Datasets:

hatakeyama-llm-team

/

PMC

like 0

Follow

Team Hatakeyama 25

Patients with prosthetic heart valves are a challenge to any anesthesiologist due to the risk of infective endocarditis, bleeding and thrombosis.We present anesthetic management of a 58-year-old Indian lady with a prosthetic heart valve who underwent hemireplacement arthroplasty.Patients with prosthetic heart valves, especially those with the mechanical valves are prone for thrombosis and resultant complications if anticoagulation is not maintained properly. However, when they are scheduled for major surgery, they can be best managed by normalising the coagulation profile immediately prior to surgery and restarting the anticoagulation as early as possible. Management of patients with prosthetic heart valves for non-cardiac surgery involves cardiac assessment for valvular function, residual pathology, infective endocarditis and functional status; assessment of the status of anticoagulation, any risk of bleeding, preparation for reversal of anticoagulants if needed intraoperatively; and neurological evaluation for detecting any impairment due to thromboembolism. We present successful anesthetic management of a lady with prosthetic mitral and aortic valves who underwent hemireplacement arthroplasty of her right hip.A 58-year-old Indian lady, a known case of rheumatic heart disease since the age of 16 years who had undergone a successful mitral and aortic valve replacement surgery 11 years previously, sustained a fall and fractured the neck of her right femur. She was scheduled for hemireplacement arthroplasty. She had not sustained any head injury during the fall. She was a known diabetic on insulin therapy. Her past history revealed that prior to the valve replacement, she used to get breathless even while doing routine daily activities. Presently, she could climb two flights of stairs without any syncope, palpitations, fatigue, chest pain or breathlessness prior to the trauma. She was receiving oral warfarin 2 mg once daily.Physical examination revealed her to be afebrile, with an irregularly irregular pulse-104 beats per minute, respiratory rate 18 breaths per minute and blood pressure 160/86 mmHg. Her systemic examination did not reveal any pathology. Patient's electrocardiogram showed atrial fibrillation with a heart rate of 110 per minute. Her ECHO showed 54% ejection fraction, normally functioning valves, no paravalvular leak and confirmed absence of vegetations and clots. The chest X ray revealed ball in cage mitral valve prosthesis, an aortic prosthesis, sternotomy sutures and cardiomegaly and 14 (control) with a INR 1.1, APTT 32 (patient) and 28 (control). Two units of packed red blood cells were cross matched in view of anemia. Fresh frozen plasma and protamine were reserved for emergency use in case of undue blood loss during the surgery. Her morning dose of insulin was skipped and she was kept fasting as per the standard guidelines. She received ampicillin 1.5 g and gentamicin 80 mg intravenously as infective endocarditis prophylaxis 30 minutes prior to skin incision.We advised the patient to discontinue warfarin for four days and started on unfractionated heparin 4000 IU subcutaneously 6As the patient was not willing for a regional anesthetic, general anesthesia was planned. Anesthesia was maintained intraoperatively with intravenous infusion of fentanyl 1 μg per minute and isoflurane in a mixture of oxygen and nitrous oxide. Neuromuscular blockade was maintained with vecuronium. The process of cementing was uneventful. The operation resulted in 300 ml blood loss which was replaced with one unit of packed red blood cells and crystalloids. Anesthesia was smooth and uneventful. After tracheal extubation, the patient was shifted to high dependency unit for monitoring.Six hours from the last dose of infective endocarditis administration, the second dose of ampicillin 1.5 g was administered in the postoperative period to the patient. Four hours after the surgery, as the drains did not show any undue bleeding, it was decided to administer her next dose of unfractionated heparin. From next day morning, she was also started on warfarin and PT and APTT were repeated daily. By fourth day the INR was 3.0, heparin was stopped and warfarin continued as before and an ECHO was done which revealed normal functioning valves with no clot or vegetation. Now, ten days after the procedure, she is ready to be discharged home.Patients with mechanical prosthetic heart valves are exposed to a significant threat of thromboembolism and valve dysfunction if proper anticoagulation is not achieved. Patients with new generation prosthetic mechanical mitral valves should receive warfarin to a target INR of 2.5–3.5 and for older types of valves the target INR should be 3.5–4.5 . HoweverOral anticoagulation should be discontinued atleast three days before any major surgery and as a compromise between no anticoagulation and intravenous heparin, subcutaneous conventional heparin or low-molecular-weight heparin in prophylactic doses is substituted preoperatively. A dose of heparin should be given 3–6 h preoperatively in patients at high risk of thromboembolic events and heparin should be restarted as soon as possible post operatively (preferably within 12 h). Warfarin is restarted 24 hours postoperatively or when patients can start oral intake. Heparin should be continued till the INR is in the therapeutic range for at least 48 h, to enable a reduction in all the vitamin-K-dependent clotting factors ,11.In emergency surgery, the affect of warfarin needs to be neutralized by FFP, the dose of which depends upon the individual and this is titrated till INR < 1.5. In addition to this, vitamin K may also be given intravenously in small doses as large doses may lead to resistance to warfarin when it is restarted following surgery.We conclude that in patients with mechanical prosthetic heart valves for major elective surgery like bipolar hemireplacement arthroplasty, warfarin should be changed to unfractionated heparin atleast 4–5 days prior to surgery. INR should be less than 1.5 for proceeding with surgery. In view of risk of possible thrombosis, unfractionated heparin should be discontinued 3–6 h prior to surgery and restarted within 6–12 h of completion of the operation. Infective endocarditis prophylaxis should be administered to all patients with prosthetic heart valves.The authors declare that they have no competing interests.All of the authors were involved in the management of the case and finalizing the article. All of the authors were involved in the process of editing, correcting, and finalizing the manuscript. All authors have read and approved the final manuscript.The patient and the patient's relatives are pleased to give written consent for publishing this particular case scenario.

The Morris water maze task is a hippocampus-dependent learning and memory test that typically takes between 3 days to 2 weeks of training. This task is used to assess spatial learning and induces the expression of genes known to be crucial to learning and memory in the hippocampus. A major caveat in the protocol is the prolonged duration of training, and difficulty of assessing the time during training in which animals have learned the task. We introduce here a condensed version of the task that like traditional water maze tasks, creates lasting hippocampus-dependent spatial cognitive maps and elicits gene expression following learning.This paradigm was designed for rats to quickly acquire a hippocampus-dependent spatial cognitive map and retain this memory for at least 24 hours. To accomplish this, we interspersed visible and hidden training trials, delivering them in a massed fashion so training takes a maximum of 15 minutes. Learning was assessed based on latencies to the platform during each training trial, as well as time spent in the goal quadrant during probe testing 30 minutes and 24 hours after training. Normal rats were compared to two impaired cohorts (rats with fimbria-fornix lesions and rats administered NMDA receptor antagonist (CPP)). To quantitate hippocampal expression of known learning genes, real-time polymerase chain reaction (RT-PCR) was performed on hippocampal cDNA.homer1a, cfos and zif268.We show that massed training using alternating visible and hidden training trials generates robust short-term working and long-term reference memories in rats. Like the traditional Morris water maze paradigm, this task requires proper hippocampal function, as rats with fimbria-fornix lesions and rats administered CPP fail to learn the spatial component of the task. Furthermore, training in this paradigm elicits hippocampal expression of genes upregulated following learning in a variety of spatial tasks: We introduce here a condensed version of the Morris water maze, which is like a traditional water maze paradigm, in that it is hippocampus-dependent, and elicits hippocampal expression of learning genes. However, this task is administered in 15 minutes and induces spatial memory for at least 24 hours. The Morris water maze is a spatial cognitive task that requires the creation of a hippocampus-dependent cognitive map of the environment. While the water maze is commonly used to differentiate learning between various cohorts of rodents, there are a number of disadvantages that limit the practicality of this task including the time required to sufficiently train animals, difficulty controlling for motivational or physical disabilities, and controlling for animal anxiety. There are further caveats that lie in the interpretation of water maze data including identifying when learning has taken place, and how to distinguish simple motor response learning from true spatial learning. We introduce here a novel abbreviated version of the water maze that was designed to overcome some of these limitations, to create a hippocampus-dependent spatial memory that persists for at least 24 hours, and which elicits gene expression of learning-related genes in the hippocampus.Rodents are challenged in the Morris water maze to integrate environmental spatial cues and use them to locate a hidden platform in a pool of opaque water , therebyThe duration of memory for training tasks is dependent on the number of training trials and the amount of time allotted between trials, whereby the longer inter-trial interval results in improved memory -5. With Success in spatial tasks depends on proper hippocampal function, and as such, performance in the Morris water maze is especially sensitive to hippocampal damage. Both animals with hippocampal lesions , and aniC-fos is a transcription factor whose upregulation correlates with spatial and behavior learning and memory in mice (CPP) show impaired spatial acquisition and memory. Furthermore, real time reverse-transcriptase polymerase chain reaction (RT-PCR) performed on cDNA from hippocampi of trained rats reveal a significant up-regulation of immediate early learning genes 30 minutes after training. These data reflect that this novel paradigm requires the hippocampus for successful spatial acquisition and long-term memory consolidation, and also elicits hippocampal genes previously implicated in learning.Three groups of Long Evans male rats were included in this study: group 1 animals were trained in the spatial paradigm [two separate groups (n = 14) and (n = 5)], group 2 animals trained in a similar, but hippocampus-independent cue paradigm (n = 10), and group 3 animals were behaviorally naive (n = 10). Group 1 rats trained in the spatial paradigm included normal rats, pharmacologic controls and surgical controls (fornix-lesioned rats).All rats were housed in pairs, given ad libitum food and water, and kept on a 12 hour light/dark cycle. Rats were allowed to acclimatize to the colony room for at least two days prior to handling. Each rat was handled for two consecutive days before training, injections or surgery. Behavioral training took place in a 180 cm diameter, 80 cm deep pool filled with 60 cm of water (22°C) rendered opaque by the addition of white, non-toxic paint. A video camera mounted to the ceiling directly above the pool recorded swim paths and was connected to a personal computer. Visual cues surrounding the pool included a black and white poster, a neon Frisbee, a hanging plant in a corner and a black curtain. A 21 by 21 cm Plexiglas platform was submerged 3 cm below the water surface in the goal quadrant of the pool, and was made visible by an iron cone that protruded above the water (10 cm). Tracker software calculated and recorded the latency to platform (sec), and search pathways for each subject on each training trial and probe.Rats are adversely affected by i.p. injections of competitive NMDA antagonists with side effects such as hyperactivity, stereotypy, ataxia, and catalepsy . To reduOn the actual test day, rats were given i.p. injections of CPP (12 mg/kg), returned to their home cages in the colony room, and one hour later underwent behavioral training.In the surgical control groups, lesions were made to the fimbria-fornix by radiofrequency using Grass Instrument LM4 Lesion Maker. Rats were nothing per os (NPO) 24 hours prior surgery, and were given subcutaneous injections of the anesthetic Acepromazine (0.5 mg/kg) 20 minutes prior surgery. Fifteen minutes prior to placement in the stereotaxic apparatus, the rats were given an intramuscular injection of the anesthetic Ketamine (50 mg/kg), and 5 minutes later, were given a contralateral intramuscular injection of the analgesic Xylazine (5 mg/kg). Rats were also given a subcutaneous injection of atropine sulfate (0.5 mg/kg) to reduce pulmonary secretions.Measures such as tail and toe pinching were taken to ensure the rat was unconscious prior to placement in the stereotaxic apparatus. After cleaning the skin on the head with iodine, a single anterior-posterior incision was made. Measurements from Bregma were taken: -1.5 AP, +/- 0.8, +/- 2.2 LM, +/- 4.8 DV. Holes were drilled through the skull with a standard, hand-held drill. 8mA or 17 V was delivered for 40 seconds to the lateral positions, while 10 mA or 21 V was delivered for 40 seconds to the medial positions. Antibiotic jelly was applied to the open wound, which was subsequently closed with surgical staples. After surgery, rats were prophylactically treated for infection with intramuscular injections of penicillin (0.1 mL), and treated for pain with a subcutaneous injection of Dipyrone (0.05 mL). Rats were given a 15-day recovery period in the animal facility prior to water maze training. All animal experimentation was conducted according to the guidelines of the Canadian Council on Animal Care and was approved by the Institutional Animal Care Committee.Multiple studies using fimbria-fornix lesion protocols to impair hippocampus-dependent learning in rats have also assessed the performance of sham-lesioned animals in those tasks. Sham-lesioned rats underwent anesthesia, had cranial lesions made at the same coordinates from Bregma as fimbria-fornix lesioned animals, had insertion of electrodes at those sites, but without current delivery. These sham animals showed no learning impairment in hippocampus-dependent tasks ,30 and bImmediately following the probe test, each rat trained in either the spatial or cued task was anaesthetized with an overdose intraperitoneal (i.p.) injection of 30% chloral hydrate. Additionally, two (n = 2) rats were handled for two consecutive days, and allowed to swim freely in the water maze pool for 3 minutes, which is the average time to train animals in the spatial paradigm. These 'swim' control rats were injected with 30% chloral hydrate 30 minutes following the exposure to the pool environment and stresses induced by swimming. All rats were decapitated with an animal guillotine, and both hemispheres of hippocampi were isolated and preserved in RNALater .Learning in spatially trained animals was assessed as described above, and six (n = 6) rats were selected as acceptable spatial learners. One hemisphere of hippocampus per rat was homogenized in RLT Buffer with a hand-held pestle, and run through Qia Shredder columns (Qiagen). RNA was isolated according to Qiagen RNAeasy Mini Kit instructions with minor alterations. RNA was suspended in RNAse-free DEPC-treated water, quantified by spectrophotometry, and stored at -80°C.12-18 in a total 20 μL reaction volume of 10 mM dNTP mix , 0.1 M DTT and 5 × First-strand buffer. The reaction was incubated at 65°C for 5 minutes, 37°C for 50 minutes, and finally 70°C for 15 minutes to arrest enzymatic activity.1 μg of RNA per rat hippocampus was reverse-transcribed to cDNA by Moloney Murine Leukemia Virus (M-MLV) Reverse Transcriptase , according to Invitrogen RT instructions. Total RNA was primed with 5 μg Oligo dTHousekeeping protein p31 (Accession number BC059141.1): forward tcaaccccaccgtgttcttc, reverse gaggaacccttatagccaaatcc; Homer1a (Accession number AJ276327.1): forward cgcaggagaagatggaactga, reverse tttctggtgttaaaggagactgaaga; c-fos : forward cagtggccttgtgagcatga, reverse gcagaggaagacgatgaagca. cDNA from one hemisphere of an additional rat trained in the spatial paradigm was used to create a standard curve for real-time RT-PCR. The following quantites of cDNA were used in the standard curve: 2, 1, 1:5, 1:20, 1:40, 1:60, 1:80, 1:100 μL cDNA per sample.cDNA from spatially trained and swim-control animals was diluted 1:2 in RNAse/DNAse-free DEPC-treated water. Primer pairs were designed using Primer Express 2.0 to amplify gene products 70-151 base pairs long, and were synthesized by Alpha DNA . Primers were synthesized as follows: 2, 148 μM 10 × SYBR green buffer, 0.9 mM each primer, and 0.5 μL cDNA.One master mix, created per PCR run, constituted 16 reaction tubes: 6 for each spatially trained rats, 2 for each cage control rat and 8 for each environmental control dilution. PCR reactions were prepared with SYBR Green PCR Core reagents , and each 25 μL reaction contained 0.624U of AmpliTaq Gold polymerase, 0.25U of AmpErase, 5 mM dNTP mix, 3 mM MgClPrimers were designed for the default settings for 3-step PCR using ABI prism 7000 . 3-step PCR reactions began with a 2 minute incubation period at 50°C, followed by a 10 minute incubation period at 95°C. The third step, which was repeated 40 times, included a 15 second incubation at 95°C, followed by 60 seconds at 60°C. Melt curve analysis began at 60°C and fluorescence was measured to 95°C at an interval of 1.6°C/sec. All PCR products showed one dissociation peak of fluorescence as calculated by the ABI Sequence Detection Software, version 1.1, reflecting a single gene product. Each gene product was further confirmed by electrophoresis on a 2% agarose gel.T) [or the first cycle in which fluorescence exceeds a set value above background] for each dilution was calculated and related to the input cDNA concentration. Correlation coefficients were calculated for each standard curve, and each run was only considered if equal to or greater than 0.97. CT values were measured for each unknown sample, and quantities of transcript were calculated by the software off the standard curve. Efficiencies of reactions were assessed by slopes of standard curves between candidate genes and Housekeeping protein p31 to determine equal quality of amplification between runs prior to normalization. PCR on each gene was repeated in triplicate, and all gene transcript quantities were normalized to the housekeeping gene Housekeeping protein p31 transcript quantity.A standard curve of the additional spatially trained animal dilutions was calculated by ABI prism software V1.1 . Threshold cycles quadrant of the pool. If rats failed to locate the platform, they were guided to it by hand. The platform was made visible by a protruding flag on the first 9 consecutive trials, and on the 10th trial, the flag was removed so that the platform was no longer visible. The platform was made alternatively visible and hidden during trials 11 through 15 by the consecutive replacement and removal of the flag. Thirty minutes following training, a probe test was administered in which the platform was removed from the pool, and each rat was allowed to swim freely for 60 seconds were trained with 15 trials in which the platform was made visible by a flag, and was alternated between the SE, NE, SW, NW quadrants of the pool = 2.523, p = 0.0265), and when these latencies were divided by the expected time of 15 seconds (24 hours Q1/15 vs Q3/15 = 2-tailed = t(9) = 3.13, p = 0.012).versus cue-trained: t (22) = 1.72, p < 0.05; spatially-trained versus. naïve: t (22) = 2.65, p < 0.01). The cue-trained and naïve groups performed similarly (t (22) = 0.74 p > = 0.2). Furthermore, rats in the spatially-trained group escaped onto the platform faster than the other groups of animals during training trial 2 = 4.35, p < 0.05); planned comparisons: spatially-trained versus cue-trained t (22) = 1.84, p < 0.05; spatially-trained versus naïve t (22) = 2.74, p < 0.01). Performance by the cue-trained and naïve groups did not differ during trial 2 (t (18) = 1.36, p > 0.05). Therefore, the initial performance differences between groups were due to training parameters, not spatial learning abilities.To further assess long-term savings following training, three groups of Long Evans male rats were included in the study: animals trained in the spatial paradigm (n = 20), animals trained in the cued training paradigm n = 10), and naïve animals, or rats given no behavioral pretraining (n = 10). Spatially trained animals were selected based on their performance on the spatial test given on day 1 of training, and only spatial learners were subsequently trained and tested on day 2 . Like the fimbria-fornix lesioned animals, these rats performed as well as normal animals across the cued training trials 1 to 15 (t(22) = 3.57, p < 0.005). While spatially-trained rats show distinct improvement on the hidden trials , the CPP-treated rats performed poorly on the hippocampus-dependent trials. Furthermore, CPP-treated animals did not show a bias for the SE goal quadrant during probe testing and swim-control animals (n = 2), and RNA was reverse-transcribed to cDNA. Quantitative real-time PCR was performed using this cDNA to measure transcript levels of the three immediate early genes, as well as Housekeeping protein p31 which served to normalize the samples. Thirty minutes following spatial training, there was a significant increase in the hippocampal transcript levels of Homer1a (2.6 fold), c-fos (1.8 fold), and zif268 (3.8 fold) relative to swim-control rats are used to train the animals to continue to search for a platform despite it not being visible, and serve as a preliminary assessment of spatial learning. Clearly successful performance during these trials requires an intact and functioning hippocampus, as shown by the increased latencies in the surgical and pharmacological controls on these trials. By interspersing the hidden trials amongst the visible trials, we encourage animals to alter their acquisition from cue-approach learning to spatial navigation. The probe test given 30 minutes following training serves as a second and more definitive measure of spatial learning.Making the transition from cue-approach to spatial learning is sensitive enough to distinguish the performances of fimbria-fornix lesioned animals and NMDA-antagonized animals from normal spatial learning rats. However, this transition is not simple for rats on a whole, since only 70% of normal rats will transition well. The relative difficulty of this transition, however, can likely be used to assess subtle differences in cognitive abilities between animal cohorts. Whereas multiple day training might provide the opportunity to overcome mild learning and memory deficits with over-training, this more challenging version we present here may be sensitive enough to show these deficits. The caveat with having baseline success around 70% is that researchers will require increased number of animals per cohort to properly assess overall learning abilities.The Morris water maze is used to distinguish cognitive abilities between a large variety of experimental rodent models based on pharmacological manipulation, brain trauma, toxic exposure and aging, to name a few. Some rodents within these experimental cohorts are faced with unavoidable co-morbidities that may lead to fatigability, motor impairment, or increased susceptibility to anxiety and behavioral despair. Any of these will make training in the original multiple-day Morris water maze task difficult. Performance on the visible training trials will allow detection of these abnormalities, and reflects each individual baseline level. Since the entire training period takes less than 15 minutes, animals that might be impaired by the physical exhaustion of longer training, may be good candidates for our abbreviated paradigm. Furthermore, the brevity in training allows researchers to more closely identify the time frame in which acquisition took place, which is difficult, if not impossible, to ascertain with multiple-day Morris water maze tasks.The challenges in implementing this abbreviated water maze task are those that are inherent to any massed training paradigm. Approximately 70% of normal rats are able to successfully learn the paradigm, and therefore larger cohorts of rats are required to overcome the relative difficulty of the task. As with any maze paradigm, successful training requires normal perception, physical strength and coordination, as well as appropriate stress and motivational responses. Hence experimental subjects and controls should be carefully screened to exclude physical and emotional disabilities. Finally, this task might be too physically demanding for mice, and therefore should be modified in order to accommodate mouse size and physical strength.Our paradigm uses visible training trials to serve as a baseline control measure and hidden training trials as a preliminary assessment of spatial learning. A probe test given 30 minutes after training confirms spatial learning, and short-term memory for the platform location, and a probe test administered 24 hours after training confirms lasting long-term spatial memory is generated. This paradigm gives the opportunity to dissociate poor performance along these measures , which can allow accurate study of animal deficit. It is a sensitive enough measure to detect hippocampal learning deficits from surgically and pharmacologically impaired animals, and elicits hippocampal expression of genes that are established as important to learning. Hence, we introduce this novel paradigm as a useful tool to quickly and efficiently discern learning disabilities.The authors declare that they have no competing interests.LAF participated in the design of the paradigm, performed the fimbria-fornix ablation surgeries, tested the animals, carried out RT-PCRs, performed statistical data analysis and drafted the manuscript. MLS participated in the design of the paradigm, organized the appropriate control cohorts, oversaw the statistical analysis of the behavior data, and helped to draft the manuscript. JN conceived of the study and participated in its design and coordination and helped to draft the manuscript. All authors have read and approved the final manuscript.

In this pilot study, we tested the feasibility of vaccinating advanced RCC patients with the corresponding mutant VHL peptides.Due to the lack of specific tumor antigens, the majority of tested cancer vaccines for renal cell carcinoma (RCC) are based on tumor cell lysate. The identification of the VHL genes were vaccinated with the relevant VHL peptides. Patients were injected with the peptide mixed with Montanide subcutaneously (SQ) every 4 weeks until disease progression or until the utilization of all available peptide stock.Six patients with advanced RCC and mutated Four out of five evaluable patients (80%) generated specific immune responses against the corresponding mutant VHL peptides. The vaccine was well tolerated. No grade III or IV toxicities occurred. The median overall survival (OS) and median progression-free survival (PFS) were 30.5 and 6.5 months, respectively.The vaccine demonstrated safety and proved efficacy in generating specific immune response to the mutant VHL peptide. Despite the fact that the preparation of these custom-made vaccines is time consuming, the utilization of VHL as a vaccine target presents a promising approach because of the lack of other specific targets for RCC. Accordingly, developing mutant VHL peptides as vaccines for RCC warrants further investigation in larger trials. Trial registration: 98C0139 Renal cell carcinoma comprises the majority of malignant kidney tumors. It is relatively rare in the United States but its incidence has continued to rise since 1975 . The lifRCC is one of the most resistant forms of cancers to both radiation and chemotherapy. Recently, the multitargeted tyrosine kinase inhibitors Sorafenib and Sunitinib have shown 10% and 34-44% objective response rates, respectively, in metastatic RCC -9. AccorClear cell renal carcinoma (CCRC) is the most common histological subtype of RCC and accounts for about 70% of cases . This tuvon Hippel-Lindau (VHL) gene [VHL have been linked to the development of sporadic CCRC and hemangioblastomas. Most of these mutations are frameshift and the rest are missense, nonsense, or stop mutations [VHL represents a novel potential target for clear cell RCC.One obstacle to developing a renal cancer vaccine was to identify an RCC tumor-specific antigen . Most RCHL) gene ,36. Somautations -39. Otheutations ,40-42. AIn this pilot study, we present our experience using the mutated VHL peptides as a vaccine for metastatic RCC. We show that the use of mutant VHL peptides for targeted vaccine therapy is feasible, safe, and capable of generating specific immunological responses, which provides incentive for further exploration in the management of advanced RCC.VHL gene resulting in a new amino acid sequence; lack of available standard systemic treatment; Eastern Cooperative Oncology Group (ECOG) performance status of 0 or 1; and a life expectancy of more than 3 months. Main exclusion criteria included: evidence of brain metastasis; history of autoimmune disease; history of other malignancies except basal cell carcinoma of the skin; and pregnancy. The study protocol was approved by the Institutional Review Boards of the National Cancer Institute (NCI) and the National Naval Medical Center (NNMC), Bethesda, Maryland. Written informed consent was obtained from all patients. The study was in compliance with the Helsinki Declaration.Patients with locally advanced, recurrent, progressive, or metastatic RCC were enrolled in this pilot trial. All patients enrolled in the trial met the protocol eligibility criteria, including: histologically proven CCRC; tumors expressing mutated VHL mutation and the potential binding affinity of the amino acid motif spanning the mutation to the patient's HLA (Table http://bimas.cit.nih.gov/molbio/hla_bind/. In case of a single residue point mutation (peptides 3 and 4), the mutation was placed in the center and 8 residues were included on each side, so that every 9-mer containing the mutation would be included in the peptide, to cover most possible epitopes that included the mutation. In the case of peptide 2, a shorter version of that peptide was used to avoid residues that flanked the mutation and lead to solubility problem such as a second Cysteine (C) on the n terminus, which would lead to cross-linking of peptides and aggregation. Peptides 1 and 6 were frame shift mutations, creating totally novel sequences, so as much length as possible was used until reaching a stop codon, or having to avoid some residues such as Cysteine (C), as outline above. The same concept applied to peptide 5, in which the frame shift ORF ended with Arginine (R). To have enough length, the sequence was extended to the left by 8 of the wild type residues (unmutated); so that every 9-mer would contain at least one of the abnormal frame shift residues and thus no epitope in the peptide would be contained in the wild type sequence. Peptides were synthesized under GLP conditions using an automated synthesizer and standard solid-phase chemistry. The peptides were packaged in vials by the National Institutes of Health (NIH) Clinical Center's Pharmacy. Safety, identity, and stability assays were conducted by the NIH Clinical Center Pharmaceutical Development Service (PDS). Assay results for each lot were submitted to the Cancer Therapeutic Evaluation Program (CTEP) Biological Drug Quality Assurance Committee for review and approval prior to human use. One hundred microliters of the patient dosage were re-analyzed by HPLC for purity and quantity of peptide, and sequenced by automated sequenator to confirm identity. Immediately prior to vaccination, 1000 μg of the mutant VHL peptide in 0.7 mL of normal saline were emulsified in 1:1 ratio with the adjuvant "Montanide ISA-51" .All peptides were custom-designed based on the patient's own tumor LA Table and 2. PEligible patients received a dose of 1000 μg of the emulsified corresponding mutant VHL peptide and "Montanide ISA-51." Half of the total volume of the vaccine (0.7 mL) was administered subcutaneously over each deltoid muscle. Patients were observed for 1 hour in the outpatient clinic to assess for any allergic reaction. Vaccinations were repeated every 4 weeks until disease progression or until the utilization of all available stock of the peptide.9 peripheral blood mononuclear cells (PBMC). This procedure was repeated every-other cycle. In the other cycles a 100 mL of whole blood was collected by phlebotomy to obtain 1 × 107 PBMCs. Lymphocytes obtained by apheresis were frozen and saved for future immunologic testing. An automated Ficoll-hypaque density gradient separation was used to obtain the appropriate cell types for immunological assays. The IFN-γ ELISPOT assay was used to quantify mutated VHL peptide-specific CTLs.Prior to the first vaccination, patients were apheresed to obtain 1 × 10Dendritic cells (DCs) for use in the ELISPOT assays were obtained by culturing autologous monocytes in Granulocyte-macrophage colony-stimulating factor (GM-CSF) and IL-4 according to widely established procedures. Briefly, frozen PBMCs were thawed and rested for 2 hours, followed by incubation in plastic flasks for 2 hours. The nonadherent cells were then washed away and the remaining adherent cells were cultured in 10% fetal bovine serum (FBS) DC medium containing 100 IU/mL GM-CSF and 50 ng/mL IL-4 for 6 days at 37°C. Cultures were fed at day 3-4 by removing one-half of the culture volume and adding an equal volume of fresh media containing sufficient GM-CSF and IL-4 for the entire culture volume. DCs were harvested on day 6, pulsed with antigen for 4 hours, and then matured overnight with 5 ng/mL Lipopolysaccharide (LPS). On day 7, DCs were harvested, washed, and the cell suspension volume adjusted for use in the ELISPOT assay.in vitro expansion cultures or cytokine addition. Autologous monocyte-derived dendritic cells (DCs) pulsed with antigen and matured with Lipopolysaccharide (LPS) overnight were used as the antigen presenting cells (APC). Briefly, the day before assay setup, 96-well polyvinylidene fluoride (PVDF) membrane, HTS opaque plates were coated overnight with capture antibody, anti-human IFN-γ (10 μg/mL) in DPBS at room temperature. Patient dendritic cells were harvested and were either pulsed with the patient's specific mutant VHL at 50 μg/mL, the irrelevant peptide TAX at 3 μg/mL, or no peptide for 4 hours and then matured overnight with LPS at 37°C. Antibody-coated plates were washed the next day and blocked with 5% HuAB ELISPOT medium at 37°C for approximately 2 hours; 3 × 105 freshly thawed and 2-hour rested patients' PBMCs and 3 × 104 pulsed autologous DCs were used per well. The plates were incubated for 18-20 hours at 37°C. The next day, the plates were manually washed six times with DPBS, 0.05% Tween 20, followed by a 2-hour incubation at room temperature with a 1:2000 dilution of the biotinylated secondary antibody, anti-human IFN-γ, . After incubation and four washes to remove excess antibody, a 1:3000 dilution of streptavidin alkaline phosphatase was added to each well for 1 hour followed by 4 manual washes. Finally, The BCIP/NPT substrate, 100 ul/well, was added and the reaction was stopped incubating in distilled water for 7-10 minutes, resulting in the development of spots. Plates were dried overnight and the spots were visualized and counted using the ImmunoSpot Imaging Analyzer system . The results were calculated as: total number of experimental spots with DC = (PBMC + pulsed DC) - (PBMC + nonpulsed DC). From each patient, postvaccination PBMCs were compared to prevaccination as a baseline. A positive ELISPOT result for the patient was defined as a total number of experimental spots in the postvaccination sample of more than twofold above the total spots in the prevaccination sample.All ELISPOT assays were performed at NCI Frederick (CLIA certified lab). The ELISPOT assay using autologous antigen-pulsed DCs was validated and approved by the NIH Vaccine Oversight Committee. Two frozen normal donor controls with known responsive values were run with each assay to assure quality control of the assay results. ELISPOT assay was performed on freshly thawed PBMCs with no 6/mL in D-PBS/2% BSA. The cells (1 × 106/tube) were stained for surface markers for 20 minutes at room temperature (RT) in the dark and washed two times with D-PBS/2% BSA.Cryopreserved PBMCs were thawed rapidly at 37°C. The cells were transferred into 15 mL conical tubes and diluted to 10 mL by dropwise addition of RPMI medium containing 20% FBS. The cells were pelleted by low-speed centrifugation at 250 xg for 10 min at 25°C. Supernatants were discarded and cell pellets resuspended in 5 mL of Dulbecco's phosphate buffered saline (D-PBS) containing 2% huAB serum to block cell surface Fc receptors. The samples were mixed briefly and incubated on ice for 15 minutes. Following incubation the cells were pelleted by centrifugation as described before, washed two times with D-PBS containing 2% bovine serum albumin and resuspended in 1 mL of D-PBS/2% BSA. The cells were counted in a Coulter counter and adjusted to a final concentration of 10 × 10Intracellular staining for FoxP3 was carried out using human FoxP3 buffer prepared as described by the manufacturer . Briefly, following staining of surface antigens, cells were resuspended in 2 mL of fixing solution (buffer A) and incubated for 10 minutes at RT in the dark. Cells were washed two times with PBS/2% BSA, resuspended in 0.5 mL permeabilization solution (buffer C) and incubated for 30 minutes at RT in the dark. Cells were washed two times in PBS/2% BSA and stained with anti-human FoxP3 antibody for 30 minutes at RT in the dark. Cells were then washed two times and resuspended in 0.5 mL of PBS/2% BSA for four-color flow cytometric analysis using the FACSCanto cytometer running FACS Diva acquisition software (version 6.0). Each assay contained a parallel set of cells stained with relevant isotype controls (Alexa Fluor 488 IgG1 and PE IgG1).+ T cells were identified by further gating the CD3+ subset by forward and side scatter and by CD4. The regulatory CD4+ T cell subset was identified by plotting CD25 versus FoxP3 with the quadstat setting determined based on the isotype control tube. The quadrant markers of the CD25 versus FoxP3 dot plot were set based on the isotype controls. In each case the pre and post samples were tested side by side in the same experiment and were done from frozen samples. This testing strategy was used to minimize variability from day to day in staining or thawing. The samples were tested in 4 independent setups over 3 days. We have included 2 internal controls in each experiment, one of those being a frozen leukapheresis sample that has been included in each test run as a measure of interassay reproducibility. In the limited number of assays we have performed using that control, the interassay CV% has been 33% (range of 3.4 to 9.4% for CD25/FoxP3+). Eliminating the outlier value of 9.4% reduces the CV to 15%.Flow cytometric data analysis was carried out using FlowJo Software. T cells were identified by plotting CD3 by side scatter. CD4Patients were evaluated for toxicity and tumor response during treatment and up to 2 years after the last vaccination. Physical examination and blood profiling were performed prior to each vaccination. Tumor response was assessed by the appropriate imaging technique, according to RECIST criteria, at baseline, then following every two vaccinations during therapy and every 3 months during follow-up. Disease progression was defined as the appearance of new lesions and/or 25% increase of measurable lesions as evident by CT scan. Once patients had progressed, follow-up was not required except to document late toxicities and death. Adverse events/toxicities were defined and graded according to the NCI Common Toxicity Criteria. Patients were taken off study in the case of disease progression or deterioration in performance status.VHL gene . Patients had an average age of 62 years, with an ECOG performance status of (0) in three patients and (1) in three patients , and remained fairly elevated (50-60 spots) during the first 12 months of follow-up and then decreased dramatically before returning to baseline generated specific immune responses against the corresponding mutant VHL peptides ; however, despite maintaining the immune response during the first 2 months of follow-up (160 spots/106 PBMCs), the number of reactive T cells then returned to baseline ; however, this patient was lost to follow-up for additional immune endpoints were measured in the peripheral blood of the five evaluable patients prevaccination and following each vaccination and local skin reaction in the form of mild skin redness and swelling (83% of patients), which resolved in less than 72 hours. No signs or symptoms of autoimmune disease were observed up to 88 months of follow-up.Patients received a total of 51 vaccinations. One of the treated patients did not complete the first four vaccinations (patient 1). This patient had extensive lung metastases and was removed from the study after two vaccinations because of rapid deterioration of performance status and disease progression. The other five patients received at least four vaccinations. Patient 3 had recurrent disease after six vaccinations. It is noteworthy that this patient underwent right adrenalectomy followed by subcarinal node resection and remained without any recurrence 87 months after enrollment on the study despite having no further therapy. Patient 4 was removed from the study after four vaccinations due to disease progression. The other three patients received 10, 11, and 18 vaccinations, respectively, until the peptide stock was exhausted. Patients 2 and 6 completed the study and remained without disease recurrence (patient 2) or progression (patient 6) for 88, and 57 months, respectively, after starting on the study; both patients had no further conventional therapy after finishing the study. Patient 5 had recurrent disease during follow-up with cerebral metastases . The immune responses of the three responding patients who had long-term follow-up share the same trend described as: 1) an increase in VHL peptide-specific T-cell frequency from baseline compared with the control peptide (TAX); 2) maintenance of the increased VHL-specific T-cell frequency throughout therapy; and 3) a return of the immune response to baseline after completion of the treatment.The identification of the Although cells other than T cells, such as NK cells and monocytes, present in PBMC utilized in the ELISPOT assays can secrete IFN-γ, the majority of IFN-γ secreting cells in the assays are T cells. Patients' autologous DCs were loaded with the specific peptides (10-17-mer VHL peptides) served as APC. Therefore, these peptides were presented in the appropriate context to stimulate T cell reactivity (MHC restricted peptides). Additionally, the number of IFN-γ secreting cells in response to the VHL-peptides increased after vaccination. This data demonstrates that the IFN-γ response measured in the ELISPOT is due to the induction of memory cells, and therefore T cells, to vaccination. As such, it is unlikely that any cells other than T cells are involved in the IFN-γ secretion. It would be interesting to distinguish between reactivity of CD8+ versus CD4+ T cells and if there are changes in these subsets, especially with those patients who demonstrated promising clinical out comes. However, for the purposes of this study, general T cell reactivity in response to vaccination was an appropriate measure to first assess if the vaccination could elicit an immune response to mutated self-antigen. Normally, the frequency of self-reactive T cells is quite low due to multiple mechanisms of central and peripheral tolerance. Findings from this pilot study demonstrate that we can elicit immunity to VHL peptides and thus provides the foundation for future studies to elucidate the particular immune responses generated by this vaccine.Some cancer vaccine trials showed an increase of T regulatory cells which may be due to the progressive disease status or the use of certain cytokines, such as IL-2 ,44. HereVaccinating with mutant VHL peptides was found to be generally safe. The toxicities were all grade I or II and resolved spontaneously. This was a small pilot trial and was not powered to test the vaccine for clinical efficacy; however, despite the advanced disease status of these patients, we found that their median OS and median PFS were 30.5 and 6.5 months, respectively. Three of the six vaccinated patients are still alive despite having no further conventional therapy, which is extremely unusual for patients with advanced RCC; interestingly, all three patients had a positive immune response to the corresponding peptide.VHL still provides a unique opportunity for a specific vaccine against RCC, especially in early disease, since there are very few known antigens in RCC. This trial draws attention to a novel therapeutic approach in RCC treatment that needs to be investigated further in larger clinical trials.In conclusion, we believe that vaccination with mutant VHL peptides is safe and effective in generating a specific immune response to the corresponding peptides. Manufacturing these custom-made peptides is time-consuming since it takes a cumulative 6-9 months to sequence the gene, manufacture the peptide, package it in vials, and conduct the appropriate required stability testing. This may pose practicality challenges in using such vaccination methods in advanced disease, considering the short life expectancy. Furthermore, as we have seen in this trial, the immune responses induced by these peptides along with adjuvant administered subcutaneously--as easy and practical as they may be--reverse gradually as soon as vaccinations are completed. Accordingly, we believe that such treatment needs to be continued in order to maintain meaningful immune response or use certain cytokines that can prolong the immune response such as IL-15 or GM-CSF ,46. ThatThe authors declare that they have no competing interests.OER analyzed the data and drafted the manuscriptEA participated in the patients careRI carried out the immunoassaysAT carried out the immunoassaysBG participated in the patients careVEH participated in the patients careWML analyzed the mutationsSMS performed the statistical analysisFG provided the pharmaceutical supportGG vialed the peptides and tested their stabilitySAB participated in the patients careJAB participated in the design of the studySNK conceived of the study, and participated in its design and coordinationAll authors read and approved the final manuscript.

PI4K2B is a strong functional candidate as it is a member of the phosphatidylinositol pathway, which is targeted by lithium for therapeutic effect in bipolar disorder. Two approaches were undertaken to test the PI4K2B candidate gene as a susceptibility factor for psychiatric illness. First, a case-control association study, using tagging SNPs from the PI4K2B genomic region, in bipolar disorder (n = 368), schizophrenia (n = 386) and controls (n = 458) showed association with a two-marker haplotype in schizophrenia but not bipolar disorder . Second, expression studies at the allele-specific mRNA and protein level using lymphoblastoid cell lines from members of the large Scottish family, which showed linkage to 4p15–p16 in bipolar disorder and recurrent major depression, showed no difference in expression differences between affected and non-affected family members. There is no evidence to suggest that PI4K2B is contributing to bipolar disorder in this family but a role for this gene in schizophrenia has not been excluded.Bipolar disorder, schizophrenia and recurrent major depression are complex psychiatric illnesses with a substantial, yet unknown genetic component. Linkage of bipolar disorder and recurrent major depression with markers on chromosome 4p15–p16 has been identified in a large Scottish family and three smaller families. Analysis of haplotypes in the four chromosome 4p-linked families, identified two regions, each shared by three of the four families, which are also supported by a case-control association study. The candidate gene In addition, the aforementioned association study identified SNP rs10939038, which lies in the same linkage disequilibrium (LD) block as PI4K2B, as a potentially important variant in schizophrenia cases  = 1.314, 95%CI: 1.08–1.59) .PI4K2B is a phosphatidylinositol 4-kinase and a member of the phosphoinositide (PI) signal transduction pathway. Its primary function is the phosphorylation of phosphatidylinositol to generate phosphatidylinositol 4-phosphate , schizophrenia and controls . Details of this sample have been previously reported . The stu2.1.2PI4K2B genomic region from HapMap Phase II (January 2006) (http://www.hapmap.org) was uploaded to Haploview version 3.2 in a total number of 1212 individuals (93% sample success rate). Further descriptive information on the SNPs is available in 2.1.4α = 0.01, with >93% power for association of an allele that shows a heterozygote relative risk (multiplicative model) of two, assuming a risk allele frequency of 10% and a lifetime prevalence of 1% in 368 individuals (number of bipolar disorder cases) (α = 0.01). The standard χ2 test of independence was used to examine deviations of the 11 SNPs from Hardy–Weinberg equilibrium (HWE) in the control sample . Single-marker analysis was performed using in the χ2 test of independence . The pow default ; minimumpendence . Haplotypendence , using a2.22.2.1Lymphoblastoid cell lines from members of the large Scottish family were grown under standardised conditions, following standard protocols. All cell lines were subjected to the same cell culture and experimental conditions. Genomic DNA (gDNA) and RNA were prepared by the DNeasy Tissue Kit (Qiagen) and RNeasy Mini Kit (Qiagen) respectively. mRNA was reverse transcribed to cDNA with First Strand cDNA Kit (Roche) using random primers. “Quant-iT PicoGreen dsDNA Reagent and Kit” (Molecular Probes) was used to quantify DNA.2.2.2® Universal PCR Master Mix, 0.25 μl dH2O. Each homozygote mix was assayed in quadruplicate. A standard curve (linear regression line) was established for the LOG of the fluorescent intensity ratio (FAM™/VIC®) versus the log of the allele ratio, i.e. the LOG2 ratio of the dilution of each homozygote (90:10 = LOG2 Ratio is 3.147), as previously published . From the endpoint read, the ratio of the fluorescence reading from the FAM™ reporter dye and VIC® reporter dye was calculated. cDNA values were calculated by the cDNA/gDNA ratio from the mean value of DNA from the same individual.rs313548 and rs313567 were available as pre-designed Taqman SNP genotyping assays while rs6834255 was a custom designed Taqman SNP genotyping Assay (ABI). A standard curve of dilutions from homozygous lymphoblastoid cell line samples was prepared to evaluate the contribution of each allele in the heterozygote samples; genomic DNA prepared from two homozygote samples (5 ng/μl), as previously published . Ten micublished . For the2.2.3® Electrophoresis System, as per manufacturer’s instructions with 17-well 4-12% Bis–Tris gels. Densitometry analysis was performed using ImageJ v 1.37 and rs10939038–rs3756207 . P-values for these global haplotypes. Haplotype rs17408391–rs10939038 spans from LD block 1 to LD block 2, while haplotype rs10939038–rs3756207 falls within LD block 2 as illustrated in P = 0.05) was rs10939038 in the schizophrenia cases (P = 0.006), which was previously reported  = 0.0038). No association was detected in either bipolar disorder or schizophrenia at the single-marker level for the seven additional SNPs, which were selected to increase coverage of the PI4K2B region.reported and controls (n = 10). There was no difference in allele expression of rs313548 between individuals with the PI4K2B linked haplotype and those who do not have the haplotype (t-test P = 0.28). Furthermore, there was no difference in allele expression between individuals with the PI4K2B linked haplotype and those who do not have the haplotype for rs6834255 (t-test P = 0.98) and rs313567 (t-test P = 0.36) (data not shown). PI4K2B protein expression was detected in lymphoblastoid cell lines derived from the large Scottish family: Twelve samples with a “linked haplotype” and a psychiatric diagnosis and founder individuals as controls (n = 4). PI4K2B protein expression difference between linked haplotype carriers and controls in five replicate western blot experiments (t-test P > 0.1).eviously . RNA expescribed . Based oescribed . Fig. 2 4PI4K2B was a worthy candidate gene for bipolar disorder in many respects. Positional evidence from linkage and association analyses have implicated this genomic region on chromosome 4p15–p16. Genetic evidence has also suggested other members of the phosphoinositide signalling pathway as susceptibility factors for bipolar disorder, schizophrenia and recurrent major depression (www.ConLiGen.org). Our study contributes to the genetic basis of psychiatric illness research by adopting a candidate gene study with two approaches; (i) an association study in 368 bipolar disorder, 386 schizophrenia and 458 Scottish participants and (ii) an expression study in lymphoblastoid cell lines from bipolar disorder and recurrent major depression members of a large Scottish family.pression and comppression . Indeed pression . Three PI4K2B SNPs were used to measure gene expression levels, one of which was an intronic SNP to measure heteronuclear RNA as previously described (PI4K2B expression differences due to the above association study evidence.This study of d method . This meescribed . InitialThe limitations of this expression study are the sensitivity of the technical procedures, the reduced power from the limited number of heterozygote family members with viable lymphoblastoid cell lines available and whether lymphoblastoid cell lines effectively model pathogenic processes in the brain . StudiesPI4K2B in susceptibility to bipolar disorder from expression studies in lymphoblastoid cell lines. Nevertheless, this candidate gene still merits further investigation to assess its potential role in psychiatric illness, because of the significant case-control association study result that withstood permutation testing.This study showed that there was no direct evidence for a role of All authors declare that they have no conflicts of interest.Lorna M. Houlihan, Kathryn L. Evans and David J. Porteous designed the study and wrote the protocol. Lorna M. Houlihan managed the literature searches, undertook the statistical analysis and performed the expression experiments. Andrea Christoforou helped in design and interpretation of the association study. Margaret I. Arbuckle, Helen S. Torrance and Susan M. Anderson helped with sample preparation and molecular biology techniques. Douglas H. Blackwood and Walter J. Muir ascertained the samples. Lorna M. Houlihan wrote the first draft of the manuscript. All authors contributed to and have approved the final manuscript.Funding for this study was provided by the Wellcome Trust Grant 072874; the Wellcome Trust had no further role in study design; in the collection, analysis and interpretation of data; in the writing of the report; and in the decision to submit the paper for publication.

Probabilistic Boolean Networks (PBNs) provide a convenient tool for studying genetic regulatory networks. There are three major approaches to develop intervention strategies: (1) resetting the state of the PBN to a desirable initial state and letting the network evolve from there, (2) changing the steady-state behavior of the genetic network by minimally altering the rule-based structure and (3) manipulating external control variables which alter the transition probabilities of the network and therefore desirably affects the dynamic evolution. Many literatures study various types of external control problems, with a common drawback of ignoring the number of times that external control(s) can be applied.This paper studies the intervention problem by manipulating multiple external controls in a finite time interval in a PBN. The maximum numbers of times that each control method can be applied are given. We treat the problem as an optimization problem with multi-constraints. Here we introduce an algorithm, the "Reserving Place Algorithm'', to find all optimal intervention strategies. Given a fixed number of times that a certain control method is applied, the algorithm can provide all the sub-optimal control policies. Theoretical analysis for the upper bound of the computational cost is also given. We also develop a heuristic algorithm based on Genetic Algorithm, to find the possible optimal intervention strategy for networks of large size. Studying the finite-horizon control problem with multiple hard-constraints is meaningful. The problem proposed is NP-hard. The Reserving Place Algorithm can provide more than one optimal intervention strategies if there are. Moreover, the algorithm can find all the sub-optimal control strategies corresponding to the number of times that certain control method is conducted. To speed up the computational time, a heuristic algorithm based on Genetic Algorithm is proposed for genetic networks of large size. The major goal of functional genomics is screening genes that determine specific cellular phenotypes (diseases) and modeling their activities in such a way that normal and abnormal behaviors can be differentiated. The pragmatic manifestation of the above goal is developing therapies based on the disruption or mitigation of aberrant gene function contributing to the pathology of certain disease. Mitigation would be accomplished by the use of drugs to act on the gene products. There are three things involved in engineering therapeutic tools, namely, synthesizing nonlinear dynamical networks, characterizing gene regulation and developing intervention strategies to modify dynamical behavior. In this paper, we introduce a new optimization finite-horizon control problem with multiple hard-constraints. First we review some models for studying genetic regulatory networks, Boolean networks (BNs) and Probabilistic Boolean networks (PBNs). A brief review of intervention strategies is also given. We then introduce our mathematical formulation of the problem and the Reserving Place Algorithm. The upper bound for the computational cost is also estimated. We report the results of computational experiments for different genetic regulatory networks by Reserving Place Algorithm and (or) the Genetic Algorithm. Finally, conclusions are given at the end of the paper.In computational systems biology, building mathematical models and efficient numerical algorithms to study regulatory interactions among DNA, RNA, proteins and small molecules are important issues . There hi is regarded as a vertex in the network and the gene expression state at time t is quantized to two levels: on and off (represented by 1 and 0). A BN consists of a set of genes {v1,v2, …, nv} and a set of Boolean functions {f1, f2, …, nf}. The Boolean function if : {0,1}n → {0,1} represents the rules of the regulatory interactions among the genes: iv(t + 1) = if(v(t)), i = 1, 2, … ,n. Here v(t) = (v1(t), …,nv(t))t is called the Gene Activity Profile (GAP). The GAP can take any possible form from the set S = {τ : iv ∈ {0,1}}, thus totally there are 2n possible states. A BN is indeed a deterministic model and the only randomness comes from its initial state. Given an initial state, the BN will eventually enter into a set of state(s) called the attractor cycle and stays there forever i = iv(T) is the state of gene i at time T) while minimizing the sum of the costs of the control actions applied at each time point We first give some necessary notations to introduce the mathematical formulation of our optimization control problem. We then describe an algorithm, the Reserving Place Algorithm, for obtaining all the optimal solutions. The upper bound of computational cost is also estimated. Based on this, the drawbacks of the Reserving Place Algorithm is stated and we apply the Genetic Algorithm to networks of large size. Here we study an optimization control problem with multiple hard-constraints. Our goal is to find an optimal strategy for manipulating external control variables to desirably affect the dynamic evolution of a random PBN over a finite time horizon with minimum corresponding cost. Without loss of generality, here we only consider two control methods. At each time point is is the number of times that Control i is conducted, and iK is the maximum number of times that Control i can be applied, i = 1, 2. We use ji ∈ {0,1, 2} to represent that Control ji is applied to the network at time j. Then the control string i1i2 …, ki represents the control actions conducted from time 1 to time k. We define set U = {σ = i1i2 … Ti : ji ∈ {0,1, 2}, and 0 ≤ is ≤ iK, i =1, 2} as the set containing all the possible control strategies satisfying the multiple hard-constraints. Given the initial probability distribution vector x0, the state probability distribution vector T obtained by control strategy σ = i1i2 … Ti. The feasible solution set V is a subset of set U, whereHere V is not empty.Optimal solution(s) exists(exist) if t = 1. Then one can obtain the set {00, 01, 10, 11} for time t = 2. Recursively one can get the feasible solution set while checking whether the control strategies satisfy the hard-constraint. The problem proposed in this paper involves more than one control methods under multiple hard-constraints. The recursive method in [T at the right start. For the generation of set U, the numbers of times that each control method can be applied are also involved into consideration. Then one only need to check whether the state probability distribution obtained by any control string in the set U satisfies the constraint U, the set of all possible control strategies satisfying the hard-constraints.Our proposed problem is NP-hard. Here we develop an algorithm for computing all the optimal solutions. In order to find the feasible solution set for the optimal control problem with hard-constraint, applied ethod in can be ak, 0 ≤ k ≤ K2. We reserve k places in the control string of length T for Control 2, then there are totally T − k where Control 0 (i.e. no control) and Control 1 can be applied and the maximum number of times that Control 1 can be applied is K1. We note that among all the possible control strings, binary string T−k − 1 to binary digits and checking the number of times that Control 1 is applied, one can generate all the control strings of length T − k satisfying the hard-constraint for Control 1. Finally we can obtain the set U by increasing k from 0 to K2.We first assume that the number of times that Control 2 is applied is fixed as Here we provide an upper bound of the computational cost for our Reserving Place Algorithm.Theorem 1The computation cost of the Reserving Place Algorithm is bounded above by MT22n whereProof: The main computational cost of the algorithm comes from the matrix-vector multiplication. For each control strategy, the number of matrix-vector multiplication is T, where T is the length of time interval. If we search an optimal solution in the set W = {σ = i1i2 … Ti : ji ∈ {0,1, 2}} the computational cost is T3τ22n, where n is the number of genes in the network. Since we only need to consider the strategies in the set T22nn(V), where n(V) is the number of control strategies in the set V. We note that V ⊆ U, the computational cost is bounded above by T22nn(U). By the Reserving Place algorithm, we haveT and the number of genes n. Note that the number of possible states in the network increases exponentially with respect to the number of genes n, thus the computational cost for solving the optimal control problem can be enormous even for moderate n. For any of the above two cases, we apply the Genetic Algorithm (GA) for the proposed multiple hard-constraint problem. GA is inspired by evolutionary biology such as inheritance, mutation, selection, and crossover. It is a search technique used in computing to find exact or approximate solutions to optimization and search problems. In the first step, we generate a random population of size N = 100, consisting policy vectors of length T = 100. The cost of each policy vector is evaluated which is subsequently turned into the probability that it would be picked for the next generation. Second, we pick 2 policies from the current generation with replacement according to their corresponding probabilities. Then, with cross over rate pc = 0.7, crossover of the two policies occurs at a random position. After that, each position of the policies mutates with mutation rate pm = 0.01. After the above operations, the two resulting vectors are placed in the new population. Two policies are picked at a time from the current population and then the crossover and mutation operations are performed whenever necessary until there are N or N +1 policies in the new generation. We then calculated the cost and the probability of each policy vector. If N is odd, we randomly remove one policy vector from the new generation. The cost and probability of each policy vector are then calculated. The process returns to the second step unless the stopping criteria is met. Since the GA starts by randomly generating an initial population, it cannot guarantee to obtain an optimal solution. Thus to obtain a reasonably good solution, in numerical experiments, we apply GA many times, and obtain an optimal solution from all the results obtained.It has been shown that finding a control strategy for a BN to a global state is actually NP-hard . By TheoThis section is organized into three parts. First, we provide a 2-gene hypothetical genetic network. Both the Reserving Place Algorithm and Genetic Algorithm are applied. The contrast in computational time is also given. Then both algorithms are applied to a 3-gene hypothetical genetic network. Finally, the comparison of the two algorithm is conducted.A and B. The states of gene A and gene B are given in Table We start with a 2-gene hypothetical genetic network. The network consists of two genes denoted by T the total probability of gene A being expressed is at least 0.8 with the minimum cost, given an initial state distribution of x0 = t. The maximum numbers of times that Control 1 and Control 2 can be conducted are K1 =5 and K2 = 2 respectively. The cost for conducting Control 1 is 2.5, the cost for Control 2 is 4, and no cost for Control 0. We first apply the Reserving Place Algorithm to the 2-gene network when T = 10. Table k from 0 to K2 = 2, where k is the number of times that Control 2 is conducted. From Table t = 7 and Control 1 at time point t = 8, 9,10, with total cost 11.5 and corresponding state probability distribution vector xT = t. For various values of time interval length T, Table T.Our objective is to find a control strategy that ensures after time length A, B and C are given in Table Here we consider a hypothetical network consisting of 3 genes A, B, C. The states of genes A unexpressed and gene B expressed is at least 0.8 with the minimum cost, given an initial state distribution of x0 = t. The maximum numbers of times that Control 1 and Control 2 can be conducted are K1 = 5 and K2 = 2 respectively. The cost for conducting Control 1 is 2.5, the cost for Control 2 is 4, and no cost for Control 0.Our objective is to find a control strategy that ensures the total probability of gene k from 0 to K2 = 2, where k is the number of times that Control 2 is conducted by the Reserving Place Algorithm. The length of time interval is T = 10. As listed in Table T = 15, the computing time is 8450.4 sec. In Table T = 10,15, 20.Table T as shown in Table T. By Theorem 1, the computational time of the Reserving Place Algorithm increases exponentially with respect to the number of genes n. For the Genetic Algorithm, the computing time depends on n, but not as greatly as the computational cost of the Reserving Place Algorithm. All numerical experiments were performed via MATLAB 7.60 in Window XP using an Intel 3.20 GHz processor.Based on the numerical experiments, we draw the following remarks for the comparison of the Reserving Place Algorithm and the Genetic Algorithm. The Reserving Place Algorithm obtains all the optimal control strategies, meanwhile the Genetic Algorithm provides one possible optimal solution. Moreover, the Reserving Place Algorithm can give all the sub-optimal control strategies for a fixed number of times that certain control method is applied. This is useful in practice as the results can provide more applicable control strategies to be chosen and more information about the effects of combining various control methods. In the aspect of computing time, the computing time of the Reserving Place Algorithm is closely corresponding to the length of time interval In this paper, we introduced a new optimal finite-horizon control problem with multiple hard-constraints. We proposed an algorithm, the Reserving Place Algorithm, to generate all optimal solutions. The upper bound for the computational cost was also estimated. We remark that our formulation can be applied to both perturbed and context-sensitive PBNs.The authors declare that they have no competing interests.Wai-Ki proposed the optimization problem. Yang designed and analyzed the Reserving Place Algorithm, performed the numerical experiments. Yang, Wai-Ki and Nam-Kiu wrote the manuscript. Wai-Ki and Ho-Yin contributed to the numerical experiment analysis and modification of the manuscript. All authors have read and approved the final version of the manuscript.

The dianion is located on an inversion center and the cation is linked to it by O—H⋯O and N—H⋯O hydrogen bonds. The cation is twisted with respect to the anion by 24.83 (5)°.The crystal structure of the title compound, 2C Å b = 10.4798 (13) Å c = 17.423 (2) Å β = 90.360 (5)°V = 694.52 (15) Å3 Z = 2 Kα radiationMo −1 μ = 0.12 mmT = 294 K 0.32 × 0.28 × 0.24 mm Rigaku R-AXIS RAPID IP diffractometerAbsorption correction: none7561 measured reflections1359 independent reflectionsI > 2σ(I)1237 reflections with R int = 0.024 R[F 2 > 2σ(F 2)] = 0.037 wR(F 2) = 0.100 S = 1.07 1359 reflections107 parameters2 restraintsH atoms treated by a mixture of independent and constrained refinementmax = 0.25 e Å−3 Δρmin = −0.14 e Å−3 Δρ PROCESS-AUTO (Rigaku, 1998PROCESS-AUTO; data reduction: CrystalStructure (Rigaku/MSC, 2002SIR92 (Altomare et al., 1993SHELXL97 (Sheldrick, 2008ORTEP-3 for Windows (Farrugia, 1997WinGX (Farrugia, 1999Data collection: 10.1107/S1600536809023800/ng2594sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809023800/ng2594Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

MT110 was highly potent in mediating complete redirected lysis of KRAS-, PI3 kinase- and BRAF-mutated colorectal TICs, as demonstrated in a soft agar assay. In immunodeficient mice, MT110 prevented growth of tumors from a 5,000-fold excess of a minimally tumorigenic TIC dose. T cells engaged by MT110 may provide a potent therapeutic means to eradicate TICs and bulk tumor cells derived thereof.With their resistance to genotoxic and anti-proliferative drugs and potential to grow tumors and metastases from very few cells, cancer stem or tumor-initiating cells (TICs) are a severe limitation for the treatment of cancer by conventional therapies. Here, we explored whether human T cells that are redirected via an EpCAM/CD3-bispecific antibody called MT110 can lyse colorectal TICs and prevent tumor growth from TICs. MT110 recognizes EpCAM, a cell adhesion molecule expressed on TICs from diverse human carcinoma, which was recently shown to promote tumor growth through engagement of elements of the While mortalities of heart disease, stroke and infectious diseases (flu and pneumonia) have declined over the past 55 years by 64, 74 and 58%, overall cancer mortality did only decline by 5% . One reason may be the resistance of so called cancer stem or tumor-initiating cells (TICs) to standard cancer therapies. This highly tumorigenic subpopulation of cancer cells is difficult to detect and resistant to many chemotherapeutic approaches due to overexpression of detoxifying enzymes and multidrug resistance pumps, preference for hypoxic niches and low proliferation rate. The significance of TICs for cancer therapy and biology is therefore under intense research TICs have now been identified and characterized in numerous human malignancies. Several laboratories have isolated TICs, e.g., from colorectal and pancreatic tumors, by using antibodies specific for epithelial cell adhesion molecule One reason why TICs and their progeny may express EpCAM is that the adhesion molecule can be activated by regulated intra-membrane proteolysis allowing it to function as signaling protein and proto-oncogene MT110 is a T cell-engaging antibody construct of the BiTE class i.e. bispecific T cell engager with dual specificity for EpCAM and CD3 in vivo-selected, highly tumorigenic HT-29 colorectal cancer cells were here used as source of TICs, and characterized for their tumorigenic potential and other TIC-associated properties. By analysis of in vitro cytotoxicity reactions with peripheral human T cells and MT110 in soft agar for potentially surviving target cells, we identified conditions allowing lysis of apparently all TICs. In mice, low doses of MT110 prevented outgrowth of tumors from a 5,000-fold excess of a minimally tumorigenic TIC dose, and all mice treated with the two highest MT110 doses tested survived s.c. inoculation of a highly tumorigenic cell bolus.Here we asked whether T cells engaged by BiTE antibody MT110 are a means for complete elimination of EpCAM-expressing TICs under cell culture conditions, and in immunodeficient mice. Primary colorectal TICs isolated from human colorectal tumor sections and a subpopulation of Human colorectal tumor sections were procured after patients' written consent under an IRB study for research use of their tissues. Tumor tissue (stage 4) had been collected from three patients who had undergone chemo plus radiation therapy under guidance of the Institutional Review Board from hospitals in the Los Angeles area.Tumor tissues were initially minced and then digested by collagenase A (0.2 mg/ml) and trypsin (0.05 mg/ml) for 15 minutes at 37°C by gentle pipetting. The cell suspension was centrifuged at 100×g for 7 minutes and the cell pellet washed with complete growth medium for three times. The cells were reconstituted in un-differentiation medium and cultured in pre-coated flasks with a chemically defined matrix that selects for CD133-positive cells. For the present study, primary colorectal tumor-initiating cells (TICs) from one 40 year-old male colorectal cancer patient (stage 4) were selected because of their high degree of previous characterization and expandability in cell culture.3 pieces. After one washing step in PBS, tumor tissues were incubated in digestion buffer of the Cancer Cell Isolation Kit (Panomics) for 1–2 h at 37°C with mechanical disruption every 30 min. Single cells were obtained through a 100 µm cell strainer , and were separated from hematopoietic and dead cells by gently loading the cell suspension onto a layer of purification buffer from the Cancer Cell Isolation Kit (Panomics). Sedimented tumor cells were washed twice in PBS and checked for vitality using trypan blue exclusion assay.Colon tumor xenografts derived from human CRC line HT-29 cells were removed from NOD/SCID mice and minced into 1 mmLineage-positive host cells were depleted from tumor cells using the MACS Lineage Cell Depletion Kit (Miltenyi Biotec). Anti-mouse CD45 (eBioscience) and anti-mouse CD29 (eBioscience) antibodies were used to test for the presence of contaminating mouse cells.TICs were cultured in NS-A basal serum-free medium (Euroclone) containing 2 mM L-glutamine, 0.6% glucose, 9.6 µg/ml putrescine, 6.3 ng/ml progesterone, 5.2 ng/ml sodium selenite, 0.025 mg/ml insulin, 0.1 mg/ml transferrin sodium salt, supplemented with 20 ng/ml EGF and 10 ng/ml basic FGF. HT-29 cells were purchased from the American Type Culture Collection and maintained in RPMI medium (Biochrom) containing 10% fetal bovine serum (Biochrom).NOD/SCID mice were obtained from the Jackson Laboratory (Charles River). All experiments involving animals were performed in accordance with the relevant guidelines for the care and use of animals and with approval by the responsible animal welfare authority, the Regierung von Oberbayern .PIK3CA, exon 2 of KRAS and exon 15 of BRAF were amplified with primers complementary to surrounding sequences. PCR products were purified with the QIAquick Gel Extraction Kit (Qiagen) and sequenced. Sequences have been deposited in GenBank .Genomic DNA was extracted from cells using the DNeasy Blood and Tissue Kit (Qiagen) following manufacturer's instructions. Exon 9 and 20 (codons 1023 and 1047) of high and CD44low cells were seperated by a Dynal magnet. CD44high bead-bound cells were washed three times with PBS plus 2% FCS and incubated with DNaseI to release the cells from the beads via DNA linker cleavage. The flow-through was incubated again with new CD44 antibody-coated magnetic beads to obtain a pure CD44low fraction.CD44-positive cells derived from HT-29 xenograft tumors were sorted using the Pan anti-Mouse Kit (Invitrogen) according to manufacturer's instructions. Briefly, cells were incubated 30 min with magnetic beads pre-coated with anti-CD44 antibody (Chemicon). CD44Cells were trypsinized, washed with PBS containing 2% FCS and stained with 5–10 µg/ml of the following antibodies for 30 min at 4°C: CD44-PE (Chemicon), CD24-APC (Immunostep), CD44v6-FITC (Abcam), CD133/2-PE (Miltenyi), CD166-ALEXA 647 (Serotec), ABCG2-PE (eBioscience), E-Cadherin (SantaCruz) and EpCAM . For analysis a FACSCalibur flow cytometer (Beckton Dickinson) was used.+ T cells, CD56+ NK and NKT cells (i.e. enriched for CD8+ T cells) Ten thousand to 20,000 TICs were incubated with unstimulated human peripheral blood mononuclear cells (PBMCs) or PBMCs depleted of CD4Cells were trypsinized, washed once with PBS, resuspended in serum-free medium, mixed with matrigel (BD Biosciences) 3∶1 and injected s.c. into flanks of 6–8 weeks old female NOD/SCID mice (Charles River Laboratories).2*length)/2].For transplantation of CFU, 1 or 10 colonies, >70 µm in diameter were picked with a micromanipulator . Colonies were immediately injected s.c. into NOD/SCID mice. All animals were monitored once a week for tumor formation. Growing tumors were measured with a caliper and tumor volumes were calculated according to the formula: tumor volume  =  [ was s.c. injected into the right flank of each NOD/SCID mouse. At least 3 animals per group were intravenously treated with MT110 or PBS control vehicle starting 2 h after inoculation with the indicated doses. MT110 was administered daily for a total of 12 days.1×10high/CD24high/EpCAMhigh cells and 1×105 human PBMCs were inoculated into 5 NOD/SCID mice per group. Mice were daily treated i.v. for 12 days with the indicated doses of MT110 or with vehicle controls in the presence of PBMCs.In the HT-29 model mixtures of 50,000 highly tumorigenic HT-29 xenograft-derived CD446 TICs and 1×107 human PBMCs were inoculated into 5 NOD/SCID mice per group to allow solid tumor formation. After tumor establishment at day 4, mice were treated i.v. for 14 days with 2.5 mg/kg of MT110, or with vehicle control in presence of PBMCs.For elimination of established tumors in NOD/SCID mice by treatment with MT110 mixtures of 5×10BRAF gene (V600E) and are relatively resistant to cytotoxicity by anti-EGFR antibody cetuximab PIK3CA gene (E545A). Tumor cells isolated from subcutaneously growing HT-29 tumors were sorted by CD44 and separated into CD44high/CD24high/EpCAMhigh and CD44low/CD24low/EpCAMlow subgroups (5 non-selected HT-29 cells were required to form tumors in immunodeficient mice (high/CD24high/EpCAMhigh cells or 100 CD44low/CD24low/EpCAMlow cells were sufficient for inducing a tumor in mice in two independent experiments. This showed that we had isolated highly tumorigenic subpopulations of cells from xenografts with the fraction of CD44high/CD24high/EpCAMhigh cells having the most pronounced TIC phenotype.Compared to CD44e (ALDH) , a 30-foe (ALDH) , and hige (ALDH) . While aent mice , minimalhigh/CD24high/EpCAMhigh HT-29 cells, in vitro cytotoxicity reactions were performed using unstimulated peripheral blood mononuclear cells (PBMCs) as source of T cells at an effector to target (E:T) ratio of 10∶1. Subsequently, cell culture reactions were mixed with soft agar. This way, cancer cells potentially surviving the BiTE reaction in the presence of T cells can be detected with high sensitivity and quantified by formation of colonies. The assay procedure is schematically shown in high/CD24high/EpCAMhigh HT-29 cells were used per cytotoxicity reaction, which under control conditions gave between 110 and 145 visible colonies per cm2 after 14 days per cm2 in soft agar with a diameter of >70 µm after 2 weeks. We first determined the minimal concentration of MT110 required for complete lysis of TICs using CD8+ T cells or PBMCs as effectors. An E:T ratio of 10∶1 was used and the cytotoxicity reaction allowed for 20 h. A very substantial decrease in CFU formation was already seen with a concentration of 0.1 ng/ml MT110, i.e., 2 pM of the bispecific antibody or mixes of 10 colonies were isolated from soft agar plates and subcutaneously injected into NOD/SCID mice. While soft agar alone did not cause tumors, tumor growth from single colonies was observed in 50% of cases with a latency period of 24–60 days, and in 33% of cases after 53–59 days for mixes of colonies . CFUs dihigh/CD24high/EpCAMhigh cells were sufficient to induce tumors in NOD/SCID mice with a latency of 42–66 and 33 days, respectively Click here for additional data file.Figure S1high/CD24high/EpCAMhigh phenotype. FACS analysis of human HT-29 cells isolated from mouse xenografts by (A) their levels of CD44 and CD24 expression, (B) expression of human EpCAM, murine CD29 and CD45, viability using nuclear dye propidium iodide, and (C) expression of ALDH by Aldefluor® staining in the presence or absence of ALDH inhibitor diethylamino-benzaldehyde (DEAB). The x-axis shows mean fluorescence intensity (MFI); the y-axis MFI for CD24 expression (A), cell counts (B), or sideward scatter (C). (D) Sphere formation and soft agar colony growth of CD44high/CD24high/EpCAMhigh and CD44low/CD24low/EpCAMlow HT-29 cancer cells. Spheres and crystal violet-stained soft agar colonies were counted after 18 days. The mean number of spheres formed per 96-well plate is shown +/- standard deviation (SD), as well as the mean number of colony forming units (CFUs) +/- SD per cm2 from a triplicate determination.Stem cell features of colorectal HT-29 cancer cells trace with CD44(6.16 MB TIF)Click here for additional data file.Figure S2high/CD24high/EpCAMhigh cells. CD44high/CD24high/EpCAMhigh and CD44low/CD24low/EpCAMlow HT-29 cancer cells isolated from mouse xenograft have been analyzed for EpCAM, Β-catenin, ABCG2, CD44v6, CD133 and CD166 by semiquantitative RT-PCR.Enhanced expression of cancer stem cell markers in colorectal HT-29 CD44(0.54 MB TIF)Click here for additional data file.Figure S3high/CD24high/EpCAMhigh and CD44low/CD24low/EpCAMlow were analyzed by 51Cr-release standard cytotoxicity assay. (B) TICs were analyzed by 51Cr-release standard cytotoxicity assay. CD8-enriched T cells were used at an E:T ratio of 10:1. Results from triplicate determinations are shown as mean values with standard deviations.Cytotoxicity assays using HT-29 xenograft-derived and primary tumor-initiating target cells. (A) HT-29 xenograft-derived bulk cells and cells sorted for CD44(1.65 MB TIF)Click here for additional data file.Figure S4Characterization of TICs for their cancer stem cell phenotype. (A) Sphere formation (left panel) and FACS analysis of cancer stem cells for markers by FACS analysis. MFI-values relative to isotype control are shown (right panel). (B) TICs were cultured under serum-free conditions in TIC medium or under differentiation conditions in RPMI supplemented with 10% FCS in collagen-coated culture flasks. Upper panel: FACS staining of E-cadherin (black line) vs. control (grey line) and lower panel: microphotographs of TICs cultured under FCS and TIC growth conditions taken at 40x and 100x magnification. (C) TICs cultured under serum-free conditions (TIC medium) and differentiation conditions (RPMI supplemented with 10% FCS) analyzed for PKH-26 staining by FACS after 48 and 96 h. (D) PKH-26 labeled TICs were engrafted into NOD/SCID mice. After 4 weeks, the retention of PKH-26 label was determined on TICs by FACS after tumor digestion.(9.70 MB TIF)Click here for additional data file.Figure S5Soft agar still supports colony growth after a long time. Colony growth by TICs inoculated into 3- or 5-month old soft agar.(2.11 MB TIF)Click here for additional data file.

