMIC and HGMD dataset revealed a significant elevation of SSM and ESM in cancer genes, including genes involved in Lynch Syndrome . Cancer genes are enriched in the SSM-prone genes . Cancer genes in this category have higher predicted haploinsufficiency than cancer genes associated with lower levels of SSMs . Machine learning was used to determine other features associated with the SSM-prone genes . In general, no single feature dominated, rather a combination of features determined whether a disease gene was prone to splicing mutations. However, there are certain properties of splicing mutation that warrant further consideration. Splicing disruptions are potent loss of function mutations. This property probably explains the evidence of haploinsufficiency in the SSM-prone genes. Finally, unlike protein coding variants, splicing variants could have tissue specific affects. Consistent with a model of tissue specific affects, Lynch syndrome causes a wide variety of cancer types. While beyond the scope of this work, further studies will be needed to explore tissue specific differences in splicing for Lynch syndrome mutations.A major conclusion drawn from this study is the existence of a class of diseases that are often caused by splicing mutations (i.e. SSM and ESM). The role that splicing defects plays in genetic disease varies across disease genes but genes with elevated SSM also have elevated ESMs . The finding that more than half of the 499 predicted SSM-prone genes also do not tolerate premature stop codons is further indication of strong selection . While it is beyond the scope of this work to define the role and function of each of these genes, there is an indication that many relate to cancer. Of the 12 GO terms enriched in this set, 4 categories were also associated with the original set of cancer genes suggesting the existence of novel cancer genes (comparison of COSMIC cancer gene GO terms and 499 predicted SSM-prone gene GO terms). Taken together these findings suggest a set of genes that should be prioritized in the analysis of clinical sequencing data with a particular emphasis on cancer.As there is a high medical importance in discovering new cancer genes, the random forest classifier that was trained on the set of 86 SSM-prone genes was applied across the entire genome to reveal a set of 499 predicted SSM-prone genes. One possibility is these 499 SSM-prone genes could be targets of splicing factors that contain dominant oncogenic mutations  \u201335. HighMLH1 mutations assessed for splicing defects mapped to internal exons and were selected based on their classification of being disease causing (DM) with a previously undocumented role in splicing. The splicing efficiency of wildtype and mutant exons was calculated as below:ispl is the count for spliced output ii,inp is the count for input i, and n is the number of species that were analyzed in the library pool. MaPSy experiments in vivo and in vitro were performed as previously described [The 36 exonic escribed . Brieflyin vivo splicing reporters were generated using overlapping PCR and consists of the Cytomegalovirus (CMV) promotor, Adenovirus (pHMS81) exon with part of its downstream intron at the 5\u2032 end, followed by the 200-mer library, and exon 16 of ACTN1 with part of intron 15 and the bGH polyA signal sequence at the 3\u2032 end. The resulting in vivo reporters were transfected into human embryonic kidney hek293T cells. After 24 hours of transfection, RNA was extracted and both the input reporters and spliced species were sequenced.The in vitro splicing reporters have a similar design to the in vivo reporters, but exclude the ACTN1 exon, and the CMV promoter was replaced with the T7 promoter. The in vitro splicing reporters were obtained through in vitro transcription using T7 RNA Polymerase. The resulting RNA was then used for splicing reactions in 40% HeLa-S3 nuclear extract. Pools of the input and spliced RNAs were converted to cDNA and prepped for deep sequencing.The emi and imi is the counts for the minor allele in the selected pool and input, respectively, emj and imj is the counts for the major allele in the selected pool and input, respectively. For each wildtype-mutant pair, the allele that splices more efficiently is assigned as the major allele.The allele ratios between wildtype and mutant exons in the different spliceosomal fractions were obtained as follows:Wildtype and mutant sequences of exon 15 of MLH1 (NM_000249.3:c.1684C-T), exon 2 of BRCA1 (NM_007294.3:c.5425G-T) and exon 12 of OPA1 (NM_015560.2:c.1199C-T) were synthesized by Synbio Tech  and incorporated into MaPSy in vivo backbone (Adenovirus (HMS81) and ACTN1 exon 15 by overlapping PCR . MaPSy cMLH1 exons assayed with MaPSy . The \u2018ESR wt/mt difference\u2019 in S1 Table was computed as the wild type-mutant difference in hexamer scores (17).Hexamer ESEs and ESSs were downloaded from published data (17). A sliding window of 1 nucleotide was used plot the predicted ESEs and ESSs in the Disease causing splicing and coding sequence mutations (DM\u2013disease mutations) were selected from the Human Genome Mutation Database (HGMD). The mutations were then classified as SSM, missense, or nonsense mutations. To be considered an SSM, the variant was required to be within the canonical splice-sites (-3 to +6 positions at the 5\u2032 ss and -20 to +3 at the 3\u2032 ss) and labeled as a splicing mutation by HGMD. The number of missense, nonsense, and SSM mutations were determined for each intron-containing gene.Eq 1), the proportion of SSM given the total mutations in each gene was simulated 1,000 times. Genes falling outside the simulated values represent genes that have more  or less  SSM than expected  based on the distribution of mutations types within the dataset.The total number of mutations were plotted against the total number of SSM in a gene. Weighted random sampling was then used to construct a 99.9% confidence interval that capitulates the expected number of SSM given the total number of mutations within a gene. Using the proportion of total SSM to total mutations in the HGMD as a weight for random sampling (Eq 2). To obtain a weight for random sampling using this ratio, the number of SS and the length of the CDS for each gene was used to obtain a unique SSM to total mutations weight for each gene (Eq 3). The corresponding weights were then used as before to simulate 1,000 times the expected number of SSM for each gene. Genes that have more or less SSM than the simulated values have more or less SSM than expected, respectively.The ratio in the previous simulation was normalized to the total number of splice sites (ss) and the total length of the coding sequence (CDS) in the HGMD dataset (Eq 4), the proportion of ESM given the total mutations in each exon was simulated 1,000 times. Exons falling outside the simulated values represent genes that have more  ESM than expected  based on the total number of mutations tested using MaPSy and the total number of ESMs identified using MaPSy.The total number of mutations tested using MaPSy per exon were plotted against the total number of mutations that altered splicing (ESM). Weighted random sampling was then used to construct a 99.9% confidence interval that capitulates the expected number of ESM given the total number of mutations tested in an exon. Using the proportion of total ESM to total mutations in the an exon as a weight for random sampling  was downloaded and intersected with the list of HGMD genes. A permutation test was then performed to determine if cancer genes were overrepresented in the SSM-prone genes.ESS, ESE, and ESR\u2019s were downloaded from published data  and the kth trees) in a forest are constructed based off a different sub-sample (bootstrap sample) from the original training set and then averaged to provide unbiased estimates of predicted values. Two-thirds of the training set was used for the construction of the kth trees with the remaining one-third (out-of-bag data) used for cross-validation and estimates of variable importance. Default parameters were used to construct the random forest model, with the exception that \u2018strata\u2019 was used to sample the majority class (genes with the expected number of SSM) to make the frequency of the expected class closer to the frequency of the rarest class (genes with more SSM than expected). Variable importance was measured by the degree of model accuracy decrease with the permutation of a single predictor variable. The larger the mean decease in accuracy, the more important the variable is deemed in the classification of the data.R implementation of random forest, package \u2018randomForest\u2019 , was useR implementation of logistic regression, \u2018glm\u2019 function, was used to generate a predictive model for distinguishing SSM-prone genes from non-SSM-prone genes. Logistic regression is a classification method that relies on fitting a regression curve given a set of predictor variables and categorical response variables. Again, two-thirds of the data was used to construct the model with the remaining one-third of the data used for cross-validation. Default parameters were used to construct the logistic regression model, with the exception that \u2018family = \u2018 was set to binomial.The random forest model generated from the HGMD dataset was then applied to the rest of the testable genes in genome. Testable genes were required to be void of a previously described disease phenotype by HGMD, contain introns, and have sufficient genomic feature data. This resulted in ~13,000 genes that could be tested using the random forest predictive model. The \u2018predict\u2019 function with \u2018type = \u2018 set to \u2018prob\u2019 was used to predict SSM-prone genes based on a probability estimate. A probability threshold of > 0.6 was set to select SSM-prone genes, which resulted in 499 predicted SSM-prone gene.n = 497, after intersection) and genes predicted with a high probability (prob > 0.6) to have the expected number of SSM (n = 5995). The average ExAC SS region variants per splice site were plotted for genes predicted to be prone SSM and genes with the expected number of SSM.All low frequency (MAF < 0.01%) single nucleotide ExAC variants reported in the splice site regions of genes (-3 to +6 position at the 5\u2032 ss and -20 to +3 position at the 3\u2032 ss) were counted for each gene and divided by the number of SS\u2019s. The list of ExAC SS region variants per SS was then intersected with the genomic genes tested using the random forest model. The genes were then divided into genes predicted to be SSM-prone (n = 486). All ExAC variants that fall within the splice sites (both 3\u2032 and 5\u2032) of the 486 genes were scored using the Maximum entropy model for splice sites (PMID: 15285897). The ExAC variants were separated based on their minor allele frequency into rare (MAF < 0.01%) and common (MAF > 1%). The entire distribution of scores and the two classes of alleles were plotted. The collapsed plots based on splice site score threshold were also generated.The 499 predicted SSM-prone genes were intersected with RefSeq database and only the ones having RefSeq transcript id were retained for the downstream analysis  were intersected with the list of genomic genes analyzed with the random forest model. 1,746 PTV-intolerant genes were analyzed using the random forest model. 281 of 1,746 were predicted to be prone to SSM. The intersection of the two datasets was plotted as a Venn diagram and significance was determined using the Fischer\u2019s exact test.S1 FigMLH1 exons analyzed with MaPSy. Positions of exonic mutations assayed are highlighted in blue (no effect on splicing) and red (resulting in defective splicing). Positions that had more than one mapped mutation are bold. The sequences for both the branch point sequence (BP Seq) and polypyrimidine tract (PY Tract) are also noted.Predicted ESE\u2019s (bottom brackets) and ESS\u2019s (upper brackets)  were map(TIF)Click here for additional data file.S2 FigB. List of exons enriched for ESMs (P < 0.01).ESM versus all HGMD exonic mutations tested in MaPSy exons with regions of 99.9% confidence interval shown in gray. (TIF)Click here for additional data file.S3 FigA. The results from RT-PCR of the output RNA (spliced species) from MaPSy for three replicates is shown. B. Spliceosomal complexes  visualized in native gels for the MaPSy heterogeneous library substrates. C. Migration of RNA splicing intermediates from MaPSy heterogeneous library substrates.(TIF)Click here for additional data file.S4 FigP < 0.01, Mann-Whitney U test).Average percent SSM and ESM in COSMIC identified oncogenes vs non-oncogenes and TSG vs non-TSG listed in HGMD. Star indicates a significant difference between gene groups ((TIF)Click here for additional data file.S5 FigP-values calculated using Kruskall-Wallis test.Average number of introns, exon length, SS \u2206G, HI score, and ExAC variant conservation score in genes with more SSM than expected , expected SSM , and less SSM than expected . (TIF)Click here for additional data file.S6 FigA. Common variants are depleted from the category of variants that cause loss of splice site signal at the 3\u2032 splice site. B. Rare variants are enriched in the range of the splice site signal scores that abolish 3\u2032 splice site recognition.(TIF)Click here for additional data file.S7 FigP = 7.53e-98, Fisher Exact).Enrichment of ExAC\u2019s PTV-intolerant genes in the 499 genomic genes predicted to be susceptible to SSM ((TIF)Click here for additional data file.S1 Table(XLS)Click here for additional data file.S2 Table(XLS)Click here for additional data file.S3 Table(PDF)Click here for additional data file.S4 Table(PDF)Click here for additional data file.S5 Table(XLS)Click here for additional data file.S6 Table(XLSX)Click here for additional data file.S7 Table(XLS)Click here for additional data file.S8 Table(PDF)Click here for additional data file.S9 Table(XLSX)Click here for additional data file."}
{"text": "Rivaroxaban is a direct oral anticoagulant (DOAC) approved as an important alternative to warfarin in patients with nonvalvular atrial fibrillation. We report the case of an 87-year-old man with past medical history of nonvalvular atrial fibrillation on rivaroxaban and recently started amiodarone for pulseless ventricular tachycardia who presented to our hospital with intermittent chest pain and was diagnosed with spontaneous hemopericardium causing cardiac tamponade. The culprit drugs were discontinued, and the patient was treated with emergent pericardiocentesis. Both rivaroxaban and amiodarone are substrates for the CYP3A4 hepatic pathway, and concomitant use can result in increased plasma rivaroxaban levels causing an increased propensity to bleeding. While most physicians are cognizant of the need for renal dosing of rivaroxaban, this article aims to increase awareness of its interactions with drugs that are also metabolized through the same hepatic CYP450 pathway. Rivaroxaban is a direct oral anticoagulant approved by the United States Food and Drug Administration (FDA) for stroke prevention in nonvalvular atrial fibrillation . AmiodarAn 87-year-old male with medical history of paroxysmal atrial fibrillation on 20\u2009mg of rivaroxaban daily, recent pulseless ventricular tachycardia with implantable cardiac defibrillator in situ, and nonischemic cardiomyopathy (ejection fraction 35%) presented to the emergency room (ER) with intermittent chest pain and light headedness of 2 days duration. Chest pain was exertional, left sided, and pleuritic. He also reported shortness of breath but denied cough, fever, or any other infectious. Of note, he was commenced on 200\u2009mg amiodarone daily four months prior to presentation following an episode of syncope due to pulseless ventricular tachycardia.Initial vital signs showed blood pressure of 89/60\u2009mmHg with pulse rate of 59/min, temperature of 98.2\u00b0F, and respiratory rate of 14 breaths/min with normal oxygen saturation of 100% on ambient air. On physical examination, he was in no acute distress and was alert and oriented to time, place, and person. Jugular venous distention was noted on neck examination. Heart sounds were muffled, but lung fields were clear to auscultation. Peripheral pulses were also weak but palpable.His EKG on arrival to the emergency room showed new widespread ST segment elevation . His troChest X-ray revealed enlargement of the cardiomedistinal silhouette. CT chest revealed new moderate-sized pericardial effusion .Transthoracic echocardiogram (TTE) revealed large circumferential pericardial effusion and evidence for tamponade physiology with multichamber collapse and significant respirophasic variation to the mitral inflow pattern . Please Given the patient's history of intermittent chest pain and presence of ST segment elevation on EKG, our initial suspicion was an ST segment elevation myocardial infarction. However, at the time of evaluation by the cardiologist, the patient had no chest pain and serial troponin levels remained normal. Notably, patient had coronary angiography done 9 months prior to index presentation revealed minimal plaquing of the coronary arteries. We now know that the hypotension, muffled heart sounds, and jugular venous distention were part of the Beck's triad of cardiac tamponade. The lactic acidosis, acute kidney injury, and elevated liver enzymes were likely the result of tissue hypoperfusion from hypotension while the leucocytosis was likely reactive.Based on the initial finding of ST segment elevation on EKG, he received a loading dose of 324\u2009mg of ASA by EMS. Amiodarone was discontinued due to deranged liver and renal functions. We also held his rivaroxaban due to abnormal clotting profile and finding of hemopericardium on imaging studies. He had urgent pericardiocentesis in the catheterization laboratory with initial drainage of 825\u2009mLs of sanguinous fluid, and postprocedural TTE showed evidence of resolution of tamponade. The pericardiocentesis catheter was left in place to drain any residual collections, and patient was transferred to the intensive care unit. He had daily TTE at the bedside, and his pericardial drainage volume progressively reduced from 160\u2009cc on day 1 to 100\u2009cc on day 2 to 80\u2009cc on day 3 postpericardiocentesis when the drain was removed. Pericardial fluid analysis was negative for organisms or malignancy.Our patient experienced significant improvement of his symptoms following pericardiocentesis. His blood pressure normalized, and IV dopamine was discontinued immediately after pericardiocentesis. His renal function also improved significantly evidenced by a reduction in creatinine to normal at the time of discharge. He went home 5 days after admission and was instructed to stop his amiodarone and rivaroxaban in the mean time until his office appointment with his cardiologist.Based on the Naranjo causality assessment scale , there iSerious bleeding events have been reported with rivaroxaban, mainly intracranial and gastrointestinal , but onlAltered hepatic metabolism resulting from coadministration with amiodarone and transient renal impairment synergistically resulted in supratherapeutic serum levels of rivaroxaban in our patient resulting in nontraumatic hemopericardium and eventual cardiac tamponade.Elimination of rivaroxaban occurs through a dual pathway\u2014hepatic metabolism occurs via the CYP450 pathway (mainly by CYP3A4 and CYP2J2) while renal excretion via P-glycoprotein-mediated secretion [When used for stroke prophylaxis in patients with nonvalvular atrial fibrillation, clinical trials evaluating the safety and efficacy of rivaroxaban using the cockroft-gault formula recommend that for creatinine clearance greater than 50\u2009mL/minute as was the case in our patient prior to this admission, a standard dose of 20\u2009mg once daily is adequate. However, for CrCl between 15 and 50\u2009mL/minute, a dose adjustment to 15\u2009mg once daily may be considered. Most clinicians recommend discontinuing rivaroxaban in acute kidney injury or CrCl less than 15\u2009mL/minute . No guidAndexanet alfa, a recombinant modified human factor Xa protein, is an antidote recently approved by the United States Food and Drug Administration (FDA)  for patiHowever, there are neither routinely available laboratory tests to measure the anticoagulant effect of rivaroxaban nor consensus guidelines on the use of prothrombin complex concentrates, recombinant factor VIIa, and the newly approved reversal agents in patients on direct oral anticoagulants.This article aims to alert clinicians to this rare but increasingly reported side effect of rivaroxaban. A high index of suspicion is needed for recognition and diagnosis of spontaneous hemopericardium. Caution should be observed especially in elderly patients with declining renal function and increased likelihood of polypharmacy. With increasing use of rivaroxaban and other novel anticoagulants and the recent approval of a new reversal agent, more research is needed to develop monitoring laboratory parameters to determine and monitor their therapeutic range."}
{"text": "Peptide 1 has proven effective in experimental models of PTB and OIR. Seeking understanding of the structural requirements for the activity and biased signaling of 1, a panel of twelve derivatives was synthesized employing the various stereochemical isomers of \u03b1-amino-\u03b3-lactam (Agl) and \u03b1-amino-\u03b2-hydroxy-\u03b3-lactam (Hgl) residues to constrain the D-Thr-D-Val dipeptide residue. Using circular dichroism spectroscopy, the peptide conformation in solution was observed to be contingent on Agl, Hgl, and Val stereochemistry. Moreover, the lactam mimic structure and configuration influenced biased IL-1 signaling in an in vitro panel of cellular assays as well as in vivo activity in murine models of PTB and OIR. Remarkably, all Agl and Hgl analogs of peptide 1 did not inhibit NF-\u03baB signaling but blocked other pathways, such as JNK and ROCK2 phosphorylation contingent on structure and configuration. Efficacy in preventing preterm labor correlated with a capacity to block IL-1\u03b2-induced IL-1\u03b2 synthesis. Furthermore, the importance of inhibition of JNK and ROCK2 phosphorylation for enhanced activity was highlighted for prevention of vaso-obliteration in the OIR model. Taken together, lactam mimic structure and stereochemistry strongly influenced conformation and biased signaling. Selective modulation of IL-1 signaling was proven to be particularly beneficial for curbing inflammation in models of preterm labor and retinopathy of prematurity (ROP). A class of biased ligands has been created with potential to serve as selective probes for studying IL-1 signaling in disease. Moreover, the small peptide mimic prototypes are promising leads for developing immunomodulatory therapies with easier administration and maintenance of beneficial effects of NF-\u03baB signaling.Interleukin-1\u03b2 (IL-1\u03b2) binds to the IL-1 receptor (IL-1R) and is a key cytokine mediator of inflammasome activation. IL-1\u03b2 signaling leads to parturition in preterm birth (PTB) and contributes to the retinal vaso-obliteration characteristic of oxygen-induced retinopathy (OIR) of premature infants. Therapeutics targeting IL-1\u03b2 and IL-1R are approved to treat rheumatoid arthritis; however, all are large proteins with clinical limitations including immunosuppression, due in part to inhibition of NF-\u03baB signaling, which is required for immuno-vigilance and cytoprotection. The all-D-amino acid peptide  In contrast to currently approved IL-1 inhibitors, peptide 1 exhibited pharmacological selectivity by inhibiting some IL-1-triggered pathways such as p38 mitogen-activated protein kinases (p38 MAPK) and Rho-associated coiled-coil-containing protein kinase 2 (ROCK2), while preserving NF-\u03baB , and for preventing the premature initiation of uterine activation proteins and subsequent onset of labor in mice -Agl residue, respectively at either the D-Tyr, D-Val, D-Glu, or D-Leu positions demonstrated similar efficacy, and [(S)-Bgl4]-1 increased activity compared to peptide 1 in inhibiting IL-1\u03b2-induced DNA primase-1-dependent thymocyte TF-1 proliferation -Agl3]-1 exhibited significantly diminished activity, likely due to loss of side chain  and oxygen-induced retinopathy (OIR). These investigations have illustrated the influences of the orientation of the hydroxyl group and backbone for activity and biased signaling, particularly with respect to inhibition of NF-\u03baB.Employing all configurations of Agl, Hgl, and Val residues to study the 4 or Na2SO4, filtered, and rotary-evaporated under reduced pressure. The syntheses under microwave conditions were performed on a 0\u2013400 W Biotage\u00ae Robot Eight and Robot Sixty microwave synthesizer. Column chromatography was performed on 230\u2013400 mesh silica gel, and thin-layer chromatography was performed on alumina plates coated with silica gel (Merck 60 F254 plates). Visualization of the developed chromatogram was performed by UV absorbance or staining with iodine or potassium permanganate solutions. Melting points were obtained on a Buchi melting point B-540 apparatus and are uncorrected. Specific rotations, [\u03b1]D values, were calculated from optical rotations measured at 20 and 25\u00b0C in CHCl3 or MeOH at the specified concentrations (c in g/100 mL) using a 0.5 dm cell length (l) on an Anton Paar Polarimeter, MCP 200 at 589 nm, using the following general formula: [\u03b1]c). Accurate mass measurements were performed on an LC-MSD instrument in electrospray ionization (ESI-TOF) mode at the Universit\u00e9 de Montr\u00e9al Mass Spectrometry facility. Sodium adducts [M + Na]+ were used for empirical formula confirmation. Nuclear magnetic resonance spectra  were recorded on Bruker 300, 400, 500, and 700 MHz spectrometers. 1H NMR spectra were referenced to CDCl3 (7.26 ppm), CD3OD (3.31 ppm), C6D6 (7.16 ppm) or DMSO-d6 (2.50 ppm), and 13C NMR spectra were measured in CDCl3 (77.16 ppm), CD3OD (49.0 ppm), C6D6 (128.39 ppm) or DMSO-d6 (39.52 ppm) as specified below. Coupling constant J values were measured in Hertz (Hz) and chemical shift values in parts per million (ppm). Infrared spectra were recorded in the neat on a Perkin Elmer Spectrometer FT-IR instrument, and are reported in reciprocal centimeters (cm\u22121). Analytical LCMS and HPLC analyses were performed on a 5 \u03bcM, 50 mm \u00d7 4.6 mm C18 Phenomenex Gemini column\u2122 with a flow rate of 0.5 mL/min using appropriate gradients from pure water containing 0.1% formic acid (FA), to mixtures with either CH3CN containing 0.1% FA, or MeOH containing 0.1% FA. Peptides were purified on a preparative column (C18 Gemini column\u2122) using appropriate gradients from pure water containing 0.1% FA to mixtures with MeOH containing 0.1% FA at a flow rate of 10 mL/min.Unless otherwise specified, all non-aqueous reactions were performed under an inert argon atmosphere. All glassware was dried with a flame under flushing argon gas or stored in the oven, and let cool under an inert atmosphere prior to use. Anhydrous solvents  were obtained by passage through solvent filtration systems  and solvents were transferred by syringe. Reaction mixture solutions (after aqueous workup) were dried over anhydrous MgSO3, DIAD, p-nitrobenzoic acid, NaN3, piperidine, DIEA, TFA, TES, TEA, CH3I, NaH, Fmoc-OSu, Boc2O, NaIO4, m-CPBA, TFE, and HFIP. Polystyrene Rink amide resin (0.5 mmol/g) was purchased from Advanced Chemtech\u2122, and the manufacturer's reported resin loading was used in the calculation of yields of final product. All commercially available amino acids  and coupling reagents  were purchased from GL Biochem\u2122 and used as received. Solvents were obtained from VWR international.Unless specified otherwise, commercially available reagents were purchased from Aldrich, A & C American Chemicals Ltd., Fluka and Advanced Chemtech\u2122 and used without further purification, including PPhH-d-Arg-dR)-Agl--Tyr--Agl[(33R)-5]]-1,  and ; HRMS (ESI+) calcd m/z for C38H62N11O10 [M+H]+, 832.4676 found 832.4682.A 10 mL plastic filtration tube equipped with a polyethylene filter was charged with polystyrene Rink amide resin, 75\u2013100 mesh, 1%, DVB with a 0.5 mmol/g loading, (200 mg) and DCM (about 7 mL). The tube was sealed, shaken for 30 min to induce swelling and the liquid phase was removed. The Fmoc group was cleaved from the resin-bound peptide by treatment with a freshly-prepared 20% piperidine in DMF solution (about 7 mL), shaking for 30 min, and removal of the liquid phase. The resin was repeatedly (3x per solvent) washed (10 mL per wash) over a total of 6 min with DMF and DCM, and the liquid phase was removed. Generation of the free amine resin was confirmed by a positive Kaiser test. Peptide elongation was conducted by treating the DMF-swollen free amine resin with a freshly prepared acylation solution containing Fmoc-D-Ala-OH (3 eq), HBTU (3 eq), and DIEA (6 eq) in DMF (4\u20137 mL). After agitating for 3\u20135 h at room temperature, Fmoc cleavage and peptide elongation were reiterated using Fmoc-D-Leu-OH, Fmoc-D-Glu-2-[3-N-(Fmoc)amino-2-oxopyrrolidin-1-yl]-3-methylbutanoic acid [-7]-Acid -14  was dissolved in 1:1 acetone (1 mL) and H2O (1 mL), treated with Na2CO3  followed by Fmoc-OSu , stirred at rt for 18 h, and concentrated to a residue that was dissolved in H2O and acidified to pH 3\u20134 with citric acid (0.5 N solution). The aqueous solution was extracted multiple times with EtOAc until the aqueous layer no longer exhibited the carbamate by TLC. The organic layer was extracted with saturated NaHCO3 (2 \u00d7 3 mL). The aqueous extractions were combined, acidified to pH 3\u20134 with 0.5 N citric acid solution, and extracted with EtOAc. The organic layer was washed with brine, dried over MgSO4, filtered, and concentrated to afford -carbamate -7 : Rf = 0.26 (10% MeOH:DCM); [\u03b1]c 0.41, MeOH); 1H NMR  \u03b4 7.80 , 7.68 , 7.40 , 7.31 , 5.60 , 4.53\u20134.18 , 3.74 , 3.49\u20133.35 , 2.56\u20132.37 , 2.32\u20132.16 , 2.10\u20131.85 , 1.44\u20131.21 , 1.03 , 0.93 ; 13C NMR  \u03b4 173.9, 171.6, 157.2, 143.9, 141.2, 127.4, 126.8, 124.8, 119.5, 66.7, 60.8, 52.2, 41.2, 28.1, 26.2, 18.4, 18.1; HRMS (ESI+) calcd m/z for C24H27N2O5 [M+H]+, 423.1914 found 423.1917.(3R)-N-(Boc)-Methioninyl-(R)-valine tert-butyl ester [-10]N-Boc-(R)-Methionine  and (R)-valine tert-butyl ester hydrochloride  were dissolved in dry DMF (6 mL). On treatment of the mixture with triethyl amine  a precipitate was formed, and HOBt  and DCC  were added to the mixture. The mixture was stirred at rt for 24 h, filtered and the filter cake was washed with DCM. The filtrate and washings were combined concentrated under vacuum. The residue was dissolved in EtOAc (6 mL), washed with 0.5 M citric acid (3 \u00d7 4 mL), 2 N aqueous NaHCO3 (3 \u00d7 4 mL) and brine (4 mL), dried over Na2SO4, filtered and concentrated under vacuum to give -dipeptide -10 as a white foam : Rf = 0.28 (20% EtOAc in hexane); [\u03b1] c 1.95, CHCl3); 1H NMR  \u03b4 6.61 , 5.20 , 4.40 , 4.35-4.22 , 2.59 , 2.23-1.86 , 1.46 , 1.44 , 0.91 ; 13C NMR  \u03b4 171.4, 170.7, 155.6, 82.1, 80.2, 57.7, 53.4, 31.6, 31.4, 30.3, 28.4, 28.2, 19.1, 17.6, 15.3; HRMS (ESI+) calcd m/z for C19H36N2O5S [M+H]+, 405.2418 found 405.2433.N-Boc-(R)-Methioninyl-(R)-valine tert-butyl ester methylsulfonium iodide [-11]R,R)-Dipeptide -10  was dissolved in CH3I  and stirred at rt for 24 h, and concentrated under vacuum. The volatile contaminants were removed by repeated (3x) co-evaporation with DCM to give -methylsulfonium iodide -11 as yellow gummy foam : Rf = 0.2 (5% MeOH in DCM); [\u03b1] c 1, MeOH); 1H NMR  \u03b4 7.53 , 5.98 , 4.60 , 4.24 , 3.96-3.81 , 3.73\u20133.58 , 3.32 , 3.21 , 2.64\u20132.47 , 2.42\u20132.14 , 1.45 , 1.42 , 0.99 ; HRMS (ESI+) calcd m/z for C20H39N2O5S [M]+, 419.2574 found 419.2567.-2-[3-(Fmoc)amino-4-hydroxy-2-oxopyrrolidin-1-yl]-3-methylbutanoate [-12] was prepared as previously described -tert-Butyl 2-[3-(Boc)amino-2-oxopyrrolidin-1-yl]-3-methylbutanoate [-13]-Methylsulfonium iodide -11  was dissolved in a 1:1 mixture of DMF (3.5 mL) and DCM (3.5 mL) under argon, cooled to 0\u00b0C, treated with NaH , and stirred at 0\u00b0C for 2.5 h. The reaction was diluted with methyl acetate (2.5 mL) and H2O (0.5 mL) and allowed to warm to rt with stirring overnight. The reaction mixture was concentrated under vacuum, quenched with 1 M NaH2PO4, and extracted three times with EtOAc. The combined EtOAc layers were dried over MgSO4, filtered and concentrated to a residue that was purified by column chromatography on silica gel using 20% of EtOAc in hexane as eluent. Evaporation of the collected fractions provided -lactam -13 : Rf = 0.31 (30% EtOAc in hexane); [\u03b1] c 1.6, CHCl3); 1H NMR  \u03b4 5.09 , 4.39 , 4.31\u20134.16 , 3.72 , 3.27 , 2.72\u20132.58 , 2.26\u20132.11 , 1.90\u20131.71 , 1.45 , 1.44 , 0.98 , 0.89 ; 13C NMR  \u03b4 173.0, 169.7, 156.1, 82.1, 80.0, 61.0, 52.4, 41.7, 29.4, 28.8, 28.5, 28.2, 19.4, 19.3; HRMS (ESI+) calcd m/z for C18H33N2O5 [M+H]+, 357.2384 found 357.2399.-2-[3-Amino-2-oxopyrrolidin-1-yl]-3-methylbutanoate trifluoroacetate [-14]-lactam -13  in TFA (1 mL) and DCM (1 mL) was stirred at rt. After TLC analysis revealed complete consumption of the carbamate, the volatiles were evaporated on a rotary evaporator, and the residue was precipitated from ice-cooled diethyl ether and collected using a centrifuge to yield -trifluoroacetate -14  as white precipitate: Rf = 0.1 (1:9:90 Et3N:MeOH:DCM); [\u03b1]c 0.5, MeOH); 1H NMR  \u03b4 4.40 , 4.17 , 3.92\u20133.81 , 3.60\u20133.45 , 2.66\u20132.54 , 2.35\u20132.19 , 2.14\u20131.97 , 1.05 , 0.98 ; 13C NMR  \u03b4 171.3, 170.0, 60.8, 50.3, 41.6, 28.2, 24.5, 18.3, 18.2; HRMS (ESI+) calcd m/z for C9H17N2O3 [M+H]+, 201.1234 found 201.1226.A solution of (3N-Fmoc-(R)-Methionine methyl ester [(R)-15] and N-Fmoc-(R)-Methionine sulfoxide methyl ester [(R)-16] were prepared by a modified version (vide infra) of the previously described method -Vinylglycine methyl ester [(R)-17] and - and -Methyl 2-(oxiranyl)-N-(Fmoc)glycinate [-18 and -18] were prepared as previously described -Hgl-Val-tBu [-19] and -tert-Butyl 2-[3-(Fmoc)Amino-4-p-nitrobenzoyloxy-2-oxopyrrolidin-1-yl]-3-methylbutanoate [-20] were prepared as previously described -Agl3t-Bu)-D-Leu-D-Ala-Rink amide resin (22)]-D-Val-D-Glu-7  and 2-(1H-benzotriazol-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphate  in dimethylformamide  was stirred for 1 min, treated with N,N-diisopropylethylamine , stirred for 5 min and added to H-D-Glu(t-Bu)-D-Leu-D-Ala-Rink amide resin 21 , which was placed earlier into a 3-mL plastic filtration tube equipped with a polyethylene filter and swollen in DMF (2 mL). The resin mixture was shaken at rt for 5 h, and the liquid phase was removed by filtration. The resin was repeatedly (3x per solvent) washed (15 s per wash) with DMF and DCM, and dried under vacuum to afford resin 22. To assess resin-bound peptide purity, a resin aliquot (5 mg) was placed into a 1-mL plastic filtration tube equipped with a polyethylene filter and treated with 20% piperidine in DMF. After 0.5 h, the liquid phase was removed by filtration and the resin was treated with 0.5 mL of a 95:2.5:2.5 cocktail of TFA:H2O:triethylsilane (TES) at rt for 1 h, and filtered. The filtrate was collected in a 1.5 mL tube and concentrated by purging with an air stream. The residue was treated with Et2O (1 mL), and centrifuged for 2 min. After decantation, the precipitate was dissolved in H2O (1 mL) and analyzed by LCMS  and .A solution of acid  using a 1.0 cm path-length quartz cell containing 20 \u03bcM of peptide dissolved in Milli-Q water. The experimental settings were as follows: 1 nm, bandwidth; 0.5 nm, step size; 3 s, sampling time.Timed-pregnant CD-1 mice were obtained from Charles River  at gestational day 12 and were acclimatized for 4 days prior to experiments. Animals were used according to a protocol approved by the Animal Care Committee of H\u00f4pital Sainte-Justine in accordance with the principles of the Guide for the Care and Use of Experimental Animals of the Canadian Council on Animal Care. The animals were maintained on standard laboratory chow under a 12 h:12 h light/dark cycle and allowed free access to chow and water.ad libitum access to food and water and kept in a 12 h:12 h light/dark cycle. To control for the effects of litter size on retinal development, the sizes of litters were reduced to 12 by sacrificing excess pups by decapitation while under 2% isoflurane anesthesia. All procedures and protocols involving the use of these rats were approved by the Animal Care Committee of the research center of H\u00f4pital Maisonneuve-Rosemont and are in accordance with the Statement for the Use of Animals in Ophthalmic and Vision Research approved by the Association for Research in Vision and Ophthalmology (ARVO), and guidelines established by the Canadian Council on Animal Care.Two-day-old (P2) Sprague Dawley rat pups and their mothers were ordered from Charles River  and acclimatized for 3 days. The rats were housed in standard cages with 1)  and Kineret .Chemicals were purchased from the following manufacturers: human rIL-1\u03b2 , LPS , rytvela (peptide 2). Cells were serum starved overnight and treated with 100 ng/mL IL-1\u03b2 for 4 h. Cells were pre-incubated for 30 min with peptides 1, 5, or 6 (10\u22126M) or Kineret (1.0 mg/mL) prior to the experiments to reach equilibrium (n = 4 each treatment). Cells were harvested and incubated for 5 min in RIBOzol (AMRESCO). RNA was extracted according to manufacturer's protocol and RNA concentration and integrity were measured with a NanoDrop 1,000 spectrophotometer. A total of 500 ng RNA was used to synthetize cDNA using iScript Reverse Transcription SuperMix . Primers were designed using National Center for Biotechnology Information Primer Blast and are shown in IL1\u03b2, IL6, and PTGHS2 [Prostaglandin H synthetase 2 or cyclooxygenase-2 (COX-2)]. Data are representative of 3 experiments (each with n = 4 per treatment group).HEK-Blue IL-33/IL-1\u03b2 cells were purchased from InvivoGen  and used at passages under 15. HEK-Blue cells were cultured in DMEM growth medium supplemented with 10% serum, 50 U/mL penicillin, 50 mg/mL streptomycin, 200 mg/mL zeocin, and 100 mg/mL hygromycin. Cells were grown in regular conditions  or Kineret (1.0 mg/mL) for 30 min, followed by treatment with a constant concentration of IL-1\u03b2 (100 ng/mL), and then incubated at 37\u00b0C for 4 h. Levels of secreted alkaline phosphatase in cell culture supernatant were determined using the QUANTI-Blue assay, according to the manufacturer's instructions (InvivoGen). Alkaline phosphatase activity was assessed by measuring the optical density (OD) at 620\u2013655 nm with a micro plate reader . Data are representative of 3 experiments (each with n = 4 per treatment group).HEK-Blue IL-33/IL-1\u03b2 cells (InvivoGen) were pretreated with peptides 2) and maintained under passage number 15. Cells were equilibrated with 1, 5, or 6 (10\u22126M) or Kineret (1.0 mg/mL) for 30 min, after which time they were exposed to IL-1\u03b2 (100 ng/mL) for 15 min. Cells were harvested and lysed on ice for 30 min using a radioimmunoprecipitation assay buffer  supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF) and cOmplete\u2122 EDTA-free protease inhibitor cocktail . Protein concentrations were determined using a Bradford protein assay (Bio-Rad) on 96-well plates with a microplate reader (EnVision Multilabel reader) measuring OD at 595 mm. Bovine serum albumin serial dilutions were used to generate a standard curve. Lysates were then mixed with 4X reducing sample buffer (Bio-Rad).RAW Blue cells (Invivogen) were grown under standard conditions  in a 5% acrylamide stacking gel, and samples were electrophoresed in a 12% acrylamide resolving gel for 1.5 h at 120 V, followed by a 1 h transfer onto polyvinylidene difluoride (PDVF) membranes at 100 V. Membranes were blocked and incubated with 1:1,000 dilution of primary antibody and 1:20,000 dilution of secondary antibodies according to the manufacturer's instructions. Antibodies used were for phospho-p38 MAPK , p38 MAPK , SAPK/JNK , phospho-SAPK/JNK , ROCK2 (Thermo Fisher Scientific PA5-21131), phospho-ROCK2 (Thermo Fisher Scientific PA5-34895), and goat anti-rabbit conjugated to horseradish peroxidase . Membranes were imaged using an Amersham Imager 600  using Clarity Western ECL Substrate (Bio-Rad). The intensity of protein bands was quantified using ImageJ and standardized using total (phosphorylated + non-phosphorylated) protein content. Data are representative of three independent experiments.1 was performed as described previously   and 1 mg/kg was injected 12 h after stimulation (n = 4 each treatment). Mice delivery was assessed every hour until term (G19\u2013G19.5). A mouse is considered as delivering prematurely if the first pup is delivered earlier than G18.5.Timed-pregnant CD-1 mice at 16.5 days of gestation (G16.5) were anesthetized with 2% isoflurane and received an intraperitoneal injection of LPS . To control for the effects of hyperoxia on the lactation of the dams, dams of hyperoxic litters were switched with dams of control litters on P8.On P5, litters were transferred to a controlled hyperoxic environment (Biospherix OxyCycler A84XOV) and maintained at 80 \u00b1 1% O1, 5, or 6 or 3 mg/kg/day of Kineret from P5 to P10. These doses were determined from our previous study  vehicle, 2 mg/kg/day of peptides On P10, pups were euthanized by decapitation under 2% isoflurane anesthesia. Eyes were enucleated and fixed in 4% paraformaldehyde for 1 h at room temperature before washing twice with PBS and storage at 4\u00b0C in PBS until further processing.Under a dissecting microscope, the cornea and lens were gently removed from the eyes and remnants of the hyaloid vasculature were removed from the retinas using surgical scissors and tweezers. The retinas were gently removed from the underlying sclera/choroid complex.2, 1% Triton X-100, 1% TRITC-conjugated lectin cell endothelial marker from Bandeiraea simplicifolia  and a 1:500 dilution of rabbit anti-ionized calcium-binding adapter molecule (Iba)-1 antibody  in PBS. The retinas were then washed thrice with PBS and incubated with a secondary antibody solution consisting of 1% BSA, 0.1% Triton X-100, 0.05% Tween-20 and 1:500 Alexa-594-conjugated donkey anti-rabbit IgG  in PBS for 2 h at room temperature. Retinas were washed thrice with PBS and then flat-mounted onto glass slides with coverslips and Fluoro-Gel mounting medium .Retinas were treated at room temperature for 1 h with a blocking solution consisting of 1% bovine serum albumin (BSA), 1% normal goat serum, 0.1% Triton X-100 and 0.05% Tween-20 in PBS. The retinas were then double-labeled overnight at 4\u00b0C with gentle shaking in an antibody solution consisting of 1 mM CaClFor assessment of vaso-obliteration, retinas were imaged using an epifluorescence microscope at 10X magnification (Zeiss AxioImager Z2) and version 4.8 of the AxioVision software. Images were captured and stitched together using the software's MosaiX feature. Iba-1 staining was assessed with the same microscope at 20X magnification, and a total of 4 fields per retina were imaged halfway between the optic nerve and the edge of the retina.Representative images of Iba-1 staining were taken using a laser scanning confocal microscope (Olympus IX81 with Fluoview FV1000 Scanhead) with the Fluoview Software at 30X magnification.The FIJI software was used to the quantify the area of vaso-obliteration in each retina, expressed as a percentage of the area of the whole retina. The number of Iba-1-positive cells was counted using the cell counter plug-in in FIJI, and the average of cell counts in 4 fields per retina was calculated.p was < 0.05 and expressed as mean \u00b1 SEM.Data was analyzed using GraphPad Prism 7 with one-way ANOVA and Dunnett's test for multiple comparisons. Outliers were detected using Grubb's test. Results were treated as significant when -, \u03c8-, and \u03c9-dihedral angles such that Agl and Hgl residues prefer to situate at the i+1 residue in \u03b2-turn sequences contingent on sequence stereochemistry  were performed by approaches featuring preparation of the N-Fmoc-dipeptides in solution, followed by their incorporation into the final peptides using solid-phase peptide synthesis. Although effective means for introducing Agl and Hgl residues directly on solid phase have been developed -Agl-r)-7, N-Boc-d-methionine 8 was coupled to tert-butyl r)-Agl-(R)-Val-Ot-Bu 11 in 58% yield - and -18 were prepared from N-Fmoc-d- and l-methionine methyl esters (R- and S-15) using a modification of the reported three-step protocol in which N-Fmoc-vinylglycine methyl ester 17 was synthesized by a flow process featuring elimination of N-Fmoc-methionine sulfoxide methyl ester 16 using 2,4-dichlorotoluene at 200\u00b0C, and epoxidation of olefin 17 was performed by microwave irradiation using m-CPBA in toluene at 80\u00b0C -18 was reacted with tert-butyl (R)-valinate 9 using a catalytic amount of benzoic acid and trifluoroethanol under microwave irradiation at 80\u00b0C for 90 min to provide N-Fmoc--Hgl-d-Val-Ot-Bu [-19] in 89% yield. A Mitsunobu approach was employed for the synthesis of the cis-Hgl isomers by inversion of the alcohol stereochemistry of their trans-counterparts - and -diasteromers of epoxide 18 and enantiomers of valine 9, the trans- and cis-Hgl dipeptide diasteromers 12 were, respectively, synthesized in 84 and 83% yields.The synthesis of Hgl peptides in solution and on solid phase has been accomplished using oxiranyl glycine  were performed using standard Fmoc-based solid-phase synthesis on Rink amide resin  spectroscopy of peptides 1, 5, and 6 in water were first measured to begin examining the influences of Agl-Val and Hgl-Val dipeptide configuration on conformation. The conformers in water likely represent the geometry that initially binds the receptor. Restraint that pre-organizes a favorable binding conformer may facilitate molecular recognition by diminishing the entropy costs for folding.Understanding the relationships between the preferred conformations of peptides 1 exhibited a curve shape characteristic of a disordered random coil structure -Agl3]-, [-Hgl3]- and [-Hgl3]-1, all exhibited negative and positive maximum that were, respectively, observed at 198\u2013207 and 221\u2013227 nm, indicative of a \u03b2-turn conformation (S)-Agl3-(S)-Val4]-, [-Hgl3-(S)-Val4]- and -1 gave similar but inverted curve shapes typical of \u03b2-turn conformers with notably greater ellipticity -Hgl3-(S)-Val4]-1 exhibited a curve shape indicative of a \u03b2-turn conformer -Hgl3]-1 examined in trifluoroethanol (TFE), MeOH and hexafluoroisopropanol (HFIP), and the greatest ellipticity was seen in 5% TFE in water.The CD spectrum of the parent peptide tructure . Contingormation . Inversi1 and derivatives were ascertained in vitro in RAW-blue and HEK-blue cells which were stimulated with IL-1\u03b2. The QUANTI-blue assay was employed to measure concentrations of secreted alkaline phosphatase, a reporter product from the transcription of the NF-\u03baB gene. No peptides that were tested exhibited any noticeable inhibition of NF-\u03baB signaling , p38 mitogen-activated protein kinases (p-38) and Rho-associated, coiled-coil-containing protein kinase 2 (ROCK2) in RAW-blue cells, after pre-incubation with peptides 1, 5, or 6 and stimulation with IL-1\u03b2 (- than s)-Hgl3]- and [(3R)-Agl3s)-Val4--Agl3]-, [(3R)-Agl3]-, [-Hgl3]- and - and [(3S)-Agl3-(S)-Val4]-1 and recovered in part in certain Hgl3-(S)-Val4 analogs with [-Hgl3-(S)-Val4]-1 exhibiting ability to inhibit the expression of all three genes.The effects of peptides  peptide . On the 1 is known to bind to IL-1R -Hgl3]-1, which exhibited a significantly lower (p = 0.0011) ability to compete with radiolabeled peptide 1 -Val peptides 5 and 6 exhibited little efficacy.The spectrum of rth PTB, , featuring labor . On the 1 and a subset of analogs 5 and 6 that were previously tested in the PTB model: e.g., [(3S)-Agl3]-, [(3R)-Agl3]-, [-Hgl3]-, and [-Hgl3]-1 which exhibited the best activity, -1 which had partial efficacy and -1, which was inactive in delaying labor.A model of OIR was next used to examine peptide 1 and Kineret both diminished the extent of vaso-obliteration to 15\u201320%  in the PTB model, demonstrated efficacy in reducing vaso-obliteration to a somewhat lesser extent than peptide 1. On the other hand, [-Hgl3-(S)-Val4]-1, which had no effect in the PTB model, was also ineffective in curbing vaso-obliteration.Exposure of rat pups to 80% oxygen from days 5 to 10 of life resulted usually in vaso-obliteration of ~35% of the retinal capillaries, extending radially from the optic nerve . Peptideo 15\u201320% . Among t1 -Hgl3]-, [-Hgl3]- and [-Hgl3]-1 prevented partially the activation of microglia; [(3S)-Agl3]-, [(3R)-Agl3]- and [-Hgl3-(S)-Val4]-1 had no appreciable effect on microglial morphology (S)-Agl3]-1, which modestly (< 20%) reduced microglial density despite not influencing microglial morphology. Peptides 1, 5, and 6, which prevented microglia activation, caused a statistically significant reduction in vaso-obliteration area. In summary, certain [Hgl3]-1 analogs behaved like the parent peptide and exhibited protection against vaso-obliteration in the hyperoxic phase of OIR, due in part to mitigation of microglial activation.Immuno-histochemical staining for Iba-1 was used to assess microglial activation and density, because microglia have been shown to be mediators of vaso-obliteration in the context of OIR  but fail to address the underlying inflammatory processes responsible for labor  and on the transcription of downstream pro-inflammatory genes that are mediated by IL-1\u03b2 , but did not affect NF-\u03baB signaling. Moreover, peptide 1 delayed significantly PTB in mice induced with LPS and reduced vaso-obliteration in the OIR murine model.Peptide 1 was performed by replacing -Thr3-(R)-Val4 with all four possible Agl3-Val4  and eight possible Hgl3-Val4  diastereomers. Among the twelve analogs of peptide 1, those possessing common backbone stereochemistry  exhibited circular dichroism spectra indicative of \u03b2-turn conformers in water: [(3R)-Agl3]-, [-Hgl3]- and [-Hgl3]-, [(3S)-Agl3-(S)-Val4]-, [-Hgl3-(S)-Val]-, [-Hgl3-(S)-Val]-1. Moreover, [-Hgl3-(S)-Val]-1 also exhibited a CD curve indicative of a turn conformer.Conformational constraint of peptide R,4S)-Hgl3]-1 exhibited the most similar activity as the parent peptide in the in vitro and in vivo assays with slightly reduced potency in inhibiting JNK. Moreover, [-Hgl3]-1 was also typically as potent as 1 but had slightly reduced abilities in inhibiting p38 and ROCK2. Although their CD spectra and conformers differed in water, both isomers possess trans-Hgl residues and (R)-Val stereochemistry, indicating the importance of the \u03b2-hydroxyl group and gauche-(\u2013) \u03c7-dihedral angle side chain geometry for maximum activity.Among the constrained analogs, [(3R)-Agl3]- and [(3S)-Agl3]-1 correlates with their ability to block JNK without inhibitory potency on p-38 and ROCK2. The importance of the hydroxyl group for activity on the latter kinases and for ability to reduce vaso-obliteration in the OIR model is illustrated by the potency of the corresponding Hgl analogs. Notably, [-Hgl3]-1, which positions the hydroxyl group in a gauche-(+) \u03c7-dihedral angle side chain orientation, maintains some potency on all three kinases\u2014with best activity on ROCK2\u2014and exhibits moderate and strong activities in the PTB and OIR models, respectively.The contrast of high potency and inactivity exhibited in the PTB and OIR models, respectively, by both [-Hgl3]-1, which inhibited strongly ROCK2 but had no effects on JNK and p-38, was inactive in the PTB model. The weaker potency in the PTB assay of the (S)-Val analogs correlated with their lack of inhibitory activity on JNK. Although (R)- instead of (S)-Val may be a prerequisite for binding IL-1R, the latter may also be more susceptible to enzymatic cleavage by proteases -Hgl3]-1, which displaced radio-labeled 1 to a lesser extent despite being the most efficacious molecule in vitro and in vivo , a technique that is invasive and technically demanding  and assisted in synthesis of derivatives. SC and WL supervised the progress of the project, edited, and proofread the manuscript. All authors have read the final manuscript and agree to be accountable for the content of this work.AG wrote the manuscript, synthesized and purified compounds, and conducted circular dichroism analyses. CC wrote the manuscript and conducted The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest."}