Molecular studies of microbial diversity have provided many insights into the bacterial communities inhabiting the human body and the environment. A common first step in such studies is a survey of conserved marker genes (primarily 16S rRNA) to characterize the taxonomic composition and diversity of these communities. To date, however, there exists significant variability in analysis methods employed in these studies.Here we provide a critical assessment of current analysis methodologies that cluster sequences into operational taxonomic units (OTUs) and demonstrate that small changes in algorithm parameters can lead to significantly varying results. Our analysis provides strong evidence that the species-level diversity estimates produced using common OTU methodologies are inflated due to overly stringent parameter choices. We further describe an example of how semi-supervised clustering can produce OTUs that are more robust to changes in algorithm parameters.http://fames.jgi-psf.org/.Our results highlight the need for systematic and open evaluation of data analysis methodologies, especially as targeted 16S rRNA diversity studies are increasingly relying on high-throughput sequencing technologies. All data and results from our study are available through the JGI FAMeS website An evaluation of taxonomic classification through database searches [Microbial diversity within the human body has recently been quantified through 16S rRNA surveys and metasearches or othersearches are beyoThe OTU clustering process typically begins by constructing a multiple alignment (MSA) of the 16S rRNA sequences. The MSA is then used to estimate pairwise distances between individual sequences, expressed as the fraction of nucleotides that have changed as the sequences have evolved from their most recent common ancestor. To accurately reflect evolutionary processes, the distances inferred from the MSA are corrected using one of several models of evolution . The disThe choice of MSA, distance correction, clustering algorithm, and distance threshold vary considerably between studies, and to our knowledge, there has been no rigorous evaluation of the impact of methodological choices on the ecological conclusions of the analysis process. Previously, simulated datasets have been successfully used to evaluate methods for the assembly and binning of metagenomic data . In thisThrough this evaluation framework, we will demonstrate that OTUs are highly sensitive to small changes in the clustering methodology and reveal a surprising observation that reducing the stringency of clustering distance thresholds tends to produce more accurate species-level representations of a community. We will further assess the impact of OTU variability on common ecological measures of diversity and provide an example of how semi-supervised clustering could produce more robust OTU structures by accounting for varying evolutionary rates across the microbial phylogeny.Our simulated dataset comprises 1677 16S rRNA sequences from the RDP database (release 9.57) requirinIt is important to note that, by choice, these sequences are high quality and belong to relatively well-characterized taxonomic groups. Therefore any results obtained on this highly curated dataset represent an upper bound on the performance that can be achieved when analyzing noisy data from environmental surveys.E. coli O157:H7 str. TW14359 16S rRNA gene.All 1677 sequences were aligned using MUSCLE , ClustalDistance matrices were constructed with DNADIST from the PHYLIP package using eaThe process described above generated 1242 sets of clusters/OTUs , 749 of which are distinct (i.e. multiple parameter combinations lead to the same set of OTUs).C, is a partition of a set S into disjoint subsets (clusters) where:We employed the Variation of Information (VI) metric as a meam elements in set S, and we let mi be the number of elements in cluster Ci, then to compute the Variation of Information between two clusterings, we first find the probability that a randomly selected sequence is in a particular cluster, that is, i is the entropy associated with clustering C, defined as:If there are C = {C1, C2, ..., CM}, and D = {D1, D2, ..., DM'}. Then we calculate the joint distribution C and D. The mutual information between the clusterings C and D is then defined to be C and D is defined as the sum of the individual clustering entropies less 2 times the mutual information:Now, suppose we have two clusterings C and D are identical clusterings, then H(C) = H(D) = I, and the VI = 0. The VI distance is a true metric, satisfying symmetry, non-negativity, and the triangle inequality.If In order to provide a reference set of VI distances for known clusters, we measured the VI between the "true" species clustering (i.e. annotated according to the RDP taxonomy) and the annotated phylum, class, order, family, and genus clusterings in the subtree rooted at c. Collectively, the chosen nodes correspond to a node-cut K, which induces a non-overlapping clustering AK. Let D represent the partial clustering of labeled sequences such that sequences with the same label are grouped together. The VI-cut algorithm finds the AK that minimizes the VI distance to D:VI-cut is a procedure that finds a clustering from a hierarchical tree decomposition n metric . A clustT, an optimal node-cut can be found efficiently using dynamic programming [forbidden nodes. Specifically, any node n with a corresponding diameter ≥ 0.07 was labeled as "forbidden", and we required that the clusters produced by VI-cut do not contain any forbidden nodes. This requirement implicitly restricts the maximum diameter of an OTU to 7% divergence. To incorporate forbidden nodes into the VI-cut algorithm, we first ran the standard VI-cut algorithm. Any cluster that contained a forbidden node n was then sub-divided into non-overlapping clusters by identifying subtrees dominated by n that do not contain any forbidden nodes.Although there are exponentially many possible node-cuts in gramming . As descTo isolate the individual impact of each component in an OTU methodology, the 200 methodologies resulting in the lowest VI distance from the annotated species clustering were analyzed using multi-way analysis of variance (ANOVA) considering four factors: multiple sequence alignment, evolutionary distance correction, clustering algorithm, and distance threshold.F = 0.002, P = 0.998), implying that such corrections are roughly equivalent within the short evolutionary time frame defining a microbial species. We extended this comparison to include the Olsen distance correction in ARB [The results of our analysis . In terms of clustering strategy, furthest neighbor resulted in the best agreement with the annotated species structure of our environment . Large variation in the OTU content is observed even when we fix the similarity threshold to 0.01 (approximately strain-level) - the number of OTUs ranges from 79 to 248 at this similarity level, depending on the choice of MSA or clustering strategy. Surprisingly, the OTU clustering closest to the annotated species clustering was obtained using a similarity threshold of 0.05 - a value larger than the cutoffs usually used to approximate the species-level composition of an environment (0.01-0.03 ). In tert Figure .Even the combination of analysis parameters with the lowest VI distance led to an overestimate of the number of species in our sample, resulting in 56 OTUs. This result highlights a fundamental limitation of hierarchical clustering strategies for 16S rRNA analysis - only 42 of the 49 species present in our sample corresponded to a homogeneous sub-tree within the best hierarchical clustering of the data. The remaining 7 species cannot be correctly clustered irrespective of the similarity threshold chosen.The results presented above highlight a wide variation in the OTU structure as we explore the parameters of the analysis process. To determine whether such variation is also present in the methodologies used in practice, we compared three analysis methodologies that performed well in our combinatorial search to several methodologies reported in published literature. The results shown in Table SChao1) [SAce) [H) index [SAce = 57, SChao1 = 67, and H = 3.41. SAce and SChao1 estimates for the computed OTU clusterings ranged from 52 to 427 and 84 to 466 phylotypes, respectively, while Shannon diversity indices ranged from 3.04 to 4.66 and ACE ) [SAce) richnessH) index are measTo improve phylogenetic analyses, researchers often remove hypervariable segments of MSAs either manually or using a filter such as LaneMask ,31. We eOur study has so far made the assumption that one of the primary goals of a 16S analysis pipeline is to estimate the composition of an environment at a pre-specified taxonomic level (e.g. species). As demonstrated by our results, the OTU methodologies proposed in the literature fail to achieve this goal, generally overestimating the number of species. Even by systematically evaluating various settings for the parameters of the analysis process, we could not obtain perfect concordance between the OTU structure and the species composition of the environment. This is in part due to the fact that the concept of "species" is born out of gross morphological and phenotypic traits of microorganisms, and therefore cannot be precisely mapped to fine-scale molecular measurements. Furthermore, the rate of evolution varies across the tree of life, making it unrealistic to rely on a single distance threshold.VI-cut [As an alternative, we investigated the use of a semi-supervised clustering method to adaptively select a set of local distance thresholds that lead to OTUs that better fit the species composition of the environment. Specifically, we employed VI-cut , a clustWe applied VI-cut to our data by simulating partial taxonomic knowledge of the dataset. For each MSA and the optimal distance correction fail to capture the underlying species composition of an environment and are frequently too stringent, producing inflated estimates of diversity. This result is in large part due to the fact that the overly-general biological definition of a species cannot be directly mapped at the fine-scale resolution provided by molecular-level observations. In addition, diversity estimates are highly sensitive to the abundance of rare members of a community and, thus, can be easily confused by the "noise" caused by sequencing errors, transient organisms, or "naked" DNA not originating from one of the members of the community. For all of these reasons, aggregate diversity measures do not necessarily correlate with the biological functions performed by members of a community, and must be augmented by additional, more specific, measurements of the community structure .While the community simulated in our study was dominated by Proteobacteria, a significant proportion of the data belongs to other microbial phyla, thus the general results of our study likely hold in most other datasets. Furthermore, the organisms present in our samples are sufficiently distant at the 16S rRNA level to allow unambiguous clustering once a distance threshold was selected, i.e. the results we obtained reflect actual characteristics of 16S rRNA data rather than artifacts of the analysis process.ad hoc similarity thresholds in an attempt to match poorly-defined taxonomic labels. Semi-supervised procedures such as VI-cut can generate accurate clusterings while only requiring high-quality labels for only a small subset of the sequences.Our simulated samples were composed of a small number of high-quality sequences with exceptional length (>800 bp) - a relatively simple challenge compared to current datasets generated by pyrosequencing (Roche/454). 16S surveys employing pyrosequencing technologies generate considerably larger datasets (millions of sequences per sample), comprising reads of shorter lengths (~100-400 bp). The results we describe for long reads will only be exacerbated in the context of short-read data. Further, these data present several new computational challenges for OTU clustering including the need for faster alignment algorithms, the computation and storage of evolutionary distances , and the selection of distance thresholds appropriate for sequences with significantly less phylogenetic information than the Sanger-based reads used in our study. The analysis of the new sequencing data require the development of robust methods for OTU clustering, as well as rigorous validation of analysis methods. We finally demonstrated that a semi-supervised clustering approach (VI-cut) can significantly improve analysis quality, highlighting the potential for semi-supervised clustering approaches to fill the gap between the two extreme classes of approaches commonly used in analyzing 16S rRNA datasets: fully-supervised database searches that rely on expensive highly-curated datasets; and fully unsupervised OTU clustering procedures that use ad hoc choice of analysis parameters, in particular the selection of different distance thresholds, complicates cross-study comparisons and even basic descriptions of diversity. As 16S rRNA surveys are increasingly applied in a clinical setting [Finally, it is important to observe that clustering 16S rRNA sequences into a set of OTUs is a valuable analysis tool even if the resulting OTUs do not correlate with pre-defined taxonomic entities. However, the setting ,32-35 (ehttp://fames.jgi-psf.org - a repository for metagenomic analysis benchmarks [http://www.cbcb.umd.edu/VICut/.The data used in this study have been deposited in the FAMeS online database nchmarks . SoftwarOTU: operational taxonomic unit; rRNA: ribosomal ribonucleic acid; VI: Variation of Information; MSA: multiple sequence alignment; RDP: Ribosomal Database Project; ANOVA: analysis of variance;JRW and SN ran the experiments and analyzed the data. M-RG provided computational expertise. JW, SN, NN, M-RG, CK and MP wrote the manuscript. All authors read and approved the final manuscript.Variation of information distances of high-level taxonomic clusterings from the annotated species clustering. To give the reader some intuition about the VI distance metric, we computed VI distances between the annotated species-level clustering and other clusterings based on phylum, class, order, family, and genus annotations. This file contains a table of these reference distances.Click here for file

Nanolipoprotein particles (NLPs) are discoidal, nanometer-sized particles comprised of self-assembled phospholipid membranes and apolipoproteins. NLPs assembled with human apolipoproteins have been used for myriad biotechnology applications, including membrane protein solubilization, drug delivery, and diagnostic imaging. To expand the repertoire of lipoproteins for these applications, insect apolipophorin-III (apoLp-III) was evaluated for the ability to form discretely-sized, homogeneous, and stable NLPs.Four NLP populations distinct with regards to particle diameters (ranging in size from 10 nm to >25 nm) and lipid-to-apoLp-III ratios were readily isolated to high purity by size exclusion chromatography. Remodeling of the purified NLP species over time at 4°C was monitored by native gel electrophoresis, size exclusion chromatography, and atomic force microscopy. Purified 20 nm NLPs displayed no remodeling and remained stable for over 1 year. Purified NLPs with 10 nm and 15 nm diameters ultimately remodeled into 20 nm NLPs over a period of months. Intra-particle chemical cross-linking of apoLp-III stabilized NLPs of all sizes.ApoLp-III-based NLPs can be readily prepared, purified, characterized, and stabilized, suggesting their utility for biotechnological applications. Nanolipoprotein particles (NLPs) are nanometer-sized bilayer mimetics comprised of phospholipids and apolipoproteins in vitro and in vivo applications. As such, a clear understanding of both the methodology required to prepare discretely sized particles, as well as their inherent stability, is desirable.NLP size, homogeneity, and stability are important parameters for biotechnology applications, such as membrane protein solubilization. In addition, the size of the NLP and the surface area of the lipid bilayer are key determinants of the potential for loading of cargo in or on the NLP bilayer. Homogeneity is important to provide readily characterizable starting material, and facilitates control over experimental parameters . Understanding and characterizing NLP stability over time provides insight into shelf life of the NLPs, while also providing preliminary data on NLP integrity during sn-glycero-3-phosphocholine (DMPC) or 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) lipids The size of NLPs can be tuned in a number of ways. The choice of starting materials has a great effect, as different combinations of apolipoproteins and lipids have been demonstrated to generate a range of NLP sizes. For example, the human apolipoprotein apoA-1 has been extensively studied, and has been demonstrated to produce differently sized NLP species when prepared with either 1,2-dimyristoyl-The goal of our research is to expand the repertoire of well-characterized lipoproteins currently available for biotechnological applications by demonstrating the facile preparation of discretely sized NLPs using insect apolipophorin III (apoLp-III), and to characterize their size, composition, and stability. ApoLp-III is primarily associated with lipid shuttling in hemolymph during insect flight, although additional roles in membrane remodeling and innate immunity have been identified Manduca sexta and Bombyx mori. These apolipoproteins are unglycosylated, small in size , readily expressed and purified, share ca. 74% sequence identity B. mori apoLp-III was monitored for 5 months, which revealed significant remodeling of the smaller NLP species to a consensus structure with an average diameter of 20 nm. Chemical cross-linking was successful in stabilizing the individual NLP species for months. Although to date their use in biotechnological applications has been limited, apoLp-IIIs provide a means to expand the apolipoprotein toolkit for preparing NLPs featuring varied size ranges and characteristics.Herein we describe the successful assembly and purification of four NLP species of discrete diameter using apoLp-III. The two apoLp-IIIs chosen for this study were derived from insect species within the order Lepidoptera: DMPC was purchased from Avanti Polar Lipids . All other reagents were ordered from Sigma-Aldrich .B. mori and M. sexta apolipophorin III constructs were generously provided by Dr. Robert Ryan. Proteins were expressed according to published procedures B. mori apoLp-III concentrations were determined by UV spectroscopy at 280 nm in 3 M guanidine hydrochloride (ε280 = 6970 M−1 cm−1). M. sexta apoLp-III concentrations were determined with the Advanced Protein Assay Reagent , using BSA as a standard.2 under agitation to form a thin lipid film, which was further dried in vacuo for at least 2 hours. Lipids were then solubilized in TBS buffer with 20 mM sodium cholate. After addition of apoLp-III, samples were incubated at 23.8°C for at least 4 hours. Final apoLp-III concentrations were ca. 150 µM during a typical assembly. Assemblies were then dialyzed against TBS to remove cholate and promote NLP self-assembly. Assemblies were subsequently analyzed and purified by SEC in TBS buffer . Prior to SEC analysis, all samples were filtered using a 0.22 µm spin filter (Agilent) to remove any particulates. NLP fractions were analyzed by NDGGE and/or AFM. For NDGGE, 4–20% Tris-glycine polyacrylamide gels were used . For all native gels, the NativeMark protein standard was used (Invitrogen). All gels were stained with SyproRuby and imaged using the Typhoon 9410 Variable Mode Imager . For remodeling studies, four large assemblies were prepared to enrich the four different NLP populations . To isolate the four different NLP populations, appropriate SEC fractions were pooled . These fractions were stored at 4°C and, at indicated time points, a portion of each was analyzed by SEC, NDGGE, and/or AFM. For SEC chromatogram quantitation, a Nonlinear Least Squares Fitter was used to fit a multi-peak Gaussian function, corresponding to the appropriate NLP, lipid, or protein components. The integrated peak area was then used to assess relative abundance of each population.NLPs were assembled according to previously reported procedures B. mori apoLp-III concentrations were determined by UV spectroscopy at 280 nm in 3 M guanidinium hydrochloride (ε280 = 6970 M−1 cm−1). DMPC concentrations were assessed using the colorimetric Phospholipids C kit purchased from Wako Chemicals USA, Inc. , following manufacturer's protocol using choline as a standard. For calculations of lipid bilayer area based on AFM-determined NLP diameters and DMPC molecular area, apolipophorin helices were assumed to contribute 2 nm to the overall diameter of the NLPs 2 per DMPC was used NLP-1)2/0.6). After 162 days, the 20 nm NLPs in NLP-4 were purified by SEC for composition analysis.Protein and lipid compositions were assessed for each purified NLP population. N-succinimidyl-(pentaethylene glycol) ester (henceforth abbreviated as PEO5). NLPs (ca. 25 ng apoLp-III per µL) in HEPES buffer were incubated with 0, 0.5 and 5 mM PEO5 for four hours at room temperature. Reactions were quenched with 50 mM Tris-HCl (pH 7.4) for 30 minutes at room temperature. Samples were analyzed by NDGGE (4–20% Tris-glycine) and SDS PAGE (4–12% Bis-Tris with MES running buffer or 3–8% Tris-acetate with tricine running buffer). For denaturing gels, the Mark12 protein standard was used (Invitrogen).For cross-linking experiments, NLP populations isolated by SEC were incubated with Bis-AFM measurements and analyses were conducted as previously described Locusta migratoria, M. sexta, and B. moriB. mori and M. sexta were investigated. Various lipid:apoLp-III ratios were surveyed for successful NLP formation. ApoLp-III was incubated with DMPC in the presence of cholate for ca. 4 hours at 23.8°C. After dialysis of the assembly reactions to remove excess cholate, samples were analyzed by SEC. The resultant chromatograms were effectively parsed into 6 distinct regions and two NLP species (∼18 and ∼21 min). Smaller NLP species were observed (∼23.5 and 27 min) at lower lipid ratios. As the lipid:protein ratios were decreased, the amount of unincorporated protein increased (∼33 min), suggesting that not enough lipid was present to utilize all the protein for NLP formation. These results resemble the well-established phenomenon that NLP size can be controlled by lipid:apolipoprotein stoichiometry M. sexta and B. mori successfully formed NLPs, the latter was chosen for further in-depth analysis. The primary reason for this was the difficulty in the detection and quantitation of M. sexta-derived NLPs; the protein has only a single tyrosine residue (and no tryptophan) and hence low intrinsic absorbance.Discoidal nanolipoprotein particles have been prepared using purified apoLp-III from myriad species, including B. mori assemblies; NDGGE and AFM. NDGGE is a traditional analytical technique used to differentiate between NLPs of varying sizes according to electrophoretic mobility and apparent molecular weight. AFM provides single-particle analysis of NLP diameter and height.To verify that the particles isolated from the SEC regions 2 to 5 were indeed NLPs, two independent techniques were used to characterize the Figure S1). The 175∶1 ratio produced large NLPs with a retention time of ∼18 minutes, henceforth referred to as NLP-1. NLP-2 denotes the species with a retention time of ∼21 minutes, and was the dominant species produced using a 135∶1 molar ratio. Molar ratios of 75∶1 and 45∶1 produced enriched NLP species at ∼23 and ∼27 minutes, respectively, termed NLP-3 and NLP-4. The fractions corresponding to the desired NLP species were pooled and reanalyzed by SEC . To further verify the presence of NLPs, AFM was used to confirm the discoidal morphology of the purified species . Single particle analysis by AFM elucidated that NLP-1 was comprised of numerous different sized NLP species were identified from d by SEC Table 1.5. To avoid inter-NLP cross-linking, dilute NLP concentrations were used for these studies. By NDGGE and the results correlated well with those shown in 2The four purified NLP species were analyzed to determine the lipid-to-apolipophorin ratios as well as the number of apolipophorin molecules per NLP. The composition of each NLP species was elucidated by independently determining the lipid and protein concentrations of purified NLPs, providing molar ratios of the NLP constituents . As summarized in By NDGGE Table 1.NLPs were monitored at various time points during storage and stability was assessed by both bulk and single molecule analyses. NLPs of each size were purified by SEC, stored at 4°C, and periodically assessed over 5 months. SEC and NDGGE were used to measure changes in the average characteristics of the bulk sample, whereas AFM was used for single particle measurements.Figure S4).Each purified NLP species was assessed by SEC at periodic intervals to determine the purity of the samples. If remodeling occurred, a decline in the overall percentage of the originally isolated and purified NLP would be observed, along with a concomitant increase in the amount of NLPs of other sizes. The SEC chromatograms were analyzed to assess relative abundance of each NLP species, as well as the lipid- and protein-rich components Figure 4To determine if NLPs of a particular size formed by remodeling were identical to those initially purified from an assembly, NLP-2 species remodeled from NLP-4 (after 162 days) were isolated by SEC. The purified NLP-2 population was then analyzed for DMPC and apoLp-III content. The composition of NLP-2 formed through remodeling of the NLP-4 species was identical to the stable NLP-2 particles originally purified from the NLP assembly .Figure S5).Single particle measurements using AFM gave results that were consistent with bulk measurements. AFM was used to measure NLP diameters, which allowed us to assess the distribution of NLP species. As free protein and lipid were not readily measurable by AFM, a direct comparison between AFM and SEC was afforded by looking at the distribution of NLP species as a fraction of total NLPs. For representation of AFM data, NLPs were assigned according to diameter . The relative abundance of each NLP species at each time point was nearly identical between AFM and SEC . By SEC, all NLP-1 chromatograms featured a dominant peak at 18.2 minutes, suggesting no change in NLP-1 size. However, the ability to interrogate individual NLPs by AFM provided greater resolution to measure larger particles. On Day 0, the 25 nm NLPs were the dominant species, followed closely by 30 nm and 35 nm NLPs. By Day 25, 30 nm NLPs were the majority species, although significant amounts of the other NLP species were still present. After 150 days, however, the only true NLP species present in significant quantities were the 30 nm particles. Although NLPs larger than 37.5 nm could be present, AFM is not able to distinguish these larger NLPs from these from adhered liposomes The single particle measurements by AFM elucidated population distributions in NLP-1 that were undetected by SEC (due to resolution limitations of the SEC column used in this study) . The stability of NLP-2 species was also demonstrated by the time-dependent remodeling of the smaller NLP species, NLP-3 and NLP-4. NLP-3 exhibited minimal stability over time, remodeling to form predominantly the 20 nm NLP-2, accompanied by the appearance of free apoLp-III. Remodeling of the NLP-3 may involve NLP-4 as an intermediate, as evidenced by the appearance of a significant fraction of NLP-4 by 50 days. NLP-4 also demonstrated rapid remodeling, resulting in predominantly NLP-2 and free apoLp-III. NLP-3 may play a role as an intermediate during the remodeling process, peaking at ∼20% by 29 days. These data suggest that NLP-2 species are the most stable, and that smaller NLPs will ultimately rearrange to form NLP-2. This is corroborated by the compositional analysis of the 20 nm particle (NLP-2) formed by remodeling, indicating nearly identical molar DMPC to apoLp-III ratios as NLP-2 particles directly purified from an assembly reaction. When experiments were conducted at 25°C, similar remodeling profiles were observed (data not shown). NLP-3 and NLP-4 remodeled to form predominantly the 20 nm NLP-2, although the remodeling time scales were accelerated 5-fold. The stability of NLP-2 decreased as well, and exhibited a half-life of approximately 15 days (data not shown).The remodeling data suggest that total lipid in the system is the limiting factor for the remodeling of the NLP-3 and NLP-4 species. Free apoLp-III accumulated as more of the smaller NLPs remodeled into NLP-2, while no free lipid was observed. The remodeling of the smaller NLP species follows a complex mechanism, involving the disassembly and reassembly of the three different NLP species , ultimately resulting in a preponderance of the 20 nm NLP-2. As demonstrated in Figure S5), as it validates the utility of both techniques in the study of NLPs. Furthermore, the tandem use of these techniques provides additional information beyond use of a single technique. The analysis of bulk characteristics using SEC provides insight into the average behavior. Importantly, SEC provided information of the presence of both lipid-rich and protein-rich species. This compensated for a limitation of AFM, namely the inability to easily interrogate single proteins on the mica surface. Conversely, AFM provided data on larger NLPs that were beyond the resolving capability of the SEC column used in this study. Had SEC alone been used to monitor the NLP-1 species, the remodeling of larger NLPs to 30 nm particles would not have been elucidated.The combination of bulk and single-molecule analyses is a powerful tool for the study of NLPs. The strong correlation between the AFM and SEC monitoring of NLP remodeling is important To isolate the various NLP peaks observed by SEC, four lipid:protein ratios were chosen to provide significant enrichment of the individual peaks . SEC fractions (shaded regions) for each NLP peak were pooled for further analysis. B) Pooled fractions from (A) were reanalyzed by SEC, demonstrating purity of the NLP species.(0.20 MB TIF)Click here for additional data file.Figure S2Representative AFM micrographs of the four B. mori apoLp-III NLP species purified by SEC. Scale bars correspond to 50 nm. Full-width half-maximum analysis of NLP diameter is represented by the green area in the pseudo-colored image, which accounts for the tip convolution effect. The slow scan direction was used for particle diameter analysis.(1.11 MB TIF)Click here for additional data file.Figure S3Gel analysis of crosslinking experiments. SDS-PAGE was used to resolve high molecular weight bands upon crosslinking of purified B. mori apoLp-III NLP species.(0.39 MB TIF)Click here for additional data file.Figure S4NDGGE of NLP species monitored over time. NLPs incubated at 4°C were analyzed to demonstrate remodeling of individual NLP species. A) Day 1, B) Day 29, C) Day 49, D) Day 70, E) Day 97, F) Day 162.(0.45 MB TIF)Click here for additional data file.Figure S5Direct comparison of NLP remodeling assessment by single molecule analysis (AFM) and bulk analysis (SEC). A–D) Single particle AFM analysis of the distribution of the four purified NLP species. A) NLP-1, B) NLP-2, C) NLP-3, and D) NLP-4. E–H). Bulk SEC analysis derived by integration of the four individual NLP SEC peaks. E) NLP-1, F) NLP-2, G) NLP-3, and H) NLP-4. Only the distribution of NLP species are included in the SEC analysis, not lipid- or protein rich species.(0.43 MB TIF)Click here for additional data file.Figure S6AFM identifies four unique NLP sizes in purified NLP-1 population. Single particle AFM analysis of NLP-1 identifies four unique NLP sizes not elucidated by SEC.(0.11 MB TIF)Click here for additional data file.

Splenectomy is associated with increased risk for bacteremia, due to impaired clearance of bloodborne agents and to altered phagocytosis and humoral immunity. We conducted a retrospective cohort study of patients at risk for splenectomy for a 13-year period to determine immunization coverage, and outcomes of those with and without splenectomy, and with or without receipt of influenza or pneumococcal vaccine.Data were extracted from the provincial Medical Services Insurance database for insured services rendered by a physician for 1990-2002, and from the Vital Statistics Death database. The eligible cohort was selected based on diagnostic codes for hematologic conditions for which splenectomy might be considered, such as immune thrombocytopenia. Each patient was followed longitudinally from the date of first diagnosis until 31Dec2002, or death, or relocation out-of province. In addition, persons with splenectomy and no hematologic condition were identified and followed for 6 months post-surgery. Infectious illness rates per 100 person-years of observation and death rates were calculated with and without splenectomy. Death rates were determined using splenectomy status as a time-dependent covariate. The relationship between splenectomy and death according to immunization status was examined using Cox proportional hazard ratios.Of 38,812 persons in the cohort 427 subjects with a hematologic diagnosis had splenectomy and another 452 subjects without a hematologic diagnosis had this surgery. 72% were > 18 years of age. Pneumococcal immunization was recorded in 16.5% of asplenic patients overall, and was not associated with reduced risk of death in these persons . Influenza immunization was recorded in 53.1% of asplenic patients overall, and was associated with reduced risk of death . No pneumococcal or influenza immunization was recorded in patients with a hematologic diagnosis without splenectomy. Infectious illness visits were higher among all patients who had a splenectomy than among those without a splenectomy .In asplenic patients, influenza immunization is associated with a 54% reduced risk of death compared to unimmunized asplenic persons; no reduction in risk was demonstrated with (polysaccharide) pneumococcal vaccine. Vaccine coverage in the entire cohort was less than routinely recommended. Improved delivery of infection prevention programs to this population is warranted. Conjugate pneumococcal vaccines should be urgently studied in this immunocompromised population. Streptococcus pneumoniae is the most common etiology of serious infection in this population[Haemophilus influenzae and Neisseria meningitidis, occurs.Splenectomy is associated with increased risk for bacteremia due to impaired clearance of bloodborne agents, and to altered phagocytosis and humoral immunity-4. The sopulation, but illAlthough infection prevention strategies such as immunization, antibiotic prophylaxis and early care for febrile illness have been recommended for asplenic patients for decades, implementation is often not optimal -15. LifeA population-based retrospective cohort was assembled by linking several comprehensive provincial health databases. Nova Scotia is a province in Eastern Canada with a population of ~ 900,000. All residents have a unique health card number which is used to track health services in the universal health care system, to reimburse providers and to track persons moving in and out of the province. The cohort consisted of all persons resident in the province from 1990-2002, who had health conditions for which splenectomy might be considered or indicated.th Clinical Modification 9 (ICD-CM9) for health conditions for which splenectomy might be considered or indicated. These codes were grouped into five categories, and all patients with a first field diagnostic code for at least one of the following categories were included: immune thrombocytopenia (ITP), Hodgkin's disease, non-Hodgkin lymphoma, haemolytic anemia, or hypersplenism.Data were extracted from the Nova Scotia Medical Services Insurance (MSI) database for insured services rendered by a physician for 1990-2002 and from the provincial Vital Statistics Death Database. The MSI database is a single comprehensive administrative database for health services. All physicians and all residents in the province for more than three months were participants in the health insurance plan. Recording and reporting of services given was the only method of physician remuneration in this largely fee-for-service system and regular ongoing auditing confirms services are given. The cohort of persons at risk for splenectomy was selected by identifying all International Classification of Diagnostic Codes - 9Other variables extracted included the following: birth date, diagnosis and service(s), immunizations delivered, whether a splenectomy was performed and the date of surgery, physician visits for which an infectious disease code was used ("infectious illness visit"), and, if applicable, moving out of the province or death. Antibiotic use was not recorded in these datasets. Each patient was followed from the date of first diagnosis until 31 Dec 2002, or death, or relocation out-of province. In addition, an extraction was completed for patients who had a splenectomy during the same time period but did not have one of the aforementioned health conditions. These asplenic persons were assumed to have had a splenectomy on a non-elective basis. The codes for these concurrent events were diverse and included trauma and other surgeries. An arbitrary time period of 6 months was selected to follow health outcomes post-splenectomy.® was brought into routine immunization programs between 2001 and 2003 in Canada and therefore it is assumed that the 23-valent pneumococcal polysaccharide vaccine was the only pneumococcal vaccine used to immunize the population in this study. The influenza vaccine used in Canada is a trivalent inactivated injectable formulation.The conjugate heptavalent pneumococcal vaccine PrevnarThe outcome measures of interest were the number of patients living with asplenia , the immunization history of asplenic persons compared to those without splenectomy, and the incidence of infectious illness visits and death in these high risk persons according to immunization status and splenectomy.th and 75th percentiles were used where variables were not normally distributed. In the case of cell counts less than five, the numbers are not reported.Categorical and continuous variables were analyzed using descriptive statistics. Median, 25Infectious illness rates were expressed per 100 person-years of observation in persons with splenectomy and without splenectomy. Rates of death were calculated per 1,000 person years of observation, by splenectomy status and by immunization status. The relationship between splenectomy and death was assessed using Cox proportional hazards regression models (adjusted and unadjusted) using a time-dependent covariate approach whereby the follow-up time for subjects with splenectomy is divided into pre-and post-splenectomy. The relationship between any pneumococcal or influenza immunization and death was evaluated using standard survival analysis among the subset of subjects who had a splenectomy. Survival curves were adjusted for age at diagnosis, gender and diagnostic category. The "end date" for the study was assigned using the termination date if the subject moved or died, or the end of the study period (31 December 2002).All analyses were performed using SAS .The study protocol was approved by the Research Ethics Boards of the IWK Health Centre and the Capital Health District, Halifax, Nova Scotia and by the Privacy Officer of the Nova Scotia Department of Health.The total cohort of patients with hematologic diagnoses of interest and with splenectomy but no pre-existing hematologic diagnosis consisted of 38,812 patients; 72% were >18 years of age . Females comprised 57% of the cohort . The most common hematologic diagnosis was hypersplenism followed by ITP . Splenectomy occurred in 427 patients with a hematologic diagnosis in the cohort (1.2%), and in another 452 subjects without a hematologic diagnosis . Thus over the 13 years, 879 patients, or about 68 persons each year, had splenectomy. Characteristics of the asplenic patients are seen in Table Splenectomy was most commonly performed for ITP (4.04 splenectomies/1000 person years). Rates for other hematologic conditions were hemolytic anemia (3.63/1000 person years), Non-Hodgkins lymphoma (2.84/1000 person-years), Hodgkin's disease (1.32/1000 person years) and hypersplenism (0.40/1000 person-years).Streptococcus pneumoniae was recorded in 16.5% (n = 132) of all asplenic patients, but not recorded in any patients with a hematologic diagnosis without splenectomy were higher among all patients who had a splenectomy than among those without a splenectomy . Among subjects who had a splenectomy, IIV were decreased in the period post-splenectomy compared to the period before splenectomy for all subgroups except among those patients with ITP. In the period before surgery, overall the rate of IIV was 265 per 100 person years of observation, whereas post-surgery the rate of IIV was 151 per 100 person years of observation.Among subjects with a hematologic condition, results from Cox proportional hazards regression models, in which splenectomy was modeled as a time-dependent covariate, indicated that the risk of death was significantly higher for patients who underwent splenectomy compared with those who did not Table .In subgroup analysis the HR for the association between splenectomy and death was not different for conditions which were considered malignant compared to those considered non-malignant conditions : was 1.74 (1.22-2.48). v. 1.75 (1.36-2.54).Among asplenic subjects, pneumococcal immunization, adjusted for age at diagnosis, gender and diagnostic category, was associated with a reduced risk of death when the effect of influenza vaccine was not considered . However, no protective effect of pneumococcal vaccine was observed when the analysis was adjusted for the effect of influenza vaccination: HR 1.07 (95% CI 0.70-1.65).The risk of death was reduced among those aplenic persons who had at least one influenza vaccine: HR 0.46 95% CI 0.33-0.62). In subgroup analysis this effect was seen in ITP, hemolytic anemia, and splenectomy without a pre-existing hematologic diagnosis, but not in the other groups and for the malignant subgroup is 0.48 (0.22-1.04). For pneumococcal immunization these HRs are 0.32 (0.17-0.58) in the non-malignant subgroup and 0.49 (0.22-1.10) for the malignant group.Figure Streptococcus pneumoniae, is perhaps the best known infectious complication of asplenia and thus pneumococcal immunization is universally recommended. Immunization against other encapsulated organisms such as H. influenzae and Neisseria meningitidis is also recommended, preferably at least two weeks prior to splenectomy. Annual influenza vaccine, as well as age appropriate immunization, is also considered standard of care.This study shows a 53% reduced risk of death in asplenic persons who received influenza immunization compared to those who had no record of such immunization; but surprisingly no influence on death was seen for pneumococcal immunization. Overwhelming post-splenectomy infection (OPSI), usually due to Receipt of influenza vaccine was associated with reduced risk of death in the whole cohort and in three subgroups . The mechanism of this protection is not clear, and no randomized controlled trials of influenza vaccine efficacy in asplenic persons have been performed. Asplenic persons are not generally thought to be at increased risk for complicated viral infections, since innate and cell-mediated immunity are intact. However, production of antibody involves interaction between the humoral and cell-mediated immune systems which could be altered in asplenic persons, and cases of serious viral infection in asplenic persons have been reported. The assS. pneumoniae) but better for influenza (53.1%). It is unlikely that our finding of poor immunization coverage is restricted to our jurisdiction, as others have noted incomplete physician and patient knowledge of risks and preventive interventions, poor vaccine coverage, and a lack of systematic immunization programs[Immunization coverage overall was very low for . Improved delivery of infection prevention programs to this population is warranted. Conjugate pneumococcal vaccines should be urgently studied in this immunocompromised population.In the past five years none of the authors have received reimbursements, fees, funding, or salary from an organization that may in any way gain or lose financially from the publication of this manuscript, either now or in the future. None of the authors hold any stocks or shares in an organization that may in any way gain or lose financially from the publication of this manuscript, either now or in the future. There are no relevant patents to declare. None of the authors have any other financial competing interests.There are no non-financial competing interests to declare in relation to this manuscript.GRL conceived the study and obtained the funding. GRL and JML designed the study. LD and DF designed and performed the statistical analysis. JML prepared the manuscript; and all authors contributed to subsequent revisions and approved the final version.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2334/10/219/prepub

Z-vinylic tellurides with nBuLi was observed the unexpected isomerization of double bonds leading to potassium E-vinyltrifluoroborates salts in low to moderate yields. Using EPR spin trapping experiments the radical species that promoted the stereoinversion of Z-vinylic organometallic species during the preparation of potassium vinyltrifluoroborate salts was identified. The experiments support the proposed mechanism, which is based on the homolytic cleavage of the TenBu bond.Through direct transmetalation reaction of Recently, Molander et al. and our et al. have expet al. , aryl-aret al. , alkenylet al. , and alket al. cross-coZ-vinylic tellurides [Z-vinyllithiums and Z-vinylcyanocuprates. In reactions promoted by Pd or Ni, these compounds undergo stereospecific coupling with a wide range of organic species [Distinct from the most commonly explored hydrometallation reactions, the hydrotelluration of alkynes exclusively forms llurides . Vinylic species . The vin species –11 with Z-vinylic tellurides [E-vinyltrifluoroborate salts from Z-vinylic tellurides.Taking advantage of the regio- and stereocontrol of the preparation of llurides , and of Z-vinylic tellurides 1 were prepared by hydrotelluration of alkynes [ii, iPr)3 as the electrophile and ether as the solvent (entry 6).Functionalized alkynes . Using pZ-vinylic tellurides were, to our surprise, transformed into potassium E-vinyltrifluoroborate salts exclusively . Use of 1.0 equiv of nBuLi instead of 1.5 equiv as in the optimized protocol gave the same proportion of nBuBF3K.The 1H NMR, we tried to observe the coupling constants of the vinylic hydrogens for each intermediate of the reaction route. Using this approach, we could prove the cis geometry of the vinylic hydrogens of the intermediate 2 is the DBNBS/•TenBu radical adduct [aN = 9.1 G, aH = 1.0 G) can be attributed to another DBNBS radical adduct. The intensity of the broadened triplet started to decay after 5 min incubation, and was barely detected in the 15 min incubation spectrum , which is an appropriate spin trap for tellurium centered radicals . Radical step i, , the det step i, . The tril adduct and the spectrum . The DBNiPr)3 3 ii, , the reaPr)3 ii, . The addPr)3 ii, .2 [nBuTenBu reagent. Incubation of nBuTenBu, nBuLi and B(OiPr)3 with DBNBS produced no EPR signals , an equimolar solution of nBuTenBu, B(OiPr)3 and DBNBS also did not produce EPR signals -β-bromostyrene, to achieve the desired nditions that diferformed .nBuTenBu radical behavior came from the detection of nBuBF3K as a product only from experiment A 3 species, yielding an anionic vinyl boronic “ate” radical. The boron-centered radical is then reduced by a •TenBu radical 6, leading to the E-vinyltrifluoroborate salt 9 after the reaction work up with aqueous KHF2.The results presented above support a free radical pathway for the nBu bond.In conclusion, we have identified the radical species that promoted the stereoinversion of vinylic compounds during the preparation of potassium vinyltrifluoroborate salts. The above experiments support the proposed mechanism, which is based on the homolytic cleavage of the TeFile 1Experimental section. The file describes the spectral data and the reaction procedure to prepare the potassium vinylorganotrifluoroborate salts

Tort law has legitimate social purposes of deterrence, punishment and compensation, but medical tort law does none of these well. Tort law could be counterproductive in medicine, encouraging costly defensive practices that harm some patients, restricting access to care in some settings and discouraging innovation.Patients might be better served by purchasing combined health and life insurance policies and waiving their right to pursue malpractice claims. The combined policy should encourage the insurer to profit by inexpensively delaying policyholders' deaths. A health and life insurer would attempt to minimize mortal risks to policyholders from any cause, including medical mistakes and could therefore pursue systematic quality improvement efforts. If policyholders trust the insurer to seek, develop and reward genuinely effective care; identify, deter and remediate poor care; and compensate survivors through the no-fault process of paying life insurance benefits, then tort law is largely redundant and the right to sue may be waived. If expensive defensive medicine can be avoided, that savings alone could pay for fairly large life insurance policies.Insurers are maligned largely because of their logical response to incentives that are misaligned with the interests of patients and physicians in the United States. Patient, provider and insurer incentives could be realigned by combining health and life insurance, allowing the insurer to use its considerable information access and analytic power to improve patient care. This arrangement would address the social goals of malpractice torts, so that policyholders could rationally waive their right to sue. Health care is a risky endeavor . The indMalpractice tort law has three theoretically important purposes . First, Unfortunately, current malpractice tort law does none of these tasks very well. Malpractice suits are not sensitive: real injuries are common but seldom pursued and only a small fraction result in paid claims -10. ThisFurthermore, adverse events are about equally frequent in malpractice tort systems and less expensive "no fault" systems for compensating disabled patients ,22. ThesMalpractice tort law has important unintended effects. Believing that they face a capricious threat of losing time, money and reputation, many physicians practice expensive defensive medicine -27. The Constructive change has been hard to achieve. A small survey reported that physicians do not believe that lawyers have the moral authority to guide medical practice and would prefer physician-led quality control measures . DeliberNo-fault compensation for poor medical outcomes and independent arbitration are less confrontational and potentially less expensive complements to malpractice tort law. Apology laws have been advocated as another means of indirectly reducing medical error, ideally in combination with no-fault compensation . HoweverPhysicians often call for caps on malpractice awards . This maThe Obama administration has rejected major tort reform as a component of federal health care reform. However, the administration has acknowledged that state experiments in tort reform could be instructive. The following discussion describes a possible insurance reform that could be implemented by states and how it might obviate medical tort law.There is only one group in the US health care industry that routinely collects enough data to monitor, compare and reward quality care. That group is not patients, physicians, pharmaceutical companies, public health agencies, hospitals, academics, or politicians. It is insurers. That every other group views insurers with deep and largely justified distrust is a tragic result of misaligned incentives: insurers increase profits by collecting premiums and not paying claims. Insurers must maintain a sufficiently respectable reputation to collect premiums from policyholders and must abide by contracts. A tense relationship with health care providers and patients is not surprising.Combining health and life insurance in a single long-term policy should realign insurers' incentives and lend credibility to many insurer decisions ,50. PoliPolicyholders could use a combination of term and permanent life insurance to convey longevity preferences to the insurer. Term policies convey interest in avoiding fatal accidents, while permanent policies (variable and whole life insurance) imply interest in longevity. Ideally, a basic policy would be established relatively early in life, with the expectation that policyholders could negotiate amendments to the life insurance policy. As in any viable insurance program, policyholders would need to initiate coverage while healthy, or pay a premium to purchase coverage with a pre-existing condition.The insurer could profit in two ways. First, it could keep aggregate spending on health care below the sum of collections of health insurance premiums. Second, it could earn more from invested life insurance premiums than it pays in life insurance benefits if it can increase average life expectancy, whether by preventing accidental deaths, increasing longevity, or both. If the insurer finds inexpensive ways to heal, maintain health and extend longevity, the policyholders benefit. Conversely, neglect and other health care mistakes are likely to manifest as losses on life insurance and increased long-term health costs. This should create a tense resource allocation decision. It needs to be shared, as much as possible, between suffering patients, harried physicians and well-informed, highly analytical insurers.The insurer could take a very broad perspective regarding policyholders' health. Profitable activities could be as diverse as lobbying against anti-health interests, subsidizing healthy behaviors and reducing environmental risks. A health and life insurer should have an especially strong interest in the quality of medical care provided to policyholders. In many situations, the insurer could profit twice from directing policyholders to high quality care, once if the care succeeds in avoiding complications and disability that would create additional medical expenses and again if the care reduces mortal risk. Conversely, the insurer would pay twice for failure to obtain high quality care for the average policyholder. Therefore, the insurer could reimburse health care systems or even individual physicians based on the quality of the care they deliver.Health and life insurers would have incentives to develop nuanced measures of the quality of care. Pay for performance initiatives typically use simple quality measures and may not change outcomes appreciably -56. SimpThe health and life insurer also should maintain a healthy skepticism regarding extrapolated quality measures. For instance, anticoagulation to prevent blood clots is clearly valuable for many orthopedic surgery patients, but involves serious trade-offs and may not change short-term mortality among internal medicine inpatients . NeverthThese calculations suggest a reimbursement strategy that could be called "fee for expected benefit" . A healtHealth and life insurers would provide nearly all of the social benefits of tort law. The insurer could reward and penalize providers based on average patient outcomes. Observing poorly executed care, the insurer should demand quality improvements or end reimbursements. The insurer increases profits when it employs providers who have, or can learn, the skills required to manage high-risk cases. In under-served settings, insurers might encourage and guide expansion of primary care physicians' services. If insurers are competing for high quality services for policyholders, then the insurers should spend to retain the most skilled physicians. This should encourage physicians to hone their skills, stay current with evolving treatment, monitor their patients' outcomes and seek assistance when needed rather than risk mishaps that could threaten personal income. These penalties and rewards should address the social goals of confining clinicians' scope of practice to areas of competence and punishing low quality care.always pay a price for injurious medical mistakes, whether or not mistakes come to the attention of patients, their families, or the judicial system. The insurance beneficiaries of patients who die from medical mistakes are always compensated. Young patients who die can leave fairly large settlements to their survivors by purchasing inexpensive term life policies. The life insurance benefit therefore establishes a no-fault process for compensating the survivors of patients who suffer fatal medical mistakes. After non-fatal mistakes, the insurer often will pay a new stream of health care expenses. A health and life insurance policy also could include disability insurance, comprising at least a provision to suspend premium payments in the event of disability. This would further encourage insurers to reduce non-fatal mistakes. The insurer will consistently compensate victims of low quality care, or their estates, thus addressing the third goal of tort law.Health and life insurers will Policyholders may be willing to waive their right to jury trials if they trust health and life insurers to identify and then discourage or remediate poor quality care, encourage and refine high quality care and stand by them or compensate their survivors after adverse events. Optional independent adverse event review panels could provide arbitration and root cause analysis services.If the health insurance premium is held constant, the savings from avoiding defensive medicine could subsidize the life insurance policy. If defensive medicine actually costs $100 billion per year in a nation of 300 million persons and could be eliminated by replacing malpractice threats with more constructive quality improvement processes, then the implied annual per capita savings could exceed $300. For healthy middle-age male non-smokers, that savings is enough to pay the entire premium for $100,000 of term life insurance. Alternatively, over 15 years the savings could pay for about $8,000 of whole life insurance. While the costs of defensive medicine are not likely to be distributed evenly across the population, savings on this scale should be available to large insurers.If a health and life insurer can curtail unnecessary care, a much larger amount of money could be available to subsidize life insurance purchases. According to the World Health Organization Statistical Information System (WHOSIS), among western nations in 2006, the United States spent $3,100 to $4,200 more per capita on health care than Australia, Canada, France, Germany, New Zealand, Sweden, or the United Kingdom, yet US citizens faced a 109/1,000 risk of death between ages 15 and 60, 20% to 50% higher than the other nations . At a stHealth and life insurance should not reduce the practice of medicine to algorithmic care, although there is some danger of that outcome. Rather, these insurers will need to work with expert clinicians to understand as many predictable nuances of diagnosis and treatment as possible. Insurers should prize clinicians who are discriminating history takers, expert physical examiners, selective testers, accurate diagnosticians, and clever patient managers when these skills reduce costs or improve outcomes. Insurers should strive to develop and support these clinicians, as only insurers could.Combining health and life insurance could reconcile the health interests of patients with the financial interests of one of the best-informed but least trusted industries in health care. Negotiations between these parties could provide an objective foundation for setting the prices of many medical goods and services. One of the potential benefits is that properly implemented health and life insurance should consistently promote the social goals that malpractice lawsuits promote so inconsistently, with direct and indirect cost savings. The savings from avoiding malpractice suits and defensive medical practice could substantially offset the cost of life insurance for policyholders.The author declares that he has no competing interests.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6963/10/150/prepub

We have reported a novel technique for the closure of the ports after laparoscopic surgery. Using this technique all the ports are closed under vision, thus preventing port herniation. We would like to report a novel method for the closure of the port site in laparoscopic surgery. There are usually 5 mm, 10 mm and 12 mm ports in laparoscopic surgery. The literature search reveals that the hernia through the port site can cause considerable morbidity in a post-operative patient especially requiring surgical intervention.We routinely use Hassan's port for causing pneumo-peritoneum which is then closed under vision. The lateral 10 to 12 mm ports are closed using vicryl with the help of a skin hook and a retractor . Skin hook is inserted in the corner of the wound under the sheath. This can now be palpated with the finger very easily as the sheath is taut. This also causes approximation of the sheath which can now be accessed by using another retractor (right angled retractor/skin hook) above the sheath at 90 degrees to the hook (inserted under sheath) to retract skin and subcutaneous tissue . The edg

Statistical analysis involved tabulation of descriptive height measures and BMI. Conditional logistic regression models were used to quantify the association of GCT with height, with odds ratios (OR) adjusted for BMI. The literature was searched for studies on stature in GCT patients. Body size is significantly associated with risk of GCT, very tall men (>195 cm) having a GCT risk of OR=3.35 : 2.88–3.90; adjusted). Short stature is protective . Both histologic subgroups are associated with tallness. Of 16 previous reports, 7 were confirmative, 5 had null and 4 equivocal results. The association of stature with GCT risk accords with the nutrition hypothesis of GCT. This study expands the current view of GCT tumorigenesis by suggesting that high-calorie intake in childhood promotes GCT precursors originating in utero.The pathogenesis of testicular germ cell tumours (GCTs) is potentially influenced by high-energy nutrition during infancy. As adult height is a proxy for childhood nutrition, we investigated the role of nutrition in GCT pathogenesis by comparing stature of patients with healthy men. In a matched case–control study, 6415 patients with GCT were compared with healthy army conscripts (1:6 matching modus) with regard to height (cm) and body mass index (BMI; kg/m Adult stature results from a combination of genetic and environmental factors . The mosin utero. Precursors of GCT, closely resembling primordial germ cells evolve in the primitive gonad, secondary to excess maternal oestrogen levels during embryogenesis (Testicular germ cell tumours (GCTs) are thought to originate ogenesis , such asThis investigation was designed as a matched case–control study with 228 participating institutions (appendix). Accrual started in 2002 and was terminated by the end of 2005. Cases treated during 1995–2005 were eligible . Roughly2), as well as the exact date of birth. Histology of GCT was noted (pure seminoma or non-seminoma). Measurements for controls were those taken at military enrolment, whereas those for patients were mainly self-reported. As final adult height is usually attained at the age of 18–19 years, comparison of army conscripts with adult GCT patients is reasonable with respect to height. However, as body weight and BMI mostly continue to increase beyond age 19 , weight (kg), and body mass index . As the median height of German males aged 18–40 years currently ranges from 176 to 179 cm, the height category 175–179 cm was defined as the reference group. Conditional logistic regression models on the Windows platform. First, a descriptive tabulation was performed regarding median height, 25th percentiles, 75th percentiles, as well as maximum and minimum height as found in the populations of GCT patients, controls, and in the subsets of seminoma and non-seminoma, respectively. For further detailed analysis, patients and controls were categorised with respect to height and BMI, respectively. Categories were <170, 170–174, 175–179, 180–184, 185–189, 190–194, ⩾195 with regard to height (cm), and <20, 20 to <25, 25 to <30, ⩾30 with respect to BMI and hand search of pertinent literature.P<0.0001; Wald χ2-test). There is a significantly increasing risk of GCT with increasing height. As height may conceivably be interrelated with other anthropometric parameters, a descriptive analysis was performed stratifying by BMI categories. As shown in Analysis revealed that all statistical parameters of height that is, median, minimum, maximum, 25th percentile and 75th percentile are greater in patients than in controls , whereasConditional logistic regression adjusting for BMI confirmed the significant association of height with the risk of GCT and poinOur study revealed a strongly significant association of adult height with the risk of testicular GCT. It is unique in three ways: first, it is by far the largest study to date; second, it included the highest risk ever reported; finally, there is a linear trend with increments of height whereas a distinctly decreased risk is found with short stature. The overall relative risk (OR) is 3.35 whereas previous OR ranged from 1.83 to 2.11 (The results of the present evaluation are in line with seven previous studies (This study has a number of strengths. The exceptional sample size leaves statistical chance effects at a minimum. Selection bias is unlikely because accrual of patients was performed nation-wide by 228 participating institutions across Germany. Similarly, the control population represented national standard because basically all young German men are enroled by the Federal Army. Confounding by age is ruled out because cases and controls were exactly matched by the day of birth. Conditional logistic regression models were with and without adjusting for BMI. As BMI is mainly associated with energy intake during adulthood, confounding of the present result by nutritional effects after adolescence is improbable. Yet, the study has certain weaknesses, such as controlling only for age and BMI. Anthropometric measures of patients were self-reported for the most part, whereas all of the controls had exactly measured values. As many men overestimate their own height there maThe association of tallness with testicular cancer risk lends much support to the nutrition hypothesis of GCT pathogenesis. In general, that theory implies an association of nutrition with GCT risk . As finaThe main observation is the declining incidence rates of GCT in cohorts of men born during World War II or immediately thereafter (Some decades ago, GCT had been found to be more frequent in ‘white-collar professions’ . That obTwo ecological studies support the hypothesis, one showing a correlation between high-fat intake and the incidence of GCT and the There is now sufficient evidence to acknowledge tallness as a recognised risk factor of testicular GCT. The underlying biological mechanisms linking tallness and GCT risk are less clear. However, the nutrition hypothesis outlined herein would provide an appealing explanation. According to that hypothesis, high-calorie intake during early childhood could advance length growth and promote GCT precursor cells at the same time. This hypothesis would thus complement and refine the current view of GCT pathogenesis that involves the development of GCT precursor cells during intra-uterine life.

The Clubfoot Assessment Protocol (CAP) was developed for follow-up of children treated for clubfoot. The objective of this study was to analyze reliability and validity of the six items used in the domain CAPMotion Quality using inexperienced assessors.Four raters used the CAP scores to analyze, on two different occasions, 11 videotapes containing standardized recordings of motion activity according to the domain CAPMotion Quality These results were compared to a criterion for validity and for checking for learning effect.Weighted kappa statistics, exact percentage observer agreement (Po), percentage observer agreement including one level difference (Po-1) and amount of scoring scales defined how reliability was to be interpreted. Inter- and intra rater differences were calculated using median and inter quartile ranges (IQR) on item level and mean and limits of agreement on domain level.Inter-rater reliability varied between fair and moderate (kappa) and had a mean agreement of 48/88% (Po/Po-1). Intra -rater reliability varied between moderate to good with a mean agreement of 63/96%. The intra- and inter-rater differences in the present study were generally small both on item (0.00) and domain level (-1.10). There was exact agreement of 51% and Po-1 of 91% of the six items with the criterion. No learning effect was found.The CAPMotion quality can be used by inexperienced assessors with sufficient reliability in daily clinical practice and showed acceptable accuracy compared to the criterion. The Clubfoot Assessment Protocol (CAP) ,2 Table was deveThe CAP has in previous studies shown good reliability, validity and sensitivity for change in the four domains Mobility, Muscle function, Morphology and Motion quality with experienced assessors. ,2The objective of this study was to analyze the intra-and inter rater reliability of the items used in the domain Motion Quality of the CAP and their validity, with inexperienced CAP assessors.This domain contains six items; running, walking, toe walking, heel walking, one-leg hop and one-leg balance . Gender distribution was three girls and eight boys. Five children had unilateral clubfoot and six bilateral. All families gave their informed consent for the use of the video films.Video recordings of eleven children treated for clubfoot and with varying severity and outcome results, were selected from the archives of our clubfoot clinic. The tapes contained standardized recordings of motion activity according to the domain CAPFour raters were selected according to the criteria having worked within pediatric orthopedics at least seven years including experience with children with clubfoot. Two raters were pediatric orthopedic surgeons and two were senior physiotherapists. None of the raters had previous experiences with the CAP system.Two raters well experienced with CAP, one physiotherapist and developer of the CAP (HA) and one pediatric orthopedic surgeon (GH), defined the most correct score for each child's item performance.The recording procedure was standardized and comparable with the situation in a daily clinical environment. The children were recorded from a frontal and posterior view while moving along a 10 meter pathway. The camera was positioned on one meters height and two meter from the beginning of the pathway. The children wore t-shirts, shorts or underwear and were barefoot. The children were asked if they wanted to start with walking or running. All children started with running followed by walking, toe walking, heel walking, one-leg hop and on-leg stance. Recordings were made of each performance as much as necessary to be able to make an assessment comparable with real life. Each video sequence lasted about 4 minutes.Motion Quality manual with the items criteria and a copy of the protocol form to be used during the rating session After each video recording a half minute pause was given. A short brake was made after the fifth video. 2) No possibilities were given to stop the video or to assess the recordings in slow motion. 3) Before each new video sequence the raters received only information about the child's age and gender. 4) Both left and right side should be rated. As a training session, the raters viewed and at the same time rated a videotaped recording of a child without a disability and a child treated for congenital clubfoot. Total testing time was approximately one hour and 15 minutes.The two experienced assessors (HA and GH) analyzed and discussed the same videos at one meeting and defined the most correct rating for each side and each child. This was done before the first assessment of the four raters.Both legs were rated and used as individual ratings in the statistical analyses.k) statistics [Motion quality domain exists out of five scoring possibilities we regarded a Po ≥ 50% or a Po-1 ≥ 80% as good.Inter – and intra tester reliability was calculated using the weighted kappa and/or a good percentage agreement. Sufficient item reliability was considered when the kappa values ranged between 0.41–0.60 (fair to moderate) for more than halve of the inter-intra ratings and/or had good percentage agreement.The median differences and inter quartile ranges (IQR) for each item and the mean difference and its limits of agreement (LOA) for the domain motion quality for the inter-and intrarater were calculated. For evaluating if there was a learning effect between the first and second session, the Po and Po-1 assessed with the criterion, were used. A difference of more than 10% was set as level for a real difference.The item inter-rater reliability between the four raters is presented in Table According to the reliability criteria four out of six items showed sufficient inter-rater reliability. The items toe-and heel walking showed overall problems with sufficient assessment agreement.The median intra-rater reliability for the individual raters is presented in Table Three items showed good reliability and three showed sufficient intra-rater agreement.No general improvement was seen between the first and second session regarding the exact observed mean percentage agreement for all items Figure . Item toMotion quality showed sufficient reliability. The items toe-and heel-walking showed fair reliability. The observers' intra-rater reliability showed reliability between good to sufficient for all items. Inter- and intra rater score differences on item and domain level were relatively small. No clear learning effects were found between the first and second session.This is, to our knowledge, the first study focusing on reliability on assessing different activity performances in children born with clubfoot in a situation comparable with a daily clinical setting. The inter-rater reliability for four out of six items from the CAPThree-dimensional gait analyses (3DGA) are commonly advocated as the golden standard within gait analysis. In our study these computerized motion analyses were not useful for validation of our items as they are not (yet) obtainable. The exact agreement of 51% with our criterion, the five scorings possibilities and the Po-1 agreement of 91% shows evidence for a valid assessment system. It will be interesting to study how more experience of the CAP system or a CAP course can increase the validity and reliability.It is impossible to actual calculate the true reliability of an instrument. Many internal factors such as sample size, amount of scoring possibilities, statistical method, and external factors such as assessment procedure and shifting performance of the object under observation, can influence the outcome of studies on reliability. In studies with young children these external factors can be very difficult to keep stable. We tried to control the external factors by using video recordings which resembled as much as possible the daily clinical situation. This made it possible for several raters to assess the same phenomenon.Strictly methodologically it is not correct to use both legs of the same child as individual ratings as they can be dependent of each other. This can be a significant problem in treatment outcome studies. In the present study, however, we think this is of minor importance as the aim was to study the reliability of assessors when they have to assess both legs similar to the normal clinical situation.Defining the cut off points for the percentage agreement is arbitrarily. A concordance of 75–80% with two possibilities is commonly used. We think that our cut off point with 50% for the exact percentage agreement with a 5-point scale is acceptable. We also checked the score differences for information on the clinical implication of the reliability.We tried to integrate different information on the instruments behavior with inter-and intra rater testing trying to create an as truthful picture as possible.Wren et al found inThe observers in the present study explained difficulties in not having control over the assessment situation. The raters were not allowed to stop, rewind or see the recording in slow motion. This might have had a negative influence on our reliability and validity results.Motionquality with a total score of 24 and a 5 point scale is in comparison very promising.Knowledge about the score differences between observers is important as this has to be incorporated in studies on responsiveness. The intra- and inter-rater measurement errors in the present study were small both on item and domain level. Celebi et al. found meMotionquality items, but decrease the sensitivity for differences. An instrument with higher sensitivity is clinically more informative. More scoring possibilities also demands the administrator to more critically assess an observation and decide which scoring is the most correct. These situations can have a learning effect and with time increases the quality and reliability of assessments.Fewer scoring levels would probably increase the reliability for the CAPMotion quality can be used with good reliability and validity in daily clinical practice. When different observers are used, and within research, it is recommended to check the inter-rater reliability and calculate the scores differences on item or domain level.We conclude that the CAPThe authors declare that they have no competing interests.HA and GH designed and collected the data. HA and P-EI analyzed, interpreted and revised the data and manuscript. HA drafted the manuscript. GH and P-EI revised the manuscript.Appendix. Summary of the Clubfoot Assessment Protocol (CAP version 1.1) domain motion quality.Click here for file

P=0.55, absolute difference between the groups 5.2%; 95% confidence interval (CI) for the difference −7 to 17.3%. Only one episode in the oral arm was associated with significant clinical deterioration: this occurred within the initial in-patient assessment period. The median in-patient stay was 4 days in the intravenous arm (range 2–8) and 2 days in the oral arm (range 1–16 days), P<0.0005. The reduction in hospital stay led to significant cost-savings in the oral arm. In conclusion, this study suggests that oral antibiotics in conjunction with early hospital discharge for patients who remain stable after a 24 h period of in-patient monitoring offers a feasible and cost-effective alternative to conventional management of low-risk neutropenic fever.Neutropenic sepsis remains a potentially life-threatening complication of anticancer chemotherapy. However, it is possible to identify patients who are at low risk for serious complications and for whom less-intensive, more-convenient treatment may be appropriate. The aim of this study was to assess the efficacy and safety of oral antibiotics in conjunction with early hospital discharge in comparison with standard in-patient intravenous antibiotics in patients with low-risk neutropenic fever. In all, 126 episodes of low-risk neutropenic fever occurred in 102 patients. Patients were randomised to receive either: an oral regimen of ciprofloxacin (750 mg 12 hourly) plus amoxicillin–clavulanate (675 mg 8 hourly) for a total of 5 days, or a standard intravenous regimen of gentamicin and tazocin (piperacillin/tazobactam) until hospital discharge. Patients randomised to oral antibiotics were eligible for discharge following 24 h of hospitalisation, if clinically stable and symptomatically improved. The efficacy of the two arms was similar: initial treatment was successful without antibiotic modification in 90% of episodes in the intravenous arm and 84.8% of episodes in the oral arm, Neutropenic sepsis is a well recognised, potentially life-threatening complication for patients undergoing cytotoxic chemotherapy for cancer . While tThe aim of defining low-risk neutropenia has been to identify those patients who may be candidates for less-intensive, more-convenient antibiotic therapy. Thus, in parallel with the development of the definition of low-risk, several studies have demonstrated the feasibility of newer approaches including intravenous antibiotic monotherapy using both intravenous and oral regimens in the outpatient setting have reported both high response rates and low readmission rates. However, these studies have not evaluated outpatient therapy in a randomised comparison with standard in-patient intravenous treatment.Serial studies at the MD Anderson Center were recruited between February 1997 and September 2000.9 l−1, but patients were also eligible if their ANC was ⩽1 × 109 l−1, but anticipated to fall to ⩽0.5 × 109 l−1 within 24 h of entry into the study. Fever was defined as a temperature of ⩾38oC on two oral measurements 4 h apart within a 24 h period, one of which could have been measured by the patient prior to admission, or ⩾38.5oC on one occasion. It was also required that patients should have an anticipated duration of neutropenia of no longer than 7 days. Patients could be entered more than once following subsequent episodes of febrile neutropenia.Neutropenia was defined according to standard criteria as an abPatients were required to be haemodynamically stable with no signs or symptoms that required intravenous fluid support. Adequate renal function and the ability to maintain satisfactory oral intake were therefore required.Patients were not eligible if they had undergone autologous bone marrow or peripheral blood stem-cell transplantation or had received antibacterial medication within 7 days of enrolment. The use of CSFs and cytokines was not permitted.Further exclusion criteria included (i) any coexisting medical condition that would require in-patient treatment or monitoring, (ii) clinically documented infection, in the opinion of the investigator, likely to require targeted or prolonged duration of antibiotic therapy , (iii) inability to tolerate oral medication, and (iv) known allergy to study drugs.Finally, all patients were required to have a responsible adult living with them who would be prepared to act as a carer if the patient were eligible for early discharge. Either patient or carer was also required to be able to read a thermometre. Patients with a history of poor compliance were excluded. All patients were 18 or over and gave written informed consent.All patients were initially assessed with a history and full physical examination. Standard screening investigations consisted of a full blood count and differential, a biochemical screen and a minimum of one set of peripheral venous blood cultures in addition to cultures via a central venous catheter if present. Chest radiographs and other microbiological cultures were performed only where clinically indicated.Eligible patients were randomly assigned by means of consecutively drawn sealed envelopes to receive either an oral regimen of ciprofloxacin 750 mg every 12 h plus amoxicillin–clavulanate (amoxicillin 500 mg+clavulanate 175 mg) every 8 h for a total of 5 days, or an intravenous regimen of gentamicin 80 mg every 8 h and dose adjusted according to therapeutic levels plus tazocin every 8 h until hospital discharge.Patients randomised to the intravenous arm were subject to a standard protocol for the management of neutopenic fever, with daily clinical assessment, repeat full blood count and differential at 48 h intervals, repeat blood cultures for patients with persistent fever and any additional investigations as clinically indicated. Patients were eligible for discharge when afebrile for 24 h with a rising neutrophil count . Patients did not routinely receive antibiotics on discharge. Indications for changes in the treatment regimen included persistent fever ⩾72 h, positive culture results with resistant organisms, or clinical deterioration at the discretion of the treating clinician.Patients randomised to the oral arm were eligible for discharge following 24 h of hospitalisation, if clinically stable and symptomatically improved, and according to the patient's wishes. On discharge, patients were supplied with a daily diary to record their temperature at 6-hourly intervals and any associated symptoms, and telephone contact was maintained with a member of the clinical research team. They were also given oral and written instructions with a 24-h contact telephone number at the specialist centre, emphasising the need for early reporting of any symptomatic deterioration. After discharge, patients were reviewed 7–10 days later in the oncology outpatient department to ensure full haematological recovery, assess outcome and determine further oncological management.Those patients randomised into the oral arm who were not discharged after the 24 h assessment were reassessed daily including their eligibility for discharge as described above. Criteria for alterations to the antibiotic regimen were as outlined in the intravenous arm together with the inability to tolerate oral medication for any reason. Patients in the oral arm who required readmission following early discharge had their antibiotic regimen altered at the discretion of the treating physician depending on the indication for readmission.The primary end points of the study were success and safety. ‘Success’ was defined according to EORTC guidelines , an international nursing workload management system that is increasingly used within the NHS, to obtain an estimate of the nursing time required in ‘actual patient contact’.α=0.05 with power of 80% using a two-sided χ2 test (N Query sample size program). In addition, first episodes of neutropenic fever (i.e. occurring in patients not previously randomised) were analysed separately to exclude any bias induced by repeat randomisation. We used the χ2 test or Fisher's exact test to compare various base-line characteristics and outcomes between the groups. The Mann–Whitney U-test was used to compare the continuous variables of neutrophil counts and stay length.From our own previous experience and previously published studies, and assuming a response rate of approximately 80% for the intravenous arm, this study was designed to enrol 63 episodes per arm to ensure that the oral arm would not be 20% worse at a level of significance Between February 1997 and August 2000 111 patients, representing 135 episodes of fever associated with neutropenia, consented to participate in the study. Of the 135 episodes evaluated, nine episodes were excluded from the analysis, seven in the intravenous arm and two in the oral arm. Eight failed to meet the inclusion criteria; four were not neutropenic, one did not have fever, one required intravenous fluids at the time of randomisation, one had received antibiotics within 7 days of being entered into the study and one was allergic to study drugs. The final patient withdrew consent prior to commencement of antibiotics. The remaining 126 eligible episodes occurred in 102 patients .Sixty eligible episodes of neutropenic fever were assigned to the intravenous regimen of gentamicin and tazocin and 66 were assigned to receive the oral regimen of ciprofloxacin and amoxicillin–clavulanate. Of the 102 first episodes of neutropenic fever (i.e. occurring in patients not previously randomised), 51 were in the oral and 51 in the intravenous arm. The arms were well balanced with respect to age, sex and primary site of cancer, 9 l−1 at randomisation.The majority of episodes occurred in women, reflecting the most frequent underlying diagnoses of breast cancer and small-cell lung cancer. Only 4.8% of episodes had a diagnosis of lymphoma, 92% of episodes had neutrophil counts of ⩽0.5 × 10Clostridium difficile associated diarrhoea following hospitalisation (superinfection).Clinical symptoms at randomisation were by definition mild to moderate (CTC grades I–II), Table 2P=0.55: absolute difference between the groups is 5.2%; 95% confidence interval for the difference −7 to 17.3%. Treatment was successful in all episodes with positive blood cultures. The success rates in the 102 first episodes of neutropenic fever were very similar: 45 of the 51 (88.2%) first episodes of neutropenic fever in the intravenous arm were successful, while 43 of the 51 (84.3%) first episodes in the oral arm were successful, P=0.77.The success rate to initial antibiotic therapy was similar in both groups. Treatment was successful in 90% of all episodes of neutropenic fever in the intravenous arm and 84.8% of all episodes of neutropenic fever in the oral arm, Episodes of neutropenic fever deemed failures are summarised in Table 3In the oral arm there were no deaths. A total of 10 episodes of neutropenic fever in the oral arm required modification of the initial antibiotic regimen and were therefore deemed failures, Of the remaining nine failures in the oral arm, all were converted to intravenous antibiotic regimens. Indications for the modification to the initial antibiotic regimen were: intolerance of the oral regimen due to vomiting (one); development of severe oesophagitis (two) and persistent fever at 72 h without serious clinical deterioration (six).Five patients in the oral arm required readmission to hospital. Four of these were deemed failures and are described above. The fifth patient was readmitted with chest pain diagnosed as a pulmonary embolism.Both arms of the study were very well tolerated. In the oral arm there was one episode (0.8%) of severe toxicity, CTC grade 3, in which a patient was unable to tolerate oral ciprofloxacin due to vomiting, thus requiring a change to intravenous antibiotics. Other toxicity in this arm was mild–moderate gastrointestinal toxicity that did not require a change in antibiotic regimen, 14 patients (21.2%) having CTC grade 1–2 diarrhoea and five patients (7.6%) having CTC grade 1–2 nausea/vomiting. In the intravenous arm, there were no episodes of toxicity of CTC grade>1.P<0.0005, Table 4The median in-patient stay was 4 days in the intravenous arm (range 2–8) and 2 days in the oral arm (range 1–16 days), The financial costs of hospitalisation and antibiotic costs, together with the estimated direct patient contact nursing hours required in the two arms are given in vs monotherapy), changes in route of administration and treatment setting (in-patient vs outpatient). Response rates and safety have remained the main end points for antibiotic research in this area. However, as a consequence of the high response rates of newer antimicrobials and the low incidence of complications in this population, the safety and efficacy of different regimens are very similar , required readmission, one of these for reasons apparently unrelated to the neutropenic episode. We used the criteria of clinical stability as judged by individual clinicians together with patients' symptomatic response to determine whether patients were eligible for early hospital discharge. This use of patients' subjective response is supported by a study from the MD Anderson Cancer Center (The majority of patients admitted with complications of chemotherapy are receiving palliative treatment. Thus, the shorter duration of hospitalisation in the oral arm may be anticipated to impact upon patients' quality of life. Unfortunately, currently available instruments designed for measuring quality of life (Toxicity of treatment is also an important end point and is also likely to impact upon patients' quality of life. In this study, toxicity in the oral arm was generally mild and consisted of easily managed nausea and diarrhoea. Only one patient required antibiotic modification because of toxicity. Toxicity was less than was reported in the two largest studies comparing oral and intravenous regimens (Resource implications of different therapeutic strategies are increasingly important in all healthcare systems. The major financial burden of conventional treatment of neutropenic fever is the cost of in-patient care, estimated to be between 58 and 78% of the total cost. . This isThe introduction of oral antibiotics and early hospital discharge may have additional, though less easily quantifiable, benefits with respect to nursing and pharmacy time. Oral therapy clearly negates the requirement for care of intravenous cannulae as well as aseptic reconstitution. Assessment using the GRASP nursing management tool suggested that this treatment approach might reduce number of nursing hours required in ‘direct patient care’ by more than half.In conclusion, our study suggests that oral antibiotics in conjunction with early hospital discharge for patients who remain stable after a 24 h period of in-patient monitoring offers a feasible and cost-effective alternative to conventional management of low-risk neutropenic fever. However, we urge caution when applying these findings outside the setting of a single specialist centre. We also recognise that the power of this study to detect small but clinically important differences in safety is limited. We therefore believe that the results of this study should provide a platform for larger trials to further evaluate the policy of oral antibiotics with early discharge in the multicentre setting.

Interleukin 2 (IL-2) exhibits anti-tumour activity. High-dose IL-2 regimens are limited by side-effects such as pulmonary oedema and a systemic vascular leak. The mechanisms by which IL-2 mediates transvascular fluid and protein losses in humans are largely unknown. We have, therefore, measured the transcapillary escape rate (TER) of albumin as a reflection of the vascular permeability by injecting [125I]albumin (5 microCi i.v.). In ten melanoma patients pretreated with interferon alpha TER of albumin was measured before and after IL-2 injections (1.5 x 10(6) Cetus-U. s.c. daily for 4 days). The TER of albumin increased from 9.4 +/- 2.7% h-1 before to 14.9 +/- 3.3% h-1 (P < 0.001) after IL-2 injections and the absolute outflux of albumin from 159 +/- 28 mg kg-1 h-1 to 261 +/- 44 mg kg-1 h-1 (P < 0.001), whereas the intravascular albumin pool remained stable (136 +/- 19 g vs 136 +/- 18 g). IL-2 and IL-6 were not detectable in the plasma prior to IL-2 injections and increased to 549 +/- 315 U ml-1 (P < 0.001) and 7 +/- 6 pg ml-1 (P < 0.01), respectively, after IL-2 administration. In conclusion, IL-2 increases the vascular permeability in humans, without affecting the intravascular albumin pool. This suggests that mechanisms such as the lymphatic return can compensate for the severe transendothelial fluid/albumin losses.

The middle initial of the last author's name was omitted. The correct name is: Arup K. Indra.

Sir,This is with reference to the article entitled “Use of patch testing for identifying allergen causing chronic urticaria” which appeared in the March–April issue of IJDVL. The artiet al. and Bajaj, et al. mentions about positive autologous serum skin test in 34 and 49.5% of patients, respectively.[35in vivo in patients with chronic urticaria. ASST is the only practicable test available to clinicians to detect autoimmune urticaria in India.[et al., in the Blue journal.[None of the patients underwent autologous serum skin test, which can be done with the help of pathology laboratory. Mamatha, tively.35 Autologoin India. The real journal.Observations of Sharma are of interest but need to be confirmed by other controlled studies before routine patch testing and avoidance measures are recommended in the diagnosis and treatment of chronic urticaria.

Feedback regulation plays crucial roles in the robust control and maintenance of many cellular systems. Negative feedbacks are found to underline both stable and unstable, often oscillatory, behaviours. We explore the dynamical characteristics of systems with single as well as coupled negative feedback loops using a combined approach of analytical and numerical techniques. Particularly, we emphasise how the loop's characterising factors (strength and cooperativity levels) affect system dynamics and how individual loops interact in the coupled-loop systems.We develop an analytical bifurcation analysis based on the stability and the Routh- Hurwitz theorem for a common negative feedback system and a variety of its variants. We demonstrate that different combinations of the feedback strengths of individual loops give rise to different dynamical behaviours. Moreover, incorporating more negative feedback loops always tend to enhance system stability. We show that two mechanisms, in addition to the lengthening of pathway, can lower the Hill coefficient to a biologically plausible level required for sustained oscillations. These include loops coupling and end-product utilisation. We find that the degradation rates solely affect the threshold Hill coefficient for sustained oscillation, while the synthesis rates have more significant roles in determining the threshold feedback strength. Unbalancing the degradation rates between the system species is found as a way to improve stability.The analytical methods and insights presented in this study demonstrate that reallocation of the feedback loop may or may not make the system more stable; the specific effect is determined by the degradation rates of the newly inhibited molecular species. As the loop moves closer to the end of the pathway, the minimum Hill coefficient for oscillation is reduced. Furthermore, under general values of the degradation rates, system extension becomes more stable only when the added species degrades slower than it is being produced; otherwise the system is more prone to oscillation. The coupling of loops significantly increases the richness of dynamical bifurcation characteristics. The likelihood of having oscillatory behaviour is directly determined by the loops' strength: stronger loops always result in smaller oscillatory regions. Escherichia coli, LexA, represses its own production [Mdm2 gene and Mdm2 sequesters p53 [Pseudomonas fluorescens the acetate represses seven preceding reactions [Feedback control mechanisms are vital to the robust functioning of gene regulatory and metabolic pathways. They have been extensively researched over the last two decades: we now know more about the topology and functionality of positive and negative feedback in intra- and inter-cellular systems than ever before . For exaoduction ; the Hesoduction ; the p53ters p53 ; and theters p53 ; (2) meteactions ,10; and,eactions ; and cireactions . These fEarly work on negative feedback in gene regulatory systems goes back to that of Goodwin who propTwo important factors that can be used to characterise a negative feedback loop are the feedback strength and level of binding cooperativity (nonlinearity) between an inhibitor and its regulated molecule ,26. In tWe consider a commonly encountered motif of the negative feedback systems in which negative feedback is imposed by the last species of the system pathway on the upstream species. We develop mathematical models to analyze for stability and bifurcation, in order to study the behaviour of these systems, confining ourselves to the analytical solutions which allow us to obtain bifurcation points dependent on the feedback strengths and nonlinearity as the parameters. Based on these results, the conditions on the feedback strength or nonlinearity for: no stability; no oscillation; stability enhancement; oscillation enhancement; and guaranteed stability (oscillation) can be established. Our analyses will lead to regimes in the parameter space in which different dynamical behaviours can be identified. In contrast to numerical methods, analytical methods facilitate an analysis of the parameter sensitivities of the system dynamics.robustness and stability used in this paper. Robustness is referred to as the ability of a system to maintain its functionality against internal perturbations and environmental variations. Stability, on the other hand, is only concerned with the ability to maintain the system state. Although both are important properties of living systems, robustness is a broader concept than stability, with the emphasis on system functionality rather than system state [For clarification, here we define the meanings of em state . A systeem state . In thisEscherichia coli as examples. Finally, we end the paper with the Summary and Conclusion section.The remaining structure of this paper is given as follows: the Methods section discusses Hill function and its use for negative feedback modelling, followed by a description of the regulatory motifs studied in the current paper and their mathematical models. The analytical methods developed for stability and bifurcation analyses are outlined in the last subsection. Detailed analyses along with discussion of pertinent results are presented in the section Results and Discussion. In the section Biological Examples, we analyze the Hes1 oscillator in vertebrates and the Tryptophan operon system in bacteria X can be described by the Hill function of the following form :Ki represents the half-saturation constant (i.e. the concentration of X that gives 0.5 ratio repression). It is also commonly referred to as the dissociation constant or binding constant. The parameter n (Hill coefficient) is related to the cooperativity level of the chemical process.where the parameter Ki: increasing Ki lowers the repression level while decreasing Ki increases the repression for a given n; therefore we may define K as feedback strength FS = 1/, the Hill function resembles the step function by change of binding site position within the DNA. The Hill coefficient can be changed, for example, by mutations that alter number of binding sites within the DNA. It has been experimentally shown for bacteria that they can accurately tune these parameters within only several hundred generations for optimal performance when faced with environmental change [In gene regulatory networks, change in FS could be brought about in a number of ways: 1) by mutations that alter the DNA sequence of the binding site of by mutatl-species system with length l by Ll; while a system having single feedback loop on the step k is denoted by k ≤ l). The system with the coupled loops on the steps k1, k2,.., kj is denoted by Our model motifs consist of generic pathways of activation steps (reactions) with arbitrary lengths with single or coupled negative feedback loops imposed by the end-product of the pathway. Figure l differential equations as follows,A model system can be described by using a set of xj, kj, kdj represent the concentration of species Xj, its synthesis rate, and its degradation rate, respectively. And,where H = 1 if no feedback loop is present for the jth step.X0 is often assumed to be static, i.e. its concentration is unchanged. In most cases, it represents the gene which is the source of the pathway and activates the whole sequence of reactions. However, we also consider the cases when X0 is variable by studying the variants of system Ll with shorter lengths. The degradation process of model species is assumed to follow first-order kinetics. Degradation parameter kdj is actually an aggregated rate combining transport (or modification) and decay rate of corresponding species. The Goodwin oscillator is a special case and represented by system The first species of the pathways acDonald .Despite their simplicity, these models can readily be used to model real biological systems. For instance, a generic model with three variables can be interpreted as follows: the first equation as the synthesis of nucleic mRNA, the second equation describing transportation of mRNA to the cytoplasm, while the last equation explains translation of mRNA into protein. Extended four-variable system can be interpreted by including a fourth equation describing transportation of protein back to the nucleus.We first analyse the single-loop systems with three and four variables. The coupled-loops systems are examined next. We then study the generalised, extended systems with arbitrary pathway lengths.Biological systems display many types of dynamic behaviours including stable steady state, sustained oscillations, and irregular fluctuating dynamics (chaos). Change of system parameters may lead to change of system dynamics. Bifurcation analysis allows one to subdivide the parameter space into qualitatively different regions within each, the system dynamics are homogeneous. Furthermore, the changes in the size and location of resulting regions due to parameters variation can be investigated.J) [The stability analysis of a system consisting of a set of differential equations can be conducted by considering its dynamical behaviour in the neighbourhood of its equilibrium (i.e. steady) state. A steady state is classified locally stable if the system returns to this steady state after a sufficiently small but arbitrary perturbation. Local stability of a steady state can be analysed by linearising the differential equations around the steady state and assessing the eigenvalues of the resulting Jacobian matrix (J) . For a sJ's eigenvalues are negative, the steady state is said to be stable, while if any of the real parts are positive, the steady state is unstable (in this case the system oscillates if the imaginary part is nonzero).If the real parts of all J's eigenvalues are actually the roots of the following characteristic equationBecause αis are the coefficients – to assess the signs of J' eigenvalues, we make use of the Routh-Hurwitz theorem [λ all have negative real parts if- theorem ,32 whichwhereOur aim is to establish analytical bifurcation points for the feedback strengths, Hill coefficients, and other model parameters of single-loop as well as multiple-loop systems. System stability conditions are first formulated using the Routh-Hurwitz stability criteria outlined above. These conditions are then examined using a geometrically-motivated approach. We demonstrate the method below using a system with length 3. Longer pathway systems are similarly analysed. Consider the case where all three loops are present Figure , and thexi, Denote the equilibrium values of the state variables xi, i = , 2, 3. SwhereIn this case, the characteristic polynomial is cubicFollowing the Routh-Hurwitz theorem, the system is stable if and only if the following Stability Condition (SC) is satisfied:It is convenient to introduce the following composite variablesM1, M2, M3 interestingly have the characteristics of activation functions. Working with M1, M2, M3 is more straightforward than with x1, x2 and x3 directly as it spares one from having to deal with the exponential and rational forms in (2). We also have 0 <M1, M2, M3 < 1. The equilibrium condition (2) is now simplified toVariables α1, α2 and α3 to be expressed in terms of only M1, M2, M3 and other model parameters, i.e. the synthetic and degradation rates (see equations (9) below for example). Particularly, the conditions (3) and (5) for simpler system motifs with less feedback loops can be easily derived. For example, setting Mi = 0 for some index i gives rise to a system structure lacking the corresponding feedback loop, e.g. M1 = 0 gives M1 = M2 = 0 gives Equations (4) also allow the characteristic coefficients M1, M2 and M3 can be expressed as functions of the others involving only Kis and nis. For example, assume M3 = 0 for simplicity (system Combined with (5) and (6), each of M1 is a strictly decreasing function of M2 over . Substitute this into Here, K2 and M2. Moreover, K1 is strictly increasing with M2 since the derivatives with respect to M2 of the terms inside the brackets in (7) are positive over ) such that M2l ≤ M2 ≤ M2h, then the stability condition (3) would be equivalent toThis means if there exist bounds K1 and K2 of the loops in action, and f1 and f1 are the bifurcation points of K1.Condition (8) represents an analytical relationship between the feedback strength indicators M2l and M2h, note that (3) can be manipulated to take the formTo determine the bounds g is a function whose explicit form depends on the particular system motif. For system where α1, α2, α3 > 0, (3) is equivalent to α1α2 - α3 > 0. Substituting (9) into this relation we obtainBecause f(M2) = M1 and a0, a1 and b1 are expressions of the system parameters and given in the supplementary material and g(M2) are drawn on the two dimensional M1-M2 coordinate plane is a strictly decreasing curve contained within the unit square U = {; ; ; } is a straight line with a positive slope. As 0 <M1, M2 < 1, the analysis is constrained within U only. Range of M2 satisfying (10) can be determined along with its lower and upper bounds M2l and M2h, illustrated in Figure Note that (10) is to take different forms depending on specific motifs of feedback loops. Next, we analyse the inequality (10) for the system e Figure . f(M2) iBecause two-species systems are incapable of demonstrating oscillatory dynamics, we only consider systems with three species or more. Here, we present the results for the systems with a single feedback loop. To this end, the three-species systems are first considered. We then examine the four-species systems and investigate potential effects on system functional dynamics as a result of lengthening the pathways.Three negative feedback motifs are possible for the three-species system where the feedback loop is imposed on the first, second, and the last step of the pathway. These are denoted The system is stable if and only if the following condition is satisfied yields an equivalent condition between the inverse feedback strength indicator 1 yields whereK1thresh) at which the system loses stability to an oscillatory regime. Based on (13), two-parameter bifurcation diagrams of K1 against other model parameters can be set up. Figure K1 vs. n1 plane, regions of stable and oscillatory dynamics, separated by the K1thresh curve.This shows, given other model parameters' values, the existence of a threshold feedback strength (1/K1 below the curve). Furthermore, K1thresh saturates at high n1 which indicates that there exists a critical value of K1 or feedback strength above which, the system is guaranteed to have sustained oscillations regardless of the value of the Hill coefficient n1 is the RGS of K1 with respect to n1.Here, we define the Ranges of Guaranteed Stability (RGS) of a model parameter M1 < 1, equation (11) means that the system is always stable if n1 ≤ B. This threshold value depends on the degradation rates only. It also yields the RGS of n1 to equal .The degradation rates, on the other hand, have opposite effect on system dynamics. Higher degradation rates tend to reduce n Figure and consB), our analysis reveals that comparable degradation rates across model species (kd1 ≈ kd2 ≈ kd3) leads to minimum B and thus minimum RGS for n1; whereas if one is many folds greater than another , B will be high, resulting in a large RGS and (13), however with different expressions of A and B:Interestingly for B ≥ 4 for arbitrary values of the degradation rates. Compared with the three-species system, n1's RGS is reduced, supposedly due to the lengthening of system pathway. Furthermore, for n1 > 4 the system is capable of displaying sustained oscillation for an indefinite number of parameter sets, given a proper selection while B is reduced to resemble that of the three-species system where l, the minimum Hill coefficient required for sustained oscillations has been theoretically computed to beIn fact, for the single-loop Goodwin system with arbitrary length kd1 = kd2 =...= kdl [although this calculation is done under the stringent assumption of equal degradation rates ...= kdl ,19.l (≥ 3). We observe dramatic reduction of the minimum n1 at small length (≤ 10) but this reduction becomes insignificant for longer pathway; a saturation trend is instead observed. Our derivation, however, gives us explicit form of the minimum n1 as analytical expression of the degradation rates.Figure Comparative study of the systems K1crit(L) the critical K1 value of system L, (14) and (15) then giveIf we denote k4 <kd4), K1crit will be reduced for the extended system. On the other hand, K1crit for k4 > kd4 and unchanged if k4 = kd4. Also, note that if kd4 is small (large) relative to other degradation rates, n1crit for the extended system becomes greater (see (12) and (16)).Equation (18) indicates that if the additional species is more quickly degraded than produced . In addition, the generalised critical value of the feedback strength is A. A system with feedback strength weaker than this value is guaranteed a stable dynamics independent of the Hill coefficient values.and B. Further generalisations, therefore, can be made for variants of the general Goodwin systems: the systems with single negative feedback loop in which any step in the biochemical pathway can be potentially inhibited by the end-product shows that the threshold Hill coefficient of A is retained its form as in (19) whereas B involves only the degradation rates of downstream species of the repressive targeted species Xk.where B has similar form as that of the reduced Goodwin system Kkthesh for variant systems More importantly, Kcrit). Regardless of the loop's position, the system's stability is ensured if the feedback strength is weaker than this value.The generalised findings above have important implications concerning the dynamical behaviour of feedback systems. Comparing (19) and (20) reveals that reallocation of the negative feedback loop has no effect on the critical feedback strength (1/B in (19) and (20) are different. The ratios of B for However, loop reallocation may or may not make the system more stable. This is because the threshold Hill coefficient values kd2 = kd3 = kd4 = 1. We observe that B is also incapable of having oscillatory dynamics under certain conditions.Let us consider systems with increased complexity in which several negative feedback loops are coupled together. Understanding of composite behaviour of coupled loops has been limited. We aim to establish meaningful connections between the feedback strength of these loops (through the inverse indicator parameters g(M2) intersect the M1-axis at a point above point , indicated by a dot in Figure a0 ≥ b1 or n1 ≤ B with B as in (12). Compared to the results from the previous section of the three-species, single-loop system, we found that adding a second feedback loop does not affect the RGS of n1. On the other hand, if n1 > B, the line g(M2) must intersect f(M2) within the unit square U and so condition (10) is violated for some M2, subsequently destabilising the system can be determined, indicated by its lower bound M2l and higher bound M2h in Figure K2, we obtain corresponding values for M2l and M2h. Using (8), we construct the two-parameter bifurcation diagram with the feedback strength indicators K1 and K2 being the axes.Range of f(M2) and g(M2) within U, indicating a simple binary separation of the K1-K2 bifurcation diagram into stable and oscillatory regions. A typical K1-K2 bifurcation profile for K1 and K2 as loop L1 and L2, respectively.Note that in this case, there exists at most one (unique) intersection point between L1 is relaxed (larger K1), sustained oscillation becomes more difficult to obtain at stronger L2 (indicated by raised minimum K2 possible for oscillation). Stability is most likely under weak L1 coupled with strong L2. Oscillations, on the other hand, are most likely at weak L2 coupled with strong L1; shifting system dynamics to being stable at strong L1, however, requires L2 to be very strong too. Dynamical behaviours are summarised in Table As loop K1 above which the system must be stable. This means stability is guaranteed if L1 is sufficiently weak, regardless of the nature of the second loop L2. Unlike L1, stable as well as oscillatory dynamics can be obtained at any strength of L2, given the proper specification of L1 The critical K1crit is independent of L2's specification, whereas it increases with n1. As a result, higher n1 enhances oscillatory behaviour due to the expansion of the oscillatory region. Increase n1 therefore enables oscillatory exhibition at weaker L1 leads to low B . Figure g(M3) is a concaved-up parabola instead of a straight line like g(M2) in the previously considered system f(M3) and g(M3), resulting in a similar bifurcation pattern for the K1 vs. K3 diagram as in K1 discussed previously is found to have the same form here. This again confirms that incorporation of additional feedback loop does not affect K1crit, regardless of the location of the added loop. Moreover, the first loop's Hill coefficient (n1) also has its RGS unchanged: RGS = is superimposed on the M1-M3 plane (by setting M2 ≡ M3) and indicated by the thin line in Figure g(M2) and g(M3) meets on the M1-axis. Moreover, the slope at this point for g(M3) is always steeper than g(M2), suggesting a higher lower bound for M3 for stability. The implication is: given the same set of parameter values, adding loop L3 results in a larger stability region than adding loop L2, therefore better enhance system stability. On the other hand, Here, we compare the bifurcation profiles between two doubled-loop systems In this section, we consider the system structure which incorporates all three feedback loops imposing on all pathway steps . In all the cases, it is found that having extra third loop always increases the stability of the system, illustrated by expansion of the stability region on bifurcation diagrams. The likelihood of obtaining oscillatory dynamics is directly controlled by strengths of the loops in effect, with stronger feedback loops always result in smaller oscillatory region. Figure Following the similar methodology laid out above, we were able to compute bifurcation diagrams for any pair of feedback strengths still have the usual formIn this case A as in equation (15). However, we havewith a0, a1 and a2 are given in the supplementary material via examining the curves in (23) and (24) on the M1-M2 coordinate. System stability occurs over the ranges of M2 such that f(M2) lies below g(M2), while oscillatory dynamics reigns over the remaining ranges.In a similar fashion, to construct bifurcation diagram of the loops' feedback strengths, we need to determine the ranges of g(M2).As expected, system extension greatly complicates the analysis due to the increased number of parameters and the increased complexity of n1 and n2, we determine on the two-parameter Hill coefficients n1-n2 plane regions that give rise to system stability regardless of the feedback loops' strengths and other parameters. These regions can be referred to as the Regions of Guaranteed Stability for n1 and n2.To find the RGS for the Hill coefficients g(M2) always lies above the unit square U and therefore above f(M2) for all K2. The RGS for n1, n2 can thus be found by solving the following system of inequalities,From Figure n2, n1) on the n1-n2 plane such thatPut B1 and B2 have the same form as in (16) and (17), respectively. Specifically,where B1 and B2). Figure n1, n2) inside this triangular guarantees system stability regardless of all other model parameters including the feedback strengths. On the other hand, for outside the triangular, we can always find a set of kdi so that its RGS does not contain , giving rise to unstable system equilibrium.This region is presented in Figure n1 must > 4 for n2 must > 8 for n1 (n2) given proper choice of n2 (n1). As a result, sustained oscillation can occur at much more biologically plausible values of n1, n2; e.g. = or , indicated by the dots in Figure Recall that in the cases of single-loop systems considered before, there exist lower bound conditions for the Hill coefficients if oscillatory dynamics is to be obtained. For example, n1, n2) solely depends on only the degradation rates. Variation on these rates affects its size and location. B2 is maximised if among the degradation parameters, one is many folds greater than another . Similarly, B1 is maximised if kdi >> kjd. On the other hand, B1, B2 are lowest when kdi >> kdj with kd1 ≈ kd2 ≈ kd3 ≈ kd4. Therefore, reducing any degradation rate to extreme low or high level will expand the RGS, resulting in system stability for wider range of Hill coefficients. Oscillation, consequently, is enhanced when the degradation rates are kept comparable between the system species.It is important to note that the RGS for lies outside the RGS region, g(M2) must cross U and therefore must intersect with f(M2) at least once at some value of the feedback strength indicator K2. Unlike the previously considered systems where only one intersection point is detected, the number of intersection points in this case could be up to three. This provides a rich variety of different bifurcation profiles for the system. In fact, we identify a total of 13 distinct patterns of bifurcation on the K1 vs. K2 bifurcation plane; each pattern for one choice of the Hill coefficients. These 13 patterns are displayed in Figure If . However, species' reduction could also occur via other mechanisms. We consider here the scenario where the end-product (inhibitor), besides being degraded, is due to be consumed by the cell for synthesising other cellular components. Notable examples are of common amino acid biosynthesis pathways in which the amino acid (pathway's end-product) is utilised by the cell for protein synthesis -35. Earlg complicates our analysis, we were able to obtain the stability condition for the system in simple form similar to (11) and (16) of system with g must not exceed a critical valueAs shown in Additional file Bg < 1 for all n1 and g. Hence, for any n1, stability condition (3.24) can be breached by choosing K1 sufficiently large , the inclusion of g, even small, has enabled the system to attain oscillation at any n1. End-product utilisation therefore allows oscillatory dynamics at low cooperativity level. This is demonstrated in Figure K1-n1 plane are compared for system with (thick line) and without (thin line) end-product utilisation. The bifurcation diagrams were constructed based on the threshold K1 which we calculated to be , it is easy to check that n1 increases; K1crit is given by (1-G)/A which is smaller than K1crit of A). This indicates in order to achieve oscillation; the feedback strength of the system with end-product utilisation must generally be stronger increases, K1crit reduces, causing shrinking of oscillatory region, especially at high n1 . Now at low n1, oscillatory region is greatly expanded, enabling oscillation at a much wider range of K1.We expect that change in 1 Figure . TherefoK1 vs. G bifurcation diagrams for n1 = 2, 4 and 6. In this case, higher cooperativity generally gives rise to larger oscillatory region, consequently promoting oscillation. We observe an intermediate value of G (and so g) for which oscillation is most likely (widest range of K1) while at low and high G the system tends to be more stable. This is consistent for all three plotted n1. As n1 increases, this intermediate g moves further left in its spectrum (between 0 and gc)We also present on Figure To sum up, we showed that end-product utilisation enhances sustained oscillation at low cooperativity level while it enhances stability at high cooperativity. However, it is important to note that raising the utilisation level does not always further these enhancements. In fact, there exists an intermediate rate for utilisation at which sustained oscillation is detected most likely, while less likely at other rates.Escherichia coli. The former system exemplifies single-loop system while the later is an instance of multiple-loop system.Restricted by the paper's scope, we only present here two biological examples from the literature where useful insights can be readily obtained by applying the analysis outlined in this paper. These are (1) the Hes1 oscillator which plays an important role during somitogenesis of vertebrates and (2) the Tryptophan operon system responsible for regulatory production of tryptophan in A wide range of cellular phenomena have their activities centred on oscillations ,37. One A few models have been developed for this network ,41-44. Hm1 and m2 represents the concentration of Hes1 mRNA before and after being transported from the nucleus to the cytoplasm, respectively; while p1 and p2 are the concentration of Hes1 protein before and after being transported from the cytoplasm to the nucleus, respectively. Equation (29a) describes the synthesis of mRNA in the nucleus. The mRNA is then transported into the cytoplasm, described by (29b). Translation into protein is specified by (29c) while (29d) represents transportation of the protein into the nucleus where it represses its own transcription. Parameters b and a denote the decay and modification rates for mRNA respectively; while d and e are used for the protein. To simplify the analysis, Zeiser et al. assumed the decay rates (b and d) as being identical for both forms of the mRNA and protein. By fixing b = 0.028, d = 0.031 and under condition of having oscillation period about 120 min, all determined in Hirata et al. [Here a et al. , Zeiser K1-n1 bifurcation diagram in Figure K1thesh = 1/A = 3296. Thus, for the Hes1 system to be an oscillator, the necessary condition for K1 is that K1 < 3296, given other parameters' values in Table n1 = 6.2, viable range of feedback strength for the Hes1 oscillator is 0 <K1 < 207.6. Zeiser et al. therefore used a quite small K1 (i.e. 10). Interestingly, we find that variation of the feedback strength (K1) has little effect on the oscillation period. Figure p2 in (29), for the parameter set in Table K1 = 0.1), and 10-fold weaker (K1 = 100). So in fact, constraining the oscillation period to be 120 mins can gives rise to many more suitable parameter sets other than one in Table It is easy to see that model 29) is just a special case of system model 9 is justE. coli controls the production of tryptophan amino acid inside the cell. Key molecular processes include transcription, translation and synthesis of tryptophan. To regulate these processes, the tryptophan operon utilises three negative feedback mechanisms: transcriptional repression, attenuation, and enzyme inhibition [The tryptophan operon system in hibition ,45.The transcription process is initiated as RNA polymerase binds to the promoter. However, when the activated form of repressor which is induced by the attachment of two tryptophan molecules become abundant, it will bind to the operator site and block RNA polymerase from binding to the promoter, thereby, repressing transcription and forming the first feedback loop. Furthermore, transcription can also be attenuated depending on the level of intracellular tryptophan and is controlled by the leader region sitting between the operator and the genes Figure . This atAnthranilate synthase (AS) is the enzyme catalysing the first reaction step in the tryptophan synthesis pathway. The pathway end product tryptophan is fedback to inhibit anthranilate synthase activity if tryptophan level is high. Enzyme inhibition therefore forms the third negative feedback loop in the tryptophan operon system.M), the AS enzyme (E) and the tryptophan amino acid (T). Each negative feedback loop is modelled using a Hill function; Ot is the static total operon concentration; k1, k2, k3 represent transcription rate, translation rate and tryptophan synthesis rate, respectively; kd1, kd2, kd3 are the degradation rates (aggregated parameters combining the decay rate and dilution rate due to cell growth). Consumption of tryptophan for protein synthesis is simply assumed to follow first order kinetics and represented by the last term of equation (30c). Parameter values are adapted from [We set up a simple three-species model for the tryptophan system as in equations (30). The state variables are the mRNA while fixing the other parameters. Under all these scenarios, system stability was always obtained. Given the nominal values of the synthetic and degradation rates, the system failed to demonstrate oscillations even at very high Hill coefficient values (> 50) and at weak or strong feedback loops. This suggests that the tryptophan system is extremely stable.It can be seen that model (30) is a case of the general multiple-looped kd1, kd2 and (kd3+g) are significantly different to each other as shown in Table kd1, kd2, kd3 and g so that kd1 ≈ kd2 ≈ kd3+g, oscillatory behaviour can now be observed at much lower Hill coefficient and at appropriate feedback strength of the loops. For example, setting kd1= kd2= kd3+g = 15 can give rise to oscillatory dynamics with n2, n3 as in Table n1 as low as 8.5.The highly stable property of the tryptophan system is probably underlined by the fact that it is regulated by multiple feedback loops in concert. In addition, the system's degradation rates Previous studies -19 have For single-loop systems where inhibition is fedback by the end-product on the first reaction step, i.e. the original Goodwin system, it was found that oscillatory behaviour is only obtainable if the feedback loop is sufficiently strong. Otherwise, the system is stable and achieves steady state. Switching between these dynamics occurs through a Hopf bifurcation. We derived an explicit, analytical form for the feedback strength's bifurcation point which can be straightforwardly computed if the other model parameters are known. Interestingly, this threshold strength was found to follow a saturation trend and approaches a critical level as the Hill coefficient increases. We further showed that this critical feedback strength equals the ratio of the product of the degradation rates and the product of the synthesis rates. So for a system with feedback strength weaker than this critical level, system stability is guaranteed regardless of how high the Hill coefficient is.Studying the two-parameter bifurcation diagram with the feedback strength and the Hill coefficient as parameters revealed that as the Hill coefficient is raised, sustained oscillation can be obtained over a wider range of feedback strength; suggesting that higher cooperativity level tends to enhance the probability of demonstrating sustained oscillations. This result is in line with previous results from Tyson & Othmer and GoldAssuming identical degradation rates, previous studies of the Goodwin system have identified a threshold value for the Hill coefficient lower than which, sustained oscillation is unachievable. Under this over-simplifying assumption, the threshold cooperativity level was found only dependent of the length of the system pathway. However, such a similar threshold Hill coefficient has not been analytically determined for systems with general, arbitrary degradation rates. We explicitly derived this threshold for the three and four-species systems, which turns out to be rather simple, symmetrical functions of only the degradation rates and are not influenced by the synthesis rates. More importantly, the threshold reaches its minimum when all the degradation rates are equal. The threshold Hill coefficient obtained under identical degradation rates, therefore, provides a lower bound for that of the general case. We further showed that for the systems with Hill coefficient exceeding the threshold value, it can always oscillate with a properly chosen set of parameters' values. In fact, the number of parameter sets giving rise to sustained oscillations is indefinite. For the systems with more species, the threshold Hill coefficient is also explicitly derivable; however, the form of the resulting function becomes significantly more complex. Nevertheless, the above results also apply for longer systems which we confirmed using numerical simulations.Parameter sensitivity analysis revealed interesting effects of parameters (the synthetic and degradation rates) variation on the dynamical characteristics of the system. Because of the symmetry in the expressions involving the threshold feedback strength and Hill coefficient, the individual model species equally characterise the system bifurcation profiles despite the fact that the feedback loop is only acting on the first reaction step. Specifically, increasing the synthesis rate of any model species by the same proportion results in a proportionally larger oscillatory region and hence in a system which is more likely to oscillate. In contrast to this simple linear relationship between the synthesis rates and the bifurcation profiles, the degradation rates affect system dynamics in a more intricate manner. We found that system stability is most likely when the model species are rapidly degraded while slow degradation only leads to stability if the feedback strength is significantly weak. We further showed that having comparable degradation rates between the model species promotes oscillations, whereas stability is promoted if one rate is significantly larger than another. This suggests a way to enhance system stability by unbalancing the degradation rates; preferably, towards high levels. These results are particularly helpful for the engineering of synthetic circuits with desirable dynamical behaviour, as well as for parameter estimation and optimisation.For single-loop systems, reallocation of the feedback loop to inhibit a reaction step further downstream may or may not make the system more stable. Interestingly, the specific effect is determined only by the degradation rates of the model species downstream of the newly inhibited species. The dynamical properties of the new system closely resemble those of the Goodwin system with reduced length, which equals to the number of species downstream of the inhibited species. Therefore, as the loop moves closer towards the end of the pathway, the minimum Hill coefficient for oscillation is reduced. In addition, we found that feedback reallocation does not influence the critical feedback strength discussed above. This means that for a system possessing a loop weaker than this strength, its stability is ensured regardless of the loop's position and the cooperativity level.It has been known that lengthening the system by increasing the number of reaction steps, i.e, increasing number of model species, reduces the cooperativity necessarily required for sustained oscillations ,19. The It has been known that the systems with two species are incapable of exhibiting sustained oscillations, regardless of the feedback strength and the Hill coefficient value ,15. Our at any Hill coefficient value. More specifically, end-product utilisation enhances sustained oscillation at low cooperativity level but enhances stability at high cooperativity level. It is important to note that raising the utilisation level does not always further these enhancements. In fact, there exists an intermediate rate for utilisation at which sustained oscillation is most likely to be detected, while being less likely at other utilisation rates.We also investigated the situation when the pathway's end-product is used up by the cells, which is common in many metabolic pathways. Most interestingly, we showed analytically that end-product utilisation enables oscillatory dynamics Since cellular systems are complex and often consist of multiple, interlocked feedback loops. Understanding of how the loops act together in giving rise to the system dynamics is absolutely crucial. Designs with interlinked positive and negative feedback loop have been shown to exhibit performance advantages over simple negative feedback loops, such as the ability to easily tune frequency of oscillators, improved robustness and reliability, even under noisy environments ,27,50. MFirst, coupled loops effectively enable oscillations at lower, more biologically plausible Hill coefficient value. For example, a four-species single loop Goodwin system requires the Hill coefficient (n1) to be at least 4 for oscillations. Its variant design with the loop reallocated to impose on the second pathway step requires the Hill coefficient (n2) to be at least 8 for oscillations. However, a system with both of these loops in effect can achieve oscillations at practically any Hill coefficient value for one loop, given proper choice of the Hill coefficient for the other loop. Oscillations, therefore, are possible at more biologically plausible Hill coefficients, for example at = or .Reduction of the Hill coefficient for oscillations is often only suggested via pathway lengthening by previous studies. In this study, loops coupling and end-product utilisation (discussed above) were shown as the two additional mechanisms where this reduction can be obtained without increasing the number of system variables.Secondly, coupled-loop systems were also shown to exhibit much greater complexity and more diverse behaviours compared to their single-loop counterparts. We showed that, by having just two loops performing cooperatively, the four-species system demonstrates a rich diversity of dynamical characteristics. For example, we detected a total of up to13 different bifurcation patterns between the feedback strengths. This enhancement in behavioral complexity and diversity might be the reason why evolution has driven some systems to acquire multiple feedback regulations as it will increase the chance of organisms' survival when facing fluctuating environments.Thirdly, we found that different combinations of feedback strengths of individual loops give rise to different dynamical regimes. For three species with double loops acting on the first and second steps, stability is most probable when a weak first loop is coupled with a strong second loop. Oscillations, on the other hand, are most likely if a weak second loop is coupled with a strong first loop. If oscillations are to be obtained with a strong first loop, the second loop must also be significantly strong.Fourthly, we found a threshold strength for the first loop. If the loop is weaker than this threshold, the system is always stable regardless of the strength of the second loop. This threshold strength turns out to be independent of the second loop's specification (its strength and cooperativity level). On the contrary, at any strength of the second loop, stable as well as oscillatory dynamics are obtainable given a proper choice of the first loop's strength. By further considering the coupled-loop system consisting of the loops on the first and the third reaction step, we discovered that the location of the additional loop has no influence on the threshold strength of the first feedback loop.Finally, examining the system with all three loops in action showed that incorporating the extra third loop always enhances system stability. The likelihood of having oscillatory behaviour is directly determined by the loops' strength: stronger loops always result in smaller oscillatory region.We demonstrate the practicality of our analysis by including a brief investigation of two example systems: the Hes1 oscillator and the Tryptophan operon system. The former system represents a single-loop system while the latter represents one with multiple negative feedback loops coupled together. Because of the abundant number of biological systems regulated by negative feedback loops (and many can be represented under simplifying assumptions by one of the motifs considered here) the methods developed in this study may prove useful in gaining better understanding of their dynamical behaviours.LKN devised the work, carried out the mathematical research and implemented the numerical simulations with guidance from DK. LKN and DK wrote the paper. Both authors have read and approved the final version of the manuscript.Supplementary Information. This file consists of three parts. Section 1 presents the mathematical derivations for the results involving the single-loop systems. Section 2 presents the mathematical derivations for the results involving the coupled-loop systems. Section 3 presents the mathematical derivations for the results involving the system with endproduct utilisation. Section 4 gives the explicit expressions of the coefficients of functions f and g discussed in the main text, and some intermediate derivation steps. The supplementary figure S1 is given in section 5.Click here for file

In the crystal, inversion dimers linked by two O—H⋯O hydrogen bonds arise from the carboxyl groups. N—H⋯O hydrogen bonds link the dimers into chains and short C—Cl⋯π and S—O⋯π contacts are also seen.In the title compound, C Å b = 5.3957 (2) Å c = 20.7565 (8) Å β = 91.483 (2)°V = 1311.47 (8) Å3 Z = 4 Kα radiationMo −1 μ = 0.46 mmT = 296 K 0.24 × 0.18 × 0.15 mm Bruker Kappa APEXII CCD diffractometerSADABS; Bruker, 2005T min = 0.939, T max = 0.940Absorption correction: multi-scan (14693 measured reflections3269 independent reflectionsI > 2σ(I)2513 reflections with R int = 0.029 R[F 2 > 2σ(F 2)] = 0.039 wR(F 2) = 0.108 S = 1.02 3269 reflections182 parametersH-atom parameters constrainedmax = 0.37 e Å−3 Δρmin = −0.36 e Å−3 Δρ APEX2 used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 for Windows (Farrugia, 1997PLATON (Spek, 2009WinGX (Farrugia, 1999PLATON.Data collection: 10.1107/S1600536809009787/hb2925sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809009787/hb2925Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The dihredral angles between the five- and six-membered rings are 5.50 (2) and 6.90 (2)° in the two molecules. The structure is stabilized by N—H⋯O and weak C—H⋯O hydrogen-bonding inter­actions between the cations and anions, resulting in chains propagating in [110].There are two 2-phenyl­imidazole cations and two acetate anions in the asymmetric unit of the title mol­ecular salt, C Å b = 11.0043 (7) Å c = 19.3936 (9) Å β = 97.982 (5)°V = 2120.2 (2) Å3 Z = 8 Kα radiationMo −1 μ = 0.09 mmT = 293 K 0.21 × 0.18 × 0.17 mm Oxford Diffraction Gemini R Ultra diffractometerCrysAlis RED; Oxford Diffraction, 2006T min = 0.57, T max = 0.81Absorption correction: multi-scan (9257 measured reflections4331 independent reflectionsI > 2 σ(I)2142 reflections with R int = 0.023 R[F 2 > 2σ(F 2)] = 0.041 wR(F 2) = 0.114 S = 0.82 4331 reflections272 parametersH-atom parameters constrainedmax = 0.17 e Å−3 Δρmin = −0.16 e Å−3 Δρ CrysAlis CCD used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536810004939/pv2258sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536810004939/pv2258Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

An intra­molecular O—H⋯O hydrogen bond generates an S(6) ring motif. The crystal packing is stabilized by inter­molecular C—H⋯O hydrogen bonds. Short intra­molecular Cl⋯O [2.8234 (8) Å] and O⋯O [2.5530 (11) Å], and inter­molecular Cl⋯Cl [3.2777 (3) Å] contacts further stabilize the crystal structure.The mol­ecule of the title compound, C Å b = 10.3104 (1) Å c = 16.8370 (2) Å β = 100.285 (1)°V = 1836.96 (3) Å3 Z = 8 Kα radiationMo −1 μ = 0.40 mmT = 100 K 0.30 × 0.21 × 0.14 mm Bruker SMART APEXII CCD area-detector diffractometerSADABS; Bruker, 2005T min = 0.891, T max = 0.945Absorption correction: multi-scan (17328 measured reflections4015 independent reflectionsI > 2σ(I)3356 reflections with R int = 0.031 R[F 2 > 2σ(F 2)] = 0.038 wR(F 2) = 0.109 S = 1.07 4015 reflections137 parametersH-atom parameters constrainedmax = 0.61 e Å−3 Δρmin = −0.35 e Å−3 Δρ APEX2 used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL software used to prepare material for publication: SHELXTL and PLATON (Spek, 2009Data collection: 10.1107/S1600536809010137/sj2597sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809010137/sj2597Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

A new strategy is proposed for identifying synergistic transcription factors by function conservation, leading to the identification of 51 homotypic transcription-factor combinations. Previous methods employed for the identification of synergistic transcription factors (TFs) are based on either TF enrichment from co-regulated genes or phylogenetic footprinting. Despite the success of these methods, both have limitations.We propose a new strategy to identify synergistic TFs by function conservation. Rather than aligning the regulatory sequences from orthologous genes and then identifying conserved TF binding sites (TFBSs) in the alignment, we developed computational approaches to implement the novel strategy. These methods include combinatorial TFBS enrichment utilizing distance constraints followed by enrichment of overlapping orthologous genes from human and mouse, whose regulatory sequences contain the enriched TFBS combinations. Subsequently, integration of function conservation from both TFBS and overlapping orthologous genes was achieved by correlation analyses. These techniques have been used for genome-wide promoter analyses, which have led to the identification of 51 homotypic TF combinations; the validity of these approaches has been exemplified by both known TF-TF interactions and function coherence analyses. We further provide computational evidence that our novel methods were able to identify synergistic TFs to a much greater extent than phylogenetic footprinting.Function conservation based on the concordance of combinatorial TFBS enrichment along with enrichment of overlapping orthologous genes has been proven to be a successful means for the identification of synergistic TFs. This approach avoids the limitations of phylogenetic footprinting as it does not depend upon sequence alignment. It utilizes existing gene annotation data, such as those available in GO, thus providing an alternative method for functional TF discovery and annotation. In eukaryotic organisms, transcriptional regulation of a gene's spatial, temporal, and expression level is generally mediated by multiple TFs [The expression of genes is regulated by transcription factors (TFs), which interact with the basic transcription machinery to activate or repress transcription after binding to TF binding sites -chip, and protein-protein interaction data. For this approach, the majority of studies analyzed gene expression data across a variety of experimental conditions to infer synergistic relationships between TFs -9. Statia priori knowledge, such as gene expression patterns in a certain tissue, which restricts synergistic TF determination to those tissues or cells studied and thus prevents the discovery of TF combinations from multiple biological conditions. Conversely, computational approaches can predict TF combinations on a large scale, but they usually lack the ability to functionally annotate synergistic TFs. Furthermore, methods based on phylogenetically conserved sequences, although they can greatly reduce the false prediction rate [Despite the success of these approaches, both have limitations. The approach based on experimental observation needs ion rate , have liIn the current study, rather than utilizing these traditional approaches, we propose a novel strategy to identify TF combinations by function conservation, which can be implemented at two levels. The first is functional conservation of TFs between species. Based on the strong possibility that each specific TF plays the same role in regulating gene expression between closely related species, the occurrence of its binding sites is expected to be more highly enriched in promoter sequences of orthologous genes than in promoter sequences of non-orthologous genes. The second is functional conservation of TFBSs between promoter sequences of individual orthologous genes. For identifying TF combinations, the general pattern of TFBS arrangement on promoters of orthologous genes is most likely more important than the precise positions of the binding sites . To applGenome-wide promoter analyses have led not only to the development of computational approaches but also to the identification of 51 homotypic TF combinations using known TFBSs from precompiled position weight matrices (PWMs) in the TRANSFAC database . As a fi® program and 234 unique PWMs from the professional TRANSFAC 9.1 database [LODco scores, which represent the frequency of co-occurrence for particular TFBSs in promoter sequences with respect to random expectation for the co-occurrence of the same TFBSs . The assumption behind this enrichment analysis is that random co-occurrence of TFBSs has less or no distance constraint when compared to functional TFBSs, although specific distance constraints may vary for different TFBSs. To incorporate functional conservation of TFs into the analysis, we estimated the degree of enrichment by using the hypergeometric distribution, which was represented as LODog scores, for overlapping human and mouse orthologous genes whose promoter sequences contained the enriched TFBS combinations.The overall analysis procedures are shown in Figure database . We thenLODco and LODog. We hypothesized that if the enriched TFBS combinations had functional significance, then the enrichment of common orthologous genes would correlate with the LODco scores from both human and mouse promoter sequences, since functional TFBSs are expected to be highly conserved between orthologous gene promoter sequences from closely related species. The degree of correlation would therefore allow us to identify combinatorial TFs that potentially regulated genes in a synergistic fashion. For the selection of significant correlations, we performed permutation tests to obtain p values, which were used to set up filtering criteria for multiple tests. Functional TF combinations were predicted based on p value cutoff threshold in both human and mouse and further validated by both known TF-TF interactions and function coherence based on Gene Ontology (GO) annotation of common mouse and human genes containing co-occurring TFBSs [The integration of function conservation from both levels was achieved by the estimation of correlation between ng TFBSs ,24.For the enrichment of functionally co-occurring TFBSs, we first employed 234 PWMs, which represent unique TFs in the TRANSFAC 9.1 database, to identify homotypic TFBS combinations . As one of the important components of the approach, a total of 18 between-TFBS distances were defined and used to obtain co-occurring TFBSs from individual promoter sequences. Enrichment of TFBS combinations was estimated on a genome-scale by comparing co-occurring TFBS frequencies in known promoter sequences to those from random background sequences.LODco score > 0 exemplifies a higher frequency of TFBSs per promoter sequence when compared to background sequences. Thus, the larger the LODco score, the greater the enrichment of a particular TFBS. The results show that the distributions of LODco scores obtained from orthologous human and mouse promoters have similar patterns. Whereas the distribution of LODco scores from the no distance constraint situation is significantly shifted in isolation to the left, LODco score distributions from distance constraints are shifted to the right along with the smaller between-TFBS distances. Similar results were also obtained for enrichment of common orthologous genes containing the identified TFBS combinations, as can be seen from the LODog distributions in Figure Figure LODco and LODog score distributions from individual distance constraints using Wilcoxon signed-rank tests. The results indicated that both median LODco and LODog scores from individual distance constraints were significantly larger than those from no distance constraint (p < 10-15), further confirming the enrichment of co-occurring TFBSs and of common orthologous genes. It is important to note that median LODco scores from individual distance constraints increase along with smaller between-TFBS distance , suggesting that MYOGENIN may not be a functional pair.To estimate the statistical significance of the correlations, we performed permutation tests using randomly paired a Figure . This isd Figure , with bod Figure , resulti® professional version 10.4 to determine if known TF combinations were statistically enriched in the 51 identified TFs [® database contains approximately 180 experimentally proven composite elements of two or more binding sites; of these approximately 180 composite elements, 15 are synergistic combinations of homotypic TFs. Interestingly, 7 of these known combinations are in the 51 selected TFs, including CEBPB, CREB, E2F1, HNF1, HNF3B, OCT1, and PIT. To estimate the degree of enrichment, we performed a Fisher's exact test comparing the occurrence of known TF combinations in the 51 identified TFs to all 234 TFs. The results indicated that known TF combinations were significantly enriched in the 51 selected TFs (p = 0.035) compared to those TFs that did not meet the selection criterion (p = 0.59). These results indicated that our approach was able to identify to a great extent functionally co-occurring TFs, which exemplifies the validity of our methods.To assess the validity of the predicted TF combinations, we first used TRANSCompelfied TFs . The TRAIt is a well-established fact that TFs control cellular biological processes by targeting groups of genes encoding proteins with similar functions. Based on this fact, we performed function coherence analyses to determine if genes whose promoter sequences contained the co-occurring TFBSs had known biological functions associated with the TF predicted to bind to them. Two of the 51 selected TFs, namely E2F1 and NFAT, are of particular interest, as the genes that they regulate have well established physiological roles by previous studies. E2F1 regulates cell cycle progression via transcriptional regulation of proliferation-associated and cell cycle-related genes -28, whilp values from Fisher's exact tests are listed from eight distance constraints. These results indicate that identified genes with co-occurring E2F1 binding sites are involved in cell cycle control, sterol metabolism, and nucleotide and nucleic acid metabolism; notably, the biological process of cell cycle is over-represented at most distance constraints tested. In the case of NFAT, major over-represented biological functions include homophilic cell adhesion and immune response. As mentioned above, immune response is directly controlled by NFAT transcription factor. Overall, these results provide strong evidence for the functional co-occurrence of the identified TFs, and again exemplify the validity of our novel approaches.Accordingly, we examined the functional association of genes with predicted synergistic TFBSs by looking for similar enriched GO biological process categories in overlapping human and mouse orthologous genes. This was done by first identifying the statistically over-represented GO biological process categories for genes whose promoter sequences contained the co-occurring TFBSs by DAVID , followeAs mentioned above, it is well known that TFs control cellular biological processes via transcriptional regulation of groups of genes with similar functions. The roles of a particular TF in cellular processes can, therefore, be deduced from the known physiological functions of the TF's target genes.LODco and LODog scores from the 51 identified TFs. Accordingly, 10,000 random correlations were computed for each distance constraint using permuted LODco and LODog scores from the 51 TFs and used to estimate the statistical significance for real correlations. Correlations from human promoter analyses displayed significance for between-TFBS distances of 20 bp up to 90 bp, with p values ranging from 0.044 to 0.006 . In some genes, such as the TSPAN14 and FBN2 genes, E2F1 binding sites are in exactly the same position on mouse and human promoters, while in other genes, such as the E2F1 and YY1 genes, the TFBS pairs are in vastly different locations. We thus hypothesize that it is very unlikely that traditional approaches like phylogenetic footprinting could identify all of these putative synergistic TF interactions. To test this hypothesis, we used the rVista program to perform phylogenetic footprinting to search for conserved binding sites between human and mouse promoter sequences for all genes [STAG1 [YY1 [CDCA7L [RNF167 [FBN2 [NULP1 [DTNB [MYBL2 [E2F1 [E2F1, STAG1, YY1, CDCA7L, and NULP1 genes.Detailed analysis of identified E2F1 binding sites exemplifies this point; Figure ll genes . Notablys [STAG1 , YY1 [58B [MYBL2 , and E2FL2 [E2F1 ,60. PhylACVR1 gene with two E2F1 binding site clusters containing a total of five putative binding sites, which show a similar arrangement between orthologous genes but are located at different positions on the promoter. A closer examination demonstrates that these two clusters are highly conserved in regards to both nucleotide sequence and spacing between each binding site within each cluster ,60. Sequr Figure , suggestp values from 5 × 10-4 to 6 × 10-34 with q-value < 0.001) and obtained the corresponding promoters algorithm ; the latUsing these human gene promoters with combinatorial E2F1 binding sites , we next assessed the sensitivity and specificity for detecting synergistic E2F1 combinations by function conservation and phylogenetic footprinting. In this analysis, real promoters were used as true positives and the corresponding randomized promoters with shuffled nucleotides as true negatives. Sensitivity was defined as the proportion of true positives over combined true positives and false negatives, and specificity as the proportion of true negatives over combined true negatives and false positives, the latter being the fraction of randomized promoters that were identified to have synergistic E2F1 combinations. We applied our function conservation, phylogenetic footprinting (using rVista), and EEL to the selected human and their corresponding mouse orthologous gene promoters. Results indicated that our function conservation approach had much higher sensitivity (approximately ten-fold) than phylogenetic footprinting for all distance constraints tested, as shown in Table Results of this analysis further indicated that the EEL algorithm was able to detect conserved pairs or clusters of E2F1 sites in only 9 of the 575 target human promoters, demonstrating a much lower sensitivity (1.6%) than our function conservation approach. It is interesting to note that EEL detected multiple single E2F1 sites in many target human promoters. Although these E2F1 sites may not be conserved ones based on the underlying premise of the EEL algorithm, we nonetheless manually calculated all possible combinations of E2F1 sites for each target promoter. The overestimated positive rates are listed in Table LODco and LODog scores for these TF combinations had similar distributions to those from homotypic TF combinations, ranging from -0.96 to 0.99 for human and from -0.94 to 0.99 for mouse (data not shown). Statistical significance of the correlations estimated from permutation tests indicated that the number of significant TF combinations was overwhelming, even when a highly stringent cutoff threshold was applied . Nevertheless, we selected 78 heterotypic TF combinations that passed the cutoff threshold and also had high correlations in both human and mouse (R > 0.85) for further TF interaction analysis. We felt that this combination of using a low q-value along with a high correlation coefficient would allow us to minimize false positive predictions.In an effort to expand our analyses to a more complex, perhaps more physiologically relevant situation, we applied our novel approaches to identify potential heterotypic TF combinations using the selected 51 TFs; a total of 1,275 TF combinations was considered. Correlations between As shown in Figure The identification of combinatorial TFs and the elucidation of relationships among them are of great importance for understanding transcriptional regulation as well as TF networks. Previous approaches employed for the identification of functional TF combinations are based on either TFBS enrichment from co-regulated genes or phylogenetic footprinting. Although both approaches have proven to be successful, they each have limitations. To explore alternative approaches, we propose a new strategy to look for synergistic TFs by function conservation, which was implemented from functional conservation of TFs between species and corresponding TFBSs between orthologous genes.Although prior to our study there had not been a genome-wide function-based approach for the prediction of combinatorial TFs, several previous studies employed distance constraints to help identify interacting TFs ,16,61, iThe enrichment of functional TFBSs plays an important role in the integration of function conservation from different levels by correlation analyses, as the functional conservation of TFs is based on genes whose promoter sequences contain over-represented binding sites. In this study, TFBS enrichment was achieved by first obtaining all potential TFBSs on a genome-scale, followed by searching for TFBS combinations by using distance constraints. Although this method was successful, other methods can also be used as long as they are able to identify over-represented TFBSs or reliably distinguish functional from non-functional TFBSs. Therefore, the strategy of function conservation is not limited to synergistic TF discovery, but is applicable to single TFs and even transcriptional regulatory modules.LODco score trends would contribute more to functional TFBS identification, when compared to a small number of TFBS enrichments identified by other methods. The validity of using distance constraints for enriching TFBS combinations was demonstrated not only by our study, in which the LODco scores from no distance constraint were significantly smaller than those with distance constraints (p < 10-15), but also previous studies by other authors [The distinct advantage of using distance constraints for enrichment of TFBSs is that it not only provided a simple means for enriching functional TFBS combinations for a large number of genes, but it also allowed us to compute correlation with many enrichment results. The latter is especially important, as a large number of TFBS enrichments with changing authors ,16.LODco and LODog scores for individual distance constraints. We reasoned that an optimal distance constraint is most likely to have not only a significantly large correlation but also a higher correlation than those from its two adjacent distance constraints. Interestingly, although LODog and LODco scores displayed general patterns of increasing correlations along with smaller between-TFBS distance (data not shown), none of these correlations were statistically significant (p > 0.3), based on random correlations from 10,000 permuted LODco and LODog scores from the same distance constraint. Although no optimal distance constraints were found for all TFBSs, we noticed that correlations between TFBS enrichment and common orthologous gene enrichment from those 51 selected TFBS combinations displayed significance for some, but not all, distance constraints and mouse were extracted from DBTSS and used for TFBS detection with the repeat sequences unmasked.® program [To perform the measurement for significant co-occurrence of TFBSs, an appropriate randomly generated background model is necessary. A Perl script was written to shuffle the DNA sequences within each promoter to create background sequences that have the same nucleotide content as the original promoter sequences. These background sequences are preferable to using intergenic sequences, which usually are AT-rich or exonic sequences whose nucleotide distributions tend to be biased. The resulting two sets of shuffled sequences from human and mouse, together with the original two sets of promoter sequences, were used for TFBS detection. To provide important information for estimating statistical significance for single gene pairwise comparisons, multiple shuffled sequences as background are usually employed. In our case, however, multiple sets of shuffled promoter sequences as background are not necessary, since no direct pairwise gene comparisons were performed; instead, comparisons were performed on a genome-scale using all shuffled sequences as background. The Match program , for whiThe co-occurrence of TFBSs was defined as two or more binding sites in the same promoter, which can be TFBSs either from the same PWM or from two PWMs. For combinatorial TFBS enrichment, distance constraints were first applied for the selection of co-occurring TFBSs with a certain defined maximum between-TFBS distance, which is the largest number of nucleotides allowed between the end of the first TFBS and the start of the next TFBS. In the case of two PWMs, the distance constraints were applied to TFBSs from 2 different PWMs but not from an identical PWM, and the number of TFBS from each individual PWM may vary. To prevent double counting of TFBSs, two overlapping matches for the same PWM were considered as a single match and the one closer to the next co-occurring TFBS was counted. A total of 18 distances were defined, ranging from the smallest 10 bp to the largest 900 bp, for which 10 bp increments were used for those with distance constraints of less than 100 bp and 100 bp increments for those with distance constraints of more than 100 bp. The counts of co-occurring TFBSs from distance constraints with smaller between-TFBS distances were also included in those with larger between-TFBS distances. The occurrence of TFBSs without a distance constraint was also computed, but overlapping TFBSs were counted only once. All calculations were separately computed using in-house developed Perl scripts .LOD) was used to measure TFBS enrichment, which is the frequency of co-occurrence for a particular TFBS in real promoter sequences with respect to random expectation for the co-occurrence of the same TFBS from one corresponding set of shuffled promoter sequences:The log odds ratio (fr(#TFBS/#promoters) is the TFBS frequency per gene from real promoter sequences, and fs(#TFBS/#promoters) is the frequency from shuffled promoter sequences.Where p value for the between species enrichment of overlapping orthologous genes, which contained the same TFBS combinations from the same enforced distance constraint in both human and mouse, was computed using a hypergeometric distribution:For enrichment analyses of overlapping orthologous genes, genes whose promoter sequences contain at least two co-occurring TFBSs were obtained from both human and mouse. The S1 and S2 are the numbers of genes whose promoters possess the co-occurring TFBSs from either mouse or human, respectively; N is the total number of orthologous gene pairs used in this study ; and c is the number of common orthologous genes between S1 and S2. The resulting p value is the chance probability of observing c or more common orthologous genes from two sets of size S1 and S2 drawn from a set of N gene pairs. The enrichment analyses of overlapping orthologous genes were performed for both original and shuffled promoter sequences. The latter, as described below, was obtained for the purpose of normalization.Where p values of overlapping orthologous gene enrichment from original promoter sequences were first (-)log transformed and then normalized with the corresponding (-)log transformed p values from shuffled promoter sequences. To have a similar scale as LODco, the LOD for overlapping orthologous gene enrichment was computed as follows:For computing the correlation between the TFBS enrichment utilizing distance constraints and the overlapping orthologous gene enrichment, the LODco and their corresponding LODog scores for each TFBS combination, and permutation tests were employed to estimate the statistical significance of the correlation. To perform the permutation tests, the 19 LODco and their corresponding LODog scores from each TFBS combination were randomly paired and used for random correlation computation. The procedures were repeated 10,000 times to reach a random distribution and to give sufficient power for the estimation of p values. The resulting p values were used to set up a cutoff threshold for the selection of the most statistically significant correlation from multiple analyses.Pearson correlation coefficients were employed to estimate the correlation between the 19 LOD, log odds ratio; PWM, position weight matrices; TF, transcription factor; TFBS, transcription factor binding site.DBTSS, Database of Transcriptional Start Sites; EEL, enhancer element locator; GO, Gene Ontology; ZH initiated and designed the study, conceived the methodology, carried out data analysis, and wrote the manuscript. BH performed the GO analysis and helped write Perl scripts. JFC participated in data analysis and writing of the manuscript. All authors read and approved the final manuscript.The following additional data are available with the online version of this paper. Additional data file Promoter sequences of 1,591 human genes from with at Click here for filePromoter sequences of 575 human genes from with at Click here for filePromoter sequences within 1 kb upstream of the annotated TSS for the 10,046 human genes.Click here for filePromoter sequences within 1 kb upstream of the annotated TSS for the 10,046 mouse genes.Click here for fileMatrix ID in the TRANSFAC database for the 234 PWMs used in this study.Click here for filePERL scripts for computing TFBS combinations by distance constraints.Click here for file

Protection against clinical malaria episodes is acquired slowly after frequent exposure to malaria parasites. This is reflected by a decrease with increasing age in both parasite density and incidence of clinical episodes. In many settings of stable malaria transmission, the presence of asymptomatic malaria parasite carriers is common and the definition of clinical malaria remains uncertain.Between February 2002 and April 2003, a country-wide malaria survey was conducted in 24 districts of Mozambique, aiming to characterize the malaria transmission intensities and to estimate the proportion of fever cases attributable to malaria infections in order to establish the malaria case definition. A total of 8,816 children less than ten years of age were selected for the study. Axillary temperature was measured in all participating subjects and finger prick blood collections were taken to prepare thick and thin films for identification of parasite species and determination of parasite density. The proportion of fever cases attributable to malaria infection was estimated using a logistic regression of the fever on a monotonic function of the parasite density and, using bootstrap facilities, bootstrapped estimated confidence intervals, as well as the sensitivity and specificity for different parasite density cut-offs were produced.Plasmodium falciparum was 52.4% . The prevalence of fever (axillary temperature ≥ 37.5°C) was 9.4% . Fever episodes peaked among children below 12 months of life [15.1% ]. The lowest fever prevalence of 5.9% was recorded amongst children between five and seven years of age. Among 4,098 parasitized children, 498/4,098 (13.02%) had fever. The prevalence of malaria infections associated with fever peaked among children in the less than twelve months age group and thereafter decreased rapidly with increasing age (p < 0.001). High parasite densities were significantly associated with fever (p < 0.04).Overall, the prevalence of The proportion of fever attributed to malaria was 37.8% (95% CI 32.9% – 42.7%). An age-specific pattern was observed with significant variations across different regions in the country. In general, among children less than 12 months of life, the proportion of fever attributed to malaria infection was 43.5% (95% CI 25.8% – 61.2%), in children aged between 12 and 59 months of age was 39.6% (95% CI 30.3% – 48.9%), and among children aged between 5 and 10 years old was 21.5% (95% CI 11.6% – 31.4%).This study confirms that malaria remains a major cause of febrile illness during childhood. It also defines the relation between parasite density and fever and how this varies with age and region. This may help guide case definition for clinical trials of preventive tools, as well as provide definitions that may improve the precision of measurement of the burden of disease. In many malaria endemic regions, children acquire clinical immunity to malaria, and develop anti-parasitic mechanisms during the first few years of life consequent to repetitive exposures . Thus, aet al [The concept of "pyrogenic threshold" has been proposed for defining malaria episode in endemic areas -9. The oet al proposedet al . In addiIn Mozambique, malaria remains one of the main causes of febrile illness among children. Transmission is perennial with regional variations throughout the country. The incidence of clinical malaria established through weekly active case detection suggests that the risk of clinical malaria is highest between the age of one and three years when children experience an average of more than two episodes per year. Based on a continuous demographic surveillance system and verbal autopsies carried out in Manhiça district, the risk of clinical malaria drops sharply after the age of six .Early diagnosis and prompt treatment of cases, especially in children represent the keystone strategy aiming at reducing the burden of malaria-related morbidity and mortality. However, in most rural areas, diagnosis of clinical malaria is rather presumptive based on fever or history of fever, though a positive blood film is required to confirm the diagnosis in areas where laboratory facilities exist.This paper reports the results of a national malaria survey, carried out in Mozambique, in which the prevalence and the intensity of malaria infections, the establishment of malaria case definition and its relation to age strata across the country were determined.Plasmodium falciparum infections, fever, and malaria parasite infection associated with fever were estimated in each age group for each region and stratum.A detailed description of the methods used in this survey is presented in a companion paper . Brieflyet al [logit(πi) = α + β(xi)τ, and represents a logistic regression model where πI is the probability that observation i with parasite density xi is a fever case. β(xi)t corresponds to model type 3 described by Smith et al and is a monotonic function which is more flexible than the regression on xi or log(xi). The models were fitted using maximum likelihood. To constrain the parameter τ to be positive, the maximum likelihood were estimated for the log(τ). Confidence intervals for the estimated attributable fraction, the τ parameter, the sensitivity and specificity were obtained using the bootstrap methodology [Using the method proposed by Smith et al , the atthodology . AnalysiP. falciparum infections accounted for 5.7% , but, among febrile children, 72.4% (554/766) were infected. The prevalence of malaria infection associated with fever peaked among children during the first year of life and thereafter decreased sharply with increasing age, and the differences among age groups were statistically significant (p < 0.001).Overall, fever prevalence (axillary temperature ≥ 37.5°C) among children was 9.4% 766/8,816). Table 6. Table P. falciparum parasite densities were significantly associated with fever (p < 0.05) Table . AccordiThe model define malaria case as any case with at least one parasite, hence sensitivity of parasite density cut-off of one parasite or more will be always 100%. Table After adjusting for region, the fever proportion attributable to malaria was 36.5%, decreasing from the northern to the southern region, the differences were statistically significant (p < 0.05). When adjusted for stratum the attributable fraction of fever was 38.1%, but without significant variations across strata. When adjusted for age group and region the attributable fraction of fever dropped to 36.1% and the differences observed among regions and age groups were statistically significant (p < 0.05). When adjusted for age group, region and stratum there were no differences statistically significant across strata, however, across regions there were differences statistically significant (p < 0.05).The proportion of fever attributable to malaria infection among children less than 12 months of life was 43.5% (95% CI 25.8% – 61.2%) , representing the proportion of febrile morbidity that would have been removed if malaria infections were eliminated among children in various settings in the study area. On the other hand, the results of this study highlighted the importance of other fever episodes not attributed to malaria infections in the study area.In many malaria endemic areas, the burden of disease, a definition based on fever or reported episode of fever within the previous 48 hours in the presence of any level of parasitaemia, would result in an over-diagnosis of malaria cases. This study was conducted during high malaria transmission season, nevertheless, among febrile children approximately one third did not have malaria parasites. This finding has significant implications on the treatment policy, particularly in rural areas where in the absence of laboratorial diagnosis, all febrile cases would be considered as clinical malaria episodes. Moreover, even among febrile parasitized children, the proportion attributable to malaria infection was less than 40%.The association between malaria infection and body temperature varies significantly among children. Despite, that the definition of clinical malaria have been related to fever episode and presence of parasites in the blood stream, in endemic-malaria areas, manifestations of clinical malaria have a wide spectrum and the P. falciparum infections were observed. Additionally, the risk of fever among parasitized children was age-dependent, and increased with increasing mean parasite density.In the study area, the majority of parasitized children were asymptomatic carriers, and not all fever episodes were associated with malaria parasites, hence very few fever episodes associated with asexual In the study area, the overall proportion of fever cases attributable to the presence of malaria infection, when adjusted for age showed significant variations. Among younger children, it was 43.5% and decreased with increasing age to reach a low of 21.5% among older children. Therefore, the proportion of fever cases attributed to parasitaemia, the sensitivity and specificity of clinical malaria definition was age-specific. Consequently, among children exposed to malaria infection, the outcome or the risk of developing fever as a clinical manifestation of malaria infection, decreased with increasing age. These findings corroborate with results from other studies carried out in highly endemic areas [Regional variations on the proportion of fever attributable to malaria infection among children have been reported from other community-based surveys in endemic-malaria areas , highligThe case definitions derived from this survey, have shown the relationship between parasite density and fever and how this varies with age and region. This may help guide case definition for clinical trials of preventive tools, as well as provide definitions that may improve the precision of burden of disease assessment.This study confirms that malaria infection remains a major cause of febrile illness during childhood. However, other causes of fever should be considered in case management of febrile illnesses during childhood.The authors declare that they have no competing interests.SM made a substantial contribution on conception and design of the study, coordinated and supervised data collection in all regions, interpretation of data, performed all statistical analysis and wrote the manuscript. JA gave a major contribution on data interpretation and statistical analysis and helped to draft and revised the manuscript. AT helped to draft, gave contribution and critically revised the manuscript. PA gave a major contribution on conception and study design and helped to draft and critically revised the manuscript. All authors read and approved the final manuscript.

Femoral impaction grafting requires vigorous impaction to obtain adequate stability without risk of fracture, but the force of impaction has not been determined. We determined this threshold force in a preliminary study using animal femurs.Adult sow femurs were used because of their morphological similarity to human femurs in revision hip arthroplasty. 35 sow femurs were impacted with morselized bone chips and an increasing force was applied until the femur fractured. This allowed a threshold force to be established. 5 other femurs were impacted to this force and an Exeter stem was cemented into the neomedullary canal. A 28-mm Exeter head was attached and loaded by direct contact with a hydraulic testing machine. Axial cyclic loading was performed and the position sensor of the hydraulic testing machine measured the prosthetic head subsidence.29 tests were completed successfully. The threshold force was found to be 4 kN. There was no statistically significant correlation between the load at fracture and the cortex-to-canal ratio or the bone mineral density. Following impaction with a maximum force of 4 kN, the average axial subsidence was 0.28 mm.We achieved a stable construct without fracture. Further studies using human cadaveric femurs should be done to determine the threshold force required for femoral impaction grafting in revision hip surgery. The use of impaction grafting in total hip arthroplasty was first introduced by Evidence of revascularization, retrabeculation, and recorticalization of impacted allograft has been shown using bone scintigraphies and radiResults to date are promising, with improvement in hip and pain scores and radiological signs of retrabeculation . HoweverIn this preliminary study, we determined the threshold force required for impaction grafting of the femoral component in an animal femur. Factors such as femoral cortical defects, cortex-to-canal diameter, and bone mineral density (BMD), which have been associated with fracture , were stAfter examination of several kinds of animal femurs, adult sow femurs were selected. The femurs were sealed in plastic and stored in a freezer at –20ºC. Before testing, they were thawed in a refrigerator at 4ºC for 24 h. The femurs were stripped of soft tissue and the heads were excised and the neck trimmed, as for a hip replacement. The femoral canal was cleared, leaving only the cortical shell, and the condyles excised. The Gruen zones were marked on each femur before being placed through a DEXA scanner. Each femur was scanned twice and the average BMD overall and for each Gruen zone was determined.The distal part of the femur was held upright in a cement base. Strain gauges were applied as outlined by The excised femoral heads and femoral condyles were used to obtain bone grafts. A force was gradually applied in the Instron until 1.5 kN was reached. An impact force was then applied using the hydraulic testing machine by first setting the machine at a frequency of 5 Hz with Haversian square wave form. An increasing force of 0.5 kN was then applied and recorded until the femur fractured or the second mark on the impactor was in line with the cut of the neck. If the femur did not fracture then, more bone chips were added and the impaction process was repeated until the femur fractured. The graft in the femoral canal was then inspected and the level was noted to be distal or proximal to the base of the lesser trochanter, where the strain gauges had been applied. The strain gauges gave measurements for the strain at the bone surface during impaction. Using callipers, the cortical thickness of the bone was measured along the fracture line.To estimate the force applied in the clinical setting, the Exeter slap hammer was placed directly on the load cell of the biaxial hydraulic fatigue testing machine and the maximum load obtained from manual use by the authors was noted .Once the threshold force was determined, 5 femurs were impacted to the threshold force and an Exeter 37.5-mm offset size-1 stem was cemented into the neomedullary canal and a 28-mm Exeter head attached. Each femur was cemented at its base with an abduction angle of 7 degrees and a flexion angle of 15 degrees, which is the natural alignment of the proximal human femur. The femur was then loaded through the 28-mm femoral head by direct contact with the hydraulic fatigue testing machine .3 cycles at a frequency of 3 Hz. The position sensor of the hydraulic testing machine measured the axial displacement of the femoral head. The initial loading of the implant to 880 N was not recorded. Subsidence was defined as the difference between the first and last cycle under 440 N load.Axial cyclic loading was performed between 440 N (swing phase of gait) and 1,320 N (stance phase of gait) for 150 Regression techniques were applied to determine whether a correlation existed between the force applied and calculated bone surface strain levels, cortical thickness, canal diameter, and bone density.35 femurs were marked, scanned, and tested. For 2 femurs, the strain gauges failed during testing and they were excluded. A fracture occurred on removing the proximal impactor in 3 femurs and a fracture was noted at the early stages of testing in another femur before impaction grafting was started. As a result, the testing was complete and successful for 29 femurs .The threshold force was found to be 4 kN, i.e. all femurs fractured at a greater load. This threshold force was similar to the maximum force obtained when the slap hammer was impacted on the load cell directly, which was 3.5 kN .The bone surface strain at failure ranged between 1,040 and 15,800 microstrain. There was no correlation between the load applied and the resulting strain. In 20 femurs, where the level of the bone graft was proximal to the base of the lesser trochanter, the average strain at fracture was 6,246 microstrain. For the remaining 9 femurs where the bone graft was distal to the lesser trochanter, the average strain at fracture was 2,459 microstrain. The maximum strain at failure was noted from the strain gauge positioned medially in 19 femurs and from the lateral strain gauge for the remaining 10 femurs. The position of the fracture varied, but most often occurred on the medial aspect of the proximal femur. In 19 femurs, the maximum strain was recorded from the strain gauge at or closest to the fracture.The average cortical thickness at the level of the strain gauge where the fracture occurred was 3.9 (3–5.3) mm. The mean canal diameter was 24 (18–28) mm and the mean cortex-to-canal ratio was 0.16 (0.12–0.22). There was no statistically significant correlation between the load at fracture and these parameters.2. However, there was a slight variation in the length of the femurs so the average BMD was calculated for the femoral length excluding Gruen zone 4. This average BMD was 1.22 (0.96–1.5) g/cm2. There was no statistically significant correlation between the average BMD and the load of fracture or between the BMD for each Gruen zone and the load (r2 = 0.0031). An r2 of > 0.7 is required for the correlation to be statistically significant.The average BMD was 1.16 (0.92–1.44) g/cm3 cycles at a frequency of 3 Hz was 0.28 (0.24–0.33) mm mm .The high risk of fracture during femoral impaction grafting is of some concern. Our experimental animal study was designed to determine the threshold force until fracture for femoral impaction grafting. We selected adult sow femurs as they lack trabecular bone between the lesser trochanter and femoral condyles, and have a wide femoral canal with a thin cortex . These cThe thinnest part of the cortex for the femurs tested was 3.2 mm on average, but there were no cortical defects. In revision hip surgery, large cortical defects of the femur can be encountered. Thus, although the threshold force of 4 kN is similar to that obtained from direct impaction with the Exeter slap hammer on the load cell (3.5 kN), this is unlikely to be obtained in the clinical situation—and if it was reached, the risk of fracture would probably be high. In revision surgery, cages, meshes, cerclage wires, or strut grafts are used to reinforce a thin or absent cortex. This was not considered in our animal study, as no cortical defects were encountered.Another limitation of our study is that the bone had to be stripped of soft tissue and was fixed and potted in cement, resulting in an aphysiological set-up. During revision hip arthroplasty, the femur is embedded in soft tissues and is not in a fixed stable position. Therefore, the forces obtained in our animal study may never be reached clinically. Thus, the methods we used are inappropriate in some respects but we attempted to put some boundaries on the forces applied in femoral impaction grafting to reduce the risk of fracture.We expected the bone mineral density, cortical thickness, and canal diameter to be correlated to the load but this was not found. The reason for this is that failure most likely occurs from some isolated defect in the bone cortex rather than being due to a low overall density. We used callipers to measure the cortical thickness along the fracture line. For femurs where the maximum resultant strain was not at the fracture site, the cortex was cut and the thickness measured. The canal diameter was measured from the images obtained from the DEXA scan, and in retrospect plain radiographs should have been used to obtain more accurate measurements of both cortical thickness and canal diameter.3 cycles at a frequency of 3 Hz, which would simulate the first 2 months of load bearing.The initial stability is of paramount importance in femoral impaction grafting. Inadequate impaction of the bone chips is a possible reason for early massive subsidence . The mecIn conclusion, a threshold force of 4 kN was determined in this preliminary study. Minimal axial subsidence of the implant occurred when impacting the graft with this threshold force. We therefore achieved a stable construct without fracture. We have started further studies in human cadaveric femurs using radiographs to measure the canal diameter and cortical thickness, in order to determine the threshold force required in femoral impaction grafting in revision hip surgery.