{"text": "Tadalafil is a cytochrome P450 (CYP) 3A4 substrate. Because there are few data on drug-drug interactions, it is advisable to take sufficient consideration when co-administering tadalafil with CYP3A4 inducers or inhibitors. This study was conducted to assess the effect of ticagrelor, a CYP3A4 inhibitor, on the pharmacokinetic properties of tadalafil after oral administration to rats. A total of 20 Sprague\u2013Dawley male rats were randomly divided into the non-pretreated group and ticagrelor-pretreated group, and tadalafil was orally administered to each group after pretreatment with or without ticagrelor. Blood samples were collected at predetermined time points after oral administration of tadalafil. As a result, systemic exposure of tadalafil in the ticagrelor-pretreated group was significantly increased compared to the non-pretreated group (1.61-fold), and the clearance of tadalafil in the ticagrelor-pretreated group was significantly reduced than the non-pretreated group (37%). The prediction of the drug profile through the one-compartment model could explain the differences of pharmacokinetic properties of tadalafil in the non-pretreated and ticagrelor-pretreated groups. This study suggests that ticagrelor reduces a CYP3A-mediated tadalafil metabolism and that tadalafil and a combination regimen with tadalafil and ticagrelor requires dose control and specific pharmacotherapy. Erectile dysfunction (ED), the most prevalent complaint in males, is the persistent inability to maintain an erection . Various\u00ae), the approved PDE5 inhibitor, is used in the treatment of ED and is one of the most frequently prescribed PDE5 inhibitors [Tadalafil , the platelet aggregation inhibitor, belongs to P2Y12 receptor antagonists and is used for the treatment of CAD [12 receptor antagonist [Ticagrelor ) were kindly obtained from Korea United Pharma Inc. . Dimethyl sulfoxide, formic acid, and polyethylene glycol 400 (PEG 400) were purchased from Sigma\u2013Aldrich . Acetonitrile and methanol were purchased from J.T. Baker . Analytical grade reagents were used throughout this study. Overall, distilled water was used.v/v), and the flow rate was 0.4 mL/min. The temperature of the column and autosampler were set as 30 \u00b0C and 4 \u00b0C, respectively. The positive ion mode using Agilent jet stream electrospray ionization (AJS-ESI) was applied to record the scan mass spectra. The ion transitions of tadalafil and IS were set as 390.4\u2192268.1 m/z and 876.4\u2192308.1 m/z, respectively, and detected with a multiple reaction monitoring (MRM) mode. The collision energies for tadalafil and IS were 10 V and 30 V, respectively. The cell accelerator voltage was 5 V and the dwell time was set as 200 ms. The source parameters were set as follows: Gas temperature 200 \u00b0C, gas flow 14 L/min, nebulizer 20 psi, sheath gas heater 250 \u00b0C, sheath gas flow 11 L/min, capillary 3000 V, and nozzle voltage 1500 V.The concentrations of tadalafil were analyzed by a liquid chromatography tandem-mass spectrometry (LC-MS/MS) system equipped with Agilent 1290 series and Agilent 6495 Triple Quad LC/MS . A YMC-Triart C18 column  was used. The mobile phase was a mixture of 0.2% formic acid in acetonitrile and 0.2% formic acid in distilled water  at LLOQ and less than 15% CV at all other concentrations) [In this analysis, the most abundant ion transition of tadalafil (390.4\u2192268.1 m/z) was selected to determine the lowest limit of quantification (LLOQ), and the LLOQ of tadalafil was 3 ng/mL. The range of calibration curve of tadalafil was set to 3\u20136670 ng/mL. The curve was written with a weighted linear regression (1/x) and showed excellent linearity with Rrations) . The acqAll animal experiments were carried out in accordance with the protocol (No. CNU-01167) and the \u201cGuidelines in Use of Animal\u201d approved by Chungnam National University Institutional Animal Care and Use Committee . Male Sprague\u2013Dawley rats  were purchased from Nara-Biotec . All animals were housed in a dark-light cycle of 12 h at 22 \u00b0C and were allowed free access to water and food.g for 5 min at 4 \u00b0C. The plasma was collected and stored at \u221220 \u00b0C until the concentration of tadalafil was analyzed by LC-MS/MS.The experiment was performed in a parallel design. A total of 20 rats were randomly divided into two groups. The control group, Group N , was orally administered for 7 days only with the vehicle . Group T , an experimental group, received 10 mg/kg of ticagrelor in the vehicle once a day for 7 days orally. Thereafter, on the seventh day, tadalafil (2 mg/kg) was orally administered 30 min after the final administration of the vehicle or ticagrelor. Doses of all samples were calculated according to the weight of the rats and administered using gavage. The dose of ticagrelor and tadalafil given to rats were determined by converting the human doses  to animal doses with body surface area, according to the United States Food and Drug Administration guidelines . Blood (v/v% formic acid) containing 500 ng/mL of IS was added to 20 \u00b5L of the plasma sample. After shaking for 5 min, the mixture was centrifuged at 15,000\u00d7 g for 5 min. The supernatant (150 \u00b5L) was transferred and 5 \u00b5L of the sample was injected into the LC-MS/MS.Protein precipitation was applied to extract tadalafil from plasma. Briefly, 200 \u00b5L of acetonitrile (0.2 max)) and the time to reach the maximal plasma concentration (Tmax) of tadalafil were determined from the plasma concentration-time profiles. The area under the plasma concentration vs time curve from 0 to 24 h (AUC0\u201324) was calculated by the linear trapezoidal rule and the area under the plasma concentration vs time curve from 0 h to infinite time (AUC0\u2013\u221e) was estimated by extrapolating time to infinity. The elimination half-life (T1/2) and apparent total clearance (CL/F) were determined from the ln 2/elimination rate constant and dose/AUC0\u2013\u221e, respectively [Pharmacokinetic data were analyzed based on the non-compartment analysis of WinNonlin software 8.1 . The maximum plasma concentration of tadalafil .In this model, the shift of the tadalafil amount in the gut compartment and the central compartment is described by the following equations :dGdt=\u00a0\u2212KpredCon) using the one-compartment model were estimated by the following equation [V/F indicates the central volume of distribution of tadalafil.Predicted plasma concentrations of tadalafil  and the statistical analysis was performed using GraphPad Prism 8 software .Values are represented as mean \u00b1 standard deviation (SD). A student\u2019s t-test was applied for statistical significance of differences  and AUC0\u2013\u221e . The Cmax of Group T slightly increased 1.15-fold compared to that of Group N, but there was no significant difference (p = 0.3332). The ratio of ACU0\u201324 and AUC0\u2013\u221e between Group N and Group T exceeded the range of 0.8\u20131.25, where no pre-specified pharmacological effect was observed [The pharmacokinetic profiles of tadalafil for Group N and Group T are shown in observed .max, T1/2, and CL/F showed statistically significant differences between Groups T and Group N. In the case of Tmax, the absorption of tadalafil in Group T was delayed (Tmax of 3.22 \u00b1 1.30 h) compared to that in Group N (Tmax of 1.45 \u00b1 0.50 h) (p < 0.005). Thus, the tadalafil plasma concentration remained high until 8 h. This result indicated that the reduced metabolism of tadalafil by CYP3A inhibition caused the absorption of the drug for a longer period of time [1/2 compared to Group N (p < 0.005) and the CL/F value of Group T was significantly lower than that of Group N (p < 0.005). These results showed that the inhibition of hepatic CYP3A metabolism and the reduction of the first pass effect increased the exposure of tadalafil [As a result of CYP inhibition by ticagrelor, the plasma concentration of tadalafil decreased more slowly after co-administration of ticagrelor and tadalafil than after tadalafil alone. T of time . In partadalafil .0\u201324, AUC0-\u221e, Tmax, and half-life of tadalafil. In particular, the half-life of tadalafil increased from 3.15 h in Group N to 4.47 h in Group T, resulting in the increased AUC0\u201324 (1.61-fold), AUC0\u2013\u221e (1.66-fold), and Tmax (2.22-fold). In addition, the result of 37% reduction of tadalafil clearance in Group T compared with Group N supported our findings. These data suggest that ticagrelor inhibits tadalafil metabolism due to drug-drug interaction with tadalafil.In general, the non-compartment analysis parameters of tadalafil showed statistically significant differences between Group N and Group T . In the The one-compartment model was successfully applied to describe each group in terms of the plasma concentration-time profile after a single oral administration of 2 mg/kg tadalafil. Among the various compartment models, the one-compartment model, which is the simplest and best suited to the observed pharmacokinetic profile of tadalafil, was used to compare the observed pharmacokinetic profile with the fitted pharmacokinetic profile. The one-compartment modeling supports the results of the non-compartment analysis that changed by the co-administration of ticagrelor. The modeling-based comparison allows for greater confidence in the metabolic inhibition effect by comparing the observed pharmacokinetic profile with the fitted pharmacokinetic profile, as well as by matching with the parameters of the non-compartment analysis. Additionally, the model-based approach was used to evaluate a more specific and quantified absorption, elimination, and distribution of tadalafil in vivo.As shown in e and V/F were decreased significantly in Group T compared to Group N. The Ke of Group T (0.13 \u00b1 0.03 h\u22121) were decreased compared with that of Group N (0.17 \u00b1 0.05 h\u22121) (p < 0.05). Moreover, the V/F of Group T (3.36 \u00b1 0.95 L/kg) was significantly decreased compared with that of Group N (4.39 \u00b1 0.78 L/kg) (p < 0.05). These reductions led to a decrease in the clearance of tadalafil. In addition, the Ka of Group T was also decreased, but there was no statistical significance (p = 0.1933)  . HoweverIn addition, the results from the modeling indicate that ticagrelor is a weak CYP3A inhibitor. The weak inhibitor is defined as a substance that increases the AUC value of the CYP substrate by 1.25-fold to 2-fold, or that it reduces the clearance of the CYP substrate by 20\u201350%, and ticagrelor is also classified as this inhibitor ,41. ChanIn a clinical aspect, tadalafil shows robust safety and tolerability . HoweverIn our study, the plasma concentration-time profile of tadalafil was significantly changed by co-administration with ticagrelor. A ticagrelor-inhibited CYP3A-mediated tadalafil metabolism and the systemic exposure of tadalafil increased by pretreatment with ticagrelor. Co-administration of tadalafil with ticagrelor increased the AUC of tadalafil by approximately 61% and decreased the clearance of tadalafil by 37%. These results suggest that the co-administration of tadalafil and ticagrelor may need dose control and specific drug therapy to avoid side effects from drug-drug interactions. Therefore, CAD patients receiving ticagrelor should be closely monitored when administering tadalafil concomitantly. For further studies, an additional experiment is expected to identify the variation of clinical efficacy of tadalafil by co-administration with ticagrelor, a CYP3A4 inhibitor."}
{"text": "Marchantia emarginata and has been functionally characterized. Experiments based on recombinant protein showed that the enzyme uses \u03c9-hydroxy fatty acids or primary alcohols as its acyl acceptor and various hydroxycinnamoyl-CoAs\u2014preferentially feruloyl-CoA and caffeoyl-CoA\u2014as acyl donors at least in vitro. The transient expression of a MeHFT-GFP fusion transgene in the Nicotiana benthamiana leaf demonstrated that MeHFT is directed to the cytoplasm, suggesting that the feruloylation of cutin monomers takes place there. The aerial organs of most terrestrial plants are covered by a hydrophobic protective cuticle. The main constituent of the cuticle is the lipid polyester cutin, which is composed of aliphatic and aromatic domains. The aliphatic component is a polyester between fatty acid/alcohol and hydroxycinnamoyl acid. The BAHD/HxxxD family enzymes are central to the synthesis of these polyesters. The nature of this class of enzymes in bryophytes has not been explored to date. Here, a gene encoding a fatty \u03c9-hydroxyacid/fatty alcohol hydroxycinnamoyl transferase (HFT) has been isolated from the liverwort  Theglycerol ,5,6. Altglycerol .Arabidopsis thaliana BAHD/HXXXD family acyltransferase, encoded by the gene At5g41040, has been shown to have HHT activity [At5g41040 reduces both the ferulate ester and \u03c9-hydroxy fatty acid contents of suberin, resulting in the development of a thickened peel and an increased rate of water loss [A. thaliana mutant lacking cutin feruloyltransferase (a distant homolog of HHT1) activity displays no marked alteration in its cuticle function in relation to ion permeability, water loss or pathogen infection [The enzymes responsible for acylation belong to the large BAHD/HXXXD acyltransferase family , almost activity ,21 and iter loss . In contnfection . Populus trachocarpa FHT1 enzyme accepts both p-coumaroyl and feruloyl CoA as a thioester donor and is able to acylate \u03c9-hydroxy acids and fatty alcohols in vitro. Heterologously expressing the Populus gene in A. thaliana has the effect of increasing, by as much as 45%, the incorporation of phenolic esters into both the leaf cutin and the root and seed suberin; the accumulation of ferulate esters conferred thereby confer a significantly increased tolerance to salinity stress [The y stress . WoLF PSy stress  has indiy stress .M. emarginata (MeHFT) has been characterized. The enzyme appears to be involved in the formation of alkyl hydroxycinnamate esters and is active in the cytoplasm; in vitro, the enzyme can use either feruloyl or caffeoyl-CoA as its acyl donor, and \u03c9-hydroxyacids or fatty alcohols as its acyl acceptor. Bryophytes, the group of non-vascular plants which includes mosses, liverworts and hornworts, were among the first plants to colonize land. To achieve this, they needed to evolve an number of adaptations to cope with a range of abiotic stresses which are not relevant in a marine or aquatic environment . The livM. emarginata transcriptome (SRP078649), a sequence encoding a putative HFT was identified and given the designation MeHFT. The sequence\u2019s length was 1413 nt and its predicted product a 470 residue protein of molecular mass 51.93 kDa and pI 4.91. The predicted polypeptide\u2019s sequence shared, respectively, 50.6%, 48.2%, 42.3%, 44.3% and 49.5% identity with those of PtFHT , AtHHT1X515962: ,21), AtDX515962: ), AtFACTX515962: ) and StFX515962: ). Sequenp-coumaroyl CoA, caffeoyl CoA and feruloyl CoA) and acyl acceptors  showed that when recombinant MeHFT was provided with feruloyl CoA and 1-dodecanol, a single prominent HPLC peak was observed  , which iobserved A. MS/MS with C12 B. The pr plasmid A. When Croyl CoA . The datroyl CoA  showed tcat/Km ratios in the presence of 1-decanol (3181 M\u22121s\u22121) and 1-dodecanol (3015 M\u22121s\u22121)  . When prr plants . These m-decanol 81 M\u22121s\u2212135S::MeHFT-GFP trangene in the N. benthamiana leaf is shown in The pattern of expression of the pM. emarginata thallus was raised under a 12 h photoperiod and a constant temperature of 25 \u00b0C. Harvested thalli were snap-frozen in liquid nitrogen and stored at \u221280 \u00b0C. Nicotiana benthamiana plants were soil-grown for 5\u20136 weeks under a 12 h photoperiod, with a day/night temperature regime of 24 \u00b0C/22 \u00b0C. p-coumaroyl CoA and caffeoyl CoA were synthesized from ferulic acid, p-coumaric acid and caffeic acid, respectively, using liverwort 4-coumarate CoA ligase [All chemicals and reagents required were purchased from either Sigma\u2013Aldrich  or Energy Chemical , unless otherwise noted. Feruloyl CoA, A ligase , then puA ligase . The proMeHFT sequence and certain selected related plant proteins was carried out using routines implemented in MEGA v5.1 software. [A phylogenetic analysis involving the oftware. . The NeiM. emarginata thallus was extracted using a CTAB-based method [MeHFT was amplified from a cDNA template using PrimeSTAR HS DNA polymerase (Takara) driven by the primer pair MeHFT-F/-R , and ligated into the corresponding cleavage sites of pET32a  in order to generate a transgene which encoded a His-tagged version of MeHFT. To heterologously express this transgene, it was transferred into competent E. coli BL21 (DE3) cells Expression of the transgene was induced by the addition of 0.5 mM isopropyl \u03b2-d-1-thiogalactopyranoside to the culture medium, and the cells were held at 16 \u00b0C for 16 h. Recombinant protein was purified from the medium by passage through a Ni-NTA Sefinose His-bind column , following Gao et al. [Total RNA from two month old d method , and revo et al. . The cono et al. .p-coumaroyl-CoA, caffeoyl-CoA or feruloyl-CoA and 20 \u03bcM acyl acceptor (see below) in 0.1 M Tris-HCl buffer, pH 7.5. The reactions were initiated by the addition of the recombinant protein, held at 40 \u00b0C for 20 min, and terminated by the addition of 50 \u03bcL acetonitrile. After centrifugation  to remove any precipitated protein, a 20 \u03bcL aliquot of the mixture was injected into an HPLC device equipped with C18 reverse-phase column . The material was eluted by passing a mixture of 0.2% v/v glacial acetic acid in water (A) and acetonitrile (B) provided at a flow of 0.8 mL min\u22121. In the period 0\u20135 min, the eluate was composed of 85% A, 15% B; from 5 to 25 min, the proportion of B was raised linearly to 100%; from 25 to 35 min, the eluate was 100% B; and from 35 to 40 min, the proportion of B was lowered linearly to 15%. UV absorption was monitored at 330 nm.Each 50 \u03bcL enzymatic assay reaction comprised 1 \u03bcg recombinant protein, along with 50 \u03bcM of either www.graphpad.com). The quantity of reaction product was calculated based on a standard calibration curve. The reaction kinetics of the recombinant MeHFT was tested in two sets of experiments. In the first, the recombinant enzyme was provided with 0.1 mM 1-decanol and a range of concentrations of feruloyl-CoA in 0.1 M Tris-HCl buffer (pH 7.5), while in the second, the feruloyl-CoA concentration was fixed at 0.1 mM and the 1-decanol concentration was varied. Both sets of experiment utilized 1 \u03bcg purified protein, and were held at 40 \u00b0C for 10 min. Kinetic data were calculated on the basis of the Michaelis-Menten equation, using Graphpad Prism 5 software (MeHFT sequence was inserted into pGWB5 (p35S::GL2-GFP) (www.thermofisher.com) for the purpose of determining the subcellular localization of MeHFT. After its amplification driven by primer pair attB1-MeHFT-F/R  and held at 28 \u00b0C until their OD600 reached about 0.5. The cells were then harvested by centrifugation , rinsed in 50 mM MES/KOH (pH 5.6), 2 mM Na3PO4, 28 mM glucose, 100 mM acetosyringone, then re-suspended in the same buffer to an OD600 of 1.0. The resuspended cells and p19 were mixed in a 1:1 ratio and the mixture incubated for 3 h at 25 \u00b0C, then infiltrated with a syringe into the base of a N. benthamiana leaf [The eHFT-F/R , the seqana leaf . After tM. emarginata may reveal new insights into the diversity of acyltransferases.This represents the first report of the in vitro functionality of a bryophyte HFT. The identification of a member of the BAHD family in as basal a land plant as the liverwort"}
{"text": "Trauma informed care (TIC) is a whole system organisational change process which emerged from the seminal Adverse Childhood Experiences (ACE) study, establishing a strong graded relationship between the number of childhood adversities experienced and a range of negative outcomes across multiple domains over the life course. To date, there has been no systematic review of organisation-wide implementation initiatives in the child welfare system. As part of a wider cross-system rapid evidence review of the trauma-informed implementation literature using systematic search, screening and review procedures, twenty-one papers reporting on trauma-informed implementation in the child welfare system at state/regional and organisational/agency levels were identified. This paper presents a narrative synthesis of the various implementation strategies and components used across child welfare initiatives, with associated evidence of effectiveness. Training was the TIC implementation component most frequently evaluated with all studies reporting positive impact on staff knowledge, skills and/or confidence. The development of trauma-informed screening processes, and evidence-based treatments/trauma focused services, where evaluated, all produced positive results. Whilst weaknesses in study design often limited generalisability, there was preliminary evidence for the efficacy of trauma-informed approaches in improving the mental and emotional well-being of children served by community-based child welfare services, as well as their potential for reducing caregiver stress and improving placement stability.  Trauma informed care (TIC) is a whole system organisational change process which seeks to embed theoretically coherent models of practice across diverse settings and roles, including child welfare, family support, justice, mental health and education. It emerged from the findings of the seminal Adverse Childhood Experiences (ACE) study in the U.S.  with subIn recognising the impact of childhood adversity on child and adult outcomes, trauma-informed services strive to build trustworthy collaborative relationships with children and the important adults in their lives, as well as improve consistency and communication across linked organisations and sectors, with the aim of mitigating the impact of adversity by supporting and enhancing child and family capacity for resilience and recovery. TIC also seeks to change organisational practices and reduce the use of some practices, such as restraint or seclusion, which may inadvertently exacerbate the detrimental effects of severe adversity and constrain client/service user engagement. TIC advocates have developed a set of key assumptions and principles to help design responsive, holistic and effective systems of care . These iThe child welfare workforce interfaces with children and adults who have experienced adversity and trauma on an everyday basis. Indeed, it can be argued that no other child-serving system encounters a higher percentage of service users with trauma histories, whether it be in family support, child protection, foster, kinship or residential care. Experiences of maltreatment and neglect, parental mental ill health, domestic violence and substance misuse often co-occur , while rIn an effort to develop more trauma-informed child welfare systems, various national initiatives, practice and training models have emerged. Of particular note is the work of the National Child Traumatic Stress Network (NCTSN) in the United States. Established by Congress in 2000, the NCTSN is a group of 70 treatment and research centres across the United States which has been instrumental in implementing trauma-informed child welfare initiatives in the USA and internationally. The development of trauma-informed practice in child welfare has also seen substantial federal funding with the Administration for Children and Families (ACF), a division of the United States Department of Health and Human Services (HHS), funding five-year demonstration grants in 2011 to develop and evaluate a range of strategies for improving care for children in the child welfare system suffering from exposure to trauma. Strategies included workforce development, trauma screening and referral, dissemination of trauma-focused evidence-based treatments (EBTs), and improved collaboration between child welfare and behavioural health services.Given that TIC requires multiple level change, various guidance and frameworks for implementing trauma-informed approaches in organisations have also been developed. While definitions and terminology vary, Hanson and Lang  identifiHowever, to date, there has been no systematic review of child welfare system initiatives encompassing the broader range of child welfare services outside of residential or out-of-home care. As part of a wider cross-system rapid evidence review of the trauma-informed implementation literature using systematic search, screening and review procedures , this paWhat are the key components of approaches used within systems of care to create trauma-informed practice and what is the evidence of their effectiveness?A systematic search for relevant articles was conducted on the 22nd October 2018 using the databases: International Bibliography of the Social Sciences (IBSS); Science Citation Index Expanded (SCI-EXPANDED)\u20141970\u2013present); PsycINFO (2002\u2013present); Ovid MEDLINE (ALL 1946 to 31 August 2018); SCOPUS; and ERIC  or different forms of psychotherapy, were excluded, as were those which reported on a specific service/intervention but did not include wider, organisational implementation components.To be eligible for inclusion, papers needed to clearly identify the trauma-informed components of the initiative being implemented and contain some evaluation component with associated data. No limits were placed on the type of outcomes measured and papers could include a range of outcomes such as the impact on service users, improvements to staff knowledge and practice, organisational change, policy development etc.As well as including an evaluation component, articles which only reported on training evaluations also needed to include a pre- and post-test evaluation design to be eligible for inclusion. Literature reviews based on systematic methods were included while non-systematic reviews were excluded, as were studies using a single case design. Additionally, non-English language papers, papers published before 2009, and conference proceedings, dissertations and other papers not published in journals, were excluded. The search identified 5527 potentially relevant articles. References were exported to an excel database and 3824 duplicates removed see . The titThe full text of the remaining 125 articles was then reviewed against the eligibility criteria. Forty-five articles were excluded at this point, primarily because they did not present evaluation data, they only evaluated training with a post-test or qualitative design, or they were not systematic reviews. There was no full-text availability for an additional five papers.The remaining seventy-five papers selected for data extraction contained five systematic reviews which identified definitions and components of TIC relevant to: the juvenile justice system ; out-of-Data extraction entailed extracting key study data  and exporting to an MS Excel spreadsheet. For those papers cited in systematic reviews, the systematic review was the primary source for data extraction supplemented, where necessary, with data from the original article.A narrative approach to synthesis was adopted. Narrative synthesis relies primarily on text to summarise and explain the findings from multiple studies  and is cOf the 75 relevant papers identified through searching the academic literature, 21 papers reported on evaluations of 17 community-based child welfare initiatives involving frontline social workers, family welfare staff and/or other professionals. All originated in the USA. Eight initiatives were large state-wide initiatives usually comprising multiple TIC implementation components and covering multiple professions and agencies, primarily child welfare caseworkers, clinical staff, foster care and adoption services, family preservation services and/or child welfare/treatment facilities. Nine were organisational or agency-level initiatives which generally targeted staff employed in specific agencies such as Child Advocacy Centres, fostering agencies or family preservation services. Across initiatives, service user and training outcomes were the most commonly evaluated elements of the TIC initiatives, followed by evidence-based treatment and trauma-focused services see . EvaluatOnly eight projects reported specifically on outcomes for children and/or their families see . The staSix organisational-level initiatives also evaluated case outcomes. Two initiatives involving child protection/family preservation services reported reductions in child behaviour problems following implementation of the Attachment, Regulation and Competence (ARC) model in a community trauma treatment centre , and incWith the exception of the MCTP outcome evaluation , most stTraining was, by far, the most common component of TIC implementation and was described in almost all of the child welfare papers as a central element of the trauma-informed initiatives under review. Nine of the initiatives specifically evaluated training outcomes, mainly through quantitative pre-test/post-test designs see , althougPost-training follow-up ranged from six weeks to two years, with retention rates between 12% and 89%. Assessment was primarily based on self-reporting, although a number of studies utilised validated measures such as the Evidence-Based Practice Attitudes Scale (EBPAS), the Trauma-Informed System Change Instrument (TISCI) and the Trauma System Readiness Tool ,26,31 toSimilarly, participants in the \u201cTraining for Adoption Competency\u201d initiative, which involved 855 professionals employed in mental health, adoption, family service and residential care agencies across 16 States , reporteVarious initiatives stressed the importance of on-going staff support as crucial to maximising the impact of initial training and embedding TIC in practice. Strategies to address this included the use of learning collaboratives ,31,32, cAlthough staff care/self-care features as a key element of various TIC implementation frameworks, specific efforts to address this in community-based child welfare initiatives were limited with the exception of the Connecticut Collaborative on Effective Practices for Trauma (CONCEPT)  and the A number of papers discussed the implementation of specific trauma screening processes, outcomes from training in routine inquiry, or described inclusion of evidence-based screening measures as part of trauma-informed training ,32,34,37In addition to presenting screening data, Lang et al.  noted thIn Michigan Children\u2019s Trauma Assessment Centre , screeniFour state-wide initiatives, the Massachusetts Child Trauma Project , the ArkOther trauma-focused services provided as part of the implementation process included a 24 month, four phase programme to help youth in out-of-home placement achieve permanency and strengthen their connections to supportive adults ; the devMany of the TIC initiatives reported were part of broader, organisation-wide trauma-informed implementation strategies aimed at changing organisational culture and practices. Key elements of implementation therefore focused on targeting leadership buy-in. This was achieved via providing initial training to agency directors and senior management, establishing implementation teams, developing strategic implementation plans and structures, and assessing organisation readiness ,31,32,35The Michigan Children\u2019s Trauma Assessment Centre  placed aA number of papers drew attention to changes made to policies, processes and/or data systems as part of the implementation process ,31,32,37In an effort to embed trauma-informed principles into decision-making processes, the Michigan Children\u2019s Trauma Assessment Centre  developeAlthough not specifically evaluated, a number of other initiatives described efforts to develop trauma-informed policy and procedures. In the CONCEPT initiative in Connecticut , implemeAlthough a number of initiatives reported on steps taken to engage service users as an integral component of implementing TIC in child welfare settings, the data included were largely descriptive with parents and carers the primary targets, rather than children and young people. Initiatives took the form of parent and carer involvement in trauma-informed training ,27,32 anThe KVC Behavioural Healthcare initiative\u2019s implementation of Trauma Systems Therapy (TST) provided one of the most comprehensive examples of a systems-wide training which initially targeted staff and foster parents and later expanded to encompass community partners and birth parents. It was also the only project to present process evaluation data which indicated that, after two years, 67% of foster parents had received trauma-informed training .None of the community-based child welfare projects reported on changes made to offices or other facilities as a means of promoting a positive, safe physical environment in which to engage service users. Previous reviews of the TIC implementation literature have highlighted a variety of methodological difficulties. These include a relative dearth of outcome focused evaluations, particularly in relation to large-scale TIC efforts, a lack of experimental designs, small sample sizes, high attrition rates and short follow-up periods in longitudinal designs ,11,12. IThe review methodology described in this paper also presents its own limitations when interpreting the findings from the child welfare TIC literature. Firstly, it was limited to organisational interventions that were explicitly trauma-informed. Although this allowed for the application of systematic and replicable methods to be applied to evaluate the body of evidence, it excluded interventions that embraced TIC principles without using the language of the trauma-informed. Secondly, as the review was concerned with effective approaches used within systems, it excluded specific trauma-informed clinical interventions and trauma-focused services/interventions which were not delivered as part of a wider programme of organisational change. Thirdly, although systematic search and data extraction methods were applied, this was a rapid evidence review rather than a systematic review and, as such, evaluation of research quality was limited to broad assessment of the study design and reported limitations. Despite these limitations, this review presents preliminary evidence for the efficacy of trauma-informed approaches in improving the mental and emotional well-being of children served by community-based child welfare services, as well as their potential for reducing caregiver stress and improving placement stability. Implementation at the workforce level focused primarily on staff training with all evaluations showing significant increases in staff knowledge, confidence and/or skills in applying TIC principles. These changes were maintained over time, in some cases up to one to two years after initial training. The development of specific TIC standardised measures such as the Trauma-Informed System Change Instrument (TISCI) and the Trauma System Readiness Tool (TSRT) brought additional rigour to these evaluations, enabling researchers/developers to assess baseline levels of knowledge of TIC policy and practice, assess system readiness, identify training and support needs and measure changes over time ,26,31,32Many initiatives also introduced strategies to provide on-going support to staff after initial training through supervision, booster training, coaching and mentoring. While the extent to which these contributed to overall outcomes was unclear, this implementation element was consistently emphasised as central to embedding TIC principles into every-day organisational practice. However, a focus on staff support/self-care was noticeably absent in this review with only two projects detailing specific efforts to address this . To dateIn the domain of trauma-focused treatment/services, the introduction of trauma screening processes was relatively common. Although evaluation was limited and it was not always clear how, or if, this led to changes in the services provided, there was some evidence that this was perceived positively by professionals, resulting in substantial increases in the numbers of children screened at intake by child welfare and mental health professionals ,32. WhilImportantly, a number of state-wide initiatives ,29,31,32At the organisational level, leadership buy-in and strategic planning were the most commonly reported implementation components, although, as with other implementation domains, evaluation was often limited to qualitative findings. Despite these limitations, these elements of TIC implementation were highlighted as essential to success ,32. Top-Other components of organisational change were less prominent in the papers reviewed. Service user engagement formed part of only a few implementation strategies and primarily took the form of parent and carer inclusion in TIC training, although the Massachusetts Child Trauma Project also included service users in leadership teams  and the There is a robust and growing body of research which indicates that severe or chronic adversity in childhood has a significant, negative impact on a child\u2019s development, health and life chances across their life course. Integrating awareness of childhood adversity into the public health agenda and cross-system service delivery  is therefore essential to prevent, recognise and mitigate the impact of trauma on children. This body of research also points to the importance of understanding parental/caregiver histories, who may also be impacted by early adversity. This knowledge has led to the development of models of trauma informed care in diverse practice settings in the USA which seek to mitigate the impact of adversity by promoting collaborative engagement with children and their caregivers and enhance child and family capacity for resilience and recovery. TIC has international reach with country-wide initiatives appearing across the UK and Europe. The rapid evidence review presented here sought, primarily, to explore the evidence pertaining to the organisational change processes required to implement trauma-informed care at a whole systems level within community-based child welfare settings. As part of a wider cross-system rapid evidence review of the trauma-informed implementation literature, twenty-one papers reporting on trauma-informed implementation at state/regional and organisational/agency levels of the child welfare system were identified. The diversity of interventions included in the papers reviewed and a variety of methodological difficulties, intrinsically limit the potential to draw firm conclusions from the literature. Notwithstanding these limitations, a number of multi-component evaluations of large-scale child welfare initiatives have begun to elucidate the positive impact of different TIC components. Training was the component of implementation most frequently evaluated with all studies reporting positive impact in terms of staff knowledge, skills and/or confidence. Other implementation components such as leadership and strategic planning, the development of evidence-based treatment and trauma-focused services, the provision of on-going staff support and the development of trauma-aligned policies and procedures, were also evidenced to varying degrees across many initiatives. The development of trauma-informed screening processes, and evidence-based treatments/trauma-focused services, where evaluated, all produced positive results. Staff support, service user engagement and changes to the physical environment were less prominent in the papers reviewed, pointing to evident research gaps. Whilst weaknesses in study design often limited generalisability, there was preliminary evidence for the efficacy of trauma-informed approaches in improving the mental and emotional well-being of children served by community-based child welfare services, as well as potential for reducing caregiver stress and improving placement stability. This body of literature, with good practice examples embedded within, will assist others in taking forward the important challenge of evidencing the effectiveness of TIC in child welfare settings."}
{"text": "Mouse models have delivered variable recapitulation of Kyasanur Forest disease (KFD) pathology and consistently demonstrated neurological involvement which may be a limited feature of human disease. With the purpose of more accurately modelling human disease progression we infected several small-mammalian models: guinea pigs, hamsters and ferrets with a titered infectious dose of Kyasanur Forest disease virus (KFDV). Clinical indicators of disease severity were observed for seventeen days, on day eighteen a visual post-mortem analysis of visceral organs was conducted. Viral load in selected tissues was measured to infer disease signs and the establishment of viral replication.Daily monitoring did not reveal any observable signs of illness; weight loss was minimal across species and gross pathology did not indicate severe viral infection. Tissue specific tropism and establishment of viral infection was monitored by quantitative real-time polymerase chain reaction (qRT-PCR). No viral replication was detected in ferrets (n\u2009=\u20090/3), but was present in the spleen of guinea pigs (n\u2009=\u20093/3) and the brain of hamsters (n\u2009=\u20093/3). Low levels of viral RNA were detected in multiple hamster tissues  suggesting the possibility of viral tropism and possible adaptation to the host. No serological tests were performed. Cavia porcellus), hamster (Mesocricetus auratus) and ferrets (Mustela putorius furo)). Animals challenged with an infectious dose of Kyasanur Forest disease virus (KFDV) were monitored daily for visual signs of disease, febrility (ferret only), lethality, and weight loss. Post-mortem examination was performed to collect tissue from the: brain, kidney, liver, lung, spleen of each animal. Viral RNA was extracted from tissue samples and quantified by real-time RT-PCR. Presence of viral RNA was interpreted as evidence of viral tropism and replication. We hypothesized that one of the selected non-mouse models may act as a better model for human disease of KFDV infection than current mouse models.In humans, Kyasanur Forest disease (KFD) is described as a biphasic illness that presents with flu-like symptoms in the first stage and may advance to a second stage with hemorrhagic fever manifestations and/or neurological abnormalities , 2. EpidKFDV isolate P9605  was prev4 TCID50 units of passage-two KFDV was intra-peritoneal-injected. The challenge dose was back titrated on Vero E6 cells. Observations of visual disease, weight loss and lethality were conducted for 16\u00a0days (hamsters and guinea pigs) or 17\u00a0days (ferrets). For ferrets, temperature was also recorded via the subcutaneous IPTT-300 sensors.Each animal species was housed separately in groups of three per cage: female (28\u201370\u00a0days old) outbred LVG Golden Syrian hamsters , female (26\u201358\u00a0weeks old) outbred Hartley guinea pigs  and female (650\u2013800\u00a0g) specific pathogen-free (SPF) ferrets  with subcutaneous implanted IPTT-300 temperature and ID transponder devices . The procedures described herein, were approved by the Canadian Science Centre for Human and Animal Health-Animal Care Committee  adhering to the Canadian Council on Animal Care guidelines. Animals were fed and monitored daily for a 7-day acclimation period and for the duration of the experiment. Pre-challenge, each animal was anesthetized with 5% isoflurane in oxygen and 0.1\u00a0mL with 6.3 \u00d7 10\u00ae 480 RNA Master Hydrolysis Probes and a previously published primer design [At the end of the observation period, animals were anesthetized with 5% isoflurane in oxygen and blood was collected. While under anesthesia, animals were euthanized  for gross pathology and tissue collection. Isolated tissues  were inactivated with RLT and viral RNA was extracted with the RNeasy Plus Mini kit . Viral RNA was detected via quantitative real-time polymerase chain reaction (qRT-PCR) using the Roche LightCycler r design , 12.Throughout the course of observation, clinical signs of disease  were not observed and all animals gained weight . TemperaThis pilot study contains several limitations including: small sample size, no replication for statistical inference, single dose-inoculation, and the presence of infectious virus cannot be directly inferred from the detection of nucleic acid . Additio"}
{"text": "Enhanced Recovery After Surgery (ERAS) is a multimodal perioperative care bundle aimed at the early recovery of patients. Well accepted in gastric and pelvic surgeries, there is minimal evidence in neurosurgery and neurocritical care barring spinal surgeries. We wished to compare the length of intensive care unit (ICU) or high dependency unit (HDU) stay of patients undergoing elective craniotomy for supratentorial neurosurgery: ERAS protocol versus routine care. The secondary objective was to compare the postoperative pain scores, opioid use, glycemic control, and the duration of postoperative hospital stay between the two groups.In this pragmatic non-randomized controlled trial (CTRI/2017/07/015451), consenting adult patients scheduled for elective supratentorial intracranial tumor excision were enrolled prospectively after institutional ethical clearance and consent. Elements-of-care in the ERAS group were- Preoperative \u2013family education, complex-carbohydrate drink, flupiritine; Intraoperative \u2013 scalp blocks, limited opioids, rigorous fluid and temperature regulation; Postoperative- flupiritine, early mobilization, removal of catheters, and initiation of feeds. Apart from these, all perioperative protocols and management strategies were similar between groups. The two groups were compared with regards to the length of ICU stay, pain scores in ICU, opioid requirement, glycemic control, and hospital stay duration. The decision for discharge from ICU and hospital, data collection, and analysis was by independent assessors blind to the patient group.p\u2009=\u20090.04, 0.001, 0.004 respectively). The total hospital stay was similar in both groups.Seventy patients were enrolled. Baseline demographics \u2013 age, sex, tumor volume, and comorbidities were comparable between the groups. The proportion of patients staying in the ICU for less than 48\u2009h after surgery, the cumulative insulin requirement, and the episodes of VAS scores >\u20094 in the first 48\u2009h after surgery was significantly less in the ERAS group \u2013 40.6% vs. 65.7%, 0.6 (\u00b12.5) units vs. 3.6 (\u00b18.1) units, and one vs. ten episodes (The study demonstrated a significant reduction in the proportion of patients requiring ICU/ HDU stay >\u200948\u2009h. Better pain and glycemic control in the postoperative period may have contributed to a decreased stay. More extensive randomized studies may be designed to confirm these results.CTRI/2018/04/013247), registered retrospectively on April 2018.Clinical Trial Registry of India ( Enhanced Recovery After Surgery (ERAS) is a multimodal perioperative care pathway that has led to a dramatic change in the conventional surgical doctrine . Its impERAS protocols target perioperative stress response with specific goal-directed evidence-based practices . Many suWe describe the use of a modified, multidisciplinary ERAS protocol for neurosurgical patients. This study aims to prospectively analyze the effect of the modified ERAS protocol on the outcomes of patients undergoing elective supratentorial tumor surgeries.Our study was a prospective non-randomized assessor-blinded trial conducted in an 800 bedded tertiary center  as the doctoral thesis requirement of A.E. The institute has a dedicated neuro ICU with 24-h coverage by a dedicated team of doctors and nurses. At the time of this study, the area had a combination of 8 ICU and high dependency beds (HDU), and henceforth we use the term ICU to refer to any of these bed types. The study was granted permission by the institute ethics committee (IEC) and was prospectively registered (CTRI/2017/07/015451). Informed written consent was obtained from all patients. A change in the study design (as suggested by the IEC) lead to retrospective re-registration (CTRI/2018/04/013247).All adult patients of ASA physical status I and II over 18\u2009years (inclusive), with a single supratentorial space-occupying lesion posted for elective craniotomies, were included. Moribund patients requiring emergency craniotomies, uncontrolled diabetics, severely cognitively impaired patients unable to follow simple instructions, and those who did not consent were excluded. Informed consents were obtained, and cohort assignments were based on the patients\u2019 and family members\u2019 agreement to be assigned to the ERAS protocol versus control.An ERAS protocol bundle, based on the existing literature and that proposed by Hagen et al., was agreed upon by the Department of Anesthesiology and Critical care and the Department of Neurosurgery in conjunction with the Critical care nursing and dietetics divisions and approved by the institutional ethics committee . The protocol consisted of primarily three segments \u2013 Preoperative, intra-operative, and postoperative. , short-acting opioids (fentanyl \u2013 2 mcg/kg body weight), vecuronium (0.1\u2009mg/kg body weight), and isoflurane titrated to minimum alveolar concentration (MAC) of 1.0. Incision site infiltration with lignocaine 2% (10\u2009mL), invasive arterial pressure monitoring with arterial blood gases on demand, point of care sugar monitoring, pulse pressure variation, and temperature management were available to all anesthetists at all times, but their use was not enforced.Care in the ICU- Standard nurse-led analgesia and sedation management in the ICU followed second hourly documentation of Visual Analogue of pain (VAS) and Richmond Agitation Sedation Scales (RASS), aiming for a VAS <\u20094 and RASS between \u2212\u20092 to +\u20091. Intravenous paracetamol  followed by non-steroidal agents (NSAIDs) as required was administered. Fentanyl (1 mcg/kg body weight) was used only as rescue analgesia for VAS >\u20094. Dexmedetomidine (first choice) or propofol infusions were used for postoperative sedation of ventilated patients, midazolam being reserved for hemodynamically unstable ones. The unit has standard SOPs for insulin infusion to maintain blood sugars in the 110\u2013180\u2009mg% range. Patients whose blood glucose levels were above 180\u2009mg %were started on an insulin infusion with second-hourly monitoring to reach the target range. Patients meeting pre-set criteria were extubated by the on-floor ICU team of doctors and nurses. However, starting enteral feeds, removing drains, urinary catheters, and ambulation awaited the ICU and neurosurgery consultant rounds the day after the surgery, as per unit protocol.The preoperative ERAS bundle began in Group ERAS (GrE) with structured preoperative counseling and education. The patients and next of kin were informed about the elements of care of the multimodal ERAS protocol. An active patient and caregiver participation was encouraged to improve compliance. All patients received a preoperative complex carbohydrate maltodextrin drink (Preload\u00ae) 100\u2009g in 200\u2009mL of clear water the night before surgery and repeated 50\u2009g in 100\u2009mL water 2\u2009h preceding the surgery . Pre-empThe discharge decision from the ICU was taken by the neurosurgical and critical care teams together. Discharge criteria were the same for both groups and included adequate pain control, afebrile state, cardiopulmonary stability, and being able to sit out of bed. Both subsets of patients were followed up till the day of discharge from the hospital.To maximize adherence, an ERAS checklist was attached to all GrE patient-files after obtaining consent. Before starting the study, a workshop was organized to train the nursing teams of both intensive care units and neurosurgery ward to familiarize the staff and resident doctors with the various elements of the ERAS protocol- this module was repeated twice during the study period to cater to changes in staff- mix.Duration of ICU stay defined as calendar days from ICU admission was the primary outcome. The secondary measures were total episodes of the visual analogue score (VAS)\u2009>\u20094, insulin (units) and fentanyl (micrograms) administered in the first 48\u2009h of ICU stay, and the total duration of hospital stay after surgery.All the interventions related to implementing the ERAS protocol were made by the research team belonging to anesthesia , Critical Care (S.T.), and Neurosurgery (R.N.S). Members of the study team were not involved in the decision to discharge from the ICU or hospital.All assessments and documentation  were made by ICU nurses not a part of the study team. After discharge from the ICU, the ERAS checklist was removed from the patient-files, and a blinded assessor collected the data for analysis. The data analyzer was unaware of the group allocation of the patients.The sample size calculation was based on data obtained from the previous six months\u2019 medical records. Seventy percent of patients operated for supratentorial tumors by the same surgery, and the anesthesia team had a postoperative ICU stay of >\u200948\u2009h. It was hypothesized that the ERAS protocol could bring this down by 50%. For 80% power, an alpha error of 5, and 10% attrition, a sample of 70 patients would be needed.Descriptive statistics were used to compare the patient baseline characteristics. All continuous data which were normally distributed were analyzed using Student\u2019s t-test, whereas nonparametric data were analyzed using the Mann \u2013 Whitney U test. A chi-square test or Fisher\u2019s exact test was used for qualitative variables. All the statistical tests were performed using the SPSS software, version 25.A total of 108 patients were eligible, of which 14 patients were excluded for lack of consent. Twenty-four patients (11 in Gr E and 13 in Gr C) were excluded after consent due to logistic reasons such as operation theatre unavailability on the day of surgery. Patients were recruited between August 2017 to October 2018, and the follow-up was completed by the end of November 2018. Figure\u00a0The baseline demographic characteristics were similar between the two groups Table\u00a0. The medX2 \u2009=\u20098.571, p\u2009=\u20090.003) The absolute risk reduction was 25.02% , which showed that one out of every four patients benefitted from the ERAS protocol with a reduced ICU stay duration.Number of patients staying in ICU/HDU for more than 48\u2009h was significantly lesser in the ERAS group of patients than in the Control group.  had their urinary catheters removed on the first postoperative day against 13 in Gr C. Of the 14 in Gr E whose catheters were not removed, 9 had SIADH.U\u2009=\u2009486.00, p\u2009=\u20090.03, r\u2009=\u2009.25).There was a significant difference in the insulin administered to the groups - Gr C required a higher cumulative dosage of insulin within the first 48\u2009h after surgery  than the ERAS group  \u2009=\u20099.79, p\u2009=\u20090.02).Postoperative pain scores showed a significant difference between the groups. Twenty-eight out of 35 patients in ERAS did not have even one episode of VAS above 4 in the first 48\u2009h of ICU stay compared to 19 in the control group. .The cumulative fentanyl dose in ERAS group , was significantly lesser as compared to control group   and 1 for abscess- GrE); 1 patient developed an infarct (GrC), two patients developed postoperative cerebral edema (GrC), 1 developed transient renal failure (GrE), and 1 went into septic shock (GrE). The ERAS group of patients did not exhibit any complications related to the implementation of the protocol.There is limited evidence for the benefit of an ERAS protocol in neurosurgery patients. We show in this study that implementing a multidisciplinary ERAS protocol suited for craniotomy patients is feasible and may reduce the proportion of patients requiring a longer ICU stay significantly. We also demonstrate possible associations with specific protocol components responsible for this improvement in the outcome- decreased pain, less requirement of opioids after surgery, better glycemic control, and earlier mobilization.When our study was initiated in early 2017, there was no evidence that ERAS protocols could be modified and used for neurosurgery patients. A set of suggested guidelines based on non-neurosurgical evidence was presented by Hagan et al., which, although intuitively attractive, would need evidence to be applied to craniotomy patients. ERAS guidelines for spinal surgeries and related studies showing benefits followed , 14. WanERAS protocols are flexible and adapted to individual centers, keeping the basic tenets in place. This is well demonstrated when the two protocols  are compared. Many components were based on previous recommendations and were similar between our groups .The differences are as follows-.Preoperative phase-In our center, relatives are allowed a significant role in patient mobilization, feeding, and patient care - ignorance, fear, and hesitation, delays ambulation, nutritional intake, and rehabilitation during and after the hospital stay. Our preoperative counseling involved an in-depth education of the relatives, including empowering them to question delays in feeding or ambulation orders and removal of foley\u2019s catheter, if any. We educated them on the harmful effects of smoking and alcohol, but abstinence was not essential. As our surgeries were restricted to supratentorial tumors, no added focus than the conventional existed for PONV risk stratification.We administered maltodextrin  drink in different dosages, volumes and times - 200\u2009ml (100\u2009mg) the night before and 100\u2009ml (50\u2009ml) just 2\u2009h. before surgery vs. Wang\u2019s 400\u2009ml maltodextrose-fructose solution on the morning of the day of surgery.We had a more aggressive analgesia plan in Gr E in the form of flupiritine perioperatively  and bilateral complete scalp blocks along with skin site infiltration . This enabled a stricter postoperative VAS guided pain management plan- paracetamol, tramadol, or NSAIDS up to a VAS of 4 and Inj Fentanyl beyond VAS 4.Unlike Wang et al., we did not emphasize on a difference in the ways of stitching/ craniotomy closure or type of suture used between the two groups. Protocols such as antimicrobial preparation, shaving policies, respiratory interventions, goal-directed therapy, and temperature control were the same between Wang et al. and us.We found a significant reduction in the proportion of patients requiring an ICU stay of >\u200948\u2009h, although there was no significant difference in the total duration of hospital stay. The factors affecting the length of postoperative hospital stay are known to vary widely . Ours isThe ERAS group patients had significantly lower insulin requirements than the controls over 48\u2009h to achieve similar blood glucose targets. Sarin et al. nicely sum the practice points for instituting a protocol for preoperative carbohydrate loading benefits in 2017 . WithoutScalp blocks provide better attenuation of inflammatory and hemodynamic response to craniotomy and better postoperative analgesia than incision site infiltration with local anesthetics . This, aThe strengths of our study are the inexpensive interventions and the pragmatic reproducible endpoints. \u2018Availability\u2019 of family members to care for their patients is common in low, middle-income countries (LMIC) where cultural values and norms encourage family involvement . Many syThe lack of randomization is a definite limitation of our study. In 2017, ERAS protocols were allowed to be randomized in gastrointestinal oncosurgeries by our IEC ; evidencNotwithstanding clear protocols for pain assessment, analgesia administration, blood sugar control, extubation, and discharge from ICU, members of the surgical, anesthesia, and ICU teams had been educated of the purported \u2018benefits\u2019 of ERAS, and bias is possible. All attempts were made to blind the data collector and analyzer, however. The generalizability of our primary results may depend on institute protocols for ICU discharge. We believe that they will be replicable in centers with limited ICU resources  in other parts of the world. The secondary outcomes, based on internationally accepted protocols, should have external validity.In this study, we have adapted the ERAS protocol to a neurosurgical setting, showing its feasibility and benefits in early discharge from the ICU/ HDU and better pain and blood sugar control postoperatively. However, there was no difference in length of stay in the hospital. ERAS protocols are bundles of care and include various interventions, and further studies are needed to standardize these for the patients undergoing craniotomy such that they may be kept pragmatic and easy to implement."}