Stavudine continues to be widely used in resource poor settings despite its toxicity. Our objective was to determine association between plasma stavudine concentrations and lipoatrophy, concentrations of glucose, lactate and triglycerides.Participants were enrolled in a cross-sectional study with lipoatrophy assessment, oral glucose tolerance test, fasting triglycerides, finger prick lactate, and stavudine concentrations. Individual predictions of the area under the concentration curve (AUC) were obtained using a population pharmacokinetic approach. Logistic regression models were fitted to assess the association between stavudine geometric mean ratio > 1 and impaired fasting glucose, impaired glucose tolerance, hyperlactataemia, hypertriglyceridaemia, and lipoatrophy.2 and 0.85 respectively. The median duration on stavudine treatment was 14.5 months. The prevalence of lipoatrophy, impaired fasting glucose, impaired glucose tolerance, hyperlactataemia, and hypertriglyceridaemia were 34%, 19%, 4%, 32%, and 23% respectively. Estimated median (interquartile range) stavudine AUC was 2191 (1957 to 2712) ng*h/mL. Twenty two participants had stavudine geometric mean ratio >1. Univariate logistic regression analysis showed no association between stavudine geometric mean ratio >1 and impaired fasting glucose (odds ratio (OR) 2.00, 95% CI 0.44 to 9.19), impaired glucose tolerance , hyperlactataemia , hypertriglyceridaemia , and lipoatrophy .There were 47 study participants with a median age of 34 years and 83% were women. The median body mass index and waist:hip ratio was 24.5 kg/mThere was a high prevalence of metabolic complications of stavudine, but these were not associated with plasma stavudine concentrations. Until there is universal access to safer antiretroviral drugs, there is a need for further studies examining the pathogenesis of stavudine-associated toxicities. Stavudine is no longer recommended as part of first line combination antiretroviral therapy (ART) because of a high cumulative risk of toxicity, notably symptomatic hyperlactataemia/lactic acidosis, lipoatrophy, and peripheral neuropathy ,2. In adIn 2006, WHO recommended reduced doses of stavudine following the findings of a systematic review that lower doses caused less toxicity without reducing efficacy ,5. Most,We investigated whether there was an association between stavudine plasma concentrations and lipoatrophy or concentrations of glucose, lactate and triglyceride in a population where stavudine use is likely to be widespread in the medium term: African HIV-infected adults.We conducted a prospective cross sectional study between February 2007 and January 2008. Ambulatory HIV-infected African black adults who presented for a routine follow up visit at public sector antiretroviral clinics in Cape Town were recruited by convenient sampling. Participants were eligible if they were on stavudine-based therapy for a minimum of 6 months. Participants with renal or hepatic disease, active opportunistic infections, known diabetes or dyslipidaemia, or self-reported non-adherence were excluded. All participants gave informed consent. The University of Cape Town research ethics committee approved the study.® lactate meter . Hyperlactataemia was defined as a lactate concentration greater or equal to 2.5 mmol/L.Participants fasted overnight and underwent an oral glucose tolerance test (OGTT). Impaired fasting glucose (IFG), impaired glucose tolerance (IGT) and diabetes were defined according to the American Diabetes Association criteria . FastingLipoatrophy was determined by self-reported peripheral fat loss using a validated questionnaire . LipoatrSelf reported adherence was determined using a standard 4-day adherence questionnaire administered by trained field workers . We reviWe measured plasma stavudine concentrations at 0, 30, and 120 minutes of the OGTT. We collected the blood samples using heparinised tubes that were immediately placed on ice until centrifugation within 4 hours, and then kept in a minus 80°C freezer until analysis. Stavudine was assayed by liquid chromatography tandem mass spectrometry using a validated method on an API 4000 mass spectrometer. The mobile phase consisted of gradient of acetonitrile and 0.5% glacial acetic acid. Chromatography was performed on a Phenomonex Synergi fusion C18 column maintained at 25°C. Reserpine was used as an internal standard. 50 μL of each sample was precipitated with acetonitrile containing the internal standard, centrifuged and 5 μL of the supernatant injected onto the column. Standard curves in the range 0.02 - 6 μg/mL and appropriate quality control samples were run with each batch. The lower limit of quantification was 20 ng/mL. Inter- and intra-day coefficients of variation were below 9% for all quality control samples.® . Given the sparse data (1-3 observations per participant), a model developed using rich stavudine concentration data from a separate study our group has conducted of African adults from the same community was used [3/4 (between subject variability 17%CV), apparent volume of distribution 33.5 L/kg, first-order absorption rate constant 11.1/h (between subject variability 125%CV), absorption lag time 0.41 h, proportional residual variability 27% and additive residual variability 10 ng/mL. Individual pharmacokinetic parameter sets were then obtained using Bayesian estimation given these model parameters and the observed data. The geometric mean ratio (GMR) was calculated by comparing the individual log-transformed AUC to the mean log-transformed AUC of the overall population.The aim of the pharmacokinetic analysis was to obtain a prediction of each participant's apparent stavudine clearance (CL/F) for calculation of the area under the concentration curve (AUC), where AUC = dose (ng)/clearance (L/h). The data were analysed using nonlinear mixed effects modelling with NONMEMwas used . The pop2 test (or Fisher's exact test), and continuous data were compared using student's T-test or Mann-Whitney test, whichever was appropriate. Logistic regression models were fitted to assess the association between GMR > 1 and IFG, IGT, hyperlactataemia, hypertriglyceridaemia and lipoatrophy. Linear regression models were fitted to assess the association between log-transformed stavudine area under the curve and the following variables: concentrations of glucose, lactate and triglycerides, and lipoatrophy scores. All tests were two-sided, and a P-value < 0.05 was considered significant. Analyses were performed using SPSS Means (standard deviation (S.D)) and medians (interquartile range) were used to describe parametric data and non-parametric data, respectively. Categorical data were compared using χ2, respectively. Median waist to hip ratio was 0.85 (0.80 to 0.92). Median (IQR) current CD4 count was 304 (234-516) cells/μL. Twelve participants were virologically suppressed, 6 had viral load above 50 copies/mL and 29 had no viral load data. Forty and seven participants were on 30 mg and 40 mg of stavudine, respectively. Twenty six, twenty and one participants were on efavirenz, nevirapine and lopinavir, respectively. All participants were on lamivudine. The median (interquartile range (IQR)) fasting glucose concentration was 4.9 (4.7 to 5.4) mmol/L and the mean (standard deviation (sd)) 2 hour glucose concentration was 5.34 (1.43) mmol/L. Nine and two participants had IFG and IGT, respectively. The mean (sd) lactate concentration was 2.26 (0.78) mmol/L and 15 participants had hyperlactataemia. The median (IQR) triglyceride concentration was 1.17 (0.85 to 1.60) mmol/L and 11 participants had hypertriglyceridaemia. The median (IQR) lipoatrophy score was 0 (0 to 9) and 16 patients had lipoatrophy.Forty seven black participants were included for the analysis. Median (IQR) age was 34 (30-38) years. Thirty nine participants were female. Median (IQR) weight and body mass index were, 61.0 (54.4 to 73.8) kg and 24.5 (21.5 to 30.4) kg/mA total of 122 stavudine concentrations from 47 participants were analysed. Eleven participants had no pre-dose concentrations because they took their stavudine morning doses prior to the OGTT. The observed stavudine concentrations plotted against the model predictions are shown in Figure We found no association between log-transformed stavudine AUC and metabolic parameters expressed as continuous variables Table . We alsoDespite guidelines recommending that the use of stavudine be avoided because of its toxicity, it continues to play a critical role in scaling up antiretroviral therapy in resource poor settings. Therefore, studies examining pathogenesis of stavudine toxicity are still relevant. We found no association between stavudine AUC and the lipoatrophy scores or concentrations of glucose, lactate and triglycerides. To our knowledge this is the first study to evaluate the association between plasma stavudine concentrations and serum glucose, lactate and triglycerides. We found high prevalence of metabolic abnormalities in this black African cohort with a median duration of stavudine exposure of 14.5 months: lipoatrophy (34%), dysglycaemia (23%), hyperlactataemia (32%), and hypertriglyceridaemia (23%). We found an association between duration and triglycerides concentrations.A meta-analysis from randomised control trials and cohort studies showed that switching from higher to lower doses of stavudine, or starting at lower doses, is associated with improvement in stavudine toxicity without loss of efficacy . SwitchiAlthough stavudine related toxicity is well documented, to date, few studies have investigated pharmacokinetic relationship with stavudine toxicity. Our findings are different to a case-control study conducted by ter Hofstede et al, which reported that cases with lipoatrophy had higher stavudine exposure than controls . HoweverOur study had a few limitations. First, we measured stavudine concentrations in plasma and not the active intracellular triphosphorylated metabolite. Second, we used sparse sampling instead of intensive sampling. However, a population approach allowed us to predict individual AUCs, an acceptable measure of drug exposure. Third, we did not have data on genetic polymorphisms. Fourth, sample size of this study was small, and therefore might have insufficient power to detect relatively small effects of plasma concentrations on metabolic abnormalities. However, this sample size is larger than in other pharmacokinetic studies that have examined the association between stavudine concentrations and metabolic toxicity ,22.Future studies examining the pathogenesis of stavudine-associated toxicities should have adequate power and preferably be longitudinal. Relevant genetic studies should also be done in the populations where stavudine will still be used in the medium term. Physiologically based pharmacokinetic models that take into account the temporal fluctuations and intracellular cascade steps of plasma NRTIs and metabolites should be used to establish pharmacokinetic-pharmacodynamic relationships.In conclusion, we did not find an association between stavudine exposure and metabolic complications. Despite guidelines recommending that the use of stavudine be avoided because of its toxicity, it is still widely used in resource poor settings. Until there is universal access to safer drugs, there is a need for further studies examining the pathogenesis of stavudine-associated toxicities.The authors declare that they have no competing interests.PZS participated in the study design, acquisition of data, data analysis and interpretation, and drafted the manuscript. JSvdW participated in study design, population pharmacokinetic analysis and helped to draft and critically revise manuscript. HMM participated in study design, data interpretation, and critical revision of the manuscript. MB performed statistical analysis and helped to draft and revise manuscript. PJS performed analysis of the samples and helped to draft the manuscript. JAD participated in study design, acquisition of data and critically revised the manuscript. NSL participated in study design and acquisition of data. GM conceived of the study, participated in study design, data interpretation, and critically revised manuscript. All authors read and approved the final manuscript.

The 4-fluoro­phenyl ring of mol­ecule A makes dihedral angles of 17.17 (16) and 62.25 (15)°, respectively, with the phenyl and pyridine rings. The 4-fluoro­phenyl ring of mol­ecule B makes dihedral angles of 8.50 (16) and 64.59 (15)°, respectively, with the phenyl and pyridine rings. The dihedral angle between the pyridine ring and the phenyl ring of mol­ecule A [60.97 (15)°] is bigger than in mol­ecule B [59.49 (15)°]. The dihedral angle between the two pyridine rings is 1.37 (14)° and between the two phenyl rings is 3.64 (16)°.The crystal structure of the title compound, C Å b = 7.4097 (8) Å c = 35.163 (5) Å V = 3151.3 (7) Å3 Z = 8 Kα radiationCu −1 μ = 0.83 mmT = 193 K 0.38 × 0.19 × 0.10 mm Enraf–Nonius CAD-4 diffractometerAbsorption correction: none5637 measured reflections5558 independent reflectionsI > 2σ(I)4832 reflections with R int = 0.054 3 standard reflections frequency: 60 min intensity decay: 2% R[F 2 > 2σ(F 2)] = 0.048 wR(F 2) = 0.132 S = 1.05 5558 reflections451 parameters1 restraintH-atom parameters constrainedmax = 0.19 e Å−3 Δρmin = −0.23 e Å−3 ΔρAbsolute structure: Flack 1983, 2522 FrFlack parameter: 0.35 (19) CAD-4 Software (Enraf–Nonius, 1989CAD-4 Software; data reduction: CORINC (Dräger & Gattow, 1971SIR97 (Altomare et al., 1999SHELXL97 (Sheldrick, 2008PLATON (Spek, 2009PLATON .Data collection: 10.1107/S1600536809019801/nc2145sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809019801/nc2145Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

To the Editor: Free-range domestic ducks can be a key factor in regional spreading of Asian subtype H5N1 avian influenza (AI) virus (Anas platyrhynchos var. domestica) and influenza A virus (H5N1) A/chicken/Miyazaki/K11/2007 as previously described (7 50% egg infectious doses (EID50) of 0.1 mL. All experimental procedures were approved by the Ethics Committee of the National Institute of Animal Health in Japan.An experimental infection study was conducted with Japanese domestic ducks . Samples were examined by rapid tests, virus isolation, and reverse transcription–PCR (RT-PCR). Feathers were also examined by immunohistochemical testing.A). Briefly, we put the calamuses into the test tube containing attached reagent solution (340 μL) and chopped them into small pieces with an iris scissor and then placed the test strip in the tube. We obtained the following results: feathers tested positive for influenza A virus from days 3 through 6 pi in 1 duck (a), and on days 3 and 4 pi in 2 ducks (b and c), whereas all oropharyngeal and cloacal swabs were negative (B).On-site rapid tests were performed with a commercial kit, QuickVue Influenza A+B , which can detect influenza virus nucleoprotein. The first set of swabs was used for rapid tests according to the manufacturer’s instructions. We also tested 1–2 sticks of the feather calamus (≈15–30 mg per stick) for rapid tests , panel Anegative , panel B50/mL. Viruses were isolated from the oropharyngeal swabs, cloacal swabs, and feathers of all birds, and feathers tested positive for the virus for a longer period than did the swabs feather homogenate supernatants were calculated with 10-day-old embryonated chicken eggs and expressed as EIDhe swabs . AlthougOne-step RT-PCR was performed on the total RNA extracted from the same samples as in virus isolation to detect the H5 AI virus gene . The 1:10 dilution of RNA templates was used for feathers. The primers used were H5–248–270F and H5–671–647R; the expected product was 424 bp .C).Immunohistochemical testing was performed to detect influenza virus nucleoprotein in the feather tissue by using a rabbit polyclonal antibody . Virus antigens were detected in feather epidermal cells from days 3 through 6 pi, and in a few stromal cells in the feather pulp on days 3 and 4 pi , panel COur results indicate that larger amounts of viruses can be isolated for a longer time from feathers than from swabs. Therefore, feathers can be considered useful samples for surveillance or diagnostic examination of AI virus (H5N1) in domestic ducks. The epidermis, the outer layer of the feather, is a tissue that has poor host immune response against viral replication Developing contour feather. The calamus was used for examination (bar = 1 cm). B) Result of the rapid test with feathers. A pink line (arrowhead) indicates a positive result for influenza A virus. C) Immunohistochemical stain of a biopsied feather composed of feather epidermis (fe) and feather pulp (fp). Influenza virus nucleoprotein was detected in the fe epidermal cells (arrowheads) (bar = 200 m).

Psychological distress (i.e. depression and anxiety) is a strong predictor of functional status and other aspects of quality of life in autologous stem cell transplantation following high-dose chemotherapy. Treatment of psychological distress is hypothesized to result in improvement of functional status and other aspects of quality of life. The aim is to evaluate the outcome of stepped care for psychological distress on functional status and other aspects of quality of life in patients with hematological malignancy treated with autologous stem cell transplantation.The study is designed as a randomized clinical trial with 2 treatment arms: a stepped care intervention program versus care as usual. Patients are randomized immediately pre transplant. Stepped care and care as usual are initiated after a 6 weeks buffer period. Outcome is evaluated at 13, 30, and 42 weeks post transplant.In the experimental group, the first step includes an Internet-based self-help program. If psychological distress persists after the self-help intervention, the second step of the program is executed, i.e. a diagnostic evaluation and a standardized interview, yielding a problem analysis. Based on this information, a contract is made with the patient and treatment is provided consisting of individual face-to-face counseling, medication, or referral to other services. Care as usual comprises an interview with the patient, on ad hoc basis; emotional support and advice, on ad hoc basis; if urgent problems emerge, the patient is referred to other services.Primary outcome variables are psychological distress and functional status. Data are analyzed according to the intention to treat-principle.This study has several innovative characteristics. First, the outcome of the intervention for psychological distress in patients with hematological malignancy treated with autologous stem cell transplantation is evaluated in a randomized controlled study. Second, the impact of the intervention on functional status is evaluated: it is hypothesized that reduction of psychological distress results in improved functional status. Furthermore, the intervention concerns an Internet-based treatment in the first step. Finally, the intervention is characterized by an emphasis on self-management, efficiency, and a multi-disciplinary approach with nurses taking up a central role.NTR1770 Autologous stem cell transplantation (auto-SCT) following high-dose chemotherapy is acknowledged as one of the most stressful treatments in anti-cancer therapy. Previous research documented strong decreases of health-related quality of life during and directly after auto-SCT, with gradual improvement during the first year of follow up . Three tPsychological distress has shown to be the strongest predictor of health-related quality of life apart from relapse in cancer patients following auto-SCT -5. DistrPatients who suffer from depression before stem cell transplantation, are more likely to have impaired functional status post transplant . FurtherFrom the existing literature we may conclude that psychological distress, specifically depression and anxiety, are predictors of functional status and other aspects of quality of life in patients treated with auto-SCT.The findings on psychological distress being a prognostic determinant of health-related quality of life provide a strong empirical basis for an intervention focusing on treatment of psychological distress in auto-SCT. Treating psychological distress is expected to substantially improve functional status and other aspects of health-related quality of life following auto-SCT.Problem solving treatment is an effective intervention for reducing psychological distress and improving quality of life in cancer survivors -15. ProbIn delivering treatment for psychological distress, the stepped care approach has been strongly advocated -19. In tIn the present study, treatment for psychological distress, applying the stepped care approach, will be offered to patients receiving auto-SCT for the treatment of a hematological malignancy. Patients will receive auto-SCT for relapsed disease or upfront. All patients will be pretreated with (immuno-)chemotherapy. The transplant related mortality of auto-SCT is low (<5%). Relapsed disease occurs between 5 and 50% of the patients, depending on their disease.The aim of this study is to evaluate the outcome of stepped care for psychological distress on functional status and other aspects of quality of life in patients with hematological malignancy treated with auto-SCT. It is hypothesized that stepped care results in improvement of psychological distress, and thereby in improvement of functional status and other aspects of quality of life . Stepped care and care as usual are initiated after a 6 weeks buffer period, allowing for initial recovery post-transplant. At 13 weeks (T13), 30 weeks (T30) and 42 weeks (T42) post-transplant, outcome is evaluated. The design is illustrated in figure Inclusion criteria:(a) patients with hematological malignancy Hodgkin lymphoma, acute myeloid leukemia, or acute lymphoid leukemia) treated with auto-SCT after (immuno-)chemotherapy; and (b) life expectation >3 months. Exclusion criteria: (c) age <18 or >65 years (65 years is included); (d) insufficient command of the Dutch language to complete questionnaires; or, if so: no support by family or professional interpreters; (e) contraindication for the stepped care approach; (f) no informed consent.This will be a multicenter study in one of the large Dutch university hospitals and a Dutch teaching hospital. To allocate patients to either stepped care or to care as usual, permutated-blocked randomization with stratification for study center and for diagnosis Hodgkin lymphoma, or acute (myeloid or lymphoid) leukemia) made up by a random digit generator is used. When patients have completed the baseline-questionnaire (T0), allocation will be performed by an independent researcher (BM), who is not in contact with the patients and keeps the randomization list in secure and confidential custody. He gives the patient a unique randomization number. The allocation will be sent by email to the investigator (AMJB), who informs the patient. The clinicians involved in the stepped care program will be informed of the allocation by AMJB only after screening for psychological distress at T13, and only if the patient meets the criterion for psychological distress after completion of the Internet based self-help program, resulting in further treatment being offered.Due to the nature of the intervention, neither patients nor health care providers can be blinded to the intervention. However, randomization, scoring of outcome variables, and statistical analysis will be performed blindly.The key-elements of the protocol for stepped care are described below.http://www.allesondercontrole.nu/sct. "Everything under control" is a brief, web based intervention for problem-solving (which is based on self-examination therapy). Both international and national research has shown that this intervention is effective in treating psychological distress [The Dutch website "Alles onder controle" ["Everything under control"] is used, adjusted for patients with hematological malignancy receiving auto-SCT distress ,21. The distress . There idistress .The intervention "Everything under control" takes approximately five weeks in total. In that period, respondents describe what they think is important in their lives, make a list of their problems and concerns, and divide these into three categories: important and solvable problems (these are solved through a six-step procedure of problem-solving); unimportant problems (problems that are not related to what is important in their lives); and important but unsolvable problems (such as losing someone through death). For the important and solvable problems, the respondent analyzes the problem and generates alternative solutions; selects and implements the chosen solution; and evaluates the results and prepares for the future. For the important but unsolvable problems, the respondent makes a plan on how to cope with them.Coaching will be given by one of the researchers (AMJB). The coaching consists of brief, weekly contacts by e-mail, which take about 10 to 15 minutes per week. The total coaching time is 1 to 1,5 hours per respondent. The coaching is not aimed at developing a patient-therapist relationship but is only meant to give support in working through the self-help method.The intervention "Everything under control" is available in a booklet for those patients who do not have access to the Internet or who prefer the booklet over the web based therapy. The content of the booklet is similar to the web based intervention. Coaching will be via telephone or e-mail.The intervention "Everything under control" is offered to all patients in the experimental treatment arm: most patients are expected to suffer from psychological distress during the acute phase of the transplant ,24. The After completing the Internet-based self-help program, all patients are screened for psychological distress. In order to cover the entire range of mood states associated with psychological distress, three instruments will be used measuring symptoms of psychological distress. These instruments are the Patient Health Questionnaire (PHQ-9), the Hospital Anxiety and Depression Scale (HADS), and the State-Trait Anxiety Scale: state version (STAI-state). For details on the measurement instruments, see section 'Assessment' below.Psychological distress is defined as a score ≥10 on the PHQ-9, or ≥8 on the HADS (anxiety), or ≥8 on the HADS (depression), or ≥40 on the STAI (state) , hematologist and patient is formed. The team evaluates the patient's need for treatment and develops the treatment plan. The nurse practitioner coordinates the team efforts, the development of the treatment plan and the execution of it. The team meets to develop tentative treatment options and to evaluate outcome of treatment.Diagnostic evaluation is made by the consultant psychiatrist. The anxiety and depression modules of the Composite International Diagnostic Interview (CIDI) are administered for the classification of symptoms . AdditioWhen treatment options have been developed, the patient is invited for an appointment with the consultant psychiatric nurse. In this meeting, the results of the problem identification and analysis are presented, personalized goals are identified and the patient is offered a choice between several treatment options (see below). The patient and consultant psychiatric nurse decide on the treatment, which matches the patient's problems, needs and preferences (contracting). The shared decision is written down in the personalized treatment plan: the treatment plan specifies identified problems, need for care, personalized goals, tailored treatment, and times for evaluation. The patient receives a copy of the personalized treatment plan and is invited to use the plan in staying focused on the personalized goals.The following treatment options are available:Face-to-face counseling is provided by the consultant psychiatric nurse, with the individual treatment plan serving as a guide. The treatment consists of problem solving treatment (see above), with a maximum of six sessions. The consultant psychiatric nurses have been thoroughly trained in problem solving treatment, and will follow a manual in delivering treatment ,30. If iMedication is prescribed by the consultant psychiatrist as needed. Suggested medication includes, among others, SSRI's and benzodiazepines. Occasionally, antipsychotics or mood stabilizers may be needed.If an indication exists, the team refers the patient to health care or social services, e.g. physiotherapy, social work, or psychotherapy.Step 2 including contracting and implementation of treatment options lasts for a maximum of 10 weeks.Care as usual consists of the following elements: If the patient brings up any problem, the hematologist interviews the patient . During regular visits to the department of Hematology, hematologists and nurses provide emotional support and advise patients on how to cope with impairments of quality of life, on an ad hoc basis. If urgent problems emerge, the patient is referred to other services.A marked contrast between stepped care and care as usual exists. Key elements of the contrast include:versus no self-help program.- Internet-based self-help program, based on the principles of problem solving therapy versus ad hoc interview if a patient brings up any problems.- Formal screening for psychological distress versus ad hoc care delivered by hematologist and nurse.- Collaborative team coordinated by nurse practitioner versus non-standardized interview performed by hematologist and nurse.- Diagnostic evaluation (consultant psychiatrist), standardized interview assessing psychological distress (consultant psychiatric nurse) and problem analysis versus no contracting.- Contracting versus support, advice, and referral to other services on ad hoc basis.- Individual face-to-face counseling, medication, or planned referral to other services Assessments are made at baseline, 13 weeks, 30 weeks and 42 weeks post transplant.The following sociodemographic data are collected: age, gender, social status, employment, and Dutch vs. non-Dutch origin.Collected medical-somatic data are: diagnosis, time from diagnosis to auto-SCT, cancer treatment , proceeding to allogeneic SCT within six months after auto-SCT (only in multiple myeloma group), hematological recovery data, number of platelet transfusions and packed cell transfusions, and survival/relapsed disease with concomitant second/third line treatment/death.Psychological distress is measured by the Hospital Anxiety and Depression Scale (HADS). The HADS consists of 14 questions. There are two subscales assessing anxiety and depression, respectively. The two scales can be combined into one scale assessing psychological distress. The HADS does not contain items which might also be symptoms of physical illness (such as loss of appetite) -33. ThisQuality of life is measured by the European Organisation for Research and Treatment of Cancer - Quality of Life Questionnaire - C30 (EORTC-QLQ-C30) version 3.0. The EORTC Quality of Life Questionnaire is an integrated system for assessing the health-related quality of life of cancer patients. The core questionnaire incorporates five functional scales , three symptom scales , a global health status and quality of life scale, and a number of single items assessing additional symptoms commonly reported by cancer patients and perceived financial impact of the disease. The instrument has been shown to be valid, reliable, and responsive to change .As secondary outcome variables, depression and anxiety are assessed by the Patient Health Questionnaire (PHQ-9) (depression) and the The evaluation of the patient's need for treatment prior to step 2 is made with the following instruments. Diagnostic evaluation is established with the anxiety and depression modules of the Composite International Diagnostic Interview (CIDI) . The CIDA checklist is used to collect data on process of care: number of visits to an outpatient clinic, number of (re-)admissions, length of stay, second/third line treatment, content of stepped care (step 1 and step 2), and co-interventions . This checklist was developed specifically for the trial.Primary outcomes are psychological distress as measured with the HADS and physical role function as measured with the EORTC-QLQ-C30. These primary outcomes reflect the central hypothesis of the study: stepped care is hypothesized to result in improvement in psychological distress, and thereby in improvement of functional status analysis of covariance. The randomization strata will be included as covariates. In addition, a group*time-interaction term will be entered into the model to test for a difference in treatment effect over time. In analyzing a specific outcome variable, the baseline score of that variable is used as covariate.If shown to be effective, we will explore whether patient characteristics moderate outcome of stepped care, using analyses of interaction between patient characteristics and treatment . Furthermore, we will explore which changes mediate outcome, by analyzing whether (a) change in psychological distress, (b) change in cognition, or (c) characteristics of the process of care mediate the outcome of stepped care, using the Baron and Kenny approach towards mediation and the Sobel test.Both the analysis of moderating factors and the analysis of mediating factors is explorative in nature. This study is powered to answer the primary research question, i.e. the outcome of stepped care for psychological distress on functional status.The power calculation concerns the comparison at T30 compared to T0 between the two groups . A recent meta-analysis on problem solving therapy for mental and physical health problems has documented an effect size of d = 0.54, compared to treatment as usual . Setting d = 0.5, alpha = 0.05 (two tail), beta = 0.80, the required sample size is 2 × 64 = 128 patientsA second power calculation was made concerning the difference in treatment effect over time . Setting the within-subject correlation coefficient (rho) at 0.5, the required sample size following from this calculation is 2 × 42 = 84 patients.The exclusion rate is estimated at 30% (primarily due to no informed consent). A detailed analysis of historical data has shown that the loss due to inclusion in other studies and mortality is 20%. The drop out rate is estimated at 20%. Consequently, 286 patients need to be invited for the study. On an annual basis, 80 autologous transplants are expected. Therefore, the inclusion period is 43 months.This study design has several innovative characteristics. As to our knowledge, this is the first study in which the outcome of an intervention for psychological distress in patients with hematological malignancy treated with auto-SCT is evaluated in a randomized controlled protocol. Auto-SCT following high dose chemotherapy is a stressful treatment, leading to high levels of psychological distress . PsycholThe intervention in our study has been developed to improve patients' self-management and has been tailored to the needs of our specific patient group. Self-management is intended to help patients adjust to their condition and to improve their quality of life. The aims are to give patients control over their life and to obtain a proactive attitude in the patient . PatientFurthermore, since psychological distress is a predictor of functional status in patients with hematological malignancy treated with auto-SCT -5, it isA third innovative characteristic of the present study is that the intervention aims at efficiency both in efforts and costs. This is reflected in the choice for a stepped care program, in which patients start with the least intensive treatment that is most likely to work, with more intensive and costly interventions reserved for those insufficiently helped by the initial self-help intervention. It is expected that most patients will be sufficiently helped by the Internet-based treatment, offered in step 1 . Since tSome patients will need more help than the Internet-based self-help program can offer them and will therefore enter step 2. A strength of this stage of the program is the multidisciplinary approach with a clear distribution of tasks and the nurse accomplishing a coordinating role. Multiple professional disciplines are brought together to treat the patients in the aftermath of disease. The collaborative team will evaluate the patients' need for treatment from various perspectives and subsequently develop the treatment plan. This collaboration of the various disciplines is coordinated by a nurse practitioner. Consequently, the professionals have the opportunity to deliver care efficacious and efficiently, and patients are assured of tailored care.In the implementation of the stepped care program, nurses take up a central role. Especially during the phase of diagnostic evaluation and problem analysis, and during step 2, the nurse's contribution to treatment and care is essential. The nurse not only coordinates the collaborative team efforts, the development of the treatment plan, and the execution of it, but also assesses patients' case complexity and resulting care needs. Furthermore, the problem solving treatment sessions during step 2 are provided by a consultant psychiatric nurse.The study also has some limitations that have to be taken into account. It could be that the most vulnerable patients will drop out of the experimental group because of difficulties completing the intervention program. This could reflect selective drop-out and lead to differences between the experimental and control group, because participants in the control group do not have to adhere to an intervention program, but only have to complete questionnaires. The data will be analyzed according to the intention to treat-principle. As a result, we will estimate the effects of allocating an intervention in practice, and not the effects in the subgroup of participants who adhere to the program. During the study, the drop out and (non-)compliance will be monitored. In a secondary analysis, patients completing treatment will be analyzed : this will allow us to estimate the effect of the intervention as such. Another limitation could be the length of the recruitment period. Given the long recruitment period, changes in medical treatment cannot be excluded. This may have impact on the intervention, although it is expected that patients in the intervention group and the control group will be affected in the same way.If our trial shows a successful outcome, the intervention will be available for use in clinical practice. Results of this study will be available in 2014.The study protocol has been approved by the Medical Ethical Committee of VU University Medical Center, Amsterdam, the Netherlands. All patients gave written informed consent.The authors declare that they have no competing interests.JD, BM, OV, ATFB, PC, AB, PO, CE and AMJB contributed to the design of the study. The study is being coordinated by JD and BM. The present manuscript was drafted by AMJB, BM, and JD. All authors contributed to critical revision of the manuscript for important intellectual content. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/10/361/prepub

Greenspace has the potential to be a vital resource for promoting healthy living for people in urban areas, offering both opportunities for physical activity and wellbeing. Much research has explored the objectively measurable factors within areas to the end of explaining the role of greenspace access in continuing health inequalities. This paper explores the subjective reasons why people in urban areas choose to use, or not use, local public greenspace.In-depth interviews with 24 people living in two areas of Glasgow, United Kingdom were conducted, supplemented with participant photography and participatory methods. Data was thematically categorised to explore subjectively experienced facilitators and barriers to greenspace use in urban areas.From the perspective of current and potential urban greenspace users, access is revealed to be about more than the physical characteristics of neighbourhoods, greenspace resources or objectively measurable features of walkability and connectivity. Subjectively, the idea of walkability includes perceptions of social cohesion at a community level and the level of felt integration and inclusion by individuals in their communities. Individual's feelings of integration and inclusion potentially mitigate the effects of experiential barriers to urban greenspace access, such as evidence of anti-social behaviour.We conclude that improving access to greenspace for all in urban communities will require more than providing high quality resources such as parks, footpaths, activities and lighting. Physical availability interacts with community contexts already established and a holistic understanding of access is required. A key cultural component of areas and neighbourhoods is the level of social cohesion, a factor that has the potential to reinforce existing health inequalities through shaping differentiated greenspace access between subgroups of the local population. Although there is now widespread acceptance from studies of neighbourhood effects that where people live affects their health, the underlying mechanisms are only beginning to be understood -5. One mAs a consequence of such findings, lack of access to and/or use of urban greenspace become a public health issue for people living in urban areas. With regard to health inequalities between socio-economic groups, greenspace access has been implicated in social inequalities in obesity and overweight, with parks and other urban greenspaces being viewed as important components of community 'opportunity structures' for health ,20. ThusThe idea of the 'walkability' of communities has become a focus of research seeking to understand inequalities in access and use of available urban greenspace -27. 'WalConsequently explorations of the relationship between elements of urban infrastructure and health also need to address why people choose, or choose not to use greenspace. While there has been research exploring the connection between physical attributes of local areas and health, most have been conducted using method protocols better placed to capture objective qualities of neighbourhoods such as GIS mapping or surveys. As a result, studies focussing on how places influence health have tended to look at the physical characteristics of neighbourhoods and/or the characteristics of the people who live there -32. LessFacilitators and Barriers to Greenspace Study (FAB Greenspaces) conducted by a working group of researchers from the Glasgow Centre for Population Health, the Medical Research Council (UK) Social and Public Health Sciences Unit and the local National Health Service (NHS) board (Greater Glasgow and Clyde). The study city, Glasgow, is well-resourced in greenspaces but displays significant inequalities in health both within the city and between other areas of the United Kingdom. The study explored the quality and accessibility of greenspaces across two socially contrasting areas of the city to capture subjective understandings of access and quality. The two localities had been the subject of a longitudinal study and the areas were selected from a continuum of eight socio-residential types in the city of Glasgow, the North West locality being towards the 'better' pole and the South West locality towards the 'worse' pole of this continuum, but not at the extremes that's going playing football and all that. It's a good bit, a brilliant bit.Derek, more deprived areaNot so much now no I don't [use the local park] I probably will because I'm going to have a grand-child soon.Dolan, more affluent areaThe availability of quality greenspace offers a resource that adults and young people could use, which is reinforced by parenting or grand-parenting values that promote active leisure.We wouldn't let them sit and watch TV, we controlled it a lot, you know. We wouldn't let them have the TV as the focal point all the time you don't want that, you know. A lot of kids, maybe that's all for them nowadays too, maybe they're just couch potatoes, you know. It makes them lazy too, and it's an unhealthy lifestyle.Dolan, more deprived areaThe presence of young people in parks could produce ambivalent feelings from respondents. Many found the presence of unsupervised, older children and adolescents a barrier to greenspace. This finding highlights how community cohesion becomes an important factor in determining greenspace access. The perceptions subgroups (such as adults and young people) have of one another can lead to self-exclusion of some (such as adults) from parks. This self-exclusion becomes an important barrier to greenspace access not captured in understandings of physical quality of greenspace. For Archie (below) accessibility was impeded by the presence of younger people.They could make it a bit more accessible, I don't mean getting there, but I mean it's inhabited by the youngsters now and they're not very friendly youngsters, you know, it can be quite intimidating at times, you know. I think perhaps if they put more effort into maybe policing that park then you'd probably get people having a walk round it. I would rather travel anyway, you know, for a walk I would rather travel somewhere else, you know.Archie, more deprived areaThe presence of young people could be associated (fairly or unfairly) with anti-social behaviour. There were two responses to young people and the (related) issues of graffiti and perceived incivility by adults in the study. These responses appear to have origins in the level of integration and confidence individuals felt in their communities.One response was fear of young people in public space, leading to either a removal of oneself and family from public space or, for those with children, to an increase in the amount of supervision felt necessary. For those who had more resources and choices, exiting public space for private resources was a more easily achieved strategy. The second response was to be stoical about the presence of anti-social behaviour. Stoicism appeared to be grounded in being confident about oneself and having a degree of control."drug users, neds and yobs". When Jack wanted to walk in greenspace, he would take a train to the coast 20 or so miles away. After Jack's home was burgled, he installed closed circuit television cameras reflecting a lack of confidence in his wider community and societal responses to crime. He felt stiffer law and order responses and more police on the beat were required. In terms of local leisure opportunities, Jack chose to join a local private bowling club. While he did not possess a high disposable income, he felt the private club was the only means of securing his safety locally.Jack, a fifty-seven year old carer in the North, chose to remove himself from public space on the basis of his experiences with others in his local community. Despite living in the area for thirty years, he felt unable to use the local public greenspaces on account of fears about those he described as It's out of control. Law and order has broken down. All they do is put a veneer on it. They use all these initiatives, it's all whitewash, the criminal justice system has broken down ... It's private members' club so you don't get..., it run by ex army and there is a duty officer on and he's responsible for discipline, anybody steps out of line, raising their voice, swearing, anything like that, you're on a charge and they're stricter than the courts. I mean some of them have been sin binned, six months suspension.Jack, more affluent areaJack's choice to use private greenspace facilities reveals that for him, accessibility is not an issue of quality but wider societal issues of cohesion and of shared values. What the private space provides is certainty, viewed as absent in public space, about the values and behaviours with which he will come into contact.Naomi dealt with the issue of anti-social behaviour in shared public space differently, choosing to increase the monitoring and supervision she gave to her children to enable them to play outside.Naomi: You're feert (scared) to let your kids out on the streets you know the way we used to go out and play, that doesnae happen here.Interviewer: Do you mean because of the traffic or just because of the vandalism or...Naomi: Just because of everything, because of people hanging about and the threat of somebody maybe taking them away or all the fighting and things like that, that go on.Interviewer: It's obviously quite frustrating for you.Naomi: Well, as I say I just take them out myself, if they go out on their bikes we go out with them as well.Naomi, more deprived areaExploration of Naomi's circumstances reveals how she also chose to remove herself and her children from shared public space on account of safety fears. As with Jack, it was not the quality of resources available that prevented her usage, it was the overriding sense that the values and behaviours she found in her community around her were not ones that would ensure safety. Neither was Naomi particularly socio-economically disadvantaged; indeed her access to resources such as a car enabled the removal of herself and children from community resources such as parks, ferrying her children to organised activities such as dancing lessons. The theme of controlling the circumstances, people and values her children came into contact with pervaded.Another individual who selected her public space use with care was Nyela, a female asylum seeker from Somalia, in her twenties with three young children. Nyela differed from Jack and Naomi in a number of ways, not least amongst them that she was socio-economically more disadvantaged and she described the greenspace she could access as poor quality. The data collected from her came from a discussion group using participatory methods. Nyela and a group of fellow migrant women drew maps that revealed their perceptions of greenspace available to them. Objectively, the area they lived in was well provided for in terms of facilities, a country park was adjacent to the area they lived in. However the greenspace maps drawn by Nyela and her friends depicted only football pitches and low quality green space (open plains of grass) that flanked the high rises in her neighbourhood. The maps also listed a number of obstacles to greenspace usage such as broken lifts, racist graffiti, gangs of young people "shouting things" and the tendency for flooding after rain (frequent in the West of Scotland).The experience of Nyela and her fellow asylum seekers offers an important counterpoint to the earlier findings about the role of children in promoting greenspace access. Having young children did not always result in use of free amenities such as local parks, as fear of navigating local communities remained a significant barrier. Chosen instead was the local community café, established by a community health project, because it provided feelings of safety and inclusion.The second type of response to evidence of anti-social behaviour in public space we coded as stoical responses. These were responses where people recognised the presence of incivilities and anti-social behaviour and noted the deleterious effect it had on the experience of using urban greenspace and public space in general. However, often through attempts to understand the origins of such behaviours, stoics were able to perceive the actions less threateningly. Moira, below, when reporting anti-social behaviour she has suffered attempted to play down its severity .and I know it's fairly low level vandalism it's not as if they are drawing all over our walls or something like that, but there's been some tagging with, I believe that's what they call it, tagging ... So that's a bit disappointing and also about a month ago somebody broke into my dad's car when it was parked outside the house and it happened in the middle of the day. That was disappointing that that happened. It's low level it's not anything, it's not anything that I'm going to get particularly upset about I think it's an annoyance it's not something I get really, really bogged down [with] and, I was very annoyed obviously about my dad's car getting broken into, but in terms of things like the litter and the vandalism I think it's something that happens when you live in a city.A couple of things, we've had a bit of a spate of vandalism Moira, more affluent areaAttempts to understand the causes of such incivilities and anti-social behaviour can be interpreted as attempts to maintain a sense of shared values and social cohesion in light of evidence of its possible decline. Such responses are in many ways more hopeful than the previous fearful responses, as the response itself does not further exacerbate the separation of young and old in public space.but I'd like to think it's more that I can understand why these things happen, things like vandalism happens why do we drop litter and hang about streets and stuff like that because they've probably just not got anything else to do and they're bored and fed up and that's just how you find a lot of areas like Glasgow and I think you just accept that that could have been me if maybe I hadn't had the same advantages and I don't like to judge people. Yes I would be annoyed if somebody sprayed painted my windows or something like that, but I'd like to think that once I'd calmed down I could say well there might be a reason why that happened and it's maybe not through fault or it's just a collection of circumstances have led to that and we've all got a part to play really in trying to make sure these things don't happen and people don't really need to do that.Yeah, maybe, Moira, more affluent areaA similar logic is in operation in the thinking of Kevin, a middle class parent in the more affluent part of the city. He comments on the presence of young people in public space in more positive terms, even taking account of associated incivilities such as graffiti and behaviour that can often be interpreted as rowdy or potentially threatening. He refers to a local skate park where young people engage in leisure pursuits as offering colour and vibrancy to public space (even with the associated graffiti). He finds the growth of corporate monopolies in his community and the homogenisation of his high street to be more anti-social. Difference for Kevin is to be celebrated and encouraged and a benefit of living in a mixed urban community. Kevin is a keen cyclist and therefore a frequent user of public space and perhaps more able to engage with its many aspects.A recent study exploring relationships between environment and obesity in a Canadian city cited a cultural preference for car ownership and use as reducing the potentially beneficial effects of the city's good greenspace quality Such a fOur analysis adds to this developing understanding by highlighting the role of social cohesion subjectively experienced as how we anticipate and interpret the actions of others in public space. Consequently social cohesion should be understood as an important component of accessibility around urban greenspace.The quality of the greenspace on offer interacts at subjective with the level of social cohesion perceived within a community. Whether the greenspace 'offer' made through infrastructure and provision coincides with individual values and their resulting motivations is an individual level factor that also shaping access.; However, access to personal resources also underpin a sense of social inclusion, when personal resources mitigate the physical evidence of low levels of social cohesion in a community .Where a feeling of social inclusion was absent, the self-removal of individuals from community greenspace resources could be observed. In the cases of those with fewer resources, the removal of an accessible and free at the point of use community resource such as public parks can compound the material disadvantages that underlie population level health inequalities. The findings therefore illustrate the role of social capital, particularly the components of trust, networks of cooperation and strong community identity, in facilitating, access to a health resource and its central role in maintaining wellbeing for all members of the geographical community .The findings indicate support for previous work suggesting aspects of local environments that heighten feelings of insecurity may be mechanisms through which place affects health . One proThis local cultural aspect of neighbourhoods or urban areas should be considered alongside quality, availability and connectedness of space and the characteristics of populations. Levels of social cohesion appear a key process variable by which inequalities in access can continue for certain marginalised subgroups once established. In the context of this study, this is experienced as an intergenerational segregation of public space use, between younger and older users. In other contexts the absence of community cohesion may be evident in other ways between different groups, possibly evident through ethnic, gang associated or sectarian division.Segregation in the use of public space highlights one way in which low levels of community bridging social capital mediates individual health inequalities previously identified by researchers such as Cattell and how those with more resources can protect themselves from some of the health consequences stemming from reduced community cohesion . AddressRussell Jones is a Board Member of the Glasgow and Clyde Valley Green NetworkFAB greenspaces study and made contributions to study design, data collection, analysis and drafting of the manuscript. AE was involved in the steering group around the qualitative study, made contributions to analysis and the drafting of the manuscript. All authors read and approved the final manuscript.PS designed the qualitative component of the FAB greenspaces study, oversaw and participated in data collection, led on the analysis and interpretation of data and is responsible for the drafting, and argument found within, this manuscript. RJ managed the broader

Type 2 Diabetes Mellitus (T2DM) and diabetic symmetrical polyneuropathy (DSP) impact multiple modalities of sensation including light touch, temperature, position sense and vibration perception. No study to date has examined the mechanosensitivity of peripheral nerves during limb movement in this population. The objective was to determine the unique effects T2DM and DSP have on nerve mechanosensitivity in the lower extremity.This cross-sectional study included 43 people with T2DM. Straight leg raise neurodynamic tests were performed with ankle plantar flexion (PF/SLR) and dorsiflexion (DF/SLR). Hip flexion range of motion (ROM), lower extremity muscle activity and symptom profile, intensity and location were measured at rest, first onset of symptoms (P1) and maximally tolerated symptoms (P2).The addition of ankle dorsiflexion during SLR testing reduced the hip flexion ROM by 4.3° ± 6.5° at P1 and by 5.4° ± 4.9° at P2. Individuals in the T2DM group with signs of severe DSP (n = 9) had no difference in hip flexion ROM between PF/SLR and DF/SLR at P1 or P2 . Movement induced muscle activity was absent during SLR with the exception of the tibialis anterior during DF/SLR testing. Increases in symptom intensity during SLR testing were similar for both PF/SLR and DF/SLR. The addition of ankle dorsiflexion induced more frequent posterior leg symptoms when taken to P2.Consistent with previous recommendations in the literature, P1 is an appropriate test end point for SLR neurodynamic testing in people with T2DM. However, our findings suggest that people with T2DM and severe DSP have limited responses to SLR neurodynamic testing, and thus may be at risk for harm from nerve overstretch and the information gathered will be of limited clinical value. Diabetes mellitus (DM) is a group of metabolic disorders that are characterized by hyperglycemia . The CenChronic hyperglycemia has adverse metabolic and vascular consequences for the peripheral nervous system ,4. DistaClinical neurodynamic tests are procedures designed to assess the mechanosensitivity of the nervous system through sequential limb movements -14. MultThis cross sectional study included 43 people with T2DM recruited from local medical and academic facilities. Sample size was based on power calculations for a multiple linear regression model with 5 predictor variables, alpha = 0.05, power of 0.8, and an effect size = 0.35. Exclusion criteria included low back or leg pain lasting >3 consecutive days in the past 6 months, complex regional pain syndrome, lumbar spine surgeries, chemical dependence or alcohol abuse, a history of sciatica or trauma to the nerves of the lower extremity, or chemotherapy in the past year. Participants had to meet flexibility requirements of isolated hip flexion ≥90°, full knee extension, ankle dorsiflexion ≥0° and plantar flexion ≥30°. Institutional review boards at UCSF, SFSU and the General Clinical Research Center's Advisory Committee at UCSF approved the study and assured compliance with the ethical treatment of human subjects. Written informed consent was obtained from subjects prior to testing. All subjects attended a single clinical assessment session. One examiner (BB) performed all physical examinations.Participants completed 1) a medical history questionnaire, 2) the Brief Pain Inventory - Short Form (BPI-SF) , 3) the Vibration perception thresholds (VPT) were measured bilaterally on the distal pad of the halluces using a 60-Hz biothesiometer . The halluces were tested in prone with the leg supported in 90° knee flexion and neutral ankle. The tip of the biothesiometer was balanced on the testing site to ensure consistent contact pressure as described previously ,25. The Two scoring instruments of composite physical examinations were used as additional means of quantifying severity of DSP . First, Second, the Michigan Diabetic Neuropathy Score (MDNS) clinical examination was performed, which included Achilles, patellar, biceps brachii and triceps brachii deep tendon reflexes, monofilament, tuning fork vibration and sharp/dull sensation of the dorsal halluces and muscle strength of finger abduction, ankle dorsiflexion and halluces extension. Scoring for each examination has been described in detail ,26,27. RStandard surface electromyography (EMG) electrodes were placed over the soleus, medial gastrocnemius, tibialis anterior, vastus medialis, rectus femoris, semitendinosus, biceps femoris, and gluteus maximus muscles of the right lower extremity . Skin prTwin-axis electrogoniometers were used to measure sagittal and coronal plane movement of the right hip and knee . The gon® PRAFO® ankle brace with outrigger bar and extra straps to maintain a fixed ankle position in either plantar flexion (30°) for the base SLR test (PF/SLR) or in neutral (0°) dorsiflexion for the "sensitized" SLR test (DF/SLR) [Straight leg raise (SLR) neurodynamic testing methodology has been described . In brie(DF/SLR) . One insThe tester placed the subject's knee in full extension (defined as end range resistance) and the subject was instructed to indicate this start position (START) by pressing the hand held trigger. Maintaining this knee position, the subject's hip was moved passively into flexion at a rate of approximately 3°/sec while manually avoiding hip rotation, abduction, or adduction. During this passive hip flexion movement, the subject pressed the hand held trigger to identify the moment they first felt the onset of ANY symptoms (P1) and when their symptoms became too intense to continue and they felt they could not tolerate any further movement (P2). The SLR test was stopped at P2 and this position was held for 5 seconds before the limb was returned to resting on the plinth. Two-minute rests were given between each SLR trial. Subjects were asked to report their symptoms including location, intensity, and quality at each of these time points; START, P1, P2, and after 2 minutes rest.Mean voltage for EMG and degrees for hip range of motion were obtained for a 100 msec window centered on each of the following 4 time points; relaxed pre-testing, START, P1, and P2. Raw EMG signals were converted using a root mean squared (RMS) formula with a 50 msec interval and then normalized using the average from the center 3-second window of the three trials of MVC testing (presented as %MVC) ,30. A "tSubjects underwent a blood draw at the General Clinical Research Center at UCSF. Blood samples were sent to Quest Diagnostics, Inc for hemoglobin A1c (HbA1c) and mean plasma glucose (MPG) analysis. These laboratory tests estimate average blood glucose levels over the preceding 2-3 months.SPSS software, version 16.0 was used to perform all statistical analyses. Descriptive statistics were used to describe the means ± standard deviations (SD) for all variables except frequency descriptive statistics for symptom quality and location, which are reported as percentages. Repeated measures reliability analysis included intraclass correlation coefficients including 95% confidence intervals . Relationships between demographic, clinical measures and SLR testing variables were assessed using Pearson correlation coefficients. Repeated measures general linear models were used for within test differences between the START, P1 and P2 positions for EMG and ROM data. Paired t-tests were used for between test comparisons (DF/SLR to PF/SLR). One-way ANOVA was used to determine the influence of DSP measures on EMG and ROM data using subgroups defined by severity of neuropathy. Subgroups were based on the bilateral averaged VPT (VPT-AVG): Group 1) no signs of DSP: 0-15 V; Group 2) signs of mild DSP: >15-25 V; Group 3) signs of moderate DSP: >25-50 V; and Group 4) signs of severe DSP: >50 V. The thresholds for Groups 1-3 are based on the relative risk of developing foot ulcerations as outlined in a literature review by Garrow and Boulton [The sample of people with T2DM (n = 43) consisted of 21 females and 22 males with an average age of 56.3 ± 11.1 (range 21-75) years. Demographic information and clinical examinations of signs of neuropathy included VPT, MNSIc, and MDNS are provided in Table Correlations between assessment tools and demographic data are presented in Table The clinical questionnaires for symptoms related to neuropathy (MNSIq) and activity level (Modified Baecke questionnaire) are presented in Table The average speed of hip flexion during PF/SLR was 2.3 ± 1.2°/second and DF/SLR was 2.1 ± 1.2°/second (p = 0.002). Amongst the participants, 23.3% did not request any extra head support, 65.1% requested 1 pillow, 9.3% requested 2 pillows and 2.3% requested 3 pillows during the SLR testing. The number of pillows did not affect the hip range of motion for either DF/SLR or PF/SLR at either P1 or P2 (p = 0.55-0.94).ICCs for hip flexion range of motion (ROM) between trials were 0.90 for PF/SLR at P1, 0.94 for PF/SLR at P2, 0.89 for DF/SLR at P1 and 0.96 for DF/SLR at P2. The hip range of motion to P1 and to P2 during SLR was greater than the START position for both DF/SLR and PF/SLR (p < 0.0005) Figure . There w2 of 0.28, which indicates that subgroup explains 28% of the variability in the P2diff outcome measure. There was 1.9° ± 4.5° more hip abduction at P2 during PF/SLR compared to DF/SLR (p = 0.008). There were no differences in hip abduction at P1 between PF/SLR and DF/SLR, nor in knee extension or valgus at either P1 or P2 .Further analysis revealed no effect of subgroup on hip flexion range of motion for the P1diff measure. However, those individuals with signs of severe DSP had no statistical difference in hip flexion ROM between PF/SLR and DF/SLR tests . There was a significant effect of subgroup on the difference in hip flexion ROM between PF/SLR and DF/SLR at P2 Table . InteresThe mean symptom intensity at the START position was 0.7 ± 1.4 during PF/SLR Figure . The symThe frequencies of symptom locations reported at the START, P1 and P2 during SLR are presented in Figure With the addition of ankle dorsiflexion (DF/SLR) there was an increase in the frequency of reported movement induced symptoms (not present at START position) at P1 by 16.2% in the posterior thigh compared to PF/SLR. However, the addition of ankle dorsiflexion only increased the frequency of movement induced symptoms by 2.3% in the posterior leg and reduced the frequency of movement induced symptoms by 2.3% in plantar surface of the foot. When taken to P2, the addition of ankle dorsiflexion increased the frequency of movement induced symptoms in the posterior thigh by 4.6% and the posterior leg by 16.3%, while there was a reduction in movement induced symptoms in the plantar surface of the foot by 7.0%Frequencies of symptom descriptions are presented in Figure Between test comparisons revealed that there was only a 2.3% increase in reported pain at P1 during the DF/SLR compared to the PF/SLR and no difference (0%) at P2. There were no differences greater than 5% in frequency of reported stretch, tightness/tension, numbness, tingling between DF/SLR and PF/SLR tests at either P1 or P2 with the one exception being a 7.0% increase in the frequency of reported stretch at P2 during DF/SLR compared to PF/SLR. Further analysis revealed that in individuals with signs of severe DSP, 44.4% (4/9) reported parasthesias at rest prior to beginning testing and 55.6% (5/9) reported them during SLR testing. Of the four subjects that reported paraesthsias at rest, all reported them in bilateral dorsal and plantar surfaces of their feet and these symptoms were unchanged during testing.We found that mechanosensitivity in the lower extremity is present in people with T2DM when evaluated through clinical neurodynamic testing. However, many of the outcome measures utilized in neurodynamic testing, including changes in hip flexion range of motion with addition of ankle dorsiflexion, symptom location and muscle activity, differed in people with T2DM when compared with previous findings in people without T2DM. Importantly, some of the signs and symptoms that present with the sensitizing maneuver of ankle dorsiflexion were not present in individuals with T2DM with signs of severe neuropathy.The magnitude of impact that the addition of ankle dorsiflexion has on hip flexion range of motion during SLR testing may reflect the state of mechanosensitivity of the neural structures being tested. Mechanosensitivity is a normal protective response to the stresses applied to nerves during limb movement. Thus, it is reasonable to expect hip flexion range of motion to be reduced when a SLR is performed with the ankle in a position of dorsiflexion. The addition of dorsiflexion has been shown to induce longitudinal gliding and increased strain in the lower extremity posterior neural structures, providing a "sensitized" version of the SLR -34. In pA comparison to findings in healthy controls in a previous study demonstrates that our sample of people with T2DM had reduced general flexibility during SLR . SpecifiThe absence of triggered muscle activation found in the present study in people with T2DM is drastically different from that found previously in healthy individuals without T2DM. In the present study we found only the tibialis anterior became activated during the DF/SLR as defined by a 1.5× increase over resting EMG activity. In comparison, a previous study of healthy individuals without T2DM found muscle activation using this same threshold criteria during the PF/SLR in the rectus femoris at P1 and in the soleus, medial gastrocnemius, tibialis anterior, vastus medialis, rectus femoris, biceps femoris, and gluteus maximus at P2 . This stOur sample of individuals with T2DM had much higher resting muscle activity in comparison to previously reported healthy individuals without T2DM . It is pReliance solely on muscle activity measures for decisive conclusions for mechanosensitivity is not reasonable due to the high variability of this type of measurement. Some individuals had no muscle activation during SLR testing at P1 and P2, which is consistent with previous study findings ,39. In oSymptom quality, intensity and distribution differed in people with T2DM when compared to healthy individuals without T2DM . At the In the subgroup of individuals with T2DM and severe DSP we found symptoms and clinical examination signs that were consistent with recent findings examining pain presentation phenotypes in neuropathic pain conditions . Scholz A mechanism that would explain the reduction of mechanosensitivity seen in people with T2DM and DSP has yet to be established. A recent study documented an altered ratio of mechanoresponsive to mechanoinsensitive C-fibers in people with diabetes and mild DSP in the common fibular nerve at the knee level . It was One major limitation of our study is the small sample size reducing the power to detect differences between variables with smaller effect sizes and diminishing the ability to extrapolate findings to larger populations. A potential covariate in our study is the impact of age on peripheral nerve health. We attempted to match our sample mean age to previous studies of peripheral nerve health in people with T2DM and studies of SLR neurodynamic testing to allow for valid comparisons. In our study we found no correlation between age and any hip flexion range of motion measure during SLR testing, in agreement with a previous study of age and hamstring length . The aveAn additional limitation is the difference of hip abduction range of motion at P2 during PF/SLR compared to DF/SLR which could have influenced the SLR outcome measures. The mean difference was less than 2° between the PF/SLR and DF/SLR and is not likely clinically significant but still represents a potential confounding variable that should be acknowledged in the interpretation of our study findings. Precisely controlled standardized procedures for clinical neurodynamic testing, as were utilized in this study, are warranted to minimize tester induced variability.2) compared to healthy individuals without T2DM [One characteristic difference between our present findings and that of SLR neurodynamic test findings in healthy individuals without T2DM is body mass index (BMI). The body mass index was larger in our sample of people with T2DM (32.8 ± 6.6 kg/m= 0.001) . Mean we= 0.001) . Height = 0.001) . We did Our study supports specific considerations for patient education and therapeutic exercise instructions. Alterations or avoidance of activities that involve cumulative loading of the nervous system via multiple joints should be considered in people with T2DM and signs of DSP. This could include avoiding movements into slumped postures with the feet elevated, altering specific activities of daily living such as forward bending to tie one's shoes, or avoiding specific movements or postures assumed during recreational activities such as yoga or Pilates. An understanding of the health of the nervous system including the ability to respond to and protect against over stretch should be incorporated into clinical decision making for physical examination, exercise prescription and patient education in people with T2DM. Although this study only examined passive limb positioning for short duration, it provides evidence to help support our clinical decisions related to protection of the peripheral nervous system in people with T2DM and DSP.We have provided evidence that the normal protective responses to neural loading during neurodynamic testing may be diminished in people with T2DM particularly those with signs of severe DSP. Additionally, we found increased frequency of resting symptoms in people with T2DM and increased frequency of reported neurogenic related symptom qualities during SLR testing. We found the addition of ankle dorsiflexion does not induce the same degree of reduction of hip flexion range of motion and the same pattern of muscle protective guarding during SLR testing in people with T2DM. The findings of our study call into question the clinical decision of performing neurodynamic testing on people with signs of severe DSP. Without the ability to respond to the increases in neural loading associated with neurodynamic testing and sensitizing maneuvers, this population is at risk for injury from testing and the information gathered will be of limited use to the clinician. It is recommended that clinicians perform a simple screen of sensation such as vibration perception testing or the MDNS prior to considering the appropriateness of neurodynamic assessments.When considering testing in people with T2DM, it is important to understand the global impact on mechanosensitivity due to the common distal symmetrical polyneuropathy associated with T2DM. When neurodynamic testing is deemed appropriate in this population, additional considerations are necessary for test interpretation in people with T2DM. It is paramount to clearly establish the person's resting symptoms prior to performing SLR testing. Symptoms that are normally associated with neurogenic sources may be present bilaterally at rest confounding SLR test interpretation in people with T2DM. Consideration of specific movement induced symptoms in addition to symptoms present at rest should assist the clinician interpret neurodynamic testing appropriately. Previous recommendations have included utilizing the onset of symptoms (P1) or the increase above resting symptoms as the end point of the SLR neurodynamic test ,44. The The authors declare that they have no competing interests.BSB provided input into study design, performed all clinical testing, performed the statistical analysis and helped to draft the manuscript. LW provided input into study design and helped to draft the manuscript. ATG provided input into study design and helped to draft the manuscript. KST provided input into study design and helped to draft the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2377/10/75/prepub

On the epidemiology of influenza: reply to Radonovich LJ, Martinello RA, Hodgson M, Milton DK, Nardell EA. Influenza and ultraviolet germicidal irradiation. Virol J. 2008, 5:149 To the Editor:et al . Indeed, per photon, UVC photosynthesis is greater than UVB [as illustrated in MacLaughlin et al's figure 1(C)].Radonovich in et al . The beleference would haet al found evidence that significant amounts of UVC penetrate through the stratum corneum, stratum lucidum, stratum granulosum, and small amounts of UVC even reach the upper layers of the 7-DHC-rich stratum spinosum [Furthermore, several animal studies indicate that UVC, which should never be used in man, is highly effective in both producing vitamin D and in treating rachitic rats . Knudsonspinosum . Thus, Uet al's landmark study showing most human Vitamin D production occurs in the deep epidermis was based on surgically obtained skin samples that then had surface oils removed again by washing in hot water [However, even if no UVC penetrated the stratum corneum, Helmer and Jensen published a remarkable human/animal study in 1937, showing that significant amounts of Vitamin D are made on the surface of human skin . They coot water . Indeed,It appears to us that the percentage of Vitamin D made on the surface of the human epidermis, compared to that made inta-epidermally, is unknown at this time and in need of additional and careful research. What percentage of the Vitamin D made in human skin after sun exposure is removed by simply washing? Furthermore, as the percentage made of the surface is significant, studies of cutaneous Vitamin D production in modern humans, unless unwashed, will not give accurate estimates of Vitamin D production in early man and thus an estimate of the "natural" 25(OH)D levels present when the human genome evolved.We repeat our aside hypothesis that the patients in UVC irradiated hospitals may have been the beneficiaries of more than just cleaner air. Much more importantly, influenza is just one of many seasonal infections sensitive to the broad spectrum anti-microbial peptides (AMP) that vitamin D up-regulates . InvasivAs research into vitamin D's remarkable effects on innate immunity quickens , we hope

Growth hormone is an important regulator of post-natal growth and metabolism. We have investigated the metabolic consequences of altered growth hormone signalling in mutant mice that have truncations at position 569 and 391 of the intracellular domain of the growth hormone receptor, and thus exhibit either low (around 30% maximum) or no growth hormone-dependent STAT5 signalling respectively. These mutations result in altered liver metabolism, obesity and insulin resistance.The analysis of metabolic changes was performed using microarray analysis of liver tissue and NMR metabonomics of urine and liver tissue. Data were analyzed using multivariate statistics and Gene Ontology tools. The metabolic profiles characteristic for each of the two mutant groups and wild-type mice were identified with NMR metabonomics. We found decreased urinary levels of taurine, citrate and 2-oxoglutarate, and increased levels of trimethylamine, creatine and creatinine when compared to wild-type mice. These results indicate significant changes in lipid and choline metabolism, and were coupled with increased fat deposition, leading to obesity. The microarray analysis identified changes in expression of metabolic enzymes correlating with alterations in metabolite concentration both in urine and liver. Similarity of mutant 569 to the wild-type was seen in young mice, but the pattern of metabolites shifted to that of the 391 mutant as the 569 mice became obese after six months age.The metabonomic observations were consistent with the parallel analysis of gene expression and pathway mapping using microarray data, identifying metabolites and gene transcripts involved in hepatic metabolism, especially for taurine, choline and creatinine metabolism. The systems biology approach applied in this study provides a coherent picture of metabolic changes resulting from impaired STAT5 signalling by the growth hormone receptor, and supports a potentially important role for taurine in enhancing β-oxidation. Growth hormone (GH) is both the major regulator of postnatal growth and an important metabolic regulator, influencing many aspects of lipid, carbohydrate, and protein metabolism GH acts through its receptor on the cell surface, which is a cytokine class I receptor with multiple tyrosines on the intracellular domain. Binding of the hormone to the receptor induces receptor tyrosine phosphorylation with intracellular signaling through a number of pathways, such as signal transducer and activator of transcription 5 (STAT5), Mitogen-activated protein kinase (MAPK), Phosphoinositide-3 kinase (PI3K) and Janus kinase 2 (JAK2) The microarray analysis in our previous study focused on the genes involved in GH enhancement of postnatal growth. We identified sets of genes regulated by particular signaling pathways with a major focus on STAT5 targets. However, there was little analysis of how this differential gene expression affects metabolism in the GHR mutant mice. As GH regulates metabolism in many ways, we were interested in identification of the actual metabolic changes that relate to the development of obesity and insulin resistance in our mice. However, changes in gene expression do not directly measure metabolic changes, and mapping of the differentially expressed genes onto metabolic pathways only provides an indication of pathways that can be affected, without defining the actual metabolic consequences. Therefore there was a need to use an alternative method to assess the global metabolic changes and their time course to determine the likely causes of observed phenotypic changes in our mouse model.Any significant perturbation of metabolism, such as the one caused by the GHR mutations, is reflected in the composition of body fluids such as urine, blood or saliva, which yield a different “metabolic fingerprint” for each metabolic state Nuclear magnetic resonance (NMR) spectroscopy is one of the major techniques used in metabonomic studies. The advantage of using NMR over other techniques such as mass spectroscopy is that it requires only minimal sample preparation, is non-destructive and inherently quantitative The aim of this study was therefore to identify metabolic changes in our GHR mutant mice by analysis of urinary and hepatic metabolites and to correlate these changes with transcriptome-based pathway analysis to establish metabolic pathways affected by the extents of differential STAT5 signalling. This is to our knowledge the first study linking the analysis of transcriptional changes based on microarrays with metabonomic analysis of actual metabolite changes in strains of receptor mutant mice. Our approach has allowed us to identify key metabolites and altered pathways, which provide a coherent and complementary picture of physiological changes at the level of the whole organism in relation to the metabolic role of GH.In this study we used animals previously generated in our laboratory with characterized mutations in the intracellular domain of the GHR −/− mutants than for their wild-type littermate controls at 2 months of age To investigate the biological processes underlying this dramatic change in phenotype, we determined the effects of the GHR mutations and altered STAT5 signalling on transcript expression in liver tissue of 42-day old mice, In a first round of analysis, we used the MAS 5.0 algorithm and fold changes with a cut-off of 1.5-fold to identify differentially expressed genes. These were subsequently analysed by ANOVA to identify predictor genes able to separate the four classes of microarray data , esterase 31 (Es31), hydroxysteroid dehydrogenase-5, delta<5>-3-beta (Hsd3b5), hydroxysteroid (17-beta) dehydrogenase 2 (Hsd3b2) and kidney expressed gene 1 (Keg1) as well as transcripts decreased in the wild-type, such as sulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 2 (Sult2a2), flavin containing monooxygenase 3 (Fmo3), hydroxyacid oxidase (glyoxylate oxidase) 3 (Hao3), cytochrome P450, family 2, and subfamily b, polypeptide 9 (Cyp2b9). The only genes not identified as biomarkers in our previous approach were Ghr, Rck, Fmo3 and Dbp. In addition, Hsd3b2, Fos, H19, Mt1 and Igfbp1, were differential in our previous study GeneRaVE identified three genes as differentiating the groups, Csad, were reduced in mutant 391 and GHR−/−. In contrast, the possible metabolic effects of changes in genes encoding other enzymes were not immediately obvious. It was also clear from this analysis that at 42 days of age the hepatic expression pattern of the mutant 569 was very similar to that of the wild-type, and it was expected that these mice would have very similar metabolic profiles.Based on these results we predicted taurine as one of the metabolites that would differentiate between the groups, as the mRNA levels of the key enzyme involved in its biosynthesis, GeneRaVE To further characterize the pathways affected in the mutant mice and to determine how the physiological response was changed, we used Gene Ontology analysis and pathway mapping. Gene Ontology (GO) analysis using NetAffx GO Browser identified that 228 (57.3%) out of 398 genes differentially expressed between the strains were involved in metabolism, with a number of biological processes identified. The most prominent processes affected were generation of precursor metabolites and energy metabolism, lipid metabolism, nucleic acid metabolism, biopolymer metabolism and sulfur metabolism . In addihttp://www.biorag.org). This analysis indicated major changes in multiple pathways, including xenobiotic metabolism, complement cascades, glutathione, tricarboxylic acid (TCA) cycle, fatty acid metabolism and others (While gene ontology (GO) analysis and functional annotation were pointing consistently to differences in metabolic responses between the mouse groups, they did not indicate which individual pathways were affected. Therefore we used pathway mapping to identify these. In addition to functional classification, DAVID mapped the genes successfully to pathways . In addid others . It is cNMR-based metabonomics provides this alternative, as it integrates the responses of all different organs to the altered GHR signalling on a whole-body level and thus offers a direct, cost-effective and non-invasive avenue to monitor actual metabolic changes in a subject over several months. Therefore we used NMR metabonomics to provide a global metabolite analysis of the GHR mutant mice.−/− mice was not analyzed with NMR spectroscopy because of difficulties in obtaining samples from those animals. Only a few systematic differences were detected by visual inspection, as can be seen in the comparison of urine spectra at four months of age, depicted in http://mdl.imv.liu.se, http://www.hmdb.ca, http://www.bmrb.wisc.edu), and additional information obtained from high-resolution homo- and heteronuclear two-dimensional (2D) correlation spectra of representative urine samples of the wild-type and 391 mouse strains. To facilitate chemometric analysis and to reduce the complexity of the NMR spectra, all 1D spectra were data reduced to integral segments (“buckets”) with a width of 0.05 ppm.500 MHz one-dimensional (1D) proton NMR spectra of urine from wild-type mice (n = 16) and GHR mutant mice (n = 39) were compared. Urine from GHRPrincipal components analysis (PCA) is a standard technique of pattern recognition and multivariate data analysis. The technique is particularly suited to the analysis of a set of data where each individual measurement contains itself a multitude of data – as is the case in a series of NMR spectra, containing signals from hundreds of individual metabolites. PCA compares all measurements with each other and explains the variation inherent in the data set in terms of artificial components called principal components (PCs). The first principal component (PC1) is reponsible for the largest amount of variation in the data, the second principal component is orthogonal to PC1 and explains the largest amount of yet unexplained variation, and so forth with higher PCs. In effect, the first two PCs explain the vast majority of variation present in the data. In the resulting scores plot , each daPCA was performed on urine to find if it was possible to distinguish the three different mouse strains on the basis of their NMR spectra. A preliminary PCA showed that the urine samples were contaminated by ethanol, possibly from sterilisation of the urine collection vials (data not shown). Thus, a second data reduction and PCA was performed, in which the spectral regions containing ethanol signals were excluded. The PCA scores plot of the first two principal components showed ce.g. genotype or health state) in the data. Thus, the class membership of each sample must be known and is provided in form of a Y-table. PLS-DA then performs a regression of the original data against the Y-table to maximise separation between the individual classes. In our case, the group identity of the three mouse strains was used in the Y-table. The PLS-DA scores plot of the first two partial least squares (PLS) components, PLS1 and PLS2, was performed. In contrast to PCA, which is an unsupervised multivariate statistical classification method that works to explain maximum variation between samples, PLS-DA is a supervised method that explains maximum separation between pre-defined classes and trimethylamine-N-oxide (TMAO). Taurine was less prominent in the spectra of the 391 and 569 mutants than in the wild-type mice. In contrast TMA and TMAO were present in higher concentrations in the spectra of the mutant mice as compared to the wild-type. Other compounds discriminating between the three strains were creatine, creatinine, allantoin, and hippurate, all of which increased in the mutant mice. In contrast, the concentrations of citrate and 2-oxoglutarate were decreased in the mutant mice. Other compounds with significant loadings coefficients in PLS1 or PLS2 that could be identified are listed in In addition to the PLS-DA comprising all three mouse genotypes , two-wayInterestingly, while the positions of the wild-type mice and the 391 mutants in the PLS-DA scores plot remain constant, the position of the 569 mutant mice is clearly dependent on the age of the mice: The samples of the younger 569 mutant mice with an age up to 6.5 months cluster in the PLS1-PLS2 scores plot in the metabolic space close to the wild-type mice , while tAfter establishing the effects of the GHR mutations on the metabolite profile of mouse urine we wanted to determine if these mutations manifest in the metabolite profile of liver, as this was the subject of the microarray analysis and a major GH target tissue. We specifically wanted to compare the taurine status in the livers of wild-type mice to their counterparts from the 569 and 391 mutants, as taurine status relates to obesity 700 MHz 1D high-resolution magic angle spinning (HR-MAS) proton NMR spectra of intact liver tissue from four months old wild-type mice (n = 6), mutant 569 mice (n = 3), mutant 391 mice (n = 6), and wild-type mice fed on a high-fat diet (n = 3) were measured. An example spectrum is shown in versus PC2 . Thus, a second data reduction and PCA was performed, in which the spectral regions containing these signals were excluded. The PCA scores plot of PC1 rsus PC2 showed crsus PC2 reveals In this paper we have shown that metabonomics can identify significant metabolic changes in animal models exhibiting altered signalling by the growth hormone receptor and that these changes correlate with altered expression of key metabolic enzymes in the liver, the major GH target organ. While both metabonomics and microarray approaches are very different, both allowed identification of groups of animals according to their genotype. This was achieved by using multivariate statistical tools, which identified markers (metabolites and genes) correlating with a particular genotype. As the strains of mice used in this study have the same C57Bl/6J background and differ only in the GHR sequence The observed separation of the mouse strains in PCA, PLS-DA and GeneRaVE, reflects the observed phenotype and gene expression, with the 569 mutant locating between the wild-type and the 391 mutant. The 569 mutant, possessing only partial STAT5 signalling ability, was generally not well separated from the wild-type or the 391 mutant. Moreover, while the metabolism in mutant 391 is clearly different from that of the wild-type littermates at 4 monCsad (cysteine sulfinic acid dehydrogenase) as one of the marker transcripts decreased in the mutant mice. As CSAD is the rate-limiting enzyme in taurine biosynthesis Csad transcript levels were decreased in STAT5A−/− mice The NMR-metabonomic analysis identified taurine as the most prominent metabolite able to distinguish between wild-type and mutant mice, with urinary taurine levels being decreased in mutants. This was in agreement with the microarray analysis, which identified Taurine is an important metabolite involved in the bile acid synthesis pathway Most significantly, a vicious cycle involving obesity and taurine has recently been discovered Csad are found only in the liver and kidney i.e. taurine levels are reduced in liver tissue of 391 mutant mice when compared to lean wild-type mice . This result demonstrates directly that the reduced urinary taurine levels in the mutant mice reflect decreased hepatic taurine biosynthesis. In contrast, taurine levels are increased in obese (fat fed) wild-type mice compared to their lean counterparts . This shows that the effects of GHR mutation are clearly different from the effects of obesity and that the obesity in the mutant mice is likely to be a consequence of the low taurine levels and the GHR mutations rather than the converse. It is plausible that the increase in hepatic taurine levels seen in fat-fed wild-type mice is a compensatory mechanism to overcome the increased supply of dietary triglycerides by promoting β-oxidation.High expression levels of Indeed, while a reduction in β-oxidation would be expected in obesity, we have observed an increase in expression of a number of genes involved in fatty acid β-oxidation. Similar observations were made previously by other groups The increased lipid transport in the GHR mutant mice is likely to create an increased demand for lecithin, which can be satisfied by increased lecithin synthesis via glycine and choline, causing an increased flux through the choline metabolism. This interpretation is corroborated by increased urinary levels of TMA, dimethylamine (DMA) and TMAO. Indeed, these three metabolites are the second-most significant metabolites in the metabonomic analysis after taurine. They can be made either via endogenous pathways from choline or from dimethylglycine , for which transcript levels were increased from 3.8 fold in mutant 569 to 11 fold in mutant 391 and GHR−/− mice. This would lead to an increase in nitrite levels and consequently ammonia levels, which can enter the urea cycle, further increasing urea excretion.One of the other categories changed in Gene Ontology analysis was the metabolism of nucleic acids and its components . While wIn this paper we have shown that truncations in the intracellular domain of the GHR that impair STAT5 signaling in particular cause dramatic metabolic changes, leading to obesity, and involving the metabolism of the whole body, as evidenced by their consistency between liver tissue and urine. The most prominent hallmarks of these changes are a decrease in taurine levels and changes in choline metabolism, characterized by increased levels of TMA, TMAO and DMA. Both changes are connected via lipid transport pathways and amino acid metabolism and support a potentially important role of taurine in regulating β-oxidation.We have also has shown how various parts of metabolism interact with each other in response to altered hormonal levels. The effects of GH on metabolism were always described as complex, but they can be unraveled when global metabolism analysis methods are used.The multivariate statistical techniques analysing metabonomic and gene expression data implicated the same biochemical pathways. The convergence of both methods on the same biochemical pathways underlines the complementarity of both techniques and exemplifies the power of this combined approach. Our results demonstrate that metabonomic data can be successfully linked with microarray results to develop a coherent picture of physiological changes in response to a varying genetic background, allowing a deeper understanding of systems biology. Future studies combining more detailed genetic expression profile data with established data of metabolic fluxes in tissues, metabolic modelling, and metabonomic data will be useful in developing a more detailed understanding of how changes in gene transcription lead to the observed metabolic and systemic changes.ab libitum under a 12 hr light/dark cycle at 20–22°C. Prior to urine collection, animals were fasted overnight (16 hours), with water being provided ab libitum. Urine samples were taken from 55 male mice aged from 2 to 12 months. The mice were either wild-type C57Bl/6J (n = 16), or had a truncation in the GHR at lysine 569 together with conversion of tyrosines 539 and 545 to phenylalanine (mutant 569) (n = 27) or had a truncation in the GHR at lysine 391 (mutant 391) (n = 12). In addition, three animals/strain were used for gene expression analysis using microarrays (see below). In addition, a second cohort of male mice was used for metabonomic analysis of liver tissue. This cohort comprised six wild-type C57Bl/6J mice fed on standard chow, three wild-type mice fed on a special high-fat diet, three mutant 569 mice and six mutant 391 mice, both fed on standard chow. Mice were sactrificed at four months of age, the left lateral lobe of the liver was removed immediately after killing, snap frozen in liquid nitrogen, and stored at −80°C until required. Creation of the two mutant strains is described in Rowland et al.−/− mice in Zhou et al.Animals were housed in an approved facility and treated as per university guidelines with ethics approval from the University of Queensland Animal Ethics Committee and the Australian Office of the Gene Technology Regulator. Water and standard feed pellets were available Adipose tissue was dissected from two separate areas. Subcutaneous fat pads were obtained from the side of the back legs and body, and renal adipose tissue was dissected from around the kidneys. Each of the fat pads was weighed, and their weight relative to the whole body weight is reported in the figures. For each time point 4–8 animals/strain were sacrificed.et al.Mice were sacrificed at 42 days of age and the livers were dissected directly into RNAlater solution . Total RNA was extracted using RNAqueous kit (Ambion) according to the manufacturer's instructions, quality of RNA was confirmed by spectrophotometry and gel electrophoresis. Probes were prepared as described in Rowland The increases and decreases, as well as signal log ratios were identified following standard Affymetrix protocol with MAS 5.0, and then the comparisons were loaded into DMT (Affymetrix), which allowed identification of transcripts changing in the same direction and the number of comparisons in which they change as described in https://www.bioinformatics.csiro.au/GeneRave/index.shtml). Genes were identified whose expression values could be used to distinguish between the sets of array data. These genes were removed from the dataset and a further set of classifiers were obtained. This iterative process was continued until the predictive power of the dataset was exhausted (11 rounds). Default settings for GeneRaVE were used (kbess & bbess), as described in the accompanying software vignette. The function ‘deleteRepeat’ was used to extract multiple classifiers from the data using the HGmultc method for fitting a multiclass logistic regression models to our data. Ten-fold cross validation was also used to assess the error associated with the chosen classifiers.Microarray data were normalised using RMA http://www.biorag.org) Functional classification and pathway analysis was performed on the 399 genes identified in the previous study http://www.ncbi.nlm.nih.gov/geo/), with accession numbers GSM15488, GSM15489, GSM15490, GSM15491, GSM15492, GSM15493, GSM15494, GSM15495, GSM15496, GSM15497, GSM15498, and GSM15499.Array data are available from the NIH Gene Expression Omnibus database for calibration of the 1H and 13C chemical shifts.Urine was collected from animals into glass containers and frozen immediately at −20°C. Samples were prepared for NMR by diluting 200 μl mouse urine with 300 μl 0.1 M sodium phosphate buffer, pH 7.4, and 50 μl DNMR spectroscopy of mouse urine samples was carried out on a Bruker AV500 NMR spectrometer equipped with a 5 mm self-shielded z-gradient triple resonance probe and a sample changer. All spectra were recorded at 298 K. 1D proton spectra were measured with 256 scans and 64k resolution over a spectral width of 14 ppm. To ensure solvent suppression of the water signal, 1D spectra were measured with the noesypr1d pulse program (Bruker pulse program library), using a mixing time of 150 ms. The water signal was additionally suppressed by low-power continuous irradiation on the water resonance during the mixing time and the relaxation delay of 2.3 s.13C-heteronuclear single-quantum correlation (13C-HSQC), 13C-heteronuclear multiple bond correlation (13C-HMBC) and 13C-HSQC-TOCSY.In addition, the following 2D spectra were recorded on representative samples of wild-type and 391 mice to facilitate the assignment of signals in the 1D spectra: total correlation spectroscopy (TOCSY), double-quantum filtered correlation spectroscopy (DQF-COSY), 1H carrier frequency was positioned on the water resonance. TOCSY −1 either side of a 10 kHz 3-9-19 binomial pulse. TOCSY experiments used a MLEV17 sequence In all 2D spectra the 13C-HSQC 1H and 100 ppm for 13C with the 13C carrier frequency positioned at 45 ppm. 13C-HSQC-TOCSY 1H and 13C, respectively. Isotropic mixing was achieved with a DIPSI2 sequence 13C-HMBC 1H and 13C, respectively. A relaxation delay of 2.0 s was used, and the transfer delay was optimized for indirect coupling constants of 6 Hz.n-acquisition] of 20 ms duration (n = 80) to suppress signals from macromolecules and other substances with short T2 values. The refocusing delay τ was set to 125 μs to match the rotation speed of the rotor. Proton 1D spectra were measured unlocked with 128 scans and 32k resolution over a spectral width of 15 ppm. The water signal was additionally suppressed by continuous low-power irradiation on the water resonance during the relaxation delay of 3.0 s. The total acquisition time for each spectrum was 11 min.For each sample about 50 mg of liver tissue were placed in a 4 mm reduced volume 50 μl zirconia rotor with a teflon top insert and a Kel-F rotor cap . All experiments were carried out on a Bruker AV700 spectrometer, equipped with a 4 mm HR-MAS triple resonance probe with z-gradients, at a sample spinning rate of 8 kHz. 1D spectra were aquired with the standard cpmgpr1d pulse program, using a rotor-synchronised Carr-Purcell-Meiboom-Gill sequence [90°-(τ-180°-τ)All NMR spectra were processed with TopSpin . 1D spectra were processed to a size of 64k after multiplying with an exponential window function. Spectra were manually phase and baseline corrected, and chemical shifts were referenced to the TSP signal in the case of urine spectra or lactate in the case of HR-MAS spectra of liver tissue.Homonuclear 2D spectra were processed to a size of 4096×1024 data points. Prior to Fourier transformation, a Lorentz to Gauss transformation with a line broadening factor of of −10 Hz and a GB of 0.1 was applied in the direct dimension, while in the indirect dimension data were linearly predicted, using 30 poles, and then multiplied with a squared sine bell function, shifted by π/2.13C-HMBC spectra after Fourier transformationHeteronuclear 2D spectra were processed in a similar fashion to a data matrix size of 2048×512 data points, except that the window function in the direct dimension was a squared sine bell function, shifted by π/2. A magnitude calculation was applied in the indirect dimension to all The 1D spectra of mouse urine were data reduced over the shift range of δ = 10.0–0.5 ppm into spectral integral regions (“buckets”) of 0.05 ppm width, using AMIX3.6.6 . The regions δ = 4.6–5.0 ppm and δ = 5.5–6.5 ppm were excluded to avoid artefacts from varying water suppression and cross-saturation through chemical exchange in the urea signal. NMR signals were integrated for each region and normalised to the total spectral intensity over the whole spectrum. A second bucket table was constructed in a similar fashion, additionally excluding the regions of 1.22–1.16 ppm and 3.7–3.6 ppm to exclude ethanol signals.A similar procedure was applied for the HR-MAS spectra of mouse liver tissue. Buckets ranged from δ = 10.0–0.2 ppm with a bucket width of 0.1 ppm. The region δ = 4.5–6.5 ppm was excluded to avoid artefacts from varying water suppression. A second bucket table was constructed in a similar fashion, additionally excluding the regions of δ = 1.9–2.5 ppm, and δ = 1.2–1.5 ppm to avoid artefacts from shifts in the signals of lactate and glutamate/glutamine that otherwise dominated the analysis.PCA was performed in AMIX, using the data from the bucketed 1D spectra of mouse urine. A first PCA model was constructed using all samples. The scores plots of PC1 versus PC2 and PC1 versus PC3 were inspected for differences between the different mouse strains. Samples that constituted outliers were identified in AMIX by cross-validation, removed from the model, and a further round of PCA was performed. The refined model contained seven principal components (PCs) and comprised data from 44 urine samples.A second PCA model was constructed in a similar fashion from the bucket table, additionally excluding ethanol signals. The final model contained seven PCs, explaining 90.8% of total variance, and comprised data from 48 urine samples.PCA was also performed similarly with the data from the bucketed 1D spectra of mouse liver tissue. The PCA model contained all samples and three PCs. As this analysis was dominated by large variations in the signals of lactate and glutamate/glutamine, a refined PCA was performed, additionally excluding these signals. The final model contained three PCs, explaining 92.0% of total variance, and comprised data from 18 tissue samples.PLS-DA was performed in AMIX, using data from the bucketed 1D spectra of urine and group IDs of 0 (wild-type mice), 1 (569 mice), and 2 (391 mice) as Y table. Buckets containing signals of water, urea and ethanol were excluded from the analysis as described above. Samples that constituted outliers were identified in AMIX by cross-validation, removed from the model, and further round of PLS-DA was performed. The refined model comprised data from 54 urine samples and contained seven PLS components, explaining 84.2% of total X-variance and 87.5% of total Y-variance with an rmsec value of 0.249. In addition, the mouse strains were compared pairwise in three separate PLS-DAs. These analyses were performed similarly to the PLS-DA comparing all three mouse strains.Metabolic trajectories for each mouse strain were constructed by averaging the PLS1 scores for groups of mice with similar age. Age stages where only one single mouse was available were included in the next closest age group if their ages did not differ by more than half a month, otherwise they were omitted from the analysis. In addition, the 2σ standard deviation from the mean PLS1 scores was calculated to indicate the possible bandwidth of the metabolic trajectories.1H and 13C chemical shifts and coupling patterns with corresponding values of metabolites from previously published data http://www.bmrb.wisc.edu), the Metabolomics Database of Linkoping (MDL) (http://mdl.imv.liu.se), or the Human Metabolome Data Bank (http://www.hmdb.ca). In addition, the information contained in the high-resolution 2D NMR spectra was used for the identification of metabolites.Metabolites were identified in the NMR spectra by comparing their Figure S1Metabolic Pathways affected by GHR mutations. Individual enzymes are depicted in italics, and sections of metabolism in bold and boxed. Metabolites with increased concentration in the mutants, as detected by the metabonomic study, are indicated in green and marked by plus signs, whereas metabolites with decreased concentration in the mutants are indicated in red and marked by minus signs. Enzymes in the pathways with increased or decreased expression levels are indicated similarly. The feedback loops between taurine levels, CDO levels, β-oxidation and obesity are indicated by dashed connections in blue. Arrowheads indicate positive feedback and bar heads negative (inhibitory) feedback. The two negative feedback connections beween taurine and fat levels form a vicious cycle. Enzyme abbreviations: Csad - cysteine sulfinic acid decarboxylase, Pdha1 - pyruvate dehydrogenase alpha 1, Idh2 - isocitrate dehydrogenase 2, Suclg1 - succinate-CoA ligase, Sdhb - succinate dehydrogenase complex, subunit B, Fmo3 - flavin containing monooxygenase 3, LCAT - lecithin cholesterol acyltransferase, and CDO - cysteine dioxygenase 1.(0.63 MB TIF)Click here for additional data file.

Specifically sought was a protocol that allows for efficient transduction with minimal ex vivo manipulation without serum or other reagents of animal origin.Hematopoietic stem cells (HSC), in particular mobilized peripheral blood stem cells, represent an attractive target for cell and gene therapy. Efficient gene delivery into these target cells without compromising self-renewal and multi-potency is crucial for the success of gene therapy. We investigated factors involved in the + cells as the most clinically relevant target, we systematically examined factors including the use of serum, cytokine combinations, pre-stimulation time, multiplicity of infection (MOI), transduction duration and the use of spinoculation and/or retronectin. A self-inactivating lentiviral vector (SIN-LV) carrying enhanced green fluorescent protein (GFP) was used as the gene delivery vehicle. HSCs were monitored for transduction efficiency, surface marker expression and cellular function. We were able to demonstrate that efficient gene transduction can be achieved with minimal ex vivo manipulation while maintaining the cellular function of transduced HSCs without serum or other reagents of animal origin.Using commercially available G-CSF mobilized peripheral blood (PB) CD34+ cells.This study helps to better define factors relevant towards developing a standard clinical protocol for the delivery of SIN-LV into CD34 Gene therapy holds promise for the cure of various inherited and acquired diseases, as evidenced by the success in the treatment of X-linked severe combined immunodeficiency (SCID-X1) in vitro, harbor a higher proliferative capacity and are more susceptible to gene transduction Various sources of HSCs have been used in research and clinical studies including cord blood (CB), adult bone marrow (BM) and mobilized peripheral blood (PB) HSCs. Although CB HSCs are relatively easier to manipulate ex vivo manipulation induces entry into the cell cycle resulting in proliferation. This has, in many cases, been shown to decrease the frequency of primitive HSCs in culture and compromise their long-term repopulating ability ex vivo manipulation of the target cells with the aim of preserving their cellular functions. Although efficient lentiviral transduction of human HSCs may not necessarily require proliferation itself, cytokine stimulation to activate the cells to enter cell cycle may improve their susceptibility to transduction Prolonged ex vivo manipulation of human HSCs for clinical application be carried out in the absence of animal products.Reagents of animal origin, in particular fetal bovine serum (FBS), are commonly used in primary cell culture for both research and clinical trials, particularly in retroviral gene therapy applications ex vivo transduction of CD34+ (G-CSF) mobilized PB HSCs and contribute to the development of a clinically relevant transduction protocol.Currently, there is great variation among research and clinical groups regarding optimal transduction conditions for efficient lentiviral gene delivery into target HSCs + cells (cryopreserved) were obtained from either Lonza or StemCell Technologies . Briefly, mononuclear cells were obtained from a peripheral blood collected through apheresis. CD34+ cells were then isolated from the MNC population by positive selection using immunomagnetic cell separation procedures. Cells were cryopreserved in a 1.8 ml solution of 50% IMDM, 40% FBS, 10% DMSO (0.2 µm filtered), and shipped on dry ice. All recombinant human cytokines used in primary cell culture, including stem cell factor (SCF), thrombopoietin (TPO), flt3/flk2 ligand (Flt3L) and interleukin-3 (IL-3) were obtained from R&D Systems . Unless otherwise stated, a standard cytokine mix of SCF, Flt3L and TPO at 50 ng/ml each was used. Various culture media were used, including IMDM , X-vivo 10 , Stemline , Stemline II , StemSpan , HPMG , and CellGro-SCGM .Human primary G-CSF mobilized peripheral blood CD346/T225 flask and cultured overnight. The next day cells were transfected in the presence of 10% FBS with 30 µg of transfer vector plasmid and 37.5 µg of packaging mix . Media was removed 4 h post transfection, cells rinsed and serum free media added. Virus was harvested 24 h later, centrifuged and filtered through 0.2 µm pore size. Virus was harvested in serum free X-vivo 10 unless otherwise stated. Viral titre was determined by transduction of HT1080 cells with 4-fold serial dilutions of VCM (neat to 1/4096) in a 96-well format in triplicate. 72 h post transduction, cells were detached with trypsin and transferred to a 96-well non-tissue culture treated plate for FACS analysis of GFP expression. Viral titre (ivp/ml) was calculated using the percentage of GFP expressing HT1080 cells using the formula as follow: Titre (ivp/ml) equals to (cell number×percentage of GFP+ cells×Dilution factor) divided by VCM volume (ml) A four-plasmid self-inactivating lentiviral vector system was obtained from Cell Genesys . A transfer vector encoding enhanced green fluorescent protein (pKC.MND-eGFP-neo) was used throughout this study . GFP, wh+ cells were thawed, counted, assessed for viability and seeded at 0.5 to 2×105 cells/ml in various culture media (as specified in each experiment). Media was supplemented with a number of cytokine combinations including SCF, Flt3L, TPO and IL-3 at different concentrations (as specified in 2) , with or without spinoculation , at various multiplicity of infection (MOI) and differing transduction durations. Cells were harvested 48 h post transduction for FACS analysis. GFP and cell surface marker expression were determined using a FACSCanto II with FACSDiva software . Transduction efficiency was estimated as the percentage of GFP positive cells. The panel of surface markers used to assess the differentiation state of CD34+ cells in culture included CD34, CD38, CD90, CD117, CD135 (BD Biosciences) and CD133 . An Aldefluor kit was used to measure aldehyde dehydrogenase activity, another marker for HSCs. CountBright beads were added to each FACS tube to allow the estimation of cell concentration. Unless otherwise stated, each experiment was performed with three biological replicates for each condition and FACS analysis for GFP and CD34 expression only was performed in duplicate for each replicate. A summary of experimental procedures is shown in CD34+ cells were assessed following lentiviral transduction. Cells were plated at 1×103/ml in 1% methylcellulose supplemented with SCF 50 ng/ml, GM-CSF 10 ng/ml, IL-3 10 ng/ml and erythropoietin 3 U/ml . Granulocyte-macrophage colony-forming units (CFU-GM), erythroid burst-forming units/cluster-forming units (BFU-E/CFU-E), and granulocyte, erythrocyte, megakaryocyte and macrophage colony-forming units (CFU-GEMM) consisting of more than 40 cells were scored at days 10 to 14.The clonogenic activities of CD34Statistical analysis was carried out using GraphPad Prism 5 software. Data sets were analysed for statistical significance by One-way ANOVA followed by post hoc Tukey test or Mann-Whitney two tailed test, unless otherwise stated. Results are presented as mean±SD (standard deviation).+ growth, maintain multi-potency and to allow efficient gene delivery via lentiviral transduction. Cryopreserved G-CSF mobilized PB CD34+ cells were thawed and seeded at 1-2×105cells/ml in various serum free media supplemented with a combination of cytokines, either as recommended by the manufacturer or a “standard” cytokine combination used in our laboratory . IMDM with 10% FBS, a standard culture medium for primary CD34+ cells, was used as the serum-containing control. CD34+ cells were assessed via FACS analysis at day 4 and/or day 7 for cell expansion using counting beads and the differentiation status of the cells was determined by the expression of various primitive markers . Aldehyde dehydrogenase, the expression of which is elevated in primitive cells + cells was not markedly different between the media tested, with the exception of CellGro, which resulted in lower expansion over the 4-day culture period or serum containing medium (IMDM+10% FBS) supplemented with either a triple cytokine combination or a combination of two cytokines as previously used in a phase II retroviral/CD34+ clinical trial by this group (SCF 50 ng/ml and TPO at 100 ng/ml) (manuscript submitted). Cells were transduced on retronectin coated plates (5 µg/cm2) at an MOI of 9 and transduction efficiency was assessed via GFP expression 48 h post transduction. Overall, a higher level of transduction was seen in serum free cultures: 24.8±1.0% in serum-free versus 17.1±1.5% in serum containing media in the presence of two cytokines (p<0.05); and 22±0.6% in serum-free versus 19.2±0.8% in serum containing media with the triple combination (p>0.05) . While t+/CD38−) and late (CD34+/CD38+) progenitor cells.Two serum free media, X-vivo 10 and Stemline II, were chosen for further assessment based on the need for serum-free and animal origin-free reagents, availability of GMP grade products for clinical application and pre-existing data. Stemline II was selected over Stemline due to the manufacturer's claims of a high capacity for the maintenance and expansion of both early . Cells were then transduced with virus containing media (VCM) containing GFP lentivirus harvested in either X-vivo 10 or Stemline II at an MOI of 9. Transduction was performed on retronectin coated plates via spinoculation. Cells were analyzed by FACS analysis for EGFP expression and cell surface marker expression 48 h post transduction. A higher percentage of transduction was seen in cultures supplemented with the triple cytokine combination as compared to any combination of two (p<0.05), irrespective of the basal media or tissue culture treated plates with and without spinoculation. As shown in The necessity for the use of retronectin and spinoculation to facilitate transduction was assessed to further streamline the transduction protocol for possible clinical application. Following 24 h pre-stimulation , CD34+ cells was assessed. Cells were pre-stimulated for 24 h and transduced on retronectin coated plates using 2-fold serial dilutions of VCM resulting in MOIs ranging from 2 to 12. When analysed 48 h post transduction, an increase in the percentage of cells transduced correlated well (R2 = 0.9655) with the increase in MOI at an MOI of 9 and analysed for GFP and surface marker expression 48 h post transduction. Transduced cells were then plated into methylcellulose cultures to measure the effects of each cytokine combination on the clonogenic capacity of the cells. Similar levels of transduction were seen with all combinations (ranging from 23.7% to 28.6%) with the exception of the IL-3 containing cytokine mix, in which transduction was significantly higher at 53.4±1.2% . No marked difference in cell viability was observed between the conditions. Although the addition of IL-3 increased the transduction level, it may negatively act to induce cell differentiation ex vivo, thereby reducing the multi-potency of the CD34+ cells. Interestingly, increased cytokine concentrations did not provide any advantage over the low concentration conditions in terms of either transduction –based gammaretroviral vectors and human immunodeficiency virus (HIV)–based lentiviral vectors are the two most commonly used retroviral vector systems used in gene therapy. Theoretically, both of these integrative viral vectors may trigger oncogenesis as a consequence of insertional mutagenesis, as shown in early clinical trials in which gamma-retrovirus caused overt leukemia in some patients + cells with minimal ex vivo manipulation under serum-free culture conditions, without altering their proliferation potential or ability to maintain multi-lineage differentiation. The removal of FBS from cell culture eliminates the safety concerns associated with the use of such products and provides for a more consistent outcome by removing likely batch variations in FBS. Serum-free culture conditions have been increasingly used for clinical gene transfer + cell survival or growth in vitro and maintains the primitiveness of these cells as measured by aldehyde dehydrogenase expression. This study also demonstrates that serum-free culture supports lentiviral gene delivery into primary cells as well as, if not better, than serum containing media. This is further evidence to support the use of serum-free ex vivo culture as a practical approach for gene therapy applications.We demonstrated that a SIN lentiviral vector can readily transduce G-CSF mobilized PB CD34ex vivo manipulation by reducing culture time and the concentration of stimulatory cytokines in the culture media is an important step. Minimal cytokine stimulation of HSCs may help preserve stem cell function and provide for the effective “activation” of stem cells that renders them susceptible to transduction. Although other reports demonstrate transduction of human CD34+ cells in the absence of cytokine pre-stimulation, increased levels of gene transfer were consistently observed if the cells were cultured with well-defined cytokines To maintain the biological function of HSCs, namely self-renewal and multipotency, minimizing It has been demonstrated that the MOI at the time of transduction closely correlates with the copy number in target cells ex vivo manipulation of primary CD34+ cells for use in clinical applications with the primary aim of maintaining safety and efficacy. Critical parameters, such as culture conditions free of serum and other products of animal origin, pre-stimulation and cytokine combinations, transduction, MOI and virus exposure period were assessed. Our study supports the practicality of using a transduction protocol that employs short to no pre-stimulation with low cytokine concentrations, low MOI and short virus exposure times under serum-free culture conditions. Further detailed analysis of integrated viral copy number and evaluation of transduction protocols would be required in the context of the intended clinical application along with functionality testing for the transduced cells.In summary, our study investigated the possibility of minimizing the

Over the past decade there has been increasing interest in the use of lactic acid bacteria as mucosal delivery vehicles for vaccine antigens, microbicides and therapeutics. We investigated the mechanism by which a mucosal vaccine based in recombinant lactic acid bacteria breaks the immunological tolerance of the gut in order to elicit a protective immune response.L. plantarum breaks the oral tolerance of the gut by stimulating human intestinal epithelial cells, peripheral blood mononuclear cells and monocyte derived dendritic cells and measuring cytokine production. We show that the leader peptide of OspA targets the protein to the cell envelope of L. plantarum, and it is responsible for protein export across the membrane. Mutation of the lipidation site in OspA redirects protein localization within the cell envelope. Further, we show that lipidated-OspA-expressing L. plantarum does not induce secretion of the pro-inflammatory cytokine IL-8 by intestinal epithelial cells. In addition, it breaks oral tolerance of the gut via Th1/Th2 cell mediated immunity, as shown by the production of pro- and anti-inflammatory cytokines by human dendritic cells, and by the production of IgG2a and IgG1 antibodies, respectively.We analyzed how the lipid modification of OspA affects the localization of the antigen in our delivery vehicle using a number of biochemistry techniques. Furthermore, we examined how OspA-expressing L. plantarum modulates the immune response to this antigen through a Th1/Th2 immune response.Lipid modification of OspA expressed in Lactobacillus plantarum belongs to the natural flora of the vagina and the gastrointestinal tract. We have recently developed an oral vaccine based in L. plantarum expressing the outer surface protein A (OspA), a lipoprotein from Borrelia burgdorferiOver the past decade there has been increasing interest in the use of lactic acid bacteria (LAB) as mucosal delivery vehicles for vaccine antigens, microbicides and therapeutics L. plantarum.Evidence suggests that the peptidoglycan layer of some LAB promote natural immuno-adjuvanticity L. plantarum expressing the OspA lipoprotein induced a protective, IgG-based, immune response in mice L. plantarum expressing OspA lipoprotein in breaking the oral tolerance of the gut and if this immune response was dependent on the lipid modification of OspA.The normal immune response to harmless gut antigens and commensal bacteria is the induction of a local and systemic immunological tolerance, known as oral tolerance The procedures involving human blood were approved by the Institutional Review Board (IRB) of the University of Tennessee Health Science Center, under the provisions of the Department of Health and Human Services Regulations for Protection of Human Subjects (45 CFR 46) and similar FDA Regulations (21 CFR 50 and 56). All participants provided written informed consent. The procedures involving mice were in accordance with the Animal Welfare Act and the Public Health Service Policy on Humane Care and Use of Laboratory Animals and were approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Tennessee Health Science Center.L. plantarum was grown at 30°C in LM medium , supplemented with 10 µg/ml of chloramphenicol (Cm). E. coli was grown at 37°C in TBY medium . T84 human colonic carcinoma epithelial cells were obtained from the American Type Culture Collection . T84 cells were maintained at 37°C, 5% CO2 in DMEM-F12K medium modified by ATCC, containing 10% FCS, 100 U/ml penicillin and 100 µg/ml streptomycin.ospA gene from B. burgdogferi in L. plantarum was previously described 17 with Asp17. Expression vectors were then transformed into L. plantarum strain 256 to obtain the clones LpA and LpAD17, respectively. Protein expression was checked by immunoblot as follows. Recombinant L. plantarum cells were disrupted with a French® press , supernatants were analyzed on a 12% denaturing polyacrilamide gels and electrotransferred to a polyvinylidene difluoride membrane for analysis with an OspA-specific monoclonal antibody (mAb 184.1). To evaluate export and lipidation of OspA and its mutant expressed by recombinant Lactobacillus, we performed Triton X-114 phase partitioning L. plantarum cultures were grown overnight at 30°C, harvested and resuspended to an OD600 of 1.0 in PBS. Bacteria were disrupted with a French® press and the insoluble material was separated from the cytosol fraction by centrifugation. This cell envelope fraction was suspended in 1 ml of ice-cold 2% Triton-X114 (v/v) in PBS. The fractions were rotated end over end at 4°C for 1 h and were phase-separated by warming the solution for 30 min in a water bath at 37°C followed by centrifugation for 15 min at 25°C. The separated detergent and aqueous phases were each washed three times. The solutions were then rewarmed and recentrifuged as described and the detergent and aqueous phases were collected. Ten (10) µl of each phase was analyzed on 15% denaturing polyacrylamide gels, electrotransferred to PVDF filters, and used for immunoblot analysis. OspA-specific monoclonal antibody LA2.2 (1∶100) was used as primary antibody, goat anti-mouse IgG (H+L) conjugated to alkaline phosphatase was used as secondary antibody and the immunoblot was developed by BCIP/NBT™ . The protein bands corresponding to each OspA antigen were quantified by densitometry using a Multi Image™ Light Cabinet and the AlphaEase™ software . The results were plotted as a percentage of the total OspA content for each recombinant Lactobacillus.A vector that expresses the full-length ospA gene from B. burgdogferi in Escherichia coli (EcA) was previously described mutOspA that expresses the OspA mutant (mutOspA), we designed primers to amplify the B. burgdorferi ospA gene lacking the signal sequence and we cloned the PCR fragment into pET9c. The expression vectors were transformed into E. coli BL21 (DE3) pLysS, the recombinant proteins were purified and the endotoxines were removed using the Detoxi-Gel™ Endotoxin Removing Gel .A vector that expresses the full-length Lactobacillus cultures were grown overnight at 30°C, harvested and resuspended to an OD600 of 1.0 in TGE buffer . For cell wall removal, aliquots of 1 ml were treated with 250 KU/ml of lysozyme for 45 min at 37°C. Protoplasts and cell wall fractions were separated by centrifugation and the supernatants containing the cell walls collected. Protoplasts were washed, resuspended in TED buffer and disrupted with a French® press. Supernatants were ultracentrifugated for 1 h to separate membranes from cytosol fractions. Three (3) µg of each fraction was analyzed on 15% denaturing polyacrylamide gels, electrotransferred to PVDF filters and used for immunoblot analysis with mAb LA2.2 as described above.Lactobacillus were treated with and without 250 kU/ml of Lyz in TGF buffer for 30 min. Cells were washed and resuspended in TGF buffer with mAb LA2.2 (1∶100) for 1 h at room temperature, washed three times with 500 µl TGF buffer and resuspended on 100 µl of the same buffer. Aliquots of 10 µl were placed on slides and air-dried at 37°C for 1 h. Slides were incubated with Alexa Fluor 488-labeled goat anti-mouse IgG antibody (1∶250) in 100 µl TGF buffer at 23°C for 1 h with intermittent gentle mixing. After incubation, slides were washed three times with TGF buffer and fixed with 4% PBS–buffered formaldehyde for an additional 15 min at room temperature. Labeled cells were mounted in VectaShield medium containing 4,6-diamidino-2-phenylindole and visualized using a Zeiss inverted Axiovert 200 motorized microscope and analyzed using the Axiovision 4.3 software.Recombinant Lactobacillus cell envelope, we developed an indirect live-cell enzyme-linked immunosorbent assay (lcELISA). Lactobacillus cultures were grown overnight at 30°C, harvested and resuspended to an OD600 of 1.0 in TG buffer . For cell wall digestion, 1 ml aliquots were resuspended in TG buffer with or without Lyz (250 kU/ml) for 5 or 45 min at 37°C. Cells were washed twice with TG buffer, resuspended in the same buffer supplemented with 3% BSA , and incubated with mAb LA2.2 (1∶500). Samples were washed twice and incubated for 30 min with goat anti-mouse IgG (H+L) antibodies conjugated to alkaline phosphatase (1∶1000). After an extensive wash, labeled cells were incubated with pNPP Microwell Substrate System (KPL). Microtiter plates were loaded with 100 µl of each cellular suspension, and optical densities were measured at 405 nm by a Spectra MAX plus ELISA reader .To further investigate the localization of antigens on the 6 cells/well and grown until they reached 90 to 95% confluence. L. plantarum cells were killed by exposure to UV light for 1 h and the lack of cell viability was confirmed by culture in MRS agar. T84 cells were co-cultured with UV-killed recombinant L. plantarum at a MOI 10∶1 bacteria per cell, for 48 h. L. plantarum control and 0.5 µg/ml TNFα were used as negative and positive controls, respectively. Supernatants were collected and the human IL-8 production was measured by ELISA .T84 cells were seeded in 24-well tissue culture plates at a density of 1×10Human peripheral blood was collected into heparin vacutainer tubes from healthy individuals. Peripheral blood mononuclear cells (PBMCs) were isolated by Ficoll-Paque density gradient centrifugation . A final suspension was made in complete RPMI 1640 (Hyclone), supplemented with 10% [v/v] FBS, 100 U/ml penicillin, 100 µg/ml streptomycin, 0.25 µg/ml and fungizone. Cell viability (greater than 95%) was determined by trypan blue exclusion. Human monocytes were purified from PBMC using the Monocyte Isolation Kit II , according to the manufacturer's recommendations. These monocytes were then used to produce Monocyte Derived Dendric Cells (MDDC) as described below.6 or 2×105 cells/well, respectively, in 24-well tissue culture plates for 5 days in 2 ml of complete RPMI 1640 supplemented with 10 ng/ml IL-4, and 100 ng/ml recombinant human granulocyte-macrophage colony-stimulating factor (GM-CSF) . Cultures were placed at 37°C in a 5% CO2 humidified incubator. Every two days the medium was removed and 2 ml of fresh complete medium was added. At day 5 the cells were co-cultured with 2.5 µg/ml of purified recombinant OspA or UV-killed recombinant Lactobacillus at MOI 10∶1 colony-forming units per cell for 48 h at 37°C. 100 ng/ml of lipopolysaccharide (LPS) from Escherichia coli O111:B4 and L. plantarum were used as positive and negative control, respectively. Supernatants were collected and TNFα, IL-12, IFNγ, IL-6, and IL-10 were quantified by ELISA .To derive dendritic cells from PBMCs and monocytes we cultured 1×10L. plantarum expressing the target antigen was cultured in LM medium supplemented with 10 µg/ml Cm, and grown at 30°C to an OD600 of 1.0. That is the equivalent of 1×109 cells/ml corresponding to approximately 125 µg of total protein. The cells were harvested by centrifugation at 3000 g for 10 min at 4°C and resuspended in 20% glycerol/phosphate buffered salt solution in 1% of the initial volume. Cell suspensions in aliquots of 2 ml were frozen quickly in a dry ice bath and stored at −80°C. Aliquots were thawed at 4°C and 400 µl (4×1010 cells) were placed in a ball-tipped syringe for oral gavage inoculation. Groups of four female C3H-HeJ mice were immunized by intragastric inoculation of 4×1010Lactobacillus expressing OspA recombinant antigens. L. plantarum (Lp) was used as control. Mice received the first immunization, twice daily, for 8 days (days 1–4 and 8–11). After resting for two weeks the mice were bled (day 28). On days 29–32 they received the 1st oral boost and rested for an additional 2 weeks. On day 49, the mice were bled. On days 50–53 they received the 2nd oral boost and rested for an additional 2 weeks. On day 68 mice were terminated, and blood, stool and bronchoalveolar lavage fluids (BAL) were collected. The animals were housed in a pathogen free colony on hardwood chip bedding in microisolator cages at the University of Tennessee Health Science Center, Memphis, TN. They were maintained on a 12 h light-dark cycle, in a room kept al 23°C with 50–60% relative humidity; they were given tap water and sterile irradiated rodent chow ad libitum.Serum, stool and BAL from orally inoculated mice were tested by indirect ELISA for the presence of total IgG, IgG1, IgG2a or IgA to OspA. Purified recombinant OspA was coated at 0.5 µg/ml on Nunc MaxiSorp™ flat-bottom ELISA plates and indirect ELISA was performed using serum (1∶500), stool (1∶10) or bronchoalveolar fluid. Anti-mouse IgG, anti-mouse IgG1, anti-mouse IgG2a or anti-mouse IgA horseradish peroxidase-conjugated antibodies was used as secondary antibody.t-test. p<0.05 are considered statistically significant.All data is represented as mean ± standard deviation. Statistical analyses were performed using Student's B. burgdorferi in a lactobacilli expression vector and designed an oral vaccine candidate for Lyme disease (LpA) ospA by replacing the cystein at position 17 with aspartic acid to generate a protein that lacks the post-translational lipid attachment (L. plantarum carrying the empty vector (Lp), and expressing OspA (LpA) or OspAD17 (LpAD17) were analyzed by SDS-PAGE and protein expression was confirmed using anti-OspA monoclonal antibody, mAb 184.1 (D17 (30.4 kDa) may represent the unlipidated OspA (containing the leader peptide).Previously, we reported the cloning and expression of full length OspA from tachment . Total eAb 184.1 . The twoLactobacillus, OspA partitions to the detergent phase, suggesting that OspA is exported through the membrane and that the amount of OspA that is hydrophobic (∼50%) is higher than the hydrophilic form (∼40%), although not significantly so. In contrast, the mutant OspAD17 partitions mostly to the aqueous phase, suggesting that, in addition to being exported, the mutant generated more hydrophilic OspA (∼70%) than hydrophobic (∼25%) (D17 in the detergent phase of LpAD17), then the difference should be protein that is associated with the cell envelope via the lipid anchor, or the lipidated form of OspA. Differences for the mutant OspAD17 partitions are statistically significant (p<0.05).We further evaluated the export and lipidation of OspA and its mutant by Triton X-114 phase partitioning of the cell envelope . In the c (∼25%) . If abounificant , *p<0.05L. plantarum (L. plantarum with Lysozyme (Lyz) for 45 min and separated the cell wall fraction from the protoplast by centrifugation. We then disrupted the cells and separated the membrane from the cytosol fractions by ultracentifugation. The three fractions were then analyzed on denaturing polyacrylamide gels and OspA was identified by Immunoblot with anti-OspA monoclonal antibody (mAb LA2.2). Lipidated OspA expressed in L. plantarum is exported through the membrane and accumulates in the cell wall, while unlipidated OspAD17 remains mostly attached to the membrane (L. plantarum. We incubated live recombinant L. plantarum with and without Lyz and we performed both live-cell ELISA (lcELISA) and immunofluorescence (IFA) assays. For lcELISA, we incubated the recombinant L. plantarum with Lyz for 5 and 45 min, the cells were washed and incubated with mAb LA2.2 is trapped within the peptidoglycan layer of the cell wall, maybe attached to the membrane. That is, a 5 min digestion with Lyz exposes a low amount of OspA that is associated with the peptidoglycan layer , a human colon carcinoma cell line, stimulated with UV-killed LpA and LpAD17 and determined the production of IL-8 (D17 did not induce significant production of the pro-inflammatory chemokine IL-8 in comparison to the positive control (TNFα).In order to analyze the potential inflammatory response to the oral administration of of IL-8 . The co-wtOspA) versus a OspA mutant lacking the leader peptide (mutOspA)), on cytokine induction. We co-cultured MDDCs with 2.5 µg/ml of purified wtOspA or mutOspA during 48 h and the production of pro-inflammatory cytokines TNFα, IL-12, IFNγ, and anti-inflammatory cytokine IL-10 was quantified by ELISA .Dendritic cells (DCs) play a decisive role in the innate and adaptive immune response, as they produce cytokines in response to antigen stimulation and activated T cells. Monocytes were isolated from human Peripheral Blood Mononuclear Cells (PBMCs) and were treated with GM-CSF and IL-4 to derive to MDDCs. Because OspA is known to trigger TLR2-based receptors we stimulated MDDCs with purified proteins in order to access the effect of the naked protein (wildtype OspA (oduction but it doduction . Compareoduction and a 2 oduction . Similaroduction . DiffereL. plantarum expressing either lipidated OspA (LpA), the mutant unlipidated OspA (LpAD17) or the control (Lp). The amount of pro-inflammatory cytokines TNFα, IL-12, IFNγ and IL-6, and anti-inflammatory cytokine IL-10 was quantified by ELISA (L. plantarum expressing lipidated (LpA) as compared to the control (Lp) (L. plantarum expressing the unlipidated OspA (LpAD17) induced significantly less TNFα, IL-12, IFNγ, IL-6 and IL-10 . Further, compared to the control (Lp), LpAD17 induced TNFα, IL-6 and IL-10 (p<0.001). LPS was used as a positive control and upregulated secretion of all cytokines tested (data not shown).Next, we treated PBMCs with GM-CSF and IL-4 to derive the monocyte population into immature dentritic cells (PBMC/DCs), and we investigated the cytokine production of human PBMC/DCs co-cultured with UV-killed recombinant by ELISA . As compby ELISA . Additiorol (Lp) . Comparend IL-10 . DiffereL. plantarum expressing the unlipidated OspA (LpAD17) abrogated this response as seen by the decreased production of TNFα, IL-12 and IL-6 (L. plantarum expressing lipidated (LpA) and the mutant appeared to impair this response .In order to dissect these results, we further purified monocytes by MACS to derive MDDC and analyzed cytokine production after stimulation . As expeand IL-6 . Additioresponse . DiffereL. plantarum, we immunized mice and tested serum levels of OspA-specific total IgG, IgG1 and IgG2a antibodies (L. plantarum expressing lipidated OspA (LpA) or the unlipidated mutant developed high titers of IgG specific antibody 68 days after the first inoculation . In contof IgG2a . Furtherr in BAL and stoor in BAL , 68 daysL. plantarum expressing B. burgdorferi OspA lipoprotein induced the production of OspA-specific IgA and IgG antibodies as a result of oral administration L. plantarum. Furthermore, we investigated how recombinant L. plantarum expressing OspA lipoprotein breaks the oral tolerance of the gut. We show that the leader peptide of OspA targets the protein to the cell envelope of the delivery vehicle L. plantarum, and that the Cys17 is the substract for OspA lipidation. Further, we show that our recombinant L. plantarum based mucosal delivery system does not induce secretion of IL-8 by intestinal epithelial cells and that it breaks oral tolerance of the gut via Th1/Th2 cell mediated immunity.It is now generally accepted that mucosal vaccines that can elicit both secretory IgA and effective systemic immune responses could have advantages over many existing vaccines B. burgdorferi OspA gene in E. coli, a Gram-negative bacteria, produces a protein that is processed post-translationally by signal peptidase II and contains an attached lipid moiety. In E. coli this lipoprotein partitions mostly into the detergent phase following extraction with Triton X-114 E. coli, we show that in Gram-positive L. plantarum, the leader peptide also marks OspA for translocation or export across the cytoplasmic membrane given that wildtype OspA partitions to the detergent phase following extraction with Triton X-114, suggesting that it is lipidated. In contrast, the mutant OspAD17, which lacks the cystein that is needed for the lipid moiety attachment, partitions mostly to the aqueous phase. This shift on the solubility of the mutant OspAD17 appears to be due to the lack of the lipid attachment, that makes the antigen more hydrophilic than the native lipidated OspA, and therefore the mutant appears to be unlipidated. It appears that OspA is indeed lipidated and localizes mostly at the membrane-cell wall interface. This observation is consistent with a previous study of Gram-positive Lactococcus spp. lipoprotein processing that found that lipid modification is predominantly required to retain proteins at the membrane cell-wall interface Expression of the full-length L. plantarum is consistent with previous findings L. plantarum expressing the OspA lipoprotein would not induce the local adverse inflammatory effects attributed to pathogenic bacteria.The intestinal immune system is the largest and the most complex part of the immune system L. plantarum expressing the OspA lipoprotein, but not the unlipidated mutant, we observed that pro-inflammatory cytokines TNFα, IFNγ and IL-6 were markedly upregulated. In addition, we observed an increase of anti-inflammatory cytokine IL-10. When we stimulated monocyte derived dendritic cells (MDDC) with L. plantarum expressing lipidated OspA, but not unlipidated OspA, we observed that pro-inflammatory cytokines TNFα and IL-12 were markedly upregulated. Here too, we observed an increase of anti-inflammatory cytokine IL-10. Differences in detection of cytokines in both assays can be explained by the fact that in the former (PBMC/DC) assay we expect to have a mixed population of monocyte derived dendritic cells, T cells, B cells and NK cells, and in the later (MDDC), we expect to have a relatively pure population of dendritic cells. These data indicate that recombinant OspA-expressing-L. plantarum stimulates the immune response via Th1/Th2 cell mediated immunity and that, lipidation of the antigen in the delivery agent plays an active role in this response.In the lamina propria of the intestine, the adaptive immune response is oriented towards tolerance and it involves suppression of Th1 cytokines such as IL-12 and activation of regulatory T cells that inhibit the proliferation of other T cells through production of IL-10 and TGFβ1 + and cytotoxic CD8+) responses wtOspA) induced TNFα and IL-10 but it did not induce IL-12 or IFNγ. In the absence of the leader peptide, as in mutOspA, the TNFα response was abrogated and IL-10 was reduced in half. In contrast, if OspA is delivered in Lactobacillus we also observe an effect on the production of IL-12. This effect appears to be related to the delivery vehicle in which OspA is presented. Furthermore, our results show that mutation of the Cys17 on the leader peptide of OspA decreases significantly the production of pro- and anti-inflammatory cytokines, and that this effect is related to the lipidation of OspA. In addition, we observed that lipidation of protein is not essential to induce a specific humoral immune response to OspA when the antigen is orally delivered by Lactobacillus. The adjuvant effect of Lactobacillus as oral carrier, exerts a synergized effect along with the intrinsic antigenicity of unlipidated OspA. This result differs with others, where the lipid modification of OspA seems to be essential to induce a humoral immune response, when the soluble unlipidated antigen is delivered subcutaneously without a cellular carrier 17 skewed the systemic IgG production towards IgG2a, probably as result of a shift from a Th2 to a Th1 response. Over all, our data suggest that the lipidation of OspA has a clear role on the mixed Th1/Th2 cellular and humoral immune response to orally administered Lactobacillus expressing OspA.The lipid attachment in OspA seems to be a critical determinant of the mature protein immunogenicity Given that we inoculate our animals with very high doses of vaccine for long periods of time our results appear to contradict the dogma that high and repeated doses of stimulating antigen induces oral tolerance L. plantarum or OspA lipoprotein as it is released from lysed recombinant L. plantarum across the epithelium where they can induce primary immune responses In summary, we investigated the mechanism by which a mucosal vaccine based in recombinant LAB breaks the immunological tolerance of the gut in order to elicit a protective immune response. It is possible that mucosal tolerance may have been broken by two different mechanisms. In the first scenario, M cells might transport whole recombinant

Plasmodium falciparum (Pf) malaria is only acquired after years of repeated infections and wanes rapidly without ongoing parasite exposure. Antibodies are central to malaria immunity, yet little is known about the B-cell biology that underlies the inefficient acquisition of Pf-specific humoral immunity. This year-long prospective study in Mali of 185 individuals aged 2 to 25 years shows that Pf-specific memory B-cells and antibodies are acquired gradually in a stepwise fashion over years of repeated Pf exposure. Both Pf-specific memory B cells and antibody titers increased after acute malaria and then, after six months of decreased Pf exposure, contracted to a point slightly higher than pre-infection levels. This inefficient, stepwise expansion of both the Pf-specific memory B-cell and long-lived antibody compartments depends on Pf exposure rather than age, based on the comparator response to tetanus vaccination that was efficient and stable. These observations lend new insights into the cellular basis of the delayed acquisition of malaria immunity.Immunity to Plasmodium falciparum (Pf) is a mosquito-borne parasite that causes over 500 million cases of malaria annually, one million of which result in death, primarily among African children. The development of an effective malaria vaccine would be a critical step toward the control and eventual elimination of this disease. To date, most licensed vaccines are for pathogens that induce long-lived protective antibodies after a single infection. In contrast, immunity to malaria is only acquired after repeated infections. Antibodies play a key role in protection from malaria, yet several studies indicate that antibodies against some Pf proteins are generated inefficiently and lost rapidly. The cells that are responsible for the maintenance of antibodies over the human lifespan are memory B-cells and long-lived plasma cells. To determine how these cells are generated and maintained in response to Pf infection, we conducted a year-long study in an area of Mali that experiences a six-month malaria season. We found memory B-cells and long-lived antibodies specific for the parasite were generated in a gradual, step-wise fashion over years despite intense Pf exposure. This contrasts sharply with the efficient response to tetanus vaccination in the same population. This study lends new insights into the delayed acquisition of malaria immunity. Future studies of the cellular and molecular basis of these observations could open the door to strategies for the development of a highly effective malaria vaccine. Mycobacterium tuberculosis (Mtb), and Plasmodium falciparum malaria Pf infections Pf antigens are inefficiently generated and rapidly lost in the absence of ongoing exposure to the parasite . MBCs recirculate and mediate recall responses after re-exposure to their cognate antigen by rapidly expanding and differentiating into PCs, whereas LLPCs residing in the bone marrow constitutively secrete antibody and provide a critical first line of defense against re-infection.Despite the key role that antibodies play in protection from a variety of infectious diseases, remarkably little is known about the cellular basis of acquiring humoral immunity in response to natural infections in humans. This gap in our knowledge is due in large part to the difficulty in studying natural infections in humans when we cannot predict who within a population will be infected with a given pathogen at a given time. Thus, our current understanding of the acquisition of immunity is largely derived from animal models and studies of humans after vaccination. These studies have established that long-lived, antibody-based immunity requires the generation and maintenance of memory B cells (MBCs) and long-lived plasma cells (LLPCs) - and Pf-specific MBCs and Ab, and also tested three hypotheses: 1) that growth of the MBC compartment depends on immunological experience rather than age, 2) that Pf infection induces non-specific activation of bystander B cells The mechanisms by which antibody responses are maintained over the human life-span remains an open question. In one model, LLPCs survive indefinitely in the bone marrow and independently maintain steady-state antibody levels Pf parasitemia at study enrollment. During the one-year study period there were 380 unscheduled clinic visits, during which 219 cases of malaria were diagnosed, five of which met the WHO criteria for severe malaria Pf asexual parasitemia ≥5000 parasites/µL, and a non-focal physical exam by the study physician. As expected in this region of Mali, all malaria cases were confined to a six-month period that began in July, peaked in October, and ended by January , with age. In Mali, a single TT vaccine is administered to infants less than six months of age and a second TT vaccine is administered to females around 15 years of age to prevent neonatal tetanus. Thus, we measured TT-specific antibody and MBC responses at least 18 months after TT vaccination, a point at which the TT-specific response is likely to be at steady state. In contrast to what was observed for AMA1- and MSP1-specific MBCs, the frequency of TT-specific MBCs among males did not change significantly from age 2 to 25 years , and in a cross-sectional survey at the end of the following dry season (month 12), and compared these frequencies to the pre-malaria season baseline . Malaria episodes were defined as an axillary temperature ≥37.5°C, Pf asexual parasitemia ≥5000 parasites/µL, and a non-focal physical exam by the study physician. Because few adults experienced malaria to that 14 days after acute malaria . We observed a small, but statistically significant increase in the frequency of TT-specific MBCs from month 0 to convalescence and naïve B cells and an increase in resting IgG+ MBCs and activated IgG+ MBCs . The increase with age of classical MBCs is consistent with the increase in total IgG+ MBCs we observed using the MBC ELISPOT assay before the malaria season . With inOT assay .Pf exposure is associated with an expanded subset of ‘atypical’ MBCs that express FCRL4 and are hyporesponsive to in vitro stimuli + CD27− CD21− CD20+ CD10− and typically represents <4% of circulating CD19+ B cells in healthy U.S. adults In a subset of 87 individuals from this same study cohort, we previously reported that + 14 days after acute malaria. Within the CD19+ B cell population there were no significant changes in the percent of immature B cells, naïve B cells, or resting MBCs, after acute malaria. Moreover, there was no change in the proportions of resting and atypical MBCs that were IgG+. However, we observed a decrease in the percentage of total atypical MBCs . The decrease in the proportion of atypical MBCs in the peripheral blood suggests that this subpopulation may be trafficking out of the circulation into tissues in response to acute malaria.We investigated the impact of acute malaria on the relative proportion of B cells in each subset in children aged 2–10 years. Compared to the pre-malaria season baseline (month 0), there were no significant changes in the percent of lymphocytes that were CD19Pf asexual parasitemia ≥5000 parasites/µL, and a non-focal exam by the study physician. Because the incidence of malaria was very low in adults during the study period MBCs in nearly all vaccinees Pf infection disrupts the immune system's ability to generate or maintain MBCs or LLPCs. The differentiation of B cells into long-lived MBCs depends to a great extent on the affinity of their BCRs for antigen. Recently, evidence was presented that affinity maturation of B cells may fail to occur in the absence of adequate Toll-like receptor (TLR) stimulation Pf infection. Although our data do not directly address the role of apoptosis in the gradual acquisition of Pf-specific MBCs, it is worth noting that we found no evidence of Pf-induced ablation of Plasmodium-specific MBCs, as was observed in mice four days after Plasmodium yoelii infection Pf infection also does not appear to be due to a persistent, Pf-induced general immunosuppression as the frequency of TT-specific MBCs increased significantly in most adult females in response to a single TT booster vaccination, an increase that appeared to be maintained for years. In an experimental model of lymphocytic choriomeningitis virus (LCMV) infection, a high antigen-to-B cell ratio disrupted germinal center formation and the establishment of B cell memory Pf infection when the immune system encounters high concentrations of parasite proteins. Indeed, germinal center disruption is observed in mice infected with P. berghei ANKA P. chabaudiPf infection arises from pre-diversified IgM+IgD+CD27+ B cells—analogous to the rapid protective response against highly virulent encapsulated bacteria that do not elicit classical T-dependent responses ex vivo and in vitro assays to rigorously conducted prospective studies of Pf-exposed populations.It is also possible that Pf exposure is associated with a functionally and phenotypically distinct population of FCRL4+ hypo-responsive atypical MBCs Pf exposure is associated with an expansion of FCRL4+ MBCs. The accumulation of atypical MBCs could be linked to the slow acquisition of Pf-specific MBCs, as naïve B cells in response to Pf infection could have a propensity to differentiate into atypical rather than classical MBCs. We also observed that the FCRL4+ MBC population decreased in the peripheral circulation two weeks after acute malaria suggesting that these MBCs are directly involved in the response to Pf infection, possibly trafficking to secondary lymphoid tissues. Although the function of FCRL4+ MBCs is not established, Moir et al. + ‘exhausted MBCs’ contribute to the B cell deficiencies observed in HIV-infected individuals. In contrast, Ehrhardt et al.+ ‘tissue-like MBCs’ in lymphoid tissues associated with epithelium, suggested that these cells may play a protective role during infections. At present, the factors that underlie the expansion of atypical MBCs in this study population are not known. Genetic or environmental factors that are associated with Pf transmission but not accounted for in this study could explain this observation. It will be of interest to understand the origin, antigen-specificity, and function of FCRL4+ MBCs in the context of Pf infection and the potential impact of these MBCs on the ability of children to respond to malaria vaccines.We previously reported that per se may not reliably predict clinical immunity to malaria regardless of antigen specificity. Malaria symptoms only occur during the blood stages of Pf infection and can begin as early as three days after the blood stage infection begins Pf blood stage antigens to differentiate into the antibody-secreting cells that would prevent the onset of malaria symptoms. In contrast, the longer incubation period of other pathogens allows MBCs to differentiate into protective antibody-secreting cells before symptoms develop. For example, follow-up studies of hepatitis B vaccinees have shown that protection can persist despite the decline of hepatitis B-specific antibodies to undetectable levels Pf infection.In multivariate analysis we found no correlation between the frequency of MBCs and levels of Abs specific for AMA1 or MSP1 and malaria risk. This is not necessarily unexpected in light of recent clinical trials that showed that vaccination with either AMA1 or MSP1 did not confer protection Pf-induced polyclonal activation are matched by the rate of loss of senescent TT-specific MBCs. It has also been proposed that non-specific polyclonal stimulation maintains long-lived Ab responses by driving MBCs to differentiate into SLPCs or LLPCs Plasmodium infection generates large amounts of non-specific Ig Pf infection, we did not observe a concomitant increase in TT-specific IgG. This finding is consistent with recent human studies that demonstrate a lack of bystander IgG production after heterologous vaccination or viral infection in vivo upon TLR4 and 9 activation Pf infection, but based on the results of this study we hypothesize that the preponderance of IgG produced in response to malaria is specific for the ∼2400 Pf proteins expressed during the blood-stage of infection in vivo after immunization with an irrelevant antigen Here we also provide evidence concerning the mechanism by which MBCs and LLPCs are maintained. We observed a modest but statistically significant increase in TT-specific MBCs two weeks after acute malaria, in support of the hypothesis that MBCs are renewed by polyclonal or ‘bystander’ activation in vitro suggest that Pf drives polyclonal MBC activation by the cysteine-rich interdomain regions 1α (CIDR1α) of the Pf erythrocyte membrane protein 1 (PfEMP1) Pf-derived TLR agonists It is of general interest to determine which parasite products are responsible for the polyclonal activation of MBCs observed here. Studies Plasmodium infection Pf in longitudinal studies since findings from animal models do not always mirror human biology or pertain to the clinical context Pf infection and to determine the longevity of these cells in the absence of Pf transmission over longer periods of time. Greater insight into the molecular and cellular basis of naturally-acquired malaria immunity could open the door to strategies that ultimately prove useful to the development of a highly effective malaria vaccine.Animal models have provided important insights into the immunobiology of The ethics committee of the Faculty of Medicine, Pharmacy, and Odonto-Stomatology, and the institutional review board at the National Institute of Allergy and Infectious Diseases, National Institutes of Health approved this study (NIAID protocol number 06-I-N147). Written, informed consent was obtained from adult participants and from the parents or guardians of participating children.2) rural village with a population of 1500, located 20 km north of Bamako, the capital of Mali. Pf transmission is seasonal and intense at this site from July through December. The entomological inoculation rate measured in a nearby village was approximately 50–60 infective bites per person per month in October 2000 and fell to near zero during the dry season This study was carried out in Kambila, a small (<1 kmPf. Patients with positive smear results (i.e. any level of parasitemia) were treated with a standard 3-day course of artesunate plus amodiaquine, following the guidelines of the Mali National Malaria Control Program. Anti-malarial drugs were provided exclusively by the study investigators. Children with severe malaria were referred to Kati District Hospital after an initial parenteral dose of quinine. For research purposes, a malaria episode was defined as an axillary temperature ≥37.5°C, Pf asexual parasitemia ≥5000 parasites/µL, and a nonfocal physical examination by the study physician. Severe malaria, as defined by the WHO Pf-specific immune responses and malaria risk: 1) whether or not malaria was experienced, 2) the incidence of malaria, and 3) the time to the first malaria episode. Blood smears were prepared and venous blood samples collected during the two-week enrollment period (month 0), 14 days after the first episode of malaria , and during a two-week period at the end of the six-month dry season (month 12). Hemoglobin was typed from venous blood samples. Stool and urine were examined at enrollment for the presence of helminth infections. Venous blood samples from ten healthy U.S. adult blood bank donors were analyzed as controls. Travel histories for these U.S. adults were not available, but prior exposure to Pf is unlikely.In May 2006, during a two-week period just prior to the malaria season, 225 individuals aged 2–10 years and 18–25 years were enrolled after random selection from an age-stratified census of the entire village population. Enrollment exclusion criteria were hemoglobin <7 g/dL, fever ≥37.5°C, acute systemic illness, use of anti-malarial or immunosuppressive medications in the past 30 days, or pregnancy. All analysis in the present study pertains to an age-stratified subset of individuals (n = 185) randomly selected from those who had complete sets of PBMC samples over the entire study period. From May 2006 through May 2007, participants were instructed to report symptoms of malaria at the village health center, staffed 24 hours per day by a study physician. For individuals with signs or symptoms of malaria, blood smears were examined for the presence of Blood samples (8 ml for children and 16 ml for adults) were drawn by venipuncture into sodium citrate-containing cell preparation tubes and transported 20 km to the laboratory where they were processed within three hours of collection. Plasma and PBMCs were isolated according to the manufacturer's instructions. Plasma was stored at −80°C. PBMCs were frozen in fetal bovine serum (FBS) containing 7.5% dimethyl sulfoxide , kept at −80°C for 24 hours, and then stored at −196°C in liquid nitrogen. For each individual, PBMC and plasma samples from all time points were thawed and assayed simultaneously.Pf densities were recorded as the number of asexual parasites/µl of whole blood, based on an average leukocyte count of 7500/µl. Each smear was evaluated separately by two expert microscopists blinded to the clinical status of study participants. Any discrepancies were resolved by a third expert microscopist.Thick blood smears were stained with Giemsa and counted against 300 leukocytes. Hemoglobin was typed by high performance liquid chromatography as previously described Schistosoma mansoni eggs and other intestinal helminths using the semi-quantitative Kato-Katz method. To detect Schistosoma haematobium eggs, 10 ml of urine were poured over Whatman filter paper. One or two drops of ninhydrine were placed on the filter and left to air dry. After drying, the filter was dampened with tap water and helminths were eggs detected by microscopy.At enrollment, duplicate stool samples were examined for Latitude and longitude coordinates of study subjects' households were measured by a handheld global positioning system receiver and reported earlier ELISAs were performed by a standardized method as described previously et alet al., unpublished observation). Briefly, PBMCs were thawed and cultured in 24 well plates at 37°C in a 5% CO2 atmosphere for six days in media alone or media plus a cocktail of polyclonal activators: 2.5 µg/ml of CpG oligonucleotide ODN-2006 , Protein A from Staphylococcus aureus Cowan (SAC) at a 1/10,000 dilution , pokeweed mitogen at a 1/100,000 dilution (Sigma-Aldrich), and IL-10 at 25 ng/ml (BD Biosciences). Cells were washed and distributed on 96-well ELISPOT plates to detect antibody-secreting cells (ASCs). ELISPOT plates were prepared by coating with either: a 10 µg/ml solution of polyclonal goat antibodies specific for human IgG to detect all IgG-secreting cells; a 1% solution of bovine serum albumin (BSA) as a non-specific protein control; or 5 µg/ml solutions of either tetanus toxoid (TT), AMA1, or MSP1 to detect antigen-specific ASCs. For AMA1 and MSP1, a 1∶1 mixture of FVO and 3D7 isotypes was used to coat the ELISPOT plates. Plates were blocked by incubation with a solution of 1% BSA. For the detection of antigen-specific ASCs, cells were plated in duplicate in eight serial dilutions beginning with 5×105 cells/well. For detection of total IgG ASCs cells were plated at six serial dilutions beginning at 4×104 cells/well. After a five hour incubation of the cells in the ELISPOT plates, plates were washed four times each in PBS and PBS-Tween 20 0.05% (PBST), and incubated overnight with a 1∶1000 dilution of alkaline phosphatase-conjugated goat antibodies specific for human IgG (Zymed) in PBST/1% FCS. Plates were washed four times each in PBST, PBS, and ddH2O; developed using 100 µl/well BCIP/NBT for 10 minutes; washed thoroughly with ddH2O and dried in the dark. ELISPOTS were quantified using Cellular Technologies LTD plate-reader and results analyzed using Cellspot software. Results are reported as frequencies of MBCs per 106 PBMCs after the six-day culture. The limit of detection of the MBC ELISPOT assay for this analysis was five ASCs per 106 PBMC based on the average number of ASCs on the BSA control. Assay failure was defined as fewer than 1000 IgG+ ASCs per 106 PBMCs after the six-day culture which resulted in the exclusion of 15% of individuals at month 0, 13.2% 14 days after the first malaria episode, and 7.3% at month 12. For individuals with a limited number of PBMCs, priority was given to performing the ELISPOT assay for MSP1, then TT, and then AMA1.Antigen-specific MBCs were quantified by a modified version of the method developed by Crotty + CD21− CD20−), naive B cells (CD19+ CD27−CD10−), immature B cells (CD19+ CD10+), classical MBCs (CD19+ CD27+ CD21+), atypical MBCs (CD19+ CD21− CD27− CD10−) and activated MBCs (CD19+ CD21− CD27+CD20+). FACS analyses were performed on a FACSCalibur flow cytometer (BD Biosciences) using FlowJo software .All phenotypic analyses were performed using mouse mAbs specific for human B cell markers conjugated to fluorophores as previously reported Data were analyzed using STATA and GraphPad Prism for Windows .The Kruskal-Wallis test was used to compare continuous variables between groups, and the Fisher's exact test was used to compare categorical variables. The Wilcoxon matched-pairs signed-rank test was used to compare measurements of the same parameter at two time points for the same individual. The correlation between different continuous measures was determined by using the Spearman correlation coefficient. The malaria-free probability over the twelve-month study period was estimated by the Kaplan-Meier curve, and the time to the first malaria episode was compared by the log rank test. Cox's proportional hazards model was used to assess the effect of the following factors on the hazard of malaria: age, gender, weight, ethnicity, distance lived from study clinic, self-reported bednet use, hemoglobin type, antigen-specific MBC frequencies and Ab levels. The same list of variables was included in logistic and Poisson regression models to determine their impact on the odds and incidence of malaria episodes, respectively. For all tests, two-tailed p values were considered significant if ≤0.05.Figure S1+ ASCs per 106 PBMCs after the six-day culture. The Spearman's correlation coefficient is given for each plot.Correlative analysis of antibody levels and memory B cell frequencies specific for AMA1, MSP1, and tetanus toxoid. Shown are scatterplots of antibody levels versus memory B cell frequencies specific for (A) AMA1 (n = 64), (B) MSP1 (n = 67) and (C) tetanus toxoid (n = 128). Data are derived from venous blood samples drawn before the malaria season. Only individuals with both antibody and memory B cell data are included. For AMA1 and MSP1 the plots include individuals with antibody levels at or above the limit of detection of the ELISA. Individuals with ‘failed' ELISPOT assays are not included. As described in (3.84 MB TIF)Click here for additional data file.