{"text": "Aspergillus sydowii, a halophilic species, when growing in three different salinity conditions . (3) Results: In this fungus, major physiological modifications occur under high salinity (2.0 M NaCl) and not when cultured under optimal conditions (0.5 M NaCl), suggesting that most of the mechanisms described for halophilic growth are a consequence of saline stress response and not an adaptation to saline conditions. Cell wall modifications occur exclusively at extreme salinity, with an increase in cell wall thickness and lamellar structure, which seem to involve a decrease in chitin content and an augmented content of alfa and beta-glucans. Additionally, three hydrophobin genes were differentially expressed under hypo- or hyperosmotic stress but not when the fungus grows optimally. Regarding compatible solutes, glycerol is the main compound accumulated in salt stress conditions, whereas trehalose is accumulated in the absence of salt. (4) Conclusions: Physiological responses to salinity vary greatly between optimal and high salt concentrations and are not a simple graded effect as the salt concentration increases. Our results highlight the influence of stress in reshaping the response of extremophiles to environmental challenges.(1) Background: Mechanisms of cellular and molecular adaptation of fungi to salinity have been commonly drawn from halotolerant strains and few studies in basidiomycete fungi. These studies have been conducted in settings where cells are subjected to stress, either hypo- or hyperosmotic, which can be a confounding factor in describing physiological mechanisms related to salinity. (2) Methods: We have studied transcriptomic changes in  Aspergillus sydowii is mainly known as a pathogen of corals, which causes tissue lesions and darkening by melanization  aTo describe the morphology of the strain, the fungus was grown at 25 \u00b0C on malt extract agar (MEA), Czapek yeast extract agar (CYA), and creatine-sucrose agar (CREA) for 7 days. Additionally, the strain was grown at 30 and 37 \u00b0C on CYA and 25 \u00b0C on saline CYA (CYAS) with 5% NaCl. Colony diameter, color, texture, production of soluble pigments, and exudates were evaluated in all culture conditions. Conidia and conidiophores were visualized for colonies grown at 25 \u00b0C on MEA.For RNA extraction, the strain was cultivated on a semi-solid fermentation of autoclaved (121 \u00b0C for 15 min) wheat straw. Three plugs of fresh mycelium grown on PDA without NaCl were inoculated onto 3.0 g of wheat straw soaked with thirty milliliters of Voegel\u2019s medium (without NaCl (No NaCl) and with 0.5 M NaCl or 2.0 M NaCl) in 25.0-cm petri dishes and cultured for 7 days at 28 \u00b0C without agitation. For the relative quantification of selected genes by qPCR, an additional group cultured with 1.0 M NaCl in the medium was also considered. The mycelium was collected by adding 15 mL of diethyl-pyrocarbonate (DEPC)-treated water to recover the biomass from the petri dishes and vortexed in sterile conical tubes. This procedure was repeated three times, and the resulting washing liquid was centrifuged to obtain a pellet of cells. Triplicate cultures were obtained for RNA extraction and transcriptome profiling.rpb2), \u03b2-tubulin gene (benA), and calmodulin gene (cam) were used as recommended for classification of Aspergillus species [Genomic DNA was extracted from PDA-grown mycelium using standard phenol:chloroform procedure. Primers for internal transcribed spacer (ITS) rDNA, RNA polymerase II second-largest subunit gene  (http://tree.bio.ed.ac.uk/software/figtree/). Further image improvement was performed in CorelDraw Graphics Suite X8 .First, the sequences of ITS,  species  were retutgroups . Multiplutgroups . Maximumml-sms/) . One thoSamples were ground with liquid nitrogen, and RNA purification was performed by the Tri-Reagent method . Libraries were constructed with the TruSeq Stranded mRNA HT kit , and sequencing was performed by the Mass Sequencing Unit of the Biotechnology Institute  with a NextSeq 500 Sequencer  using 150 cycles of pair-end readings.de novo assembly was performed with Trinity [A. sydowii genome for quality control purposes, which rendered a 90.4% overall similarity and approximately 73% coverage. Functional annotation of transcript sequences was achieved by BLAST against nr NCBI RefSeq and UniProt databases using Trinotate software [http://www.tcdb.org) was used to refine the annotations of transcripts belonging to transporter encoding genes of A. sydowii, and substrate specificity of DE transcripts was predicted using the TrSSP tool (http://bioinfo.noble.org/TrSSP/).Sequence reads were filtered/trimmed by quality using FASTQC/Trimmomatic (cutoff: Q20), and  Trinity . The asssoftware . Pfam, Gsoftware ), were ahttp://www.sanger.ac.uk/science/tools/smalt-0). With this alignment, expression levels were quantified using Samtools [The mapping of reads to the assembled transcriptome was done by SMALT  were filtered, aiming to increase the statistical strength of the prediction of differentially expressed transcripts . As showExpression data were normalized using the RUVseq algorithm  for the https://bioconductor.org/). Pathway enrichment analysis was done using the BlastKOALA tool from KEGG database.Gene ontology enrichment was determined by the over-representation analysis (ORA) method with a Fisher\u2019s statistical test using the topGO package (sarA and cox5) were selected according to a previous standardization for Aspergillus niger [sih1, sih2, sih4, and AsHog1 genes was calculated as described by Pfaffl [For validation of RNA sequencing results, 1 \u00b5g of total RNA isolated as previously described from semi-solid wheat straw fermentation was treated with DNase I  and used for cDNA synthesis with the RevertAid First-Strand Synthesis kit  using oligo (dT) nucleotides. Two-step quantitative PCR (qPCR) reactions were carried out in a rotor-gene apparatus . Each reaction contained 5 \u00b5L of QuantiNova SYBR Green PCR MasterMix and 1 \u00b5L of 1:8 dilution of cDNA as the template . The primers used for qPCR, their final concentration on the assay, and the annealing/extension temperature for each primer pair are listed in us niger . Relativy Pfaffl  using tht-test.Fungal tissues were embedded in agarose gel to facilitate fixation procedures, as described elsewhere . BrieflyA. sydowii, the fungus was cultured for 7 days at 150 rpm and 28 \u00b0C in 250 mL flasks containing 100 mL of Vogel\u2019s medium (without NaCl (No NaCl) and with 0.5 M NaCl or 2.0 M NaCl) supplemented with 2% glucose as the carbon source. The mycelium was collected by filtration through a 40 \u03bcm cell strainer and dried in an oven at 60 \u00b0C. Compatible solute extraction for HPLC analysis  was performed as previously described with minor modifications [g for 10 min for phase separation. The upper methanol:water phase was transferred to a 15 mL falcon tube and stored at \u221220 \u00b0C. The HPLC analysis was performed in an isocratic system with an AMINEX-HPX87H column  at 50 \u00b0C. Fifty microliters of each sample were injected, and 5mM sulfuric acid was used as the mobile phase at a flow rate of 0.8 mL/min. Glycerol and trehalose standards with an initial concentration of 5 mg/mL were used to construct calibration curves. Chromatogram analysis was performed using ChromQuest software version 2.51 .For the determination of glycerol and trehalose in salt-adapted cultures of Sequencing short read data and processed data were deposited to SRA database under accession number GSE139804, BioProject PRJNA587059. All scripts used for the analysis of high-throughput sequencing data are available from the authors upon request.Aspergillus caesiellus by a polyphasic identification based on: (i) molecular markers ; (ii) micromorphological traits of the colonies, such as shape, size, and grouping of conidiophores and hyphae; and (iii) macromorphological aspects, such as exudates and pigmentation. Although none of the listed molecular markers rendered a resolved phylogram, the authors identified the strain as A. caesiellus, primarily based on micromorphology.The strain BMH-0004 was isolated from a sugarcane bagasse fermentation with 2.0 M NaCl and a posterior screening on a solid medium with carboxymethylcellulose at 0.5 M NaCl . This stAspergillus genus, secondary markers are necessary to ascertain species level with higher confidence [benA, cam, and rpb2 phylogenetic markers were also amplified to aid with identification. The reconstructed phylogeny with these markers showed that strain BMH-0004 is closely related to A. sydowii, Aspergillus section Versicolores [A. caesiellus  Thom and Church [Aspergillus identification is in accordance with A. sydowii. Additionally, microscopic parameters, like biseriate aspergilli, spathulate to subclavate vesicles measuring 10\u201320 \u03bcm, and cylindrical short neck phialides, 5\u20137 \u00d7 3 \u03bcm, as well as conspicuously spinose conidia of diameter 3\u20134 \u03bcm, are corresponding. The strain BMH-0004 could grow on solid and in liquid media without NaCl, but its optimal growth was detected when salinity ranged between 0.5 M and 1.0 M NaCl. The maximum tolerated salinity was 2.0 M NaCl when grown on glucose (unpublished data) and complex substrates (carboxymethylcellulose or wheat straw) [The morphology of this strain confirmed the characteristics of d Church . It is mA. sydowii transcriptomes of the fungus growing without NaCl or at 2.0 M NaCl  were more similar to each other than to the transcriptome at the optimum salinity (0.5 M NaCl). This suggests that the expression profile under nonoptimal conditions is driven by stress-related responses, which include a global upregulation of central catabolic and secondary metabolism transcripts and substrate-degrading enzymes  and a methyl-sterol monooxygenase at 0.5 M NaCl (logFC 0.5 M NaCl vs No NaCl = 2.29). The overexpression of the former would imply an increase in unsaturated lipids, while the latter is involved in the ergosterol synthesis pathway. The action of these enzymes possibly increases membrane fluidity, which was observed previously in the extremely halotolerant black yeast Hortaea werneckii and the halotolerant black yeast Aureobasidium pullulans [In nt fungi ,46. Whilullulans .A. sydowii, this structure is extensively modified in salinity conditions -glucans forming a rigid hydrophobic core surrounded by cross-linked \u03b2(1-3)-glucans [Transcriptional changes of genes associated with construction, deconstruction, and remodeling of the fungal cell wall suggest that, in nditions . The cur-glucans ,48,49. CA. fumigatus, eight CHS (chsA\u2013G) genes have been identified, but their specific biological roles are still unclear, as deletion of many of these genes had no observable effect on growth or chitin content in the cell wall [A.sydowii, at least 11 different transcripts encoding eight chitin synthases genes (chs) were identified, but only one of these was strongly downregulated (logFC 2.0 M NaCl vs No NaCl = \u22123.18) when growing in the presence of salt. Nonetheless, the cumulative transcription level of all chs genes did not change significantly, suggesting that chitin synthesis is not affected  and chitotriosidase (chit) transcripts levels were upregulated when the fungus grew in 2.0 M NaCl, which may result in an overall decrease of the chitin and chitosan content in the cell wall.The amount of chitin in cell walls is a function of its synthesis and degradation. Chitin synthases (CHS) are membrane proteins that polymerize intracellular UDP-N-acetyl-glucosamine and extrude the chitin polymer to the cell wall space. In ell wall . In A.syaffected A. AdditiA. fumigatus, chsE and chsG deletion mutants displayed substantial changes in growth, hyphal morphology, conidiation, and chitin content, with a decrease in chitin being counterbalanced by an increase in \u03b1-glucan [A. sydowii suggested that, in response to salinity, the increase in \u03b2-glucans was more pronounced than that of \u03b1-glucans (As shown in )-glucan . Interes-glucans B.A. fumigatus is mainly composed of \u03b2-glucans and \u03b1-glucans. The \u03b2 -glucan is synthesized as a linear polymer by the FKS1 synthase complex, while the extruded chains can be transferred to extend existent \u03b2-glucan or to GPI-anchored proteins that link cell wall polysaccharides to the cell membrane. Four families of GPI-anchored proteins  were found to be common to all fungi [A. sydowii transcriptome, indicating the importance of cross-linkage modifications for maintaining cell wall integrity during osmotic stress, as discussed below.The cell wall of ll fungi ,53. Geneecm33 gene display increased sensitivity to a variety of stress conditions, such as oxidative agents, fungicides, cell wall perturbing agents, and osmotic and ionic imbalances [ecm33 genes in A. sydowii was almost two times greater at 2.0 M NaCl than at the other two tested conditions, which indicates they favor the fungus\u2019 stress tolerance.ECM33 proteins are involved in the correct assembly of the cell wall \u03b2-glucan and the mannoprotein layer . Severalbalances ,56. ECM3crh mutants of Saccharomyces cerevisiae, the chitin fraction is completely devoid of linkages to \u03b2-glucans [crh genes in Candida albicans increases the elasticity of the cell wall, reducing survival during osmotic shock, while overexpression of one crh gene has an osmoprotective effect [A. sydowii, where a CRH homologue gene (crf) was overexpressed at 2.0 M NaCl (logFC 2.0 M NaCl vs No NaCl = 1.23)  B.A. fumigatus, seven gel genes have been identified, of which only three  are expressed during mycelial growth [gel4 is an essential gene [gel2 mutants have reduced growth, and gel1 deletion has no evident effect on morphology [Neurospora crassa, individual deletions of gel genes do not influence stress sensitivity [A. fumigatus. Noticeably, if the function of GEL proteins is abolished\u2014with a triple mutation in N. crassa [gas1 in S. cerevisiae [A. sydowii, the same balancing effect can be observed. At 2.0 M NaCl, chitin content should be lower due to increased chitin degradation, which is compensated by \u03b2-glucan cross-linking as a result of higher GEL expression.Finally, the GEL family of glucanosyltransferases is the most studied among cell wall-associated proteins, and its members are present in a relatively high amounts in fungal cell walls. Their function is to cleave the newly synthesized linear \u03b2-glucan and transfer it to another \u03b2-glucan molecule, resulting in elongation or shortening of the glucan fibers. GEL proteins also regulate the cross-linking of proteins into the cell wall, therefore allowing the correct assembly of cell wall structures . In A. fl growth ,60. In trphology . In Neursitivity , indicat. crassa  or a sinrevisiae \u2014the chitA. sydowii supported this notion, showing that the cells grown in 2.0 M NaCl exhibit significantly thicker cell walls compared to the other two investigated conditions  generate a reduction in cell wall elasticity that allows resistance to external insults. Ultrastructural analysis of nditions C. Furthenditions D.One of the novel halophilic strategies described in fungi is the production of hydrophobins (HFBs), which have been observed in both basidiomycete and ascomycete model fungi when growing in high salinity. HFBs are small extracellular proteins produced exclusively by filamentous fungi, which means that even yeasts do not contain genes for these proteins. HFBs self-assemble at hydrophobic-hydrophilic interfaces and have been associated with the morphogenesis of aerial hyphae and the adhesion of hyphae to hydrophobic surfaces . The abuWallemia ichthyophaga, there are 26 HFB genes, more than twice the number found in related species of the genus. At the low-salinity growth limit of this species (10% NaCl), eight HFB genes are overexpressed, while four are overexpressed at high salt concentrations (30% NaCl) [Individual species of filamentous fungi usually contain between two and seven HFB genes . In the 0% NaCl) . Another0% NaCl) . This su0% NaCl) , but thiAspergillus, the estimated number of HFB per species is between six and 10, with an average of nine [A. sydowii transcriptome, we identified four HFBs (sih1-4), fewer than in some other members of the genus. Of these, only three  were completely represented in the sequenced genome of A. sydowii. In the genomic locus corresponding to the sih4 transcript, there is a truncated version of the gene that codes for a protein product with only four cysteine residues. As this transcript was highly expressed when the fungus was grown without NaCl, we cloned the sih4 coding sequence from cDNA and confirmed that the transcript corresponds to a complete HFB gene (data not shown). This gene might have been lost (or repurposed) during the migration of A. sydowii from the terrestrial to the marine habitat, which has been previously proposed as a mechanism of evolution of HFB genes in the ascomycete family of Hypocreales [Particularly in the genus  of nine . In the ocreales . It alsoocreales .A. sydowii hydrophobins do not have a high proportion of acidic residues, as observed for their orthologues in the halophilic W. ichthyophaga, and their pI values do not distinguish them from their counterparts in nonhalophilic fungi  indicated that only  to zero E. Relatinditions F. On thent years , but thent years , thus prH. werneckii and W. ichthyophaga, glycerol is the most abundant osmolyte, but also, erythritol, arabitol, and mannitol can be found in lesser amounts [A. niger, glycerol and erythritol accumulate in young mycelium, whereas mannitol and erythritol are the signature compatible solutes in old mycelium [A. niger and A. nidulans, trehalose and mannitol have been found [Among the most crucial adaptations to salinity in fungi is an increased concentration of intracellular compatible solutes. For example, in  amounts ,72. Simimycelium ,74. In cen found ,76.A. sydowii BMH-0004 strain, some transcripts associated with the metabolism of osmolytes were differentially regulated in response to osmotic stress. Noteworthy was the expression of genes involved in trehalose synthesis, where \u03b1-trehalose phosphate synthase (TpsA) was expressed under both hypo- and hyperosmotic stress , encoding the rate-limiting enzyme in the pathway of glycerol synthesis. At the same time, the transcription of the genes encoding the STL1 glycerol:H+ transporters, which facilitate the import of glycerol into the cells, also increased at 2.0 M NaCl. Glycerol was accumulated only at 2.0 M NaCl and not at the optimal salinity for growth  of the glycerol-3-phosphate dehydrogenase gene . The activation of the HOG pathway induces the accumulation of glycerol, arrest of the cell cycle, and reorganization in the actin cytoskeleton, as well as changes in cell wall dynamics ,81. In tic shock F.+) [A. sydowii and A. versicolor, and the halotolerant relatives A. nidulans, A. niger, and A. fumigatus ; MFS members (Pfam 07690 and 00083); and cation/transporter ATPase exchangers  showed striking differences  revealed a higher number of genes encoding APC members, which could have a role in ensuring a rapid uptake of certain amino acids under hypersaline conditions. Osmoregulation at increased salinity in prokaryotes often involves accumulation of amino acids, such as proline and betaines, which could be also the case in halophile fungi growing in rich substrates. The contribution of the APC transporters to halotolerance remains underexplored in filamentous fungi.Although not universally, some fungal halophilic strains have a higher number of transport systems\u2014when compared with mesophilic relatives \u2013 to regulate the homeostasis of alkali cation levels, as well as the fluxes across the plasma membrane, to eliminate toxic ions such as sodium (Na+) ,82,83. Fumigatus . The halferences . The genA. sydowii was grown at 0.5 M NaCl but not at 2.0 M NaCl , but their expression level mean across all conditions was 1.36 tpm.Gene expression analysis showed an enrichment of transport-related genes when 0 M NaCl . In totalinities . One posena2 gene (ATN2), a sodium P-type ATPase commonly associated with salinity adaptations in the yeast Saccharomyces cerevisiae and other fungi, was downregulated at 0.5 M NaCl when compared to the conditions without salt or 2.0 M NaCl. This gene was found differentially expressed in W. ichthyophaga and H. werneckii under high salinity conditions [A. sydowii, the expression of ena2 is regulated by stress signals rather than high concentrations of salt. ENA P-type ATPase family in fungi are functionally different from animal Na+, K+- ATPases, as they have lower selectivity to cations  [+ concentrations, the ENA P-type ATPase pumps out K+ to maintain the Na+/K+ ratio, whereas the opposite occurs in hypersalinity conditions. Supporting this notion, the K+/H+ antiporter kha1 gene, which presumably extrudes K+ from the cell or into intracellular vesicles [atc3 and atc9 genes are other putative P-type ATPases with the same expression profile as the ena2 gene in A. sydowii, suggesting that the fungus actively transport cations under nonoptimal conditions to maintain the Na+/K+ ratio.The nditions . Our rescations) . In condvesicles ,86, was A. sydowii in three different osmotic conditions, we learned that physiological responses to salinity vary greatly and are not a simple graded effect as the salt concentration of the medium is increased. In fact, in each condition assayed, the responses could be assumed as a distinct physiological state  (sih1 and sih2).By comparing the transcriptomic profiles of al state . When gre (sih4) . Stress A. sydowii, these are not taking place concurrently. The adaptations to ensure osmotic balance and avoid ion toxicity when the fungus grows under optimal salinity conditions are not completely understood, as they do not coincide with the halophile adaptations described in the literature. Further experiments should be conducted to identify and understand these adaptations and the effects of different stress signals on modulating the response. Our results indicate that the interpretation of physiological reactions in extremophiles or extremotolerant microorganisms should be addressed differently, as stress can reshape the physiological outcome. In this sense, the strain A. sydowii BMH-0004 was a useful model to observe these transitions.While most of the mechanisms of adaptation to salinity described to date in eukaryotes are also occurring in"}
{"text": "These reactions are site-selective, yielding, respectively, 17,18- or 12,13-dihydroporpholactones. The crystal and molecular features of pyrrolidine-fused and isoxazolidine-fused dihydroporpholactones were unveiled from single-crystal X-ray diffraction studies.The reaction of  Pyrrole-modified porphyrins have attracted considerable attention in recent years. This group of compounds comprises a large diversity of porphyrin analogues where one or more pyrrolic units of the porphyrin macrocycle are replaced by non-pyrrolic units. The synthesis, reactivity, structural features, optical properties, and applications of these compounds have been comprehensively reviewed ,3,4,5,6.meso-tetraarylporphyrins in a two-step procedure  ), 7.32 , 7.59 , 7.77 . 13C NMR : \u03b4 40.9, 47.6, 48.8, 62.0, 62.2, 83.2, 95.7, 109.3, 110.2, 110.6, 112.5, 113.7, 114.1, 122.0, 123.3, 134.7, 135.6, 135.9, 137.0, 138.5, 139.0, 141.2, 143.2, 144.1, 144.8, 145.4, 146.1, 146.6, 147.3, 151.2, 154.1, 157.6, 159.1, 162.2, 164.6. 19F NMR : \u03b4 \u2212158.0 to \u2212155.9 , \u2212148.3 to \u2212147.2 , \u2212135.6 to \u2212132.0 . UV-Vis (CHCl3): \u03bbmax (log \u03b5) 382 (5.23), 531 (4.38), 572 (4.60), 617 (3.93). MS (ESI): m/z 1050.5 [M + H]+.Adduct 3b: , 1H NMR : \u03b4 2.53\u20132.60 , 2.84 , 3.46 , 3.58 , 4.45\u20134.63 ]), 7.06\u20137.09 , 7.15\u20137.18 , 7.28\u20137.30 , 7.59 , 7.77 . 13C NMR : \u03b4 47.0, 48.2, 59.1, 59.7, 59.9, 83.1, 95.7, 109.4, 110.2, 110.5, 112.5, 114.0, 122.0, 123.2, 125.3, 127.7, 128.2, 128.4, 128.8, 129.05, 129.11, 134.8, 135.6, 135.8, 136.8, 138.8, 141.0, 143.2, 144.0, 144.5, 145.2, 146.0, 146.4, 146.8, 147.3, 151.3, 154.1, 157.6, 159.1, 162.3, 164.6. 19F NMR : \u03b4 \u2212158.0 to \u2212155.9 , \u2212148.3 to \u2212147.3 , \u2212135.7 to \u2212131.8 . UV-Vis (CHCl3): \u03bbmax (log \u03b5) 382 (5.21), 532 (4.34), 572 (4.59), 629 (3.56). MS (ESI): m/z 1126.1 [M + H]+.Adduct 1  in toluene (5 mL), N-substituted hydroxylamine hydrochloride (0.20 mmol), paraformaldehyde , and K2CO3  were added. The mixture was heated at 60 \u00b0C under a nitrogen atmosphere for 12 h, and then additional portions of N-substituted hydroxylamine hydrochloride, paraformaldehyde, and K2CO3 were added to the reaction mixture, which was heated for a total of 30 h. The reaction mixture was washed with H2O and then was purified by preparative TLC using dichloromethane/hexane (1:1) as the eluent. The fraction with higher Rf corresponded to unreacted porpholactone (~60%), the following one was the major cycloadduct, and the third one the minor cycloadduct. Isolated yields: 6a = 19% (48% yield based on consumed porpholactone 1), 7a = 8% (19% yield based on consumed porpholactone 1); 6b = 22% (43% yield based on consumed porpholactone 1), 7b = 9% (18% yield based on consumed porpholactone 1).To a solution of porpholactone 6a: 1H NMR : \u03b4 \u22121.53 , \u22121.19 , 2.57 , 2.86\u20132.95 , 3.35\u20133.43 , 5.14\u20135.19 ]), 6.65 ]), 8.19 , 8.48\u20138.52 , 8.64 . 13C NMR : \u03b4 44.0, 55.4, 64.0, 85.0, 89.7, 98.7, 102.3; 105.5, 105.8, 110.7, 111.4, 114.5; 122.9, 125.3, 126.8, 127.9, 128.1, 128.2, 128.3, 134.7, 137.5, 138.2, 138.9, 140.9, 141.6, 143.5, 145.1, 147.1, 148.9, 152.6, 162.9, 165.8. 19F NMR : \u03b4 \u2212158.2 to \u2212155.7 , \u2212148.3 to \u2212146.7 , \u2212136.0 to \u2212131.1 . UV-vis (CHCl3): \u03bbmax (log \u03b5) 404 (5.30), 497 (4.07), 530 (3.86), 625 (3.75), 684 (4.61). MS (ESI): m/z 1052.5 [M + H]+.Adduct 7a: 1H NMR : \u03b4 \u22121.67 , \u22121.36 , 2.57 , 2.90\u20132.95 , 3.39\u20133.44 , 5.21\u20135.23 ]), 6.66 ]), 8.33 , 8.40 , 8.56 , 8.66 . 19F NMR : \u03b4 \u2212158.4 to \u2212155.6 , \u2212148.7 to \u2212146.1 , \u2212136.3 to \u2212131.2 . UV-vis (CHCl3): \u03bbmax (log \u03b5) 404 (5.44), 496 (4.20), 530 (3.97), 625 (3.90), 684 (4.83). MS (ESI): m/z 1052.2 [M + H]+.Adduct 6b: 1H NMR : \u03b4 \u22121.68 , \u22121.31 , 3.25 , 3.81 , 5.24\u20135.25 , 6.65 ]), 7.00\u20137.02 , 7.19\u20137.22 , 8.22 , 8.46 , 8.55 , 8.66 . 13C NMR : \u03b4 44.0, 53.9, 64.6, 86.1, 89.3, 99.6, 101.0, 105.8, 110.7, 112.7, 113.7, 115.3, 122.3, 125.4, 127.3, 128.3, 136.8, 137.5, 138.9, 139.3, 139.4, 141.2, 141.6, 143.3, 143.7, 144.8, 145.2, 146.9, 152.9, 163.0, 165.8. 19F NMR : \u03b4 \u2212158.2 to \u2212155.8 , \u2212148.2 to \u2212146.7 , \u2212135.7 to \u2212130.1 . UV-vis (CHCl3): \u03bbmax (log \u03b5) 404 (5.92), 496 (4.66), 529 (4.46), 623 (4.35), 646 (4.33), 682 (5.24). MS (ESI): m/z 1128.4 [M + H]+.Adduct 7b: 1H NMR : \u03b4 \u22121.73 , \u22121.43 , 3.31 , 3.85 , 5.33\u20135.37 , 6.67 ]), 7.02\u20137.06 , 7.19\u20137.23 , 8.30 , 8.42 , 8.57 , 8.68 . 19F NMR : \u03b4 \u2212158.3 to 155.5 , \u2212148.3 to \u2212146.1 , \u2212136.3 to \u2212130.0 . UV-vis (CHCl3): \u03bbmax (log \u03b5) 404 (5.57), 497 (4.30), 529 (4.06), 626 (3.97), 643 (4.05), 684 (4.87). MS (ESI): m/z 1128.3 [M + H]+.Adduct www.ccdc.cam.ac.uk/data_request/cif, by emailing data_request@ccdc.cam.ac.uk, or by contacting The Cambridge Crystallographic Data Centre, 12 Union Road, Cambridge CB2 1EZ, UK; fax: +44 1223 336033.CCDC 1832879, 1832880, and 1985131 contain the supplementary crystallographic data for this paper. These data can be obtained free of charge via"}
{"text": "In Ghana, home delivery among women in urban areas is relatively low compared to rural areas. However, the few women who deliver at home in urban areas still face enormous risk of infections and death, just like those in rural areas. The present study investigated the factors associated with home delivery among women who live in urban areas in Ghana.Data for this study was obtained from the 2014 Ghana Demographic and Health Survey. We used data of 1,441 women who gave birth in the 5 years preceding the survey and were dwelling in urban areas. By the use of Stata version 14.2, we conducted both descriptive and multivariable logistic regression analyses.We found that 7.9% of women in urban areas in Ghana delivered at home. The study revealed that, compared to women who lived in the Northern region, women who lived in the Brong Ahafo region  were less likely to deliver at home. The likelihood of home delivery was high among women in the poorest wealth quintile , women who professed other religions , and those who had no antenatal care visits . Conversely, the likelihood of home delivery was lower among women who had attained secondary/higher education , compared to those with no formal education.The study identified region of residence, wealth quintile, religion, antenatal care visits, and level of education as factors associated with home delivery among urban residents in Ghana. Therefore, health promotion programs targeted at home delivery need to focus on these factors. We also recommend that a qualitative study should be conducted to investigate the factors responsible for the differences in home delivery in terms of region, as the present study could not do so. Reducing maternal mortality has been one of the greatest public health concerns. In line with this, the United Nations instituted the Millennium Development Goals (MDGs) in 2000 with Goal 5 aimed at reducing maternal mortality by 75% by the year 2015 . In 2015In low- and middle-income countries (LMICs), several significant efforts have been made to reduce maternal deaths through enhanced maternal healthcare services utilization globally \u201310. HoweA larger percentage of maternal mortalities in Ghana is caused by pregnancy-related issues such as obstetric complications, which result in death during pregnancy, childbirth, or within 42 days after delivery . This imOver the years, the government of Ghana has attempted to improve access to maternal healthcare services. In 2003, the government, for example, introduced the waiver of delivery fees, and by 2005, fees on delivery care were abolished in all the then 10 regions of the country . This waIt is, therefore, important to understand the factors associated with home delivery among urban women in Ghana and provide useful information for interventions aimed at reducing maternal mortality in the country. In Ghana, a few studies have been conducted in this regard. Studies by Ganle et al.  and BoahThe study setting is the Republic of Ghana. The Republic of Ghana is one of the countries in West Africa and has a total land area of 238,533 square kilometres ?\u201d In the GDHS, responses to this question were home, other home, government hospital, government health centre/clinic, government health post/ Community-based Health Planning and Services (CHPS), other public, private hospital/clinic, maternity homes, and others. These responses were dichotomised into health facility delivery = 0 and home delivery = 1. Home delivery referred to deliveries that occurred in respondent\u2019s home and other home. On the other hand, deliveries that occurred at government hospital, government health centre/clinic, government health post/CHPS, other public, private hospital/clinic, maternity homes, and other health facilities were grouped as \u201chealth facility delivery.\u201dThe study considered twelve explanatory variables. These are age, region, religion, ethnicity, educational level, marital status, wealth status, employment, parity, sex of household head, ANC visits, and decision-making for healthcare. These variables were not determined a priori; instead, they were determined based on parsimony, theoretical relevance, and practical significance with place of delivery \u201337. The ). The results were presented as adjusted odds ratios, with their corresponding 95% confidence intervals signifying their level of precision. Statistical significance was declared at p<0.05. Sample weight was applied and the survey command (svy) was used to account for the complex sampling design of the survey. We wrote the manuscript following the \u201cStrengthening the Reporting of Observational Studies in Epidemiology\u201d (STROBE) statement.The statistical software Stata version 14.0 was used to process the data. Both bivariate and multivariate analyses were employed in this study and results were tested at 95% confidence interval. Bivariate analysis was conducted to show the proportion of home deliveries across socio-demographic characteristics with their significance levels and chi-square values (\u03c72). Multivariable analysis (binary logistic regression) was further conducted. Only the variables that showed statistical significance in the bivariate analysis were included in the regression analysis. Before the binary logistic regression analysis, we conducted a multicollinearity test of all the statistically significant variables using the variance inflation factor (VIF), and it showed no evidence of collinearity among the explanatory variables . You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsIf applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:\u00a0We look forward to receiving your revised manuscript.Kind regards,Frank T. SpradleyAcademic EditorPLOS ONEJournal requirements:When submitting your revision, we need you to address these additional requirements.1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found athttps://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf andhttps://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf2. We suggest you thoroughly copyedit your manuscript for language usage, spelling, and grammar. If you do not know anyone who can help you do this, you may wish to consider employing a professional scientific editing service. \u00a0http://learn.aje.com/plos/) for a 15% discount off AJE services. To take advantage of our partnership with Editage, visit the Editage website (www.editage.com) and enter referral code PLOSEDIT for a 15% discount off Editage services.\u00a0 If the PLOS editorial team finds any language issues in text that either AJE or Editage has edited, the service provider will re-edit the text for free.Whilst you may use any professional scientific editing service of your choice, PLOS has partnered with both American Journal Experts (AJE) and Editage to provide discounted services to PLOS authors. Both organizations have experience helping authors meet PLOS guidelines and can provide language editing, translation, manuscript formatting, and figure formatting to ensure your manuscript meets our submission guidelines. To take advantage of our partnership with AJE, visit the AJE website A clean copy of the edited manuscript (uploaded as the new *manuscript* file)3. We noticed you have some minor occurrence of overlapping text with the following previous publication, which needs to be addressed:https://journals.plos.org/plosone/article/file?id=10.1371%2Fjournal.pone.0220970&type=printable- In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the methods section. Further consideration is dependent on these concerns being addressed.Reviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********2. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********3. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********4. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0NoReviewer #3:\u00a0Yes**********5. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0Background information, the following are missing1. Clear definition of home birth is missing2. What is situation in Ghana, does home birth = unskilled assistance3. How does this study define unskilled birth assistance?4. It must come clearly why urban? The expectation is urban home birth may invite skilled attendant as compared to rural? 5. Are there traditional birth attendants in urban?The paper is about predictors of home birth but authors have to say something on the proportion of home birth vs health facility birth.Reviewer #2:\u00a0Review report ( Dr. Habtamu Tolera)The manuscript reports the findings regarding \u201cWhat influences home delivery among women who live in urban areas in Ghana? Analysis of 2014 Ghana Demographic and Health Survey data (PONE-D-20-23864). This kind of study is much relevant in context of LMICs like Ghana. The sample size is adequate and the analyses is really very rigorous and well done. I have found that authors strongly need to rework on the background and methodology sections. They also need to avoid long sentences used across the manuscript. Here below in my report I have tried to review some points or concerns that need authors to further rework on them to improve the power of this manuscript to get published in PLoS One Journal. Authors can also refer to the attached pdf file.Affiliation:Corresponding author's E-mail address is enough. So, remove others\u2019 email addresses from the front page of the manuscriptBackground:\u2022 I have found the sentences in the first paragraph of the \u201cBackground\u201d section of this study  were too long and lacks clarity. Thus, I advise authors: (1) avoiding long sentences from this section and elsewhere across the manuscript, (2) clarify all so that they convey the correct information for potential readers of the manuscript.\u2022 See Page # 3, line 97. If this is so, why do the author(s) interested to urban Ghana than rural Ghana in this study? authors need to give justifications for selection criteria.\u2022 See also sentences on page 3, lines 103 through 110. They were not clearly stated for potential international readers, all have been needed to be rewritten.\u2022 Page 3, Lines 110-112 said like this, \u201cHowever, these studies focused more on rural areas, ignoring the fact that a considerable number of women in urban areas still use home delivery service\u201d This needs authors to acknowledge (cite) supporting evidences to say so. So that they may convince the readers.\u2022 Finally, your \u201cBackground\u201d section needs more detail. I suggest that authors improve the description at \"Background\" section to provide more justification for their study . I also recommend authors to read and review adequate empirical works on home delivery elsewhere in LMICs to enrich also their \"Background\" section. Why did you stick to works done in Ghana alone? They need to read vast works beyond urban Ghana and describe the contexts, background pictures  of the topic; empirical/theoretical/methodological gaps observed with regard to the issue/the problem under study as well. Authors again need to state the benefits of this research findings (for program/policy interventions) in the last sentence of the \"background\" section or somewhere in this section.Methods and materials\u2022 I understand that authors analyzed GDHS or survey data collected by government. However, I have found that important methodological subsections/elements or components were missing in this study. So, authors need to add \"Study setting\", \"study design\", \"Sampling procedure/sample size determination\", \"Data collection/quality assurance\", \"Data processing procedures and analyses\". They need to customize these methodologies from GDHS \"survey they used for this study. These are mandatory to be included under the methodological sections to be published in PLoS ONE.\u2022 On Page 3, lines 119 through 121 Under \u201cData Source\u201d section, it was stated/listed like this, \u201cThe survey targets core maternal and child health indicators such as unintended pregnancy, contraceptive use, skilled birth attendance, immunization among under-fives, and intimate partner violence\u201d. Did these variables were captured/considered in the report/ analyses of this study? I have not they found them. If not relevant, please remove it If were not well addressed or if they were inserted by mistake.\u2022 Line 133, better if you label it like this, \"Variables studied\" or \u201cMeasurements\u201d\u2022 Sentences from Lines 135 through 140, is not clear. The current phrasing makes comprehension difficult. so, have been rewritten.\u2022 A sentence from Lines 135-38, were put like this, \u201cThe outcome variable employed for this study was \u201chome delivery\u201d which was obtained from the 136 question, \u201cWhere did you deliver?\u201d Responses to this question were coded respondent\u2019s home, other home, government hospital, government health centre/clinic, government health post/CHPS, other public, private hospital/clinic, maternity homes, and others\u201d. My concern is that, under which category did authors assign or grouping \"maternity home\u201d in this coding of categories of the outcome variable, delivery choice status of study subjects. They need to recheck the codingResults:\u2022 Authors need to insert a new column in Tables 1 and 2 to report the frequency and the proportion of both home delivery and Non-home delivery statuses of women. Readers need to get these two values together AOR, CI, P-values, etc.\u2022 Finally, some texts and paragraphs need editorial problems and authors need to rewrite with clear and plain languageReviewer #3:\u00a0This is an informative piece of work.However, it would do better with inclusion of recent studies on home delivery in the introduction and or discussion to make it stronger.Summarize all the key findings at the beginning of the discussion to get the reader a better perspective vs the discussion of results separately in fragmented styleThe conclusion can still be strengthened, made more clearer and indicative.Take care of references to ensure consistency, providing key links for critical documents and when these were accessed.**********what does this mean?). If published, this will include your full peer review and any attached files.6. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0AttachmentFinal HOME DELIVERY_Vancouver copy.docxSubmitted filename: Click here for additional data file.AttachmentGahan paper PONE-D-20-23864_reviewer.pdfSubmitted filename: Click here for additional data file. 16 Nov 2020AUTHOR\u2019S RESPONSE TO REVIEWSTitle: What influences home delivery among women who live in urban areas in Ghana? Analysis of 2014 Ghana Demographic and Health Survey dataDate: 16/11/2020AUTHOR\u2019S RESPONSE TO REVIEWSDear Editor and Reviewers,We are pleased to resubmit for publication the revised version of \u201cWhat influences home delivery among women who live in urban areas in Ghana? Analysis of 2014 Ghana Demographic and Health Survey data\u201d. Thank you for giving us the opportunity to revise and resubmit this manuscript. We appreciate the time and constructive feedback provided by the reviewers and the Editor. We have added an additional author Anita Gracious Archer based on her valuable inputs during the revision process. The manuscript has certainly benefited from these insightful suggestions. Overall, the revision process is very productive. We have made every attempt to fully address all the comments in the revised manuscript. period. Based on the comments, we have responded specifically to each suggestion below. RESPONSE TO REVIEWS Reviewer #1: Background information, the following are missing1. Clear definition of home birth is missing2. What is situation in Ghana, does home birth = unskilled assistance3. How does this study define unskilled birth assistance?4. It must come clearly why urban? The expectation is urban home birth may invite skilled attendant as compared to rural? 5. Are there traditional birth attendants in urban?Response: The background has been revised to incorporate all these suggestions (Line 99-104).The paper is about predictors of home birth but authors have to say something on the proportion of home birth vs health facility birth. Response: We have mentioned that \u201cWe found that 7.9% of women in urbans areas in Ghana delivered at home\u201d (Line 55).Reviewer #2: Review report ( Dr. Habtamu Tolera)The manuscript reports the findings regarding \u201cWhat influences home delivery among women who live in urban areas in Ghana? Analysis of 2014 Ghana Demographic and Health Survey data (PONE-D-20-23864). This kind of study is much relevant in context of LMICs like Ghana. The sample size is adequate and the analyses is really very rigorous and well done. I have found that authors strongly need to rework on the background and methodology sections. They also need to avoid long sentences used across the manuscript. Here below in my report I have tried to review some points or concerns that need authors to further rework on them to improve the power of this manuscript to get published in PLoS One Journal. Authors can also refer to the attached pdf file.Response: Thank you for your useful comments. We have considered all of them in the revised manuscript. Affiliation:Corresponding author's E-mail address is enough. So, remove others\u2019 email addresses from the front page of the manuscriptResponse: We have taken out the E-mail addresses of the co-authors and left only that of the corresponding author. Background:\u2022 I have found the sentences in the first paragraph of the \u201cBackground\u201d section of this study  were too long and lacks clarity. Thus, I advise authors: (1) avoiding long sentences from this section and elsewhere across the manuscript, (2) clarify all so that they convey the correct information for potential readers of the manuscript.Response: We have clarified the information provided in that paragraph (Line 73-84)\u2022 See Page # 3, line 97. If this is so, why do the author(s) interested to urban Ghana than rural Ghana in this study? authors need to give justifications for selection criteria.Response: We have revised the background and provided justification for conducting the study using urban women. A recent study and a number of previous studies have focused on rural Ghana despite urban women who deliver at home still going through the same risk of infections and deaths as their rural counterparts (Line 113-120).\u2022 See also sentences on page 3, lines 103 through 110. They were not clearly stated for potential international readers, all have been needed to be rewritten.Response: We have revised those sentences (Line 121-130).\u2022 Page 3, Lines 110-112 said like this, \u201cHowever, these studies focused more on rural areas, ignoring the fact that a considerable number of women in urban areas still use home delivery service\u201d This needs authors to acknowledge (cite) supporting evidences to say so. So that they may convince the readers.Response: We have cited sources for the information (Line 130)\u2022 Finally, your \u201cBackground\u201d section needs more detail. I suggest that authors improve the description at \"Background\" section to provide more justification for their study . I also recommend authors to read and review adequate empirical works on home delivery elsewhere in LMICs to enrich also their \"Background\" section. Why did you stick to works done in Ghana alone? They need to read vast works beyond urban Ghana and describe the contexts, background pictures  of the topic; empirical/theoretical/methodological gaps observed with regard to the issue/the problem under study as well. Authors again need to state the benefits of this research findings (for program/policy interventions) in the last sentence of the \"background\" section or somewhere in this section.Response: We have revised the background section to incorporate all these useful suggestions Methods and materials\u2022 I understand that authors analyzed GDHS or survey data collected by government. However, I have found that important methodological subsections/elements or components were missing in this study. So, authors need to add \"Study setting\", \"study design\", \"Sampling procedure/sample size determination\", \"Data collection/quality assurance\", \"Data processing procedures and analyses\". They need to customize these methodologies from GDHS \"survey they used for this study. These are mandatory to be included under the methodological sections to be published in PLoS ONE.Response: We have considered these useful suggestions under \u201cMaterials and methods\u201d.\u2022 On Page 3, lines 119 through 121 Under \u201cData Source\u201d section, it was stated/listed like this, \u201cThe survey targets core maternal and child health indicators such as unintended pregnancy, contraceptive use, skilled birth attendance, immunization among under-fives, and intimate partner violence\u201d. Did these variables were captured/considered in the report/ analyses of this study? I have not they found them. If not relevant, please remove it If were not well addressed or if they were inserted by mistake.Response: We have removed these from the paper (Line 160-163). \u2022 Line 133, better if you label it like this, \"Variables studied\" or \u201cMeasurements\u201dResponse: We have now used variables studied (Line 194).\u2022 Sentences from Lines 135 through 140, is not clear. The current phrasing makes comprehension difficult. so, have been rewritten.Response: We have made the paragraph very clear (Line 196-204). \u2022 A sentence from Lines 135-38, were put like this, \u201cThe outcome variable employed for this study was \u201chome delivery\u201d which was obtained from the 136 question, \u201cWhere did you deliver?\u201d Responses to this question were coded respondent\u2019s home, other home, government hospital, government health centre/clinic, government health post/CHPS, other public, private hospital/clinic, maternity homes, and others\u201d. My concern is that, under which category did authors assign or grouping \"maternity home\u201d in this coding of categories of the outcome variable, delivery choice status of study subjects. They need to recheck the codingResponse: In line with the definition of home delivery and health facility delivery in the DHS and in previous studies, \u2018maternity home\u2019 is considered part of health facility delivery in this study. Results:\u2022 Authors need to insert a new column in Tables 1 and 2 to report the frequency and the proportion of both home delivery and Non-home delivery statuses of women. Readers need to get these two values together AOR, CI, P-values, etc.Response: Per our understanding of your suggestion, we have inserted a column in Table 1 to report on the frequency and proportion of home delivery and health facility delivery. We are unsure if you also suggested we insert a column in Table 2 to report AOR, CI and P-values for health facility delivery as this is not appropriate since the outcome of interest in this study was \u201chome delivery\u201d and the AOR, CI and P-values produced in the regression analysis are only for the outcome of interest and not for both \u201chome delivery\u201d and \u201chealth facility delivery\u201d. \u2022 Finally, some texts and paragraphs need editorial problems and authors need to rewrite with clear and plain languageResponse: We have addressed all these issues. Reviewer #3: This is an informative piece of work.However, it would do better with inclusion of recent studies on home delivery in the introduction and or discussion to make it stronger.Summarize all the key findings at the beginning of the discussion to get the reader a better perspective vs the discussion of results separately in fragmented styleThe conclusion can still be strengthened, made more clearer and indicative.Take care of references to ensure consistency, providing key links for critical documents and when these were accessed.Response: Thanks for your useful comments suggestions. All these issues have been considered in the revised paper  10 Dec 2020PONE-D-20-23864R1What influences home delivery among women who live in urban areas in Ghana? Analysis of 2014 Ghana Demographic and Health Survey dataPLOS ONEDear Dr. Budu,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Carefully proof your manuscript to correct grammar or spelling errors.plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.Please submit your revised manuscript by Jan 24 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocolsIf applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see:\u00a0We look forward to receiving your revised manuscript.Kind regards,Frank T. SpradleyAcademic EditorPLOS ONEReviewers' comments:Reviewer's Responses to QuestionsComments to the Author1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the \u201cComments to the Author\u201d section, enter your conflict of interest statement in the \u201cConfidential to Editor\u201d section, and submit your \"Accept\" recommendation.Reviewer #1:\u00a0All comments have been addressedReviewer #2:\u00a0All comments have been addressedReviewer #3:\u00a0All comments have been addressed**********2. Is the manuscript technically sound, and do the data support the conclusions?The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented. Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********3. Has the statistical analysis been performed appropriately and rigorously? Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********4. Have the authors made all data underlying the findings in their manuscript fully available?PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data\u2014e.g. participant privacy or use of data from a third party\u2014those must be specified.The Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********5. Is the manuscript presented in an intelligible fashion and written in standard English?PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.Reviewer #1:\u00a0YesReviewer #2:\u00a0YesReviewer #3:\u00a0Yes**********6. Review Comments to the AuthorPlease use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. Reviewer #1:\u00a0Authors have addressed the raised comments as required,Minor revisions on the abstract and some typographical errorsReviewer #2:\u00a0I hope authors did all best. I appreciate your commitments. I have any concerns. I have finished in my side.Reviewer #3:\u00a0All concerns have been duly addressed. Information and narrative provided is sufficient. The data provided supports the conclusion provided.**********what does this mean?). If published, this will include your full peer review and any attached files.7. PLOS authors have the option to publish the peer review history of their article  digital diagnostic tool,\u00a0 14 Dec 2020AUTHORS\u2019 RESPONSE TO EDITOR\u2019S COMMENTSTitle: What influences home delivery among women who live in urban areas in Ghana? Analysis of 2014 Ghana Demographic and Health Survey dataDear Editor,Thank you for your email dated 10 December 2020 enclosing the Editor\u2019s comments. We convey our gratitude to you for the comment that has led to the massive improvement of our paper entitled \u201cWhat influences home delivery among women who live in urban areas in Ghana? Analysis of 2014 Ghana Demographic and Health Survey data\u201d. We have now proofread the paper to correct grammar and spelling errors. All the changes are in tack changes in the revised manuscript. We believe the manuscript has improved substantively and will be published in your reputable journal. Version 2: PONE-D-20-23864R2Date: 11/12/2020Editor\u2019s commentDear Dr. Budu,Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE\u2019s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.Carefully proof your manuscript to correct grammar or spelling errors.Response: We have now proofread the paper to correct grammar and spelling errors Thank youSincerelyEugene BuduAttachmentResponse to Editors comments.docxSubmitted filename: Click here for additional data file. 17 Dec 2020What influences home delivery among women who live in urban areas in Ghana? Analysis of 2014 Ghana Demographic and Health Survey dataPONE-D-20-23864R2Dear Dr. Budu,We\u2019re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.Within one week, you\u2019ll receive an e-mail detailing the required amendments. When these have been addressed, you\u2019ll receive a formal acceptance letter and your manuscript will be scheduled for publication.http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at onepress@plos.org.If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they\u2019ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact Kind regards,Frank T. SpradleyAcademic EditorPLOS ONE 23 Dec 2020PONE-D-20-23864R2 What influences home delivery among women who live in urban areas? Analysis of 2014 Ghana Demographic and Health Survey data Dear Dr. Budu:I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department. onepress@plos.org.If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact plosone@plos.org. If we can help with anything else, please email us at Thank you for submitting your work to PLOS ONE and supporting open access. Kind regards, PLOS ONE Editorial Office Staffon behalf ofDr. Frank T. Spradley Academic EditorPLOS ONE"}