Plasmodium falciparum sporozoites that develop and mature inside an Anopheles mosquito initiate a malaria infection in humans. Here we report the first proteomic comparison of different parasite stages from the mosquito—early and late oocysts containing midgut sporozoites, and the mature, infectious salivary gland sporozoites. Despite the morphological similarity between midgut and salivary gland sporozoites, their proteomes are markedly different, in agreement with their increase in hepatocyte infectivity. The different sporozoite proteomes contain a large number of stage specific proteins whose annotation suggest an involvement in sporozoite maturation, motility, infection of the human host and associated metabolic adjustments. Analyses of proteins identified in the P. falciparum sporozoite proteomes by orthologous gene disruption in the rodent malaria parasite, P. berghei, revealed three previously uncharacterized Plasmodium proteins that appear to be essential for sporozoite development at distinct points of maturation in the mosquito. This study sheds light on the development and maturation of the malaria parasite in an Anopheles mosquito and also identifies proteins that may be essential for sporozoite infectivity to humans. Plasmodium falciparum, a unicellular protozoan parasite that is transmitted by Anopheles mosquitoes. An infectious mosquito injects saliva containing sporozoite forms of the parasite and these then migrate from the skin to the liver, where they establish an infection. Many intervention strategies are currently focused on preventing the establishment of infection by sporozoites. Clearly, an understanding of the biology of the sporozoite is essential for developing new intervention strategies. Sporozoites are produced within the oocyst, located on the outside wall of the mosquito midgut, and migrate after release from the oocysts to the salivary glands where they are stored as mature infectious forms. Comparison of the proteomes of sporozoites derived from either the oocyst or from the salivary gland reveals remarkable differences in the protein content of these stages despite their similar morphology. The changes in protein content reflect the very specific preparations the sporozoites make in order to establish an infection of the liver. Analysis of the function of several previously uncharacterized, conserved proteins revealed proteins essential for sporozoite development at distinct points of their maturation.Human malaria is caused by Plasmodium falciparum within the mosquito vector begins when gametocytes are taken up in an infected blood meal; after forming gametes and fertilisation, the resulting zygote differentiates into a motile ookinete that traverses the midgut epithelium and transforms within 36–48 hours into an oocyst (OOC) between the midgut epithelial cells and the basal lamina. The oocyst is an asexually replicating form of the parasite, which produces up to 2000–4000 sporozoites in about two weeks. Rupture of mature oocysts releases oocyst-derived sporozoites (ODS) into the hemocoel of the mosquito. The movement of the hemolymph brings the ODS in contact with the salivary glands, which they then invade. The sporozoites mature inside the salivary glands and then are stored ready for transmission to the mammalian host upon the next blood meal. A limited number of the salivary gland sporozoites (SGS) are injected during a mosquito bite and only a few of these complete the necessary migration from the skin to the liver to establish an infection inside hepatocytes. Clearly, the sporozoite has to complete a number of functions and metabolic readjustments both before and after injection into a mammalian host. The sporozoite has to be capable of actively exiting an oocyst, travelling through the hemolymph (the mosquito circulatory system), and invading salivary glands. Further, following a mosquito bite injection the sporozoites enters a very different physiological environment of the human host, and then has to traverse through human endothelial cells, possibly Kupffer cells and finally hepatocytes where they establish an infection; moving all the time using a specialized form of gliding motility. Despite all these events the general morphology of the sporozoite is not visibly altered at any stage proteins. The proteomic analysis of P. falciparum oocysts, oocyst-derived sporozoites, and salivary gland sporozoites resulted in a total of 4611 unique peptides mapping to 728 non redundant P. falciparum proteins; they are distributed over the three stages with 127, 450 and 477, respectively and depicted as a Venn diagram in Plasmodium proteins of the mosquito stages are provided as supplementary material and have identified a total of 1543 Plasmodium proteins. The proportion of ‘stage specific’ proteins in the different life cycle stages ranged from 12% (gametes) to 28% and the stage specificity of proteins in the mosquito stages ranged between 15–24% essentially as previously described material . In our proteins that areproteins . Howevern 15–24% .P. falciparumP. bergheiP.yoeliiGenome-wide proteome and transcriptome studies have previously been reported for salivary gland sporozoites of P. berghei described by Hall et al P. falciparum and 87 of these (i.e. 50%) were also detected in our mosquito proteomes (P. berghei orthologs (i.e. 54%) were found in common. Similarly, of the 108 proteins identified in the P. berghei SGS proteome 86 proteins have an orthologue in P. falciparum were also detected in our P. falciparum SGS proteome. Selecting the 202 genes that were commonly expressed in our SGS proteome and in the published SGS proteome of P. falciparumP. falciparum SGS proteome.The oocyst proteome of roteomes . Again clciparum of whichHowever, when we compared abundance of our SGS proteins with the abundance of mRNA SGS transcripts reported by Le Roch and Zhou et al P. bergheiP. yoeliiP. yoelii mRNAs with our proteomes showed that for nearly all genes transcribed in sporozoites (20 out of 23 sporozoite (S) genes), proteins were detected in our sporozoite proteomes genes studies have been reported that using either subtractive hybridization or cDNA quantification methods ) to identify sets of genes transcribed in sporozoites in the rodent malaria parasites, roteomes . This maS) genes ) but onlS) genes ). It is P. falciparum and 728 proteins in our mosquito stage proteome, these 15 proteins represent a 4.8 fold functional enrichment relative to the annotated genome and is highly significant (p<0.001 using Ontologizer). A good agreement exists between the function of the sporozoite proteins as shown in A global functional characterization of the ‘mosquito stage’ proteome was performed by an enrichment analysis of Gene Ontology (GO) annotations, for both the proteins that are shared between blood stages and mosquito stages (n = 478) and for the mosquito stage specific proteins (n = 250). The set of 478 genes commonly expressed in both mosquito and blood stages showed enrichment in GO annotations in all classes and thiP. falciparum proteome of 5410 proteins.Sporozoites, like other motile stages of Apicomplexan organisms, move on substrates by a mechanism known as gliding motility which is driven by an actomyosin motor complex P. berghei are significantly less infective to the mammalian host than SGS Although the morphology of oocyst-derived and salivary gland sporozoites is identical at the level of light microscopy, ODS of P. berghei. The three groups were further refined for subsequent functional analysis using the following criteria .Consequently, based on the expression pattern and relative abundance of the peptides in the proteomes from OOC, ODS and SGS see section see also section:P. berghei, specifically, 3 ODS specific genes (Group I), 2 SGS specific genes (Group II) and 3 from Group III (shared ODS/SGS). The sequences of the eight P. berghei gene orthologs (as well as their corresponding up and downstream sequences) were retrieved from the on-line Plasmodium genome databases, http://www.plasmodb.org and http://www.genedb.org/genedb/pberghei. However, for 4 of the 8 genes the P. berghei orthologs were fragmented and complete genes were manually assembled from a number of different P. berghei sequences by performing BLAST sequence searches of the full length P. falciparum genes against the P. berghei genome and closing gaps by PCR; details of the P. berghei orthologs, assemblies and generation of knock-out constructs is available in P. berghei (i.e. line 507cl1) by standard genetic transfection of constructs for gene-disruption by double cross-over homologous recombination In total eight genes identified in this study were selected for funcIt was not possible to select mutant parasites for two genes, one belonging to Group I (orthologous to PF14_0607) and the other belonging to Group III (orthologous to PFA0205w) in 3 independent transfection experiments, suggesting that both these proteins may have an additional and essential role during blood stage development. For the remaining 6 genes mutants were generated in two independent transfection experiments per gene and corr6 sporozoites) they were infective to mice comparable to wild type ODS (2 experiments each with 2 mice). Additionally, if such oocyst-extracted sporozoites were used in in vitro hepatocyte invasion assays they showed hepatocyte traversal and invasion that was not significantly lower than sporozoites from wild type sporozoites also mechanically extracted from oocysts (4 sporozoites) or by mosquito bite were not infective for mice (2 experiments with 2 mice). Interestingly, 843cl1 sporozoites demonstrated the same or greater hepatocyte traversal rate than wild type sporozoites and they were also able to traverse and invade hepatocytes in vitro showed an aberrant development during mosquito development. The phenotypes of cloned lines of these mutants were therefore analyzed in more detail. Clones of all 3 gene-disrupted lines produced wild type numbers of oocysts ranging from 150–250 oocysts per mosquito on day7/8 post infection. The development of parasites deficient in PB000829.02.0 was blocked at the developing oocyst stage and no sporozoite formation was detectable within the oocysts by either fluorescence or phase-contrast microscopy . This ea oocysts . The ‘wiin vitro . This suPlasmodium falciparum, oocysts, oocyst-derived sporozoites and salivary gland sporozoites, resulted in the identification of 728 proteins of which 250 are ‘mosquito stage specific’, having not been detected in our previous analysis of blood stage parasites The proteome analyses of the three mosquito stages of Plasmodium. This concept is supported by the observation that 15 of the 23 Plasmodium proteins known to have a sporozoite specific function are present in the 250 mosquito stage proteins identified in this study, a 4–5 fold enrichment. Moreover, their stage specific expression in our different proteomes also confirms that in general the timing of protein expression coincides with observation of function as inferred from gene deletion studies. For example, proteins involved in the traversal and invasion of the hepatocyte stage proteomes demonstrated that expression of proteins restricted to a single stage ranges from 12 to 28% with the highest percentage of ‘stage specificity’ in the gametocyte and reaching 24% in ODS. The 478 proteins common to blood and mosquito stages are significantly enriched in house keeping proteins involved in metabolic processes. The absence of specific enrichment of GO annotations in the 250 proteins of the mosquito stage specific proteome can most likely be ascribed to the fact that a relatively small number of these proteins posses a GO designation. Many of the mosquito stage specific proteins are still annotated as hypothetical and probably have functions that are specific for sporozoites and/or and P36 ) are eitP. falciparumP. bergheiP. yoeliiP. falciparum SGS and Hall P. berghei SGS) we found a greater than 50% overlap in proteins. Moreover, in the Hall P. berghei SGS and OOC proteomes it is observed that more than 80% of these proteins have a direct ortholog in P. falciparum. Further, when we again only compare ‘fully tryptic proteomes’ we find 75% of the P. berghei SGS proteins are also expressed in the SGS of P. falciparum indicating that sporozoites of different Plasmodium species employ similar processes of maturation and invasion. Despite the relatively low overlap in total numbers of proteins detected in the different proteomes, there is good correlation of protein abundance between our SGS proteome and the previously reported SGS proteome of P. falciparumProtein and gene expression studies of SGS have previously been performed in P. yoelii sporozoites detected by EST analyses P. yoelii, where 5500 expressed genes were measured in the ODS/SGS stages we find that all of our 601 mosquito stage specific P. falciparum proteins are also detected as mRNA Interestingly, nearly all the expressed genes of P. bergheiP. falciparum SGS We found a lower percentage of shared proteins between our proteome and the transcripts detected in sporozoites of P. berghei. Mutant P. berghei parasites lacking mosquito stage specific proteins have proven to be an efficient way to obtain an understanding into the function of such proteins P. berghei of which 3 showed distinct phenotypes, demonstrating an important and essential role of these proteins in sporozoite development and maturation. The knock-out parasite lines of 3 genes that do not exhibit a clear phenotypic difference from wild type parasites indicate either a redundancy in function for the proteins encoded by these genes or else phenotypes that are presently too subtle for us to detect with our current methodologies. However, functional redundancy is a well-established phenomenon for a number of Plasmodium proteins that are expressed in the blood and sexual stages of the parasite The sporozoite proteomes, despite not being exhaustive, provide for the first time information on parasite protein expression both at the mosquito midgut and salivary gland stages. This has allowed for the identification of hitherto uncharacterized proteins which in turn has informed the selection of genes for targeted orthologous gene disruption studies in the rodent malaria parasite, P. falciparum protein PF14_0435 is highly and exclusively expressed in sporozoites obtained from the oocyst stage and the phenotype of the orthologous gene knock-out mutant in P. berghei, 802cl1, is an abnormal development of the oocyst and the complete absence of sporozoite production. This example demonstrates not only the validity of the orthologous gene studies in P. berghei but also the informative power of this combination of proteome-reverse genetic approach in the characterization of proteins at discreet stages of the parasite life-cycle. Furthermore, the number of oocysts produced by the 802cl1 mutant is not different from wild type levels and a defect appears to occur prior to sporozoite development indicating that the role of PF14_0435 is upstream of sporozoite production. The phenotype of a second P. berghei mutant, line 841cl1, which lacks the orthologue of PFD0425w closely resembles the egress defects observed with the cysteine protease ECP1 and CS mutants that are mutated in their thrombospondin repeat; where sporozoites are unable to exit from midgut oocysts in vitro but are unable to infect mice, suggesting an additional role during further development inside the hepatocyte. Interestingly and in line with the expectation, the expression of MAL8P1.66 has recently been identified in liver stage of PlasmodiumThe Anopheles mosquito but also identifies proteins that are uniquely synthesized as the sporozoite becomes increasingly infectious to humans. Infection initiated by injection of P. falciparum sporozoites into humans represents the culmination of many precise, sequential and critical developmental steps of the malaria parasite through the mosquito. Moreover, transmission is a bottle neck in the life cycle of Plasmodium and the full maturation of sporozoites is essential in the survival of the parasite. The changes in the different sporozoite proteomes documented here emphasise that each event from oocyst development to egress and invasion of salivary gland and injection is tightly regulated. Intervention studies are now being conducted that aim to exploit the tightly regulated pathways that the parasite has evolved to ensure transmission. This has been recently demonstrated with the use of genetically attenuated sporozoites that have rapidly become an important focus in the development of new vaccines. The disruptions of individual genes that encode sporozoite proteins sufficiently weakens the parasite such that development in the liver is blocked, enabling the mammalian host to generate a strong protective immunity against subsequent infection. Clearly, the targeted disruption of genes encoding proteins identified in this study, which are involved in essential mature sporozoites functions, namely hepatocyte traversal, invasion and intracellular survival may also accelerate the identification of new protective attenuated parasite lines. Understanding the sporozoite and all its various developmental steps during the establishment of an infection continues to represent a promising approach in the hunt for new weapons in the fight against malaria.This study sheds light not only on the development and maturation of the malaria parasite in an Anopheles stephensi mosquitoes P. falciparum gametocytes (NF54) 5 sporozoites obtained from salivary glands of one mosquito, and 0.5–5×105 sporozoites per mosquito midgut). Parasites samples from mosquito midguts and salivary glands were divided into a soluble and insoluble fraction by a freeze–thawing procedure similar to the parasite sample preparation procedure of blood stages P. falciparum blood stages. Gel slices were treated with dithiothreitol and iodoacetamide and digested by trypsin as described before In order to estimate the number of sporozoites in the samples described above the total number of oocyst and salivary gland sporozoites per mosquito was determined as follows: midguts and salivary glands were dissected from 10 mosquitoes at day 13 and day 22 after feeding respectively. The midguts/salivary glands were homogenized in a home made glass grinder in 1000 µl of PBS pH 7.2 and sporozoites were counted in a Bürker-Türk counting chamber using phase-contrast microscopy , Anopheles gambiae (ftp://ftp.ensembl.org/pub/) and human IPI (ftp://ftp.ebi.ac.uk/pub/databases/IPI/) using the Mascot search algorithm (Matrix Science) with tryptic requirement and 0.2 Da mass tolerance for precursor mass and fragment masses. First ranked peptides (Mascot peptide scores>15) were parsed from Mascot database search html-files with MSQuant (http://www.msquant.sourceforge.net) to generate unique first ranked peptide lists. Plasmodium proteins identified by 1–3 three first ranked peptides were verified by manual inspection of the MS/MS spectra in MSQuant or in Mascot. An initial validation filter was applied to the dataset after reversed database searches. A minimal Mascot peptide score of 30 was determined by a reverse database search, which revealed a false positive rate of 17% for proteins identified by 1 peptide with a Mascot peptide score>30, delta score>5), 5% for proteins identified by 2 peptides (average Mascot score>30) and 0.3% for proteins identified by more than 2 peptides. Manual verification for proteins detected by less than 4 peptides substantially decreased the false positive rates and included proteins below this filter. After internal calibration of the peptide masses by MSQuant, an average absolute mass accuracy of 23.5 ppm was obtained for the entire dataset of P. falciparum peptides. To remove redundancy on the protein level and to uniquely assign peptides to one protein, the peptides were remapped to PlasmoDB 5.3 annotated genome using the program Protein Coverage Summarizer (http://ncrr.pnl.gov/software/). The collected peptide list of this study is available in The nLC-MS/MS procedure as described for the analysis of blood stages PAI–1 (PAI = nobserved peptides/nobservable peptides). The number of ‘observable’ peptides per protein was calculated from the output of the program Protein Digestion Simulator (http://ncrr.pnl.gov/software/), which computes peptide masses and hydrophobicities of simulated digests of protein databases. Two approaches were chosen to merge data from proteins identified in several slices, runs and batches. The first approach calculates emPAI values per slice for collapsed data of different runs. Per sample batch, emPAI values were subsequently summed over all slices. In cases for 22 gel slices per lane, data of two slices were merged to create a similar number of emPAI fractions for all samples. The second approach calculates emPAI values for merged data of all slices of all runs per sample batch. Both approaches resulted in protein emPAI values in 4 OOC batches (1–2×104 oocysts), 3 ODS batches (1.4–3.8×107 sporozoites) and 2 SGS batches (1.3–2.5×107 sporozoites).To determine the protein abundance in our samples, mass spectrometric data was analyzed using an identified peptide per protein count analysis to compute the exponentially modified Protein Abundance Index (emPAI) values P.falciparum salivary gland sporozoites Normalization between different batches was performed according to the median and 20 percent trimmed mean method http://www.r-project.org/).Values for the level (abundance) of protein expression from different datasets were obtained for all individual proteins by calculated emPAI values. EmPAI values and mRNA levels of microarray analyses were log2 transformed before regression analysis to obtain normal distributions. Pearson correlation between datasets was performed using R (http://go.princeton.edu/cgi-bin/GOTermMapper). A GO enrichment analysis for ‘Biological Process’, ‘Cellular Component’ and ‘Molecular Function’ using default GO association files was performed with “GO Term Finder” (http://go.princeton.edu/cgi-bin/GOTermFinder) where statistical significance is calculated based on hypergeometric distribution with Bonferroni multiple testing correction and false discovery rate calculation as described http://www.charite.de/ch/medgen/ontologizer/) was used where statistical significance is calculated as in ‘GO Term Finder’(see above and Gene Ontology SLIM terms were assigned using “Generic GO (mosq/(nmosq+nblood) where n is the number of unique peptides per protein at the mosquito and blood stages, respectively. The mosquito enriched proteins were further subdivided into 112 ODS-specific proteins expressed in the ODS stage and not SGS (Group I); 74 SGS-specific proteins not expressed in ODS (Group II); and finally 59 Group III proteins that are shared between several mosquito life cycle stages. A further refinement of these groups was based on the following criteria. Only proteins with more than two peptides detected in the mosquito stages (nmosq≥3) were considered. In addition, only proteins were selected that contained Signal peptide (SP), Transmembrane (TM) or Glycosylphosphatidylinositol (GPI) domains and combinations of these motifs. Sequence–based prediction data for these domains was retrieved from PlasmoDB (http://www.plasmodb.org) for SP and TM domain predictions based on TMHMM, TMAP, TMHMM2 and TOPRED2 algorithms; from http://gpi.unibe.ch/ for GPI predictions by a Kohonen Self Organizing Map; and from http://smart.embl-heidelberg.de/ for SMART protein domain searches. The number of TM domains is the average of four values obtained from the different TM prediction algorithms. Different criterions were set for combinations of predicted motifs. For less abundant proteins without predicted signal peptide , only proteins with at least 4 predicted TM regions were included (average TM>4). For abundant proteins without signal peptide proteins with at least 0.5 predicted TM regions (average TM≥0.5) were included. For proteins with predicted signal peptide (SP = 1), all proteins with at least 0.5 predicted TM regions (average TM≥0.5) were included. Finally, all proteins with a predicted GPI anchor (GPI = 1) were selected independent of the presence of predicted signal peptide or TM regions.Proteins with more than 90 percent of the peptides detected in the mosquito stages (mosquito fraction>0.9) were divided into three groups based on their expression patterns. The mosquito fraction equals nP. falciparum proteins were selected for functional analysis by targeted gene disruption of their corresponding orthologs in P. berghei. The sequences of the eight P. berghei gene orthologs (as well their corresponding up and downstream sequences) were retrieved from the on-line Plasmodium genome databases, http://www.plasmodb.org and http://www.genedb.genedb/genedb/pberghei .For P. berghei genes with incomplete sequence information in the database (4 out of 8), the complete genes were manually assembled from a number of different P. berghei sequences by performing BLAST sequence searches of the full length P. falciparum genes against the P. berghei genome and closing gaps by PCR and DNA sequencing . Briefly described for one candidate gene, to generate a PB000829.02.0/PF14_0435 disruption vector, an upstream region (position 74–436 on singleton berg-2274h02.p1k) and a downstream region (position 516–1016 on contig PB_RP2658) - the latter containing the P. berghei orthologous gene PB000829.02.0 - were amplified from P. berghei genomic DNA using primer-pairs 2666–2653 and 2654–2655, respectively. The PCR products were digested with Asp718 and HindIII, or EcoRI and NotI, respectively, and ligated into plasmid pl0001 yielding targeting plasmid pL1175 to 40–50 mosquitoes, at day 20 after the infectious blood meal. Infection was monitored by analysis of blood stage infection in Giemsa stained films of tail blood at day 4 till day 8 after infection. Infectivity was recorded as ‘wild type’ if mice developed a parasitemia of 0.1–0.5% at day 4 after infection. Infectivity of sporozoites to mice of 2 mutant lines was also determined by intravenous injection of sporozoites that were mechanically liberated by a glass grinder from either midgut oocysts (1–2×106 oocyst sporozoites collected at day 20 from mutant line 841 and wild type line 507cl1) or collected from salivary glands . For obtaining oocysts and salivary gland sporozoites, mosquito midguts or salivary glands were dissected in a drop of RPMI culture medium and the transferred by a custom made needle into a glass grinder after which sporozoites were released by gently grinding. Blood stage infection in mice injected with sporozoites in 200 µl RPMI buffer was monitored as described for infection of mice via mosquito interrupted feeding.Phenotype analysis of mutant parasites during blood stage development, quantification of gametocyte production and ookinete development In vitro hepatocyte traversal and invasion experiments were performed as described elsewhere 4) to confluent monolayers of HepG2 cells in DMEM medium (note: medium had 10% FCS and 1% PenStrep). Mutant sporozoites were obtained as described above from either oocysts (day 20) or from salivary glands (day 27). Quantification of cell traversal and invasion was accomplished by using a cell-impermeable fluorescent marker molecule, rhodamine-dextran at 1 mg/ml that will visualize parasitized wounded cells specifically but not uninfected HepG2 cells. Sporozoites were incubated with HepG2 cells in the presence of fluorescent dextran for 2 hr, followed by washing the cells to remove the marker and incubation for an additional 24 hours to determine the development of exoerythrocytic forms (EEFs) of the parasite. Hepatocyte invasion was determined by counting the percentage of sporozoites inside dextran-negative cells because parasites do not develop successfully in wounded dextran-positive cells http://www.plasmodb.orgAll datasets will become available through the official Web site of the Plasmodium genome project, PlasmoDB , TRAP (PF13_0201), UIS3 (PF13_0012), P36 (PFD0210c), P36p (PFD0215c), myosin A (PF13_0233), MTIP (PFL2225w), actin (PFL2215w) and F-1,6-BP aldolase (PF14_0425), AMA-1 (PF11_0344), TRSP (PFA0200w), RESA8 (PFB0325c), SPECT1 (MAL13P1.212), SPECT2 (PFD0430c), CelTOS (PFL0800c), STARP (PF07_0006); and for P. berghei: UIS4 (PB100551.00.0), ECP1 (PB000649.01.0).The PlasmoDB accession numbers for other genes and gene products discussed in this paper are for P. berghei gene orthologs (as well their corresponding up and downstream sequences) that have been analysed in gene-disruption studies were retrieved from the PlasmoDB database (http://www.plasmodb.org) and from the GeneDB database (http://www.genedb.genedb/genedb/pberghei). For 4 out of 8 P. berghei genes with incomplete sequence information in the database, the complete genes were manually assembled from a number of different P. berghei sequences by performing BLAST sequence searches, PCR and DNA sequencing annotation for proteins from proteomes from two mosquito stages of (0.05 MB DOC)Click here for additional data file.Figure S2Pathway profiling with the number of unique peptides/protein detected in 5 different life-cycle stages Click here for additional data file.Figure S3P. berghei mutants with disrupted genes that encode orthologs of mosquito stage proteins of P. falciparum.Generation and genotype analysis of (5.77 MB PPT)Click here for additional data file.Table S1P. falciparum identified in proteomes of oocysts, oocyst-derived sporozoites and salivary gland sporozoites. Page ‘Peptides’: peptides identified by nLC-MS/MS. Information provided in the table: 1) life cycle stage, 2) peptide sequence, 3) MCR (mass of charge of parent ion), 4) charge of parent ion, 5) measured mass of peptide, 6) calibrated mass of peptide after internal mass calibration, 7) peptide rank in Mascot searches, 8) peptide score in Mascot searches, 9) Mascot peptide delta score , 10) accession number of protein identification from PlasmoDB version 5.3, 11) protein name, 12 reannotation PlasmoDB 2008)07)15 (genes with the most recently modified annotation by PlasmoDB), 13) protein mass (molecular weight), 14) protein pI (iso-electric point), 15) nr pept)prot)sample (the number of unique peptides per protein), 16) Residue Start , 17) Residue End , 18) sequence coverage (percentage of the protein covered by the identified peptides), and 19) protein emPAI value. Page ‘Proteins’: The corresponding proteins identified by the sequenced peptides, listing: 1) accession number (PlasmoDB version 5.3), 2) protein name, 3 reannotation PlasmoDB 2008)07)15 (genes with the most recently modified annotation by PlasmoDB) 4) protein mass (molecular weight), 5) protein pI (iso-electric point), 6) number of unique identified peptides, 7) protein emPAI value, and 8) mosquito fraction . Page ‘OOC’: proteins detected in OOC; column headings the same as for Page ‘Proteins’. Page ‘ODS’: proteins detected in ODS; column headings the same as for Page ‘Proteins’. Page ‘SGS’: proteins detected in SGS; column headings the same as for Page ‘Proteins’. Page ‘Mosquito stage specific’: proteins exclusively detected in mosquito stages (mosquito fraction = 1); column headings the same as for Page ‘Proteins’. Page ‘Shared with RBC stages’: proteins detected in mosquito stages and blood stages (0<mosquito fraction<1); column headings the same as for Page ‘Proteins’. Page ‘OOC-enriched’: proteins that are ‘highly enriched’ in OOC (mosquito fraction>0.9); column headings the same as for Page ‘Proteins’. Page ‘ODS-enriched’: proteins that are ‘highly enriched’ in ODS (mosquito fraction>0.9); column headings the same as for Page ‘Proteins’. Page ‘SGS-enriched’: proteins that are ‘highly enriched’ in SGS (mosquito fraction>0.9); column headings the same as for Page ‘Proteins’. Page ‘tRNA ligase’: overview of all tRNA proteins detected in mosquito stages, column headings the same as for Page ‘Proteins’.Peptides and proteins of (3.44 MB ZIP)Click here for additional data file.Table S2P. falciparum as reported by Florens and colleagues P. berghei as reported by Hall and coworkers Comparison of proteins identified in the mosquito stage proteomes of this study with the proteomes of salivary gland sporozoites (SGS) of (1.58 MB ZIP)Click here for additional data file.Table S3P. falciparum as reported by Le Roch and coworkers Correlation of protein abundance (emPAI approach) identified in the SGS stage proteome of this study with mRNA levels of the SGS transcriptomes of (0.02 MB XLS)Click here for additional data file.Table S4P. berghei and P. yoelii as identified by either subtractive hybridization (SSH) or cDNA quantification methods (SAGE). S-genes: 25 sporozoite (S) genes identified in a P.yoelii SSH screen UIS-genes: 30 UIS genes (Upregulated In Sporozoites) identified in a P. berghei SSH screen SIS genes: 123 SIS genes (Sporozoite expressed gene Identified by SAGE (SIS) genes) identified in a P. berghei SAGE analysis Comparison of proteins identified in the mosquito stage proteomes with genes transcribed in sporozoites in (0.06 MB XLS)Click here for additional data file.Table S5Primer sequences used in this study. Primers used in KO targeting plasmid construction. Primers used to check for plasmid integration in mutant (KO) parasites. Primers used in contig gap closure and wild type (WT) PCR analysis.(0.03 MB XLS)Click here for additional data file.

The influence of photodynamic therapy (PDT) on vascular perfusion and the development of hypoxia was investigated in the murine RIF-1 tumour. Image analysis was used to quantify changes in perfusion and hypoxia at 5 min after interstitial Photofrin-mediated PDT. The fluorescent stain Hoechst 33342 was used as an in vivo marker of functional vascular perfusion and the antibody anti-collagen type IV as a marker of the tumour vasculature. The percentage of total tumour vasculature that was perfused decreased to less than 30% of control values after PDT. For the lower light doses this decrease was more pronounced in the centre of the tumour. The observed reduction in vascular perfusion showed a good linear correlation (r = 0.98) with previously published tumour perfusion data obtained with the 86Rb extraction technique. The image analysis technique provides extra information concerning the localisation of (non)-perfused vessels. To detect hypoxic tumour areas in vivo, an immunohistochemical method was used employing NITP [7-(4'-(2-nitroimidazol-1-yl)-butyl)-theophylline]. A large increase in hypoxic areas was found for PDT-treated tumours. More than half the total tumour area was hypoxic after PDT, compared with < 4% for control tumours. Our studies illustrate the potential of image analysis systems for monitoring the functional consequences of PDT-mediated vascular damage early after treatment. This provides direct confirmation that the perfusion changes lead to tissue hypoxia, which has implications for the combined treatment of PDT with bioreductive drugs.

Atherosclerosis is an inflammatory process that develops in individuals with known risk factors that include hypertension and hyperlipidaemia, influenced by diet. However, the interplay between diet, inflammatory mechanisms and vascular risk factors requires further research. We hypothesised that interleukin-1 (IL-1) signaling in the vessel wall would raise arterial blood pressure and promote atheroma.−/−Apoe and −/−/IL-1R1−/−Apoe mice were fed high fat diets for 8 weeks, and their blood pressure and atherosclerosis development measured. −/−/IL-R1−/−Apoe mice had a reduced blood pressure and significantly less atheroma than −/−Apoe mice. Selective loss of IL-1 signaling in the vessel wall by bone marrow transplantation also reduced plaque burden (p<0.05). This was associated with an IL-1 mediated loss of endothelium-dependent relaxation and an increase in vessel wall Nox 4. Inhibition of IL-1 restored endothelium-dependent vasodilatation and reduced levels of arterial oxidative stress.The IL-1 cytokine system links atherogenic environmental stimuli with arterial inflammation, oxidative stress, increased blood pressure and atherosclerosis. This is the first demonstration that inhibition of a single cytokine can block the rise in blood pressure in response to an environmental stimulus. IL-1 inhibition may have profound beneficial effects on atherogenesis in man. Drugs to decrease plasma lipid levels and blood pressure are the basis of the medical treatment strategy for cardiovascular disease. Dietary modification of macronutrient and salt intakes has also been studied with some large effects upon systolic blood pressure in particular In the arterial wall, IL-1 is secreted primarily by monocytes and macrophages but also by endothelial and smooth muscle cells IL-1 is a powerful inflammatory stimulus to endothelial and vascular smooth muscle cells with effects that are plausibly linked with known mechanisms of atherogenesis −/−Apoe mice fed atherogenic diets. We also show a link between fat feeding and blood pressure that is mediated via IL-1 through modulation of the NADPH-oxidase subunit 4 (Nox 4).We report here the cardiovascular effects of abolishing IL-1 signaling either by genetic deletion of IL-1R1 or by administration of IL-1ra in proatherogenic More detailed methods can be found in the online supplemental material .−/−/IL-R1−/−Apoe mice were generated at JAX labs by cross breeding of −/−Apoe (JAX 2052) with −/−IL-R1 (JAX 3245) mice. All mice were on a C57BL/6 background. Male mice, 8 weeks of age, (12 per group) were fed normal chow , Western diet or Western High Cholate (WHC or Paigen) diet for 8 weeks. No differences in body weights between the strains were observed either with or without fat feeding. Diets were supplied by Special Diet Services, UK. All animal experiments were approved by the University of Sheffield Project Review Committee and conformed to UK Home Office ethical guidelines.Histologically stained paraffin wax embedded sections were analysed as previously described Systolic and diastolic blood pressures of mice were measured using a Visitech tail-cuff system and mean blood pressure calculated was used to determine arteriolar myogenic reactivity and responsiveness to nitric oxide, as previously described Irradiation and bone marrow transplantation of mice was performed as previously described in-situSuperoxide production in mouse aortic tissue sections was detected 2, annealing at 60°C and extension at 72°C. Primer sequences were as described in Quantification of Nox 2 and Nox 4 was performed by amplification of artery cDNA using a MX3000P instrument (Stratagene) with SYBR green dye, and normalization to 18S rRNA. For cultured cells, normalization was to β-actin. Optimized amplification conditions were 150 mmol/L primers, 2.5 mmol/L MgCl2, Emax, L-NAME effects and wall: lumen ratios were compared by t-tests. Data are presented as mean±SEM. p<0.05 was regarded as a significant difference.Data groups were analyzed by t-test or one-way ANOVA followed by a Bonferroni multiple comparison post-test, as appropriate. Blood pressure measurements were analyzed by global non-linear regression, followed by an F-test. Vessel diameters were analyzed by two-way repeated-measures ANOVA. pDFurther results can be found in the online supplementary text .−/−Apoe mice fed high fat diets displayed significant increases in atherosclerotic lesion area compared to mice fed chow, with the Western diet with high cholate (WHC) causing the a greatest increase , or Western diet (p = 0.4). However, when fed the WHC diet, −/−/IL-R1−/−Apoe mice developed a 36% smaller atherosclerotic lesion in the aortic sinus compared to −/−Apoe mice (p<0.001) . Represep<0.001) . Body we−/−Apoe and −/−/IL-R1−/−Apoe chimeric mice were used to determine the relative contribution of IL-1 signaling in cells derived from the bone marrow and non-bone marrow (tissue cells) upon the development of atherosclerosis following fat feeding. Irradiated −/−Apoe mice receiving −/−Apoe bone marrow had large, and −/−/IL-R1−/−Apoe mice receiving −/−/IL-R1−/−Apoe marrow relatively little, atherosclerosis in their aortic sinus following 8 weeks on a WHC diet, as expected and analogous to −/−Apoe and −/−/IL-R1−/−Apoe non-chimeric animals.−/−Apoe animals receiving −/−/IL-R1−/−Apoe bone marrow did not develop a lesion that was significantly different from −/Apoe mice receiving −/−Apoe marrow developed a 1.9-fold smaller lesion than the −/−Apoe to −/−Apoe controls (p<0.05). The lesion size between −/−/IL-R1−/−Apoe into −/−Apoe and −/−Apoe into −/−/IL-R1−/−Apoe mice also differed significantly (p<0.05) .Pathological analysis, by chromosome painting, of these animals showed all had engrafted donor marrow .−/−/IL-R1−/−Apoe mice fed the Western, WHC or chow diet (There was no difference in mean blood pressure in how diet . However or chow).−/−/IL-R1−/−Apoe or −/−Apoe fed a normal chow diet over an 8-week period (p = ns)(−/−/IL-R1−/−Apoe mice fed either the Western or WHC diet had a significantly lower blood pressure (a level comparable to −/−Apoe mice on chow diet) than the −/−Apoe mice fed the equivalent diet . However−/−Apoe mice on WHC diets infused with IL-1ra using an osmotic pump also had a significantly lower blood pressure than −/−Apoe mice given placebo ( placebo . Elevati−/−Apoe and −/−/IL-R1−/−Apoe mice fed Western and WHC diets did not differ in their sensitivity to phenylephrine (PE) (−/−/IL-R1−/−Apoe mice fed these diets displayed significantly greater vasodilator sensitivity to acetyl choline (ACh) . In −/−/IL-R1−/−Apoe mice fed WHC diet there was greater constriction (19.1+/−1.3%) compared to −/−Apoe (8.6+/−2.7%) following incubation with N(G)-nitro-L-arginine methyl ester (L-NAME) (p = 0.003), without a significant difference between pD2 (Mesenteric arteries from ine (PE) . However p<0.05; comparedesponse) .−/−Apoe and −/−/IL-R1−/−Apoe mice demonstrated similar internal luminal diameters of small mesenteric arteries increased in response to increasing intraluminal pressure (active response), with −/−Apoe mice fed either diet showing a trend towards a reduced myogenic response (−/−/IL-R1−/−Apoe mice fed WHC diet demonstrated a greater active pressure-diameter response compared to chow fed −/−Apoe mice (Both response . However−/− mice .h/R) −/−/IL-R1−/−Apoe vs 0.111+/−0.011 −/−Apoe, n = 6). Endothelium-independent relaxation responses, assessed by superfusion of sodium nitroprusside (SNP), also did not differ (−/−/IL-R1−/−Apoe mice fed a WHC diet compared with −/−Apoe mice (p = ns) .NO bioactivity was increased in p<0.05) . Activit(p = ns) . QualitaWHC diet . Quantit, p<0.05). ROS pro, p<0.05). Generat, p<0.05). Apoe−/−−/−/IL-R1−/−Apoe mice fed the WHC diet compared to −/−Apoe mice , −/−Apoe mice develop aortic atheroma −/−Apoe mice fed high fat diets.The Apoe and IL-1 receptor 1 (IL-1R1) genes. As expected, aortic atheroma was significantly reduced in −/−/IL-R1−/−Apoe mice fed WHC compared with −/−Apoe controls. This is in agreement with previous studies that showed decreased atherosclerosis in IL-1β−/− and IL-1α−/− mice fed a high cholate diet −/−Apoe model −/−/IL-1R1−/−Apoe mice showed no difference in blood pressure if given IL-1ra (data not shown), suggesting that IL-1ra does not act as a non-specific vasodilator.−/−/IL-R1−/−Apoe mice we investigated active arteriolar pressure-diameter responses and basal and agonist-induced NO production in −/−Apoe and −/−/IL-R1−/−Apoe fat-fed mice. The greater vessel diameter in response to increasing pressure in vessels from −/−/ILR1−/−Apoe, together with no observed difference in sensitivity to PE between groups or in vascular smooth muscle constriction for the given degree of muscle shortening , as well as the preserved response to SNP, all suggest a specific endothelial response.To study the mechanism of the attenuation of the blood pressure rise in the −/−/IL-1R1−/−Apoe mice compared to −/−Apoe in both diet groups as well as the greater contraction in response to L-NAME in the fat-fed −/−/IL-1R1−/−Apoe mice indicate a fundamental increase in bioavailable vessel wall nitric oxide as a result of selective loss of IL-1 signaling. This is emphasised by the observed increase in basal cGMP production seen in these mice. The activity of eNOS, in the presence or absence of eNOS co-factors, did not differ between the two mouse strains suggesting that the difference in bioavailable NO attributable to selective IL-1 inhibition is mediated by increased consumption of NO via increased arterial oxidative stress.The strikingly preserved agonist-induced NO dependent vasodilatation of resistance vessels from Apoe−/− mouse attenuated by abolition of IL-1 signaling. Taken together, these results suggest a central role for IL-1 in modulating the blood pressure response to high lipids and that this is via a selective reduction in bioavailable nitric oxide.In support of these data, there was consistent reduction of arterial ROS levels in mice unable to signal via IL-1. Investigation of Nox isoforms, known to regulate NADPH activity et al. who showed reduced atherosclerosis in wild type, WHC-fed mice reconstituted with either IL-1β−/− or IL-1α−/− bone marrow The chimeric mouse experiments were conducted to examine the compartment in which IL-1 signaling was important. Only in chimeras where tissue cells were unable to signal via IL-1 was a there a decrease in atherosclerotic lesion size. These data complement a recent study by Kamari −/−Apoe and −/−/IL-1R1−/−Apoe strains on high fat diets. The myography experiments also suggest a selective endothelial loss of function. Thus, the data presented here add to the hypothesis that IL-1 signaling within the blood vessel wall cells is the mechanism involved in the blood pressure and atherogenic responses to fat feeding in −/−Apoe mice.We also demonstrate that vessel wall ROS production and Nox 4 levels are altered between the non-chimeric Our studies examined the effects of two different pro-atherogenic diets, administered for 8 weeks. Of these diets, the WHC diet is known to be the most aggressive, giving a chronic inflammatory response compared to the acute response of a standard Western (high cholesterol/low cholate) diet The WHC diet can cause intense metabolic disruption, hepatic dysfunction and inflammatory activation. We did not see these effects. Additionally, we saw similar index data (e.g. blood pressure and atheroma formation) for mice fed on the Western and the WHC diet, though the magnitude of the blood pressure effects was reduced with the Western diet. We feel, therefore, that where we have used the WHC diet for further detailed experimentation that this is justified and that the results derived are the result of elevation in cholesterol: the Western diet giving intermediate cholesterol levels and intermediate phenotype, and the WHC diet giving rise to high cholesterol and an advanced phenotype.There is considerable interest in harnessing knowledge of basic inflammatory mechanisms of atherogenesis for therapeutic benefit. We show that dietary manipulation in a murine model of atherosclerosis is associated with a rise in blood pressure, an effect attenuated by selective inhibition of a single cytokine. High fat diets may be particularly linked with elevation in blood pressure −/−Apoe mice, development of atheroma is not driven directly by the rise in blood pressure In our experiments, there was a concomitant reduction in blood pressure and atheroma development. In fat-fed These data raise the possibility of an entirely novel strategy for prevention of atherosclerosis. An anti-IL-1 based approach would be expected to have a beneficial effect upon atherogenic mechanisms at multiple levels. Indeed, very recent data have indicated a beneficial effect of IL-1ra upon patients with type II diabetes Text S1Expanded methods.(0.04 MB DOC)Click here for additional data file.Results S1Additional data(0.04 MB DOC)Click here for additional data file.Figure S1−/− mice fed chow, Western, and WHC compared with ApoE−/−/IL-1R1−/− mice. Original magnification×2.Microscopic appearances around the aortic sinus of ApoE(1.18 MB TIF)Click here for additional data file.Figure S2−/− mice on both high fat diets, an increase that was significantly reduced in the Apoe−/−/IL-R1−/− mice on equivalent diets. (n = 9–20)Modulation of IL-1 signaling decreases acute phase reactant serum amyloid A (SAA) levels. SAA was elevated in Apoe(4.80 MB TIF)Click here for additional data file.Figure S3Chromosome painting of bone-marrow transplanted mice. No Y-chromosomes were seen in male mice transplanted with female bone marrow, confirming engraftment was successful. Male recipients of male bone marrow all have Y-chromosomes, as expected, as a positive control for this method.(2.45 MB TIF)Click here for additional data file.Figure S4−/− and Apoe−/−/IL-R1−/− mice. Intraluminal arteriolar diameter in response to increasing pressure (0–120 mmHg). *P<0.05 Apoe−/−/IL-R1−/− (n = 6) and **P<0.05 Apoe−/− WHC (n = 6) versus Apoe−/− chow (n = 4).Vascular reactivity of arterioles from Apoe(0.61 MB TIF)Click here for additional data file.Figure S5−/− mice (n = 6) (a) and human coronary endothelial cells (hCAEC) (n = 6) (b). However, no increase in ROS are seen in ECs isolated from Apoe−/−/IL-1R1−/− mice (n = 6) (a). Nox 4 mRNA expression is increased in hCAEC stimulated with IL-1β (n = 5) (c).ROS and Nox 4 expression in endothelial cells in culture. Increased ROS are seen following IL-1β stimulation of endothelial cells isolated from Apoe(9.90 MB TIF)Click here for additional data file.Figure S6ROS and Nox 4 expression in vascular smooth muscle cells in culture. No significant difference in ROS are seen following IL-1β stimulation of VSMCs (n = 6) (a). Nox 4 mRNA expression is decreased in VSMC stimulated with IL-1β (n = 1) (b).(0.30 MB TIF)Click here for additional data file.Figure S7−/− mice following feeding of a high fat diet. Mice fed WHC had significantly more ROS than those fed chow alone, with Western diet giving intermediate levels of ROS. (n = 9).ROS generation in Apoe(2.79 MB TIF)Click here for additional data file.Table S1−/−/IL-1R1−/− and ApoE−/− mice fed chow, Western High Cholate (WHC), and Western diets. Data represents mean+/−SEM.Lipid, glucose and ALT levels in ApoE(0.05 MB DOC)Click here for additional data file.Table S2−/−/IL-1R1−/− and ApoE−/− mice fed chow, Western high cholate (WHC), and Western diets, determined by ELISA. Data represents mean+/−SEM.Plasma levels of IL-1ra, IL-1β, IL-1α and IL-6 in ApoE(0.04 MB DOC)Click here for additional data file.Table S3−/−/IL1R1−/− and Apoe−/− mice fed a Western high cholate (WHC), Western, or Apoe−/− mice fed chow diet, assessed by pD2 and Emax (percentage maximum constriction). All data are means+SEM. p = ns.Potency and efficacy of vasoconstrictor response to phenylephrine in pressurised mesenteric arterioles from Apoe(0.04 MB DOC)Click here for additional data file.

The hydrogen-bonding scheme gives rise to a three-dimensional network.In the crystal structure of the title compound, C DOI: 10.1107/S1600536808014347/tk2271Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Genetic association studies are identifying genetic risks for common complex ocular traits such as age-related macular degeneration (AMD). The subjects used for discovery of these loci have been largely from clinic-based, case-control studies. Typically, only the primary phenotype being studied is systematically documented and other complex traits are largely ignored. The purpose of this study was to characterize these other or secondary complex ocular traits present in the cases and controls of clinic-based studies being used for genetic study of AMD. The records of 100 consecutive new patients (of any diagnosis) age 60 or older for which all traits affecting the eye had been recorded systematically were reviewed. The average patient had 3.5 distinct diagnoses. A subset of 10 complex traits was selected for further study because they were common and could be reliably diagnosed. The density of these 10 complex ocular traits increased by 0.017 log-traits/year (P = 0.03), ranging from a predicted 2.74 at age 60 to 4.45 at age 90. Trait-trait association was observed only between AMD and primary vitreomacular traction (P = 0.0009). Only 1% of subjects age 60 or older had no common complex traits affecting the eye. Extrapolations suggested that a study of 2000 similar subjects would have sufficient power to detect genetic association with an odds ratio of 2.0 or less for 4 of these 10 traits. In conclusion, the high prevalence of complex traits affecting the aging eye and the inherent biases in referral patterns leads to the potential for confounding by undocumented secondary traits within case-control studies. In addition to the primary trait, other common ocular phenotypes should be systematically documented in genetic association studies so that adjustments for potential trait-trait associations and other bias can be made and genetic risk variants identified in secondary analyses. The eye has long been an excellent organ for studying hereditary diseases, in part, because the visual system enables use of our discriminating sense of vision to characterize phenotypes. Genetic association studies on age-related macular degeneration , cataract (OMIM 601371), glaucoma (OMIM 137760), and other diseases are unraveling the genetic risks for common complex ocular traits The unavailability of phenotypes on other (secondary) ocular traits in a case-control study gives rise to a number of limitations. Because such clinic based studies are collected from a number of different subspecialty clinics, the inability to account for the diagnoses for which the patient presented could lead to undetected confounding of genetic results. Trait-trait associations that might confound the interpretation of association results, such as the reported increased risk of exudative AMD in eyes with posterior vitreous adherence to the macula or Fuchs endothelial dystrophy (OMIM 610158), cannot be assessed Equally important to these potential problems is the inability to explore genotypes generated in genome-wide studies for association with secondary ocular traits or even the large number of biomorphic and biochemical variables such as axial length of the eye, corneal thickness, and retinal autofluorescence that influence disease progression A great deal of work goes into the ascertainment of subjects for disease-specific case-control studies. Some of this effort is specific to each disease. However other factors such as fundus photographs of the macula in studies of AMD can also be used to study the retinal vasculature and optic nerve . Similarly, activities such as consent, eye examination, phlebotomy, isolation of genomic DNA, and genotyping would apply to all traits initially. Environmental exposures such as tobacco smoking and body mass index alter the risk of multiple eye diseases and the effort to collect this information would be applicable to a number of complex traits affecting the eye One might argue that the use of clinic-based case-control studies should be minimized in favor of population-based case-control cohorts or family studies as more robust designs for avoiding possible confounding and biases The purpose of this study was to better understand the other complex ocular traits affecting the aging eye in the types of clinic-based, case-control studies currently being used by us and others to study the genetics of AMD and other traits. To this end, we documented the density of complex traits present in 100 consecutive patients age 60 or older attending a referral-based vitreoretinal clinic. This information was used to explore the additional information that might be gained by considering secondary ocular traits in genetic-epidemiology studies. The study revealed that most patients age 60 older have greater than 3 distinct diseases affecting their eyes, that most of these diseases were common ocular traits, and that they were typically present at a similar or higher frequency as population estimates. Controls without any other common and potentially hereditary eye diseases were rare. Rather than ignoring the potential confounding of secondary traits, we propose an alternative strategy in which subjects selected based on the presence of a disease be characterized for all other common diseases within that organ system. This approach would enable the detection of genetic risks for secondary traits while accounting for any stratification, confounding, or association between traits and other variables using standard statistical methods. The proposed “multiple-trait case-control study” employing several binary traits is analogous to traditional cohort studies in which the incidence of multiple quantitative traits are ascertained. These observations are important for the design of large-scale genome-wide association studies studying ocular traits and possibly for the study of other organ systems.In order to determine the density (number of traits per patient) of traits affecting the aging eye, the systematically documented diagnoses of 100 consecutive patients seen in the clinic for the first time for any reason from one retinal specialist were extracted from the medical record . An averA scatter plot of year of age versus the density of the ten complex ocular traits listed in Exploratory analyses were performed looking for gender-trait and trait-trait associations. Fisher's exact test was used to test for association with gender for all traits with at least 5 patients with the trait and 5 patients without the trait. No gender-trait association was observed for Fuchs, AMD, glaucoma, PVD, VMT, retinal vascular occlusion (RVO), or retinal tears. The low frequency of conditions thought to be associated with gender , may explain the failure to observe an association.Trait-trait associations were assessed for each of the ten complex traits having at least 10 patients with and 10 patients without the trait . The only significant association was AMD with VMT (P = 0.0009) in which VMT was protective. The distribution was as follows: AMD/VMT 4, AMD/No VMT 50, No AMD/VMT 16, and No AMD/No VMT 30. Since both eyes were always examined, it is unlikely that the VMT obscured the diagnosis of AMD, which usually affects both eyes. This observation probably reflects a referral bias in which patients with AMD and VMT are not referred for surgery for VMT, thus leading to a decrease in the number of subjects with AMD and VMT.We sought to determine the odds-ratio of a genetic effect that could be detected in a case-control study based on this clinic-based study. Using the frequencies of traits observed in the 100-person sample, we extrapolated to a similar hypothesized clinic-based sample of 2000 subjects. The 2000 subjects effectively form a cross-sectional study, where one defines diseased and not-diseased then analyzes with logistic regression models with estimation of odds-ratios for each genetic variant (a case-control study). The analysis enabled an estimation of the information on secondary traits that would be ignored in most ocular case-control studies. Specifically, we tested the hypothesis that comprehensive phenotyping of common ocular traits would enable discovery of genetic risks for secondary traits. The genotype data would be re-analyzed after re-coding cases and controls based on each secondary trait. The analysis showed that even this primitive ascertainment strategy, without any effort to increase the representation of less common traits, would have enabled detection of genetic risks for most of the traits see . There wWe show that the average patient age 60 or older has at least 3.5 distinct ocular diseases or traits, and that the majority of these diseases arise from common complex traits affecting the eye. Further, we show that some traits steadily increase with age, but that others do not appear to increase after the age of 60 years. Finally, we show that comprehensive documentation of secondary common complex traits affecting the aging eye would substantially increase the value of a genome-wide genetic association study.We chose to use clinic-based cases and controls from a subspecialty clinic, because this represents the most common method used to ascertain patients for genetic case-control studies of eye diseases. Such samples are easily collected during the course of routine patient care. Further, large numbers of affected subjects with broad representation of the spectrum of disease and its complications can be collected in this manner, which is typically not possible with population-based approaches due to financial constraints. It is important to realize the limitations of clinic-based, case-control studies. The frequencies of traits do not necessarily reflect the underlying population prevalence and they tend to over-estimate population parameters such as relative risks and attributable fractions. Further, replication is essential for all genetic association results, regardless of the study design Additional concerns in the use of case-control studies are the potential for selection bias and the possibility of confounding due to unmeasured differences between case and control status that are associated with genetic exposures. One manner is which this could arise might be from referral patterns to the specific physicians from which the case or control subjects are being collected. Thus, an additional benefit of documentation of secondary complex traits affecting the eye would be to account for such effects using standard statistical techniques. At this time it is largely unknown if this type of confounding exists in genetic association studies of ophthalmic or other traits. Thus, our identification of association between vitreomacular traction and AMD is of particular interest. The observation that patients with vitreomacular traction were less likely to have AMD, was unexpected because previous studies have suggested it might be a risk factor for exudative AMD Even though the examiner of the 100 consecutive subjects in this study routinely documents all ocular traits including the ten in Prevalence studies of corneal guttae have not been performed in North American populations. The Reykjavik study estimated an overall 9% prevalence in a Caucasian population, while a study on Asians estimated 3.5% to 6.5% depending on the population The much higher prevalence of AMD in our patients, compared to the population estimate of 15%, is due to referral bias, since this was the leading cause of presenting diagnosis Genetic association studies on age-related ocular traits often use age 60 or older for controls, under the assumption that subjects in this age range are unlikely to develop the trait under study at a later age. Our observation of a steady increase in the density of complex traits with age might be explained by only older subjects symptomatic or having vision threatening eye diseases coming to the clinic. We have no method for controlling for this possibility, but our observations are consistent with the already established increase in disease prevalence for AMD, glaucoma, and RVO In addition to these complex traits affecting the eye, there are a number of quantitative biomorphic and biochemical variables of interest in eye development and disease risk. For example, central corneal thickness has been associated with risk of development of glaucoma and many investigators believe that macular pigment and macular autofluorescence alter the risk of macular degeneration The density of complex traits in these patients and our modeling studies suggest that future studies of complex ocular traits would benefit from the systematic documentation of secondary traits. An ascertainment strategy that focused on the diseases of highest priority could be employed to optimize the case-control study for detection of other traits of secondary interest. There is substantial evidence that many of the common traits have genetic influences, as illustrated in A number of study designs are available to study common complex traits. The Wellcome Trust Case Control Consortium used a pool of unexamined subjects as the controls for each of the seven traits studied This retrospective chart review was approved by the institutional review board of the Mayo Clinic and patient consent was not required. The data was extracted twice and any discrepancies resolved by the first author. The initial visit was reviewed first and subsequent visits reviewed to look for diseases present at the first examination, but that were not documented. Although this study is retrospective, the retina specialist performed a systematic and comprehensive eye examination documenting all ocular diagnoses, including the complex traits listed in The diagnostic criteria followed standard clinical criteria. The diagnosis of AMD was made based on a published classification system Primary complex traits and all distinct diagnoses were recorded. Complications of primary diseases, such as retinal edema from branch retinal vein occlusions, were not extracted. Refractive errors were not recorded because of the absence of refractive status prior to cataract surgery and the absence of important refractive components such as axial length. Posterior staphylomata from high myopia were not recorded because of the lack of an ophthalmic ultrasound to record the diagnosis accurately, but myopic degeneration of the RPE and retina was recorded as an accurate marker of myopic degeneration. Secondary diagnoses such as epiretinal membranes from trauma or glaucoma from surgical complications were not included. Drusen insufficient to meet the diagnosis of AMD were not considered a diagnosis. Extraocular conditions such as blepharitis and ptosis were not extracted.This study was primarily descriptive with the goal of determining the density (number per patient) of complex ocular traits affecting a clinic-based study of patients age 60 or older. Poisson regression models were fit to assess the effect of age and gender on the density of the 10 complex ocular traits in The traits observed in the 100 consecutive patients were extrapolated to create a hypothetical clinic-based study of 2000 patients. The odds-ratio that could be detected with power of 0.8 given the frequency of each trait and a minor allele frequency of 0.1, 0.2, and 0.4 were calculated. Power for the main analysis of AMD and the secondary eye traits was computed assuming a log-additive genetic model, complete linkage disequilibrium between the SNP and the causative variant, and a population-based estimate of the prevalence of each trait. Varying significance levels were used to adjust for multiple testing of many variants, namely, 0.05 for one variant, 0.001 for multiple variants in a single gene, and 0.00001 for multiple variants across the genome.

Enhanced relapse prevention (ERP) is a psychological intervention delivered by mental health professionals to help individuals with bipolar disorder (BD) recognise and manage early warning signs for mania and depression. ERP has an emerging evidence base and is recommended as good practice for mental health professionals. However, without highly perceived value to both those receiving (services users) or delivering it , implementation will not occur. The aim of this study is to determine what values of ERP are perceived by service users (SUs) and mental health professionals providing community case management.A nested qualitative study design was employed as part of a randomised controlled trial of ERP. Semi-structured interviews were conducted with a purposive sub-sample of 21 CCs and 21 SUs, and an iterative approach used to develop a framework of conceptual categories that was applied systematically to the data.The process of implementing and receiving ERP was valued by both SUs and CCs for three similar sets of reasons: improved understanding of BD (where a knowledge deficit of BD was perceived), enhanced working relationships, and improved ways of managing the condition. There were some differences in the implications these had for both CCs and SUs who also held some reservations.CCs and SUs perceive similar value in early warning signs interventions to prevent relapse, and these have particular benefits to them. If this perceived value is maintained, CCs and SUs in routine practice may use ERP long-term. Bipolar disorder (BD) is a serious mental illness affecting one to two percent of the population , charactSurveys of patient organisations across Europe and the US reveal there is a strong desire by patients with BD for both self-help and psychological treatments in addition to pharmacotherapy ,4. RecenOne form of psychological intervention is relapse prevention (RP), which (taking a psychoeducation approach) teaches people with BD to recognise early warning signs to manic and depressive episodes ,9. This The main advantage of RP interventions compared to more sophisticated approaches involving early warning signs, such as some forms of cognitive behaviour therapy and family therapy ,15, is tet al. . Because I thought I could stop taking my tablets and I can't It also provided an argument for why SUs should respond to any warning signs:Knowledge is power, isn't it? . . . If they are beginning to go into a relapse, the wish is to stick their head in the sand . . .'I will be alright by the end of the week, this is just passing'. Whereas what this work [ERP] was doing is saying you feel it – well react! Straight off, because we have only got limited time An element that some SUs identified as valuable was feeling they could now 'face' the illness without fear, realising they are not alone in suffering from BD:At first, like before I had the intervention, it was like, I just felt like I was the only one out there . . . It was just learning, really. Being educated about it, whereas before all I knew about it was . . . That's all I knew about it An element of the intervention that was particularly valued was creating a timeline, charting past manic and depressive episodes. This gave the opportunity to make sense of what had occurred in their lives, to reflect on the past and understand how the illness had affected them as an individual. While the value of this process was recognised, some SUs found recalling past episodes uncomfortable, especially identifying triggers and warning signs of depression:She finds it painful looking at when she was being depressed . . . Once she is out of that depression she doesn't want to revisit there SUs described talking about their illness as emotionally tiring and upsetting, and some reported induced feelings of anxiety. CCs were aware of this being demanding, and one reported that looking at triggers and early warning signs had the potential to induce a relapse.For CCs, managing BD meant adjusting the ways they worked with clients. Management for SUs involved self-care, including their use of health services and advice from CCs. Both sets of participants described differently the changes to how they managed BD.ERP meant CCs spent more time with SUs, because sessions were longer or more frequent than usual – particularly when SUs were well, rather than , having most contact during a crisis or relapse. Although spending more time together was valued, CCs perceived this as an added burden on their workload and time. Progress could be hampered by competing demands from SUs, which required them to react to current problems rather than engaging in preventative therapy. CCs described having to juggle two aspects of their role – reaction and prevention . For some, the intervention was recognised as building on this latter role. For others, this was a less familiar role and necessitated a change in their way of working, which increased the complexity of their role, and hence was demanding. Some reported that ERP sessions diverted being able to discuss other issues of importance to SUs, such as accommodation or financial concerns:The client has got other issues going on, and sometimes its [ERP] is just not a major . . . agenda for them The time spent together doing ERP was more formal and structured compared with previous encounters or that described by untrained CCs:Doing it this way it's very focused . . . and moves on progressively, whereas sometimes if you are not careful you can do tea-drinking exercises. You go in 'how are you today? . . . Are you taking your meds alright? . . . Sleeping and eating alright? Any pressures in your life?' . . . It can become very generalised, and I found with this it was good that you had a real focus CCs valued the structure and focus of ERP as it gave them a sense of purpose:I am actually doing something useful, rather than just talking about nothing Despite the need for some planning prior to the sessions and how this also added to their workload, many reported the value of having a manual and accompanying documentation was valued. Getting plans and information down on paper gave SUs something to refer to:They have actually got visual stuff to look at and remind them of what is happening . . . to look at and say well 'ok, if this, that is what I am going to avoid'. Formulating an action plan was useful not just for the SU but for CCs and other health professionals. Care plans used in the TAU group were largely undervalued and seen as 'a waste of time' 'ineffective', 'patronising', and 'burdensome', having little function for either CCs or SUs:I would say that 75% of my service users would not open their care plan from the day it was sent out to them to the day it's renewed In contrast, the action plans devised as part of ERP were viewed as being accessible and used by SUs:She has got it [action plan] up on her wardrobe, so when she opens her wardrobe she can see it I got all the symptoms on mania and depression, I have got two sheets . . . if I find am not being able to cope with any of them, I have got the numbers to ring. (14: SU: ERP)However this was not necessarily true for all participants: some reported only using the plan occasionally, particularly when SUs were stable.CCs liked that the action plan was 'much more personal and appropriate to that one individual' as well as being more concise. It was useful for disseminating the plan to other health professionals in that it told them 'what to do', which was particularly important in case the SU did not have access to their CC or usual care providers during a crisis. Nevertheless, several CCs still voiced concerns that SUs would not use it in a crisis, or that it would not be accessed and used by the wider care team.In addition to devising personalised action plans, CCs described valuing focussing on coping strategies particular to the individual:Very specific things to them. So like this one lady, she would go and have a massage or a facial, or have her nails done. That is what she likes doing to relax, whereas that man that I saw he would go and clean his motor bike Or more typically, to clarify and reinforce existing strategies:Most people have already got coping skills. Its just either altering them because they are a little bit inappropriate, or just using the ones that they have already got but make it very clear to them that it is a good thing to do CC valued the changes to the way they worked with those with BD. In addition, it was reported that the core elements of ERP could be applied to other conditions such as schizophrenia and psychosis:Even though you have to use a different perspective a little bit, it is still the same, same process . . . whether that was schizophrenia or bipolar. Respondents described how increased awareness of triggers, early warning signs, and coping strategies had changed behaviour, particularly medication adherence. By looking back over previous episodes some believed their awareness of their early warning signs to relapse had increased:I feel a lot more aware now of what goes on. Before I really didn't have a clue, to be honest As a consequence, SUs described being better able to monitor their mood and behaviour. Moreover, instead of relying on their CC for monitoring, SUs were more able to identify early warning signs themselves:She wouldn't have identified them as quickly. It would have been me going round and questioning her, rather than her actually identifying them herself This gave a new perception of control about managing their illness:It's like new for me, you know. You are always looking for goals . . . Not that you want to sit and feel sorry for yourself, but if you have got a focus to learn more about it then you can have more control . . . I can't be thinking 'what if I just go like that and I can't control it', which used to terrify me Both SUs and CCs described this in terms of empowering for SUs:It has actually structurally empowered the client to actually look at their own patterns of behaviour, patterns of illness, so they actually have a self-monitoring part In consequence, SUs responded to early warning signs more quickly, contacting services earlier, more appropriately, and at a point where relapse prevention was possible:When she has two nights of no sleep, she becomes ill very quickly and she is one of the people that text me to say I am not sleeping, 'can I have some tablets'? I get it arranged, she comes and she picks it up, and that's that. She hasn't had a relapse in a year and so she has been brilliant . . . And I have found it really beneficial They also found other ways of responding to early warning signs to prevent them developing:You just have to think of the steps what you have got to do, you know, the programme thing [ERP], be calm, do whatever, relax . . . have a bath and work it through, talk to your care worker, or whatever, and it's better, and that's what I did However, some SUs felt coping strategies were ineffective, as relapses occurred too quickly and that there was little they could do to prevent them. For others, they chose not to intervene – one individual explained that although she could recognise the early signs of mania, because they were positive, she was unmotivated to try to prevent relapse:I know the early signs of highs, I talk faster. I don't go to bed. I nibble; I don't eat proper meals or anything . . . I don't want to watch out for them, I want to go out and enjoy myself Another set of values identified by both CCs and SUs related to an improved relationship between SUs and CCs and the mental health service. Because of the increased time SU spent with their CCs, there was more time to get to know one another better:We got on really well . . . didn't so much at the beginning, but because I hardly saw her . . . We just talk about absolutely anything, which is great. It also gave CCs and SUs an opportunity to talk about things they had not necessarily discussed before. SUs and CCs independently described the way in which ERP gave an opportunity to work collaboratively. SUs talked about the value of 'having a say in it' and 'working together' with their CC. CCs talked about a 'working relationship' and ERP being a 'relationship-former'. Working collaboratively also built trust:I have worked more closely with her, even though I was seeing her weekly; it's probably been closer because we have actually been doing something together. So yes, probably more trust. Improved relationships and trust was reported to influence help-seeking behaviour and increase contact with service providers when support is needed:And she now, more so than before, [will] ring me if there was a problem. Whereas before, even though I say to people' ring me if there is', nine times out of ten they think, well, they are being a nuisance so I won't. But that has gone, with [SU] she would. However, one CC reported that the impact of increased knowledge of the SU and of an enhanced relationship created a greater dependency on the CC as an individual care provider rather than the service as a whole:Because they feel I know a lot about them and their illness and its presentation, they feel quite anxious when I am not around, if I am on leave While ERP was reported by many of the SUs and CCs to change their relationship for the better, it was recognised by some that ERP had a less positive impact on their relationship. Changing the balance of roles of CCs and their way of working with SUs had the potential to change the dynamic of their relationship whereby it became more structured, focused, and less reactive:I wouldn't want all my sessions with [CC] to be like that [ERP] because they would be too heavy, you know e.g., primary care mental health workers) and in developing resources for SUs that are more personalized and suited to meeting individuals needs.Within the context of a contemporary policy commitment to making psychological interventions more widely available within health services, the significance of findings of this study assumes significant salience. In the UK, the Improving Access to Psychological Therapies (IAPT) programme seeks to provide better access to psychological therapies for people with mental health needs (DoH 2008). A fine-grained view of the components of ERP, which was the aim and focus of this study, fits with this broader policy agenda that seeks to engage a wider group of professionals in delivering a range of psychological interventions and individuals with BD who are receiving the intervention (SUs). The process of implementing and receiving ERP in a community mental health setting was valued by both SUs and CCs for similar reasons: benefiting from an increased understanding of BD, developing ways of working with and managing BD, and enhancing working relationships. This is a key step in establishing the feasibility of providing relapse prevention in this way to individuals with BD .Our results resonate with the findings of two previous qualitative studies of SUs with BD. Previously, it was found that those with BD who had stayed well for two years valued being able to recognise triggers and early warning symptoms, and this was identified as a means of preventing further episodes . In addiERP delivered through case management in community mental health teams also fulfils an unmet need. SUs report frequent discontinuities of medical and psychological care, inadequate and inappropriate care in crises, and exclusion of carers and families from management decisions . ERP proAlthough there were many similarities between the perceived value of ERP for CCs and SUs, there were some important differences in emphasis. SUs emphasised reduced isolation, empowerment, making sense of their lives, and acceptance as a result of their diagnosis and medication. Interventions that promote a bigger role of the SU in management of their condition tend to reduce social isolation and increase empowerment , althougERP was perceived to increase individuals' understanding of BD. SUs were given knowledge that was specific to BD that fit with their personal experience of living with the disorder. It maybe therefore, that being given information that is specific enough to the individual's illness and experience is a necessary pre-requisite to promote relapse prevention. The data also revealed the lack of previous knowledge about BD that most CCs felt they had prior to undertaking the ERP training. CCs emphasised the benefits of more structure and focus to their thinking about relapse, their intervention, and their action plans as a result of ERP training. Furthermore, although ERP was developed specifically for BD, CCs spontaneously recognised that they could apply the core elements of the intervention when working with clients with other conditions. Demonstrating that an intervention can be applied to other conditions is an important selling point for its implementation.Overall, the impression obtained of case management, as carried out in CMHTs under treatment as usual with SUs with BD, was that the skills of CCs were not being used optimally. The additional benefits of nursing intervention for SUs with BD may only arise if the CCs are properly trained and supported for the role . The perIn general, ERP was valued, but not for all CCs and SUs, such as SUs who may become distressed by reviewing previous episodes of illness, who believe that they do not have the ability to prevent fast onset illness episodes , or valuCase management by mental health professionals working in the community is common in the UK but it is less common, especially for younger people with BD, in other health systems . In the There are a number of limitations to the study. Rather than being able to assess actual behaviour, reliance has been on accounts of participants involved in the study. Limitations in the methodology also include the important question of whether CCs and SUs told the research team what CCs and SUs thought they wanted to hear rather than their beliefs. We tried to prevent this by presenting to CCs and SUs a separate identity for the qualitative team from the team carrying out the randomised controlled trial and the service in which the CCs worked, adopting a neutral stance in the interview process using open questions that did not indicate any preference for one treatment over another, and selecting participants who did not complete ERP as well as those who did.In undertaking a qualitative investigation we did not seek to recruit a representative sample, but rather to access the range of available views. Participants were those who were already recruited for a training trial and therBecause the study was conducted alongside a randomised controlled trial, participants were interviewed within 12 months of delivering or receiving ERP. Consequently only eight out of the fourteen SU interviewed in the ERP group had experienced a relapse by the time of the interview. It may be that over a longer period further value for SU may have been identified or elements identified early on may be less valued and this would be an interesting area for further research. Similarly for CC, experiences over a longer time period with a range of different SUs and situations may influence their views of ERP.In summary, ERP appears to be of perceived value to many CCs and SUs in the management of BD. The intervention was reported to provide a greater understanding of BD and developed ways of working with and managing BD in terms of skills and confidence in dealing with the early stages of acute episodes, and by enhancing the working relationships between CC and SU. It is recommended that SU and CC perceptions of value of an intervention (rather than just the evidence base of effectiveness) are identified and incorporated into an implementation strategy. ERP was valued by CCs and SUs; therefore, with conditions that support the introduction of complex interventions , its impThe authors declare that they have no competing interests.All authors contributed to the design and analysis of the study. FL was principle investigator on the trial from which the participants were recruited. EP collected the data and led the analysis. SP led the writing of the paper to which all authors contributed and commented on drafts.

The relationship between tumour growth, insulin status, blood lipids and adipose linoleic acid was studied in 19 Jewish women suffering from early and advanced stages (ES and AS) of ovarian and endometrial tumours. Blood insulin in patients with ES tumours was four times higher than the control value in cancer-free subjects, but fell to normal levels at AS and after ES surgery (PES). Tumours and abdominal adipose tissue (AAT) had 4-6 and 1.4-1.7 times as much insulin as non-cancerous control organs. Serum total cholesterol (CHOL) and LDL-cholesterol were high at ES, dropped below normal at AS, but normalised at PES, while HDL-cholesterol increased after ES surgery. Linoleic acid in subcutaneous adipose tissue (SAT) was high in controls , but lower in cancer patients , while palmitic acid showed the opposite change. The results suggest mobilisation of glucose, cholesterol and linoleic acid for the supply of energy and structural lipids to rapidly multiplying tumour cells and possibly for prostaglandin synthesis. They also raise the question of whether the high linoleic acid intake by the Jewish population in Israel predisposes individuals to tumour development.

The M.AhdI enzyme has been prepared with deuterated S subunits, to allow contrast variation using small-angle neutron scattering (SANS) methods. The SANS data were collected in a number of 1H:2H solvent contrasts to allow matching of one or other of the subunits in the multisubunit enzyme. The radius of gyration (Rg) and maximum dimensions (Dmax) of the M subunits in situ in the multisubunit enzyme are close of those of the entire MTase (51 Å and 190 Å). In contrast, the S subunits in situ have experimentally determined values of Rg = 35 Å and Dmax = 110 Å, indicating their more central location in the enzyme. Ab initio reconstruction methods yield a low-resolution structural model of the shape and subunit organization of M.AhdI, in which the Z-shaped structure of the S subunit dimer can be discerned. In contrast, the M subunits form a much more elongated and extended structure. The core of the MTase comprises the two S subunits and the globular regions of the two M subunits, with the extended portion of the M subunits most probably forming highly mobile regions at the outer extremities, which collapse around the DNA when the MTase binds.Type I restriction-modification (R-M) systems encode multisubunit/multidomain enzymes. Two genes (M and S) are required to form the methyltransferase (MTase) that methylates a specific base within the recognition sequence and protects DNA from cleavage by the endonuclease. The DNA methyltransferase M.AhdI is a 170 kDa tetramer with the stoichiometry M The enzyme has the stoichiometry M2S2 and recognizes and methylates the symmetrical DNA sequence, GACN5GTC.in vitro.The related MTase, M.AhdI, from Methanococcus jannaschiiMycoplasma genitaliumM. genitalium, there seems to be no corresponding M subunit encoded in the genome and thus the function of this protein is unclear; it may have some other DNA-binding role, unrelated to R-M activity. Nevertheless, the overall features of these structures are similar, and are likely to apply to the S subunits of other, well-characterized, MTases. In both structures, the two TRDs form globular domains linked by two antiparallel α helices, corresponding to the two conserved domains of the protein. Both structures have a circular topology, as predicted on theoretical grounds, with the N and C termini of the polypeptide in close proximity.There is no high-resolution structure available for any intact type I MTase, although the structures of the putative S subunits of 2AR0) but the structure has not been published. In the crystal, the M subunits form a symmetrical dimer, although it is not known whether the protein is dimeric in solution. Significantly, substantial parts of the structure are unresolved in the electron density map, suggesting the presence of highly mobile regions. The M subunits of both M.EcoKI and M.EcoR124I are susceptible to limited proteolysis, an indication of the presence of flexible and/or unstructured regions,The X-ray crystal structure of an M subunit is available in the Protein Structure Databank (PDB ID Rg) of 56 Å and a maximum dimension of 180 Å.A number of quite different models have been proposed for type I MTases, based on partial homology to various subunits or domains of known structures.2H2O, the M subunits are “matched out” and the structure and location of the S subunits within the MTase can be analysed. Likewise, in 100% 2H2O, one essentially sees the structure of the M-subunits within the selectively deuterated enzyme.A limitation of SAXS is the difficulty in determining the locations of individual subunits, even if the overall shape can be determined. However, with small-angle neutron scattering (SANS), individual subunits can be perdeuterated to permit the use of contrast matching.1H:2H content of the solvent, the selectively labeled subunits can be contrast-matched and scattering data collected for the individual subunits in situ in the MTase complex. From such experiments, we have determined the low-resolution shape of the M and S subunits in the complex and the location of these subunits in the MTase.Unlike R-M systems such as EcoR124I, both the M and S subunits of M.AhdI are sufficiently soluble to allow reconstitution of the enzyme from separately expressed subunits, which can be differentially deuterated before reconstitution. In order to determine the arrangement of the subunits of the methyltransferase, we have prepared M.AhdI in two states for SANS experiments: the first as a fully hydrogenated enzyme, the second with the M subunit hydrogenated and the S subunits perdeuterated. By varying the 2H2O (P(r), which shows the distribution of all inter-atomic vectors in the molecule (Rg and the longest dimension (Dmax) of the entire complex. For M.AhdI, the Rg was found to be 51( ± 1) Å and the Dmax was 190 Å; these values are of a magnitude similar to those determined for the EcoR124I MTase by SAXS .Firstly, data were collected for the hydrogenated M.AhdI enzyme in 100% 2H2O, where the hydrogenated M subunits of the complex are contrast-matched and therefore do not contribute to the scattering pattern, and 100% 2H2O, where the contribution of the deuterated S subunits to the scattering pattern is minimal. The corresponding distance distribution curves, P(r), are shown in Rg and Dmax values calculated for the native enzyme and the selectively perdeuterated M.AhdI enzyme in 40% 2H2O and 100% 2H2O, the latter corresponding to values for the S subunits and the M subunits, respectively, in situ in the MTase.Scattering data were collected for an M.AhdI sample in which the S subunits were perdeuterated and the M subunits were hydrogenated and Rg (35 Å) values than those of the M subunits . Thus, the M subunits extend towards the outside of the complex, while the S subunits are located more centrally.For the selectively perdeuterated M.AhdI in 100% ct MTase implies Rg and Dmax of the related restriction-modification subunits have been calculated from the available crystal structures of the M. jannaschii S subunit (PDB code 1YF2), and the EcoKI M subunit dimer (PDB code 2AR0), , see . In eachRg and Dmax values for the M and S subunits are determined in situ) with the values calculated from the crystal structures of the equivalent subunits, we observe that in both instances the values of Rg and Dmax are larger for the SANS-derived structures. The increases in Rg are much larger than any possible effects to due hydration, which are generally minimal for SANS.M. jannaschii and/or EcoKI enzymes, discrepancies between solution and crystal structures or structural differences between the free subunits and the subunits in situ in the MTase (see Discussion).If one compares the values determined by SANS for the selectively deuterated M.AhdI (where the Rg = 35( ± 0.5) Å, in excellent agreement with the value obtained for the S subunit dimer in situ by SANS. Thus the discrepancy in Rg between the latter and the value of 29 Å for the M. jannaschii S subunit arises most probably from the larger size of the AhdI S subunit dimer (51 kDa compared to 48 kDa), rather than any gross conformational change when forming the MTase.The latter possibility could, in principle, be investigated by solution scattering experiments on the isolated subunits. However, the M subunit of AhdI aggregates at high concentrations of protein and consequently is unsuitable for small-angle scattering studies in free solution, although the AhdI S subunit is much more soluble. We therefore carried out SAXS on the isolated AhdI S subunit dimer (data not shown). Analysis of the SAXS data gave a value of Ab initio shape determination has been performed for the data obtained under different contrast conditions using DAMMIN,ab initio shape determined for the M.AhdI complex is markedly elongated, with a central core that is more globular (ab initio model for the selectively perdeuterated enzyme in 100% 2H2O (i.e. when the S subunits are contrast-matched) indicates the shape of the M subunits within the complex. When this shape is aligned with the shape for the entire complex, it is possible to assign the M subunits to various regions of the complex. As was inferred from the distance distribution functions of the isolated subunits are good models for those of the multisubunit complex. Attempts were made to fit the SANS data for M.AhdI by rigid-body modeling, based on the available crystal structures of the homologues of the S and M subunits. These attempts included allowing the position and orientations of each M subunit to vary independently, as well as keeping the crystallographic dimer as one unit. We also allowed the inner and outer domains of the M subunit to move independently. However, in none of these cases was the fit to the data satisfactory, and the resulting structures did not look sensible. We conclude that the available structures are not appropriate for rigid-body modeling of M.AhdI. The reported crystal structures for the M dimer of EcoKI and the S subunit of MjaI may not be sufficiently good models for the solution structure of M.AhdI, since there is only weak sequence homology (as discussed below). Moreover, significant parts of the structure of the M subunit of M.EcoKI are missing in the reported crystal structure, and there is significant conformational flexibility.Rigid-body modeling provides an alternative approach to Dmax. The structure we have determined for M.AhdI represents the first experimental structure of any type I MTase, albeit at low resolution. From the overall shape of the multi-subunit enzyme, the location of the subunits (and their domains) cannot be determined, since they are in intimate contact. However, by employing specific deuteration/contrast variation techniques, the location of the M and S subunits becomes apparent. The dimer of AhdI S subunits has the Z-shaped structure that has been observed in other (putative) S subunits at high resolution by X-ray crystallography. The M subunit is much more extended, with a globular core in contact with the S subunits and an extended outer region that is responsible for the high Dmax for the two reduction in dimensions of M.EcoR124I observed by SAXS may be due to the outer regions of the M subunits collapsing in to surround the DNA.Comparison of the shape of the M.AhdI M subunit dimer determined by SANS with the crystal structure of the equivalent EcoKI M-dimer shows that the outer extended regions of the AhdI structure are not present in the EcoKI structure but comparison of their sequences shows that they have only weak overall homology at the N and C terminii of each TRD interact to form anti-parallel β-ribbons at the entrance to the TRD. On the alignment shown, all seven of the hydrophobic residues in each TRDComparison of the sequences of the AhdI and Rg of the AhdI dimer compared to the S subunit of M. jannaschii.On this alignment of the two sequences cells, from which they can be over-expressed. The bacteria were then grown on Enfors minimal medium using an Infors fermentation system at 30 °C to an Q range of 0.01–0.25 Å−1). Data reduction was performed using the GRASansP software Io value for each sample in each 2H2O:H2O solvent contrast, we established the contrast match points for the hydrogenated and deuterated protein within the M.AhdI complex.2H2O and for the partially deuterated enzyme, 89% 2H2O, confirming the successful incorporation of the deuterated subunits.Data were collected using the D22 diffractometer at the ILL , were calculated using GNOM.Rg directly from the scattering curves using the Guinier approximation, multiple p(r) functions were calculated using the program GNOM, with Dmax varying from 80 Å to 220 Å for each of the data sets. Scattering curves were then generated by back transformation of each of these p(r) functions and compared to the experimental data. The value of Dmax finally chosen was the value that gives an Rg that matches most closely the experimental Rg determined from Guinier plots.Modeling of the SANS data was performed using the ATSAS software package developed by Svergun Ab initio shape determination was performed using DAMMIN,P2 symmetry was imposed on the ellipsoid and the simulated annealing procedure was run with the schedule factor (which determines the rate of convergence of the iteration) set to 0.9. A penalty weight of 4 × 10−3 for the looseness and disconnectivity parameters was applied to the resulting models, and for the peripheral penalty weight, a value of 0.3 was applied. Initially, the shape of the entire complex was modeled using the data collected for hydrogenated M.AhdI in 100% deuterated buffer. Models with Rf, Looseness and disconnectivity values of greater than 0.01, 0.10 and 0.00, respectively were discarded. The resulting models were used as the starting template to model the M and S subunits, using the data collected for M.AhdI, where the S subunit was selectively deuterated and data collected in 100% and 40% deuterated buffer, respectively. For each of these data sets, the data were modeled to a Q value of 0.22 Å−1 and the 2-fold symmetry axis maintained.Rg (using the program CRYSONEach data set was modeled 20 times and the resulting shapes were aligned, averaged and filtered using the DAMAVER package of programs.ab initio shapes had been determined for each of the subunits of M.AhdI and for the complex itself the first stage of the alignment was performed computationally. The M subunits were aligned to the MTase using the program SUPCOMB20Rg was calculated for the shape defined by the two aligned shapes representing the S and M subunits, and was in agreement with that seen for the M.AhdI complex.Once ab initio models of the subunits was performed both manually and computationally using SUPCOMB20.The alignment of the available crystal structures with the Rigid-body refinement was performed using the program MASSHA.