{"text": "Staphylococcus aureus is an important human pathogen that has acquired several mechanisms to evade antibiotic treatment. In addition, S. aureus is able to invade and persist within human cells, hiding from the immune response and antibiotic therapies. For these reasons, novel antibacterial strategies against these pathogens are needed. Here, we developed lytic enzymes which are able to effectively target drug-resistant and intracellular S. aureus. Fusion of these so-called enzybiotics to cell-penetrating peptides enhanced their uptake and intracellular bactericidal activity in cell culture and in an abscess mouse model. Our results suggest that cell-penetrating enzybiotics are a promising new class of therapeutics against staphylococcal infections.The increasing prevalence of antibiotic-resistant bacteria is one of the most urgent problems of our time.  Staphylococcus aureus is a major concern in human health care, mostly due to the increasing prevalence of antibiotic resistance. Intracellular localization of S. aureus plays a key role in recurrent infections by protecting the pathogens from antibiotics and immune responses. Peptidoglycan hydrolases (PGHs) are highly specific bactericidal enzymes active against both drug-sensitive and -resistant bacteria. However, PGHs able to effectively target intracellular S. aureus are not yet available. To overcome this limitation, we first screened 322 recombineered PGHs for staphylolytic activity under conditions found inside eukaryotic intracellular compartments. The most active constructs were modified by fusion to different cell-penetrating peptides (CPPs), resulting in increased uptake and enhanced intracellular killing (reduction by up to 4.5 log units) of various S. aureus strains (including methicillin-resistant S. aureus [MRSA]) in different tissue culture infection models. The combined application of synergistic PGH-CPP constructs further enhanced their intracellular efficacy. Finally, synergistically active PGH-CPP cocktails reduced the total S. aureus by more than 2.2 log units in a murine abscess model after peripheral injection. Significantly more intracellular bacteria were killed by the PGH-CPPs than by the PGHs alone. Collectively, our findings show that CPP-fused PGHs are effective novel protein therapeutics against both intracellular and drug-resistant S. aureus. Staphylococcus aureus is a Gram-positive, opportunistic pathogen which colonizes 30% to 50% of the human population  was a leading cause of health care-associated infections in the United States, with 323,700 estimated cases in hospitalized patients and 10,600 MRSA-related deaths  , which recognizes and binds the PG (Peptidoglycan hydrolases (PGHs) may represent such an alternative antibacterial agent . These e. aureus . It conss the PG . Endolyss the PG . Their ms the PG .d-alanine-glycine peptide bond, followed by a centrally located amidase domain, which cleaves the N-acetylmuramoyl-l-alanine amide bond within the PG , cytosolic (intracellular buffer), and lysosomal  conditions. This initial screening yielded a selection of 36 PGH constructs (approximately 11% of the entire library) that exceeded a relative activity score of 0.6, displaying robust staphylolytic activity throughout the tested conditions ; SEP, phage SEP1 endolysin; f11, phage phi11 endolysin; GH15, phage GH15 endolysin; LysH5, phage H5 endolysin; ALE1, bacteriocin ALE1; LST, lysostaphin; Xa, factor Xa protease cleavage site; TEV, tobacco etch virus cleavage site; PTD, protein transduction domain; H, His tag. Download FIG\u00a0S1, PDF file, 0.2 MB.Relative activity scores of the 36 most potent staphylolytic PGHs identified by microtiter plate-based screening simulating extra- and intracellular conditions. Composite scores are the sum of individual scores derived from activities in 4 different buffers or media. Constructs are named according to their domain structure and origin of individual domains. CHAP, CHAP endopeptidase domain; M23, M23 endopeptidase domain; Pep, endolysin-derived endopeptidase domain; Ami, Copyright \u00a9 2020 R\u00f6hrig et al.2020R\u00f6hrig et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the in vitro activity assays, namely, a time kill assay (TKA), turbidity reduction assay (TRA), and spot-on-lawn assay (SLA)  (S. aureus.We expressed and purified the 36 PGHs identified by our screening approach and quantitatively compared them in three different reening) , which mreening) , a propeEscherichia coli, and purified. At this stage, His tag-free versions of all constructs were used to avoid possible biases. All proteins containing the CPP KalaSyn, as well as LysK, KLST, and CKAK fused to certain CPPs such as Pvec, were found to be either insoluble or insufficiently expressed and were therefore excluded from further analysis. The in vitro antibacterial activities of the remaining PGH-CPP fusion proteins were compared with those of the respective parental enzymes  were fused to various CPPs , cloned, enzymes . In gene enzymes . Therefo3+). When A549 epithelial cells were incubated with different concentrations of europium-labeled PGHs for 4 h, we observed a dose-dependent uptake of all proteins. Notably, a higher uptake rate was observed for the TAT-fused versions of all three proteins than that for the parental PGHs amino]biphenyl-4-yl}-2,2\u2032:6\u2032,2\u2033-terpyridine-6,6\u2032\u2032-diyl}bis-(methylenenitrilo)}tetrakis(acetato)} europium(III)  infected with three different S. aureus strains . We screened for killing of S. aureus in this broad selection of cell lines to find PGH-CPP constructs with the ability to kill intracellular S. aureus regardless of the host cell tissue type. The selected cell lines originate from different tissues/organs within the body, which can all be infected by S. aureus, namely, lung, bone, and connective tissue.To test whether the increased cellular uptake of CPP-fused PGHs translates into enhanced killing of intracellular S. aureus cells were inactivated by the addition of flucloxacillin before treatment with the PGHs. When infected cells were exposed to LST and its CPP-containing derivatives for 4 h, we consistently found the intracellular killing activity of the CPP-fused variants to be significantly higher than that of the parental enzyme (S. aureus (numbers below the detection limit) was achieved with CPP-fused LST variants in the majority of the cell line-strain combinations -expressing S. aureus strain were exposed to LST, LST_TAT, or PBS and monitored by confocal laser scanning microscopy (CLSM). In these experiments, both LST and LST-TAT caused a reduction in the number of intracellular S. aureus bacteria compared to the control . This points toward a rapid release of cytosolic GFP upon lysis of S. aureus and is in agreement with the active killing mechanism of PGHs.To visualize the lysis of intracellular  control  to S3. A10.1128/mBio.00209-20.8MOVIE\u00a0S1S. aureus and treated with PBS (control treatment). The GFP-expressing S. aureus RN9623 (green) was used for infection of MG-63 cells, and flucloxacillin was added to the medium after infection. DNA was stained with Hoechst 33342 (blue) and cell membranes with FM464 (red). Treatment with PBS was initiated at t\u2009=\u20090 h. To demonstrate intracellular localization of S. aureus, the red channel was imaged at t\u2009=\u20090 h but not used afterwards to minimize additional photobleaching. z-stacks were recorded every 5 minutes for 5 h. Scale bar\u2009=\u200930 \u03bcm. Download Movie S1, AVI file, 8.4 MB.Time-resolved three-dimensional CLSM video of eukaryotic cells infected with Copyright \u00a9 2020 R\u00f6hrig et al.2020R\u00f6hrig et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the S. aureus in the coculture models. The effects were dependent on the eukaryotic cell line used, with the most significant reductions in intracellular CFU observed in the 3T3-L1 adipocytes  and their TAT-containing derivatives. For all three PGHs, increased killing in MG-63 cells was observed after 15 h, with GH15-TAT, SEP, SEP-TAT, and LysK significantly reducing intracellular  control . It is wS. aureus in our coculture model. Subsequently, we compared the efficacies of each tested pair of individual enzymes at these predetermined concentrations to that of a mixture of both enzymes at half the concentrations. In all cases, the PGH mixture killed significantly more bacteria than did the single PGHs , 20 \u03bcg (pink squares), and 100 \u03bcg (dark-pink squares), and cocktail_2_TAT was tested at 4 \u03bcg (light-blue squares), 20 \u03bcg (blue squares), and 100 \u03bcg (dark-blue squares). All animals received 1 mg flucloxacillin (F) at days 2 and 3 postinfection. (a to c) Total S. aureus numbers in the abscesses after 4 days (a) were determined as the sum of bacterial numbers in pus (b) and the surrounding tissue (c). (d) Relative numbers of intracellular bacteria in pus after treatment of pus with flucloxacillin ex vivo. (e) Relative mean bodyweight of mice treated with cocktail_1_TAT (pink squares), cocktail_2_TAT (blue squares), or buffer (black circles) over the time of infection and treatment. Error bars show the standard error of the mean (SEM). The administration of PGHs and flucloxacillin is indicated by black and gray arrows, respectively. Download FIG\u00a0S2, PDF file, 0.4 MB.Efficacy of different doses of cocktail_1_TAT and cocktail_2_TAT against Copyright \u00a9 2020 R\u00f6hrig et al.2020R\u00f6hrig et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the 8 CFU (inoculum) to 1.3\u2009\u00d7\u2009109 CFU during the course of the experiment indicates that S. aureus Cowan was able to proliferate in the mice despite flucloxacillin treatment. The synergism of LST_TAT and SEP_TAT that we had demonstrated in the cell culture model was also apparent in vivo, since the treatment with the individual PGHs was significantly less effective than with cocktail_2_TAT  S. aureus by PGHs.We therefore chose cocktail_2_TAT to further analyze its therapeutic potential in the murine abscess model, in comparison with its individual components (LST_TAT and SEP_TAT), as well as the respective parental  PGHs LST and SEP, alone and in combination (cocktail_2). As shown in il_2_TAT  and c. I the pus . This fi the pus  and d. I32.7 mm3 . As prev32.7 mm3 . Taken t10.1128/mBio.00209-20.3FIG\u00a0S3S. aureus numbers in pus and tissue of murine abscesses. Animals were treated with 100 \u03bcg of LST (green squares), LST_TAT (dark-green triangles), SEP (orange inverted triangles), SEP_TAT (dark-orange diamonds), cocktail_2 , and cocktail_2_TAT (navy-blue squares) on days 1, 2, and 3 after infection. All animals including control mice (black circles) received 1 mg flucloxacillin (F) at days 2 and 3 after infection. (a and b) Numbers of viable S. aureus after the different treatments were determined in the pus (a) and tissue (b). The pound symbol (#) indicates a statistically significant difference between cocktail_2_TAT and all other treatments (P\u2009\u2264\u20090.0001 for panel a and P\u2009\u2264\u20090.05 for panel b). At least seven representative CLSM images of each of the four independent pus smears per treatment group were evaluated for total S. aureus numbers, eukaryotic cell numbers, and intracellular S. aureus. (c and d) Analyses are shown for total bacteria per square millimeter and intracellular bacteria per host cell. Asterisks (*) indicate levels of significance . Download FIG\u00a0S3, PDF file, 0.3 MB.Analysis of Copyright \u00a9 2020 R\u00f6hrig et al.2020R\u00f6hrig et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the S. aureus. The different, highly complex environments found inside and outside cellular compartments pose diverse challenges to PGH activity, as they vary in multiple parameters such as pH, ionic strength, and osmolality  was more effective in this model than was cocktail_1_TAT, which instead contained GH15, an enzyme much less active in acidic environments   , effection (MBC) . Anothereptidase , 49.in vivo , but that the non-LST components within these mixtures  have an important impact on the potency of the cocktails. This is further supported by the relatively weak effects of LST and LST_TAT when applied individually in vivo , an obsein vivo . One reain vivo . Our celreatment . This efreatment .S. aureus has the striking ability to acquire new resistances and develop strategies to survive under stress conditions. The importance of intracellular S. aureus for recurrent infections is evident  and/or in abscesses  at 37\u00b0C. For the GFP-expressing S. aureus RN9623 (E. coli strains used for protein expression were grown at 37\u00b0C in Luria-Bertani (LB) medium  and on LB agar (LB medium\u2009plus\u200914 g/liter agar) supplemented with suitable antibiotics where necessary .All bacterial strains used in this study are indicated in s RN9623 , media w10.1128/mBio.00209-20.5TABLE\u00a0S2Table\u00a0S2, PDF file, 0.2 MB.Bacterial strains used in the present study. Download Copyright \u00a9 2020 R\u00f6hrig et al.2020R\u00f6hrig et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the E. coli BL21-Gold(DE3), and their construct identity was confirmed by commercial Sanger sequencing . A list of the plasmids used and created in this study is presented in The plasmid constructs used in this work were generated using standard molecular cloning techniques . DNA fra10.1128/mBio.00209-20.6TABLE\u00a0S3Table\u00a0S3, PDF file, 0.2 MB.PCR primers used in the present study. Download Copyright \u00a9 2020 R\u00f6hrig et al.2020R\u00f6hrig et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the 10.1128/mBio.00209-20.7TABLE\u00a0S4Table\u00a0S4, PDF file, 0.2 MB.Plasmids used and created in the present study. Download Copyright \u00a9 2020 R\u00f6hrig et al.2020R\u00f6hrig et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the E. coli strains carrying the constructs of interest were performed in 96-well plates, as previously described  without calcium and magnesium , Dulbecco\u2019s modified Eagle\u2019s medium , intracellular buffer   supplemented with 1% albumin fraction V . Lysosomal buffer was produced by adjusting the pH of extracellular buffer . A score between 0 and 3 was assigned for each spot, and the scores at each of the three positions on the plate and of each buffer/medium were summed up to obtain a microtiter plate score for each PGH, as follows:m is the medium or buffer, p is the position, and PGHScore is {0, 1, 2, 3}, with 3 for complete clearance (0 CFU), 2 for 1 to 15 CFU, 1 for >15 CFU with visible single colonies, and 0 for >15 CFU without visible single colonies or bacterial lawns.We screened 322 PGH constructs from our library using a previously described microtiter plate-based approach  in an efescribed . Each PGith KOH)  supplemer buffer  to 4.7 uThe 36 PGHs with the highest activity across all four buffers/media were selected for further characterization.E. coli and purified essentially as previously described (600) of 0.5 at 37\u00b0C under agitation in LB medium modified for protein expression   and continued for 18 h at 19\u00b0C under agitation. Cells were harvested by centrifugation, and pellets were frozen at \u221280\u00b0C.Recombinant proteins were expressed in escribed . In briepH 7.8])  and coolE. coli was resuspended in lysis buffer  and lysed in a Stansted pressure cell homogenizer  at 100\u2009MPa. The lysate was cleared of cellular debris by centrifugation and incubated with low-density nickel resin  in a gravity flow column. After washing, proteins were eluted with elution buffer , and fractions containing protein were identified using a NanoDrop ND-1000 spectrophotometer . Pooled fractions were dialyzed in Spectra/Por 1 dialysis tubing, with a 6- to 8-kDa molecular weight cutoff  against two changes of dialysis buffer  and consequently sterile filtered (0.2-\u03bcm pore).For constructs containing His tags, 2PO4, 20% glycerol [pH 7.4]) was used instead of lysis buffer. After clearance from the cellular debris, the lysate was sterile filtered and loaded onto a HiTrap Sepharose (SP) fast-flow (FF) cation exchange column  in an \u00c4kta fast-performance liquid chromatography (FPLC) device . After washing with 3 column volumes of buffer A, a gradient of 1%/min of buffer B  was used to elute the protein. Fractions of 0.5\u2009ml were collected, and those containing protein were dialyzed as described above.For constructs without a His tag, buffer A . All purified proteins were stored on ice at 4\u00b0C.To test for protein identity and purity, 4\u2009\u03bcg of protein was analyzed by SDS-PAGE using Mini-Protean TGX-stain-free precast gels . Impure preparations underwent size exclusion chromatography in a Superdex 200 10/300 GL column  using gel filtration buffer  at this time point were scored with 4, 3, 2, and 1, respectively. The scores obtained for both tested enzyme concentrations were added and further processed as described above.TKAs were performed essentially as previously described . The fouS. aureus Newman substrate cells in each buffer, and 100\u2009\u03bcl of the bacterial suspensions was mixed with 100\u2009\u03bcl of each dilution of the PGHs in a 96-well plate, so that the initial OD600 of the suspension was 1. The decrease in optical density over time was monitored for 1 h at 30-s intervals with a FLUOstar Omega plate reader . The resulting lysis curves were corrected for the negative controls (no enzyme) and fitted to a 5-parametric sigmoidal function, as described before  with 10% fetal bovine serum  (l-glutamine) with 10% FBS (2 and maintained at\u2009\u226490% confluence for A549 and MG-63 cells and\u2009\u226480% confluence for 3T3-L1 cells. Differentiation of 3T3-L1 cells was performed as described before (A549 (ATCC CCL-185) adenocarcinomic human alveolar basal epithelial cells (A549 cells) and 3T3-L1 ATCC CL-173) primary murine fibroblast-derived adipocytes (3T3-L1 cells) were grown in Dulbecco\u2019s modified Eagle medium  , 73. MG- primary  10% FBS . Cells wd before , with th3+) chelate was performed essentially as described before  in 0.1 M sodium acetate buffer (pH 4.9) were mixed with five parts of 17.2\u2009mg/ml cyanuric chloride in acetone for 30 min at room temperature. The mixture was precipitated in pure acetone in a dropwise manner and washed with acetone two times, followed by vacuum drying for 1 h. Synthesis of the DTBTA-Eu3+ molecule was confirmed by electrospray ionization-mass spectrometry (ESI-MS) at the Functional Genomics Center Zurich . ESI-MS analysis was performed within a mass range between 50 and 5,000\u2009Da, with a sampling cone energy of 40 V. Proteins were dialyzed into carbonate buffer (300\u2009mM NaCl [pH 9.1]), and DTBTA-Eu3+ was mixed with purified proteins at a molar ratio of 4:1 and incubated for 2.5 h under agitation at room temperature. Unbound label was removed by gel filtration chromatography on a Sephadex G-25 gravity flow column . Protein concentrations were determined using the Pierce bicinchoninic acid (BCA) protein assay kit , according to the manufacturer\u2019s instructions, and protein purity was confirmed by SDS-PAGE. Labeled proteins were incubated with A549 cells grown in a 24-well tissue culture plate  at concentrations of 0.5, 1.0, and 2.0\u2009\u03bcM for 4 h. Cells were then washed three times with medium (DMEM or MEM) to remove PGHs. Cell integrity was confirmed by microscopy before and after washing. Eukaryotic cells were detached by adding 60\u2009\u03bcl trypsin  and lysed by adding 240\u2009\u03bcl of 0.1% Triton X-100  for 3 min at 37\u00b0C. Additionally, the mixture was mashed by repeatedly pipetting up and down. A 2-fold dilution series of each labeled PGH was prepared in the same buffer. Time-resolved fluorescence of the lysate and the dilution series (for generating a standard curve) was measured in a 384-well plate in an Infinite M1000 reader . PGH concentrations in the lysate were calculated from the standard curve.Labeling of PGHs and PGH-CPP fusion proteins with the fluorescent {{2,2\u2032,2\u2033,2\u2034-{4\u2032-{[amino]biphenyl-4-yl}-2,2\u2032:6\u2032,2\u2033-terpyridine-6,6\u2032\u2032-diyl}bis-(methylenenitrilo)}tetrakis(acetato)} europium(III)  of 1 for 1 h. At the start of infection, 225\u2009nM death-associated protein kinase (DAPK) inhibitor  and 20\u2009\u03bcM (3S)-5--3-[[(2S)-3-methyl-1-oxo-2-[(2-quinolinylcarbonyl)amino]butyl]amino]-4-oxo-pentanoic acid (Q-VD-OPh)  were added to minimize the cytotoxic effects of S. aureus. Subsequently, eukaryotic cells were washed with prewarmed medium, and medium supplemented with 1\u2009mg/ml flucloxacillin was added for 1 h to kill all extracellular bacteria  equipped with an HCX PL Fluotar 63\u00d7\u20091.30 oil objective. A z-stack of 20\u2009\u03bcm with a z-slice thickness of 0.5\u2009\u03bcm was imaged every 5 min, thereby creating time-resolved 3-dimensional reconstructions of the infected cells over a treatment duration of\u2009>4 h. Hoechst 33342, GFP, and FM4-64 were excited at \u03bb of 405\u2009nm, 488\u2009nm, and 532\u2009nm, respectively. Image analysis was performed with the Imaris Software .In each well of a 2-well imaging chamber , 1.25\u2009\u00d7\u200910bacteria , 59. The5 A549 or MG-63 cells were seeded 24 h before infection. For the 3T3-L1 cell line, 6.25\u2009\u00d7\u2009104 cells were seeded in a 24-well plate 7 days before infection and differentiated as described above. On the day of infection, a log-phase culture of S. aureus Newman, Cowan, or USA300 JE2 was washed once and resuspended in PBS. The MOIs used for the infection of eukaryotic cells were 10, 1, and 1, respectively. The higher MOI for Newman was chosen because of its low propensity to invade eukaryotic cells, which is most likely due to the truncation of fibronectin binding proteins , and incubated with medium supplemented with 1\u2009mg/ml flucloxacillin, which was determined to be at least 40\u00d7 higher than the MIC of each strain. After 1 h, PGHs or PGH-CPP fusion proteins were added to the cells at 2\u2009\u03bcM and incubated for 4 or 15 h at 37\u00b0C and 5% CO2. Controls without S. aureus infection and without PGH treatment were included in the assay. Additionally, the extracellular medium was plated to confirm the absence of extracellular S. aureus. Cells were washed three times with medium (DMEM or MEM) to remove flucloxacillin and enzymes. Cell integrity was confirmed by microscopy, and eukaryotic cells were detached by adding 60\u2009\u03bcl trypsin  and lysed by adding 240\u2009\u03bcl of 0.1% Triton X-100  for 3 min at 37\u00b0C. Additionally, the mixture was mashed by repeated pipetting, and 700\u2009\u03bcl of cold PBS was subsequently added to the mixture. The cell lysate was serially diluted in PBS, plated on tryptic soy agar (TSA) plates, and incubated at 37\u00b0C overnight. On the following day, emerging colonies were enumerated.In each well of a 24-well tissue culture plate , 2.5\u2009\u00d7\u200910proteins . Cells wS. aureus USA300 JE2 as described above, with the following modifications. In a preliminary dose-response experiment, 2-fold serial dilutions ranging from 0.04 to 0.0025\u2009\u03bcM for LST_TAT and from 4 to 0.25\u2009\u03bcM for CHAPGH15_SH3bALE1_TAT, LysK_TAT, and CHAPSEP_SH3b2638a_TAT were added to the eukaryotic cells for 15 h. For all enzymes, concentrations yielding approximately the same log reduction in intracellular S. aureus numbers were determined. To test for synergy between LST_TAT and any of the other three PGHs, log reductions caused by two individual enzymes in the intracellular killing assay at these predetermined concentrations were compared with those caused by a mixture of the two proteins at half these concentrations.To determine the synergistic effects of mixtures of PGH-CPP fusion proteins inside eukaryotic cells, intracellular killing assays were performed in MG-63 cells infected with S. aureus USA300 JE2. In both cases, cells were treated with 2\u2009\u03bcM PGHs for 15 h, as described for the intracellular killing assay. The absorption of the supernatant at 490\u2009nm  and 680\u2009nm (background) was measured with a FLUOstar Omega plate reader . After background subtraction, cytotoxicity was determined by division of the signal of the samples by the signal of a maximum LDH activity obtained through lysis of all cells by a detergent and subsequent multiplication by 100%.Cytotoxicity assays were performed according to the manufacturer\u2019s instructions of the Pierce LDH cytotoxicity assay kit . Briefly, the supernatant of A549 cells was tested for its LDH content either with or without infection by The Institutional Animal Care and Use Committee of the University of Zurich approved the study under protocol ZH050/18, and all animal experiments conducted in this study were approved by the Cantonal Veterinary Office Zurich.S. aureus Cowan was grown to logarithmic phase, and 108 CFU were mixed 1:1 with Cytodex beads  and injected subcutaneously into the flanks of 7- to 8-week-old female C57BL/6 mice , as previously described  and with Alexa Fluor 488-conjugated goat anti-mouse secondary antibody Ab150113 (Abcam). The samples were visualized as described above.In addition, abscess pus was stained with 10\u2009\u03bcg/ml FM 4-64FX  and 1\u2009\u03bcg/ml Hoechst 33342 (Thermo Fisher Scientific) before fixation with 4% paraformaldehyde . PBS with 0.1% albumin fraction V , 2% FBS (Thermo Fisher Scientific), and 1% saponin (Sigma-Aldrich) was used to block and permeabilize the samples. in vivo experiments, the weight loss data of mice were analyzed by a two-way ANOVA with Dunnett\u2019s correction for multiple comparisons. Differences in CFU counts and abscess size were analyzed using a one-way ANOVA with Tukey\u2019s correction for multiple comparisons.All experiments were performed at least in biological triplicates, and statistical analysis was performed in Prism v8.0 . The CFU counts of all experiments were log transformed prior to analysis. A two-way analysis of variance (ANOVA) with Tukey\u2019s correction for multiple comparisons was used to analyze the difference in (i) the uptake of europium-labeled PGHs with or without CPPs, (ii) intracellular CFU after exposure to different PGHs with and without CPPs, and (iii) the difference in intracellular CFU after exposure to these agents for different periods (4 h and 15 h). Differences in intracellular CFU in synergy experiments were analyzed using a one-way ANOVA with Tukey\u2019s correction for multiple comparisons. For The data supporting the findings of this study are available within the article and its supplemental material files, or from the corresponding author on request.10.1128/mBio.00209-20.9MOVIE\u00a0S2S. aureus and treated with LST. The GFP-expressing S. aureus RN9623 (green) was used for infection of MG-63 cells, and flucloxacillin was added to the medium after infection. DNA was stained with Hoechst 33342 (blue) and cell membranes with FM464 (red). Treatment with LST was initiated at t\u2009=\u20090 h. To demonstrate intracellular localization of S. aureus, the red channel was imaged at t\u2009=\u20090 h but not used afterwards to minimize additional photobleaching. z-stacks were recorded every 5 minutes for 5 h. Scale bar\u2009=\u200930 \u03bcm. Download Movie S2, AVI file, 8.2 MB.Time-resolved three-dimensional CLSM video of eukaryotic cells infected with Copyright \u00a9 2020 R\u00f6hrig et al.2020R\u00f6hrig et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the 10.1128/mBio.00209-20.10MOVIE\u00a0S3S. aureus and treated with LST_TAT. The GFP-expressing S. aureus RN9623 (green) was used for infection of MG-63 cells, and flucloxacillin was added to the medium after infection. DNA was stained with Hoechst 33342 (blue) and cell membranes with FM464 (red). Treatment with LST_TAT was initiated at t\u2009=\u20090 h. To demonstrate intracellular localization of S. aureus, the red channel was imaged at t\u2009=\u20090 h but not used afterwards to minimize additional photobleaching. z-stacks were recorded every 5 minutes for 5 h. Scale bar\u2009=\u200930 \u03bcm. Download Movie S3, AVI file, 8.2 MB.Time-resolved three-dimensional CLSM video of eukaryotic cells infected with Copyright \u00a9 2020 R\u00f6hrig et al.2020R\u00f6hrig et al.Creative Commons Attribution 4.0 International license.This content is distributed under the terms of the"}
{"text": "The peg-in-hole task with object feature uncertain is a typical case of robotic operation in the real-world unstructured environment. It is nontrivial to realize object perception and operational decisions autonomously, under the usual visual occlusion and real-time constraints of such tasks. In this paper, a Bayesian networks-based strategy is presented in order to seamlessly combine multiple heterogeneous senses data like humans. In the proposed strategy, an interactive exploration method implemented by hybrid Monte Carlo sampling algorithms and particle filtering is designed to identify the features\u2019 estimated starting value, and the memory adjustment method and the inertial thinking method are introduced to correct the target position and shape features of the object respectively. Based on the Dempster\u2013Shafer evidence theory (D-S theory), a fusion decision strategy is designed using probabilistic models of forces and positions, which guided the robot motion after each acquisition of the estimated features of the object. It also enables the robot to judge whether the desired operation target is achieved or the feature estimate needs to be updated. Meanwhile, the pliability model is introduced into repeatedly perform exploration, planning and execution steps to reduce interaction forces, the number of exploration. The effectiveness of the strategy is validated in simulations and in a physical robot task. Several recent studies have demonstrated that robotic operations may no longer be targeted at specific objects and structured tasks. For example, in the medical field, robots autonomously perform large-scale pharyngeal swab sampling to reduce the risk of COVID-19 (Coronavirus Disease 2019) in health care workers [Visual sensors are considered to be the most common and direct method, which are used to perceive important features of the uncertain object. In ,4 they pSome methods based on various learning algorithms that fuse visual and tactile information are proposed, for example, in-depth researches on grasping stability prediction ,14 and sCompared to the above methods, the approach based on Bayesian probabilistic techniques has a clear advantage that a large amount of training data is not required in fusing multi-sensor information. The results in  also demTo achieve robotic autonomy operation without human intervention and without making any provisions for an uncertain object, the designed solution scheme in this paper is shown in To achieve the function of the robot deciding the next operation by relying on its own judgement, a fusion decision strategy (FD) is designed which is adapted to fine-grained operations with multiple requirements, such as operating accuracy and preload. The purpose of this is to avoid the errors that can arise from single-evidence decisions, for example, when evidenced by position only, substandard quality of operation may occur . When evidence by contact force only, it can be incorrectly judged as satisfying the task requirements, because an interaction during operation creates a contact force similar to the expected one. The fusion decision strategy is used after each exploration of operating object features. Unlike existed research works that only used position accuracy as an indicator, the designed fusion decision strategy fuses both position and force evidence information in the D-S theoretical framework and includes their uncertainties to guide the subsequent operations.Finally, command information, such as the features of the uncertain object and the evaluation results of the operation, from the MSP is sent to the robot to guide the operation. As shown in the pink box in This paper includes the following contents. In (1)how to perceive the features of the uncertain operating object, (2)how to achieve make an automatic decision for the robotic operation,(3)how to achieve safety interaction between the robot and the uncertain operating object.Based on the above analysis, the following issues will be investigated in this paper:For the critical step of the pen-in-hole task, a mathematical description of the above problem was presented. As shown in Besides visual error and occlusion, the operating object may generate continuous dynamic effects due to the interaction process, which can increase uncertainty. The uncertainty can be expressed as Moreover, in practical application, the operation task performed by the robot is usually composed of several continuous nail hole operations. Each contact behavior induces dynamic interactions at the operational object connections, resulting in coupling effects of robot operational errors and system stability. This coupling effect accumulates and increases over the course of the task. From the above description and analysis, it is clear that for each peg-in-hole operation, the robot must perform with high operational accuracy and apply appropriate forces to the operational object during continuous and large task volumes. That is, the contact force needs to satisfy:reliable .If the robot can make timely autonomy decisions based on the collected limited information to guide the subsequent movements, the number of contacts can be effectively reduced and thus the dynamic effects are reduced. In addition, it also reduces human involvement, which effectively avoids human errors and workload. Therefore, a variable The multi-sensor perception strategy is divided into two parts, i.e., interactive exploration and fusion decision, which are shown in In the case of imperfect vision sensors, the features of the uncertain operating object are explored by integrating three sources of information. Given the position of the robotic end  according to the new Gaussian distribution is performed to obtain the particles:The random walk of particles is defined as:In the following section, based on the position information and force information of the robotic end and visual estimated operating object features at the current moment, probability calculations are performed on each sampled particle to recursively design a Gaussian distribution so that the features of the uncertain operating object at each moment can be estimated.The robotic end position The contact force When the direction of the end contact force is inside the friction cone, the particle corresponds to the uncertain operating object with the highest probability, as shown in When the robot starts to move toward the operation object, vision can easily provide feature information of the object. The current moment object features can be estimated by the Euclidean distance between To improve the accuracy of the estimation, the posterior probabilities obtained from these two information sources are integrated to obtain the weighting coefficient of the particles. At a certain moment, given the end position and robotic contact force, the weight of the particle can be expressed as:Redefine the Gaussian distribution of particles as:Since there may be errors in the shape and position of the uncertain object after sampling and estimation, historical information and rules of inertia thinking are used to correct the estimated value of the features of the uncertain object to improve the accuracy of the estimation, as shown in (1) Memory adjustment correction methodThe shape features of the uncertain object are calculated based on the estimated value, after completing the sampling estimation. According to the uncertain object proposed in n-th element in According to the estimated value To obtain the most suitable correction angle, historical information is introduced to participate in the correction calculation. The history information collection of angle is defined as The angle error The posterior probability of the angle based on the angle error A simple fuzzy system with two fuzzy rules is established, and the fuzzy membership function is:The history information at the current moment is defined as The depth In order to obtain the most suitable correction depth, historical information is introduced to participate in the correction calculation. The history information collection of depth is defined as The depth error The posterior probability of the depth based on the depth error The history information at the current moment is defined as After obtaining the correction angle and correction depth, the initial correction value (2) Inertia thinking correction methodHuman tactile perception is an iterative process of recognition\u2013decision\u2013correction. In this part, the features of the uncertain object will be corrected based on the result of the fused decision and the sensor information. For the sake of correcting the estimated features of the uncertain object, a novel method is proposed based on inertial thinking in the following.Rule 1: When the robot moves towards the target position, the end of the robot should gradually approach the target position,If In the process of exploration, if humans perceive a collision, they will explore in the opposite direction.Rule 2: If the end of the robot collides with The end of the robot collides with The end of the robot collides with After the correction is completed, As shown in The D-S theory is used to analyze the position information provided by the robot and the force information provided by the force sensor. This fusion decision strategy provides a mechanism to represent and process the uncertainty from robots and force sensors. Moreover, Dempster\u2019s combination rules  are usedFirst, the recognition framework The main elements of the recognition framework, Next, the basic probability assignment (BPA) of different categories to which different information sources belong is calculated. In the method in this paper, the fuzzy naive Bayes method is used to generate BPA for each category and assign it to D-S theory. Let According to D-S theory, there is a compound hypothesis that an object may belong to both For systems with multiple information sources, the overall BPA , After the fusion is completed, the entire decision-making process has changed from multiple information sources to single information source decision-making. Choose the hypothesis with the greatest probability as the predicted category of the sample in the test data. Finally, the result of the task assessment The n-degree-of-freedom robot dynamics are:The above formula is rewritten into Cartesian coordinate form as:Rewrite the above formula further:In this part, the uncertain of the robot model and the uncertain of the object are considered in the design of the robot controller. In the outer loop, the pliability model is introduced and combined with a multi-sensor perception strategy to perceive the object and provide a command position The pliability model is:The position error is defined as:Sliding mode is defined as:The robot reference state is defined as:The controller can be designed as:Simulation and physical robot task experiments are designed for the narrow uncertain object. The proposed whole solution scheme is evaluated in terms of intelligence, autonomy and safety. (1) accuracy of interactive exploration for the features of the uncertain object Let Impedance coefficient:Sliding mode parameters:Inertial matrix estimates:In the simulation, the initial position of the robot is set near the operation object . The initial features of the uncertain object are given and are in error with the expected value. Since the estimates of our method are based on the previous moment\u2019s ones each time, the range of applicability of interactive exploration can be tested by adjusting the initial error. Considering that the entire operating object should be stabilized after the task is completed, the preload force is introduced and was set to 5 N.We give the initial features of the uncertain object, and the errors of these features (target position) from the expected values are \u22120.8 mm, \u22123 mm, 0, 3 mm and 10 mm, respectively. As can be seen from In addition, to verify the advantages of the proposed method in terms of estimation accuracy, we also evaluate the MAC and ITC methods. The simulation results of MAC are represented in In During the ITC design stage, we consider four possible scenarios that can cause inaccurate estimation (only three scenarios have appeared in the results of many simulations so far). Moreover, with the introduction of the ITC, the estimation results of the interactive exploration method are more accurate. Therefore, the validity of the design in this paper was verified.The fusion decision results can be viewed as a classification of the current task progress (finished and unfinished). Therefore, the confusion matrix is proposed to evaluate the performance of the fusion decision strategy. As shown in The result in To further validate the performance of the proposed strategy in more complex and uncertain objects, a peg-in-hole experiment with dynamic effects is designed, and the experimental equipment is shown in Two sets of workpieces (operating tools and simulation components) are used in the experiment to verify the versatility of the proposed method for different workpieces. As shown in Operation tool 1: full length is 176 mm, diameter of bottom end is 20 mm, diameter of top end is 40 mm, tilt angle Operation object 1: hole deep is 80 mm, hole diameter of bottom end is 20 mm, hole diameter of top end is 40 mm, and tilt angle Operation tool 2: full length is 197 mm, diameter of bottom end is 19 mm, diameter of top end is 13 mm, tilt angle Operation object 2: hole deep is 32 mm, hole diameter of bottom end is 13 mm, hole diameter of top end is 20 mm, and tilt angle In the experiment, the basic parameters used in the control system are as follows.Impedance coefficient:We first show the result of the fusion decision by the position and force on the end of the robot with the finished and unfinished operation, as shown in Some details are shown in As shown in In this section, we conduct experiments on the proposed system under the dynamic effects conditions of In the previous experiment, we illustrated the generality of the proposed system in terms of safety. To verify the safety attributed to the proposed method, we compare the proposed system with two benchmark experiments: (1) guide operation by MSP only, without impedance control, and (2) variable impedance control only, without MSP. For each method, experiments are performed sequentially at three types of dynamic effects. As shown in (1) The maximum contact force (orange) is demonstrated using only MSP-guided operation without impedance control. This result is expected and indicates that a pliability model is needed to accomplish the operation task to minimize the contact force between the robot and the uncertain object. Although the target position is updated by MSP, it leads to large contact forces when guiding the robot movement, which is undesirable since the robot\u2013object interaction is not considered.(2) Variable impedance control is a classical approach to deal with the problem of robot interaction with an uncertain object, which adjusts the impedance parameters online by contact forces to accommodate the uncertain object with dynamic effects. The approach using variable impedance control only without MSP (green) presents multiple peaks, which means that the robot guided only by variable impedance without MSP may lead to frequent collisions and possibly even divergence during operation. Frequent collisions can also exacerbate dynamic effects.(3) In summary, the proposed method (blue) demonstrates minimal contact forces and no multiple collisions. It indicates that the method proposed in this paper is effective.In this paper, we focused on the issue of robotic autonomy operations in the real-world unstructured environment. Missing or inaccurate visual information was also considered due to confined space limitations and interference from complex environments. In order to satisfy the three requirements of intelligence, autonomy and safety, a multi-sensor perception strategy for the robot was proposed to achieve a humanoid autonomy operation process integrating exploration, decision and guidance with uncertain objects. In terms of intelligence, it was our goal to obtain information about the features of the uncertain object. An interactive exploration method using Bayesian networks was proposed to integrate multimodal information and accurately estimate the features of the uncertain object, which can comprehensively perceive the features of the uncertain object even in the presence of visual occlusion. The exploration approach was general for static objects and multiple dynamic objects. In terms of safety, the proposed system was capable of performing tasks under the uncertain object and minimizing the forces of interaction between the robot and the uncertain object. In terms of autonomy, the proposed fusion decision strategy has enabled autonomous start\u2013stop and guided subsequent operations of the robot, which could reduce the workload of the operators. Based on the D-S theory, the evidence information provided by multiple information sources was fused to judge the task progress, which gives the robot human-like decision-making capability. Moreover, the pliability model was combined with an MSP to reduce the interaction forces during operation. In general, the multi-sensor-based solution scheme showed fine performance for robotic operation tasks with both position and force requirements.There is one more area where the proposed method could be improved. The inclusion of a pose adjustment strategy before the MSP will improve the generality of the method for pegs and holes with multiple angles. This attitude adjustment strategy performs a tilt-right\u2013rotate\u2013alignment process to bring the robotic end into an ideal attitude for operation."}
{"text": "Cassava is a key food security crop in Central Africa, but its production depends largely on the use of local farmers\u2019 varieties characterized by inherently low yield which is compounded by generally high susceptibility to various growth and yield-limiting pests and diseases. Improved cassava genotypes have demonstrated the potential to substantially improve cassava\u2019s contribution to food security and the development of the cassava industry and the improvement of nutrition status elsewhere in Western Africa. Eleven improved cassava genotypes were compared with a local landrace (LMR) used as a check under field conditions over two years in eight locations, grouped in four agro-ecologies in Cameroon. Pest and disease abundance/incidence and damage severity were evaluated. At harvest, root yield and carotenoid content were measured. Best linear unbiased predictors showed the lowest breeding value for LMR with the cassava mosaic virus disease (+\u200966.40\u2009\u00b1\u20092.42) compared with 1.00\u2009\u00b1\u20090.02% for the most susceptible improved genotype. Two genotypes (I010040-27 and I011797) stood out for having higher predicted fresh root yield means which were at least 16 times greater compared with LMR. Predicted total carotenoid content was the highest (+\u20095.04\u2009\u00b1\u20090.17) for improved genotype I070593 compared with LMR which showed the lowest (\u2212 3.90\u2009\u00b1\u20090.06%) and could contribute to the alleviation of vitamin A deficiency from cassava-based food systems. Diffusion of high-yielding and nutritious genotypes could alleviate food and nutritional security in Central Africa. Manihot esculenta Crantz), is the main source of calories for 800 million people across the globe1. No other continent depends on cassava to feed as many people as does Africa2. Its production is estimated at 178 million tons\u201461% of global production\u2014produced annually in sub-Saharan Africa (SSA)3. Population growth and demands by emerging cassava industries are increasingly straining current production capacities that rely widely on low-yielding farmers\u2019 local varieties that are particularly susceptible to widespread and emerging pests and diseases such as cassava mosaic virus disease, cassava brown streak virus disease, and cassava whiteflies8. Moreover, the local varieties are deficient in micronutrients, thus their consumption could lead to micronutrient deficiency, also referred to as hidden hunger9. Acute deficiencies in one or more micronutrients, including vitamins A, C, E, and minerals are reported in about two billion people9. In Cameroon, about 39% of preschool-aged children and 18% of pregnant women are deficient in vitamin A. For example, acute malnutrition is estimated at around 4.8% in the East region of Cameroon10. According to UNHCR (2018), nearly 265,000 refugees from the Central African Republic have sought shelter in eastern Cameroon, increasing the level of food insecurity in the region.Cassava  and its partners have developed new cassava genotypes to improve the livelihoods of millions of farmers in SSA. It is now widely recognized that traditional staple crops  are no longer providing adequate and enough solutions to the world\u2019s food insecurity19; however, its production in Cameroon and elsewhere\u2014particularly in Central Africa\u2014is constrained by heavy yield losses from pests and diseases among which are: (1) cassava mosaic virus disease (CMD) transmitted largely by the whitefly Bemisia tabaci (G.) and by infected cassava stems used as vegetative propagules; (2) cassava anthracnose disease (CAD) caused by the fungus Colletotrichum gloeosporioides (Penz.) Sacc. and also vectored by Pseudotheraptus devastans Dist. (Het. Coreidae); and (3) cassava green mite (CGM) Mononychellus tanajoa (B.)23. CMD is the most challenging disease as it can cause 25\u201390% yield losses, with substantial negative impact on people\u2019s livelihoods24, particularly where CMD-susceptible traditional farmers cassava varieties are used compared with the CMD-resistant improved varieties8. Host plant resistance provides the cheapest and simplest technology where chemical inputs are not available or affordable.Cassava is resistant to adverse environments25 and for sustainable improvement in the lives of millions of people in developing countries, particularly in Africa and South Asia27.Crop improvement has traditionally focused on increasing crop yield and building resistance to pests and diseases. In recent years, enhancement of crops nutrient has been increasingly incorporated in breeding programs. Biofortification of staple food crops like cassava has been advocated as one of the cost-effective solutions to combat the scourge of micronutrient malnutrition32. In a previous study8, we evaluated a set of 18 cassava genotypes, mostly oriented toward industrial processing, across eight environments in Cameroon to assess the level of stability of their yield and pest and disease resistance. The principal objective of the present study was to evaluate and select new cassava genotypes suitable for non-fermented products prepared using a single-step process after peeling (boiling or frying) and with high resistance to CMD and other pests, and with higher provitamin A content under specific environments. Broadly, the results from this Cameroon study are likely to be extended to countries sharing similar ecologies, mainly in the Congo Basin, as Cameroon, with its varied environments, is considered the gateway to the rest of Central Africa.Genotype x environment interaction is the greatest challenge to breeders due to differential genotypic responses across environmentsThe levels of soil pH and various soil chemical characteristics varied among locations. Soil pH in Foumbot (6.06\u2009\u00b1\u20090.02) differed significantly from the other locations, with Bambui and Njombe being most acidic (3.93\u2009\u00b1\u20090.01 and 3.93\u2009\u00b1\u20090.06 respectively). The highest organic carbon content (6.96\u2009\u00b1\u20090.03) was recorded in Bambui. Ekona, Foumbot, and Meiganga differed from the other locations with their higher level of Ca, Mg, and P. Meyomessala soil had the highest sand content while Njombe and Bambui soils had the highest clay and silt respectively  , which showed the lowest CAD incidence,\u2014to\u2009+\u20094.90\u2009\u00b1\u20093.21 for LMR which also had the highest CAD severity (+\u20090.07\u2009\u00b1\u20090.01) (Table p\u2009<\u20090.001) in genotype x environment interactions for all the parameters  and severity (0.64) compared with CAD. The linear mixed model test indicated highly significant effects  was predicted on I090616, while the lowest was on I071026 (\u2212 3.73\u2009\u00b1\u20094.80) (Table Two genotypes (I010040-27 and I011797) stood out for having the highest predicted fresh root yield means among all the tested genotypes Table . The yiep\u2009<\u20090.001) for genotype and environmental interactions for all tested traits  among the traits was estimated from TCC Table . The lints Table .The quadrants in Fig.\u00a08, provide a highly important set of data on the effects of genotype and environment on 28 cassava genotypes that are in advanced stages of development. Moreover, the two studies together, are a rarity in evaluations that covers a very wide spectrum of pest/disease resistance, yield, and nutritional value, all with a significant potential contribution to food and nutritional security in Central Africa. The four agroecological zones in which the genotypes were tested are representative of the agro-ecologies of the Congo Basin, including nearly all states in Central Africa, except the Sahelian zone33. Importantly, we found that the environment was not the main determinant of a genotype response to cassava mosaic virus (CMD) as the heritability was close to one; this opens the possibility of introducing genotypes with good performance in terms of productivity, yield stability, and resistance to pest and disease into areas with similar characteristics as in Cameroon. Indeed, as with varieties for industrial processing, the tested genotypes were initially selected based on their resistance to CMD and yield, as well as provitamin A content for the yellow root genotypes, traits in which variability comes from genetic differences, with very little contribution from environmental factors34. We noted, however, two genotypes, I070593 and LMR, that had CMD severity scores of 2.8 and 2.6 respectively on average for both years, although the incidence on the same genotypes was nearly nil (less than 2% on average). Our two checks, I010040-27 and LMR, displayed on average the same incidence and severity as in the previous study8; however, the other improved varieties  were five-fold more resistant to CMD compared with the 16 of the previous study, thus confirming the improvement made on the current set of varieties with respect to CMD resistance and the necessity to disseminate those genotypes. The significant interaction observed between environment and genotype for CMD infection could be related to the virus strains present in the locations as previous studies established the presence of various CMD strains in Cameroon, particularly the Ugandan variant which is the most virulent and present in the east region (Gamboula)35.Multi-environment experiments are a primary focus in plant breeding programs; therefore, their prediction accuracy, compared with observed value, is crucial for selection recommendation of cultivars, and the identification of mega-environments. This study showed variable responses of a set of new cassava genotypes for food and nutritional value in contrasting environments in Cameroon, thus justifying the necessity to evaluate genotype by environment interactions. This study, together with the previous study conducted in the same locations, but with different genotypes36. Contrary to CMD, Cassava Anthracnose Disease (CAD) was found mostly in the forest areas where relative humidity and rainfall significantly influence the levels of CAD inoculum pressure, in addition to favoring the development of its vector Pseudotheraptus devastans Dist (Het. Coreidae)23. CAD severity was statistically similar on all genotypes, but with low incidence. Genotype I071026 did not show CAD symptoms during the 2nd year. CAD has become an economic threat to cassava production as severe outbreaks have been reported22. Affected plants display necrotic lesions on leaves and stem, reducing planting material availability37. Careful selection of clean planting material and good field maintenance (timely weeding and field aeration) could help in reducing CAD pressure in the forest zone where it is most prevalent.Typical CMD symptoms on cassava plants are misshapen leaves which hamper the growth of the plant and reduce root yields, hence lowering productivity and profitability8; however, the lack of CMD symptoms could mean that whiteflies did not carry enough virus loads to efficiently transmit the virus, as an increase in whitefly numbers can lead to the higher efficiency of CMD transmission on cassava38 and also could likely be explained by the resistance mechanism of this cassava line. This contradicts other findings39 which reported that 10 whiteflies per plant constituted an adequate population for the spread of CMD due to their persistent mode of transmission.Interestingly, the genotype I090521 did not show any CMD symptoms over the two trial years despite harboring the highest number of whiteflies per plant as previously demonstrated with four genotypes 3. Therefore, promoting the new genotypes with an average yield of 31 t/ha could potentially increase production in Cameroon to 12,353,035 tons with the current production areas  which would represent an increase from 11 to 24% of the cassava production in Central Africa. It is worth noting the sharp increase in yield of the check I010040-27 which almost doubled within two years after its first evaluation. Cassava's potential to alleviate food and nutritional security in Central Africa would substantially increase if neighboring countries sharing similar ecologies with Cameroon \u2014where cassava is an essential food security crop\u2014also adopt the new genotypes.The observed resistance to major disease was translated into a higher yield for the improved genotypes.These varieties could also be carriers of genes for higher yield. Current cassava production in Cameroon  stands at 5,798,909 tons  with an average yield of 14.5 t/ha (resp. 8.9 t/ha)40. Dry matter content was constant for all genotypes across all environments. As a polygenic trait, dry matter varies from one genotype to another (20\u201340%) and is usually stable across locations41. Genotypes with high dry matter (>\u200930%) are generally mealy with high starch content44, making them suitable for processing into flour and starch which have been shown to improve the potential for cassava adoption and commercialization for income generation and livelihoods improvement45.Two genotypes  produced the highest and most stable fresh root yield across locations, which are qualities that favors them for dissemination throughout the targeted environments to improve cassava yields and hence food security. Overall, tested cassava genotypes performed best at Ekona and Bambui, probably because of the high K and Organic C in their soils8, thus justifying the improvement of their nutritional content and the need to promote them for nutritional security in central Africa. Total carotenoid content is known to be affected by the location in which the genotype is grown, especially in sweet potato (Ipomoea batatas (L.)46, but it appears not to be the case for cassava as the levels of provitamin A (\u03b2-carotene) of a genotype were stable across all the different environments used in the present study and elsewhere47. These results are very encouraging, but it would be necessary to conserve as much of the provitamin A as possible when cassava is transformed into different products\u2014including cooking\u2014to harness the full potential of biofortified cassava\u2019s contribution to reductions in vitamin A deficiency48.Nutritionally-biofortified genotypes evaluated in this study contain up to 6-folds higher provitamin A \u03b2-carotene compared with the local genotype, underlining the potential contribution of the biofortified genotypes to nutritional security in Cameroon and central Africa. These varieties have almost 3 times (up to 11.1\u00a0\u03bcg/g) the level of carotenoids contents of our previous set of yellow varietiesThis study identified high-yielding cassava genotypes with higher levels of resistance/tolerance to pests and diseases and with elevated provitamin A-improved nutritional content. Disseminating the selected genotypes for cassava production in Cameroon\u2014and by extension elsewhere in Central Africa\u2014would improve cassava production for food and nutritional security. Despite the good performance of most of the tested genotypes, there is also a strong need to conduct consumer preference studies to match the usability of these newly developed varieties to actual use of cassava in the area of introduction to ensure proper adoption by the end-users in the various agro-ecologies.www.cassavabase.org). All improved genotypes were tested along with two cassava genotypes from our recent work8 which were used here as references (1) for high yield (I010040-27) and (2) for high susceptibility to cassava mosaic virus disease (LMR). Including reference genotypes is a common practice in such studies. The present and previous8 study were conducted in the same locations (not same fields) in Cameroon and followed a similar methodology to provide a basis for comparisons between them. The first study8 used mostly white-fleshed genotypes oriented toward industrial processing, while the second (present) study emphasized a new set of white-fleshed genotypes for boiling and yellow-fleshed genotypes with higher total carotenoids content. The studies complied with the local and national regulations in Cameroon.IITA had the permission to collect all the plants used in this study. The improved cassava genotypes used were selected in Nigeria by the IITA cassava breeding unit and sent to IITA Cameroon. Accession names and their pedigree are available in the cassava database Table  . The locations of Mbalmayo, Meyomessala, and Gamboula are in the humid forest zone which is characterized by a bimodal rainfall pattern, while the locations of Njombe and Ekona are in the humid forest with monomodal rainfall patterns. The locations of Foumbot and Bambui are in the Western Highlands while Meiganga is in the high Guinean savannah Fig.\u00a0. VegetatThe trial was set-up in a completely randomized block design with three replicate blocks comprised of 5\u2009\u00d7\u20096\u00a0m plots of 42 plants (with 1\u00a0m spacing between and within rows) of each of the 12 genotypes. Plants were grown under rainfed conditions for 12\u00a0months and managed according to prevailing farmer practices. Pesticides and fertilizers were not used at any time during the trials. Plots were manually weeded with machete and hoe as needed.49. Total N was determined from a wet acid digest50 and analyzed by colorimetric analysis. Exchangeable Ca, Mg, K, and P were extracted using the Mehlich-3 procedure51, and the cations were determined by flame atomic absorption spectrophotometry. Exchangeable P from the resulting extract above was determined with the molybdate blue procedure52. Particle size was determined with a hydrometer.At each location, 5 soil samples were collected from each plot and mixed thoroughly in a plastic basin to obtain a composite soil sample. A subsample of 250\u00a0g of soil from each plot was used for the determination of various soil physical and chemical properties at the IITA-Cameroon Analytical Laboratory. Soil samples were air-dried and ground to pass through a 2-mm sieve. The sample was further ground to pass through a 0.5\u00a0mm sieve for C and N analysis. Soil pH in water was determined in a 1:2.5 (w/v) soil: water suspension. Organic C was determined by chromic acid digestion and spectrophotometric analysisBemisia tabaci Gennadius) was counted on the top  of the plant, while the number of nymphs was counted on the 14th fully developed leaf53. The cassava green mite (CGM) was counted on the fifth fully developed leaf using a head lens . CMD incidence (presence/absence) was scored on the whole plant foliage, while CAD incidence and severity were scored based on disease symptoms on the stems. Disease and damage scoring was done on a scale of 1 (no symptoms observed) to 5 (severe symptoms on plant parts)54.Cassava disease incidence and severity were evaluated at 3, 6, and 9\u00a0months after planting on 10 plants per plot, excluding border rows, while alternating plants within a row. On each plant, the number of whitefly adults , above-ground biomass (stems and leaves) and storage roots were weighed using Macro scales type with optional accessories . Samples of 500\u00a0g of the fresh root of each genotype were collected and oven-dried at 60\u00a0\u00b0C for 48\u00a0h to measure their dry matter content. Total carotenoid content (TCC) in storage roots was determined within 24\u00a0h of harvest using iCheck Carotene following the BioAnalyt protocolIncidence data was calculated for CMD and CAD for each plot by calculating the percentage of sampled plants that showed symptoms of the diseases.56 to perform a stability analysis of multi-environment trial data (MET57) using parametric and non-parametric. MET allows the identification of genotypes that display a small temporal variability\u2014which is desired by breeders and is beneficial to growers, or cultivars that are consistent from location to location\u2014which is desired by and is beneficial to seed companies and breeders57. Incidence data were calculated for CMD and CAD by calculating the percentage of sampled plants that showed symptoms of the diseases. Whitefly and CGM densities were log-transformed to reduce heteroscedasticity inherent in insect and mite counts. The best linear unbiased prediction (BLUP) was used to predict Breeding Values (BV) of each genotype for cassava mosaic disease incidence and severity, cassava anthracnose disease incidence and severity, whitefly and cassava green mite densities, fresh root yield (FRY), biomass (BY), dry matter (DM), total carotenoid content (TCC), CMD and CAD severity. The BLUP was performed using the linear mixed model's approach (ANOVA) that considered cassava genotype as fixed factor and locations and year as random factors. The model also included genotype by location (G\u2009\u00d7\u2009L) interactions.We used the metan package of the R 3.6.2 software60.To select genotypes that combine high performance and stability, we introduced the weighted average of absolute scores from the singular value decomposition of the matrix of best linear unbiased predictions for the genotype\u2009\u00d7\u2009environment interaction effects generated by a linear mixed effect model index (WAASB), which is a superiority index that allows weighting between performance  and stability (WAASB index). The first step is rescaling FRY and WAASB; CMD and WAASB that can be directly used to compare genotypes. The best values for FRY and CMD are the highest value and for WAASB is the lowest value"}