The levels of several predicted target mRNAs of miR-211 were reduced in melanoma cell lines that ectopically expressed miR-211. In vivo target cleavage assays confirmed one such target mRNA encoded by KCNMA1. Mutating the miR-211 binding site seed sequences at the KCNMA1 3′-UTR abolished target cleavage. KCNMA1 mRNA and protein expression levels varied inversely with miR-211 levels. Two different melanoma cell lines ectopically expressing miR-211 exhibited significant growth inhibition and reduced invasiveness compared with the respective parental melanoma cell lines. An shRNA against KCNMA1 mRNA also demonstrated similar effects on melanoma cells. miR-211 is encoded within the sixth intron of TRPM1, a candidate suppressor of melanoma metastasis. The transcription factor MITF, important for melanocyte development and function, is needed for high TRPM1 expression. MITF is also needed for miR-211 expression, suggesting that the tumor-suppressor activities of MITF and/or TRPM1 may at least partially be due to miR-211's negative post transcriptional effects on the KCNMA1 transcript. Given previous reports of high KCNMA1 levels in metastasizing melanoma, prostate cancer and glioma, our findings that miR-211 is a direct posttranscriptional regulator of KCNMA1 expression as well as the dependence of this miRNA's expression on MITF activity, establishes miR-211 as an important regulatory agent in human melanoma.The immediate molecular mechanisms behind invasive melanoma are poorly understood. Recent studies implicate microRNAs (miRNAs) as important agents in melanoma and other cancers. To investigate the role of miRNAs in melanoma, we subjected human melanoma cell lines to miRNA expression profiling, and report a range of variations in several miRNAs. Specifically, compared with expression levels in melanocytes, levels of miR-211 were consistently reduced in all eight non-pigmented melanoma cell lines we examined; they were also reduced in 21 out of 30 distinct melanoma samples from patients, classified as primary Hedgehog pathway, which controls BCL2-mediated apoptosis; mutations in the Patched gene, the endpoint of the Hedgehog pathway, have been correlated with skin cancers BRAFARF. P14ARF binds to the Mdm2 protein in several cell lines and thereby abrogates Mdm2's binding to p53, causing p53 to be stabilized and nuclear localized. The loss of INK4a therefore may lead to interference of two separate pathways of cell cycle control: CDK signaling and suppression of p53 activity by Mdm2-induced acceleration of p53 degradation. Methylation near the 5′ upstream region of INK4a has been shown in some 10% of melanomas BRAF alone may be insufficient to cause metastatic melanoma, but additional mutagenic or epigenetic events such as the inactivation of tumor suppressor genes, e.g., Pten NOTCH signalling pathway is important for distinguishing normal melanocytes from melanoma cells Melanoma, a cancer of the pigment-producing cells in the skin epidermis, can be highly metastatic, and malignant melanomas are relatively resistant to standard chemotherapy Attention has recently focused on the role of small non-coding RNA molecules in cancer development KCNMA1, encoding a calcium ion-regulated potassium channel protein, appears to at least partially account for the high cell proliferation rate and invasiveness of melanoma cell lines. We also demonstrate that MITF expression is important for the coordinate expression of miR-211, and TRPM1. TRPM1 gene is a suppressor of melanoma metastasis, which encodes a transient receptor potential family member calcium channel protein, and encodes miR-211 gene in its sixth intron. Here, we propose a model for the role of miR-211 and its regulation in melanoma cells.In contrast to miRNAs that are over-expressed in melanoma, and their respective target genes that are thus under-expressed, relatively little is known about miRNA species that are systematically depleted in melanomas. Consequently, their respective target genes, expected to be up-regulated, which might explain some of the oncogenic potentials of invasive melanomas, are largely unrecognized. Realizing this gap in knowledge, we examined the expression levels of human miRNAs in defined melanoma cell lines and clinical melanoma samples. We report here the reduced expression of miR-211 in these cell lines and clinical isolates of human melanomas, and present evidence that a principal effect of the reduced expression of miR-211 is the increased expression of its target transcript KCNMA1. The expression of As the first step in identifying down-regulated miRNAs in human melanoma, we identified significantly differentially expressed miRNA species in the melanoma cell line WM1552C compared to those in the normal melanocyte cell line HEM-l by hybridization of total RNA samples to miRNA probe arrays see . Figure P = 0.029, for random distribution by Fisher's exact test) that is consistent with the uniformly low expression levels in all eight melanoma-derived cell lines we studied. Note that miR-211 expression levels were also observed to be low in normal skin samples, which is expected given that melanocytes constitute a minor fraction of skin cells. Additional miRNAs that were over-expressed in melanoma cell lines relative to those in melanocytes were also over-expressed in the clinical melanoma samples but not in the normal skin samples (data not shown), confirming that normal skin samples are not the ideal background controls. Although there is no perfect “normal” counterpart tissue for melanoma in clinical skin samples, we have tested miR-211 expression levels in additional melanocyte cell lines and in five independent isolates of normal skin samples. Results show that miR-211 is elevated in both melanocyte cell lines compared to normal human skin into WM1552C and A375 cells, followed by selection for stable expression of miR-211 and confirmation of expression by qRT-PCR analysis see . The melKCNMA1 transcript, KCNMA1 protein expression levels should inversely correlate with that of miR-211 expression levels. A western blot analysis of KCNMA1 expression was performed, utilizing the same cell lines previously examined by northern blot revealed that the introduction of miR-211 down-regulates the KCNMA1 transcript WM1552C, 2) WM1552C/VO (WM1552C cells with a stably-incorporated empty expression vector), 3) WM1552C/211(400), 4) WM1552C/211(800), and 5) WM1552C/KC KO (WM1552C cells with a stably-expressing shRNA against the KCNMA1 mRNA) . As expeanocytes . To furtanocytes . The resanocytes .KCNMA1 transcript confers sensitivity to miR-211, we performed a target cleavage assay with a construct containing the 3′-UTR of KCNMA1 cDNA fused downstream of the reporter gene β-galactosidase. The construct, pcDNA6/LacZ/KCNMA1, as well as a derivative, pcDNA6/LacZ/KCNMA1-MUT protein family member thought to be a potential suppressor of melanoma metastasis TRPM1 gene is not understood. The transcription factor MITF regulates the expression of TRPM1 gene, where the MITF-binding motif (GCTCACATGT) is located in the TRPM1 promoter TRPM1 promoter. We found that both TRPM1 and miR-211 transcripts are expressed in pigmented but not in the non-pigmented melanoma cells. To determine whether MITF expression modulates miR-211 expression, we knocked down MITF expression by siRNA in the pigmented melanoma cell line SK-MEL28. Three different doses of siRNA were used, and the knock-down efficiency was measured by qRT-PCR. As expected, the extent of reduction in MITF transcript levels directly correlated with the reduction in TRPM1 and miR-211 transcript levels and WM1552C/211(800) cells, along with WM1552C/VO, WM1552C/KC KO, and untransfected WM1552C cells were seeded separately into invasion chambers, and the cells were allowed to migrate see . Resultsin vitro.Current understanding of the molecular mechanisms of carcinogenesis is beginning to include not only the role of protein coding genes but also that of non-coding regulatory RNA, especially miRNAs. In the case of melanoma, our discovery of miRNAs whose expression levels are reduced in melanoma cells can potentially lead to the identification of genes that are responsible for oncogenesis and invasiveness. Along that line, we report here that miR-211 levels are consistently reduced in melanoma cells compared to its levels in melanocytes, and that the expression levels of several potential miR-211 target mRNAs are elevated in melanoma cells. We demonstrate that the increased expression of one particular confirmed target transcript, KCNMA1, is associated with high invasiveness and proliferation in melanoma cells KCNMA1, leading to higher oncogenesis and invasiveness. Both of these more complex possibilities are consistent with some of our results, but not with the full set of results presented here. While the assays of cell invasion reported here are widely used for demonstrating metastatic potential in situ studies with immunodeficient mice are needed to confirm the role of KCNMA1 in melanoma invasiveness in vivo. We observed that melanoma cell lines engineered to express high levels of miR-211 begin to lose expression shortly after removal from selection, indicating a strong bias against miR-211 expression during the growth of melanoma cell lines and suggests that the rapid proliferation of melanoma cells in culture is directly related to low miR-211 activity in these cells. Future experiments will explore whether the progressive reduction in miR-211 levels observed in these engineered cells is due to genetic or epigenetic changes.The simplest model we offer is that the down-regulation of miR-211 causes elevated levels of KCNMA1 protein in melanoma cells, which at least in part explains the invasiveness of malignant melanoma. More complex models are possible, such as yet unidentified targets of miR-211 (besides KCNMA1) that may have a positive feedback effect on KCNMA1 levels and are responsible for invasiveness. Another alternative possibility is that miR-211 down-regulation in melanoma causes other transformational events unrelated to TRPM1 gene, which contains miR-211 sequences in the sixth intron, was previously suggested to be a suppressor of melanoma aggressiveness TRPM1, is also needed for high-level expression of miR-211. Thus, the regulation by MITF of both TRPM1 and miR-211 genes can be speculated to have similar effects on melanoma invasiveness separately through their respective gene products: the former a Ca++ channel protein (TRPM1), and the latter a miRNA targeted against the Ca++ regulated K+ channel protein KCNMA1. If true, the invasiveness of melanoma cells could partly be the result of the breakdown of processes related to calcium-regulated ion homeostasis. The recent finding that salinomycin, an inhibitor of K+ transport, is a selective inhibitor of cancer stem cell proliferation is consistent with our findings on the role of KCNMA1 in melanoma cells TRPM1 gene is, at least in part, due to the co-expression of miR-211 encoded from within its sixth intron. In The et al.et al. et al. et al., In contrast to our finding that miR-211 levels in most melanoma cells and clinical samples were down-regulated, Gaur In conclusion, we have demonstrated that miR-211 is down-regulated in non-pigmented melanoma and its expression is regulated by the MITF gene. The down-regulation of miR-211 and the corresponding up-regulation of its target transcript KCNMA1 are therefore important molecular events for melanoma development and/or progression.2.The human epidermal melanocyte cell line HEM-l and primary epidermal melanoyctes –neonatal (ATCC - PCS-200-012) were grown in MelM media containing MelGS growth supplements, 0.5% FBS, and pen/strep solution. The melanoma cell lines examined included: A375 , G361 , LOX-IMV1 , HT-144 , RPMI-7951 , SK-MEL2 , SK-MEL28 , WM793B , and WM1552C . All melanoma cell lines were grown in Complete Tu Media containing a 4∶1 mixture of MCDB-153 medium with 1.5 g/L sodium bicarbonate and Leibovitz's L-15 medium with 2 mM L-glutamine, 2% FBS, and 1.68 mM CaClInformation regarding all clinical samples, derived from frozen samples, is described in miRNA NCode™ version 2 array (Invitrogen) containing 553 human and 427 mouse miRNAs, and the TILDA array (ABI) were used for miRNA expression profiling. The miRNA samples were labelled with AlexaFluor® conjugated dendrimers using the direct labelling kit (Genisphere). We routinely evaluated hybridization conditions by discriminating between 2 nt variants at internal sites, and most probes can distinguish between 1 nt variants. The arrays were scanned with Axon B-4000 (Agilent).GAPDH was used as the internal reference probe for normalization of expression values of mRNA, and RNU48 was used for normalization of miRNA. RNA analysis by Northern blots used 20 µg of total RNA concentrated from each sample (melanoma cell lines and melanocytes), separated on 15% urea denaturing polyacrylamide gels by electrophoresis. Gels were electroblotted to nylon membranes, cross-linked by UV, prehybridized in ULTRAhyb®-Oligo (Ambion) for 30 minutes at 42°C, and hybridized with 5′-biotinylated anti-miRNA DNA oligonucleotides (100 nM each) at 42°C overnight, washed, and detected by chemiluminescence . Anti-U6 probes were used as a reference control (at 10 pM).Expression levels of all statistically significant and differentially expressed mRNAs and miRNAs were confirmed by qRT-PCR using TaqMan® expression kits (Applied Biosystems) e.g., to select genes that have significantly less within sample variance compared to between sample variance), and correlation analysis with Pearson's product moment r and Spearman's r. Analysis was controlled for false discovery rate using q-values, with a priori cut off point of 10 percent j = µ+Tj+€, where µ is the mean expression of the gene, Tj is the tissue type, and € is the error term. The ANOVA model generated a significance level for each probe set, along with the fold change, and imputed gene annotations. miR-211 target set of genes were obtained from public databases , and the results from ANOVA were matched to obtain the final target gene list of genes. This target list was imported into Ingenuity Pathway Analysis Version 6.0-1202 (Ingenuity Systems®). A core analysis was run employing direct relationships only, the Ingenuity knowledge base genes as the reference set, and with down-regulators as the defined expression value parameter. All microarray data have been deposited into GEO, and accession number is pending.For the initial transformation of miRNA array data, the GenePixPro 6.0 global normalization method was employed in which images and results are normalized together. Statistical significance tests were Welsh t-test, nonparametric ANOVA, were used to amplify the 110 bp pre-miR-211 sequence from human melanocyte genomic DNA and TOPO®-cloned into the pCR®4-TOPO® vector (Invitrogen). The construct was sequenced, and the pre-hsa-miR-211 fragment was sub-cloned into pcDNA4/myc-HisA (Invitrogen) to create pcDNA4/miR-211. The KCNMA1 siRNA sequence was derived from Silencer® siRNA and constructed as long complementary oligos . The oligos were mixed at 100 µM, heated, and amplified through one round of PCR and then TOPO®-cloned into the pCR®4-TOPO® vector (Invitrogen). Inserts were sequenced and then sub-cloned into pcDNA4/myc-HisA (Invitrogen) to create pcDNA4/shKCNMA1.Oligonucleotides complementary to the 5 WM1552C or A375 melanoma cells were seeded into a single well of a 6-well plate and transfected overnight with 5 µg pcDNA4/miR-211, pcDNA4/shKCNMA1, or pcDNA4/myc-HisA (“vector only” negative control) using Fugene® 6 (Roche). The transfected cells were selected at 400 or 800 µg/mL Zeocin™ for 15 days, and the presence of the transgene copy in stable Zeocin™-resistant foci was confirmed by PCR . Cell lines were named WM1552C/211(400) or A375/211(400) when selection was at 400 µg/ml Zeocin™, and WM1552C/211(800) when selection was at 800 µg/ml Zeocin™, respectively. The “vector only” control cells were selected at 800 µg/ml Zeocin™. WM1552C/KC KO were selected at 400 µg/ml Zeocin™.2.5×10tgcggccgccttccctatatctaaacaatgcaaaatc, KCNMA1 Rev – aaccggtcacccatccaggcgaggagc, the primer set contained 5′ NotI or 3′ AgeI sites). The PCR product was cloned into pCR®4-TOPO® (Invitrogen), confirmed by sequencing, then sub-cloned into the 3′ UTR of the LacZ gene in pcDNA6/V5-His/LacZ (Invitrogen) using the 5′ NotI and 3′ AgeI restriction sites and reconfirmed by sequencing (pcDNA6/LacZ/KCNMA1). The cloned 3′UTR of KCNMA1 was mutated using the primers: KC Mut For- TACGCATATGAATTATTAAAACAATTTT and KC Mut Rev - TATGCGTAAATTACAATTAATTGTGCT, and used to PCR amplify pcDNA6/LacZ/KCNMA1 using Quickchange (Stratagene). The plasmid product was then recovered and confirmed by sequencing . A375 melanoma cell lines were then transfected in triplicate with 5 µg plasmid DNA of: A) pcDNA6/LacZ/KCNMA1, B) pcDNA6/V5-His/KCNMA1-MUT or C) pcDNA6/V5-His/LacZ (positive control), and co-transfected at 100 nM with miRIDIAN microRNA Mimics (Dharmacon) for A) miR-16-1, B) miR-211, C) miR-34b, D) miR-let-7a-1, E) miRIDIAN cel-miR-67 , or F) no mimic miRNA. After overnight incubation, cells were washed in PBS and reincubated in fresh media. After 48 hours, cells were harvested by trypsinization, examined for viability, and samples were prepared for the β-galactosidase assay using the β-Gal Assay kit (Invitrogen). Samples were incubated overnight at 37°C, then assayed for β -galactosidase activity in a 96-well plate format using a FlexStation3 (Molecular Devices).The 3′ UTR seed sequences of putative target genes were amplified by PCR from human melanocyte genomic DNA at 1/500 and anti-β-tubulin (BD Pharmingen) at 1/2000 according to standard methods. Blots were probed with horseradish peroxidase-conjugated secondary antibodies and visualized with ECL chemiluminescence (Pierce) or Alexa 680-conjugated secondary antibodies (Molecular Probes) and visualized on the Licor Odyssesy (Licor).Total lysates of 5×102 flasks at 5×105 cells per flask (in triplicate). Media was changed after 6 hours, and cells were further fed every 48 hours (Complete Tu Media). At days 4, 10, 15, and 21, cells were trypsinized, counted , and then reseeded. Each assay was performed in duplicate for all cell lines.Assays were performed using WM1552C, WM1552C/VO, WM1552C/211(400), WM1552C/211(800), A375, A375/VO, and A375/211 cell lines. Cells were grown in log phase, trypsinized, counted using an automated cell counter , and then seeded into 75 cm4 cells suspended in 0.5 ml of serum-free Complete Tu media were added to each insert well. WM1552C/211(800) cells were additionally transfected with the Anti-miR miRNA Inhibiter for hsa-miR-211 as well as Negative Control#1 (Ambion) (miR-Scramble) at a concentration of 100 nM using siPORT NeoFX (Ambion). Invasion assay plates were incubated for 48 hours at 37°C. Following incubation, the non-invading cells were removed by scrubbing the upper surface of the insert. The cells on the lower surface of the insert were stained with crystal violet, and each trans-well membrane was mounted on a microscope slide for visualization and analysis. The slides were scanned using the Aperio Scanscope XT and visualized using the Aperio Imagescope v10 software. The number of migrating tumor cells was counted from each of five images per cell line (including miR Inhibiter transfected cells) in the central area of the filter. Cell lines were tested in triplicate, and the assays were performed twice. Data are expressed as the percent invasion through the membrane relative to the migration of WM1552C (Wild Type) through the membrane.BD BioCoat™ growth factor reduced insert plates (Matrigel™ Invasion Chamber 12 well plates) were prepared by rehydrating the BD Matrigel™ matrix coating in the inserts with 0.5 mls of serum-free Complete Tu media for two hours at 37°C. The rehydration solution was carefully removed from the inserts, 0.5 ml Complete Tu (2% FBS) was added to the lower wells of the plate, and 2.5×105 HEM-l cells were seeded into wells of a 6-well plate. The cells were then transfected with Fugene® 6 (Roche) and either 100 nM of anti-miR-211 Inhibitors (Exiqon), 100 nM of anti-miR Inhibiter Negative Control #1 (“miR-Scramble”), or transfection agent only. After 48 hours, the cells were harvested by trypsinization and counted using an automated cell counter . 2.5×105 cells were then prepared for western blotting (as above).5×105 cells WM1552C/211(800) cells were seeded into wells of a 6-well plate. 1 well was transfected with 5 µg of KCNMA1-expressing plasmid using Fugene® 6 (Roche) and a second well was treated with transfection reagent only. After 48 hours, the cells were harvested by trypsinization and counted using an automated cell counter . 2.5×104 cells were then utilized for invasion assays (in triplicate) and 2.5×105 cells were prepared for western blotting (as above).2.5×10Figure S1miR-211 expression in melanocytes, normal skin and nevus. Both melanocytes and nevus sample indicate a higher expression of miR-211. Melanocyte A - HEM-l, Melanocyte B - HEM .(0.26 MB TIF)Click here for additional data file.Figure S2miR-211 expression in stable melanoma cell lines compared to melanocytes. Two stable miR-211-expressing WM1552C cell lines, as well as a “Vector Only” (VO) control cell line, as measured by qRT-PCR relative to levels in the melanocyte cell line HEM-l, are plotted as histograms. Error bars are standard errors of mean of three independent measurements.(0.24 MB TIF)Click here for additional data file.Figure S3Mutagenesis of miR-211 target seed sequence in the 3′UTR of KCNMA1. Diagram indicates the four nucleotides altered in the target seed sequence within the 3′UTR of KCNMA1 relative to the wild type.(0.25 MB TIF)Click here for additional data file.Table S1Description of human clinical samples.(0.72 MB TIF)Click here for additional data file.Table S2miR-211 expression levels in clinical samples. Note: Two-tailed t-test comparisons for miR-211 by mean relative quantification levels of melanocyte and primary melanoma, as well as regional, distant, and nodal metastatic melanoma were all statistically significant at P<0.000001.(0.84 MB TIF)Click here for additional data file.

Plasmodium falciparum-parasitized red blood cells (RBCs) are equipped with protective antioxidant enzymes and heat shock proteins (HSPs). The latter are only considered to protect against thermal stress. Important issues are poorly explored: first, it is insufficiently known how both systems are expressed in relation to the parasite developmental stage; secondly, it is unknown whether P. falciparum HSPs are redox-responsive, in view of redox sensitivity of HSP in eukaryotic cells; thirdly, it is poorly known how the antioxidant defense machinery would respond to increased oxidative stress or inhibited antioxidant defense. Those issues are interesting as several antimalarials increase the oxidative stress or block antioxidant defense in the parasitized RBC. In addition, numerous inhibitors of HSPs are currently developed for cancer therapy and might be tested as anti-malarials. Thus, the joint disruption of the parasite antioxidant enzymes/HSP system would interfere with parasite growth and open new perspectives for anti-malaria therapy.P. falciparum antioxidant enzymes and hsp60/70–2/70–3/75/90 was studied by quantitative real-time RT-PCR in parasites growing in normal RBCs, in RBCs oxidatively-stressed by moderate H2O2 generation and in G6PD-deficient RBCs. Protein expression of antioxidant enzymes was assayed by Western blotting. The pentosephosphate-pathway flux was measured in isolated parasites after Sendai-virus lysis of RBC membrane.Stage-dependent mRNA expression of ten representative In parasites growing in normal RBCs, mRNA expression of antioxidant enzymes and HSPs displayed co-ordinated stage-dependent modulation, being low at ring, highest at early trophozoite and again very low at schizont stage. Additional exogenous oxidative stress or growth in antioxidant blunted G6PD-deficient RBCs indicated remarkable flexibility of both systems, manifested by enhanced, co-ordinated mRNA expression of antioxidant enzymes and HSPs. Protein expression of antioxidant enzymes was also increased in oxidatively-stressed trophozoites.Results indicated that mRNA expression of parasite antioxidant enzymes and HSPs was co-ordinated and stage-dependent. Secondly, both systems were redox-responsive and showed remarkably increased and co-ordinated expression in oxidatively-stressed parasites and in parasites growing in antioxidant blunted G6PD-deficient RBCs. Lastly, as important anti-malarials either increase oxidant stress or impair antioxidant defense, results may encourage the inclusion of anti-HSP molecules in anti-malarial combined drugs. Plasmodium falciparum, reactive oxygen species (ROS) are produced by both the parasite and the host red blood cells (RBCs) falciparusee ref. ,17-20 suP. falciparum HSPs take part into antioxidant defense, and are modulated by oxidative stress possibly in a co-ordinated way with the antioxidant enzyme system. Redox-sensitivity of HSPs is unexplored in Plasmodium, although a number of HSPs are remarkably redox-responsive in most eukaryotic cells glucose was from Amersham International, Amersham, UK; Diff-Quik parasite stain was from Baxter Dade AG, Dudingen, Switzerland; Standard RNA Releaser was from Nurex, Sassari, Italy; RNaseOut RibonucleaseInhibitor, M-MLV reverse transcriptase, oligo-dT and Platinum Taq DNA polymerase were from Invitrogen, Milano, Italy; sterile plastics were from Falcon, Becton Dickinson Labware, Franklin Lakes, NJ; nitrocellulose transfer membranes were from Whatman-Schleicher & Schuell, Dassel, Germany; West Pico Chemiluminescent Substrate was from Pierce, Rockford, Illinois, USA. Bradford reagent was from Bio-Rad, Hercules, California, USA. All other reagents were purchased from common commercial sources.Buffers, RPMI 1640 culture medium containing Hepes, methionine-free RPMI 1640, mannitol, octylphenyl-polyethylene glycol (IGEPAL CA-630), gentamicin, xanthine (X), xanthine oxidase (XO), superoxide dismutase (SOD), allopurinol and SYBR Green 1 were from Sigma, St. Louis, Missouri, USA; Percoll was from Pharmacia, Uppsala, Sweden; RLN lysis buffer was prepared according to RNeasy Mini Handbook, Qiagen, Milano, Italy; DNA-P. falciparum parasites were cultivated at 2% haematocrit and synchronized as already described -CO2 production from D- [1-14C] glucose [14C] glucose and 32 mg/l gentamicin, pH 7.4) at 5% haematocrit. After 90 min of preincubation at 37°C, [14C]-CO2 production was measured as indicated [14C]-CO2 was expressed as μmol/1010 cells/h at 37°C. G6PD activity was measured spectrophotometrically at 340 nm and 37°C in the lysate as indicated [PPP flux was measured in trophozoites growing in normal or G6PD-deficient RBCs, treated or not for 18 h with XO-X by assessing the [ glucose . Trophoz glucose ,32. Sendndicated . For G6Pndicated .n. Significant differences between groups were assessed by one-way ANOVA followed by the Duncan's multiple-range test or Student's t-test depending on the experiments. p < 0.05 was chosen as the level of significance.Values are expressed as mean ± SEM unless otherwise noted. The number of experiments is indicated by P. falciparum, parasites were grown in presence of varying XO activities at constant 1 mM × concentration. The highest XO activity , which culture ) totallyP. falciparum growing in unstressed normal RBCs. Taking as a reference mRNA expression levels at early ring stage, a remarkably coordinated and homogenous increase in both antioxidant enzymes and HSPs expression was observed .The effect of oxidative stress on protein expression was studied by Western blotting and band densitometry in a panel of selected antioxidant enzymes in early trophozoite stage parasites growing in normal and oxidatively stressed RBCs. As shown in Figure PPP flux reflects the in vivo activity of G6PD, the first and pace-keeping enzyme of the pathway and the main producer of NADPH, the reductant utilized by the GSH- and thioredoxin-dependent antioxidant systems of the parasite. PPP flux was measured in Sendai-virus treated trophozoite-parasitized RBCs. This treatment allows measurement of the PPP flux in the parasite, since the virus lyses the RBC membrane by selectively binding to glycophorin A, leaving the parasite membrane intact and allowing elimination of cytosolic host enzymes ,32. TablP. falciparum parasite generates large amounts of toxic oxidants [P. falciparum genome appears to encode HSPs expressed at various stages of the parasite life cycle [Pf-HSPs and HSP-related proteins, but only a small number of those has been characterized biochemically and functionally [Pf-HSP to hyperthermia [Pf-HSPs to oxidative stress, extensively studied in pro- and eukaryotic cells lines [Pf-HSPs of present study were selected because they were well-characterized molecules , loc0, HSP90 ) or, by 0, HSP90 ,24, HSP90, HSP90 ) or pote0, HSP90 ,43).Pf antioxidant enzymes representative of the glutathione and thioredoxin system, and five representative and possibly redox-controlled Pf-HSPs were analysed by qRT-PCR at early and late ring stage (13 and 16 h after reinfection), early and late trophozoite stage (19 and 28 h after reinfection) and late schizont stage (46 h after reinfection).Present work addresses two aspects of parasite defense against oxidant challenge: first, modulation of expression of antioxidant enzymes and HSPs during normal parasite development, and, second, modulation of expression of both systems in front of increased exogenous and endogenous oxidative stress, represented respectively by parasite growth under a mild and constant flux of hydrogen peroxide produced extracellularly by XO/X , and groP. falciparum developing in normal RBCs show for the first time that both antioxidant enzymes and HSPs were expressed in a tightly correlated manner, as both systems peaked at early trophozoite stage at 19 h after reinfection, declined afterwards, and had very similar amplification factors between approx. 1.7 and 2.0 relative to mRNA expression at early ring stage. The two asymmetrical bell-shaped curves observed here appear to be functionally related to the kinetics of formation of superoxide anions, the principal generators of ROS mostly produced during the trophozoite phase when host haemoglobin is exposed to the acid environment of the food vacuole. These results basically agree with recently published P. falciparum transcriptome of antioxidant defense and pentose phosphate pathway enzymes in terms of time and amplitude of peak expression [The results obtained with pression -48. Studpression ,49. It wpression ,50. TakeResponse to exogenous oxidative stress was studied in parasites growing in normal RBCs subjected to a mild flow of hydrogen peroxide generated by extracellular XO/X . The restert-butylhydroperoxide and the redox cycler juglone [Protein expression of small number of antioxidant enzymes was studied by Western blotting and densitometry. Tendentially, high protein expression observed in SOD-1 and -2, Trx and Px3 corresponded to high mRNA responders, while GR was a low responder in terms of both mRNA and protein expression. Increased levels of protein expression of the 2-Cys peroxiredoxin were previously observed in parasites stressed with juglone . It shou juglone . However juglone ,53. On t juglone ,49, thusInstead of measuring enzyme activities in cell lysates we measured the PPP flux in Sendai-virus treated trophozoite-parasitized RBCs. PPP flux is considered to reflect NADPH formation by the parasite more closely than G6PD activity measured in the cell lysate, due to severe restraint of G6PD activity in the cell . For exaA second model of parasite response to oxidative stress were parasites growing in G6PD-deficient RBC . Those parasites are subjected to constantly increased endogenous oxidative stress, as G6PDdeficient RBCs have low antioxidant defense due to low steady-state levels of reduced glutathione (GSH) and severely restricted NADPH production and GSH regeneration kinetics upon oxidative challenge . In addiCompared to parasites growing in normal RBCs, parasites growing in G6PD-deficient cells displayed distinctly increased stage-dependent mRNA expression of antioxidant enzymes and HSPs, indicating that indeed the parasite was subjected to massive oxidative stress and responded with increased expression of protective molecules. While peak-to-trough ratios between approx. 1.7 and 2 were observed in parasites developing in normal RBCs, in parasites developing in G6PD-deficient RBCs ratios between approx. 4 and 8.5 were observed in antioxidant enzymes and HSPs, with the overshooting ratios of 12.8 and 15.8 in GR and Hsp75, respectively oxidation such as 4-hydroxynonenal formed in the mature parasites . SecondlPlasmodium suggest a certain degree of correlation between transcriptional response and alteration of protein levels. However, the amplitude of mRNA changes appears much more pronounced than alterations of protein levels observed in proteome studies [et al [Studies of the effects of drugs, such as chloroquine and artemisinin, on mRNA and protein levels in studies . Surpriss [et al showed ts [et al showing s [et al . Concomis [et al ,63. ThesP. falciparum to regulate gene expression at the mRNA level are poorly known, and putative regulatory elements have been sofar only identified in silico [P. falciparum genome [falciparum HSP genes [Mechanisms employed by n silico . Recentlm genome . HSP genSP genes . It is pSP genes , liberatSP genes ,67. WhicSP genes .In conclusion, it has been shown that mRNA expression of parasite antioxidant enzymes and HSPs was co-ordinated and stage-dependent. Both systems were shown to be redox-responsive and manifested enhancement of co-ordinated expression in oxidatively-stressed parasites and in parasites growing in G6PD-deficient RBCs characterized by blunted antioxidant defense. Finally, as widespread and efficient anti-malarials either increase oxidant stress or inhibit antioxidant defense, present results may encourage to consider the numerous anti-HSPs molecules currently developed for anticancer therapy -71 as poThe authors declare that they have no competing interests.FT, OA-N, SM and PA designed the research. OA-N, ET, PMM, SM and FT performed the experiments. GG helped with the real-time quantitative RT-PCR. FT, SM and PA examined and interpreted the data and wrote the manuscript. All authors read and approved the final manuscript.

To explore the effects of increasing fruit and vegetable intake and the resulting effects on levels of circulating micronutrients in a community-dwelling population with an already high consumption of fruits and vegetables, 112 volunteers (86% women) underwent targeted dietary counseling for three months. At the beginning of the study and after 4, 8 and 12 weeks a food frequency questionnaire was filled in, and plasma levels of dietary antioxidants as well as biomarkers of oxidative lipid and protein damage were determined. Compared to baseline, especially the intake of fruits was significantly improved after 3 months of intervention, and mean plasma levels of lutein, zeaxanthin, β-cryptoxanthin, lycopene, α- and β-carotene, retinol, α-tocopherol, vitamin C and vitamin B6 were increased. Biomarkers of oxidative stress remained unchanged. Thus, a nutritional counseling program is capable of improving plasma levels of antioxidants even in a health-conscious population. A decrease in biomarkers of oxidative stress, however, does not occur. Research is still needed on micronutrient requirements for optimal health and adequate vitamin intake. Identification of the conditions favoring initiation and maintenance of a healthy nutrition, especially so in adult working populations as target groups of preventive activities, has become a major health priority.Dietary habits are an important instrument of active care for maintaining the population's health due to the association between antioxidant-rich food intake and the occurrence of age-related diseases . A largeOne-hundred twenty-nine employees of a University Hospital in Düsseldorf, Germany, were recruited in the present study. All study participants gave their informed signed consent and followed an intervention plan consisting of 4 two-hour sessions for three months: baseline, T0; 4 weeks, T1; 8 weeks, T2; and 12 weeks, T3. In the sessions, guided by a nutritionist and a physician, participants were motivated to consume at least five portions of fruits and vegetables daily, i.e. at least 400 grams fruits and vegetables per day for at least the whole duration of the study. Participants were asked to fill in every two weeks a standardized qualitative food frequency questionnaire (FFQ) modified from Winkler and Döring [Blood samples (collected in a heparinized tube and immediately centrifuged), medical history and clinical data including BMI were available at each session. Plasma (or supernatant of deproteinized plasma to preserve vitamin C) was stored frozen at -80°C until analysis. Carotenoids were analyzed by HPLC with UV/vis detection with a sOne hundred-twelve subjects with complete data sets from all sessions were included in the final analysis. Twelve% of the subjects were smokers, 73% considered themselves healthy and 27% declared only minor complaints. The distribution of participants into class A, B and C at T0 and at T3 is shown in Table Most of the participants were already following health-conscious lifestyle and baseline micronutrient plasma levels were quite high (yet in the range described in the literature), but a further significant increase of lutein, lycopene, α- and β-carotene, vitamins C and B6 was achieved at T3 compared to baseline Table , Bethesda, MD. MCP is currently Fellow of the Forschungskolleg Geriatrie, Robert Bosch Foundation, Germany.

This method is illustrated for multiplexed SSAP markers based on retrotransposon insertions of pea and is applicable for the rapid and efficient generation of markers from genomes where repetitive element sequence information is available for primer design. We cross-reference SSAP markers previously generated using the 33P manual PAGE system to fluorescent peaks, and use these high-throughput fluorescent SSAP markers for further genetic studies in Pisum.Dense genetic maps, together with the efficiency and accuracy of their construction, are integral to genetic studies and marker assisted selection for plant breeding. High-throughput multiplex markers that are robust and reproducible can contribute to both efficiency and accuracy. Multiplex markers are often dominant and so have low information content, this coupled with the pressure to find alternatives to radio-labelling, has led us to adapt the SSAP (sequence specific amplified polymorphism) marker method from a The optimal conditions for the fluorescent-labelling method used a triplex set of primers in the PCR. These included a fluorescently labelled specific primer together with its unlabelled counterpart, plus an adapter-based primer with two bases of selection on the 3' end. The introduction of the unlabelled specific primer helped to optimise the fluorescent signal across the range of fragment sizes expected, and eliminated the need for extensive dilutions of PCR amplicons. The software (GeneMarker Version 1.6) used for the high-throughput data analysis provided an assessment of amplicon size in nucleotides, peak areas and fluorescence intensity in a table format, so providing additional information content for each marker. The method has been tested in a small-scale study with 12 pea accessions resulting in 467 polymorphic fluorescent SSAP markers of which 260 were identified as having been mapped previously using the radio-labelling technique. Heterozygous individuals from pea cultivar crosses were identifiable after peak area data analysis using the fluorescent SSAP method.1 and F2 progeny, indicating the potential to develop high-throughput codominant SSAPs.As well as developing a rapid, and high-throughput marker method for genetic studies, the fluorescent SSAP system improved the accuracy of amplicon scoring, increased the available marker number, improved allele discrimination, and was sensitive enough to identify heterozygous loci in F These SSAP markers have allowed the integration of Pisum genetic maps from different populations especially where there are common parents [Hibiscus [Vicia [The SSAP marker method described by Ellis et al. for pea parents , barley parents , HibiscuHibiscus , potato Hibiscus , sweetpoHibiscus , cotton Hibiscus , agave [Hibiscus , wheat [Hibiscus , vine [1Hibiscus , Vicia [s [Vicia , lettuces [Vicia , cashew s [Vicia and cucus [Vicia . Though s [Vicia -16 the Ss [Vicia in that PDR1 the relatively low copy number Ty1-copia – like retrotransposon insertions [Pis1 and Cyclops [33P labelled, PAGE (polyacrylamide gel electrophoresis) system with marker amplicons in the range ca. 100 – 1300 nucleotides (nt) that appears to be suitable for conversion to automation and fluorescent amplicon detection.For pea the SSAP marker method, based on sertions or on th Cyclops ,4,18, ha Cyclops ; it is a33P PAGE and fluorescent peaks needed to be established. Here we describe the conversion from a manual radio-labelling method to a high-throughput automated system, the capture of PDR1 retroelement related fluorescent SSAP markers in the range 100 – 1300 nt and their use in pea genetics. We also describe the development of codominant markers using the analysis of fluorescent peak areas to calculate dosage ratios for both F1 and F2 individuals, and discuss the potential use of these markers with their improved information content.To enable cross-referencing of existing SSAP markers between the radio-labelled method and fluorescent approaches, the range of amplicon sizes resulting from both techniques needed to be the same, and the correspondence between the band pattern from TaqI restriction digest, with corresponding adapter ligation, followed by PCR amplification using a specific primer, and a Taq adapter primer. To capture PDR1 insertions conveniently it is necessary to have two bases of selection at the 3'-end of the Taq adapter primer . Fluorescently labelled primers were HPLC-purified to generate a homogeneous length distribution [The most common SSAP method iribution .33P PPT specific primer described previously [xl this experiment gave consistent but unacceptable results regardless of the amplicon dilution: the labelled primer peak was vast and its intensity overwhelmed that of the amplicon peaks, which were low. There was no obvious correspondence between the peak pattern and those previously observed from the 33P PAGE method and the expected amplicon size range was not achieved.Initial attempts to generate fluorescent SSAP markers merely substituted an HPLC-purified 6-FAM labelled PPT specific primer Table for the eviously . When te6FAMPPT primer without HPLC-purification was tested and modifications to primer concentrations [6FAMPPT primer and the Taq+2 primer, and also a triplex of primers that consisted of the duplex mix plus unlabelled PPT primer. The peak patterns from a dilution series (1/10 – 1/80) of the amplicons from both of the duplex and triplex PCRs were compared.To overcome these problems a trations were mad6FAMPPT (not HPLC purified), unlabelled PPT, and the Taq+2 adapter primer (each at 0.1 μM), at tenfold dilution of amplicons in formamide loading solution, resulted in a reproducible peak pattern that matched the manual 33P PAGE banding pattern. Peaks corresponding to bands in the expected range 100 to >1200 nt, were obtained. The fluorescent tag HEX was also tested and gave comparable results to 6FAM. Subsequent experiments used both tags with different primer combinations, where the PCR products were co-electrophoresed on the ABI3700 xl.Results from the duplex reaction were variable with respect to peak intensity and SSAP amplicons > 900 nt were not resolved, or were of very low intensity, barely discernible above the background. However, triplex primer reaction conditions containing 33P PAGE procedure were mimicked by peak area variation with the fluorescent SSAP triplex primer method. Faint bands in the 33P procedure corresponded to low intensity fluorescence. For example the JI281 faint band at 802 nt on 33P PAGE . The 0 to 0.5 range of accuracy was used throughout this study as an indication for the same marker peak. Where the peak corresponded to an amplicon >1200 nt (the upper extreme for the LIZ size standard) or had a weak fluorescent signal, size was determined using the manual calling facility of the software, but the deviation between duplicate samples was sometimes 1–2 nt; in these cases duplicate samples were found to be crucial for amplicon identification.In this study we have found that for amplicons smaller than 1200 nt the estimated size range deviation was 0 to 0.5 nt between duplicate samples, monomorphic bands, and repeat ABI runs for the 33P PAGE: polymorphic markers that appear difficult to score accurately would tend not to be attempted. The base calling and binning of fluorescent markers removes this element of human bias.As a general observation an additional source of marker number differences between manual PAGE and the fluorescent system involves a human bias and selection procedure of allele scoring from ® Excel file from the GeneMarker Version 1.6 software (SoftGenetics LLC®) reduces data error. Manual peak calling and the binning facilities of the software were found to be useful where GeneMarker failed to call a peak; this was found necessary where the signal for a peak was below the set detection threshold, or where there was a run of close peaks that differ by one to two nt, and for peaks greater than 1200 nt (the upper limit of the LIZ size standard). Even with the benefits of the software all peaks needed to be checked manually.Errors in manual scoring and data tabulation create problems for genetic mapping and further data analysis ,22. The 33P manual PAGE as a high-throughput fluorescence system.The major aim of this study was to develop and optimise the well established SSAP marker method from PDR1 SSAP marker method using 33P manual PAGE has provided a core set of markers for pea genetic analysis and comparative mapping, but the fluorescent marker method provides an increased marker number and more information is associated with each marker. The use of fluorescence has eliminated many of the problems discussed above, and has made the scoring of markers all the more accurate.Since its inception the PDR133P banding pattern and fluorescent peaks. This was an important criterion as these 33P markers constitute a reference set of markers for pea map integration.A major requirement in the development of the fluorescent SSAP method was the need to establish the correspondence between the PDR1 SSAP marker development [With the fluorescent SSAP method amplicons are identified on the basis of size in relation to an incorporated known size ladder which is present in every sample. Amplicon size variation may be the consequence of conformational polymorphism from single base differences. The SSCP method is a recognised marker method ,24 and aelopment ,26. A co33P PAGE for band extraction, or whole scale cloning of the amplification products. These methods have been explored [PDR1 retroelement insertion sites as a codominant marker system described as RBIP [PDR1 right and left-hand flanking regions from the 33P SSAP have been extracted from PAGE gels and sequenced [One minor disadvantage of the fluorescent system is the difficulty isolating fluorescent amplicons for further marker characterisation and development. Almost certainly there will be the requirement to have sequence information of specific amplicons and the need either to revert to explored for the orphism) . During equenced .33P PAGE are dominant and so have low information content for analysing F2 populations [1 hybrids. Figure 1 hybrids. Of these loci, two were monomorphic for the insertion site. The Waverex peak at 295 nt . These four markers scored as dominant from 33P PAGE could be scored reliably for the presence of heterozygotes from the fluorescent method.Four polymorphic fluorescent SSAP markers . The fluorescent method highlights the unreliability of this marker.An example of a marker that does not obviously segregate the heterozygotes from the homozygous peak present state can be seen in Figure One disadvantage with this marker type is that one homozygous class will always be scored as zero. A zero result could either be a failed PCR or absence of the retrotransposon insertion, however with the multiplex amplicon pattern of SSAP a failed PCR is obvious. Monomorphic amplicons are a useful guide in the assessment of optimal PCR amplification and from this analysis are a means to determining zygosity.PDR1. In general the insertion sites of this element within the Pisum genus are quite diverse across the genome [P. sativum cultivars.The choice of monomorphic amplicons for normalisation and ratio comparisons are limited from the SSAP described here which assays the relatively low copy number, but highly polymorphic, insertion sites of the retroelement 33P method, but has improved the accuracy of marker calling and has provided useful approximations to amplicon size. In addition it has increased the number of available markers and given the ability to recognise amplicons more sensitively and with codominant marker potential. The high-throughput method described has so far used two fluorescent tags simultaneously but there is potential for at least four, this cuts down the run cost per sample per capillary. The triplex primer method, that incorporates both labelled and unlabelled specific primers, removes the need for pre-amplifications and extensive dilution series before electrophoresis on the ABI genetic analyser. The use of software for marker peak analysis reduces the error in scoring data conferring a major benefit for genetic data analysis. Isolation of fluorescent amplicons for further characterisation and development is not immediately convenient. However here we have shown using a small scale diversity analysis that there is good transferability of the method between manual PAGE and fluorescence where band to peak patterns concur. We have also shown that using peak area values the fluorescent method can distinguish the heterozygous from homozygous classes, providing the potential for a high-throughput codominant marker system.We have developed a fluorescent marker assay for SSAPs that retains the useful features of previously used : JI15, JI73, JI281, JI399, JI813, JI1194, JI1201, JI2822, JI3253 (cv. Cameor), JI3108 (cv. Terese), JI992 (cv. Torsdag), JI2025 cv. Bohatyr. For the zygosity testing of parental accessions cv. Waverex, cv. Avola (four replicates of each), and their reciprocal F1 hybrids (six from each) DNA was prepared from a single leaf using an adaptation to a rapid mini-preparation method [2, within a 1.5 ml micro-fuge tube was ground to a fine powder using a 1 ml plastic pipette tip ; 400 μl of extraction buffer was added to the powder and grinding continued, followed by addition of 20 μl of 20% w/v SDS and mixed; extraction of DNA was carried out with the addition of 400 μl chloroform:isoamyl alcohol (24:1) and after thorough mixing was centrifuged for 15 min at 16,000 g; the upper aqueous phase was removed to a fresh tube and the DNA was precipitated with 800 μl of cold absolute ethanol and centrifuged again for 10 min at 16,000 g; the pelleted DNA was washed with 1 ml of 70% ethanol and then air dried, resuspended in 50 μl of TE pH 8.0 , stored at 4°C. The F2 population from the cross JI15 × JI399 has been described previously [DNA was prepared from 10–n method modifiedeviously .TaqI , incubated at 65°C for 2–3 h. Ligation of adapters was carried out as follows: to the 40 μl digest a 10 μl ligation mix containing 1 × RL buffer, 1 mM ATP, 12.5 pmol Taq adapter reaction buffer , 50 ng/μl BSA, 5 U 33P-based SSAP PCR conditions [33P labelled specific PPT primer with its fluorescently labelled counterpart as follows: 15 ng of each of the specific 6FAM or HEX labelled PPT primer (HPLC-purified) and the Taq+2 primer , 200 μM each dNTP, 1 U Taq polymerase and 3 μl (ca. 10 ng DNA) of SSAP template . A touchdown PCR cycling regime was used in all experiments: (94°C for 30 s/65°C for 30 s (reducing 0.7°C/cycle thereafter to 56°C)/72°C for 60 s) 12 cycles; (94°C for 30 s/56°C for 30 s/72°C for 60 s) 24 cycles; hold at 12°C (MJR DNA Engine). A dilution series of the fluorescently labelled amplicons was made in sterile distilled water. 1 μl from the original fluorescently labelled PCR amplicons and from each of the subsequent dilutions were each added to 9 μl Hi-Di Formamide containing 0.1 μl of GENESCAN™ 1200 LIZ size standard . This gave a final fluorescent amplicon dilution series of 1/10, 1/20, 1/40, 1/80 from each sample for testing on the ABI 3730 xl genetic analyzer, the aim being to find the optimum fluorescent conditions for marker peak analysis.The nditions , were texl as follows: POP-7™ polymer at 63°C, sample injection voltage was 1.6 kV with 15 s injection time, 8 kV run voltage for 7500 s . GeneMarker Version 1.6 software (SoftGenetics LLC®) was used to examine and compare peak patterns.Fluorescently labelled samples were run on the Applied Biosystems 3730 33P PAGE using the above conditions a range of primer concentrations was tested; this included the use of the specific PPT primer with and without HPLC-purification. In these experiments all of the above conditions, other than for primer content, were maintained.After the failure to match the fluorescent amplicon pattern to that of the 33P PAGE were as follows: 10 μl PCRs containing 0.1 μM PPT specific primer unlabelled, 0.1 μM labelled specific primer (6FAMPPT or HEXPPT), 0.1 μM Taq + 2 primer mapping populations that had been previously run with the 33P manual PAGE system and polymorphic markers mapped. HEXPPT was used to test two primer combinations: Taq+TG, and Taq+AA for amplicon size confirmation. The F1 zygosity experiments with cv. Avola, cv. Waverex and their F1 hybrids made use of the triplex reaction with HEXPPT/PPT/Taq+TG. Amplification of the 92 F2 individuals and parental lines from the cross JI15 × JI399 was carried out with two primer combinations: 6FAMPPT/PPT/Taq+CA and HEXPPT/PPT/Taq+AT.All 16 primer combinations were tested on 12 pea lines, using the triplex reaction xl was analysed using GeneMarker Version 1.6 software (SoftGenetics LLC®). For the 12 pea accessions the bin table output of peak area called by the software was transferred to an MS® Excel spreadsheet. Each peak was then checked, and any missing peaks were manually called. The peak areas were converted to 1 and 0 scores as an indication of peak/marker presence and absence. Peak area tables were used directly in the F1 and F2 zygosity testing experiments, [see Additional file ® Excel.The raw data output from the ABI 3730PDR1 insertion site at a given locus in a given individual we needed to take account of the intrinsic peak area corresponding to a particular amplicon and to the amount of a sample loaded. Peak areas therefore needed to be normalised. If we consider a set of samples in which there are monomorphic bands and polymorphic bands (either present or absent) then for all samples the ratio of the area under any pair of monomorphic bands is expected to be constant, and its variation indicates the reliability of the measure.In order to quantify the dosage of a The ratio of the area under a polymorphic band to the area under a monomorphic band should vary according to the zygosity, and this can be used to determine allele calls. Ambiguity can be reduced by averaging the ratio with respect to several monomorphic bands.1 individuals ratiometric analysis was carried out using two pairs of monomorphic peaks: m1/m2 at 287/289 nt and m3/m4 at 448/470 nt [see Additional file 1 hybrids from their reciprocal crosses (aw F1/1-F1/6 and wa F1/1-F1/6), monomorphic peak areas were first normalised with respect to each other, eg. m1/(m1+m2), m2/(m1+m2), m3/(m3+m4), m4/(m3+m4). Peak area ratios for each of the six F1s were calculated using the normalised mean of four parental (a and w) replicates, eg. aw/a, aw/w, wa/a, wa/w. Similarly each polymorphic peak area for the 12 F1s was first normalised with respect to either m1/m2 and m3/m4, eg, p1/(m1+m2) and p1/(m3+m4) and so forth for p2 and p3 and mean peak area ratios were calculated as for the monomorphic peaks. The means from all these calculations for the F1 can be seen in Table For the F2 individuals markers from five polymorphic fluorescent SSAP markers 261, 274, 307, 396 and 193 nt and their respective peak areas selected from two primer combinations, [see Additional file 1s; peak area ratios were calculated in relation to the value of the specific parental line (JI15 or JI399) that gave rise to the marker.For the F1 analysis and Figures 2 analysis.Plots of the peak area ratios vs raw peak area are shown in Figure The authors declare that they have no competing interests.2 data analysis, and drafted the manuscript; CM undertook the fluorescent SSAP analysis of F1 hybrid screen for heterozygotes, and adapted the rapid DNA leaf preparation method; JL and DB provided the expertise in the use of ABI 3730xl and running of fluorescent SSAP samples at JGL; NE assisted in data analysis. All authors read, edited and approved the manuscript.MK developed the manual to fluorescent method conversion conditions, cross-referenced markers from radio-labelled bands to the fluorescent peaks, collated the marker data, carried out the F1 and F2 individualsZygosity analysis for F. The data provided represents raw fluorescent peak areas, the calculations for their normalisation and analysis of peak area ratios.Click here for file

Alzheimer's disease (AD) and its transitional state mild cognitive impairment (MCI) are characterized by amyloid plaque and tau neurofibrillary tangle (NFT) deposition within the cerebral neocortex and neuronal loss within the hippocampal formation. However, the precise relationship between pathologic changes in neocortical regions and hippocampal atrophy is largely unknown.In this study, combining structural MRI scans and automated image analysis tools with reduced cerebrospinal fluid (CSF) Aß levels, a surrogate for intra-cranial amyloid plaques and elevated CSF phosphorylated tau (p-tau) levels, a surrogate for neocortical NFTs, we examined the relationship between the presence of Alzheimer's pathology, gray matter thickness of select neocortical regions, and hippocampal volume in cognitively normal older participants and individuals with MCI and AD (n = 724). Amongst all 3 groups, only select heteromodal cortical regions significantly correlated with hippocampal volume. Amongst MCI and AD individuals, gray matter thickness of the entorhinal cortex and inferior temporal gyrus significantly predicted longitudinal hippocampal volume loss in both amyloid positive and p-tau positive individuals. Amongst cognitively normal older adults, thinning only within the medial portion of the orbital frontal cortex significantly differentiated amyloid positive from amyloid negative individuals whereas thinning only within the entorhinal cortex significantly discriminated p-tau positive from p-tau negative individuals.Cortical Aβ and tau pathology affects gray matter thinning within select neocortical regions and potentially contributes to downstream hippocampal degeneration. Neocortical Alzheimer's pathology is evident even amongst older asymptomatic individuals suggesting the existence of a preclinical phase of dementia. Selective neurodegeneration of the cerebral cortex is a characteristic pathological feature of Alzheimer's disease (AD). Intracellular tau-associated neurofibrillary tangles (NFTs) and extracellular amyloid-ß (Aß) associated plaques show a characteristic laminar and regional pattern of distribution within gray matter, with greater involvement of the medial temporal lobe and heteromodal association areas than primary sensory or motor cortices in vivo assessment of neuropathologic changes underlying AD. Positron emission tomography (PET) studies examining fibrillar amyloid deposition with Pittsburgh Compound B (PiB) and MRI studies of functional and structural connectivity have observed a significant overlap in a number of neocortical regions that appear preferentially affected in the earliest stages of AD in vivo the effect of tau burden on atrophy in heteromodal and limbic cortices.Recent advances in neuroimaging and image analysis algorithms allow for the Cortical atrophy resulting from cellular shrinkage, dendritic spine loss, and axonal disruption is reflected as a loss of gray matter that diminishes cortical thickness www.loni.ucla.edu/ADNI). The ADNI is a large multi-site collaborative effort launched in 2003 by the National Institute on Aging, the National Institute of Biomedical Imaging and Bioengineering, the Food and Drug Administration, private pharmaceutical companies and non-profit organizations as a public–private partnership aimed at testing whether serial MRI, PET, other biological markers and clinical and neuropsychological assessment can be combined to measure the progression of MCI and early AD. The Principal Investigator of this initiative is Michael Weiner, MD, and ADNI is the result of many co-investigators from a broad range of academic institutions and private corporations, with subjects recruited from over 50 sites across the US and Canada. For more information, please see http://www.adni-info.org.All 724 participants were selected from the Alzheimer's disease Neuroimaging Initiative (ADNI) database (http://www.adni-info.org/index.php?option=com_content&task=view&id=9&Itemid=43). The institutional review boards of all participating institutions approved the procedures for this study. Written informed consent was obtained from all participants or surrogates. Briefly, experienced clinicians conducted independent semi-structured interviews with the participant and a knowledgeable collateral source that included a health history, neurological examination, the Mini-Mental State Examination Each participant from the ADNI cohort was formally evaluated using eligibility criteria that are described in detail elsewhere (As illustrated in CN (n = 208) - Individuals who were cognitively normal at baseline and clinical follow-up (CDR 0).MCI (n = 353) – Individuals with mild cognitive impairment (MCI) defined using the revised MCI criteria AD (n = 163) – Individuals who met criteria for probable AD http://www.loni.ucla.edu/ADNI/Data/index.shtml). Parameter values vary depending on scanning site and can be found at http://www.loni.ucla.edu/ADNI/Research/Cores/.All ADNI MRI scans were acquired at multiple sites using either a GE, Siemens, or Philips 1.5T system. Multiple high-resolution T1- weighted volumetric MP-RAGE scans were collected for each subject and the raw DICOM images were downloaded from the public ADNI site , freely available at The neocortex of the brain on the MRI scans was then automatically subdivided into gyral-based regions of interest (ROIs). To accomplish this, a registration procedure was used that aligns the cortical folding patterns For longitudinal analysis, the baseline and one-year follow-up structural MRI scans were rigid body registered and an unbiased template volume was created From the current ADNI sample, a number of individuals (n = 338) underwent lumbar puncture for CSF biomarker evaluation. Methods for CSF acquisition and biomarker measurement have been reported previously for this sample Spearman's rank correlation coefficients were first used to examine relationships between the mean thickness of the individual ROIs and total hippocampal volume. Separate linear regression models were constructed for the amyloid positive, amyloid negative, p-tau positive and p-tau negative MCI and AD individuals, with the baseline thickness of the individual ROIs as predictors for hippocampal atrophy rate. Logistic regression models and multivariate analysis of variance (MANOVA) were used to compare whether baseline thickness of the individual ROIs significantly differentiated amyloid positive from amyloid negative as well as p-tau positive from p-tau negative CN individuals. In all of the analyses performed, age, gender, education, and APOE-ε4 carrier status were additionally included.Overall, the hippocampus demonstrated the largest magnitude of correlation with the entorhinal cortex , temporal pole , inferior temporal gyrus and the medial portion of the orbital frontal cortex . The infLinear regression models amongst the MCI and AD individuals demonstrated that decreased Aβ levels  = −0.01 to −0.003, p<0.01) and increased p-tau levels significantly predicted hippocampal atrophy rate. Within the amyloid positive MCI and AD individuals, baseline thickness of the entorhinal cortex and inferior temporal gyrus significantly predicted the atrophy rate of the hippocampus. Similarly, within the p-tau positive individuals, baseline thickness of the entorhinal cortex and inferior temporal gyrus significantly predicted the atrophy rate of the hippocampus . Within Logistic regression models amongst the CN cohort demonstrated that APOE-ε4 carrier status (Odds Ratio (OR) = 0.08, 95% CI = 0.02 to 0.27, p<0.0001) and thinning in the medial portion of the orbital frontal cortex significantly differentiated the amyloid positive from amyloid negative older individuals whereas thinning of the entorhinal cortex significantly differentiated the p-tau positive from p-tau negative older individuals . None ofOur results demonstrate that 1) amongst cognitively normal older participants and individuals with MCI and AD, select heteromodal association cortices correlate with hippocampal volume, 2) amongst MCI and AD individuals, gray matter thinning within the same two neocortical regions predicts longitudinal hippocampal volume loss in both amyloid positive and p-tau positive individuals and 3) amongst cognitively normal older adults, thinning within the medial portion of the orbital frontal cortex significantly differentiates amyloid positive from amyloid negative individuals whereas entorhinal cortex thinning significantly discriminates p-tau positive from p-tau negative individuals. Taken collectively, this indicates that cortical Aβ and tau pathology is evident even among asymptomatic older individuals, affects gray matter thinning within select neocortical regions and potentially contributes to downstream hippocampal degeneration. These findings are in agreement with prior work indicating the value of CSF Aβ as an early biomarker The four cerebral cortical regions that best correlated with hippocampal volume follow an interesting neurodevelopmental pattern. On architectonic grounds, the regions identified on the lateral hemisphere trace evolutionary lineage from the so-called ‘paleocortical’ trend whereas regions identified on the medial hemisphere are derived from the ‘archicortical’ trend Correlations between thickness of the individual regions and hippocampal volume may reflect underlying patterns of neuropathology. Thickness of the medial portion of the orbital frontal cortex, inferior temporal gyrus, entorhinal cortex, and the temporal pole demonstrated the strongest magnitude of association with the hippocampus amongst each of the three participant groups. In contrast, parietal, occipital, and lateral frontal cortices, correlated with the hippocampus only amongst cognitively normal older adults and MCI individuals. With AD onset, these regions failed to associate with the hippocampus. Of interest, these regions showed the largest magnitude of association with each other amongst each of the three participant groups , 4 and 5One explanation for these findings may involve the evolution of the neuropathologic cascade in AD. Amyloid deposits are first noted in the medial portions of the orbital frontal, basal temporal and entorhinal cortices and tau-associated NFTs initially affect the medial temporal and temporopolar cortices Another possibility is that associations between regions reflect underlying anatomic connections and the decreased correlation coefficients noted with AD onset represent a selective disruption in cortico-hippocampal connectivity. Though several studies have noted disruptions in anatomic connectivity with AD Significant reductions in CSF Aβ levels and elevations in CSF p-tau levels coupled with thinning within select heteromodal regions predicts longitudinal hippocampal atrophy. Prior PiB studies have demonstrated a significant relationship between neocortical amyloid deposition and hippocampal atrophy in vivo evidence that amongst cognitively normal individuals tau pathology selectively affects the thickness of the entorhinal cortex. It is important to note that almost half (47%) of the p-tau positive individuals were additionally amyloid positive and future work will involve looking at the interaction between Aβ and tau pathology.Amongst cognitively normal older adults, cortical thinning of the medial orbital frontal cortex significantly differentiated amyloid positive from amyloid negative individuals whereas thinning of the entorhinal cortex significantly discriminated p-tau positive from p-tau negative individuals. Consistent with neuropathology studies, which demonstrate early amyloid deposition within the medial orbital frontal cortex and early NFT accumulation within the entorhinal cortex The finding that amyloid positive individuals show selective thinning within the medial orbital frontal cortex is in agreement with one prior study demonstrating that older individuals with subjective memory complaints show significant correlations between gray matter atrophy and neocortical PiB increase within the medial orbital frontal/anterior cingulate cortex These findings have important clinical implications. Subtle gray matter disturbances in specific regions of the cerebral neocortex are present amongst a subset of asymptomatic older individuals and can be quantified using sensitive structural neuroimaging techniques. In combination with CSF Aβ and tau, structural MRI measures can provide an indication of disease stage and have value in identifying those who will likely benefit from early therapeutic interventions. Our results also indicate the importance of administering anti-amyloid therapy early in the disease process (at a pre-MCI stage) in order to alter or delay hippocampal degeneration and thus progressive memory loss, the harbinger of clinical Alzheimer's dementia.Why does neurodegeneration affect select cerebral cortical regions? From a phylogenetic perspective, heteromodal and archicortical medial temporal regions constitute the oldest areas of the brain a priori anatomically defined regions with disease-based statistical methods to examine neocortical and subcortical areas in AD. Another limitation involves the use of CSF Aβ and p-tau to assess the presence of amyloid and neurofibrillary pathology in the neocortex. Though amyloid load as measured using PiB and CSF Aβ are highly correlated and likely reflect plaque deposition This study has several limitations. One issue involves the use of gyral-based neuroanatomic ROIs to examine specific neocortical regions. It is likely the case that Alzheimer's pathology does not follow the specific boundaries of these ROIs and affects areas within and across multiple ROIs. The use of regions of interest generated from a disease specific effect

Here we will share our experience of the SCID mouse model of psoriasis in respect to its use in investigating psoriatic diseases and development of immune-based drugs for psoriasis, psoriatic arthritis, and other autoimmune diseases.In both skin and synovial tissues of psoriatic arthritis (PsA) patients, there are prominent lymphocytic infiltrates localized to the dermal papillae in the skin and the sublining layer stroma in the joint. T-cells, with a predominance of CD4+ lymphocytes, are the most significant lymphocytes in the tissues; in contrast, this ratio is reversed in the epidermis, synovial fluid compartment, and at the enthesis, where CD8+ T-cells are more common. This differential tropism of CD8+ T-cell suggests that the CD8+ T-cells may be driving the immune response in the joint and skin. This is supported by an association with MHC class I. The cytokine network in the psoriatic skin and synovium is dominated by monocyte and T-cell-derived cytokines: IL-1β, IL-2, IL-10, IFN-γ, and TNF-α. In PsA synovium, higher levels of IFN-γ, IL-2, and IL-10 have been detected than in psoriatic skin. An analysis of T-cell receptor beta-chain variable (TCRβV) gene repertoires revealed common expansions in both skin and synovial inflammatory sites, suggesting an important role for cognate T-cell responses in the pathogenesis of PsA and that the inciting antigen may be identical or homologous between the afflicted skin and synovium. Traditionally, T-cells have been classified as T helper 1 (Th1) or Th2 cells by production of defining cytokines, IFN-γ and IL-4, respectively. Recently, a new type of T-cell, Th17, has been linked to autoimmune inflammation. T-helper 17 (Th17) cells are a unique effector CD4+ T-cell subset characterized by the production of interleukin (IL)-17. Murine diseases that were previously considered to be pure Th1-mediated responses have been shown to contain mixed populations of Th1 and Th17 cells. Also, in humans, a critical immunoregulatory role of Th-17 cells in infectious and autoimmune diseases has been identified. It has been postulated that IL-17 may be important in psoriasis. Our initial observations demonstrate that IL-17 and its receptor system are important for PsA also. In Psoriasis is a multifactorial chronic inflammatory disease. The exac12Despite intense research work on psoriasis, the etiology is unknown and its treatment remains palliative. The lack of an animal model has been a major hurdle for the investigation of the cause and cure of psoriasis. Since there are no naturally occurring diseases in animals that exhibit all the phenotypic and immunological features of psoriasis, several approaches have been utilized, which include studies on mutant strains of mice, development of transgenic mice, and xenotransplantation models.–6Animal models based on transgenic technology have been used extensively to study the pathogenesis of various diseases, including psoriasis. As these models are created by manipulating a single gene, usually they do not represent the phenotype of these complex inflammatory diseases. Psoriasis especially, being a polygenic disease, cannot be truly reproduced in a model system by the manipulation of a single gene. In that respect xenogenic transplantation models allow investigation of a disease process in a microenvironment resembling its natural milieu. Genetically, immunodeficient mice have been used in a xenograft model as they fail to reject skin grafts. Among the xenogenic transplantation models, nude mice and SCID mice have been used to elucidate the pathogenesis of psoriasis.–6 The thscid/J SCID mice. Histological features in transplanted skin have been reported to be maintained for several months. In transplanted grafts of psoriatic tissue, we have noted that the clinical, histological, and immunological features of psoriasis could be maintained for a duration of 16-20 weeks. To establish this model, we collect 0.5 mm thick keratome shave biopsy samples (2.5 × 2.5 cm) from patients with chronic plaque psoriasis. 3-4 grafts approximately of 1 × 1 cm are grafted onto BALB/cByJSmn-PrkdcThe inflammatory reaction in psoriasis is uniquely characterized by increased expression of adhesion molecules on the endothelial cells –11 proli1217Following molecules are identified to be maintained for the lifetime in the transplanted plaques on SCID mice: p38 MAPK, STAT3, ICAM, CXCR3, Fractalkine, IL-8, CD3, CD4, CD8, HLA-DR, CD40, OX-40R, CD80, CD86, K16, Ki67, substance P, NGF, NGF-R. Several co-stimulatory molecules have a critical role for T-cell activation. Among these a principal signal is delivered by the engagement of CD28 on T-cells with CD80 (B7-1) and CD86 (B7-2) on APCs. TCR-mediated signal cascades are intact in the transplanted grafts; in a recent study, we identified ZAP70 in its phosphorylated state. Langerhans cells, dermal dendrocytes, and the activated T-cells express CD80 and CD86 the ligands of the co-stimulatory molecules.n = 12) were treated with CTLA4IgG (10 mg/kg/week), a natural inhibitor of CD28/B7 co-stimulatory signals. Cyclosporine (4mg/kg) treatment was used as a positive control group (n = 6) and untreated plaques (n = 12) were negative controls. CTLA4IgG-treated plaques significantly improved following 4 weeks of therapy. The length of the rete pegs changed from 308.57±98.72 mm to 164.64±46.78 mm . A similar improvement of psoriasis was observed in the cyclosporine group, whereas the untreated plaques did not show any improvement. Significant reduction of lymphomononuclear cells, HLA-DR, and ZAP70 expression was observed in the plaques treated with CTLA4IgG and cyclosporine. In addition to systemic therapy, this model can be used to develop novel topical pharmacologic agents. Various established topical preparations for psoriasis such as steroid and retinoid creams are highly therapeutically effective in this model. Manipulation of the CD28-B7 co-stimulatory system by an antisense CD28 nucleotide cream induced significant histological improvement with marked reduction of the activated T-cells. This model is of immense help to develop immune-based therapy for T-cell-mediated autoimmune diseases by targeting regulatory molecules of the co-stimulatory system and specific phosphokinases associated with T-cell activation.Upregulation of CD80/CD86 in psoriatic lesions suggests a critical role for the CD28/B7 co-stimulatory system in the pathogenesis of psoriasis. Thus, inhibition of the CD28 and CD80/CD86 interaction is expected to restrict the inflammatory processes of psoriasis. Antagonism of co-stimulatory molecules has provided a new dimension for treatment of the autoimmune diseases. To have in vivo/in vitro studies.[h17 cells in psoriatic arthritis and determined their phenotypes and functional significance [P<.001). Th-17 cells were significantly higher in psoriatic synovial tissue and psoriatic plaques compared to the controls [h17 cells in maintenance of psoriatic lesion we studied the Th17 cells in the SCID mouse-psoriasis skin xenografts. IL-17+T-cells could be identified in the transplanted psoriasis lesions on SCID mice. In IL-17 is produced by a unique subset of helper T-cells, Th-17 cell. The bind293133 studies. We have ificance . Comparecontrols . In the

Adherence to antipsychotics for schizophrenia is associated with favorable clinical outcomes. This study compared annual mental-health service utilization by recent medication adherence levels for patients treated for schizophrenia, and assessed whether adherence levels change from pre- to post-psychiatric hospitalization.We analyzed data from a large prospective, non-interventional study of patients treated for schizophrenia in the United States, conducted between 7/1997 and 9/2003. Detailed mental-health resource utilization was systematically abstracted from medical records and augmented with patients' self report. Medication possession ratio (MPR) with any antipsychotic in the 6 months prior to enrollment was used to categorize patients as: adherent , partially adherent , or non-adherent . Group comparisons employed propensity score-adjusted bootstrap re-sampling methods with 1000 iterations, adjusting for baseline patient demographic and clinical characteristics identified a priori.Adherent patients had a lower rate of psychiatric hospitalization compared with partially adherent and non-adherent patients (p < 0.001) and were more likely than non-adherent to engage in group therapy, individual therapy, and medication management. Most patients (92.0%) who were adherent in the 6 months prior to hospital admission continued to be adherent 6 months following hospitalization. However, 75.0% of previously partially adherent became adherent, and 38.7% of previously non-adherent became adherent following hospitalization.Adherence is associated with lower utilization of acute care services and greater engagement in outpatient mental-health treatment. Adherence is a potentially dynamic phenomenon, which may improve, at least temporarily, following patients' psychiatric hospitalizations. Schizophrenia is often a persistent, debilitating, and costly disorder requiring diverse healthcare resources to manage the illness. Although adherence with antipsychotic medications is critical for reducing the risk of relapse and enhancing long-term functional outcomes , non-adhNon-adherence is associated with increased risk of relapse and hospitalization -7, the mRecent research also suggests that adherence is not an "all or none" phenomenon as many patients appear to be partially adherent with treatment, failing to take their medications as prescribed and having gaps in medication intake ,9,10. ThTo expand on previous research and provide new information about the relationship between adherence and resource utilization, a type of information that is especially relevant for policy makers and other mental-health decision makers, this study used data from a large, prospective, naturalistic, non-interventional multi-site study of patients treated in the United States for schizophrenia ,11,12 toDiagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV) criteria as noted in patients' medical records (no structured diagnostic interviews were conducted at study entry), and ≥ 18 years old. The study protocol was reviewed and approved by the Institutional Review Board (IRB) at each site, and written informed consent was obtained from all participants. Further details about US-SCAP can be found elsewhere [Participants in US-SCAP (N = 2327), which was conducted between July 1997 and September 2003, were enrolled from large systems of care across the United States. Inclusion criteria were broad: schizophrenia, schizoaffective disorder, and/or schizophreniform disorder based on the lsewhere ,11,12. Plsewhere , the Glolsewhere , Simpsonlsewhere , Abnormalsewhere , the Qualsewhere , and theMental-health resource utilization during the 1 year following study enrollment was systematically abstracted from medical records by trained examiners, using an abstraction form developed for this study. Patient-reported use of emergency psychiatric services on the SCAP-HQ was also used to help identify use of emergency services if this medical record information was missing. Antipsychotic medication use and adherence levels were derived from prescription information in patients' medical records. Medication possession ratios (MPRs) for the 6 months prior to enrollment were computed. MPR was defined as the sum of days with medication, divided by the number of days in the observation period, 6 months prior to enrollment. Consistent with prior research ,19, the 2 tests, ANOVA, and Kruskal-Wallis tests were used to test for overall differences across adherence levels in patient characteristics at enrollment, the mean number of service contacts, and the proportion of patients with any of the following resource-utilization types: inpatient psychiatric hospitalization, emergency service, psychiatrist contact ("medication management"), partial hospitalization, psychosocial group therapy, individual therapy, and case management/Assertive Community Treatment (ACT).The current analysis used data of US-SCAP participants who had resource utilization information for the 1 year following enrollment and antipsychotic medication information for the 6 months prior to enrollment. For statistical analyses, χGroup comparisons were performed using propensity score-adjusted bootstrap re-sampling methods with 1000 iterations, adjusting for baseline patient demographic and clinical characteristics identified a priori. Propensity score stratification was used to adjust for potential confounding factors not attributable to adherence status. Bootstrap resampling was used to allow for a non-parametric assessment of mean outcomes in resource utilization. The propensity score for each patient was estimated with a logistic regression model with the following apriori selected covariates: age, gender, race, illness duration, study site, comorbid substance use disorder, schizoaffective disorder, comorbid personality disorder, comorbid borderline intelligence or mental retardation, uninsured, inpatient status at enrollment, and time elapsed between start of US-SCAP enrollment and the start date of each patient's study year. The estimated propensity scores were grouped into 5 strata based on quintiles, and bootstrap resampling was performed in a balanced fashion within each group across the propensity score strata. For example, each bootstrap replication for the non-adherent group would include approximately 43 re-sampled observations from each of the 5 strata. Pair-wise group comparisons on resource utilization were reported if the overall differences across the 3 groups were significant (p < 0.05).Of 2327 US-SCAP participants, 2010 (86.4%) had healthcare resource utilization for 1 year after study enrollment and comprised the analytic sample.Patient characteristics at enrollment are presented in Table During the 6 months prior to enrollment, most patients were deemed adherent (87.5%). The rest were non-adherent 10.7%) or partially adherent (1.8%). Patients who were adherent prior to enrollment were significantly older than partially or non-adherent. African-American patients and uninsured patients were more likely to be partially adherent than adherent or non-adherent. There was a > 3-fold higher rate of hospitalization at enrollment among non-adherent compared with partially adherent or adherent. There were also higher rates of comorbid substance abuse disorder among patients with lower adherence levels compared with partially adherent 30.6%) and non-adherent patients 29.6%) (p < 0.05) than non-adherent patients Table . The freAmong 315 patients who were hospitalized, 276 patients were adherent 6 months prior to hospitalization, 8 were partially adherent, and 31 were non-adherent. Most patients who were adherent 6 months before hospitalization were also adherent 6 months afterward (92.0%) Table . Most paIn this large, prospective, naturalistic, non-interventional study of patients treated for schizophrenia across the United States, patients who were deemed adherent immediately before enrollment had enhanced treatment outcomes in the subsequent year. Adherent patients evidenced a significantly lower risk of psychiatric hospitalization and better engagement in outpatient mental health care. Further, patient adherence proved to be a dynamic, rather than a static, phenomenon that appeared to be influenced by the experience of psychiatric hospitalization. Although most patients who were adherent before hospitalization continued to be adherent afterward, a large proportion of patients who were previously partially adherent or non-adherent became adherent in the 6 months after hospital discharge.Current findings show that recently adherent patients had about half as many psychiatric hospitalizations and 2 to 4 times fewer total days hospitalized compared with partially and non-adherent patients. These findings are consistent with previous research -7. FurthMost patients in this study (87.5%) were deemed adherent and the rate of partial or non-adherence (12.5%) was lower than the 40% to 50% non-adherence rates reported in some previous studies but was broadly consistent with data reported in some other studies ,20 in whIn the present study, treatment adherence was also found to change from the 6 months pre-hospitalization to the 6 months post hospitalization, suggesting that adherence is a dynamic phenomenon. The reasons for the observed changes are unclear, but may be driven by increased attention to patient's medication management by members of the treatment team , thus increasing intensity of medication management efforts post discharge, and leading, indirectly, to increased patients' MPR. The increased adherence post hospital discharge may also reflect involuntary commitment (compulsory treatment orders) to outpatient treatment for some patients. However, this information was not captured in our study. Another potential, but less likely, explanation is that hospitalization reflects a "teachable moment" for the patient, thereby leading to increased adherence with medication post hospital discharge.Current findings need to be evaluated in the context of the study limitation. First is the naturalistic nature of the study. Although generally considered a strength, the observational nature introduces selection biases. We utilized propensity scoring to statistically adjust for selection bias; however, such methods adjust only for known and measured confounds and cannot address the prospect that the results may be partly attributed to or altered by unknown or unmeasured group differences. Second, current findings may not be generalizable to patients with private insurance because public payers covered healthcare services for almost all US-SCAP participants . Third, In the usual treatment of schizophrenia patients, medication adherence is associated with a lower risk of psychiatric hospitalization and with greater engagement in outpatient mental-health treatment. Adherence also appears to be a dynamic phenomenon, which may improve, at least temporarily, following patients' psychiatric hospitalizations. Current findings underscore the clinical and economic value of medication adherence, the need to separately assess acute-care and non-acute care resource utilization, and the realization that partially adherent patients, not only the non-adherent patients, should be targeted for adherence-promoting interventions.H. Ascher-Svanum, B. Zhu, D.E. Faries, and W. Montgomery are employees of and minor shareholders (stocks/options) in Eli Lilly and Company. N. Furiak is an employee of Medical Decision Modeling Inc., a company that has research and development contracts with Eli Lilly and Company.All authors contributed to study conduct and design. DF oversaw study design. HA-S, BZ, DF, and WM acquired data. All authors interpreted data. HA-S prepared and revised the manuscript with editorial assistance from Robin LeWinter, PhD, and Stephen W. Gutkin, Rete Biomedical Communications Corp. with revisions by all authors. All authors read and approved the final manuscript.