{"text": "Scientific Reports 10.1038/s41598-020-77405-3, published online 24 November 2020Correction to: The original version of this Article contained an error. An affiliation was omitted for the author Jan Komdeur, which is now listed as Affiliation 4:Nature Seychelles, Victoria, Mah\u00e9, SeychellesThis has now been corrected in the HTML and PDF versions of this Article, and in the accompanying Supplemental Material."}
{"text": "Nanoporous Shape Memory Alloys (SMA) are widely used in aerospace, military industry, medical and health and other fields. More and more attention has been paid to its mechanical properties. In particular, when the size of the pores is reduced to the nanometer level, the effect of the surface effect of the nanoporous material on the mechanical properties of the SMA will increase sharply, and the residual strain of the SMA material will change with the nanoporosity. In this work, the expression of Young\u2019s modulus of nanopore SMA considering surface effects is first derived, which is a function of nanoporosity and nanopore size. Based on the obtained Young\u2019s modulus, a constitutive model of nanoporous SMA considering residual strain is established. Then, the stress\u2013strain curve of dense SMA based on the new constitutive model is drawn by numerical method. The results are in good agreement with the simulation results in the published literature. Finally, the stress-strain curves of SMA with different nanoporosities are drawn, and it is concluded that the Young\u2019s modulus and strength limit decrease with the increase of nanoporosity. Functionally gradient materials and porous materials are new smart materials developed to meet the needs of modern aerospace industries and other high-tech fields ,2,3,4. AAs the size of the material decreases, the properties of the material will change. For example, microcarbon has higher power storage performance and is often used as a supercapacitor ,10,11. PResearch into the macro-mechanical properties of nanoporous materials with interfacial effects has attracted more and more attention from scholars at home and abroad in recent years. Sharma predicted that the effective elastic modulus of nanoporous materials depends on the size of pores ,15. Xun Most of the above studies are about porous carbon or single metal nanoporous materials, but the research on nanoporous SMA is rarely mentioned, especially the effect of size on material properties. In view of this, the relationship between the mechanical properties of SMA materials with nanopores and the surface effects, especially the relationship between the mechanical properties of SMA materials and different nanopore diameters or nanoporosities, respectively, is discussed in this work. Combining the framework of micromechanics theory including surface effect, firstly, the effective Young\u2019s modulus of nanoporous SMA is calculated by composite material equivalent method. A constitutive model of SMA with nanopores considering surface effect and residual strain is then established.When the size of the material reaches the nanometer level, the surface effect needs to be considered. The stress corresponding to the surface effect is the surface stress, which can be defined in many ways. Nix et al. proposed an atomic interpretation of surface/interface stress, in which the relationship between surface stress and strain is attributed to the change in the bonding environment of atomic bonds . Bottomlensor \u03b5s , which iSun et al. pointed out that when considering the change of the stress field, the effective elastic properties will be affected by the surface stress . Therefo follows (3)\u03ba3=3\u03baApplying the above theory to nanoporous SMA materials, using SMA as the matrix, and degenerating the nano-inhomogeneous inclusion into nanopores, i.e., (There are four unknown constants and two unknown quantities r models .(18)\u03be={However, it is difficult to measure the elasticity Lame constants Then the Young\u2019s modulusResidual strain refers to the strain that the material cannot return to its original state after being unloaded. Shape memory alloys with large porosity exhibit greater macroscopic residual strain. It has been found that the residual strain increases approximately linearly with the increase of porosity by Sourav Gur et al. . In ordeThe research on the constitutive model of SMA has been fully developed in recent decades, and it has been reported in detail in theoretical research and experiments ,28. In tFor SMA with nanopores, the constitutive model considering the surface effect and the porosity of nanopores can be expressed as follows:.\u00a0where\u03benp={0\u00a0\u00a0\u00a0In order to obtain the analytical solution of the model in this paper, the surface elastic constants of aluminum are assumed to be the surface elastic constants of nanoporous SMA. The surface elastic constants of aluminum are taken from the papers of Miller and Shenoy, in which two sets of surface moduli are used, namely,2=\u221292.41 . The numvSMA=0.3 ).For brevity, define It is seen from  by Zhao . The surThe variations of the Young\u2019s modulus The value of The relationship between the normalized Young\u2019s modulus From In this paper, the effective Young\u2019s modulus of SMA with nanopores can be obtained. Gur et al. established a nanoporous NiTi shape memory alloy model with different porosities. The initial size of the model is 250 \u00c5 \u00d7 250 \u00c5 \u00d7 250 \u00c5, and the pore size is 10\u201350 \u00c5. And through molecular dynamics simulation, the stress-strain curves of NiTi shape memory alloys with different porosities were obtained , from whIn this work, based on the micromechanical framework and considering the surface effect, the effective Young\u2019s modulus of the SMA with nanopores is obtained. Based on Young\u2019s modulus and residual strain, a constitutive model of nanoporous SMA is established. In the numerical results, the effective Young\u2019s modulus is plotted against nanopore radius, nanoporosity and martensite volume fraction, and the stress\u2013strain curves of SMAs with different nanoporosities are plotted.The effective Young\u2019s modulus of nanoporous SMA, which is independent of the volume fraction of martensite, depends on the radius of nanopores and nanoporosity.The surface effect decreases with the increase of nano pore size, and the effective Young\u2019s modulus of nanoporous SMA is close to the macroscopic theory when the nano pore radius exceeds 50 nm.The constitutive model of nanoporous SMA is derived, which is in good agreement with the simulation data in the literature."}
{"text": "BPaL, a 6 month oral regimen composed of bedaquiline, pretomanid, and linezolid for treating extensively drug-resistant tuberculosis (XDR-TB) is a potential alternative for at least 20\u2009months of individualized treatment regimens (ITR). The ITR has low tolerability, treatment adherence, and success rates, and hence to limit patient burden, loss to follow-up and the emergence of resistance it is essential to implement new DR-TB regimens. The objective of this study was to assess the acceptability, feasibility, and likelihood of implementing BPaL in Indonesia, Kyrgyzstan, and Nigeria.We conducted a concurrent mixed-methods study among a cross-section of health care workers, programmatic and laboratory stakeholders between May 2018 and May 2019. We conducted semi-structured interviews and focus group discussions to assess perceptions on acceptability and feasibility of implementing BPaL. We determined the proportions of a recoded 3-point Likert scale , as well as the overall likelihood of implementing BPaL  that participants graded per regimen, pre-defined aspect and country. We analysed the qualitative results using a deductive framework analysis.In total 188 stakeholders participated in this study: 63 from Kyrgyzstan, 51 from Indonesia, and 74 from Nigeria The majority were health care workers (110). Overall, 88% (146/166) of the stakeholders would likely implement BPaL once available. Overall acceptability for BPaL was high, especially patient friendliness was often rated as acceptable . In contrast, patient friendliness of the ITR was rated as acceptable by 45%. Stakeholders appreciated that BPaL would reduce workload and financial burden on the health care system. However, several stakeholders expressed concerns regarding BPaL safety (monitoring), long-term efficacy, and national regulatory requirements regarding introduction of the regimen. Stakeholders stressed the importance of addressing current health systems constraints as well, especially in treatment and safety monitoring systems.Acceptability and feasibility of the BPaL regimen is high among TB stakeholders in Indonesia, Kyrgyzstan, and Nigeria. The majority is willing to start using BPaL as the standard of care for eligible patients despite country-specific health system constraints.The online version contains supplementary material available at 10.1186/s12889-021-11427-y. Despite increasing access to new diagnostics and anti-tuberculosis (TB) medicines, treatment success rates for extensively drug-resistant TB (XDR-TB) remain low and contribute to the ongoing transmission of DR-TB . GloballThe Global Alliance for TB Drug Development (TB Alliance) has developed a 6 month oral regimen consisting of three drugs: bedaquiline (Bdq), the new drug pretomanid, and linezolid (Lzd). This BPaL regimen was successful in over 90% of patients with XDR-TB, multidrug resistant TB (MDR-TB) treatment failure, or intolerance to MDR-TB treatment in the Nix-TB trial . Side efImplementation of the BPaL regimen would entail essential changes in clinical and programmatic TB management . The redTo ensure rapid adoption after the regimen is endorsed by regulatory authorities, evidence is needed on health care system readiness, barriers and requirements among those implementing the intervention \u201313. The We used a concurrent mixed methods design. The qualitative component, consisting of semi-structured interviews and focus group discussions (FGD) among stakeholders, explored the acceptability and feasibility of seven aspects of PMDT, comparing ITR and BPaL. The seven aspects of PMDT were: patient baseline assessment and monitoring of treatment efficacy, treatment safety monitoring, patient friendliness, patient support, programmatic aspects, human resources, and procurement and supply chain management (PSCM).For the quantitative component of the study, we used a Likert scale to quantify how acceptable stakeholders perceived each PMDT aspect for ITR and BPaL, as well as the overall likelihood of implementing BPaL. We triangulated the two data types to explore if quantitative findings could be explained by the qualitative results.We conducted the study from May 2018 \u2013 May 2019 among health care workers , programmatic stakeholders  and laboratory stakeholders  in Indonesia, Kyrgyzstan, and Nigeria. Target participant numbers per subgroup are shown in Supplementary file\u00a0We chose Indonesia, Kyrgyzstan, and Nigeria to depict various geographical settings , with differences in TB burden  and DR-TB) and health systems infrastructure. The estimated TB incidence per 100,000 population in 2018 was 316 in Indonesia, 116 in Kyrgyzstan and 219 in Nigeria . The estThe conceptual framework from Atun et al.  guided tWe developed the interview guide and questionnaire  and PMDT aspect. We also determined the proportion of stakeholder that chose likely, neutral and not likely per scenario of implementing BPaL as SoC. We stratified results by country.A total of 194 stakeholders participated in this study. Four Kyrgyz participants were excluded from all analyses due to inaudible recordings and two Kyrgyz participants were excluded due to declined consent for recording. Three stakeholders in Indonesia and three in Nigeria did not fill out the questionnaire for the quantitative part. Thus in total, 188 stakeholders were included in the qualitative data analysis and 182 in the quantitative analyses (97 and 94% respectively)  as the Nigerian health care worker: \u201c \u2026 (compared to the) individualized treatment regimen (there are many) benefits are \u2026 no matter how somebody tries, taking a drug for 20 months is not easy \u2026 in terms of adherence, \u2026 out of pocket cost, \u2026 side effects \u2026 (with the 6 months regimen) they (the patients) are going to be treated quickly and \u2026 resume their normal economic activities \u2026 I think there are more benefits for them.\u201d [FGD]Another benefit was that stakeholders believed that the BPaL regimen would increase patients\u2019 quality of life during treatment and would improve treatment adherence, which would contribute to higher treatment success (Table Indonesian caregiver: \u201cSide effects (of BPaL are) \u2026 much less \u2026 compared to the individualized (regimen) \u2026 so for the patient\u2019s level of \u2026 adherence \u2026 perhaps it\u2019d be better because what happens so far, the patient cannot bear the side effects and becomes lost to follow up... he stops taking the medication.\u201d [interview]Besides the reduction of side effects being a benefit, a challenge participants opted was about the side effects of (high-dose) Lzd, including myelosuppression (bone marrow suppression (which leads to reduced production of blood cells) and peripheral neuropathy  , it is very low the patient is dying slowly...\u201d [FGD]In terms of benefits, stakeholders perceived BPaL to be more patient-friendly compared to the ITR resulting from its shorter treatment duration, lower pill burden per day, fewer anticipated side effects, lower financial burden, decreased requirements for higher level of care, and reduced patient discomfort (including risk of hearing loss) due to the removal of injectables Table\u00a0.Nigerianss Table .Indonesin) Table . StakehoIndonesian health care worker: ( \u2026 ) we should pay attention to ( \u2026 ) supervise them (the patients) taking ( \u2026 ) the drugs \u2026 We have to provide counselling for the patients to remind them the importance of taking the drugs. It is the same.\u201d [FGD]Participants thought the BPaL regimen would allow cutting costs for patient support due to its shorter duration, while they thought the type/form of patient support required was the same Table , includiIndonesian Programmatic Stakeholder: \u201cThe initial phase and this would be a challenge if it [BPaL] is (implemented) in Puskesmas [Indonesian primary health centres], in an outpatient setting \u2026 because we must still separate the patients that have been (tested) negative from the patients who are still positive..\u201d [Interview]Despite the anticipated cost reduction for DR-TB treatment with BPaL, stakeholders from all countries considered current high costs of Bdq and Lzd a challenge . Some Kyrgyz and Nigerian stakeholders had experienced supply challenges with the introduction of the shorter regimen , Bdq and Delamanid (due to lack of registration). They therefore had concerns about sufficient supply of new drugs.Kyrgyz health care worker: \u201cSo, its (safety) is unclear yet. For example, with linezolid we notice that side effects are irreversible and with pretomanid we don\u2019t know are they reversible or irreversible... it is not studied yet \u2026 \u201d [Interview]Indonesian and Nigerian stakeholders expressed challenges about current health systems gaps, especially at lower health care levels where BPaL may be implemented. These challenges included limited availability of ancillary drugs (Indonesia) and currently weak monitoring systems for regular haematology and electrocardiogram (ECG) (Nigeria). Stakeholders opted as practical requirement that safety monitoring and side effect management should be guaranteed and provision of ancillary drugs should be free of charge:Nigerian programmatic stakeholder: \u201cWe will have to strengthen our system to ensure that patients\u2019 baseline and follow up investigations are done \u2026 when they are due so that we will be able to pick up any side effect at an early stage. If that is done, it will make it (BPaL) more friendly, but when that is not done patients will run away from it.\u201d [Interview]For monitoring of treatment safety, stakeholders considered it a benefit that BPaL has shorter duration and less audiometry requirements. However, many also perceived challenges due to uncertainties about safety, possible need for intensified monitoring due to the high-dose of Lzd in the regimen and lack of experience with pretomanid:Nigerian health care worker: \u201cIn case we adopt the BPaL and somebody has a serious adverse event (so) that you need to discontinue the linezolid, then what will happen to the potency of the regimen? \u2026 If you need to discontinue one of the drugs, what happens to the efficacy of the regimen?\u201d [FGD]Another major challenge expressed by Kyrgyz and Nigerian stakeholders was on safety concerns and the applicability of BPaL among children, pregnant women, and patients with comorbidities.Although some participants perceived the current expected low prevalence of drug resistance to drugs in the BPaL regimen as beneficial, participants from all countries had considered the emergence of resistance to BPaL or its components as a challenge. Nigerian health care workers were also concerned about baseline Lzd resistance as the drug is widely used for other diseases. Other challenges mentioned were about dose related Lzd intolerance and efficacy of the regimen when continuing treatment with only two drugs contributing to resistance to the remaining drugs or weakened regimen efficacy:In Indonesia and Nigeria, the lack of diagnostics and Drug Susceptibility Testing (DST) capacity for regimen allocation was expressed to be an important health systems challenge. This included the lack of access to GeneXpert MTB/RIF and/or second-line line probe assay testing in some areas, and the lack of DST capacity for Bdq and Lzd with liquid culture or genetic sequencing on a large scale.Kyrgyz programmatic stakeholder: \u201cEvery patient should have an individual approach. Seriously ill patients with side effects, with additional comorbidities they need a completely different approach.\u201d [Interview]Moreover, stakeholders stressed the importance of introducing BPaL under operational research conditions. The need was expressed for clear local guidelines, capacity building, and training on the use of BPaL. Stakeholders flagged the need for training on monitoring and management of DR TB treatment, related adverse events, and guidance on dealing with patients who fail on a regimen. Clear guidelines on Treatment efficacy- and safety monitoring, management of adverse events, as well as patient support would be needed to support decentralized implementation.Stakeholders expressed the need for clinical studies in certain groups and in a national context. They expressed the need for adjusted treatment guidelines among specific groups:Other crucial practical requirements expressed for BPaL implementation were the needs for diagnostic capacity for DR-TB, regimen design including the drug composition of only three drugs Table . PSCM plWe assessed the acceptability and feasibility of implementing BPaL among key stakeholders in TB care and management from Indonesia, Kyrgyzstan, and Nigeria. Study participants found BPaL more acceptable than the ITR because of anticipated benefits such as improved patient-friendliness and reduced health system burden as a result of increased patient-friendliness, likelihood of improved adherence and anticipated reduced cost of BPaL. Additionally, stakeholders considered the implementation of BPaL feasible within the local health care infrastructure if efforts are undertaken to address practical requirements such as gaps in current treatment and safety monitoring systems that have become more apparent with introduction of recent new drugs and regimens as well as efficient diagnostic and DST capacity.Triangulating the qualitative and quantitative results indicated higher overall patient-friendliness score for BPaL (93%) in comparison to the ITR (45%) could be linked to stakeholders\u2019 anticipated patient challenges with the current ITR which will be improved with BPaL, i.e. shorter duration, absence of injectables, lower pill burden, and lower financial burden to the patient. The shortened treatment duration and reduced costs may explain the higher overall acceptability of BPaL patient support in comparison to the ITR (85% vs. 69%). The higher overall acceptability of programmatic aspects of BPaL (83%) as compared to the ITR (60%) might be linked to the anticipated benefits of improved treatment outcomes as well as reduced financial burden to the health system due to the shorter treatment duration and increased possibility for the decentralization of treatment provision. Higher acceptability scores for the baseline assessment and treatment efficacy monitoring may be driven by stakeholders perceiving BPaL as beneficial in terms of being less burdensome and cost-saving as compared to the ITR. The higher acceptability for human resources for BPaL (79% vs. 59%) could be linked to the benefit of reduced burden on health care workers. The higher acceptability of PSCM (BPaL 80% vs. ITR 67%) may be explained by stakeholders\u2019 positive expectation that PSCM will become simpler, with only three drugs compared to the 15 in ITR. Acceptability ratings in Indonesia may be lower due to concerns about complexities relating to local regulatory requirements and approvals, along with requirements to procure linezolid locally at a very high price. Similar acceptability scores on the treatment safety monitoring on BPaL and ITR may be explained by the expected benefits such as shorter duration (resulting in less treatment monitoring visits and actions) being offset by challenges relating to BPaL safety, and current health systems gaps.Our findings aligned with those of Thomas et al. , and VegMany stakeholders were especially concerned about the side effects of Lzd, including myelosuppression and neuropathy. The ZeNix trial is assessing the efficacy, safety and tolerability of various doses and durations of Lzd in the BPaL regimen . ConsequThe stakeholders showed concern regarding the potential emergence of resistance to novel drugs such as Bdq, which highlights the need for development of rapid DST for new medicines . CurrentThis study has some limitations. We did not include patients in this study. We aimed to represent their experiences indirectly by interviewing health care workers. As per the design of the assessment, many questions regarding the BPaL regimen were of a hypothetical nature and participants did not have any practical experience with BPaL at the time they were interviewed. Therefore, there may have been misconceptions leading to biased perceptions around BPaL. To mitigate these biases we provided each participant with standardized information about BPaL based on the available evidence from the Nix-TB trial. We used convenience sampling for selection of our interviewees. We acknowledge that this method may lead to a non-random sample. We aimed to limit this bias by inviting participants based on a clear guidance on expertise and positions. Another limitation was that the data collection tools were only piloted in Nigeria, the translated tools were not piloted which could have caused misinterpretation due to lingual and cultural differences. Each country employed at least 1 but no more than 3 interviewers to conduct interviews. This may have caused variability, which we tried to minimize by training of interviewers and standardizing semi-structured questionnaires. We addressed this by having an interviewer present who speaks the local language and as we reached data saturation, we do not expect the variability to have limited the quality and richness of our qualitative data.To our knowledge, this is the first study to assess the acceptability and feasibility of the implementation of the BPaL regimen compared to current treatment options, thus providing unique insights from a health care system perspective. The participants appreciated being engaged in identifying and discussing concerns on safety and capacity early on; the richness of the discussions and the findings highlighted the usefulness of early stakeholder engagement when developing implementation strategies for new drugs and regimens. Studies using similar methods could be relevant to conduct future implementation research for a variety of novel drug interventions. A broader perspective should be obtained by also assessing patient perspectives. This limitation notwithstanding, our study provides some baseline evidence that could be useful for the conduct of more robust studies on this, and related research topics.Our assessment provides rich information from different stakeholder groups on perceptions and expectations on the BPaL regimen. It shows that the adoption of BPaL in three high DR-TB burden countries will be accepted and feasible. BPaL could increase the treatment success rate and alleviate the individual and health care system burden of DR-TB. Active TB drug-safety monitoring and management is crucial to address concerns on linezolid safety. National strategic plans should incorporate both the identified and anticipated country-specific challenges and requirements to facilitate smooth roll out of the BPaL regimen.Additional file 1.Additional file 2.Additional file 3."}
{"text": "To evaluate the relationship between pancreatic parenchyma loss and early postoperative hyperglycemia in patients with benign pancreatic diseases.A total\u00a0of 171 patients with benign pancreatic tumors or chronic pancreatitis, whose preoperative fasting blood glucose (FBG) was normal and who underwent partial pancreatectomy were reviewed. The pancreatic volume was measured by CT imaging before and after the operation. According to their different pancreatic resection volume (PRV), 171 patients were divided into five groups: < 30%, 30%\u201339%, 40%\u201349%, 50%\u201359%, and \u2265 60%. The correlation between the PRV and postoperative FBG was investigated. According to the postoperative FBG value, the patients were divided into a hyperglycemia group (HG) and nonhyperglycemia group (non-HG) to explore the best cutoff value of the PRV between the two groups.R\u00a0=\u00a00.727 and 0.651, respectively). ROC curve analysis showed that the best cutoff value of the PRV between the HG (n\u00a0=\u00a084) and non-HG (n\u00a0=\u00a087) was 39.95% with an AUC = 0.898; the sensitivity was 89.29%, and the specificity was 82.76%.There were significant differences in the postoperative FBG among the five groups . The PRV was positively correlated with postoperative FBG in the benign tumor group and chronic pancreatitis group (There was a linear positive correlation between the postoperative FBG level and PRV. Patients with a PRV \u2265 40% are more likely to develop early postoperative hyperglycemia. In recent years, the number of surgeries for benign pancreatic diseases has increased rapidly , 2. On tThe pancreas is an important endocrine organ in the human body. Loss of the pancreatic parenchyma directly leads to decreases in the numbers of multiple endocrine cells  and affects the secretion of hormones such as insulin, glucagon, somatostatin, and pancreatic polypeptides, thus affecting the regulation of blood glucose by the pancreas . EndocriThe postoperative survival time of patients with pancreatic malignant tumors is limited, and for patients with malignant tumors, the first consideration is tumor section followed by preservation of pancreas function. For patients with curable and long-lived benign pancreatic diseases, it is necessary to explore the effect of pancreatic parenchyma loss on postoperative blood glucose. Postoperative hyperglycemia may lead to long-term complications and a decline in the quality of life in these patients. In this study, our aim was to measure pancreatic volume by CT imaging and to explore the relationship between pancreatic parenchyma loss and postoperative blood glucose to provide some reference for the maintenance of pancreatic function after partial pancreatectomy.In this study, retrospective data from patients who underwent partial pancreatectomy in our hospital from October 2016 to October 2020 were collected. The inclusion criteria were as follows: (1) resection of the pancreatic parenchyma; (2) plain and contrast-enhanced CT images before and two week after the operation; (3) available pathological results provided after the operation; (4) no use of hypoglycemic drugs or insulin; and (5) no use of hormones, antipsychotics, or antitumor drugs. The exclusion criteria were as follows: (1) poor image quality that could not be used for analysis; (2) pathological results indicative of malignant tumors; (3) functional neuroendocrine tumors; and (4) diagnosed diabetes mellitus or impaired fasting blood glucose before surgery , 22 with nonfunctional neuroendocrine tumors of the pancreas, 3 with schwannomas, and 53 with chronic pancreatitis .This study was approved by the ethics committee of our institution. CT examinations were performed for preoperative diagnosis and postoperative evaluation of recovery. Blood glucose measurement is a parameter included in clinical biochemistry blood tests. This study only collected these results, did not interfere with the patient\u2019s treatment plan, and did not divulge the patients\u2019 personal information.The blood glucose levels of the patients during the hospitalization period were statistically analyzed. The average FBG level 7 days before the operation was taken as the preoperative FBG value (results of 2 to 5 tests over 7 days), and the average FBG value 14 days after the operation was defined as the postoperative FBG value .According to the postoperative FBG, the patients were divided into three groups. FBG \u2265 126 mg/dL (7.0 mmol/L) was classified as the hyperglycemic group (HG), FBG 110 mg/dL\u2013126 mg/dL (6.1 mmol/L\u20137.0 mmol/L) was classified as the impaired fasting blood glucose group (IFG), and FBG < 110 mg/dL (6.1 mmol/L) was classified as the normal glycemia group (NG).CT was performed with a Siemens SOMATOM Definition AS+ 128 CT scanner. The voltage of the tube was 120 kV, the tube current adopted intelligent current regulation technology, the pitch was 1.0, the width of the collimator was 0.6 mm\u00d7128, the layer thickness was 2.0 mm, the layer spacing was 2.0 mm, and the visual field was 390\u00d7390 mm. The enhanced scan was performed with a nonionic iodine contrast agent (350 mg I/ml), which was injected into the median cubital vein with a high-pressure syringe at a flow rate of 2.5 ml/s and a total volume of 1.0 ml/kg. The arterial phase, portal phase, and delayed phase were scanned 25\u201330 s, 55\u201365 s, and 150\u2013180 s after injection, respectively.Measurement of the pancreatic volume was performed on a Siemens syngo.via postprocessing workstation. Portal venous phase images from the enhanced CT scans were selected for measurement. At this time, the enhancement of the pancreas was obvious, the boundary was clear, and the contrast between normal pancreatic tissue and the tumor, surrounding fat, and peripheral blood vessels was clear, which could effectively avoid interference.3) was automatically calculated according to the delineated area and layer thickness. The volume of the pancreas was measured by two radiologists with 3-5 years of working experience who were blinded to the patients\u2019 clinical information, and the average value of the measured results was taken as the final result. The uniformity between the two radiologists was tested using the intraclass correlation coefficient (ICC).The outline of the pancreas of the patient was drawn layer by layer (layer thickness = 2 mm) to avoid peripheral blood vessels, surrounding organs, tumors (including the cystic part and the solid part), stones (larger than 5 mm), calcification (larger than 5 mm), inflammatory exudation, postoperative necrosis, etc., and only the enhanced pancreatic parenchyma was outlined  = preoperative pancreatic volume (cm3) - postoperative pancreatic volume (cm3) and PRV ratio = (1-postoperative pancreatic volume/preoperative pancreatic volume) \u00d7 100%. According to the PRV, 171 patients were divided into 5 groups based on resection volume: < 30%, 30%\u201339%, 40%\u201349%, 50%\u201359%, and \u2265 60%.The following equations were used to calculate the relevant parameters: PRV  curves were used to analyze the best cutoff value, sensitivity, and specificity of the PRV among the different postoperative blood glucose groups. The chi-square test was performed on a variety of clinical factors in the HG, IFG, and NG. Among the 171 patients, 76 were male and 95 were female, with an average age of 49.1 \u00b1 13.3 years. A total of 71 patients underwent DP, 61 patients underwent PD, 25 patients underwent DPPHR, 11 patients underwent EN, and 3 patients underwent CP.P\u00a0=\u00a00.162). However, there was a significant difference in postoperative FBG between the benign pancreatic tumor group and the chronic pancreatitis group (P\u00a0=\u00a00.010). The postoperative FBG in the chronic pancreatitis group was higher than that in the benign pancreatic tumor group. There was a significant difference in FBG before and after the operation (P\u00a0<\u00a00.001) and the blood glucose level after surgery was higher than that before surgery\u00a0 , IFG (n\u00a0=\u00a052) and NG (n\u00a0=\u00a035). As shown in Table\u00a0According to postoperative FBG, 171 patients were divided into three groups: HG . The IFG and NG were combined to form the nonhyperglycemia group (non-HG). ROC curve analysis showed that the best cutoff value of the PRV between the HG and non-HG was 39.95% with an area under the curve (AUC) of 0.898 (P\u00a0<\u00a00.001); the sensitivity was 89.29%, and the specificity was 82.76% . ROC curve analysis showed that the best cutoff value of the PRV between the HG and non-HG was 39.99% with an AUC of 0.909 (P\u00a0<\u00a00.001); the sensitivity was 86.79%, and the specificity was 90.77% . When comparing the benign tumor and chronic pancreatitis groups, we found that there was a statistically significant difference in postoperative FBG with the chronic pancreatitis group presenting a higher postoperative FBG. One possible reason is that benign tumors of pancreas may have no adverse effect on the background pancreatic parenchyma, and the compensatory ability of the residual pancreatic parenchyma is strong after partial pancreatectomy, while chronic pancreatitis, as an irreversible chronic inflammatory disease of the pancreas, may also affect the function of the residual pancreas, thus affecting the regulation of blood glucose after surgery [From Table\u00a0 surgery , 14.Due to the high variability in the locations of pancreatic tumors, the selected procedure and scope of resection also differ. The chosen operation will reduce the pancreas parenchyma while removing the lesion. Pancreatic glands are nonrenewable and pancreatic parenchyma loss directly leads to the loss of many kinds of endocrine cells and impacts the secretion of hormones, thus affecting pancreatic-mediated regulation of blood glucose . SeveralP\u00a0<\u00a00.001), which was consistent with the cutoff value of new-onset postoperative diabetes in the abovementioned study. At the same time, we also found that there were significant differences in postoperative FBG levels in the different PRV groups , and the correlation analysis between the PRV and postoperative FBG indicated that there was a positive linear correlation.In the study, we found that patients with a PRV \u2265 40% were more likely to develop early postoperative hyperglycemia , 21% after DP (95% CI: 16%\u201325%), and 6% after CP (95% CI: 3%\u20139%) . CompareP\u00a0=\u00a00.037) [In the pancreas of healthy adults, islets are mainly distributed in the body and tail . In fact=\u00a00.037) . In our This study is a single-center retrospective study in which the long-term blood glucose index values of the patients were not available, so it was unable to analyze longitudinal changes in glucose metabolism after the operation, which limits our interpretation of the results. At the same time, because the number of patients with chronic pancreatitis undergoing surgery is limited, they were not divided into separate groups in the analysis of postoperative blood glucose. Therefore, extending the postoperative follow-up time and further expanding the number of cases will be goals for our next study.In summary, there was a positive linear correlation between the postoperative early blood glucose level and the PRV in patients with benign pancreatic lesions. Furthermore, patients with a PRV \u2265 40% were more likely to develop early postoperative hyperglycemia."}
{"text": "The walkability of a neighborhood impacts public health and leads to economic and environmental benefits. The condition of sidewalks is a significant indicator of a walkable neighborhood as it supports and encourages pedestrian travel and physical activity. However, common sidewalk assessment practices are subjective, inefficient, and ineffective. Current alternate methods for objective and automated assessment of sidewalk surfaces do not consider pedestrians\u2019 physiological responses. We developed a novel classification framework for the detection of irregular walking surfaces that uses a machine learning approach to analyze gait parameters extracted from a single wearable accelerometer. We also identified the most suitable location for sensor placement. Experiments were conducted on 12 subjects walking on good and irregular walking surfaces with sensors attached at three different locations: right ankle, lower back, and back of the head. The most suitable location for sensor placement was at the ankle. Among the five classifiers trained with gait features from the ankle sensor, Support Vector Machine (SVM) was found to be the most effective model since it was the most robust to subject differences. The model\u2019s performance was improved with post-processing. This demonstrates that the SVM model trained with accelerometer-based gait features can be used as an objective tool for the assessment of sidewalk walking surface conditions. Walking is one of the most popular and cheapest forms of physical activity. A high level of walking in a community leads to various public health, environmental, and economic benefits ,2,3,4. TTo take pedestrians\u2019 perceptions into account, one of the common sidewalk assessment practices is through pedestrian interviews or surveys . HoweverWith the advancement of wearable sensors, it is possible to measure and analyze human physiological responses to surrounding environments. The portability and affordability of these sensors makes it possible to develop a real-time sidewalk condition monitoring system that incorporates the personal characteristics of pedestrians. A few studies have been conducted on using machine learning techniques for sidewalk assessment utilizing smartphone acceleration data collected from subjects. To our knowledge, no studies have been conducted on utilizing machine learning techniques that incorporate gait analysis to assess sidewalk walking surface conditions with a single accelerometer. Furthermore, no study has determined the most suitable placement of a single wearable sensor to assess walking surface conditions.In this study, we propose a novel classification framework for the walkability domain that uses machine learning to analyze gait features extracted from a single wearable accelerometer for the detection of irregular walking surfaces. We also identify the most suitable location on the human body to place a single accelerometer for irregular walking surface detection. We determine the most effective machine learning model along with an optimal subset of gait features that best discriminates between good and irregular walking surfaces, which can be implemented as a real-world application for identification of problematic walking areas in a continuous manner. Furthermore, the optimal subset of gait features helps to understand gait parameters most affected by irregular walking surfaces.The remainder of the paper is structured as follows: First, we present a review of related works. Next, the experimental design and the research methodology utilized in this work are discussed. The results are then provided followed by a discussion on the findings and implication of this study.A pedestrian survey is one of the common approaches used to detect sidewalk defects . This meMany advanced methods have been proposed to automatically assess roadways based on urban data such as images, videos, or GIS technologies ,14,15,16Only a few methods have been proposed to assess sidewalk or roadway surfaces in an automated fashion that incorporates human bodily responses using machine learning techniques. Miyata et al.  estimateSeveral studies have discovered that it is feasible to utilize pedestrians\u2019 physiological responses measured with wearable sensors placed at various locations to detect different sidewalk characteristics or defects ,27,28. TSeveral studies have placed sensors at different locations to examine the effects of the external environment and irregular surfaces on subjects\u2019 gait parameters. In examining the correlation between pedestrians\u2019 gait patterns and the built environment, Kim et al. utilized acceleration data from the right ankle to compute gait parameters . AnotherEmploying sensors at multiple locations for real-time continuous monitoring is not practical. Furthermore, adding data from multiple locations in the analysis causes the process to be computationally intensive . In addiThe workflow of incorporating gait analysis with machine learning techniques is illustrated in Twelve healthy subjects\u2014eight males and four females\u2014were recruited to participate in the study. The subjects wore three accelerometers at different locations on the body. As shown in The linear accelerations of the body were measured using Mbient sensors . These tri-axial accelerometers were configured to sample data at 100 Hz. The experiment was set up to mimic a real-world sidewalk setting. A stretch of well-paved, smooth, and levelled walking paths at The Peter Kiewit Institute of the University of Nebraska at Omaha, denoted with starting and ending points, was selected for the experiment. Within that stretch, four irregular walking surface segments were created: a grass-covered surface segment, a surface segment with obstructions, an uneven surface segment, and a debris-covered surface segment. These walking segments are typical walking surfaces that are likely to be encountered in the real-world. X, Y, and Z axes of the ankle accelerometer represent signals in Vertical (V), Anteroposterior (AP), and Mediolateral (ML) directions, respectively, as illustrated in X, Y, and Z axes represent V, ML, and AP directions, respectively.The For data pre-processing, the timestamp data from the three accelerometers were first synchronized using the synchronize function in MATLAB R2022a . Then, the raw acceleration data were labelled by referring to the video recordings. Since the aim was to analyze gait patterns to detect irregular walking surfaces, all irregular walking surface scenarios were grouped into one Irregular class. Before extracting gait features, stride segmentation was first performed on the raw data using the AP directional acceleration of the right ankle accelerometer for accurate stride recognition . The strWe extracted features that have demonstrated to be useful in mobility studies ,37. FirsWe first determined the most suitable sensor location for irregular walking surface detection. To ensure that the most suitable sensor location was subject agnostic, we used a protocol that iterates through all 12 subjects to leave one subject out as the test set and the remaining subjects as the training set. For each iteration, the three sensor locations were evaluated using a stratified five-fold cross-validation (CV) method repeated five times to compare the classification performance of each of the classification models mentioned in Since incorporating additional features is computationally costly for sensor-based systems and affects model interpretability, there is a need to systematically identify the optimal subset of the original extracted feature set of the most suitable location. We compared two popular feature selection techniques in this study: Elastic Net (ENET) and Maximum Relevance and Minimum Redundancy (MRMR). Prior to selecting features, the extracted features were normalized to zero mean and scaled to unit variance.i-th stride, respectively. Multicollinearity occurs when there is a strong correlation between features that could lead to excessively complex models and overfitting. ENET  is a popThe optimal \u03b1 and \u03bb parameters were selected using a stratified five-fold CV with a grid search. This was repeated 12 times using the leave-one-subject-out as the test set protocol. Gait studies on mobility have demonstrated that good prediction metrics can be achieved with only eight to 10 features while balancing model complexity and computational cost ,37. HencTo identify the optimal number of ENET top features to include in the final ENET feature subset, based on the feature profile, we added the features one-by-one starting with the most important feature, and ran our models using a repeated stratified five-fold CV to obtain the performance metric. The classification performance across all models would improve until they plateau as more important features were added. We determined the optimal number of features threshold based on the model that yielded the best metrics across all iterations of feature adding, since we are evaluating ENET and MRMR based on the best metric that each method can achieve. The threshold would be the point where the rate of improvement of the metric decreases. We identified that threshold objectively using an algorithm called Kneedle . This isMRMR ,41 is a k features we would like to select. The MRMR framework iterates k times until the top k features are selected. At each iteration, each feature would be scored based on this formula:Y is the class label, S is the set of selected features, |S| denotes the number of features, S is one of the features in the feature set, and Y is measured with an F-statistic as denoted by F, Random Forest (RF), Logistic Regression (LR), Ada Boost (ADA), and Extreme Gradient Boosting (XGB). SVM, RF, LR, and ADA are classification algorithms commonly used for gait analysis. XGB  was seleTo select the most effective model, we trained the top three classifiers observed during feature selection using the best feature subset. We used the leave-one-subject-out as the test set protocol to evaluate the subject-wise generalizability of our final models. As each iteration would yield a different training set, we tuned the hyperparameters for classifiers at each iteration using a randomized search with a stratified five-fold CV. The optimized models were then evaluated using the test set. The classifiers were compared using the test metrics averaged across all subjects.Since the class imbalance problem may bias certain performance metrics such as accuracy except for the area under the ROC curve , the AreBased on the label distribution in We used an over-sampling technique called Synthetic Minority Oversampling TEchnique (SMOTE) . SMOTE cTo determine whether the impact of the location on the classification performance is statistically significant for each classifier, a one-way ANOVA test was performed. Based on the results of Tukey\u2019s pairwise test in Since the right ankle accelerometer is the most suitable location for discriminating between good and irregular walking surfaces, we performed feature selection on the right ankle feature set for optimal feature subset selection.From the leave-one-subject-out as the test set protocol, the optimal \u03bb ranged from 0.001 to 0.01 while \u03b1 ranged from 0.0 to 0.9. It resulted in 17 features, since the top 10 features selected in each iteration differ. Some features were selected as frequently as other features, which means they have the same importance and usefulness in discriminating between good and irregular walking surfaces. Therefore, to determine the optimal number of top ENET features to include in the final ENET feature subset, we added the features batch-by-batch instead of one-by-one, starting from the most important feature, and ran them through all five models. As observed in We then used the Kneedle algorithm to objectively identify the threshold that balances the trade-off between model performance and training computational cost. Since different curves produced by different classifiers would yield different thresholds, we used the Kneedle algorithm to identify the optimal number of ENET top features based on the model that yields the best metric across all iterations, which is RF. Based on The frequency profile of the top 10 selected features by MRMR compiled from the leave-one-subject-out as the test set protocol is shown in There are 17 features in total. To determine the optimal number of top MRMR features to include in the final MRMR feature subset, we added one feature batch at a time moving down the importance rank and evaluated them with our models. The results are illustrated in Therefore, we ran the Kneedle algorithm on the performance results of both models. As we can see from The best classification performance achieved by the full feature set and feature subsets selected by ENET and MRMR is shown in Looking at We trained our top three classifiers identified during feature selection with the optimal feature subset. The test results for all three classifiers for each subject iteration including the average test results are shown in k consecutive strides were sampled into one segment to produce the final prediction for that segment, sliding to the next segment by the step size of one stride. The results are shown in k, the classification performance improved across all three classifiers, which confirmed our assumption. With post-processing, the average AUC of the most effective model, SVM, improved from 80% to 85%.We observed that when subjects were walking on irregular walking surfaces, interrupted gait occurred intermittently among normal gaits. Not every stride was interrupted. Up until this point, we detected irregular walking surfaces on a per stride basis by predicting if each stride occurred on an irregular surface or not. Therefore, we assumed that if we combined several consecutive strides\u2019 walking surface predictions by a classifier and took the average of the predicted probability of occurring on an irregular walking surface of the combined gaits to produce a final prediction of the walking surface covered by the combined gaits, it would improve the classification metric. We use a sliding window approach to segment the per stride prediction obtained from classifiers for each subject. In this study, we identified the most suitable placement of a single accelerometer for the purpose of discriminating between good and irregular walking surfaces, which is at the ankle. Then, we selected the optimal subset of gait features extracted from the raw accelerations of the ankle sensor to train several machine learning classifiers for comparison. The most effective model could detect irregular walking surfaces with satisfactory classification performance. Our results demonstrate the feasibility of utilizing wearable accelerometers and a machine-learning approach to differentiate good and irregular walking surfaces.Our results show that the accelerometer placed at the right ankle had better capability of estimating walking surface conditions compared to accelerometers placed at the hip and the head. It improved the classification performance of various models. This could be because changes in the magnitude of accelerations were smaller at the head and the hip compared to the ankle when subjects were walking on irregular walking surfaces. Therefore, changes in underlying stride parameters could be better captured when the sensor was placed at the ankle. Furthermore, as the ankle sensor was closer to the ground, a subtle gait adaptation for each stride when walking on irregular walking surfaces can be captured. Therefore, we recommend that a wearable acceleration sensor be placed at the ankle when implementing the proposed method in a real-time walking surface condition assessment application.This study also determined an optimized feature set that balances computational cost for a real-time sensor-based system, model interpretability, and classification performance. The optimized feature set consisted of eight features: VM, VVMD, VMD, VM30, AVM, LVMD, VHSD, and VVM. The feature VM was found to be the strongest predictor. AVM and VVM, which characterize the whole stride acceleration of the ankle sensor in different directions, were also selected. They may have been selected because subjects would adapt their whole gait to maintain their stability while walking on irregular walking surfaces. Three out of eight features selected characterize the double-stance phase: VVMD, LVMD, and VMD. Since the double-stance phase occurs when the body weight transitions from one limb to another , stabiliSVM was found to be the most generalizable subject-wise despite the limited number of subjects. The results have demonstrated that SVM was more robust to individual differences compared to RF and XGB. Its classification performance was also further improved with post-processing by combining the predicted probability of several strides to produce final predictions. This means that when the proposed method is implemented as an application, at least five seconds of data need to be measured since the average stride time is around 1.10 s based on our data.Since current sidewalk condition assessment usually relies on trained experts from governmental agencies or voluntary participation of residents or pedestrians, the intervals between assessments are long due to staffing and budget limitations . On the One of the limitations of this study is that the experiment was not conducted in a real-world walkable and less walkable neighborhood. Subjects could exhibit different walking patterns in an experimental setting. The other limitation is that the sample size in terms of the number of subjects is small. To address that, we drew conclusions repeatedly by iteratively leaving one subject out as the test set to evaluate our methods. Despite these limitations, this study is the first step towards an objective and automated assessment of sidewalk walking surface conditions of a neighborhood.For future work, we will develop a deep learning model for the same purpose with a single accelerometer placed on the ankle. We are considering using a Long Short-Term Memory network, which is widely used in the domain of human activity recognition. Future experiments will be conducted in a real-world walkable and less walkable neighborhood with more subjects. The best machine learning classifier and the optimal feature set can be used to develop an irregular walking surface detection model utilizing real-world data. Additionally, GPS data can also be incorporated to locate and identify the cause of problematic walking surface areas.In this study, we proposed a novel method for irregular walking surface detection using machine learning techniques and accelerometer-based gait features extracted from a single sensor. We also identified the most suitable location for sensor placement among the three locations commonly used to measure the effect of external environment on subjects\u2019 gait parameters, the optimal feature set, and the most effective classifier for irregular walking surface detection. Our results indicate that the most suitable location for sensor placement is a subject\u2019s ankle. We also find that SVM is the most effective model because it is the most generalizable and can achieve satisfactory classification performance with limited data. Furthermore, we also demonstrate that classification performance can be improved by taking several consecutive strides into account to make predictions. In conclusion, our results support the potential application of the proposed method as an objective tool for assessing the sidewalk walking surface condition of a neighborhood."}
{"text": "In this study, we aimed to build a machine-learning predictive model for the identification of triple negative breast cancer, the most aggressive subtype, using quantitative parameters and radiomics features extracted from tumor lesions on hybrid PET/MRI. The good performance of the model supports the hypothesis that hybrid PET/MRI can provide quantitative data able to non-invasively detect tumor biological characteristics using artificial intelligence software and further encourages the conduction of additional studies for this purpose.18F-FDG PET/MRI is effective in molecular subtyping of breast cancer (BC) and specifically in discriminating triple negative (TN) from other molecular subtypes of BC. Methods: Eighty-six patients with 98 BC lesions  were included and underwent simultaneous 18F-FDG PET/MRI of the breast. A 3D segmentation of BC lesion was performed on T2w, DCE, DWI and PET images. Quantitative diffusion and metabolic parameters were calculated and radiomics features extracted. Data were selected using the LASSO regression and used by a fine gaussian support vector machine (SVM) classifier with a 5-fold cross validation for identification of TNBC lesions. Results: Eight radiomics models were built based on different combinations of quantitative parameters and/or radiomic features. The best performance  was found for the model combining first order, neighborhood gray level dependence matrix and size zone matrix-based radiomics features extracted from ADC and PET images. Conclusion: A ML-based radiomics model applied to 18F-FDG PET/MRI is able to non-invasively discriminate TNBC lesions from other BC molecular subtypes with high accuracy. In a future perspective, a \u201cvirtual biopsy\u201d might be performed with radiomics signatures.Purpose: To investigate whether a machine learning (ML)-based radiomics model applied to  Breast cancer (BC) is a heterogeneous disease with a multifactorial etiology  affecting the capability of cells to repair DNA damages ,2,3. In The assessment of molecular subtypes is, therefore, the \u201csine qua non\u201d for treatment planning of BC. In patients with TNBC, it is especially important as they usually require upfront systemic treatment before surgery. Currently, the assessment of molecular subtypes is performed through invasive tissue sampling using invasive core needle biopsy, an approach inherently limited by sampling bias and providing only a snapshot of the biology of the entire tumor. Indeed, molecular biomarkers are likely to differ within the tumor, a phenomenon known as intratumor heterogeneity . The dev18F-fluorodeoxyglucose positron emission tomography (18F-FDG PET) as well as magnetic resonance imaging (MRI) diffusion-weighted imaging (DWI), and dynamic contrast-enhanced (DCE) techniques are the gold standard for the in vivo assessment of tumor metabolism (18F-FDG PET), cellularity (DWI) and neoangiogenesis (DCE) [18F-FDG PET and MRI have shown high sensitivity [18F-FDG PET/MRI has been shown to be promising for the accurate and non-invasive biological characterization of BC [Developments have led to sophisticated imaging techniques that can depict the functional properties of breast tumors and their underlying biology. Currently, is (DCE) ,12,13. Fsitivity ,15. Moreon of BC .18F-FDG PET/MRI for BC phenotyping, specifically for hormone receptor-positive  BC identification has been demonstrated [Initial studies have demonstrated the potential of radiomics analysis coupled with machine learning (ML) based on either PET or MRI (both DCE and DWI) for the comprehensive assessment of tumor phenotypes and for the development of predictive models ,18,19. Mnstrated ; neverth18F-FDG PET/MRI can identify the radiomic signature of TNBC. Therefore, we aimed to build an ML-based predictive model using both quantitative imaging parameters and radiomic features extracted from simultaneous 18F-FDG PET/MRI to distinguish TNBC from other molecular BC subtypes.We hypothesized that AI-enhanced simultaneous 18F-FDG PET/MRI of the breast between June 2016 and June 2020. Inclusion criteria were: >18 years-old subjects; histologically verified BC lesions; and not pregnant or breastfeeding. Exclusion criteria were: patients with standard contraindications for performing MRI examinations ; patients for whom histological proof of malignancy was not available; patients with malignant lesions other than BC; tumor recurrence; incomplete 18F-FDG PET/MRI examinations; and patients with PET, DCE, or DWI images that were not suitable for subsequent multiparametric and radiomics analyses. Patients included in this study have been investigated in a previous study with different purpose and results [This prospective single-institution study was approved by the institutional review board, and written informed consent was obtained from all participants. All patients underwent simultaneous multiparametric  results .18F-FDG PET/MRI was performed as previously described [18F-FDG PET/MRI protocol are reported in Simultaneous escribed , using aA board-certified breast radiologist and a nuclear medicine physician with 7 and 11 years of experience, respectively, independently evaluated all PET/MR images, using a previously described method that proved to be highly reproducible .MR images were analyzed for both DWI and perfusion-weighted imaging (PWI) quantitative parameters using a free, open-source software . In detail, 2D circle ROIs were placed on apparent diffusion coefficient (ADC) maps for ADCmean calculation of tumor lesion and contralateral breast parenchyma. Thereafter, 2D ROIs were drawn over tumor lesions on first post-contrast DCE images and then pasted on perfusion maps DCE maps for the extraction of quantitative perfusion parameters, including mean transit time (MTT), plasma flow (PF), and volume distribution (VD), according to previous evidence . DetailsPET images were analyzed for the quantification of tumor uptake using the Hermes Hybrid Viewer . Maximum, mean, and minimum standardized uptake values  were calculated by placing a 3D volume of interest (VOI) with a fixed threshold at the level of tumor lesions; care was taken to exclude surrounding background parenchymal uptake. The same approach was used for the extraction of SUVmean of the ipsilateral and contralateral normal appearing breast parenchyma, away from the nipple and areola.Whole BC lesions were segmented on T2-weighted, DCE, DWI, and PET images using a dedicated software . DCE (first post-contrast timepoint), DWI, and PET images were annotated using a semi-automated method selecting a lower boundary of signal intensity, while a slice-by-slice approach was used for segmenting BC lesions on T2-weighted images. In all cases, VOIs were placed within the margins of the lesions and care was taken to exclude macroscopic necrosis as well as cystic and hemorrhagic areas or biopsy markers. Prior to the extraction of radiomic features, data for all images were reduced to 16 grey levels. The Computational Environment for Radiological Research (CERR), compatible with the Image Biomarker Standardization Initiative (IBSI), platform was used to extract radiomic features  from DCEAs our study dataset consisted of a limited number of cases relative to a high number of extracted features, radiomic feature selection was performed using Least Absolute Shrinkage and Selection Operator (LASSO) regression , and subMalignant tumor samples from core biopsy and/or surgical specimen were analyzed to define tumor histology, grade, and immunohistochemical status including ER, PgR, Ki-67 expression, and overexpression and/or amplification of HER2 of each breast cancer lesion. The St. Gallen surrogate molecular subtype definitions were used to classify breast lesions .t-test were performed to assess differences in terms of lesion size, quantitative parameters and radiomics parameters between TN and non-TN breast cancer subtypes. McNemar\u2019s test was used to assess differences in terms of diagnostic performance among the different radiomics models. p values \u2264 0.05 were considered statistically significant. Confidence intervals for diagnostic metrics were calculated using a bootstrapping approach. Statistical analysis was conducted using SPSS, Version 25.0. 2017 .The Kolmogorov\u2013Smirnov test was performed to assess whether data were normally distributed. Accordingly, the Mann\u2013Whitney test or independent According to the inclusion and exclusion criteria, 144 patients were initially enrolled in the study. Of these, 86 female patients (mean age 52 \u00b1 13 years) were included in the final study sample, with 98 histologically proven BC lesions (mean size: 28.31 \u00b1 16.8 mm), comprising 25 TN, 10 Luminal A, 51 Luminal B, and 12 HER2+ lesions. In detail, there were eight patients with two BC lesions in the same breast and four patients with bilateral BC lesions. The majority  of histological types was represented by ductal invasive carcinoma. The flowchart of patient inclusion is illustrated in p < 0.001). No differences were observed in terms of lesion size and remaining quantitative parameters between TN and non-TN lesions. Mean values of tumor size and quantitative parameters are reported in TN lesions showed significantly higher SUVmax (9.5 vs. 4.9), SUVmean (5.7 vs. 3.4), and SUVmin (3.1 vs. 2) compared with lesions of other BC subtypes , and DCE-MRI, ADC, and PET (Model 7); and quantitative parameters combined with radiomic features (Model 8). Quantitative parameters and/or radiomic features selected for each model are reported in Eight radiomic models (Models 1\u20138) were developed for TNBC identification, using the following combinations of quantitative parameters and radiomic features: quantitative parameters alone (Model 1); radiomic features extracted from ADC (Model 2), DCE (Model 3), PET (Model 4) and T2-weighted (Model 5) images; combinations of radiomic features extracted from different Across all models, the area under the receiver operating curve (AUC) ranged from 0.725  to 0.887 . Model 7 showed the best performance in discriminating TNBC from other BC subtypes, with a diagnostic accuracy of 82.8% (95% CI: 78.2\u201387.1%), sensitivity of 79.7% (95% CI: 71.6\u201386.5%), and specificity of 86.0% (95% CI: 80.8\u201390.4%). In detail, Model 7 included size zone matrix-based features extracted from ADC and PET images as well as first-order and neighborhood gray level dependence matrix-based features extracted from PET images. Of note, Model 1, based on quantitative parameters extracted from both primary lesions  and contralateral breast tissue (ADCmean), achieved the second-best AUC of 0.884 (95% CI: 0.867\u20130.898), followed by Model 8, combining quantitative parameters and radiomic features, which showed an AUC of 0.871 (95% CI: 0.849\u20130.889).18F-FDG PET/MR images, the best performing one was Model 2, based on features extracted from ADC maps, which yielded an AUC of 0.826 (95% CI: 0.758\u20130.984). On the other hand, the worst performing one was Model 5, based on features extracted from T2-weighted images, which yielded an AUC of 0.725 (95% CI: 0.679\u20130.765). Accuracy metrics of all radiomic model are reported in Among the models built using radiomic features extracted from individual p = 0.005). No differences were observed between Model 7 and the remaining radiomic models. Comparisons in terms of diagnostic performance among all models are reported in A statistically significant difference in terms of diagnostic performance was found using McNemar\u2019s test between the best performing model (Model 7) and the worst performing one (Model 5)  specifically included features extracted from functional images i.e., ADC and PET, supporting the hypothesis that functional data such as tumor cellularity and metabolism may better depict biological tumor features compared to morphologic sequences. It is worth noting that no significant differences in terms of diagnostic performance were found between Model 7 and all other models except for Model 5 which was based on solely on radiomic features extracted from T2-weighted images.In the present study, we evaluated AI-enhanced simultaneous 18F-FDG PET and MRI are already indicated for both local and global staging of locally advanced breast cancer as well as for treatment monitoring. As such, it is permissible to imagine that, with a single imaging examination, tumor diagnosis, staging, and phenotyping could be obtained non-invasively at the same time. In this light, \u201cvirtual biopsies\u201d could be performed once radiomic profiles specific to molecular subtypes have been defined, aiming at providing genetic and phenotypic alterations which are representative of the whole tumor and comprehensively describe tumor heterogeneity. Furthermore, the extraction of quantitative imaging data from the whole tumor could allow the spatio-longitudinal monitoring of biomarker heterogeneity changes during treatment and the early identification of clonal dynamics and genetic modifications related to the occurrence of drug resistance.Such findings support the expectation that, in the near future, molecular data could be non-invasively obtained by imaging through the application of artificial intelligence tools. This issue is particularly relevant if we consider that PET and MRI represent the most promising imaging modalities for this purpose, due to their ability to non-invasively inform on cancer metabolism, cellularity, and neoangiogenesis. Such properties are reported to be different between BC subtypes which exhibit different biological aggressiveness and behavior . TNBC is18F-FDG PET/MRI for a comprehensive analysis of molecular subtype, Ki67 expression, nodal status, and presence of distant metastasis in a population of 124 BC patients [So far, several attempts have been made to non-invasively define BC molecular subtype through the use of radiomics and machine learning applied to PET and MRI ,18,19. Ppatients . For thepatients . Howeverpatients . Furtherpatients . Five ra18F-FDG PET/MRI was limited due to high demand from clinical needs. Furthermore, TNBC is relatively rare compared to other subtypes, thus larger numbers can only be recruited in a multi-centric setting over a reasonable time period. Due to this limitation, we refrained from using a subset of cases as a held-out test set. Indeed, a five-fold cross-validation was used, as done in previous studies involving the preliminary assessment of the applicability of the model to an unseen population [Our study has several limitations to be acknowledged, the first being the relatively small sample size, as accessibility to simultaneous pulation ,39. Pote18F-FDG PET/MRI can non-invasively identify TNBC, the most aggressive tumor type requiring intensified treatment, with high accuracy. Additional investigations on larger cohorts of patients are necessary to validate our model and fully assess its generalizability.AI-enhanced simultaneous"}
{"text": "The impact of public health policies during the COVID-19 pandemic on people who inject drugs (PWID) has varied across regions. In other countries, recent research has shown that PWID access to harm reduction services, despite rapid adaptations, has been negatively impacted. Our study describes these impacts in a rural state.We conducted semi-structured interviews with PWID, community partners, and healthcare providers in the rural state of Maine (USA). We explored how changes made during the pandemic impacted access to harm reduction services, including basic services , syringe service programs, safe drug supply, low barrier treatment, and peer support. Interviews were analyzed using the framework method to apply Penchansky\u2019s model of access, with Saurman\u2019s modification, which includes six dimensions of access\u2014accessibility, availability, acceptability, affordability, accommodation, awareness.N\u2009=\u20099 community partners, N\u2009=\u20099 healthcare providers, N\u2009=\u200918 PWID). Policies such as mobile outreach expansion, mail delivery of equipment, and relaxed telemedicine regulations facilitated accessibility to syringe service programs and low barrier buprenorphine treatment. Public health policies, such as social distancing and screening policies, reduced contact, which subsequently reduced acceptability and awareness of many services. Elimination of the one-for-one needle exchange in some areas increased, acceptability , and affordability for PWID. However, some areas actually began enforcing a one-for-one needle exchange policy, which reduced affordability, acceptability, and awareness of services.We interviewed thirty-six stakeholders (Changes resulting from the COVID-19 pandemic have impacted all dimensions of access to harm reduction services among PWID. While some barriers to harm reduction services were unavoidable during the pandemic, we found that specific policy decisions mitigated service barriers, while other policies exacerbated them. Relaxing needle exchange policies were particularly helpful in facilitating access to harm reduction services by giving community organizations flexibility to adapt to the evolving needs of PWID. These results can inform policies and service delivery to optimally mitigate the negative impacts on PWID during, and beyond, the pandemic.The online version contains supplementary material available at 10.1186/s12954-022-00660-2. The impact of the COVID-19 pandemic on how people who inject drugs (PWID) access harm reduction services, particularly in rural areas of the USA, is poorly understood. Harm reduction services, such as syringe service programs (SSPs), basic services , safe supply, peer support, and low barrier buprenorphine treatment play important roles in mitigating adverse impacts of drug use, such as infections and overdoses . Prior tEvidence is emerging on the impacts of the COVID-19 pandemic on PWID in different regions of the USA. Interviews with people who use drugs (primarily methamphetamine), in rural communities in Oregon revealed limited access to SSPs during the pandemic . AnotherIn Maine, an emergency shut-down order was declared on March 31, 2020, shortly after the first presumptive COVID-19 case was identified . At thatawareness, accessibility, availability, acceptability, affordability, and accommodation. The model, which has been used in prior health service-related studies  is that it doesn't do a good enough job of communicating with drug users.\u201d (CP 2)Changes around the one-for-one needle exchange policy were also confusing for many PWID and community partners. For example, the executive order temporarily eliminated the one-for-one needle exchange policy in the state, but a few months into the pandemic, the city of Portland was instructed to enforce the one-for-one needle exchange policy. Several PWID who accessed the Portland SSP found the policy change both confusing and detrimental to their health. The reported confusion demonstrates that efforts to communicate these various changes were unsuccessful. One community partner suggested these issues predated the pandemic:\u201cPreviously, I was just able to go to a jail and work on those values, [\u2026] So a lot of that work was being established there. But now, because I'm not able to go in there and as people are coming out, I actually don't know what are the different services that are lacking.\u201d (CP 05)Lacking a robust system of communication to reach people who inject, organizations relied on informal channels and direct relationships between service providers and service users to relay information. Unfortunately, COVID-19 policies that limited visitors to correctional facilities and other spaces also impacted the ability of some community partners do in-person outreach in those locations. As a result, they reported missed opportunities to connect with PWID and link them to harm reduction services.I think we have a lot of recognition that there are people for whom this isn't a great form of connecting which is why we've been really maintaining our in-person outreach in the places that we have those programs to connect with primarily people who are unhoused, who are camping in the woods, who are really living in a way that doesn't facilitate doing a FaceTime with us. (CP 3)Many community partners increased their outreach efforts to be able to connect with more dispersed populations:Community partners attempted to share information when possible, informing clients about other services that were available during brief contact or including contact cards in bags distributed with safe injection supplied. Additionally, because of the temporary executive order that allowed for mail delivery of drug equipment, several mobile SSPs were able to mail flyers advertising their services. SSP clients that requested naloxone for overdose prevention received a flyer in the mail alerting them that they could contact the SSP for other equipment as well. This approach was found to increase awareness and reduce stigma around accessing safer use equipment. As more mobile SSPs set up in outdoor spaces, their presence also increased awareness about accessing safer use equipment.\u201cWe made a decision as a program early on that we were going to remain open as long as we could. And be available to support patients in the community...with additional safety measures in place...\u201d (Pr 1).Other facilitators that increased awareness to harm reduction services, specifically low barrier buprenorphine treatment, involved services simply staying open and visible outdoors. Two providers from a low-barrier urban clinic started delivering services outdoors early in the pandemic, which demonstrated to community members their availability:\u201c\u2026in terms of building that relationship for me has been consistency and has been presence. [\u2026] And so I think not having that face-to-face, to me has meant a lack of consistency and a lack of physical presence to build that baseline trust with each other, which then causes a lot of gaps in the services that people need.\u201d (CP 5).Some COVID-19 policies made particular harm reduction services less acceptable to PWID. Many service providers emphasized the ways that regular, face-to-face interactions allowed them to establish trusting relationships with their clients. New restrictions often prevented them from being present in the same space:\u201cYes, they do have them, but once again, sometimes with [PWID], it's all about trust and having that rapport with folks. So, some folks are very hesitant to engage with new providers, even though we try to encourage that and help to make referrals and all those sorts of things. It still can be a barrier.\u201d (CP 6)These relationships between clients and providers are also relevant to understanding difficulties adjusting to changing sites among PWID. Asked whether there are alternative services PWID can use, one community partner explained:While COVID-19 screening , testing, physical distancing policies and quarantine protocols were acceptable to some people, COVID-19 protocols also reduced acceptability to many participants seeking harm reduction services. For several reasons, including fears of COVID-19 testing and possible quarantine, PWID participants also preferred to avoid the shelters. Many stayed in tents, while others stayed in hotels or cars.ten or fewer people, reduced acceptability of services:\u201cThey get really frustrated\u2026you have to tell them \u2018Hey, there\u2019s 10 people here\u2026you got to wait down the street\u2026a lot of people have gotten so frustrated that they just left and they were like \u2018 I don\u2019t got time for this.\u2019 And then, where are they going without their safe using equipment?\u201d (CP 1)Service providers at mobile SSPs reported that guidelines around physical distancing, specifically staying six feet apart and only allowing gatherings of \u201cIt wasn\u2019t like this before\u2026It was just like \u2018I want you to be safe. Take as many as you need to be safe.\u2019\u2026I feel like, \u2018Why are they changing this all of a sudden? Do you want people safe or do you want health [problems]\u2026There\u2019s going to be a rise in infections and HIV, hepatitis C. Why are we regressing in this now?\u201d (PWID 17)Enforcement of the one-for-one syringe policy in Portland impacted access in a variety of ways detailed in each section. One impact was reduced acceptability, as established relationships between a Portland SSP and its clients were undermined:\u201c\u2026people are being given a hard time by the police a lot more\u2026they don't necessarily get arrested if they have more than 10 needles, but they get a ticket or they'll get a summons and they'll have to go to court. Or the police will just confiscate their stuff sometimes\u2026It ties in with this whole criminalization of being homeless, as well as criminalization of using drugs. \u201c (CP 7).Interactions with law enforcement in the setting of the one-for-one needle exchange policy in Portland specifically reduced access to safer use equipment. At the time of the study, due to regulatory barriers such as the requirement to carry less than 11 hypodermic needles, participants carrying more than the limit of safer use equipment reported issues with law enforcement:\u201c\u2026every time I go, the pharmacies are trying to say they don't have needles, and blah, blah, blah, and it's just like, you all can't be out .\u201d (PWID 12)Though not reported as a barrier exacerbated by the pandemic specifically, several PWID participants also felt that stigma was a barrier to accessing safer use equipment outside of SSPs. For example, PWID in rural areas experienced stigma when buying unused injection equipment and naloxone at community pharmacies:In terms of access to low barrier buprenorphine treatment, lack of face-to-face interactions reduced acceptability for some PWID and provider participants. For those PWID participants who still sought substance use disorder treatment in person, COVID-19 policies, particularly masking requirements, reduced acceptability. One PWID participant reported a history of kidnapping, and that wearing a mask was traumatizing for her, and masking requirements contributed to her decision to abandon a methadone program.\u201cI think we're really just trying to listen to the clients even more than we already have. [\u2026] we've always had a great staff, but I think they're really shining even more now. In the slower pace, you're really able to sit with folks more and hear them out and try to do things that you might not have otherwise had time for at one point [\u2026] Just let them know that while [this Site] doesn't look the same as it did three months ago, the spirit of [the Site] and our goal is still the same.\u201d (CP 6)In terms of other harm reduction services, trust in peers/community partners generally increased acceptability of peer support and SSP, so services that were able to continue operating were crucial. Some services actually increased outreach, or dedicated greater efforts to building relationships:\u201cIt seems there's been this real shift that has been really effective. People have been really accessing services that way. I think partly just because there's more anonymity. You can show up. You're in, you're out.\u201d (CP 3)Mobile SSPs also increased outreach. For some PWID, these new means of accessing safe injection/smoking supplies were more acceptable than previous options because they provided anonymity by operating in less populated, remote areas:The mail delivery of equipment was also appealing to many participants due to perceived anonymity and thus increasing acceptability of services. Regarding MOUD treatment, some providers speculated that the inconsistency of drug supply/contaminated drug supply encouraged more people to seek treatment with MOUD, though we were unable to corroborate this in PWID interviews. Some clients did report that telemedicine visits for MOUD to be more acceptable than in-person visits, largely due to reduced travel time and costs. Finally, while social distancing and screening policies decreased the acceptability of sites for some clients, community partners reported that others appreciated the increased protection from COVID-19.The ability of people to get to desired services was impacted in complicated ways, particularly as certain services transitioned from in-person provision to contact-less alternatives\u2014counseling and treatment provided through telemedicine, and the mailing of injection supplies. Clients were differentially impacted depending on their access to smartphones, internet service, or a permanent address. Participants reported that people who did not have access to a phone and/or video calling, particularly those in rural areas, had difficulty accessing peer support groups. Similarly, lack of cell phone coverage and limited data plans were major barriers to low barrier telemedicine services in rural areas .Mobile units that distributed safe use equipment and naloxone increased SSP accessibility by bringing equipment closer to clients. A shift to telemedicine for MOUD treatment meant that patients with smartphones and access to Wi-Fi were able to more easily access treatment, without the need to physically travel to clinics . The cli\u201cWe have had a hard time getting alcohol wipes, still waters, even fresh cotton, sterile cottons have been on back order\u2026\u201d (CP 1)Community partners at SSPs reported experiencing both a lack of personal protective equipment and shortages of safe injection supplies:\u201c[Do they have everything that you do need?] Yes and no. They don't really have a lot of the pipes and stuff right now. [\u2026] And when it runs out, it runs out. You never know what they're going to have or how much; it's all about the donations and the volunteers. Sometimes it's clunky, sometimes there's nothing.\u201d (PWID 3)These issues limited what could be offered to clients:Some harm reduction suppliers also experienced staff shortages, especially earlier in the pandemic. Staff and volunteers were sometimes sick or did not want to risk exposure to the coronavirus. To minimize COVID-19 transmission, some on-site SSPs switched to pre-packaging equipment. However, this \u201cone size fits all\u201d change may have resulted in decreased availability of preferred supplies for some clients.\u201cI've certainly have had a number of my patients seem to be doing worse in terms of their substance use, that they're admitting that they're using more as a way to cope with stress.\u201d (Pr 3)In the midst of this restricted supply, providers reported increased demand as some patients were using more drugs during the pandemic, possibly to cope with stress:\u201cPeople [are] either using substances that they're not familiar with or purchasing substances from somebody who they're not familiar with and getting something that they don't know what it is or they thought it was something else. So we're seeing a lot of that. We're seeing a lot of people\u2026using recklessly because they don't know when they're going to find something else.\u201d (CP 3)Increased substance use meant increased demand for unused equipment in the setting of reduced access. Service providers often expressed concern about unsafe use:\u201cWe have a supply distributor that's based out of Washington and certain things were just on back order and there was no getting around it. We're pretty much all getting together as the organizations. Like if one organization got 20 000 boxes of alcohol wipes, they were giving it out between the rest of us. [\u2026] Which gave all the organizations access, but limited access.\u201d (CP 1)During national shortages of medical supplies, outreach and community collaborations were important factors in increasing availability of basic services. Service providers reported increased communication between organizations to try and meet the needs of their clients:Furthermore, service providers described leveraging connections among organizations to get access to naloxone and allow more distribution. SSP collaborations and sharing of equipment was thus an important facilitator that increased availability of safer use equipment for many SSP clients in rural areas. Relaxing rules and regulations around buprenorphine prescribing made low barrier buprenorphine treatment more available. These changes particularly allowed providers to prescribe buprenorphine via telemedicine at the first appointment, and thereby increased access .\u201cThe first time the cops closed us down, they closed us down saying that, we're not an essential service, you know what I mean? I mean it was a big hit just hearing that, because it would be an essential service if it was a bunch of privileged kids getting girl scout cookies at Walmart.\u201d (CP 1)Some SSPs were instructed to close early in the pandemic, which reduced access to services.\u201c\u2026 we only distribute once a week per town\u2026I\u2019ve had so many reports of people saying that they\u2019re using supplies for money to get drugs because money\u2019s harder to come by. And that leaves them without the safe using supply. And then, they end up sharing\u2026.\u201d (CP 1).While several mobile SSPs re-opened during the pandemic, these services still had limited hours. According to some participants, the lack of optimal service access led to more unsafe injection practices:Limited hours reduced access to SSPs and other basic services , particu\u201cWe also kind of, on the fly, had to introduce a lot of COVID precautions that we really haven't been told to do\u2026things like gloves, keeping people six feet apart from one another, asking folks not to touch the table and the stuff with it... And my coworker\u2026 even fashioned a $3 six-foot distance pole, a basket on the end of a six-foot pole.\u201d (CP 2)Community resilience, particularly the commitment of walk-in clinics to remain open despite risks and challenges, allowed service providers to better accommodate clients. The resilience of peer support organizations also increased adequacy of services; community partners reported lack of clear guidance early in the pandemic, however they adapted quickly to COVID-19 social distancing policies.\u201cIt would be easier at the end of the day for me to get COVID. But honestly, if we\u2019re not helping people when they really need it the most, what are we even doing?\u201d( CP 1)Despite the risk of potential COVID-19 exposure, several peer services remained open through phone or video calls. Some participants reported some peer support meetings still taking place in person, despite COVID-19 social distancing policies. SSP outreach workers continued to deliver services, despite some limitations such as less face-to-face interactions and physical distancing outdoors. No clients of mobile SSPs in rural areas reported any issues with accessing unused equipment.Stricter adherence to the one-for-one needle exchange policy in the city of Portland reduced access to safer use equipment, as clients who appeared at the SSP without used needles to exchange were unable to acquire them. The enforcement of the one-for-one needle exchange policy also meant that some participants had to purchase equipment from pharmacies, which could also be cost prohibitive.Several PWID participants reported higher drug costs , as well as unemployment issues during the pandemic; if unable to afford travel costs to pharmacy or SSP, or if unable to afford equipment at pharmacies, financial challenges could affect their ability to access unused drug equipment and/or access low barrier treatment services.\u201cThe [SSP outreach workers] around here are pretty cool\u2026they\u2019ll give you as much as you need\u2026unless they\u2019re really, really short and they don\u2019t have a lot of supplies that day, but usually they just say take as much as you want, as much as you need, give them to your friends, pass them out. They\u2019re really\u2026awesome.\u201d (PWID 3)A key facilitator that increased affordability, i.e., how clients perceived services, was the elimination of a statewide policy requiring one-for-one needle exchange at SSPs. Most SSPs adopted the change, particularly those operating in non-urban parts of Maine, meaning that people could freely access safe supplies without the need to carry used and therefore \u201cillegal\u201d equipment. While some PWID expressed concerns that needles would not be disposed properly in special containers installed throughout the city, most reported positive impacts of the change:Relaxation of the one-for-one rule and restrictions on sites for SSPs also allowed mobile SSPs more flexibility to supply equipment throughout the state. Being able to access free equipment from mobile SSPs, also mitigated travel costs and equipment costs at pharmacies or other sites. In addition, PWID participants accessing treatment using video calls also reduced travel costs and therefore increased affordability of treatment services.\u201cI think the city, the police in particular, and city hall could do a lot to lift some morale of people that are sleeping in the park and that get kicked out. We woke up at eight this morning to police kicking on our tent, kicking it and saying, \"Hey, wake up. You guys got to move. You're not allowed to be in all of Portland with your tent.\" I mean, what the hell are we supposed to do? Move to the next town? I mean, I just sat down for the whole day, and now we feel hopeless, and alone, and even further down.\u201d (PWID 6)Many participants reported that PWID lack safe housing or shelter options and experienced reduced access to a variety of public services. Changes in operating hours, available supplies and restrictive policies exacerbated the perceived loss of resources. Additionally, enforcement of public health policies throughout cities and towns that prevented people from congregating left many PWID expressing feelings of abandonment:In this study, we found that changes that occurred during the COVID-19 pandemic affected harm reduction services across many dimensions of access. Notably, we identified several facilitators and barriers to accessing harm reduction services during the COVID-19 pandemic that have policy and service delivery implications. Policies that resulted in the elimination of the one-for-one needle exchange, expansion of mobile SSP units, and permission of mail delivery of safer use equipment were particularly important in improving accessibility, availability, acceptability, and affordability of harm reduction services. On the other hand, modifiable policies, such as restrictions on drug, needle/syringe and other unused equipment possession, as well as the implementation of the one-for-one needle exchange policy, restricted harm reduction service availability, acceptability and affordability.Harm reduction service changes that occurred during this study were similar to recent studies; SSPs, for example, adapted quickly, though still faced service disruption , 40. SerOur results suggest that the one-for-one needle exchange policy, which reduced availability to and affordability of safer use equipment in this study, is a policy that should be permanently eliminated. Increased access to safer use equipment can improve injection practices and minimize adverse outcomes, such as injection drug-use associated infections , 43. NotIn our study, the combination of mail delivery of safer use equipment with expansion of mobile SSP units increased service access. These services are particularly important for rural areas where distance is a barrier to SSP use . Mail deWe found that allowing mobile units and mail delivery of equipment described above, as well as supporting policies that reduce stigma, such as drug decriminalization, may facilitate increased trust. Trust in community partners and providers and community resilience were also important facilitators to accessing harm reduction services during the pandemic. These findings are in line with prior work , 48. SevWe also identified several barriers to accessing harm reduction services that are modifiable from a policy perspective. At the time of the study, due to state laws restricting the possession of more than one needle/syringe, as well as possession of drug of small amounts of drug, several participants reported harassment and other adverse outcomes from law enforcement. Lack of regulated, safe drug supply and the presence of new/unknown drug sources was raised as a serious concern due to overdose risk . Given tThere were several limitations to our study. Due to social distancing restrictions around COVID-19, interviews were conducted over the phone. In-person interviews allow more opportunities to build rapport with participants, facilitating additional information. Since this was not a longitudinal study, we did not build a relationship/rapport with PWID first, therefore it is possible some information was withheld due to distrust. Our recruiting methods favored PWID who were accessing harm reduction services or congregating in areas where our flyers were posted. Thus, our findings may not be generalizable to PWID disengaged from community services. Our sample was limited to people who speak English; therefore, we are missing perspectives from non-English speaking PWID. Since Maine is a state with predominantly (94.4%) white people , race/etIn this study, we identified facilitators and barriers to harm reduction service access in a rural state. Advocating for relaxed policies; specifically elimination of the one-for-one exchange policy, and allowance of mobile units and mail delivery of unused equipment, can facilitate increased access to harm reduction services. The use of telemedicine, particularly in rural areas, can also facilitate access to low barrier treatment for some PWID. Finally, strengthening support for SSPs should be a priority; SSPs were not only integral in making unused equipment accessible to PWID so they could use drugs safely, but they were also key in providing non-judgmental, innovative services to a population that is often otherwise neglected by society.Changes resulting from the COVID-19 pandemic have impacted many dimensions of access to harm reduction services among people who use drugs. Our study adds to the existing literature by identifying facilitators and barriers to accessing an array of harm reduction services in a rural context. We have included the perspectives of people who inject drugs, community partners and providers, all of whom have valuable insight on how to improve access to harm reduction services. Our results can inform policies and service delivery to maximally mitigate the negative impacts on people who use drugs, particularly in rural areas during, and beyond, the pandemic.Additional file 1. Interview guides.Additional file 2. Additional study participant information."}
{"text": "Background: Myeloid cells are critical determinants of the sustained inflammation in Crohn\u2019s Disease (CD). Targeting such cells may be an effective therapeutic approach for refractory CD patients. Bromodomain and extra-terminal domain protein inhibitors (iBET) are potent anti-inflammatory agents; however, they also possess wide-ranging toxicities. In the current study, we make use of a BET inhibitor containing an esterase sensitive motif (ESM-iBET), which is cleaved by carboxylesterase-1 (CES1), a highly expressed esterase in mononuclear myeloid cells. Methods: We profiled CES1 protein expression in the intestinal biopsies, peripheral blood, and CD fistula tract (fCD) cells of CD patients using mass cytometry. The anti-inflammatory effect of ESM-iBET or its control (iBET) were evaluated in healthy donor CD14+ monocytes and fCD cells, using cytometric beads assay or RNA-sequencing. Results: CES1 was specifically expressed in monocyte, macrophage, and dendritic cell populations in the intestinal tissue, peripheral blood, and fCD cells of CD patients. ESM-iBET inhibited IL1\u03b2, IL6, and TNF\u03b1 secretion from healthy donor CD14+ monocytes and fCD immune cells, with 10- to 26-fold more potency over iBET in isolated CD14+ monocytes. Transcriptomic analysis revealed that ESM-iBET inhibited multiple inflammatory pathways, including TNF, JAK-STAT, NF-kB, NOD2, and AKT signaling, with superior potency over iBET. Conclusions: We demonstrate specific CES1 expression in mononuclear myeloid cell subsets in peripheral blood and inflamed tissues of CD patients. We report that low dose ESM-iBET accumulates in CES1-expressing cells and exerts robust anti-inflammatory effects, which could be beneficial in refractory CD patients. Crohn\u2019s disease (CD) is a complex immune-mediated disease presenting as chronic inflammation of the gastrointestinal tract . ImmunomBromodomain and extra terminal (BET) domain-containing proteins are a family of epigenetic readers  that bind acetylated lysine residues of histone proteins to allow for transcriptional complex formation and gene expression 8). Regarding regulation of the immune response, the BET proteins are essential for the transcription of several inflammation-related genes and have therefore been targets of interest in drug development for inflammatory diseases and cancer . Regardi. Small mEsterase sensitive motif (ESM) technology has previously been described to achieve cell specific accumulation of the active drug, targeting mononuclear myeloid cells based on the presence of carboxylesterase-1 (CES1) . This apDetailed information on the materials, methods, and associated references can be found in the GSK3361191 (ESM-iBET) and its non-hydrolysable control GSK3235220 (iBET) were provided by GlaxoSmithKline . GSK3361191 (ESM-iBET) is a BET inhibitor with an esterase sensitive motif (ESM), and GSK3235220 (iBET) is a pan BET-inhibitor. GSK3361191 (ESM-iBET) is similar in its mechanism of action compared to an earlier published compound, GSK3358699 [The following clinical samples were analyzed: intestinal biopsies of inflammatory bowel disease (IBD) patients (CD patients and ulcerative colitis patients), PBMCs of CD patients, and fistula tract tissue of fCD patients. Samples were obtained from the department of gastroenterology and/or surgery at the Amsterdam UMC, University of Amsterdam, under the approval of the accredited Medical Ethics Committee  or the biobank committee of the Amsterdam UMC (178 #A201470). Intestinal biopsies, PBMCs, and fistula samples were cryopreserved and handled according to the methodology published by Konnikova et al. . Detaile2O and supplemented with 10% v/v of EQ Four Element Calibration beads . After acquisition, the data were normalized, and individual files were deconvoluted using the CyTOF software v6.7 functions. Different lineages  were clustered using FlowSOM and subsequent manual annotation [Human clinical samples (see description above) were immunophenotyped using a CyTOF Helios mass cytometer. Staining, barcoding, data acquisition, and mass cytometry analysis are described in the supplementary methods. We made use of three different antibody panels: a biopsy panel, a PBMC panel, and a fistula panel found in . Acquisinotation . Data isnotation ,26.We obtained buffy coats  from Sanquin Blood Bank, Amsterdam, and isolated the peripheral blood mononuclear cells (PBMCs) according to standard Ficoll  density gradient centrifugation protocol . We furtFor the in vitro culture for cytokine analysis, the CD14+ monocytes or PBMCs were pre-treated for 1 h with a concentration range of 0.002, 0.01, 0.04, 0.156, 0.625, 2.5, and 10 \u00b5M of either GSK3361191 (ESM-iBET), non-hydrolysable control GSK3235220 (iBET), or DMSO. After 1 h, cells were washed to remove the extracellular compound, stimulated with 10 ng/mL LPS dissolved in RPMI medium , and incubated overnight. Supernatant was collected, and cytokine  analysis was performed using Cytometric Bead Array (CBA) . Intracellular TNF\u03b1 protein expression was detected by flow cytometry analysis  and analyzed using FlowJo software . Cytokine data is visualized by normalizing the actual measured values to the DMSO control to correct for the biological variation in every individual donor. For in vitro culture for RNA transcriptomics analysis, CD14+ monocytes were pre-treated for 1 h with 40 nM of either GSK3361191 (ESM-iBET), non-hydrolysable control GSK3235220 (iBET), or DMSO. After 1 h, cells were washed and stimulated with 10 ng/mL LPS dissolved in RPMI medium  and incubated for 4 h. CD fistula samples were obtained from fistulizing CD patients undergoing surgery  at the Amsterdam UMC, location AMC. Fistula scrapings were mechanically digested by mashing and flushing through a 100 \u00b5m cell strainer  placed on a 50 mL tube , and immune cells were isolated using Ficoll isolation . Immune p-value < 0.05. Gene set enrichment analysis was conducted with the fgsea package (v1.20) [Transcriptomic analyses were performed through RNA sequencing. Briefly, mRNA was isolated using the Isolate RNA mini kit  and converted into cDNA. Subsequently, cDNA was sequenced in a 150 bp paired-ended fashion on the Illumina NovaSeq6000 to a depth of 40 million reads at the Amsterdam UMC Genomics Core Facility. The quality control of the reads was performed with FastQC (v0.11.8) and summarization through MultiQC (v1.0) . The raw (v1.20)  using th (v1.20) . Visuali (v1.20) .p \u2264 0.05, ** p \u2264 0.01, *** p \u2264 0.001, **** p \u2264 0.0001; SEM is the standard error of the mean.Statistical analysis was performed using GraphPad Prism 7.0 . Statistical testing was performed using a two-way ANOVA test; * In order to explore the potential application of ESM-conjugated molecules in the treatment of IBD, we examined CES1 expression in IBD clinical samples using mass cytometry analysis, with particular emphasis on the inflamed local tissue environment. First, we investigated the immune cell composition in intestinal biopsies collected from IBD patients during endoscopy. Biopsies were taken from six IBD patients and collected from inflamed areas (n = 6) or non-inflamed areas (n = 2). We were able to identify CD27\u2212 (na\u00efve) and CD27+ (memory) B cells (CD45+CD45RA+HLA-DR+CD69+CD44+), CD4 T cells (CD45+CD3+CD69+ CD2+CD4+CD5+CD28+), CD8 T cells (CD45+CD3+CD8a+CD5+), mononuclear myeloid cells (CD45+CD14+CES1+HLA-DR+CD11a+CD44+CD11b+), epithelial cells (CD45\u2212EpCAM+CD95+), and NK cells (CD45+CD45RA+CD161+CD2+CD7+) A,C. FurtNext, we aimed to define CES1-expressing immune cell populations in the peripheral blood of CD patients, determining whether CES1 expression, among identified populations, differs between biological therapy-responsive and non-responsive patients. Therefore, we isolated PBMCs from CD patients treated with the biological agent vedolizumab and analyzed them using CyTOF to define CES1 expression among identified immune cell populations. We identified CD4+ T cells, CD8+ T cells, NK cells, and B cells and extended the analysis of myeloid subsets to include classical monocytes (CD14+++CD16\u2212), intermediate monocytes (CD14++CD16+), non-classical monocytes (CD14+CD16++), cDCs (CD16\u2212CD14\u2212HLADR++CD11a+ CD2+), and pDCs (CD16\u2212CD14\u2212HLADR+++CD45RA+ CD2++) A,C, althNext, we explored the immune cell composition within the highly inflamed tissue environment of the fistula tracts of CD patients, using a penetrating phenotype that underwent surgical intervention (n = 13). We analyzed cells retrieved from CD fistula tract curettage material using CyTOF and established the presence of different immune cell subsets, including basophils, B cells, CD4+ T cells, CD8+ T cells, NK cells, and mononuclear myeloid cell subsets A,C. CES1Next, we evaluated the anti-inflammatory efficacy of an ESM-iBET (GSK33611910) and compared this to its non-hydrolysable iBET control (GSK3235220) in LPS stimulated monocytes and PBMCs from healthy donors. Since ESM-iBET specifically accumulates in CES1-positive myeloid cells, we hypothesized a more potent immunosuppressive effect in the monocytes. PBMCs from healthy donors (n = 3) were treated with a concentration range (0.002\u201310 \u00b5M) of ESM-iBET or iBET, and TNF\u03b1 expression from CD14-expressing cells was determined using flow cytometry A. The frNext, CD14+ monocytes from healthy donors (n = 3) were treated with a concentration range (0.002\u201310 \u00b5M) of ESM-iBET or iBET, and secreted inflammatory cytokines  were quantified with cytometric bead array (CBA). ESM-iBET demonstrated significantly increased potency to inhibit IL1\u03b2, IL6, and TNF\u03b1 secretion when compared to the control iBET, with calculated IC50 of 9.6 nM vs. 257.4 nM (IL1\u03b2), 19.1 nM vs. 269.4 nM (IL6), and 14.8 nM vs. 145.6 nM (TNF\u03b1) for ESM-iBET or iBET, respectively C. Subsequently, we extended these observations to evaluate ESM-iBET (GSK33611910) or iBET (GSK3235220) anti-inflammatory activity in immune cells retrieved from inflamed fistula tract of CD patients. Ex vivo isolated immune cells were treated with a concentration range (0.002\u201310 \u00b5M) of ESM-iBET or iBET, and inflammatory cytokines , secreted overnight, were quantified. Both inhibitors efficiently reduced secreted inflammatory cytokines at relatively higher concentrations when compared to PBMC and monocyte cultures, with calculated IC50 of 441.3 nM vs. 1185 nM (IL1\u03b2), 280.3 nM vs. 358.3 nM (IL6), and 150.4 nM vs. 255.2 nM (TNF\u03b1) for ESM-iBET and iBET, respectively. There was no significant difference between the concentration of ESM-iBET and iBET required to inhibit inflammatory cytokine secretions from fCD ex vivo isolated immune cells D.In order to gain more insight into the transcriptome changes mediated by BET inhibition, we compared monocytes pre-treated with ESM-iBET or iBET to the DMSO control treatment. In line with earlier functional assays , we expeWe identified 253 significantly differentially expressed genes (DEGs), of which 163 were upregulated and 90 were downregulated. Interestingly, visualizing the top 20 upregulated or downregulated DEGs in response to BET inhibition suggested that while both BET inhibitors functioned concordantly, ESM-iBET conferred a stronger effect, as opposed to iBET, at equimolar level concentrations B, in linFurthermore, we performed gene set enrichment analysis (GSEA) with functional annotation using the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways. Multiple inflammation-related pathways were among the top significantly negatively enriched pathways in response to ESM-iBET pre-treatment D. We couNext, we aimed to explore the inflammation related cytokines and chemokines ligands and their receptors that are targeted by BET inhibition in the monocytes. The gene set enrichment analysis (GSEA) of the cytokine\u2013cytokine receptor interaction pathway was negatively enriched in response to ESM-iBET treatment when compared to the DMSO-treated monocytes E. MultipNext, we explored whether ESM-iBET affects the transcription of inflammatory pathways and target genes of therapeutic interest in CD. TNF\u03b1 and JAK-STAT signaling pathways are key players in CD pathogenesis and therefore, are of important therapeutic relevance . GSEA shDysregulated innate immunity plays a fundamental role in the sustained and recurring inflammation in CD. Through epigenetic mechanisms, BET proteins are essential for inflammatory gene expression . In the In intestinal biopsies, CES1 was mainly restricted to the CD14-expressing myeloid cells. An earlier study demonstrated a toxic effect of non-selective BET-inhibitors on intestinal epithelial cells (14) and a worsening of DSS-induced colitis in a mouse model upon BET-inhibition (13), suggesting the toxicity of non-selective BET-inhibition on intestinal epithelial cells. In this context, we demonstrated that the majority of EpCAM+ epithelial cells did not express CES1, which is of particular interest here for the application of ESM-iBET in inflammatory intestinal diseases by sparing intestinal epithelial cells, while targeting inflammatory mononuclear myeloid cells. However, a small fraction of CES1-expressing epithelial cells (median of 8.5%) is noted, which may require further investigation to determine whether this reflects a specific epithelial cell subset and whether it may have a detrimental effect on CES1-assisted drug delivery applications in IBD.In CD peripheral blood PBMCs, CES1 expression is confined to the myeloid compartment, including classical monocytes (CD14+++CD16\u2212), intermediate monocytes (CD14++CD16+), non-classical monocytes (CD14+CD16++), cDCs (CD16\u2212CD14\u2212HLADR++CD11a+CD2+), and pDCs (CD16\u2212CD14\u2212HLADR+++CD45RA+CD2++), similar to the expression pattern demonstrated earlier in healthy donor blood (20). Interestingly, we observe the highest CES1 expression among circulating non-classical (CD14+CD16++) monocytes from CD patients, in contrast to healthy donors, where CES1 expression was the highest among classical monocytes (CD14+++CD16\u2212) (20). This may potentially be reflective of a preferential trafficking of CES1-expressing classical monocytes to the locally inflamed colon in CD patients, as classical monocytes are recruited to fuel the inflammatory process ,49. The Using a non-hydrolysable iBET control (GSK3235220), we demonstrated a higher potency of ESM-iBET (GSK3361191) to inhibit inflammatory cytokines in CES1-expressing monocytes in both PBMCs or purified CD14+ monocyte culture compared to equimolar concentrations of iBET (GSK3235220). This validates the specific CES1 assisted delivery of ESM-iBET and the augmented anti-inflammatory effect. However, despite the inhibition of inflammatory cytokine secretion from ex vivo immune cells retrieved from CD fistula tracts by ESM-iBET, no differential efficacy over similar concentrations of iBET was observed. This can be explained by the presence of other immune cells, such as T cells and B cells mixed with a low yield of CES1-expressing myeloid cells, within these cell preparations compared to PBMCs and purified monocytes; therefore, the contribution of ESM-iBET targeted CES1-expressing cells to overall secreted cytokines is minimal to demonstrate an observed difference. The transcriptomic analysis of ESM-iBET (GSK3361191)-treated monocytes demonstrates a potent inhibitory effect on multiple inflammation related genes and pathways. This is in line with earlier reports using other iBET in human primary monocytes , human aThe monocyte transcriptional analysis detailed herein demonstrates that ESM-iBET can efficiently target key components of multiple inflammatory pathways involved in the pathophysiology of CD. Within the JAK-STAT signaling pathway, ESM-iBET specifically downregulated STAT5A gene expression, in line with earlier reports ,61,62, wOverall, the monocyte transcriptomic analysis demonstrates a potent effect on multiple pathways of potential therapeutic relevance to CD by ESM-iBET. Current biologic therapies are aimed at targeting specific cytokines or pathway components, which can only be beneficial to patients in which this particular pathway is predominantly driving inflammation. The advantage of a CES1-targeted iBET (ESM-iBET) is that it can interfere with multiple CD-relevant inflammatory pathways simultaneously in monocyte/myeloid cells expressing CES1, while minimizing broad iBET effects in non-CES1 expressing cells. Whether specific targeting of mononuclear myeloid cells would demonstrate clinical benefits remains uncertain. In a complex in vivo environment, other cell types, such as intestinal B cells, T cells, epithelial, and stromal cells, all contribute to intestinal inflammation. We demonstrated a specific pattern of CES1 expression in CD patients, which is confined to monocytes, macrophages, and DC populations, across blood and local inflamed tissues of CD patients. We demonstrated the increased potency of ESM-iBET (GSK3361191) in CES1-expressing monocytes compared to the non-targeted control, iBET (GSK3235220). We also defined ESM-iBET targets at the transcriptional level in the peripheral monocytes, which are therapeutically relevant in CD patients."}
{"text": "Determining accurate estimates for the characteristics of the severe acute respiratory syndrome coronavirus 2 in the upper and lower respiratory tracts, by fitting mathematical models to data, is made difficult by the lack of measurements early in the infection. To determine the sensitivity of the parameter estimates to the noise in the data, we developed a novel two-patch within-host mathematical model that considered the infection of both respiratory tracts and assumed that the viral load in the lower respiratory tract decays in a density dependent manner and investigated its ability to match population level data. We proposed several approaches that can improve practical identifiability of parameters, including an optimal experimental approach, and found that availability of viral data early in the infection is of essence for improving the accuracy of the estimates. Our findings can be useful for designing interventions. Similarly, understanding the kinetics of SARS-CoV-2 in the lower respiratory tract (LRT) is important for predicting the potential for severe disease, respiratory failure, and/or death13. Insights into the mechanism of SARS-CoV-2-host interactions and their role in transmission and disease have been found using mathematical models applied to longitudinal data17. While these studies are instrumental in determining important parameters , their predictions are limited by the lack of data early in the infection. As such, with few (if any) samples available before viral titers peak, the early virus kinetics and the mechanisms for these early kinetics are uncertain. In this study, we investigate the sensitivity of the predicted outcomes of a within-host model of SARS-CoV-2 infection to the availability of data during different stages of the infection and use our findings to make recommendation.Understanding the upper respiratory tract (URT) kinetics of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is important for designing public health interventions such as testing, isolation, quarantine, and drug therapies18. The study showed independent virus replication in upper and lower respiratory tracts19 suggesting the possibility that virus kinetics, disease stages, and host involvement in control and pathogenesis are dependent on which area of the respiratory tract is homing SARS-CoV-2 at different stages of the disease22. One shortcoming when evaluating the data in this study comes from the fact that viral RNA was collected only after the patients became symptomatic, with an estimated first data point available on average 5\u20137 days after infection. Several within-host mathematical models developed and applied to the data set in the Wolfel et al. study have evaluated SARS-CoV-2 parameters, determined the role of innate immune responses, found connections between total RNA and infectious titers, and identified the efficacy of drug therapies7. We are interested in determining how the lack of data early in the infection affects these estimates.A German study by Wolfel et al. collected data from nine patients infected early in the pandemic through contact with the same index case26 that includes both URT and LRT patches. We used the data from Wolfel et al. to estimate pertinent parameters and investigated the sensitivity of the estimated parameters to the presence of data at different stages of infection. To accomplish this, we created virtual data sets that span various stages of the infection and determined how our initial predictions are being influenced by the additional data. Such results may influence our understanding of both viral expansion and the effect of inoculum dose on disease progression.We first developed our own within-host model that does not consider innate immunity explicitly. The model is an expansion of the within-host mathematical models developed for influenza and other respiratory infections18. We model this by developing a two patch within-host model, where the patches are the two respiratory tracts which are linked through virus migration between patches, or viral shedding. Both respiratory tract patches assume interactions between uninfected epithelial cells, j, t. Here, u describing the URT patch and l describing the LRT patch. Target cells in each patch get infected at rates K is the viral load in the LRT where the clearance is half maximal. The two patches are linked via the virus populations, with a proportion SARS-CoV-2 virus infects and replicates in epithelial cells of the upper and lower respiratory tract18.We model the initial conditions of the system Eq.  as follomentclass2pt{minim19. Early detection allowed for rapid contact tracing, testing, and monitoring of the affected community: young healthy professionals in their mid-thirties. A followup study published time series for the post symptoms virus data isolated from oral-and nasopharyngeal throat swabs (in copies per swabs) and from sputum samples (in RNA copies per mL) for the same patient population over their entire course of disease. The patients\u2019 throat swabs and sputum data  were obtained through personal communication with the authors. Since we know the incubation period for each patient19 ,,\\documenmentclass2pt{minimSuppose put Eqs.  and 4)  \\documenput Eqs.  and (4).mentclass2pt{minimmentclass2pt{minimmentclass2pt{minimThe within-host model Eq. , and of conducting airways . Since the gas exchange region is affected by SARS-Cov-2 only in severe cases20 we ignore it, and restrict the LRT compartment to the conducting airways whose surface area is 36. Therefore, we obtain an initial epithelial cell target population in the LRT of 18. Lastly, the incubation periods were estimated in Ref.19 and are listed in Table We assume that the upper respiratory tract susceptible population is mentclass2pt{minimDuring the data collection process, observations are perturbed with noise. Hence, the URT and LRT viral load deviates from the smooth trajectory of the observations 38. MCMC methods generate a sequence of random samples N. The random walk Metropolis algorithm is one of the most extensively used MCMC algorithms. The Metropolis algorithm starts at position 37) and use the MATLAB toolbox provided by the same authors39. In comparison to other Metropolis algorithms, the Markov chain constructed with DRAM is robust and converges rapidly  to determine the remaining nine parameters of the model Eq. \\documentodel Eq.  and the odel Eq. , the likentclass1pt{minimaThe two patch within-host model Eq.  is novelentclass1pt{minima18. We used Bayesian parameter estimation with the viral samples in URT and LRT from a single individual (patient A) and the entire population  and approximated posterior distributions with To study the kinetics of SARS-CoV-2 in the upper and lower respiratory tracts we developed a two patch within-host model Eq.  that ass}pl see \u201c\u201d. The re}pl see \u201c was valiWe generated prediction graphs of the within-host model Eq.  by samplK where While the viral titers decay to low levels  and the entire population, During MCMC data fitting, we used parameters limits predetermined to range around a single point estimation obtained using the \u2019fminsearch\u2019 algorithm in Matlab  restrictions on the parameter space and the types of distributions we are imposing on the parameters, or (2) the limited data points early in the infection.To investigate the first hypothesis, we collected samples in the parameter space ofentclass1pt{minimaTo investigate the second hypothesis, we created synthetic data and used it to further examine how the timing of the data collection in the population correlates to the structure of the resulting parameter estimations. We assumed that the real data corresponds to the solution of model Eq.  with parentclass1pt{minimaTo determine whether practical identifiability is lost in each experiment we created parameter histograms for each parameters see Fig. . When da18. We estimated nine unknown parameters using an MCMC Bayesian fitting approach37. To avoid over fitting, we determined best estimates in a single patient (for which we have 26 data points) and in the entire population (for which we have 201 data points). We found shorter virus life-spans in LRT compared to viral URT, 2\u20133 h compared to 5.7\u20138.5 h. Our LRT estimates are similar to the fixed (and non-tract specific) virus life-span of 2.4 h used by Ke et al.3 and the estimated (and tract specific) life-span of 1.2 h in Wang et al.6, but longer than the 10 h seen in influenza and used by Hernandez et al.7. The between tracts differences may suggest the presence of additional immune mediated viral clearance in the LRT. We found similar infected cells life-span between the two tracts, with a range of 4.2\u20138 h, shorter than in other studies7. Lastly, the mean URT basic reproductive number for the entire population, 3. While we assumed two-way viral shedding between tracts, data fitting suggested higher virus shedding from upper and lower respiratory tracts than the other way around, consistent with other studies3.In this study, we developed a within-host mathematical model of SARS-CoV-2 infection that connected the virus kinetics in the upper and lower respiratory tracts of infected individuals and used it to determine the tract specific viral parameters. We removed viral production rates, to ensure structural identifiability, and fitted the rescaled model Eq.  to publiInterestingly, we found that the estimated LRT infectivity rate parameter follows a bimodal distribution when the model was fitted to the entire population data. We attributed this behavior to practical non-identifiability. Practical non-identifiability is observed when the measured data is contaminated with noise. We have inherently accounted for noisy data by combining viral measurements from nine patients with different viral profiles. We investigated several ways for improving practical identifiability of this parameter and found that both estimating the logaritmic value 43. Such a process, known as optimal experimental design, aims to obtain additional information about a system through the addition of new measurements. Since in system Eq. . This simplification may be the leading reason for larger infected cell death rate estimates in our study compared to other studies7. Thirdly, due to the novelty of the model, we have no information on parameter priors. Therefore, we fitted the within-host model to the patient A and population data, and used those estimates as means in the prior distributions. However, since the resulting means fall within ranges observed for other acute infections48, and since we consider large standard deviations around the prior means, we are confident that we are covering a large enough search space that does not exclude viable outcomes.Our study has several limitations. First, we considered a density dependent clearance term for the URT virus that saturates at around 1\u20132 In conclusion, we have developed a within-host model of SARS-CoV-2 infection in the upper and lower respiratory tracts, used it to determine pertinent viral parameters, and suggested the optimal experimental designs that can help improve the model predictions. These techniques may inform interventions.Supplementary Information."}
{"text": "Shark depredation is a complex social-ecological issue that affects a range of fisheries worldwide. Increasing concern about the impacts of shark depredation, and how it intersects with the broader context of fisheries management, has driven recent research in this area, especially in Australia and the United States. This review synthesises these recent advances and provides strategic guidance for researchers aiming to characterise the occurrence of depredation, identify the shark species responsible, and test deterrent and management approaches to reduce its impacts. Specifically, the review covers the application of social science approaches, as well as advances in video camera and genetic methods for identifying depredating species. The practicalities and considerations for testing magnetic, electrical, and acoustic deterrent devices are discussed in light of recent research. Key concepts for the management of shark depredation are reviewed, with recommendations made to guide future research and policy development. Specific management responses to address shark depredation are lacking, and this review emphasizes that a \u201csilver bullet\u201d approach for mitigating depredation does not yet exist. Rather, future efforts to manage shark depredation must rely on a diverse range of integrated approaches involving those in the fishery , social scientists, educators, and other stakeholders. Depredation, where a predator  completely or partially consumes an animal caught by fishing gear, is an issue in many fisheries around the world and in recent years has received increasing attention from researchers and fishery managers  or interviews  represent the most popular social science strategies to understand shark depredation impacts, including rates of depredation and fishers\u2019 attitudes, perceptions, and behaviours  are behavioural solutions , to more complex examinations of the themes, values, and meanings of the content. This methodology has been used to examine dominant narratives and attitudes in the media reporting on shark bites  to represent individual or group \u201cmental models\u201d of a complex system, such as depredation Fig.\u00a0. Fuzzy-cDepredation is influenced by a range of factors, including shark behaviour and abundance, spatial and temporal distribution of fishing effort and changes in fishing methods, gear and equipment. However, there remains a lack of empirical data to characterise these issues, and consequently much of the current knowledge is composed of anecdotal accounts and personal opinions. Biological data collection can help to address key questions relating to depredation, such as the impacts of shark depredation on target species, which shark species are involved and how their movement patterns and behaviour influence the occurrence of depredation. Such information can then inform future work to design effective mitigation approaches.Shark depredation can have substantial impacts on the target species of a diverse range of fisheries. In particular, shark depredation can increase the overall level of mortality that occurs, especially in fisheries where fishers are seeking to reach an allowed quota  or bag limit . Depredation of target species in catch-and-release recreational fisheries causes mortality for released fish that would otherwise mostly survive (thus undermining the catch-and-release objective), as well as diminishing the recreational fishing experience and negating the benefits of tagging programs.Scomberomorus commerson) in a commercial trolling fishery in Australia. Two studies in northwest Western Australia presented results for shark depredation rates for common recreational target species, including narrow-barred Spanish mackerel, spangled emperor (Lethrinus nebulosus) and coral trout (Plectropomus spp.)  in the Florida Keys, USA  in the Bahamas (Cooke and Phillip Lutjanus campechanus) is another key target species known to be affected by shark depredation in the southeast USA  were species not often perceived as predators, such as those from the families Aetobatidae and Rhinidae, and that there are a variety of species that simply interact with bait rather than depredating catches  are commonly used to assess depredation. Video footage collected using GoPro\u2122 cameras mounted to crab traps showed that the primary species responsible for depredation of spanner crabs  were depredating and interacting with hooked fish on a longline  to view depredation could also be trialled to see if the combination of greater manoeuvrability and a live camera feed is able to allow additional data to be collected.The use of genetic techniques for the identification of predator species responsible for depredation continues to grow, and shows increasing promise, with several research papers successfully using genetic approaches to identify depredating shark species from trace DNA collected off the remains of depredated species  was achieved by Fotedar et al.  using a Variation in the time taken to swab depredated remains is also believed to affect the success rate of identifying depredating species. Vardon et al.  found thCarcharhinus spp., one of the most common genera responsible for depredation events studied to date\u00a0 regions,\u00a0such as COI, ND2, ND4 and CtyB, which provide additional benefits when working with trace DNA due to the multi-copy nature of mtDNA. Several studies have also highlighted the importance of using primers that are specifically designed to amplify DNA of depredating species and block DNA of the species being depredated . Furthermore, the ability to swab residual DNA of different tissue types (e.g. hard exoskeletons of crustaceans or molluscs) remains untested and could be either more or less suitable than swabbing of fish soft tissue. In some circumstances, examining the bite wound on a depredated fish\u00a0or\u00a0invertebrate could be used to distinguish between broader groups of depredating taxa  , barium ferrite (BaFe12O19), and neodymium ferrite (NdFeB) have had varied success as shark deterrents and are not always effective, particularly when there is competition among sharks during feeding  calls. While these have been shown to be an effective shark deterrent  the level of statistical power required, (2) the current base-level of shark depredation , (3) the level of decrease in depredation that is required for a deterrent to be considered \u201ceffective\u201d, and 4) the change in effectiveness over time since the initial exposure (i.e. whether habituation occurs in the sharks). When planning and carrying out field sampling it is necessary to consider: (1) proximity of sampling sites to one another, (2) adequate numbers of catchable fish and sharks are present, (3) duration of fishing session to enable fish to be caught and sharks to be encountered, (4) randomisation of the order in which a control and each deterrent device are tested while fishing, (5) maintaining the same number of fishing lines in the water throughout the sampling, and (6) maintaining consistency in the fishing equipment/hardware  used throughout the sampling  in Florida  and are thus still subject to depredation. The only study that has investigated this aspect indicated that fish are far less likely to be depredated on descender devices , a known depredating species . Behaviour change may also result in indirect-economic costs, such as reduced enjoyment and reduced catches.Thunnus spp.) and yellowtail kingfish , compared to demersal species . Yet, there are widespread anecdotal reports that shark populations have increased as fishers report seeing many more sharks around their vessels than in the past. While it is possible that some local populations of sharks have increased, particularly species with more productive life history traits and relatively high site fidelity (Pardo et al. The issue represents an extremely challenging space for fishery managers, decision-makers, and politicians. Many stakeholders believe shark depredation is increasing due to increasing shark populations, particularly after the closure of some shark fisheries in the US and Australia. However, there is minimal long-term scientific data to investigate changes in abundance of sharks and there is no clear evidence to link changes in relative abundance of shark to increases in depredation rates. Studies from Australia (Braccini et al. It is also important to disentangle reported changes in relative abundance from the potential influence of changes in shark behaviour when investigating reports of increased depredation. In some areas there has been an increase in recreational fishing activity, such as in remote parts of Western Australia in recent years due to the COVID-19 pandemic (Ryan et al. It is necessary to consider how to manage stakeholders impacted by shark depredation scenarios, as well as the sharks. In several other HWC scenarios, the focus has shifted from one focused solely on the predator responsible, such as where the predominant management approach is to cull or catch and relocate the predator (Reynolds and Tapper Regardless of the methods used to mitigate depredation, it is highly unlikely that this HWC will be eliminated completely (Lennox et al. In the future, we can apply lessons learned from similarly contentious HWCs in the terrestrial realm. Recent meta-analyses indicate that reactionary predator removal programs in terrestrial ecosystems are rarely successful in reducing livestock depredation by apex predators (Eklund et al."}
{"text": "Previous studies on voting bias in competitive awards have not fully considered the role of cultural similarity. Using data for the Best FIFA Men\u2019s Player Award, we evaluate the extent of voting bias in this Award using three cultural similarity factors , six established in-group factors  and the impartiality of the voter\u2019s country. Using statistical and econometric methods, we find that voter-player cultural similarity is positively associated with voting bias and find no evidence of impartiality when it comes to cultural or national ties. We also find that media voters are less biased than captain voters and coach voters, and that coaches are less biased than captains. Awards play an important role in many industries, especially sports and entertainment. Some of these awards use voting to determine which candidate should win the award. For example, the National Basketball Association (NBA) has a panel of sportswriters and broadcasters who vote for the Most Valuable Player Award, the Eurovision Song Contest has competing countries cast votes for the other countries\u2019 songs, and members of the Academy of Motion Picture Arts and Sciences nominate and vote for Oscar winners. Given the importance of such awards, researchers have examined how voters can be unfairly in favor or against a candidate , 2.From this prior research, there is ample evidence that voters are guided not only by the quality of the candidates but also by established in-group biases \u20135. This We investigate voting bias in the Best F\u00e9d\u00e9ration Internationale de Football Association (FIFA) Men\u2019s Player award  using established in-group and cultural factors. We use seven years (2010\u20132016) of data for the Award. Officially, the Award is determined by \u201cthe best in their category, without distinction of championship or nationality for their achievements during the year\u201d . Thus voIn addition to concerns about favoritism, the Award is useful for studying voting bias for three reasons. First, we can examine how multiple in-group factors, including geographical, nationality, ethnicity, language, religion, voter type, club, league, and variables for player performance, interact to influence voter bias over time. Second, the Award is global and offers extensive information about the voters, the candidates, and how votes were cast. Each year there are three types of voters  from approximately 200 countries. Each voter has three votes to assign to a shortlist of 23 player candidates (referred to as \u2018players\u2019), awarding 5 points, 3 points, and 1 point to their selected players. The single player that receives the highest cumulative total number of points wins the Award. This international context, and the accompanying substantial cultural differences, are useful for examining the role of cultural similarity between voter and player on voting bias. We do this by unpacking cultural similarity into three factors: cultural distance, cultural clusters, and voter collectivism. We use a well-established methodology for measuring voting bias that calculates the difference between the number of points awarded to a player by a given voter and the average number of points awarded by all other voters to said player. Lastly, the Award provides a practical context for investigating how a voter\u2019s country\u2019s impartiality might affect voting bias.Our results show that voting bias exists in the Award. We find that cultural distance, cultural clusters, collectivism, and geographical distance all impact voting bias. We also find that when voters and players share nationality, club, league, or are country neighbors, then voting bias is positively correlated. In terms of the bias exhibited by different voters, media voters have a significantly lower voting bias than captain voters and coach voters, and coaches have a lower voting bias than captains. Overall, our findings show that something other than player quality  can be attributed to the voting results. This analysis provides new insights into how cultural similarity and impartiality influence bias in peer voting and international award competitions.In the context of sports, prior research has examined voting bias in the seeding of basketball teams , 16 and A few studies have examined voting bias in the Award (under its current or former names) which is the focus of our study. Focusing on the role of cultural diversity, Ruizendaal  found noVoting bias can be explained using social identity theories , 29 and Prior research on awards has found that the basis for voter-player similarity includes factors such as gender , 34, racHypothesis 1:Voters are more likely to choose players with similar in-group factors .Given that cultural similarity is a recognized determinant in social identity theory for explaining intergroup behavior such as bias, we now develop a hypothesis for how three characteristics of cultural similarity  impact voting bias in the Award. Our fundamental premise is that cultural distance, and cultural clusters are an important element of voters\u2019 calculations (conscious or unconscious) of their similarity to the players, which influences the likelihood of voting bias. Furthermore, voters from countries with strong collectivist cultures will emphasize the group rather than the individual and will more likely favor those within or close to their cultural group.Hofstede\u2019s , 38 reseOur second factor used to characterize cultural similarity between voters and players is cultural clusters. GLOBE researchers  used datOur third factor for characterizing cultural similarity is collectivism. Hofstede 43, p. 348) defines collectivism as \u201ca preference for a tightly-knit social framework in which individuals can expect their relatives, clan, or other in-group to look after them, in exchange for unquestioning loyalty.\u201d In contrast, individualism is \u201ca preference for a loosely knit framework in society in which individuals are supposed to take care of themselves and their immediate families only\u201d . Consequently, collectivist cultures are more likely to exhibit loyalty and support to those in their in-group , 42, 43., p. 348 The GLOBE data set divides collectivism into two dimensions: collectivism I  and collectivism II (in-group collectivism). The first form of collectivism is the extent to which society encourages individuals to be integrated into groups; the second is the degree to which individuals express loyalties to their families or in-groups , 45. We Hypothesis 22A: An increase in cultural distance between a voter and a player will decrease voting bias.2B: Voters and players that reside within the same cultural cluster will have higher voting bias relative to those that do not live within the same cultural clusters.2C: Voters from collectivist cultures will have a greater voting bias than those from individualistic cultures.Our final hypothesis explores how the impartiality of a voter\u2019s country impacts voting bias within the cultural clusters defined in hypothesis 2B. An impartial government  will treat individuals within its country in an impartial manner regardless of race, ethnicity, family/political ties, or social standing . ImpartiHypothesis 3:The impartiality of a voter\u2019s country reduces cultural voting bias.We use data provided by FIFA to investigate voting bias in the 2010 through 2016 Award years. The dataset consists of 10,305 votes from 3,435 voters spanning seven years. As shown in We also incorporate the GLOBE data set  on cultubjk represents the voting bias between voter j  and player k; pjk is the number of points awarded by voter j to player k ; and, all other voters to a player k . The average number of points awarded by all other voters is defined as:njk is the total number of voters awarding points to player k (less the one vote from voter j). Note that for every vote and the corresponding points awarded, we calculate the average points awarded from all other voters, excluding the points given from voter j to player k. This specification of the dependent variable has the advantage of being a continuous variable that includes a proxy of player quality  that could be determinants of voting bias. Data for nationality, league, and the football club for players and captains was collected using  country . We use  country , we test country .i) according to their respective nationality. Next, we determine the squared Euclidean distance between each voter (j) and each selected player (k) based on Hofstede\u2019s values (i) of the six dimensions and divide by the number of distance relationships (n x (n\u2013 1)) multiplied by the number of cultural dimensions . Finally, we take the square root of the term as shown in For our second hypothesis, we use the three factors related to cultural similarity: cultural distance, collectivism, and cultural clusters. For cultural distance, we use Hofstede\u2019s six cultural dimensions and the nine cultural dimensions of GLOBE. Hofstede\u2019s dimensions  are on a scale of 0 to 100. In contrast, the GLOBE dimensions  are on a scale of 1 to 7. We use both sets of cultural dimensions in different ways to investigate cultural variation and its impact on voting bias. The first technique involves calculating Euclidean distance to represent the cultural distance between voters and players. This calculation requires several steps. First, each player and voter are assigned a value for each of the six Hofstede dimensions , Ij represents the respective index of the voter, and Ik represents the respective index of the player. Lastly, Where Voter collectivism is a measure ranging from a value of 0  to a value of 100 for maximum collectivism. As discussed, we hypothesize that a voter from a more collective society  would have greater voting bias than a voter with lower collectivism. Likewise, we investigate the relationship between two cultural dimensions of the GLOBE study associated with collectivism  and voting bias.CCjk) is used to identify voters and players from countries that are defined within the same cultural cluster or not. This indicator reflects voting bias between voters and players who share the same cultural cluster.Our final measure of cultural similarity utilizes cultural clusters defined in research through the GLOBE study , 45. As For our third hypothesis, we measure impartiality using \u2018quality of government\u2019 data from the International Country Risk Guide (ICRG) . This meCCjk) is expected to be positive and significant, implying that positive voting bias exists between voters and players who share the same cultural cluster. According to our hypothesis and based on similar research conducted by Charron [CCjk x impartiality Imj) should be negative and significant, implying that voting bias across countries defined by their cultural clusters diminishes significantly as impartiality (Imj) increases. This finding is consistent with similar results of Charron [We use an interaction term of impartiality with cultural clusters to test our final hypothesis (similar to Charron ). If cul Charron , the int Charron  that demposskt, defencekt, and attackkt come from Squawka (http://www.squawka.com) and are used as additional performance metrics as only three years of performance data is available. The Squawka Player Performance Score uses data from the Premier League\u2019s official data provider Opta and uses an algorithm to rate players based on real-time play components; attack, defence and possession. The attack score takes all the attacking events into consideration , the defence scores defensive actions  and the possession score analyzes passes, through-balls, etc. The algorithm scores each event independently.We collected six performance variables for this study, three of which were found to be valuable in this study. The three variables used are: the percentage of games won, the goals per game, and the assists per game. These data were collected from websites specializing in providing football statistics: footballdatabase.eu and squawka.com. Each variable is a performance metric based on a player\u2019s performance in all games . k received in year t; \u201cwpcentkt\u201d, \u201cgpgkt\u201d and \u201capgkt\u201d are performance variables ; and \u201cak\u201d is the \u201cplayer fixed effect\u201d which is a constant representing the unobserved effect on the percentage of votes received by player k due to \u201cbeing\u201d player k. In this way, we interpret the unobserved effect as the potential for voting bias associated with individual players.We test our three hypotheses using econometric methods. The first method employs a fixed-effects regression model to predict the percentage of points earned for each shortlisted player over the 7-year time frame using only the performance characteristics collected for this study. In this way, we control for the individual heterogeneity of the players and test if individual heterogeneity (or unobserved factors not related to performance) is a significant factor in the competition. This method provides a statistical model to test our first hypothesis of whether voting bias exists. Two general assumptions justify using the fixed-effect model to investigate the presence of voting bias. The first assumption is that the performance variables  can sufficiently capture a player\u2019s performance. Second, the percentage of votes that a nominee receives each year is determined largely by the performance of that nominee in that calendar year. Therefore, any unobserved effects  influence voting results that are not related to performance. In other words, if individual heterogeneity is statistically significant, something other than performance contributes to the percentage of points received, thus allowing us to infer the possibility of voting bias. The player fixed-effect model can be represented by:j and player k in year t and Xjkt represents various explanatory and control variables. The benefit of this specification is that the dependent variable is continuous , allowing us to investigate our hypotheses and easier interpret the marginal effects of the explanatory variables. Other studies used nonlinear regression methods to investigate voting bias in this competition making the interpretation of marginal effects challenging (see [The second method uses ordinary least squares (OLS) to estimate parameter estimates with the dependent variable represented as the bias calculation, as shown by Eqs ing (see  for a goWe now briefly discuss the bivariate correlations between some variables to investigate the relationships between voting bias and established in-group factors. We then present the results for our three hypotheses.CDjk) and geographical distance are negatively correlated with voting bias and statistically significant across all points values, separately. This finding indicates that voting bias decreases on average as the cultural or geographical distances between a voter and a player increases. Likewise, nationality, club, league, and being from a neighboring country are positively correlated and statistically significant with voting bias. This result indicates that increasing similarity between these characteristics increases voting bias on average. These relationships become even more pronounced when correlations are calculated based on individual points awarded , providing further evidence to warrant the specification of regression models using individual points awarded.We use a player-specific fixed-effect regression model to investigate the presence of voting bias. Two panels were constructed for investigating the player fixed-effect model: one is constructed by players with at least three nominations from 2010 to 2016 ; one is constructed by players with at least four nominations during the same period . The two panels show similar results. The adjusted R-square is approximately 75% for all ten models (five for each panel), indicating that performance and players\u2019 heterogeneity explain a high proportion of the variability in the votes received. The statistical value of rho shows that variances due to individual heterogeneity are approximately 60% to 70%. This finding shows that something other than wins, goals, and assists can be attributed to the voting results.P < 0.0001), further providing statistical evidence of the potential for voting bias in the selection of players (and support for our first hypothesis). The analysis also shows that goals per game is the most significant of the three-performance factors utilized. Goals per game is positive  and statistically significant (P < 0.10) across both panels. Assists per game has a positive sign which corresponds to our hypothesis but is not statistically significant (0.15 < P < 0.10). Interestingly, the coefficient for the percentage of games won indicates that a higher percentage of games won leads to a lower percentage of the total votes awarded in any given year. The negative sign is not consistent with the expectation that a higher percentage of games won would lead to a higher percentage of votes received. An explanation is that this factor is not closely related enough to an individual players\u2019 performance, such as goals and assists, since the percentage of games won is the entire team\u2019s performance. For this reason, we do not use this performance measure in other estimations.The premise that there is no individual player-specific heterogeneity is firmly rejected in all models  due to the nature of the calculation of voting bias used within this study. Therefore, as shown, we have selected to control for the number of points awarded by running regression models for 5, 3, and 1 points awarded separately. Results from the first set of regression models for voting bias are presented in P < 0.001, P < 0.01 and P < 0.05 across points 5, 3 and 1 respectively; GLOBE: P < 0.001, P < 0.01 and P < 0.01 across points 5, 3 and 1 respectively). Likewise, if a voter and a player come from neighboring counties, voting bias is positive and significant across all points and data sets, but to a lesser extent for 1 point awarded. The regression models demonstrate consistent results using both Hofstede and GLOBE data sets. Model one and seven are considered the baseline models containing only the control variables. As shown, voter type and year both have significant impacts on voting bias. Interestingly, media voters have a significantly lower voting bias than captain voters (and coaches). Coaches also tend to have a lower voting bias than captains on average. However, their coefficients are not significant. Nationality is positive and statistically significant across all models indicating its significant role in voting bias in the competition. Interestingly, we also find that physical geographical characteristics are statistically significant with voting bias. As geographical distance decreases between a voter and player, voting bias is positive and significant across models using both Hofstede and GLOBE data sets . This finding may indicate that captains are trying not to disclose blatant voting bias, given their close association with teammates. When voting for players within the same league, results demonstrate positive and statistically significant voting bias across all points awarded.Interestingly, not shown in Based on these findings, we find sufficient evidence to support our first hypothesis that there exists voting bias in the Award, which can be attributed to the factors discussed.Regression models were developed for our second hypothesis regarding the affect of cultural similarity on voting bias in the Award. These models examine the relationships between the variables defined in section 3.2 for both Hofstede and GLOBE data sets. Model 1 and 6 establish a baseline with only control variables, while independent variables are integrated step-wise in the subsequent models. Models 2 to 5 and 7 to 10 test our second hypothesis using an independent variable for cultural distance, cultural clusters, and voter collectivism.CDjk) are negative and statistically significant at the 1% level except for the case of 1 point awarded for both data sets . These results are consistent when controlling for players and voters with the same nationality. Likewise, we find evidence that cultural clusters (CCjk) are positive and significant . This finding demonstrates a higher degree of voting bias when awarding points to players from the same cultural society (the \u2018in-group\u2019) than awarding points to different cultural societies (the \u2018outside group\u2019). We also find that voting bias across cultural clusters (or \u2018societies\u2019) with positive and statistically significant coefficients on all points awarded.Our findings support the hypothesis that an increase in cultural distance leads to a decrease in voting bias. All coefficients for cultural distance (VCj) would positively influence voter bias. As shown in P = 0.54) but significant for one point awarded (estimated coefficient of 0.17 and P = 0.011). For the GLOBE data set, both types of collectivism are insignificant for 3 and 1 points awarded. This finding could be due to the Hofstede data set being three times larger than GLOBE, thereby providing stronger evidence of voter collectivism. Interestingly, for the GLOBE dataset, the coefficient for collectivism II (in-group collectivism) consistently demonstrates a stronger influence on voting bias than collectivism I  through various models. When both forms of collectivism are run concurrently in the same model, collectivism I becomes insignificant (estimated coefficient of 0.05 and P = .31) and collectivism II remains positive and significant (estimated coefficient of 0.18 and P = 0.006).With hypothesis 2, we also propose that higher voter collectivism (P < 0.01) for all points awarded. This further supports our hypothesis that as voters and players become more culturally diverse, especially with respect to in-group collectivism, voting bias decreases on average.Lastly, models 5 and 10 further test the individual effects of specific cultural dimensions from both Hofstede and GLOBE on voting bias using . We findAs shown previously in Despite some inconsistency for voter collectivism at lower points awarded, we believe our findings provide sufficient evidence to support our second hypothesis that cultural factors are positively associated with voting bias in the Award.CCjk x impartiality Imj) that is expected to be negative and significant, which implies that the level of voting bias in countries of cultural clusters diminishes as impartiality Imj  increases. As shown in Although countries in cultural clusters exhibit a higher degree of voting bias than countries that are not in the cluster, they are expected to do so to a lesser extent as impartiality increases across countries within cultural clusters , 55. UsiThe coefficient for impartiality is insignificant using Hofstede across all points awarded but is significant and negative using the GLOBE data set for 5 and 1 points awarded. This means that as the quality of government improves, there is some evidence to demonstrate that voting bias decreases on average. However, the effect of a voter and a player being in the same cultural cluster is stronger, not weaker, as the quality of government of the voter\u2019s country increases. We find consistent results when using nationality within the interaction term instead of cultural clusters. In accordance with our third hypothesis, we would anticipate witnessing some evidence of impartiality in voting bias for voters and players who share the same nationality, but this is not the case again.Based on these findings, there is insufficient evidence to support our final hypothesis of greater impartiality regarding cultural voting bias . We find the opposite, with evidence of a moderating effect of cultural and national influences on impartiality.In this paper, we examine how cultural factors and established in-group factors impact voting bias in one of the world\u2019s most prominent sporting awards. Our study and results constitute the most comprehensive study on voting bias in the Award and are robust, using both Hofstede and GLOBE datasets for cultural dimensions.Consistent with previous literature on voting bias in awards and social identity theories, we find that nationality, the league, and the club are all important determinants of the voting bias in the Award. We add to existing research by showing that voter-player similarity in cultural distance, cultural clusters, and collectivism strongly influence voting bias. Furthermore, we find that countries with a greater diversity of ethnicity, language, and religion, demonstrate lower voting bias. We also find an increase in voting bias between voters and players of neighboring countries and between voters and players whose capital cities are in close geographical proximity. However, we found no evidence of impartiality in voting bias for voters and players that share the same cultural cluster or nationality.In terms of voter type, voters from the media have the least amount of voting bias for all points awarded compared to captains and coaches, and this difference is consistently significant. Captains, on the other hand, have the greatest relative degree of voting bias compared to coaches or media, but this degree is only significant for the 5 points awarded. Captains are relatively closer to players in the context of voting, and this supports the theory that the proximity of the relationship through in-group and cultural factors may play an important role in voting bias.Given the propensity for voting bias in awards, our research highlights the importance of having awards provide criteria concerning what constitutes quality. For the Award this would include total goals, goals per min, total assists, pass completions, player of the match, and saves. Such criteria could counter bias by better grounding, driving, and assessing voting choices. Also, if an award is relatively transparent concerning the voter-player factor similarities, as was the case with the Award, then this has two potential impacts. First, without such transparency, the award is more likely to escalate the effects of in-group bias while inviting irresponsible, na\u00efve, and foolish voting decisions. Second, the information from such transparency could be used to analyze how votes were cast, like our study. Award organizers could use the analysis to identify and adjust any highly inappropriate bias while reporting and declaring the levels and types of bias exhibited. Such transparency and reporting would help make voters more aware of the propensity and impact of bias. Also, like studies of fake news that expose readers to simple accuracy reminders before consuming news to enhance truth discernment in participants\u2019 , similarFurthermore, our analysis of voting bias also provides a logic to help design awards where voters are required to only vote on candidates who are sufficiently dissimilar according to one or more in-group factors. For example, the NBA altered the voting process for its MVP awards in 2017 by removing media representatives with broadcasting ties that were closely associated with individual teams in a primary role . Today, Finally, an important limitation of our study, which is also an opportunity for future research, is to control for voter taste for players who play in certain positions and play for the prestigious clubs and national teams. For player position, voters prefer forwards and midfielders over defenders and goalies, as creating and scoring goals in football is typically more entertaining and appreciated than tackling and saving shots. Similarly, there are halo effects  where thS1 Appendix(DOCX)Click here for additional data file.S1 Data(DOCX)Click here for additional data file."}
{"text": "Different copolymers were assessed, and the carrier with the highest encapsulation efficiency (EE) and drug loading capacity (DLC) was selected for further elaboration of nanocomposite in situ gel formulations. Next, the sol-to-gel transition behavior of HPC as a function of K2SO4 concentration in the aqueous solution was investigated by microcalorimetry and dynamic oscillatory rheology, and the optimal formulation capable of forming a physical gel under physiological conditions was determined. Finally, injectable nanocomposite hydrogels comprising cannabidiol were fabricated, and their drug release profile and cytotoxicity against human tumor cell lines were evaluated. The in situ gels exhibited prolonged drug release over 12 h, controlled by gel erosion, and the cytotoxicity of formulated cannabidiol was comparable with that of a free drug.Cannabidiol (CBD) is a natural terpenophenolic compound with known pharmacological activities, but the poor solubility of CBD in water limits its widespread use in medicine and pharmacy. Polymeric (nano)carriers demonstrated high potential for enhancing the solubility and therapeutic activity of lipophilic drugs such as CBD. Here, we report the elaboration of a novel hydroxypropyl cellulose (HPC)-based in situ gelling formulation for controlled delivery of CBD. In the first stage, nanosized polymeric micelles from poly(ethylene oxide)- Hydrogels are a unique class of polymeric materials capable of retaining large amounts of water while maintaining their integrity and shape ,2. In faRecently, research on hydrogels for biomedical applications has focused on stimuli-responsive systems that can form gel at physiological conditions and thus reduce the risks involved in the surgical implantation of conventional hydrogels . In thissol-gel) close to physiological temperature [sol-gel of cellulose derivatives and thus achieve gelling material at the desired temperature of 37 \u00b0C. The first approach is based on chemical modification, where synthetic (co)polymers or units are covalently attached to the polysaccharide macrochains. For instance, Miao et al. prepared a thermoresponsive hydrogel via click reactions between alkynyl-functionalized hydroxypropyl cellulose and azide-modified poly(N-isopropylacrylamide-co-hydroxyethyl methylacrylate polycaprolactone) [sol-gel of pure HPC is 44 \u00b0C. Another study revealed that the reaction of HPC with N-methyl carbamoylimidazole can also decrease the LCST of HPC, and Tsol-gel is dependent on the methylcarbamate degree of substitution [sol-gel of temperature-responsive cellulose derivatives [Polymers from natural sources such as polysaccharides  and proteins  have been widely used for fabricating injectable hydrogels ,12. Natuperature . For exaperature . Contrarperature . Generallactone) . This sytitution . It shouivatives ,17. By tb-P(CyCL-co-CL) micelles was developed, and its antiproliferative potential against human breast cancer MCF-7cells was tested in a comparative way vs. a free drug in order to enable sustained CBD release after application in the surgery area of the primary tumor and the dissected lymph nodes. In addition, the biocompatibility of the developed nanocomposite gel carriers was investigated on normal fibroblast cells and was shown to be devoid of significant cytotoxic potential. To get a physical hydrogel at physiological temperature, the Tsol-gel of HPC was decreased by adding K2SO4 to the polymer solution. At a salt concentration of 0.15 molL\u22121, the sol-gel transition point of the system was adjusted to approximately 35 \u00b0C, as confirmed by microcalorimetry and dynamic rheological measurements. Cannabidiol is a natural terpenophenolic compound with proven pharmacological activities such as anti-inflammatory, antioxidant, analgesic, antidepressant, etc. . One of Nanosized micelles comprising a hydrophobic PCL-based core and a hydrated PEO shell were formed via the aggregation of amphiphilic PEO-b-P(CyCL-co-CL) and PEO-b-PCL diblock copolymers in water and then loaded with CBD . \u22121. The copolymer concentration was approximately an order of magnitude higher than the critical micelle concentrations (CMC) of PEO-b-P(CyCL-co-CL) and PEO-b-PCL, as determined in our previous study [PEO-b-PCL block copolymers have been commonly used for biomedical applications and fabricating nanocarriers intended for controlled release of hydrophobic drugs . The incus study . Next, th), and zeta potential of the blank and CBD-loaded micelles  and PEO-b-PCL diblock copolymers demonstrated relatively high DLC and EE, which were dependent on the copolymer composition and copolymer/drug mass ratio (113-b-P(CyCL1-co-CL27)28 vs. PEO113-b-PCL29). These results confirmed our hypothesis that the cinnamyl groups enhance the compatibility between the micellar core and CBD and thus improve the loading capacity of the carrier. On the other hand, a dependence was found between the EE and DLC of the two cinnamyl-modified copolymers and the length of the PCL chain (degree of polymerization 27 vs. 12), indicating that the more hydrophobic copolymer could encapsulate a larger amount of CBD. The highest DLC values for the three investigated systems were obtained at the lowest copolymer/drug mass ratio (5:1), while the highest EE values were calculated at the highest copolymer/drug mass ratio (10:1).The carriers based on PEO-ss ratio . DefinitAs mentioned before, HPC is a temperature-responsive natural polymer possessing a lower critical solution temperature of about 44\u201345 \u00b0C, which is above the body temperature (37 \u00b0C) . However2SO4 to decrease the sol-gel transition temperature (Tsol-gel) of HPC in distilled water was investigated in detail. The measurements were conducted at an oscillatory frequency (f) of 1 Hz and a strain amplitude (\u03b30) of 0.001, which is inside the linear viscoelastic regime (\u22121) at 25 \u00b0C, and the physical gelation of different systems as a function of temperature was monitored. At low temperatures, the samples exhibited typical polymer solution behavior. The loss modulus (G\u2033) was higher than the storage modulus (G\u2032), indicating that the viscous component was predominant over the elastic one. Above the given temperature, the two moduli tended to increase, with a more pronounced effect for G\u2032. At a certain point, G\u2032 and G\u201d crossed (the sol-gel transition point), and then the curves acquired the typical pattern for gels where G\u2032 > G\u2033  was added to the HPC solution. Adding K2SO4 also affected, to some extent, the elastic properties of hydrogel. As can be seen from the data in This assumption was supported by experimental results revealing a linear decrease in T samples . The higanalyses . Indeed,2SO4 concentration of 0.15 molL\u22121 was chosen for our further experiments.The polymer concentration, ranging from 10 to 15 mass%, did not significantly influence the sol-gel transition point, indicating that the gelation under the reported conditions was predominantly a temperature-driven process. On the other hand, the increase in HPC concentration yielded hydrogel with notably enhanced elastic properties . Regardi2SO4, and nanoformulated PEO113-b-P(CyCL1-co-CL27)28/CBD in water at 25 \u00b0C and subsequent heating to 37 \u00b0C (\u22121) and micelles (1 gL\u22121) were kept constant. As discussed earlier, the physical gel was formed as a result of hydrophobic interactions between pendant hydroxypropyl groups in the polysaccharide chains. The presence of SO42\u2212 anions in the system facilitated this process and decreased the sol-gel transition temperature below the body temperature. Adding drug-loaded micelles had only a minor effect on the rheological properties of HPC/K2SO4 systems.Nanocomposite HPC in situ hydrogels, containing CBD-loaded micelles, were fabricated by dissolving HPC, Kto 37 \u00b0C . Three dsol-gel, but it contributed to the increase in the elastic modulus of the material. Indeed, G\u2032 of the nanocomposite hydrogel was more than two times higher than G\u2032 of the blank gel obtained at the same conditions (b-PPO-b-PEO micelles with a rigid core [b-P(CyCL-co-CL) micelles, the PCL-based core is rigid at 37 \u00b0C, and we hypothesized that this feature of the nanocarriers is the main factor in increasing the stiffness of the material. Having in mind that the mass ratio of HPC/copolymers in the studied sample was 150:1, we prepared an in situ gel with five times more concentrated sample of CBD-loaded micelles and then performed rheological measurements (b-P(CyCL-co-CL) micelles. In fact, the G\u2032 values at 1 Hz for pure HPC hydrogel and nanocomposite HPC hydrogels, containing 1 and 5 gL\u22121 CBD-loaded micelles, were 940, 2165, and 4360 Pa, respectively.Dynamic rheological studies confirmed that the elaborated dosage forms are liquid at room temperature and physical gels at 37 \u00b0C, respectively a. The vanditions b. Such rgid core . In the urements b. The reIt should be noted that the transition from viscous liquid to hydrogel was completed in approximately 10 s when the sample was heated on the rheometer plate from 25 to 37 \u00b0C . During In general, the rheological behavior of the developed HPC-based drug formulations fulfills one of the most important requirements for injectable hydrogels\u2014the formulation is viscous at room temperature and forms an elastic gel in situ at body temperature. This characteristic, together with the significantly improved solubility of CBD in aqueous media (with the aid of micelles), makes the nanocomposite HPC in situ gels a promising platform for developing advanced injectable forms of CBD with specific locoregional antineoplastic activity.\u22121 of CBD-loaded PEO113-b-P(CyCL1-co-CL27)28 micelles (polymer/drug mass ratio 10:1), were used. As evident from the released profiles shown in \u22121) showed a slower cannabidiol release compared to the analogous composition with a lower micellar content (1 gL\u22121). A comparison of the drug release profiles to the gel dissolution profiles showed a good correlation between the two processes. This indicates that the cannabidiol release mechanism is controlled to the greatest extent by the gel erosion process. Both the erosion of the gel and the release of cannabidiol are slower in the sample with the higher micellar fraction. This fact can be explained by the reinforcing effect of the micelles on the gel structure. These observations correlate well with the results from dynamic rheological studies, where the higher storage modulus is associated with a higher micellar content in the gel matrix , containing 1 and 5 gLtrix see b.50 concentrations thereof are shown in 50 = 10.7 \u00b5M). The two CBD formulations (micelles and nanocomposite in situ gels) showed slightly higher IC50 values as compared to the free drug  was donated by Hercules Inc., Aqualon Division, Wilmington, NC, USA. Potassium sulphate (99%), ethanol (99.5%), methanol (\u226599.8%), and acetone (99%) were purchased from Sigma-Aldrich via FOT, Sofia, Bulgaria, and used as received. Cannabidiol  was donated by PBG GLOBAL LTD., Sofia, Bulgaria. The block copolymers were synthesized as described elsewhere . Synthet\u22121) at ambient temperature for 30 min. Subsequently, the organic solvent was evaporated under vacuum at 40 \u00b0C to afford stable micellar solutions with a concentration of 1 gL\u22121.The polymeric micelles were prepared by the solvent evaporation method. Briefly, 10 mg of each copolymer were dissolved in 5 mL of acetone, and the solutions were added dropwise to 10 mL of deionized water at 25 \u00b0C under stirring. The resulting solutions were stirred vigorously (800 min\u22121) in ethanol was added dropwise to the aqueous micellar solutions (15 mL) at copolymer/CBD mass ratios of 10:1, 7:1, and 5:1. After stirring for 30 min, the ethanol was removed under vacuum at 40 \u00b0C. The micellar dispersions were filtered (0.45 \u00b5m), and the filter was rinsed with methanol. The amount of non-encapsulated CBD in the collected filter fraction was determined by UV-vis measurements (\u03bb = 274 nm) using a calibration curve in methanol (A solution of CBD (1 gLmethanol . The encw/v) were prepared by dissolving HPC  into 4 mL of pure water or aqueous solutions of K2SO4  under stirring at room temperature. After stirring for 20 min, the viscous solutions were kept overnight at room temperature (25 \u00b0C) before measurements. HPC hydrogels  and CBD-loaded micelles (1 g/L\u22121) under stirring at room temperature. After stirring for 20 min, the viscous solutions were kept overnight at room temperature before measurements. Nanocomposite formulations were prepared by dissolving HPC (0.6 g) in 4 mL of an aqueous solution of K\u22121. The ultraviolet-visible absorption spectra were recorded on a UV-vis spectrophotometer  using quartz cells with a path length of 1 cm. Calorimetric measurements were conducted using a nano-differential scanning calorimeter . Approximately 0.6 mL of sample solution and an equal amount of reference fluid (deionized water) were hermetically sealed into the sample and reference cells. DSC curves were recorded in the temperature range of 15 to 90 \u00b0C at a rate of 1 \u00b0Cmin\u22121. Dynamic rheological measurements were conducted with a HAAKE MARS 60 rheometer . The tests were performed with a parallel plate geometry  in controlled deformation (CD) mode. Three runs of each sample were conducted. Prior to the temperature sweep measurements, amplitude and frequency sweep tests were made to establish the linear viscoelastic range for HPC gels. The gelation process was studied in oscillation-temperature sweep experiments. Storage and loss moduli were determined at constant deformation and frequency  in a given temperature range (25\u201345 or 35\u201355 \u00b0C). The sample were equilibrated for 60 s at the given temperature before recording a data point. The hydrodynamic diameter of micelles was determined by using Zetasizer NanoBrook 90Plus PALS , equipped with a 35 mW red diode laser (\u03bb = 640 nm) at 25 \u00b0C and a scattering angle of 90\u00b0. The electrophoretic light scattering measurements were conducted on the same instrument at a scattering angle of 15\u00b0 and 25 \u00b0C. The phase analysis light scattering (PALS) method was applied for measuring the electrophoretic mobility. Atomic force microscopy (AFM) height images were obtained with a Bruker Dimension Icon microscope  in peak force tapping mode exploiting silicon nitride cantilevers with a spring constant of ~0.4 NmTo evaluate the cannabidiol release profiles of optimally prepared nanocomposite in situ gels, a membrane-less diffusion method was utilized as described elsewhere  with sli2 atmosphere. CCL-1 cells were maintained following the recommendations of ISO 10993-5, Annex C  [The in vitro cytotoxicity of elaborated empty micelles and nanocomposite in situ gels prepared thereof was evaluated on normal murine fibroblasts , while the antiproliferative activity of free or formulated nanocomposite in situ gels cannabidiol was assessed in malignant human tumor MCF-7 cell line (breast cancer adenocarcinoma) obtained from ATCC, Manassas, VA, USA. The cells were cultivated according to the protocol instructions of the supplier and incubated under standard conditions at 37 \u00b0C in a 5% humidified CO9, 2017) . 5. After 24 h of incubation, cells were treated with serial dilutions of the tested formulations with respect to cannabidiol concentration. Following an exposure time of 72 h, sterilized MTT substrate solution (5 mg/mL in PBS) was added to each well, and the plates were further incubated for 1\u20134 h, allowing the formation of purple insoluble formazan crystals. The latter were dissolved in an isopropyl alcohol solution containing 5% formic acid, and the absorbance was measured at 550 nm. The collected absorbance values were blanked against MTT and isopropanol solutions and normalized to the mean value of the untreated control (100% cell viability). The experimental data were processed using a non-linear regression analysis algorithm, semi-logarithmic \u201cdose-response\u201d curves were constructed, and the corresponding half-inhibitory concentrations (IC50) were calculated.The in vitro cytotoxicity of the elaborated nanocomposite in situ gels was evaluated using a standard MTT method with minor modifications . The metb-P(CyCL-co-CL) diblock copolymers played a key role in achieving a water-soluble form of the lipophilic drug CBD. Embedding CBD into nanosized micellar carriers enabled the fabrication of a homogeneous viscous mixture of the temperature-responsive HPC, K2SO4, and nanoformulated CBD, which then formed a reversible physical gel. The salting-out effect of K2SO4 was exploited to tune the sol-gel transition of the HPC-based aqueous system at near body temperature. Thus, the transition from a liquid form to a gel at approximately 35 \u00b0C was completed with a K2SO4 concentration of 0.15 molL\u22121. Nanocomposite gels released the encapsulated cannabidiol in a controlled manner over a period of 10\u201312 h, which depends on the erosion time of the polymer matrix. Tests with non-malignant fibroblast CCL-1 cells revealed that the polymeric carriers themselves are not cytotoxic, while the CBD-loaded HPC hydrogels exhibited pronounced activity against malignant MCF-7 human tumor cells. The elaborated in situ gel formulation may have beneficial advantages when applied in liquid form to the surgery area of the primary tumor and its metastatic spread to lymph nodes, liver, bones, etc.A novel in situ gelling formulation for controlled delivery of CBD based on the natural polymer hydroxypropyl cellulose was developed. Nanosized polymeric micelles of PEO-"}
{"text": "Those with cirrhosis who develop colorectal cancer (CRC) are an understudied group who may tolerate treatments poorly and are at risk of worse outcomes. This is a retrospective cohort study of 842 individuals from Ontario, Canada, with a pre-existing diagnosis of cirrhosis who underwent surgery for CRC between 2009 and 2017. Practice patterns, overall survival, and short-term morbidity and mortality were assessed. The most common cirrhosis etiology was non-alcoholic fatty liver disease (NAFLD) (52%) and alcohol-associated liver disease (29%). The model for end-stage liver disease score (MELD-Na) was available in 42% . Preoperative radiation was used in 62% of Stage II/III rectal cancer patients, while postoperative chemotherapy was used in 42% of Stage III colon cancer patients and 38% of Stage II/III rectal cancer patients. Ninety-day mortality following surgery was 12%. Five-year overall survival was 53% . Those with alcohol-associated cirrhosis  had lower survival than those with NAFLD. Those with a MELD-Na of 10+ did worse than those with a lower MELD-Na score . This study reports poor survival in those with cirrhosis who undergo treatment for CRC. Caution should be taken when considering aggressive treatment. Both liver cirrhosis and colorectal cancer are expected to rise over the next several decades, especially among young adults ,2,3. ThoTreatment of colorectal cancer in those with an existing diagnosis of cirrhosis can be a challenge. Curative intent treatment typically requires major surgical resection and may include liver-toxic chemotherapy ,5. PreviDespite the increasing incidence of both cirrhosis and colorectal cancer, there have been few contemporary studies assessing outcomes among this complex and unique group. Thus, the objectives of this study were to (1) determine the proportion of patients who receive guideline-recommended cancer treatments (such as radiation and chemotherapy); (2) determine the overall survival; (3) determine the associations between cirrhosis etiology and/or severity and survival among a cohort of patients with cirrhosis and CRC.This is a retrospective population-level study of all individuals with cirrhosis who underwent surgery for colorectal cancer in Ontario, Canada, from January 2009 to December 2017 with outcome events followed until the end of 2020. This study conforms to the Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) guidelines .This study uses routinely collected healthcare datasets stored at ICES. These datasets include health administrative data that are routinely generated upon the delivery of a healthcare service to an individual, as well as demographic and census data. The datasets were linked at the individual level using a unique encrypted identifier and analyzed at ICES .Individuals with incident or prevalent cirrhosis were identified using a previously validated algorithm . The algPatient demographics were derived and included age at the time of surgery, sex, and socioeconomic status. Co-morbid illness was defined using the Charlson co-morbidity index. Specific pre-existing comorbidities were identified in patients based on ICES-validated definitions ,25,26,27Surgery type was categorized as resection with anastomosis, resection without anastomosis (permanent ostomy), or resection with anastomosis and proximal diversion based on the fee code that was billed in OHIP at the time of surgery . SurgicaThe primary outcomes were 5-year overall survival outcome and overall survival as a time-to-event outcome. Secondary outcomes included the receipt of guideline-recommended neoadjuvant and adjuvant therapies as described in well-established clinical practice guidelines ,5.Other short-term outcomes included in-hospital mortality, 90-day mortality, intensive care unit (ICU) admission, hospital and ICU length of stay, 90-day readmission and 90-day emergency department (ED) visit, and hepatic decompensation . These dCounts and proportions were calculated for categorical variables and means with standard deviations or medians with interquartile ranges for continuous variables. We used chi-square statistical tests to compare categorical proportions, one-way analysis of variance to compare means, and Kruskal\u2013Wallis test as a non-parametric approach to compare median values between cancer-type groups. For cells with small numbers  ranges are presented to protect the anonymity of the patient population, as required by ICES.Postoperative outcomes were described according to cancer type along with counts and proportions for categorical outcomes and means with standard deviations or medians with interquartile ranges for continuous outcomes. In-hospital and 90-day mortality was further elucidated by the MELD-Na score. Five-year survival was evaluated using Kaplan\u2013Meier curves and stratified according to cancer type and stage. Predictors associated with postoperative mortality during follow-up were assessed using Cox proportional hazards models. Patients were followed from the time of surgery until death or 31 December 2020. Predictors were selected a priori and evaluated for violation of the proportional hazards assumption using Schoenfeld residuals. We performed a sensitivity analysis by repeating the multivariable Cox models for predictors of postoperative mortality in a subset of the cohort that had an available MELD-Na score and included MELD-Na as a predictor of interest. We also performed a sensitivity analysis, excluding those who died within 90 days of surgery.p-value < 0.05. All data were prepared and analyzed using the SAS Enterprise Guide, Version 7.1 . Results were considered significant at n = 441, 52%), followed by ALD , viral hepatitis , and autoimmune or other . A small number had a history of hepatic decompensation . The MELD-Na was available for 353 individuals (42%), with a median score of 9 (IQR 7\u201311). Cancer stages included Stage I disease , Stage II disease , Stage III disease , and Stage IV disease . Most individuals underwent elective surgery . In those with colon cancer (N = 696), the most common procedure was resection with anastomosis , followed by resection and permanent ostomy . Few individuals with colon cancer underwent anastomosis and proximal diversion . Those with rectal cancer (N = 146) most commonly had a resection with a permanent ostomy  or resection with anastomosis and proximal diversion . Few individuals underwent resection and anastomosis without diversion .A total of 842 individuals with cirrhosis underwent surgery for colorectal cancer, including 696 individuals with colon cancer and 146 with rectal cancer . DemograIn those with Stage III colon cancer, approximately half  had a medical oncology assessment, with 42% (90/213) ultimately receiving adjuvant chemotherapy. In those with locally advanced rectal cancer , 70% (62/89) had a radiation oncology assessment, with 62% (55/89) receiving preoperative radiation. Similar to Stage III colon cancer, about half  of those with locally advanced disease had a medical oncology assessment and 38% (34/89) ultimately received adjuvant chemotherapy. n = 219/353, 62%), with few having a score >20 . The 90-day mortality in those with a MELD-Na <10 was 6.8% vs. 22% in those with a MELD-Na >10 (p < 0.001) (Short-term outcomes are presented in < 0.001) .The 5-year overall survival for the cohort was 53%. Cox proportional hazards regression was completed for all individuals in the cohort  and was Cox proportional hazards regression was also completed for the subgroup with MELD-Na score available at the time of surgery . Those wThe present study reports practice patterns and outcomes in those with cirrhosis who develop colorectal cancer and undergo surgical resection. The 5-year overall survival for the cohort was 53%. Cirrhosis etiology was associated with overall survival, while MELD-Na score was predictive of increased 90-day mortality. A number of other major short-term complications were common, including 90-day mortality (12%).The present study is the largest and most contemporary report of outcomes in those with cirrhosis who develop colorectal cancer and receive surgery. Several older studies have reported long-term survival ,31,32,33p = 0.082). This association persisted even after adjusting for MELD-Na in those with a score available. The reasons for this are not immediately clear from the data but could relate to individuals with ALD having a more advanced liver dysfunction that is not able to be captured using MELD alone such as the degree of ascites and hepatic encephalopathy. Further, individuals with ALD cirrhosis have historically included a higher proportion who are vulnerable due to their social determinants of health, which may influence the ability of patients with ALD to access and engage in care. An interesting finding from this work is the differences in outcomes based on the etiology of cirrhosis. Those with ALD had a worse survival compared with those with NAFLD  compared to that reported for all comers in Canada (65%), based on previous publications . The CanThis study has several strengths. Due to the relative scarcity of individuals with both a diagnosis of cirrhosis and colorectal cancer, a population-based approach allowed for the inclusion of a large number of individuals. The identification of those with cirrhosis was made using a previously validated algorithm which ensured a low risk of misclassification or inappropriate inclusion. We also identified those with colorectal cancer using the Ontario Cancer Registry, which is highly accurate. For these reasons, there was a low risk of missing individuals with pre-existing cirrhosis who developed colorectal cancer. The type and extent of treatment were determined using well-established sources, while the outcomes were determined using previously validated approaches. As the data for this study were ascertained using linked administrative databases within a single-payer universal healthcare system, loss to follow-up was minimal.Despite these strengths, several well-described limitations of population-based studies exist within this study . PertinePatients with cirrhosis who develop colorectal cancer and undergo surgical resection infrequently receive guideline-recommended treatment, have poor short-term outcomes, and have poor overall survival. Further, compared to the general population, the stage of the disease is less likely to be predictive of long-term survival, especially in those with rectal cancer. We found liver-related factors, including ALD and MELD-Na > 10, to be associated with survival. This information will assist healthcare providers in having detailed discussions with these patients and their caregivers, allowing for enhanced awareness and education pertaining to the anticipated challenges associated with treatment."}
{"text": "In this paper, taking the generalized synchronization problem of discrete chaotic systems as a starting point, a generalized synchronization method incorporating error-feedback coefficients into the controller based on the generalized chaos synchronization theory and stability theorem for nonlinear systems is proposed. Two discrete chaotic systems with different dimensions are constructed in this paper, the dynamics of the proposed systems are analyzed, and finally, the phase diagrams, Lyapunov exponent diagrams, and bifurcation diagrams of these are shown and described. The experimental results show that the design of the adaptive generalized synchronization system is achievable in cases in which the error-feedback coefficient satisfies certain conditions. Finally, a chaotic hiding image encryption transmission system based on a generalized synchronization approach is proposed, in which an error-feedback coefficient is introduced into the controller. Chaos is a unique nonlinear dynamical phenomenon with the properties of ergodicity, initial sensitivity, and the long-term unpredictability of motion trajectories ,2,3,4. IGeneralized synchronization is the gradual convergence of the trajectory curves of two chaotic systems to a time-independent transformation relationship over time; that is, a functional relationship is determined between the state of the driven system and the state of the responding system, and the synchronization of the driven and responding systems is achieved by this functional relationship, which can be deterministic or nondeterministic ,20,21,22The paper is organized as follows: The generalized synchronization theoretic of discrete chaotic systems and the stability principle of error systems are analyzed in In our study of chaotic control problems, it is more important to convert the problem of chaotic synchronization into the analysis of system errors. The main idea is to consider the difference in the state between the drive and response systems, that is, the synchronization error of the system. Once a reasonable controller has been designed by parameter changes to make the system error asymptotically stable at the origin point, then the two systems can be considered synchronized with each other. Firstly, the mathematical model of generalized chaotic synchronization is proposed in this paper and described, as follows.Definition\u00a01.Consider two n-dimensional nonlinear dynamical systems, and describe them using the following equations:where\u00a0,\u00a0, and\u00a0as well as\u00a0are n-dimensional nonlinear functions, and\u00a0is an n-dimensional input control function. If the selectable function\u00a0is applied such that\u00a0, and thus\u00a0, then it can be translated into the study of the error system , for which\u00a0, and therefore\u00a0. In this case, the drive system and response system can reach a generalized synchronization.Theorem\u00a01.Define an invertible transform\u00a0;consequently, there is an incorporated error-feedback coefficient .Where the feedback coefficient satisfies the condition\u00a0, it can enable the progressive stability of the zero solution of Error Equation (3) of the system, which is represented as follows:Because the zero solution of Equation (3) is gradually stable, by introducing a reasonable feedback coefficient  and response system (2), a nonlinear error system \u00a0Chaotic system (4) is progressively stable if the modulus of all eigenvalues of matrix A is not more than 1;(2)\u00a0TPA \u2212 P = \u2212Q) has a unique positive solution (P), system (4) is asymptotically stable.In case there is a matrix (Q > 0), so that the Lyapunov equation (A.Given Proof\u00a0of\u00a0Lemma\u00a01(1).\u00a0Set A have a value of modulo less than 1, all the eigenvalues of matrix Because all the eigenvalues of matrix Proof\u00a0of\u00a0Lemma\u00a01(2).\u00a0Set Furthermore, Lemma 1, the determination processes for the stability of nonlinear discrete systems can be given through Lemma 2, which is described as follows:Based on the proof processes for the stability of linear discrete systems as related in Lemma\u00a02.For a nonlinear discrete system  be the equilibrium point of the proposed system. Provided that the scalar function\u00a0concerning\u00a0satisfies the following:(1)\u00a0,(2)\u00a0.then\u00a0is progressively stable.Proof\u00a0of\u00a0Lemma\u00a02.Lemma 1. Moreover, For condition (1), let Thus, the proof of condition (2) is complete. Based on the above, it is concluded that nonlinear system (4) is asymptotically stable at the origin point.Lemma 1 and Lemma 2, the proof of Theorem 1 can be obtained, which is as follows:Thus, having proved Proof\u00a0of\u00a0Theorem\u00a01.According to Equations (1) and (2), Equation (3) can be calculated as follows:Then, Equation (9) can be simplified as the following equation:Denote the scaled function of the nonlinear error system  is represented by a = 6.53, and after 1000 iterations, the Lyapunov exponents of system (12) are 0.7296, 0.1650, and 0.6226, which are all positive; thus, system (12) is a hyperchaotic system.A new 3D discrete chaotic system (12) is proposed in this paper, which is described as follows:Based on 64-bit Matlab software and double-floating-point representation, the initial values of the state variables of the chaotic system are set differently. The output chaotic sequences and their autocorrelation are shown in Theorem 1, the system errors are calculated as follows:Let us assume that the system of responding systems of the drive system (12) is as follows:Then, the error system equation can be expressed as follows:Let the control function be represented by Equation (16):Thus, system (14) can be simplified to expression (17):Let the Lyapunov exponent function of system (17) be represented by the following expressions:Lemma 1. The zero solution of error system (13) is asymptotically stable so that generalized chaotic synchronization can be achieved. In summary, the incorporation of the error-system-feedback coefficient  is a hyperchaotic system because the four Lyapunov exponents are positive.High-dimensional chaotic systems have more complex dynamics than low-dimensional chaotic systems; thus, they are better able to resist the degradation of dynamics caused by the limited accuracy of computers. In this paper, a new 6D discrete chaotic system (21) is constructed by expanding on system (12), which can be presented as follows:Based on 64-bit Matlab software and double-floating-point representation, for different initial values of the state variables, the output of chaotic sequences and their autocorrelations are shown in Let the corresponding system of driving system (21) be considered as follows:Lemma 2:Equation (23) is obtained from The equation of the error system can then be expressed as follows:Let the control functions be calculated as follows:Then, system (24) can be expressed as follows:Consider the Lyapunov exponent functions of system (25) as follows:Lemma 2, when the parameter Obviously, according to A be expressed as follows:Let the invertible transformation function be k changes for systems (21), (22), and (24) are shown in Moreover, set the initial conditions of the proposed driving system (21) as The framework diagram of the proposed encryption and decryption transmission system constructed in this paper is shown in The proposed system is designed for the encrypted transmission of digital images with pixel matrix values of The output sequences  image was used as an example for the encryption and decryption processes, and the results of the operation are shown in m \u00d7 n, it takes about As can be seen from the encryption process in Security analyses of the transmission system for the proposed digital image encryption and decryption based on generalized chaotic synchronization are performed in this paper, which consist of image encryption histogram analysis, key space analysis, key sensitivity analysis, and correlation analysis.A color histogram is a presentation of the statistical characteristics and distribution of the image pixels and is analyzed in terms of three colors: R, G, and B. As can be seen from the simulation results in 100. Consequently, the security of the image encryption system is improved and the resistance to exhaustive attacks is increased [Cryptographic system security and resistance to exhaustive attacks are affected by the size of the key space. The sequences of the 6D discrete hyperchaotic system (21) are applied at the encryption stage, as the production of keys depends mainly on the parameters and initial conditions of the system. Hence, all the iterative variables of the proposed chaotic system (ncreased ,25.Key sensitivity is an important measure to evaluate the security of an encrypted image. Security is highly reliable if any minimal change to the key results in a large modification; thus, the more sensitive the key, the more secure the encryption system. To evaluate the sensitivity of the key of the proposed scheme, the image was decrypted with a keystream with slight differences, the initial values were set to To prevent data from being attacked or lost, it is necessary to perform cutting attack analysis. The same encrypted Lena as in The analysis of image pixel correlation is one of the important indicators of the encryption effect of encrypted images. The color images were analyzed for correlations from R, G, and B, which are represented as red, green, and blue colors, respectively. In addition, the original image has a strong correlation between adjacent pixels, and an effective encryption system can reduce the image pixel correlation considerably. The correlation coefficient results for the Lena test images and their corresponding encrypted images are shown in To demonstrate the correlation visually, we plotted scatter plots of all sampled pixel pairs. The correlations between the test image Lena and its corresponding R, G, and B color pixels are shown separately. In this paper, two discrete chaotic systems of different dimensions are constructed. Additionally, the dynamics of the new systems are analyzed, and the phase diagram, Lyapunov exponent diagram, and bifurcation diagram of the systems are presented and analyzed simultaneously. The proposed 3D and 6D discrete chaotic systems were constructed as drive systems, and the response systems were constructed by employing the new generalized synchronization method incorporating error-feedback coefficients. The experimental results show that the design of adaptive generalized synchronous systems can be realized provided that the feedback coefficient ("}
{"text": "Living donor kidney transplantation (LDKT) is the best treatment option for patients with kidney failure and offers significant medical and economic advantages for both patients and health systems. Despite this, rates of LDKT in Canada have stagnated and vary significantly across Canadian provinces, the reasons for which are not well understood. Our prior work has suggested that system-level factors may be contributing to these differences. Identifying these factors can help inform system-level interventions to increase LDKT.Our objective is to generate a systemic interpretation of LDKT delivery across provincial health systems with variable performance. We aim to identify the attributes and processes that facilitate the delivery of LDKT to patients, and those that create barriers and compare these across systems with variable performance. These objectives are contextualized within our broader goal of increasing rates of LDKT in Canada, particularly in lower-performing provinces.This research takes the form of a qualitative comparative case study analysis of 3 provincial health systems in Canada that have high, moderate, and low rates of LDKT performance . Our approach is underpinned by an understanding of health systems as complex adaptive systems that are multilevel and interconnected, and involve nonlinear interactions between people and organizations, operating within a loosely bounded network. Data collection will comprise semistructured interviews, document reviews, and focus groups. Individual case studies will be conducted and analyzed using inductive thematic analysis. Following this, our comparative analysis will operationalize resource-based theory to compare case study data and generate explanations for our research question.This project was funded from 2020 to 2023. Individual case studies were carried out between November 2020 and August 2022. The comparative case analysis will begin in December 2022 and is expected to conclude in April 2023. Submission of the publication is projected for June 2023.By investigating health systems as complex adaptive systems and making comparisons across provinces, this study will identify how health systems can improve the delivery of LDKT to patients with kidney failure. Our resource-based theory framework will provide a granular analysis of the attributes and processes that facilitate or create barriers to LDKT delivery across multiple organizations and levels of practice. Our findings will have practice and policy implications and help inform transferrable competencies and system-level interventions conducive to increasing LDKT.DERR1-10.2196/44172 End-stage renal disease represents a major public health burden. Patients needing dialysis have extremely poor survival rates when compared with the general population ,2. This Kidney transplantation, in particular living donor kidney transplant (LDKT), is widely regarded as the best therapeutic option for patients with kidney failure. When compared with patients undergoing dialysis, those who have undergone kidney transplantation experience a 64%-75% lower risk of death by the first year following transplantation -13. LDKTDespite its significant benefits, LDKT rates in Canada have stagnated over the past decade and continue to average around 12-14 living donors per 1 million population. This is despite national efforts to increase LDKT, such as the paired kidney exchange program ,22,23. TCurrently, the impetus of finding living donors is largely placed on the patient, and much of the present work to increase LDKT focuses on patients and addressing these microlevel barriers . We condAs such, the objective of the study described in this protocol is to generate a systemic interpretation of LDKT by identifying the attributes and processes that facilitate the delivery of LDKT in a provincial health system and those that create barriers. We also aim to identify the differences between these attributes and processes by comparing higher- and lower-performing systems. These objectives are contextualized within our broader goal of increasing rates of LDKT in Canada, particularly in lower-performing provinces. Our primary research question is the following: what are the attributes and processes of provincial health systems that account for variability in LDKT rates?how and why these differences in performance exist. Qualitative methods have established relevance to answering these questions in health research [This study takes the form of a comparative case study analysis as described by Yin ,29 and iresearch . Understresearch . Our quaresearch . It willConceptually, our approach is underpinned by an understanding of health systems as complex adaptive systems (CASs). The concept of CAS stems from the complexity theory and takes a dynamic systems approach. A CAS is \u201can entity composed of many different parts that are interconnected in a way that gives the whole capabilities that the parts don\u2019t have on their own\u201d . A proviThere also exists a tight fit between a CAS approach and case study methodology . ResearcIn accordance with the CAS theory, we defined each provincial \u201ccase\u201d as the health system involved in facilitating LDKT. Adapted from the 4-level model proposed by leading agencies  we mappeWe will conduct a comparative case study between British Columbia, Ontario, and Quebec, which represent respectively high, moderate, and low performance in LDKT as defined by the percentage of LDKTs to all transplantation performed annually . These tOur study follows sequential stages of data collection and analysis . We haveParticipants from different levels of the health system, as shown in To recruit participants, purposive criterion sampling was used to invite key leadership at organ donation organizations, provincial renal programs, and transplant centers. Participants were considered to have key leadership roles if they held decision-making authority with interorganizational impact. Thereafter, snowball sampling was used to recruit providers from kidney care clinics and dialysis centers ,55. DataSemistructured interviews were conducted to understand the dynamic organization, governance, and care entailed in LDKT delivery and the interdependencies between the elements of each provincial health system. We also sought to understand what aspects of the system variously promoted or hindered patient access to LDKT. Interview guides for professional participants addressed their involvement in facilitating LDKT for patients, their interactions with other professionals in this process, their attitude toward LDKT, and which phenomena helped and which ones posed challenges in their work. Interview guides for donors and recipients of LDKT focused on their experiences of LDKT, their perception of care, and what helped and hindered their care path. Distinct interview guides with open-ended questions were developed for each category of participant with the combined expertise of our research team and preliminary document review  to compare case study data and generate explanations for our research question. The RBT is a strategic management theory that provides a framework for explaining and predicting the basis of an organization\u2019s competitive performance and advantage . RBT invFollowing inductive coding and individual analysis of data collected from British Columbia, Ontario, and Quebec, we will use an RBT framework to analyze and compare our case study data and generate explanations for our research question. To do this, we will organize codebooks from each province into capabilities identified from the RBT literature, following questions stemming from these capabilities to guide our organization . AccordiEthics approval for this study was obtained from the McGill University Health Centre Research Ethics Committee (MP-37-2021-7126/LDKT Case Study). This study is being conducted in accordance with the Tri-Council Policy Statement: Ethical Conduct for Research Involving Humans (2014), and the Declaration of Istanbul.This project was funded by a grant from a Gift of Life Institute, a Clinical Faculty Development Research Grant from the American Society of Transplantation from 2020 to 2021, and by a Health Research Grant from the Kidney Foundation of Canada. Individual case studies of British Columbia, Ontario, and Quebec were carried out between November 2020 and August 2022. The individual case study findings of LDKT delivery in British Columbia have been published ,73. FocuThis study aims to produce a system-level understanding of LDKT delivery in Canada\u2019s 3 most populous provinces that have variable rates of LDKT, presenting a unique opportunity for comparative analysis. Informed by quantitative data , we are To our knowledge, a comparative case analysis approach has not been used in the field of nephrology or kidney transplantation. Our approach has implications in these disciplines where there exists a poor understanding of system-level factors leading to inferior outcomes, inequities in access to therapy, and fractured transitions of care. This work also has global implications as LDKT is the main way to obtain a transplant in many countries that lack infrastructure for deceased donation. Based on our preliminary results and background work, we believe that to make significant improvements to LDKT delivery, interventions must target the dynamic relationships between different elements of a system. Much of the current work has focused on microlevel interventions to improve LDKT delivery ,51, missThe following limitations to our study may apply. First, our data collection largely pertains to 3 provinces of Canada and our findings may not be applicable to other regions and countries. Nonetheless, it should be noted that Quebec, Ontario, and British Columbia are Canada\u2019s most populous provinces and represent 75% of the Canadian population, and our focus group data also go some way to establish the pertinence of our findings to other provinces. Our data also lay the foundations to extend our work across Canada and to other countries. Second, our research will not comprehensively explore the system-level factors leading to disparities in LDKT, such as gender and sex disparities and low rates of LDKT in Indigenous and other vulnerable populations. However, the data collected in this study will inform future systematic approaches needed to address this complex issue.Another limitation may pertain to the challenge of delineating the \u201cboundaries\u201d of the health systems that form the basis for our cases. Identifying the unit of analysis for case study research has long been identified as a challenge , and in LDKT is the optimal treatment option for patients with kidney failure; yet, rates of LDKT have stagnated in Canada and vary significantly across provinces. There is a need to better understand how health systems deliver LDKT to patients. Following our prior work that has suggested system-level differences contributing to variability in LDKT performance, we will generate a systemic interpretation of LDKT delivery by identifying the attributes and processes that facilitate or create barriers to the delivery of LDKT. We will also identify the differences between these attributes and processes by comparing higher- and lower-performing provincial health systems. This qualitative comparative case study analysis is informed by CASs, and data analysis will be carried out in accordance with the RBT. Our findings will have practice and policy implications and help inform specific strategies, regulations, and infrastructure that are transferrable competencies and conducive to promoting the service delivery of LDKT."}
{"text": "Furthermore, the addition of ozone increased the volatile content of soot particles and improved soot oxidation reactivity.Ozone is a prospective additive for enhancing and controlling combustion under lean or very lean conditions, and reduces NOx and particulate matter emissions simultaneously. Typically, in studying the effects of ozone on combustion pollutants, the focus is on the final yield of pollutants, while its detailed effects on the soot formation process remain unknown. Here, the formation and evolution profiles of soot containing morphology and nanostructures in ethylene inverse diffusion flames with different ozone concentration additions were experimentally studied. The surface chemistry and oxidation reactivity of soot particles were also compared. The soot samples were collected by a combination of the thermophoretic sampling method and deposition sampling method. High-resolution transmission electron microscopy analysis, X-ray photoelectron spectroscopy and thermogravimetric analysis were applied to obtain the soot characteristics. The results showed that soot particles experienced inception, surface growth, and agglomeration in the ethylene inverse diffusion flame within a flame axial direction. The soot formation and agglomeration were slightly advanced since the ozone decomposition contributed to promoting the production of free radicals and active substances in the ozone added flames. The diameter of primary particles in the flame with ozone addition was larger. With the increase of ozone concentration, the content of soot surface oxygen increased and the ratio of sp As anottability ,12.2 at the beginning of combustion. Halter et al. [3 ozone concentration in air. Ombrello et al. [3H8 flame by experimental and numerical methods. The experimental result showed that the flame propagation speed was enhanced by 8% when the ozone concentration in the oxidizer stream was 1260 ppm. The enhancement in combustion and flame propagation speed could be attributed to the ozone decomposition in the preheating stage. Wang et al. [2/CO, n-heptane, iso-octane and other fuels [2/CO flames with different dilution gases. They also found that with ozone addition, the flammability limit expanded and the laminar flame velocity increased, and the enhancement effect on the flame velocity was more significant under near-limit conditions.Nishida and Tachibana  studied r et al.  studied o et al.  investigg et al.  investiger fuels ,19,20. Ver fuels  carried er fuels  numericax and SO2 by injecting ozone, and the result showed that the removal efficiency of NOx and SO2 was about 95% and 100%, respectively. Wang et al. [x, SO2, and Hg by ozone injection in a quartz flow reactor, and they found that the removal efficiency of NO and Hg gradually improved with increasing ozone concentration. A similar result was found by Sun et al. [x and SO2 using ozone, that NOx removal efficiency enhanced with increased ozone addition. Holder et al. [The effects of ozone on combustion pollutants have also been studied. Tachibana et al.  investigg et al.  further n et al.  when simr et al.  investigr et al.  used an r et al.  comparedPrevious studies have investigated the effects of ozone on flame ignition delay time, laminar flame velocity, flame stability, and combustion pollutants both experimentally and numerically. The addition of ozone improves combustion and laminar flame speed, shortens ignition delay time, expands flame flammability limit, and enhances combustion efficiency. The oxidizing reactions and chemical properties are affected by the ozone atmosphere during the course of soot oxidation. Therefore, it could be speculated that ozone addition in flame influences the generation of soot in combustion. However, these studies have not explored the particles produced with ozone during the combustion process, and the effects of ozone on soot properties in flame remain unknown.Thus, the present study aims to obtain the evolution profiles of soot in ethylene inverse diffusion flames in ozone atmosphere, including physical and chemical characteristics. The soot particles are collected by local and global sampling methods as in our previous studies ,32. The 2H4 is supplied by the intermediate tube, and the shield gas N2 is provided in the outer tube. To generate an O3 atmosphere, an ozone generator is connected to the O2 gas pipeline, and then part of the O2 is converted into O3. The partially O3 and O2 mixture gases are supplied to the central tube of the IDF as the oxidizer. The O3 concentration is measured online by an ozone detector, which is connected to the outlet of the mixing device of oxidizer gas from the ozone generator and diluent gas N2. The detailed experimental system is shown in An inverse diffusion flame (IDF) burner, the same as in the previous works ,32,33,342 gas in the flames is fixed. The concentration of ozone is changed by adjusting the discharge power of the ozone generator. According to previous studies on ozone\u2019s effects on combustion characteristics with different concentrations [During the experiments, the flow rate of Otrations ,18,20,21The flame temperatures were measured by the rapid insertion method with a B-type thermocouple ,33. To e3 is added or not, the flame is very bright. The naked eye cannot directly observe the flame variation when the ozone concentration changes.The flame images with different ozone concentrations are shown in The flame temperature distribution at different heights of the flame center line and boundary line (including the thermophoretic sampling locations) is presented in In the upper part of the flame, the soot particles present long chains or large clusters, and the aggregates are more branched. While in the lower part of the flame, the soot particles are mainly composed of individual particles, and aggregates are governed by a smaller number of primary particles. The TEM image of the soot gathered from the lowest sampling position (HAB = 4 mm) . Previous studies ,42,43,44The HRTEM images in When the sampling height increases from HAB = 30 mm to 40 mm, the soot particles are mainly composed of long or large clusters with more branches, as shown in The nanostructure characteristics of soot at different HAB in O5 flame are shown in 3 + (M) = O + O2 + (M) and releases O atoms [2H2-addition (HACA) is important in soot formation [2H4, and C2H4, then converts to important intermediates through two possible pathways: (1) C2H4 + O = CH3 + HCO, and (2) C2H4 + H(+M) = C2H5 (+M) [2H4 lead to subsequent reactions relating to soot inception. Thus, the soot formation process is promoted in the flame with a higher ozone concentration. The diameter of the particles increases due to the surface growth from HAB = 4 mm to 10 mm.With lower magnification at HAB = 4 mm, the visible particulates are rare, as the particles are just beginning to form. In this flame region, liquid-like materials (indicated by dotted arrows) with irregular shapes and high transparency coexist with solidified soot particles. The presence of these irregular-shaped features shows the soot inception course. At HAB = 10 mm, there are still singlet particles, while a small number of aggregates also appear, composed of several primary particles. The small aggregates appear earlier than that in O0 and O5 flames, illustrating a promotion in soot particle growth with higher ozone concentration. The effect of ozone addition on the facilitation of soot formation can be understood by considering the role of ozone decomposition. Ozone decomposes through the reaction O O atoms ,47. It iormation ,49,50. T2H5 (+M) . The conWhen the sampling height was increased from HAB = 10 mm to 20 mm, more chains of clustered soot aggregates appeared. In this region, the dominant process is soot particle growth and agglomeration. In the middle regions of the flame, the primary particle size increases because of surface growth and PAH condensation, and the agglomerates grow due to a cluster\u2013cluster aggregation (CCA) by collisional growth , which sThe nanostructure images of soot at different formation stages in O10 shown in The primary particle diameter increases gradually due to surface growth and PAH condensation as the particles move from the bottom to the tip of the flame. A quantitative analysis of the primary particle diameter in the flames with different ozone concentrations is shown in With the increase of sampling height, the diameter of particles increases due to surface growth. From HAB = 4 mm to HAB = 20 mm, the particle diameter increases rapidly due to the dominant surface growth and agglomeration processes. The particle size growth trend slows down from HAB = 20 mm to HAB = 40 mm because in this region, the growth of particle surface gradually ceases, while the agglomeration and carbonization of soot predominate. The particles tend to be more mature, as the nanostructure characteristics show. At HAB = 40 mm, the average peak particle diameter of soot in O0, O5, and O10 flames are 15.8 nm, 16.1 nm, and 16.3 nm, respectively. The average particle size increases when the ozone concentration in the flame increases, and the surface growth of soot is stronger in ozone flames. The variation trend of the primary particle diameter in ethylene inverse diffusion flames is constant with the previous work  regardle2 and sp3 carbon hybridization in the flames with different ozone concentrations are obtained by XPS quantitative analysis, as shown in The surface oxygen content of soot particles and the relative components of sp2/sp3 obtained (data in the upper part of 2 content can indicate graphitic carbon, and the sp3 represents the content of the defect site and organic carbon [2/sp3 can characterize the disorder degree of soot, and the smaller the ratio is, the more disordered the soot particles are. The ratio of sp2/sp3 of soot in O0, O5, and O10 flames is 4.97, 4.03, and 3.85, respectively. With the increase in ozone concentration, the ratio of sp2/sp3 decreases, which demonstrates that sp3 hybrid carbon content is higher in higher ozone concentration flames, indicating a lower degree of graphitization. This is because with higher ozone concentration in the flame, O3 decomposes to O2 and O radical, subsequently increasing the O-atom content in the flame and leading to an increase in the sp3 hybrid component. The soot nanostructure and disorder degree can affect soot oxidation reactivity [The XPS spectra of soot particles in flames with different ozone concentrations are fitted by peaking ,54, and c carbon . Previouc carbon . The actactivity .The average time from the initial oxidation of soot to 90% consumption is about 99.2, 89.8, and 84.9 min, respectively. According to the results of XPS analysis, the degree of graphitization decreases when ozone is added to the flame, which enhances the soot oxidation reactivity and makes it more easily oxidized. In addition, the content of volatile materials in the soot from the flame increases gradually with the increasing ozone content, corresponding to 11.5%, 13.2%, and 14.1% in O0, O5, and O10 flame, respectively. The higher volatile content on the soot surface with a higher ozone concentration leads to higher oxidation reactivity. The possible reason is that the decrease in volatile compounds increases the pore area on the particle surface, which facilitates contact with oxidants ,59.2/sp3 decreased. The soot generated from the flame with higher ozone concentration had higher disordered organization and a lower degree of graphitization, resulting in a higher oxidation reactivity.The soot formation and evolution profiles containing morphology and nanostructure, soot surface chemistry, and soot reactivity were studied in ethylene inverse diffusion flames with different ozone concentrations through a combination of the thermophoretic sampling method and quartz plate sampling method. Soot particles experienced inception, surface growth, agglomeration, and carbonization processes, moving from the bottom to the flame top in the ethylene inverse diffusion flames with or without ozone addition. The soot mass slightly increased under the ozone atmosphere. The soot formation and agglomeration were slightly advanced because the free radicals and active substances were promoted due to ozone decomposition. The diameter of primary particles was larger, and the degree of agglomeration of soot was higher in the ozone flames at the same sampling height. With the increase in ozone concentration in the flames, the soot surface oxygen content increased and the ratio of sp"}