One-sentence summary for table of contents: Outbreaks are decreasing and the O3:K6 pandemic strain is being replaced by a new serotype and new strains. Vibrio parahaemolyticus in Puerto Montt, Chile, began in 2004 and reached a peak in 2005 at 3,600 clinical cases. Until 2006, every analyzed case was caused by the serovar O3:K6 pandemic strain. In the summer of 2007, only 475 cases were reported; 73% corresponded to the pandemic strain. This decrease was associated with a change in serotype of many pandemic isolates to O3:K59 and the emergence of new clinical strains. One of these strains, associated with 11% of the cases, was genotypically different from the pandemic strain but contained genes that were identical to those found on its pathogenicity island. These findings suggest that pathogenicity-related genes were laterally transferred from the pandemic strain to one of the different V. parahaemolyticus groups comprising the diverse and shifting bacterial population in shellfish in this region.Disease outbreaks caused by Vibrio parahaemolyticus caused by consumption of contaminated seafood were reported .In 1998 in Antofagasta, Chile , ≈300 human cases of infection with eported –. HoweverV. parahaemolyticus pandemic strain because it had reached coastal environments worldwide and caused outbreaks. It belongs to the O3:K6 serovar, although at least 21 serovariants have emerged since 1996 (toxRS/new (orf8) probably obtained by recent lateral transfer (V. cholerae strains (Genome sequencing of the RIMD2210633 pandemic strain showed that it has 2 sets of gene clusters that encode the type III secretion system (TTSS) apparatus and RIMD 2210086 (VpI) were obtained from the Research Institute for Microbial Diseases, Osaka University, Osaka, Japan. The Chilean environmental strains, identified as PMA with a number according to origin and year of isolation, were obtained from shellfish samples obtained during outbreaks from 2004 though 2007. Most strains have been described . Sequences of these primers were VPA1321f: 5′-TGACATGCACGGCAATAGAT-3′, VPA1321r: 5-ACAGAGTTGGTTTCGCAGGT-3′, VPA1376 f: 5′-CATCGAGCGATCTTTCACAA-3′, and VPA1376r: 5′-ACCGGTTTCCAACCTTCTCT-3′. Housekeeping genes for MLST were amplified by using primers for V. parahaemolyticus and sequenced in both directions by Macrogen or by McLAB by using forward and reverse amplification primers or primers M13F and M13R (MLST loci). DNA sequences were analyzed individually and manually assembled. Alignments and sequence similarities were obtained by using BioEdit software (rrs) between nucleotides 357 and 518 (Escherichia coli numbering) were performed as described and distinctiveness of their DGREA patterns was lower than the 100% observed in previous summers . A second group contained 4 isolates positive for tdh and trh genes. The other 2 groups contained 1 isolate each, and both were negative for these 2 markers . Only 4 of the 20 shellfish samples examined produced tdh-positive enrichment cultures, which is indicative of pathogenic strains. However, no tdh-positive isolates were obtained from these enrichments after plating on thiosulfate citrate bile salts sucrose agar.There are a large number of t period . This fiV. parahaemolyticus DGREA groups found in Puerto Montt was explored. We analyzed by PCR amplification 20 strains corresponding to 18 environmental DGREA groups and 1 strain from each of 3 new clinical groups found in Puerto Montt in 2007 for the VPA1335 gene (found in T3SS2). Among these strains, only PMA339, isolated from shellfish in the summer of 2004, was positive. PCR amplification of PMA339 for the other genes in the pathogenicity island showed positive reactions for all the genes tested in PMC38.7. Nevertheless, sequences of amplicons showed strong differences from those found in PMC38.7 and those reported for the pandemic strain genome. Similarity ranged from 99.4% for VPA1362 to 93.8% for VPA1346; the average for all genes tested was 97.7%. These differences indicate a much larger evolutionary distance between the T3SS2 genes in PMA339 and the pandemic strain than between PMC38.7 and the pandemic strain.Because the presence of TTSS2 genes is not exclusive to the pandemic strain . However, PMA339 has not been observed among clinical isolates. TTSS2 genes have been found in other V. parahaemolyticus clinical strains . However, in view of a recent report . Group 60.7 contains V. parahaemolyticus in shellfish seem to have been less in 2007 than in previous years. In 2006, 10 of 20 shellfish samples were positive for tdh after enrichment; in 2007, only 4 of 20 samples were positive. PCR amplification of colonies obtained after plating the enrichment culture on thiosulfate citrate bile salts sucrose agar enabled identification of tdh-positive colonies in 6 samples in 2006; none could be identified by the same method in 2007. The observed decrease in outbreaks was probably caused by a decrease in raw seafood consumption as a result of a public health campaign and a decrease in the load of the highly virulent pandemic strain in shellfish. However, this tendency could change on the basis of dispersion and virulence of emerging pathogenic strains.The abundance and frequency of pandemic and nonpandemic

Macroautophagy, a constitutive process in higher eukaryotic cells, mediates degradation of many long-lived proteins and organelles. The actual events occurring during the process in the dynamic system of a living cell have never been thoroughly investigated. We aimed to develop a live-cell assay in which to follow the complete itinerary of an autophagosome. Our experiments show that autophagosomes are formed randomly in peripheral regions of the cell. They then move bidirectionally along microtubules, accumulating at the microtubule-organizing centre, in a similar way to lysosomes. Their centripetal movement is dependent on the motor protein dynein and is important for their fusion with lysosomes. Initially, autophagosomes dock on to lysosomes, independent of lysosomal acidification. Two kinds of fusion then occur: complete fusions, creating a hybrid organelle, or more often kiss-and-run fusions, i.e. transfer of some content while still maintaining two separate vesicles. Surprisingly, the autophagolysosomal compartment seems to be more long lived than expected. Our study documents many aspects of autophagosome behaviour, adding to our understanding of the mechanism and control of autophagy. Indeed, although the formation of autophagosomes is completely different from any other vesicular structures, their later itinerary appears to be very similar to those of other trafficking pathways. Mycobacterium tuberculosis) and is involved in antigen presentation and various cancers Macroautophagy (which we will refer to as autophagy) involves the formation of double-membrane vesicles around a portion of cytosol to form autophagosomes. These eventually fuse with lysosomes, where their contents are degraded. This process is conserved from yeast to man and plays key roles in the degradation of many long-lived cytosolic proteins and organelles. In this way, autophagy can buffer against starvation. However, autophagy also clears aggregate-prone intracellular cytosolic proteins that cause neurodegenerative diseases (e.g. Huntington's disease) and a range of pathogens next to the vacuole, while in mammalian cells, multiple sites of origin can be observed at the same time Despite the current knowledge about the autophagy machinery, there are many aspects that are unclear. Much of our understanding of the itinerary of autophagosomes is derived from light and electron microscopy of fixed cells. This has led to concepts of initial autophagic vacuoles or autophagosomes, degradative autophagic vacuoles or autolysosomes The machinery involved in autophagosome–lysosome fusion is well understood in yeast. Although some parts of the molecular machinery have been elucidated in mammalian cells In this study, we have used a combination of live-cell imaging and fixed cell studies to allow us to investigate many aspects of the itinerary of an autophagosome. We demonstrate that autophagosomes form randomly throughout the cytoplasm. Once formed, autophagosomes need to reach lysosomes, enriched perinuclearly around the microtubule-organizing centre (MTOC) Our live-cell imaging studies show that autophagosome–lysosome fusion is similar to endosome–lysosome fusion, where kiss-and-run, complete fusions or fusion mediated through tubules can all be observed In order to follow the whole itinerary of an autophagosome, the autophagosome-specific marker microtubule-associated protein 1 LC3 tagged to enhanced green fluorescent protein (EGFP) was expressed in living normal rat kidney (NRK) cells. Normal rat kidney cells were chosen for the majority of the experiments because they show a sufficient number of autophagosomes per cell in the basal unstarved state to allow efficient real-time data capture and at the same time are quite flat (thickness of approximately 2 μm), making it easier to follow dynamic processes within a single focal plane with a confocal microscope. Before embarking on studies using transfected fluorescently tagged LC3 constructs to mark autophagosomes for microscopical analyses, we confirmed that both GFP–LC3 and mCherry–LC3 were specifically labelling autophagosomes by demonstrating that the great majority of cells lose these vesicular structures when treated with 3-methyladenine, an inhibitor of autophagosome formation (data not shown). Furthermore, all fluorescently labelled LC3 structures were <1 μm in diameter, and no large aggregates were observed.First, we compared the locations of newly appearing autophagosomes, which were induced by serum starvation, with those of autophagosomes already present at the beginning of the observation. Serum starvation rapidly increased the number of autophagosomes (data not shown), as has previously been reported We then investigated the end-point of the itinerary of an autophagosome, i.e. the fusion with a lysosome. It has previously been reported that GFP–LC3 fluorescence is lost rapidly upon autophagosome–lysosome fusion In order to test how meaningful this colocalization was in relation to autophagic activity, cells were treated with known enhancers and inhibitors of autophagy. Similar to serum starvation, treatment with the enhancer rapamycin increased the number of LC3-positive vesicles (data not shown) and increased endogenous LC3-II levels in NRK cTo test the effects of bafilomycin further, cells were additionally labelled with an antibody against the cation-independent mannose-6-phosphate receptor (CIMPR). This transmembrane protein is normally localized to the Golgi network and late endosomes, but is excluded from lysosomes, and has been previously been shown to localize to a subset of autophagosomes We investigated whether autophagolysosomes were generated by formation of a hybrid organelle by complete fusion of an autophagosome and a lysosome. When we analyzed GFP–LC3-transfected cells by live-cell imaging, homotypic fusion between two LC3-positive vesicles could sometimes be observed. Fusion was either complete , i.e. fun = 26 cells, n = 9 cells).When both mCherry–LC3 and lgp120–GFP were transfected into cells, fusion events (as assayed by membrane content exchange) could be observed in about 23% of untreated cells (n = 56 cells), the autophagosomes and late endosomes/lysosomes fused completely, resulting in a completely double-labelled hybrid vesicle (n = 56 cells), the fusion seemed to be of the ‘kiss-and-run’ type. The sequence of events was the following: first, an lgp120–GFP-positive lysosome with no (or only a low amount of) mCherry–LC3 started interacting with an autophagosome. This led to an increase in the intensity of mCherry fluorescence in the lysosome. When they eventually separated, the lysosome retained the transferred mCherry–LC3 (n = 56 cells), the same kind of fusion could also be observed in the opposite direction Treatment of the cells with vacuolar H+-adenosine triphosphatase (ATPase) inhibitor bafilomycin for 24 h clearly inhibited fusion between autophagosomes and lysosomes and 5A, However, close interactions of autophagosomes with lysosomes without any obvious membrane content exchange still occurred , suggestAutophagosomes are formed randomly throughout the cytoplasm and fuse0: no bias): p = 0.02; This suggested that autophagosomes are delivered to the vicinity of the lysosomes near the MTOC in a dynein/microtubule-dependent fashion through productive movements biased in direction towards the nucleus. In order to test this, we first assessed the movement of autophagosomes in live NRK cells expressing GFP–LC3, thus labelling both autophagosomes and autophagolysosomes. When the vesicles were tracked and a velocity histogram was plotted, the resulting distribution was clearly positively skewed . For a lWe tested if autophagosome movements towards the MTOC were mediated by dynein by treating cells with the adenine analogue erythro-9-[3-(2-hydroxynonyl)]adenine (EHNA), a dynein ATPase activity inhibitor To further test the involvement of dynein in autophagosome movement, dynein heavy chain was knocked down by RNA interference . BecauseConsistent with the above data, dynein knockdown led to a redistribution of LC3-positive vesicles towards the cell periphery and membrane extensions, compared with control cells, where they were mainly localized around the nucleus . ConcomiAs we have shown in this study and a previous study Moreover, autophagy induction had no effect on the velocities of movements of autophagosomes or autophagolysosomes .Thus, the increase in autophagic clearance upon autophagy induction seems to be largely because of the increase in autophagosome formation, leading to increase cargo uptake and delivery.In conclusion, our data suggest that autophagosomes are formed randomly in more peripheral regions of the cell, in most cases far away from the nucleus. Therefore, we can exclude formation at the MTOC or any perinuclearly localized organelles, such as the Golgi.in vitro by electrostatic interactions Autophagosomes then move bidirectionally along microtubules towards and away from the MTOC, where they accumulate in a similar way to lysosomes because of a bias towards centripetal movements. These centripetal movements are dependent on the motor protein dynein and are rate limiting for their eventual fusion with perinuclearly located lysosomes. These data can explain why there is defective autophagosome–lysosome fusion associated with decreased dynein activity Initially, autophagosomes dock on to lysosomes, a process that is independent of lysosomal acidification. From our colocalization experiments, we can conclude that a high fraction of LC3-positive vesicles are autophagolysosomes, which had previously been suggested As previously reported We observed two types of autophagosome–lysosome fusions: complete fusions, where a hybrid organelle is formed, or, more often, kiss-and-run fusions, i.e. transfer of some content while still maintaining two separate vesicles. It is possible that autophagosomal content may be delivered to lysosomes by multiple events or that the delivery of lysosomal hydrolases to autophagosomes may create what appear to be degradative autophagosomes. Irrespective of these possibilities, the presence of both complete fusion and kiss-and-run events suggests different routes for autophagosome trafficking. It is interesting to speculate that these different routes may influence the efficiency of disposal of autophagic contents.We are grateful to T. Yoshimori for GFP–LC3, M. Mizuguchi for human LC3B, P. Luzio for GFP–lgp120 and R. Tsien for mCherry.The following antibodies were used: polyclonal anti-CIMPR , polyclonal anti-dynein heavy chain , monoclonal anti-huntingtin , polyclonal anti-LC3 , mouse anti-rat lgp120 , monoclonal anti-tubulin , anti-mouse Alexa 488 , anti-mouse Alexa 594 and anti-rabbit Alexa 633 .For the knockdown experiments, rat dynein heavy chain siRNA was used .Bam HI and Eco RI (both New England Biolabs (NEB)). mCherry Kpn I and Eco RI (both NEB) and subcloned in frame into the 5′ end of hLC3B pcDNA3.Human light chain 3B (LC3B) was subcloned from pGEX-6P-1 ml-glutamine (Invitrogen) at 37°C and 5% CO2. For live-cell imaging, cells were seeded on 42-mm glass cover slips (PeCon GmbH) at a density of approximately 1.5 × 105 cells per cover slip or alternatively on 22 × 22-mm cover slips in a 6-well plate at a density of 1.5 × 105 cells per cover slip for later fixation. For drug treatments, cells were treated for 24 h with 0.2 μg/mL rapamycin (Sigma), 400 nm bafilomycin A1 (Upstate) or 50 μm EHNA (Sigma). For starvation, cells were transferred to CO2-independent medium (Invitrogen) for 30–120 min.Normal rat kidney cells were grown in DMEM (Sigma) supplemented with 10% FBS (Invitrogen), 100 U/mL penicillin/streptomycin (Invitrogen) and 2 mm siRNA, 0.5 μg mCherry–LC3, 0.25 μg lgp120–GFP and 5 μL Lipofectamine 2000 in Optimem (Invitrogen) for 4 h. They were then washed once in full medium and cultured in full medium for 48 h. Finally, they were split, reseeded at 1.5 × 105 cells per cover slip and cultured for another 24 h until imaging/fixation.Cells were transfected 24 h after seeding with 1.5 μg GFP–LC3 or 1 μg mCherry–LC3 and 0.5 μg lgp120–GFP in 6 μL Lipofectamine per cover slip for 4 h in DMEM. They were then washed once in full medium and cultured in full medium for the times indicated, unless stated otherwise in the figure legends see legend. Right after 4 h of transfection, cells were loaded with 0.5 mg/mL lysine-fixable 10 kD Oregon Green 488 dextran (Molecular Probes) for 4 h at 37°C in full medium, followed by a chase of 20 h in dextran-free full medium, as previously described For the tubulin staining, cover slips were washed once in ×1 PBS, fixed for 20 min in 4% paraformaldehyde, washed once in ×1 PBS, permeabilized in ×1 PBS 0.2% Triton-X-100 for 5 min and washed three times in ×1 PBS. Then, they were blocked in blocking buffer (10% FBS and 1% BSA in ×1 PBS) for 1 h. Primary antibody diluted in blocking buffer was added, and cover slips were incubated at 4°C overnight. The next day, cells were washed three times with ×1 PBS, incubated with the appropriate secondary antibody and washed again. Finally, they were mounted in Prolong Gold antifading solution (Invitrogen) containing 4’,6-diamidino-2-phenylindole (DAPI) .For the lgp120 staining, the procedure was the same as above, except that the cover slips were fixed 10 min in −20°C in methanol.For the CIMPR staining, cells were fixed in 4% paraformaldehyde (PFA) and permeabilized in 40 μm digitonin. Primary and secondary antibodies were only incubated for 1 h each at room temperature in 3% BSA (in PBS).m Tris–HCl pH 6.8, 5% β-mercaptoethanol, 10% glycerol and 0.01% bromophenol blue) for 30 min in the presence of protease inhibitors (Roche Diagnostics). Samples were subjected to SDS–PAGE, and proteins were transferred to a polyvinylidene fluoride (PVDF) membrane . Blots were first probed with primary antibodies (see above). Then, they were probed with the appropriate anti-mouse or anti-rabbit immunoglobulin G-horseradish peroxidase secondary antibody and visualized using a enhanced chemiluminescence detection kit .Cell pellets were lysed on ice in Laemmli buffer (62.5 m2-independent medium (Invitrogen), and the temperature was equilibrated at 37°C. The imaging was performed on a Carl Zeiss with a LSM 510 confocal attachment using a ×63 1.4 NA Plan Apochromat oil immersion lens. The POC cell chamber was heated to 37°C with a heated stage and Tempcontrol 37 device (Carl Zeiss). Laser lines at 488 nm and 543 nm (mCherry–LC3) were used. Band pass (505–530 nm) and long pass (560 nm) filters were used to separate wavelengths. For the dynein heavy chain (DHC) siRNA experiments, the imaging was performed as above but with the microscope fitted with an XL-3 incubator (PeCon GmbH) and using a 594-nm laser line instead of 543 nm. Laser power was kept at a minimum to minimize photobleaching and photocytotoxicity. The detector pinholes were set to give a 0.9-μm optical slice to minimize the chances of vesicles going out of/coming into focus . Scan rates varied from 1.9 to 3.9 seconds by using multitracking (line switching) with a line average of 2 and with a delay time of 7.5 seconds in between scans. Acquisition was performed using zeisslsm 510 software. Acquisition times varied from 5 to 20 min. The maximum total imaging time per cover slip was 90 min.Twenty-four hours after transfection, the cover slips were mounted in a perfusion, open and closed cultivation (POC) chamber (PeCon GmbH) in COzeisslsmimagebrowser 3.5 for double labelling, interactions and fusions. Vesicle tracking was performed in imagej (http://rsb.info.nih.gov/ij/) using the LSM reader and Manual tracking plug-ins. Thereby, 10 vesicles (GFP–LC3 only) or five LC3+/lgp120− and five LC3+/lgp120+ vesicles (mCherry–LC3/lgp120–GFP), which could be tracked for at least 15 frames (approximately 2.5 min), were chosen at random for each cell. These vesicles were then tracked manually for as long as they were visible, while the program calculated velocities for each frame [i.e. distance divided by total time in between frames (scan time + delay time)]. The results were copied to ms excel, where all further calculations and analyses were performed. Directions relative to the nucleus were determined from the algebraic sign of differences of distances (i.e. towards the nucleus corresponds to a negative difference) from an arbitrary point in the densest part of the cell near the nucleus, where autophagosomes accumulated. At the end of each tracking, the directions of fast movements were then rechecked by eye. Because of the resolution limits of the light microscope and inherent errors of manually clicking on single pixels, we used double the mean pixel diagonal divided by the total time (i.e. 2√2 × 0.15 μm/9.5 seconds = 0.045 μm/second) as the lower threshold for velocity data.Movies were analyzed in The path of an autophagosome was defined as the distance covered from the beginning of tracking till the end, with the associated direction. For standardization between different vesicles and cells, these values were then divided by the duration of tracking and the mean diameter of the cell (the mean diameter of an ellipse approximating the cell shape).Cover slips were blinded and 5 (dimethyl sulphoxide/Rap/Baf), 7 (GFP–LC3 versus mCherry–LC3) or 20 (DHC siRNA) cells were imaged on a Zeiss Axiovert 200M microscope with a LSM 510 confocal attachment using a ×63 1.4 NA Plan Apochromat oil immersion lens. Laser lines at 488 nm (lgp120–GFP), 543 nm (mCherry–LC3) and 633 nm (Alexa 633) were used.zeiss lsm image browser 3.5 as follows: first, after switching off all other channels, all mCherry–LC3-positive vesicles were counted and marked. Then the GFP channel was switched back on, and the number of colocalized vesicles was counted. For the triple-labelling experiments, the colocalization with CIMPR was finally quantified for the single or double-labelled vesicles from the analysis above. From these values, the fraction of double/triple-labelled vesicles was determined, i.e. the percentage of LC3-positive vesicles labelled with another/both other markers was calculated.These cells were then analyzed in t-test and chi-squared test were performed in ms excel and Mann–Whitney U-test and log-rank test in graphpad prism 4. Odds ratios were determined by unconditional logistical regression analysis, using the general log-linear analysis option of spss 9 software (SPSS).Student's

Chlamydia, which include several human pathogenic species, are obligate intracellular gram-negative bacteria that replicate in cytoplasmic vacuoles. The infection triggers a host response contributing to both bacterial clearance and tissue damage. For instance, type I interferons (IFN)s have been demonstrated to exacerbate the course of Chlamydial lung infections in mice.Recognition of microorganisms by the innate immune system is mediated by pattern recognition receptors, including Toll-like receptors and cytoplasmic RIG-I-like receptors. Chlamydia pneumoniae induces expression of IFN-stimulated genes (ISG)s dependent on recognition by nucleotide-sensing Toll-like receptors and RIG-I-like receptors, localized in endosomes and the cytoplasm, respectively. The ISG response was induced with a delayed kinetics, compared to virus infections, and was dependent on bacterial replication and the bacterial type III secretion system (T3SS).Here we show that C. pneumoniae infection is mediated by intracellular nucleotide-sensing PRRs, which operate through a mechanism dependent on the bacterial T3SS. Strategies to inhibit the chlamydial T3SS may be used to limit the detrimental effects of the type I IFN system in the host response to Chlamydia infection.Activation of the IFN response during Chlamydia are gram negative obligate intracellular bacteria and among the smallest bacteria known Chlamydia pnuemoniae causes respiratory tract infections like pneumonia, pharyngitis, and sinusitis. All chlamydial species share a unique biphasic developmental cycle in which the chlamydiae alternate between two morphologically distinct forms. The elementary body (EB) is the infectious but metabolically inert form whereas the reticulate body (RB) is the non-infectious but metabolically active form Sensing of microbial infections via specific innate immune receptors plays a pivotal role in the proper functioning of the host innate immune system. The germline-encoded recognition receptors (PRR)s act as a molecular switch triggering the innate immune activation and in turn tightly regulate the downstream immune responses to microbial infections Chlamydia replicates in cytoplasmic vacuoles in the host cells C. pneumoniae revealed the predominant role of TLR2 over TLR4 following infection C. pneumoniaeIntracellular pathogens propagate inside host cells due to dependence on cellular factors for completion of the life cycle. In addition to viruses, certain bacteria and protozoa reside inside cells. Listera monocytogenes, Legionella pneumophilla) or releasing bacterial material into the host cytoplasm (group B streptococcus) have recently been reported to induce expression of IFNs and ISGs via cytoplasmic PRRs and the TBK1/IRF-3 axis Pathogen recognition activates a intracellular signaling programs Shigella, Salmonella and Yerisinia in delivering the effector proteins into the eukaryotic cells directly C. pneumoniaeThe type 3 secretion system (T3SS) is primarily characterised by the translocation of the bacterial “effectors” into the eukaryotic cell for the manifestation of pathogenesis. The T3SS is important for many gram-negative bacterial species like C. pneumoniae may provide important evidence on the pathology of Chlamydia infections. In this work we demonstrate that expression of ISGs during infection with C. pneumoniae is mediated by nucleotide-sensing PRRs residing in endosomes and the cytoplasm, and this response is induced through signalling by TBK1/IKKε and is dependent on bacterial replication and the bacterial type III secretion system.While Type I IFNs and expression of ISGs has classically been known to stimulate antiviral activity, the recent appreciation of the IFN response in bacterial infections has led to increasing attention on their role in the anti-bacterial defense −/− were obtained from Z.J.Chen, Department of Molecular Biology, University of Texas, Dallas,TX,USA. myd88−/−trif−/− and tbk1−/− ikke−/− were obtained from S. Akira, Department of Host Defense, Research Institute for Microbial Diseases, Osaka University Japan and atg +/− and atg5−/− cells were procured from RIKEN Bio Resource Center, Japan. All cell types were grown in RPMI 1640 containing 25 mM HEPES, 15% (w/v) FCS, 0.3%,10 µg/ml gentamicin in growth medium and gentamicin 2 µg/ml in infection medium at 37°C in presence of 5% CO2. Cells were infected with Chlamydia pneumoniae strain TWAR CWL029 obtained from American Type Culture Collection at MOI 5 by centrifugation for 30 minutes, 2400 rpm, at 35°C.Murine embryonic fibroblasts (MEF) cell lines were used, C57BL/6 and mavsCycloheximide (Sigma Aldrich), a eukaryotic protein biosynthesis inhibitor was used at a concentration of 1 µg/ml. The LPS/TLR4 inhibitor Polymyxin B was purchased from Invivogen and used at a working concentration of 50 µg/ml. The endosomal TLR inhibitor chloroquine (used at a concentration of 10 µM) was obtained from InvivoGen. Ampicillin was used at a concentration of 20 µg/ml. The RNA polymerase III inhibitor ML-60218 was used at a concentration of 30 µM and the T3SS inhibitor INP0341, a derivative of salicylidene acylhydrazine and its analogue control INP0406, were kindly donated by Innate Pharmaceuticals, Umeå, Sweden, and used at a concentration of 60 µM.C. pneumoniae were fixed at 36 hr time post challenge. Infected cells were treated with methanol fixed and stained with MAb 15.1 against Chlamydia LPS per cell of ydia LPS .C. pneumoniae was quantified by quantitative real-time PCR (qRT-PCR) analysis of the generated cDNAs. Total RNAs were then isolated using the High Pure RNA Isolation Kit Protocol (Roche) and subjected to RT-PCR to generate cDNA using p(dT)15 primer (Roche) and Expand Reverse Transcriptase (Roche), allowing reverse transcription of total sample mRNA. The real time PCR was performed using specific primers for murine ISG56 forward primer 5′-ACC ATG GGA GAG AAT GCT GAT-3′, reverse primer: 5′-GCC AGG AGG TTG TGC-3′; murine CCL5 forward primer 5′- ACT CCC TGC TGC TTT GCC TAC-3′, reverse primer 5′- GAG GTT CCT TCG AGT GAC A-3′; murine CXCL10 forward primer 5′- CGA TGA CGG GCC AGT GAG AAT G-3′, reverse primer 5′- TCA ACA CGT GGG CAG GAT AGG CT-3′; murine β-actin forward primer: 5′- TAG CAC CAT GAA GAT CAA GAT -3′, reverse primer: 5′-CCG ATC CAC ACA GAG TAC TT -3′ and quantified using QuantiTect SYBR Green PCR Kit (Qiagen) and the cycle number at detection threshold (crossing point (cp)) weas determined using the Lightcycler (Roche) analyzer and the LightCycler Software 3.0.ISG expression at different points in time post infection of p-values of <0.05 were considered to be statistically significant).The data are presented as means ± SD. The statistical significance was estimated with the Wilcoxon rank sum test , myd88−/−trif−/− and mavs−/− MEFs with the bacteria and measured accumulation of ISG56 mRNA 18 h post infection. Interestingly, the ability of C. pneumonia to trigger the IFN response was dependent on intact pathways from both TLRs and RLRs (MAVS) . Both kns (MAVS) whereas s (MAVS) .C. pneumonia, we treated MEFs with PAMPs, known to activate IFN-inducing TLRs and RLRs, and measured ISG56 mRNA expression. The TLR3 agonist polyIC strongly induced ISG56 expression, and the TLR4 agonist LPS induced a modest but significant response and infected with the bacteria. However, this treatment did not affect C. pneumoniae-induced ISG56 expression (data not shown), thus suggesting that MAVS signaling during C. pneumoniae infection is not activated by RNA polymerase III driven transcription of AT-rich regions in the bacterial genome. Collectively, C. pneumoniae infection stimulates expression of ISGs via recognition by endosomal TLRs and cytoplasmic RLRs.Recently it has been reported that RNA polymerase III transcribes AT-rich DNA in the cytoplasm, thus generating RNA-species recognized by RLRs (refs). To examine if the ISG response during C. pneumonia prompted us to examine the potential role for the IRF-3 kinases TBK1 and IKKε, which are involved in signaling from most of these PRRs. As expected activation of the ISG response during C. pneumonia infection was dependent on these kinases are responsible for induction of the IFN response. Since the conversion of EBs to RBs occurs between 8 and 10 h after infection, it is tempting to speculate that the Chlamydial ISG-inducing nucleotide PAMP is produced or accessible only when RBs are actively dividing.The finding that C. muridarum induces expression of a subset of inflammatory cytokines in a manner dependent on the T3SS Salmonella enterica Typhimurium T3SS has also been reported to stimulate innate immune responses, but in that case it was reported to occur directly via bacterial effector proteins independent of any known innate immune receptors C. pneumoniae to stimulate ISG expression, suggesting other mechanisms to be involved. Others have reported that the TLR adaptor MyD88 localizes to the inclusions during Chlamydia trachomatis infections, and there may therefore be a more direct interaction between the Chlamydia inclusion and endosomal TLRs Yersinia pseudotuberculosis and this was dependent on the T3SS C. trachomatis infection stimulates production of reactive oxygen species through the T3SS, which leads to activation of the inflammasome and production of bioactive IL-1β We found an essential role for the T3SS in induction of the ISG response. This is in agreement with a recent report that C. pneumonia, and that the MEFs induced ISG56 expression after stimulation with agonists for TLR3, RIG-I, and MDA5 but not after stimulation with agonists for TLR7 and 9. Therefore, the ISG response to C. pneumoniae is likely to be mediated by intracellular RNA-sensing PRRs. This is in contrast to most reports on bacterial induction of the IFN response, which is mediated primarily by cytoplasmic DNA-sensing PRRs Bacteria are recognized through all known classes of PRRs, and specifically for Chlamydia it is known that TLR2, TLR4, NOD1, NOD2, NLRP3 and possibly also TLR3 play a role in innate recognition of the bacteria C. pneumoniae infection is mediated by intracellular nucleotide-sensing PRRs, which operate through a mechanism dependent on the bacterial T3SS. Thus, specific strategies to inhibit the chlamydial T3SS may be used to limit the detrimental effects of the type I IFN system in the host response to Chlamydia infection, and hence to limit the pathology of infections with this intracellular bacterial pathogen.In conclusion, we report that activation of the type I IFN response during

The process of sperm maturation, capacitation, and fertilization occur in different molecular milieu provided by epididymis and female reproductive tract including oviduct. The different tissue environment with different oxygen tension and temperature may still influence the process of sperm maturation and capacitation. Reactive oxygen species (ROS) is reported to be an initial switch that may activate the molecular process of capacitation. Therefore, the generation of reactive oxygen species and its possible physiological role depends upon a balance between its formation and degradation in an open environment provided by female reproductive tract. The sensitivity of the spermatozoa to the action of ROS may be due to its exposure for the first time to an oxygen rich external milieu compared to its internal milieu in the male reproductive tract. Reduced temperature in testicular environment coupled with reduced oxygen tension may be the right molecular environment for the process of spermatogenesis and spermiogenesis. The morphologically mature spermatozoa then may attain its motility in an environment provided by the caput epididymis wherein, the dyenin motor can become active. This ability to move forward will make the spermatozoa physiologically fit to undertake its sojourn in the competitive race of fertilization in a new oxygen rich female reproductive tract. The first encounter may be oxygen trigger or preconditioning of the spermatozoa with reactive oxygen species that may alter the spermatozoal function. Infertility is still one of the major global health problems that need medical attention. Apart from the development of artificial methods of reproduction and development of newer techniques in the field of andrology focuses attention on spermatozoal structure and metabolism. Therefore, understanding the molecular mechanisms involved in fertilization in general and that of sperm capacitation in particular may help lead to new and better techniques for enhancing fertility, identifying and treating certain forms of male infertility, and preventing conception. One remarkable insight is the importance of membrane cholesterol efflux in initiating transmembrane signaling events that confer fertilization competence. The identity of the physiologically relevant cholesterol acceptors and modulators of cholesterol efflux is therefore of great interest. Still, it is clear that cholesterol efflux represents only a part of this story. The involvement of phospholipid translocation in mediating dynamic changes in the membrane, rendering it conducive to transmembrane signaling, and the modulation of membrane components of signal transduction cascades by cholesterol or phospholipids will yield important insights into the links between environmental sensing and transmembrane signaling in the sperm. Understanding the membrane molecular events will ultimately provide new and exciting areas of investigation for the future Morphological maturity of mammalian spermatozoa takes place in the testis after spermatogenesis and spermiogenesis. Progressive motility of spermatozoa is acquired and signaling pathways mature during sperm transit through the epididymis. Mammalian spermatozoa leaving the testis attains functional maturity (progressive motility and the ability to fertilize a metaphase-II arrested egg) only during its residence in the female reproductive tract Figures and 2.This acquired capacity to fertilize was first observed by Austin and ChanOne of the main contributing factor involved leading to such novel signaling mechanism is contributed by sperm membrane cholesterol efflux. This efflux of cholesterol controls sperm capacitation, and the details of this effect are now beginning to be understood at the molecular level.Knowledge of how cholesterol efflux occurs in these cells, as well as how this efflux is integrated with transmembrane signaling to regulate sperm function, may reveal much about the fertilization process and may also provide insights into the role and dynamics of membrane cholesterol efflux in somatic cell function.Cholesterol is found in every cell of our body. It is especially abundant in the membranes of cells, where iMolecule for molecule, cholesterol can make up nearly half of the cell membrane. Since it is smaller and weighs less than other molecules in the cell membrane, it makes up a lesser proportion of the cell membrane’s mass, usually roughly 20 percent .amphipathic molecule; it contains a hydrophilic and a hydrophobic portion. Cholesterol’s hydroxyl (OH) group aligns with the phosphate heads of the phospholipids. The remaining portion of it tucks into the fatty acid portion of the membrane.Cholesterol is an Because of the way cholesterol is shaped, part of the steroid ring (the four hydrocarbon rings in between the hydroxyl group and the hydrocarbon “tail”) is closely attracted to part of the fatty acid chain on the nearest phospholipid. This helps slightly immobilize the outer surface of the membrane and make it less soluble to very small water-soluble molecules that could otherwise pass through more easily.Without cholesterol, cell membranes would be too fluid, not firm enough, and too permeable to some molecules. In other words, it keeps the membrane from turning to mush.While cholesterol adds firmness and integrity to the plasma membrane and prevents it from becoming overly fluid, it also helps maintain its fluidity.At the high concentrations it is found in our cell’s plasma membranes cholesterol helps separate the phospholipids so that the fatty acid chains can’t come together and crystallizeTherefore, cholesterol helps prevent extremes - whether too fluid or too firm in the consistency of the cell membrane.Therefore, cholesterol influx and efflux will affect spermatozoa membrane function and influence its function.A short overview of the role of cholesterol efflux in regulating sperm capacitation is presented with a view to identifying areas of future investigation that may ultimately provide a greater understanding of the role of this sterol in regulating signal transduction and its effect on sperm capacitation.After attaining morphological maturity in the testis, sperm must undergo two distinct processes of functional maturation to be able to fertilize an egg. The first occurs in the epididymis of the male reproductive tract, as sperm move from the caput to the corpus and then to the caudal regions of this organ, where they are stored prior to ejaculation.During this transit, the signaling pathways that regulate capacitation are enabled. Thus, caput epididymal sperm fail to be capacitated in the presence of molecular stimuli (defined below) that are sufficient to capacitate sperm residing in the cauda epididymis.Several molecular events are likely to be involved in the acquisition of signaling competence. For example, concomitant with the maturation of these signaling pathways, epididymal sperm undergo dramatic alterations in their membrane sterol content. Such changes are highly species-specific and are also highly specific with regard to the class of sterol that is being changed. In additThe majority of alterations of epididymal sperm sterol content probably result from interactions of the sperm with the epididymal epithelium. Epithelial linings of both the epididymis and the vas deferens appear to have a highly developed sterol-producing capacity, althoughGiven the species-specific nature of these large-scale alterations in lipid content, it is difficult to speak generally about their function. However, in all species examined thus far, cauda epididymal sperm possess clearly delineated membrane domains that differ in their sterol composition. Initially characterized by the presence of filipin-sterol complexes (FSCs) visible by freeze-fracture electron microscopy, these domains impart heterogeneity on the sperm surface within a given region of these cells. Such sub domains suggest the possibility of still more precise compartmentalization of function beyond the obvious polarization of these cells into head and tail domains that contribute to egg interaction and motility regulation, respectively. Indeed, these sub domains have recently been hypothesized to act as scaffolds or foci for signaling pathways regulating sperm capacitation in both the head and flagellum.in vitro models support the idea that capacitation requires transmembrane signaling and intracellular signal transduction. The development of in vitro capacitation protocols for sperm of several different species has shown the critical importance of three media constituents, namely Ca2+, HCO3–, and a protein that can function as a cholesterol acceptor, such as serum albumin. In short, capacitation is shown to be regulated by a novel signal transduction pathway involving cAMP, protein kinase A (PKA), and tyrosine kinases. Tyrosine kinase signaling leads to the phosphorylation of tyrosine residues of several proteins, the identities of which are only starting to be elucidated.[et al.[in vitro in media known to support capacitation, display a timedependent increase in protein tyrosine phosphorylation. The tyrosine phosphorylation correlates with the onset of functional capacitation, operationally defined by the ability of the sperm population to fertilize eggs. The apparent absence of external stimuli, such as hormones or cytokines that might initiate the observed tyrosine phosphorylation suggested that signaling might be regulated by a time-dependent mechanism or by specific components in the media. Subsequent work showed that the extracellular Ca2+, HCO3–, and serum albumin in the capacitation medium are all absolutely required for these molecular and functional changes[3- activated adenylyl cyclase) activity elevate cAMP levels and PKA activity and stimulate downstream kinases. This signaling results in increased phospholipid scrambling, causing a disordered distribution of amino and neutral phospholipids. Together with the increase in membrane fluidity caused by the sterol efflux, this change results in lateral movement of some sterols and caveolin from the anterior to the posterior head. The loss of sterols from the membrane causes a disruption of the interaction between caveolin and the membrane fusion proteins, resulting in their activation. The plasma membrane (PM) and outer acrosomal membrane (OAM) are shown immediately adjacent to the subacrosomal ring (SAR). For simplicity, both an anion and a cation are drawn as passing through a single ion channel in b. Cholesterol can exist in a free state in the membrane or be associated with cholesterol acceptors such as HDLs or albumin (A). sAC, a novel HCO3–activated adenylyl cyclase that associates at least in part with membranes, is shown here in the sperm cytoplasm. Membrane fusion proteins (MF) can associate with either the PM or the OAM. Just as interesting as this novel mode of signal transduction is the unusual mechanism by which these medium components activate cAMP signaling [Recent studies by several laboratories using ucidated. Viscontid.[et al. have shol changes and impll changes Membraneignaling .2+ can regulate the activity of specific adenylyl cyclase and cyclic nucleotide phosphodiesterase family members, the effects of HCO3– on adenylyl cyclase activity have been demonstrated in only a small number of cells or tissues, including ocular ciliary processes, corneal endothelium, choroid plexus, the medullary and cortical regions of the kidney,[3–- activated adenylyl cyclase, which was recently purified and cloned.[3–.[Outflow (Efflux) of Cholesterol from Spermatozoal Membrane destabilizes the membrane. Calcium and Bicarbonate Ions flow into the Spermatozoan- activate Adenyl cyclase which inturn activates cAMP dependent Protein Kinase(AMPK). AMPK activation brings about changes in Tyrsoine Kinase induced tyrosine phosphorylation. In human spermatozoa, Calcium ions inhibit tyrosine phosphorylation which is supposed to be involved in Sperm Capacitation Although there is clear evidence that Cae kidney, and spere kidney, Presentle kidney, A considd cloned. This prooned.[3–.18The historical requirement for serum albumin in defined media to support capacitation had been hypothesized by several groups to be due to the ability of albumin to serve as a sink for cholesterol removal from the sperm plasma membrane.19 Remova2020In all species examined thus far by visualization of FSCs the plasma membrane overlying the acrosome has been found to be markedly enriched in sterols, relative to either the post-acrosomal plasma membrane or the acrosomal or nuclear membranes.–24 The h2 rich and caveolae) and outside rafts (GEM) [Lipid rafts are specialized membrane domains enriched in certain lipids cholesterol and proteins. Caveolae are flask shaped invaginations on the cell surface that are a type of membrane raft, these were named “caveolae intracellular”.25 It prets (GEM) .The fatty-acid chains of lipids within the rafts tend to be extended and so more tightly packed, creating domains with higher order. It is therefore thought that rafts exist in a separate ordered phase that floats in a sea of poorly ordered lipids. Glycosphingolipids, and other lipids with long, straight acetyl chains are preferentially incorporated into the rafts.The first potential role is in compartmentalizing pathways to specific regions of the cell. This “prefabricated” ordering of pathway components is critical in sperm because of their extraordinarily polarized design, as well as the fact that they are both transcriptionally and translationally inactive. Sperm must assemble and organize their pathways so that they may function precisely where needed, as they cannot synthesize new proteins to meet changing needs in the female tract. One protein enriched in sperm membrane rafts that might function to compartmentalize pathways is caveolin-1. In somatIn addition to physically compartmentalizing specific pathways, membrane rafts may regulate such pathways by facilitating the efflux of cholesterol from the sperm plasma membrane. Cholesterol efflux from rafts might initiate signaling by at least two mechanisms. First, efflux could increase membrane fluidity and thus allow previously partitioned integral membrane proteins or membrane-anchored proteins to interact with one another in order to initiate signaling. In this regard, proteins believed to be important in the fusion of the sperm with the egg plasma membrane have been shown to translocate from the anterior to the posterior sperm head during capacitation, suggesting that the loss of cholesterol and the concomitant increase in membrane fluidity is essential for fertilization. Second, 30322123in vitro by incubating sperm in the presence of a cholesterol acceptor such as serum albumin or β-cyclodextrins. Several reports suggest that the cholesterol acceptors HDL and albumin, which are both found in oviductal and follicular fluid, can stimulate capacitation.[3143in vivo, thus safeguarding sperm signaling and fertilization competence when the specific pathways are compromised, as in the knockout models studied. Recent work on phospholipid scramblases has begun to clarify the relationship between HCO3– and Ca2+ signaling and the induction of cholesterol efflux during capacitation.[3– and PKA activity.[In somatic cells, several molecular pathways have been proposed to carry out cholesterol efflux. These in35citation.42 Interecitation. Moreovercitation.314344 Thcitation.46 These citation. Phospholactivity.48–50 andDespite the focus on cholesterol above, it should be noted that sperm are remarkable for the variety of sterols they possess. The sperm of rodents, primates, and other species contain varying amounts of desmosterol,51 which 105353Plasma membrane dynamics and signaling cascades unique to Spermatozoa and its molecular understanding gives an insight into the role of sperm capacitation in fertility. The understanding at a molecular level regarding sperm capacitation may help lead to new and better techniques for enhancing fertility, identifying and treating certain forms of male infertility, and preventing conception. The impo

Cell surface glycoconjugates were investigated in a rat model of oral chemical carcinogenesis. The lectins Griffonia simplicifolia and Ulex europeus were examined microspectrofluorimetrically in the oral epithelium of rats painted with the carcinogen 4-nitroquinoline N-oxide (4NQO) and compared with those treated with solvent alone. After labelling with GS-I-B4, the fluorescent intensity of the basal and parabasal epithelial cells was significantly less after 9 months of 4NQO treatment and in overt squamous cell carcinomas compared to controls. The fluorescent activity of the spinous epithelial cells in the non-invasive tissues treated with 4NQO and in the well differentiated (sites of keratin elaboration) malignant epithelium of squamous cell carcinomas was unchanged after labelling with UEA-I. UEA-I failed to stain undifferentiated (areas lacking keratin) malignant epithelium. The findings indicate that alpha-D-galactosyl residues are diminished on the membranes of premalignant and malignant rat epithelial cells. The expression of alpha-L-fucosyl groups, however, remains unchanged in premalignant rat oral epithelium and is closely correlated to the presence of keratin in the malignant epithelium of squamous cell carcinomas.

Plasmodium falciparum isolates from coastal Kenya (Kilifi) were investigated, from 1993, prior to the withdrawal of CQ, to 2006, seven years after its withdrawal. Changes to those that occurred in the dihydrofolate reductase gene (dhfr) that confers resistance to the replacement drug, pyrimethamine/sulphadoxine were also compared.The spread of resistance to chloroquine (CQ) led to its withdrawal from use in most countries in sub-Saharan Africa in the 1990s. In Malawi, this withdrawal was followed by a rapid reduction in the frequency of resistance to the point where the drug is now considered to be effective once again, just nine years after its withdrawal. In this report, the polymorphisms of markers associated with CQ-resistance against pfcrt, at 86 of pfmdr1, and at codons 51, 59 and 164 of dhfr were analysed using PCR-restriction enzyme methods. In total, 406, 240 and 323 isolates were genotyped for pfcrt-76, pfmdr1-86 and dhfr, respectively.Mutations associated with CQ resistance, at codons 76 of pfcrt-76 mutant significantly decreased from around 95% to 60%, while the frequency of pfmdr1-86 did not decline, remaining around 75%. Though the frequency of dhfr mutants was already high (around 80%) at the start of the study, this frequency increased to above 95% during the study period. Mutation at codon 164 of dhfr was analysed in 2006 samples, and none of them had this mutation.From 1993 to 2006, the frequency of the In accord with the study in Malawi, a reduction in resistance to CQ following official withdrawal in 1999 was found, but unlike Malawi, the decline of resistance to CQ in Kilifi was much slower. It is estimated that, at current rates of decline, it will take 13 more years for the clinical efficacy of CQ to be restored in Kilifi. In addition, CQ resistance was declining before the drug's official withdrawal, suggesting that, prior to the official ban, the use of CQ had decreased, probably due to its poor clinical effectiveness. Plasmodium falciparum-resistant isolates was first reported in South-East Asia and South America in the 1950s , and amodiaquine (AQ) hypoxanthine incorporation into parasite nucleic acid (IC50), using regression analysis of the dose-response curve. Fifty microlitres of culture from these adapted parasites was spotted onto filter paper for DNA extraction and genotyping.A subset of the 2006 samples were adapted ervation . Resultspfcrt-76 and pfmdr1–86 was carried out using the PCR-restriction enzyme protocol described elsewhere [dhfr were analysed as described elsewhere [dhfr of samples was not carried out routinely, since previously reports showed that this mutation was not present at detectable levels in our study site and other African sites where SP resistance is high [dhfr mutant in Africa [dhfr in isolates collected in 2006 was analysed. Mutation at codon 108 was not analysed since the presence of a mutation at codon 51 and/or 59 indicates that the parasite carries the resistant mutation at codon 108 [Parasite genomic material from filter paper was prepared using the methanol procedure described elsewhere . The detlsewhere . Point mlsewhere ,19. The is high ,21. Howen Africa -24, the odon 108 .pfcrt-76, pfmdr1–86 and dhfr (codons 51 and 59) alleles were calculated as the proportion of samples carrying the mutant form out of the total of all samples carrying either only the mutant form or only the wild-type form: thus samples carrying both wild-type and mutant forms, in which relative frequencies could not be determined, were excluded from the denominator and numerator. In the case of dhfr, those samples with either a mutation at dhfr-51 (from the amino acid Asn to Ile) or dhfr-59 (from Cys to Arg) were denoted as 'double mutants'. Those with mutations at both dhfr-51 and dhfr-59 were denoted as 'triple mutants' and those with or without a resistant allele mutation at dhfr-108 (Ser to Asn) were pooled and denoted as wild-type/single mutants ('WT/single mutants'). The data were first analysed by treating these as three haplotypes, and then by treating the double mutant forms as two separate alleles to give four haplotypes.Frequencies of mutations at s, which describes how much more (or less) fit the resistant mutant is relative to the wild-type, and is a function of the amount of drug pressure and also the cost of resistance in the absence of drug pressure [As some of the samples were collected from patients enrolled in clinical trials, an analysis was performed to determine the potential bias to population frequencies caused by drug treatment of the patients from which the parasites were sampled. This was done by comparing the frequencies of each mutant before versus after drug treatment using a Fisher's Exact test for each trial separately. Thereafter, an analysis was carried out for trends in the frequencies of mutants through time with and then without the post-treatment samples included in the data, by fitting a logistic regression model to the frequency data with generation as a linear covariate and assuming three parasite generations per year becomes where the slope of this line is , wR and i = 1,2,3 for single/WT, double and triple mutants, respectively, and where j denotes all alleles other than i. After setting w1 = 1, Equation (2) can be solved for w2 and w3 by substituting in the observed values for pi and pj and minimizing the sum of squared differences between the observed slopei's and their expected values, ). Note, however, that wi now depends on the frequencies of the other alleles: since these change with time, Equation (2) is an approximation [dhfr in this study, the single and double mutants changed relatively little with time and so the approximation is likely to be accurate.with ximation . In the s were calculated by taking the upper and lower CI values of the regression estimates of the slope and then transforming them using Equation (1). Significance levels of differences between rates of decline of different alleles between different time periods, and when including vs. excluding post-treatment samples, were tested by t-tests. data from a previously published study in Malawi [Confidence intervals (95%) on estimates of n Malawi were anapfcrt-76, pfmdr1–86 and dhfr, respectively, collected between 1993 and 2006 in Kilifi. Of these, 41, 28 and 58 carried mixed alleles and were not used in the analysis. Data on pfcrt genotypes from patients that had been treated with AQ (in 2006) were excluded because post-treatment patients harboured a significantly higher frequency of the pfcrt-76 mutant than pre-treatment patients . There was also an indication that AL selected against the pfcrt mutant allele . There were no significant effects of any other drugs used in the clinical trials on pfmdr-86 and dhfr allele frequencies. Nor did the inclusion of these post-treatment samples alter the slope of the regression lines in analyses of time trends in allele frequencies. Nevertheless, for the final analyses of time trends, Data from post-treatment samples were excluded. The total number of samples in these analyses was 322, 169 and 248 for pfcrt, pfmdr and dhfr, respectively, with medians of 29, 20 and 23 per year from around 94% to 63% over a period of 13 years . The estimated fitness of this resistant mutant was 5% lower than that of the wild-type (s = -0.05). In Malawi, the rate of decline after CQ was withdrawn was much faster than in Kilifi (from 85% to 13% in 9 years). The estimated fitness of the resistant mutant in the Malawi study was 12% lower than that of the wild-type (s = -0.12): this was significantly greater in magnitude than that in the Kilifi study .In Kilifi, the frequency of the s Figure . This depfmdr-86 did not decline significantly (P = 0.6) in the Kilifi population with an estimated selection coefficient of -3%.n Figure , and haddhfr double and triple mutants combined was already high (around 80%) at the start of the study . Nonetheless, this frequency increased significantly (P < 0.001) to above 95% during the study period . No isolate had a mutation at 164 codon of dhfr.In Kilifi, the frequency of the d Figure . Relativdhfr Asn51Ile-Cyst59Arg double mutants were 5% and 7%, respectively, and 8% for the triple mutant. The frequencies of the double mutants stayed approximately the same through time because, at the same time as they were gaining ground to the wild-type/single mutant, they were losing ground to the triple mutant by the year 2023, over 20 years after the official removal of the drug in Kenya. This contrasts with the case in Malawi where this level of sensitivity was reached within nine years following CQ withdrawal. In Kilifi, virtually no change is expected in pfmdr1–86 frequency while in Malawi by 2009, the frequency of pfmdr1–86 mutant is expected to fall below 10%.Based on the above estimates and Equation (1), it is predicted that, if the current drug pressure were to be maintained, Kilifi isolates will have largely reverted to CQ-sensitive phenotypes and 3D7 and M24 (wild type) were analysed and and these IC50 values are 158 ± 75, 94.15 ± 16, 6.5 ± 2.3, 15.6 ± 8.6 nM respectively. The results of field isolates are summarized in Figure pfcrt-76 genotypes, parasites can be classified into three distinct groups. The first group, the wild-type group, has IC50 values ranging between 1 and 25 nM, with an average of 13 ± 12 nM. The second group is composed of mixed genotype infections (wild-type and mutant), with a mean of 24 ± 10 nM; and the third group of pfcrt-76 mutants, which forms the majority of isolates, has a mean of 63 ± 90 nM (ranging from 5 to 150 nM). To distinguish CQ-sensitive and CQ-resistant isolates, a cut-off point of 100 nM is generally used [pfcrt-76 mutant. Thus, the most accurate cut-off point to use in our setting would be 25 nM , but this difference was not statistically significant (p > 0.05).CQ IClly used ,33. HoweThe results show that CQ resistance in Kilifi was in decline since the early 1990s despite CQ only being officially withdrawn from Kenya in 1999 when it dhfr double and triple mutants in the Kilifi population from the early 1990s [These results suggest that widespread clinical failure of CQ prior to the ban drove people to use alternative drugs such as SP (which was then the second line of treatment) regardless of the prevailing official policy. This is supported by the high frequency of the ly 1990s after excluding mixed infections and post-treatment samples. Supplemental table.Click here for file

Moreover, this combined treatment reactivated viral replication in resting CD4+ T cells isolated from similar patients. Our results suggest that combinations of different kinds of proviral activators may have important implications for reducing the size of latent HIV-1 reservoirs in HAART-treated patients.The persistence of transcriptionally silent but replication-competent HIV-1 reservoirs in Highly Active Anti-Retroviral Therapy (HAART)-treated infected individuals, represents a major hurdle to virus eradication. Activation of HIV-1 gene expression in these cells together with an efficient HAART has been proposed as an adjuvant therapy aimed at decreasing the pool of latent viral reservoirs. Using the latently-infected U1 monocytic cell line and latently-infected J-Lat T-cell clones, we here demonstrated a strong synergistic activation of HIV-1 production by clinically used histone deacetylase inhibitors (HDACIs) combined with prostratin, a non-tumor-promoting nuclear factor (NF)- κB inducer. In J-Lat cells, we showed that this synergism was due, at least partially, to the synergistic recruitment of unresponsive cells into the expressing cell population. A combination of prostratin+HDACI synergistically activated the 5′ Long Terminal Repeat (5'LTR) from HIV-1 Major group subtypes representing the most prevalent viral genetic forms, as shown by transient transfection reporter assays. Mechanistically, HDACIs increased prostratin-induced DNA-binding activity of nuclear NF-κB and degradation of cytoplasmic NF-κB inhibitor, IκBα . Moreover, the combined treatment prostratin+HDACI caused a more pronounced nucleosomal remodeling in the U1 viral promoter region than the treatments with the compounds alone. This more pronounced remodeling correlated with a synergistic reactivation of HIV-1 transcription following the combined treatment prostratin+HDACI, as demonstrated by measuring recruitment of RNA polymerase II to the 5'LTR and both initiated and elongated transcripts. The physiological relevance of the prostratin+HDACI synergism was shown in CD8 HIV-1 infection can be treated effectively in many patients in the developed world, using combinations of antiretroviral therapeutics, called Highly Active Anti-Retroviral Therapy (HAART). However, despite prolonged treatment with HAART, the persistence of HIV-1 reservoirs harboring transcriptionally silent but replication-competent proviruses represents the major hurdle to virus eradication. These latently-infected cells are a permanent source for virus reactivation and lead to a rebound of the viral load after interruption of HAART. Therefore, current anti-HIV-1 research efforts are increasingly focused on strategies aimed at reducing the size of these persistent reservoirs of latent HIV-1 by forcing viral gene expression. This kind of strategy would allow latently-infected cells to die from viral cytopathic effects or host cytolytic effector mechanisms following viral reactivation, while the antiretroviral therapy would prevent spreading of the infection by the neosynthetized virus in vitro chromatin-reconstituted HIV-1 templates + T cells obtained from HAART-treated patients with undetectable viral load + T cell infection in patients who were prescribed VPA for clinical reasons while receiving standard HAART Acetylation level of histone and non-histone proteins, controlled by deacetylases (HDACs) and acetyltransferases (HATs), is a key element regulating HIV-1 transcription. In agreement, we have previously reported that treatment of latently HIV-1-infected cell lines with HDAC inhibitors (HDACIs) induces viral transcription and remodeling of the repressive nucleosome nuc-1, located immediately after the HIV-1 transcription start site under latency conditions de novo HIV-1 infection via posttranscriptional downregulation of the cellular HIV-1 receptors CD4 and CXCR4 (CXC chemokine receptor 4) Homalanthus nutans (a source of prostratin) have already been used by the Samoan healers to treat individuals with certain medical conditions such as hepatitis We have previously demonstrated a strong synergistic activation of HIV-1 promoter activity by the HDACI trichostatin A (TSA) and the NF-κB inducer TNFα in the postintegration latency model cell line U1 +-depleted peripheral blood mononuclear cells (PBMCs) isolated from HIV-1-infected patients receiving HAART and with undetectable viral load. Mechanistically, HDACI increased prostratin-induced NF-κB activation and potentiated nuc-1 remodeling. Moreover, prostratin+HDACI combined treatment caused a synergistic activation of HIV-1 transcriptional initiation and elongation. Our results constitute a proof-of-concept for the coadministration of two different types of therapeutically promising HIV-1 inducers (one acting on the NF-κB pathway and the other acting on the protein acetylation status) together with HAART as a therapeutic perspective to decrease the pool of latent HIV-1 reservoirs.Here, we demonstrated that a combination of prostratin+VPA or prostratin+SAHA reactivated more efficiently than each compound alone HIV-1 production both in several latently-infected cell lines (U1 and J-Lat clones) and in CD8HDACIs present several advantages for HIV-1 purging strategies. They do not induce proliferation or activation of T cells For various HDACIs, we determined an optimal concentration in terms of both their cellular toxicity and their HIV-1 reactivation potential by measuring cell viability and induAmong the HDACIs tested, VPA, NaBut and SAHA are already in clinical use to reduce epileptic seizures + T-cell-based model of HIV-1 postintegration latency termed J-Lat nef gene, thus permitting epifluorescence monitoring of viral transcriptional activity. Under basal conditions, little or no GFP expression is detected and transcriptional activation of the latent provirus leads to GFP expression, which can be detected at the single-cell level by flow cytometry. In contrast to several other HIV-1 postintegration model cell lines (including the U1 cell line tat (trans-activator of transcription) gene or TAR element (trans-activation response element). We observed important synergistic activations of viral production in the two J-Lat clones tested, the J-Lat 15.4 in monocytic and lymphocytic postintegration latency model systems, the two major cellular reservoirs in the natural host. Importantly, we demonstrated using human uninfected CD8ostratin .nef, transcriptional activation of the latent provirus can be readily detected in individual cells by flow cytometry. As shown in In order to assess if the synergistic effect observed with a prostratin+HDACI cotreatment on viral p24 antigen production was due to an enhanced HIV-1 expression from those cells whose transcription was already reactivated by the drugs used alone or to the recruitment of unresponsive cells into the responding population, we used J-Lat T cells. As these cells harbor a full-length latent HIV-1 provirus containing GFP in place of + T-cell-based J-Lat clones, the prostratin+HDACI combinatorial treatment caused the synergistic recruitment of unresponsive J-Lat cells into the expressing cell population.These results indicated that, in the Jurkat CD4The HIV-1 group M isolates, which are responsible for more than 99% of all infections, have diversified during their worldwide spread. These isolates have been grouped according to their genomic sequences and are divided into 9 distinct subtypes termed A, B, C, D, F, G, H, J and K that can be further divided into sub-subtypes Functional distinctions in LTR architecture among HIV-1 subtypes have been identified, thus raising the possibility that regulatory divergence among the subtypes of HIV-1 has occurred. To examine the impact of these differences among the LTR sequences on the prostratin+VPA synergism, we performed transient transfections of Jurkat cells with reporter luciferase constructs containing LTRs from subtypes A, B, C1, D, F, G, and from CRF01_AE and CRF02_AG. Transfected LTRs were assayed for their responsiveness to prostratin alone, to VPA alone, or to both agents in combination. Results presented in In conclusion, we showed that the combination prostratin+VPA synergistically activated transcription from LTRs belonging to several group M subtypes, including subtypes A, B, C, which represent the most prevalent HIV-1 genetic forms In order to assess the molecular mechanisms responsible for the synergistic reactivation of HIV-1 production we observed following a prostratin+VPA cotreatment, we analyzed the effects of VPA on prostratin-induced NF-κB DNA-binding activity. To this end, we performed electrophoretic mobility shift assays (EMSAs) using an HIV-1 NF-κB probe and nuclear extracts from Jurkat T cells . As expeNF-κB activation requires signal-coupled phosphorylation and degradation of the inhibitors of κB , which bind and sequester NF-κB dimers in an inactive form in the cytoplasm of resting cells Our results demonstrated that VPA prolonged and increased prostratin-induced NF-κB DNA-binding activity and that this correlated with a prolonged IκBα degradation. This could explain, at least in part, the transcriptional synergism we observed between prostratin and VPA on the HIV-1 promoter.in vitro with PstI and analyzed by Southern blotting using indirect end-labeling.We have previously reported that a single nucleosome (nuc-1) located immediately downstream of the HIV-1 transcription start site is remodeled during transcriptional activation of the HIV-1 promoter and that this remodeling is necessary for viral transcription At each time point tested, the combined treatment prostratin+VPA provoked an increase in nuc-1 DNA accessibility more pronounced than the increases observed after treatment with each drug individually on SouthIn order to further examine, at the chromatin level, the molecular mechanisms involved in the prostratin+VPA synergism, we analyzed levels of histone H4 acetylation (an activation mark) in the nuc-1 region. To this end, we performed chromatin immunoprecipitation (ChIP) assays using U1 cells mock-treated or treated for different time periods with prostratin and VPA alone or in combination . VPA indThese results demonstrated that the combined treatment prostratin+VPA resulted in a more rapid and pronounced nuc-1 remodeling than the treatments with the compounds alone.In order to test the effect of prostratin+VPA treatment on transcriptional activation of the HIV-1 promoter, we first monitored the RNA polymerase II (RNAPII) abundance in the 5'LTR region. To this end, we performed ChIP assays in U1 cells after treatment with prostratin alone, VPA alone or prostratin+VPA . We usedpol gene located roughly 2.9 kb downstream of the 5'LTR; 3) vif gene located roughly 4.4 kb downstream of the 5'LTR; 4) nef gene, located roughly 8.3 kb downstream of the HIV-1 LTR. Theses primer sets allow analysis of transcriptional initiation and elongation at progressive positions throughout the HIV-1 provirus. As shown in To explore the functional relevance of this cooperative recruitment, we quantified initiated and elongated HIV-1 transcripts in U1 cells mock-treated or treated with prostratin, VPA or combination of both for different time periods . Initiated versus elongated HIV-1 transcripts were measured by quantitative real-time RT-PCR with primer sets targeting four different proviral regions: 1) TAR in the 5′ 60 bp; 2) Altogether, our results measuring the RNAPII recruitment to the HIV-1 promoter and the amount of transcripts demonstrated that the prostratin+VPA synergism took place, at least in part, at the transcriptional initiation and elongation levels and demonstrated a temporal correlation between the degree of nuc-1 remodeling and the level of HIV-1 transcription.+ T cells, CD8+ T cells having an antiviral activity Our results suggested that a combination of prostratin+HDACI could have a higher potential than the compounds alone in reactivating HIV-1 expression from cells isolated from HIV-1-infected individuals with undetectable viral load (<50 copies HIV-1 RNA/ml of plasma). To evaluate this hypothesis, we purified PBMCs from blood of 52 selected patients and depl+-depleted PBMC cultures, we detected viral RNA in the supernatant even in the absence of any treatment. Therefore, these data were removed from our study. Characteristics of the 42 remaining patients (named X1 to X42) are presented in +-depleted PBMC cultures, presenting no viral outgrowth following treatment with prostratin and HDACI(s) individually or in combination, exhibited no or very weak levels of genomic viral RNA after anti-CD2+anti-CD28 costimulation compared to the levels observed with the PBMC cultures presenting viral reactivation after drug treatments − CD4+ T cells the results we obtained in CD8+-depleted PBMCs, we purified HLA DR− CD4+ T cells from blood samples obtained from 9 HAART-treated patients selected as described in − CD4+ T cells, we tested the reactivation effect of the combined treatment prostratin+SAHA, shown here above to reactivate HIV-1 expression with higher efficiency than the combination prostratin+VPA in CD8+-depleted PBMC cultures. We demonstrated that HIV-1 replication was reactivated in 7 HLA DR− T-cell cultures out of 9 tested, with RNA viral loads ranging from 215 to 6684 copies/ml depending on the patient culture and the results obtained in several latently-infected cell lines, it seems unlikely that the results reported here would be due to random distributions of the infected cells between culture wells.In our studies, we used 6×10+-depleted PBMC cultures in the absence of added IL-2 or of allogenic stimulation. Importantly, the combination prostratin+HDACI allowed HIV-1 reactivation in a higher number of cell cultures compared to the number of positive cultures observed with the activators individually, and to a higher extent than these activators alone. Moreover, the combined treatment prostratin+SAHA efficiently reactivated viral replication in resting CD4+ T cells, which constitute the most stable HIV-1 reservoir.In conclusion, although the HIV-1 reactivation levels in response to the different treatments varied importantly from one patient to the other, the clinically used HDACIs (VPA or SAHA) alone or the non-tumor-promoting phorbol ester prostratin alone induced HIV-1 outgrowth in CD8+-depleted PBMC cultures tested (with a synergistic recovery observed in 17 out of these 25). Moreover, the combination prostratin+SAHA reactivated viral replication in 7 of the 9 HLA DR− CD4+ T cell cultures prepared from additional patients. This study suggests that this type of combinatory activation approach could be used as an inducible adjuvant therapy with efficient HAART to accelerate latent HIV-1 clearance.The HIV-1 latent reservoirs decrease only slowly in patients undergoing HAART. It is estimated that decades of treatment would be required to completely eliminate the latent virus. Ideal compounds for viral purging would induce viral replication in a wide variety of infected cell types without causing massive T-cell activation and proliferation to prevent the generation of new target cells for the neosynthetized virus, while maintaining the patient on HAART to prevent a spreading infection. In this report, we combined two different types of compounds that meet these criteria: the non-tumor-promoting NF-κB inducer prostratin and HDACIs already in use for other diseases and thus clinically promising for HIV-1 flushing strategies. We demonstrated a synergistic activation of HIV-1 production by combinations of prostratin+HDACI in the latently-infected monocytic cell line U1 and T-lymphoid J-Lat 8.4 and 15.4 cell lines. In these later cell lines, we showed that the synergistic effect was due, at least partially, to the recruitment of unresponsive cells into the expressing cell population. VPA increased prostratin-induced NF-κB activation and potentiated nuc-1 remodeling. The prostratin+VPA combined treatment caused a synergistic accumulation of initiated and elongated transcripts, as demonstrated by quantitative real-time RT-PCR. We performed viral reactivation assays in cell cultures prepared from HAART-treated HIV-1-infected individuals with undetectable viral load and showed that a combination prostratin+VPA or prostratin+SAHA induced HIV-1 recovery in 25 of the 42 CD8in vivo application has resulted in deleterious side effects Viral reactivation trials with activating agents such as IL-2 and OKT3 , have shown little, if any, reduction in viral rebound after cessation of HAART +-depleted PBMC cultures prepared from patients receiving HAART. However, our results indicated that VPA used in combination with prostratin was more efficient in reactivating HIV-1 replication than these compounds used individually. Indeed, in some cell cultures in which VPA alone did not cause any detectable HIV-1 reactivation, this HDACI potentiated prostratin-induced HIV-1 recovery. Moreover, in the 3 CD8+-depleted PBMC cultures in which VPA alone reactivated viral expression, we detected a synergistic recovery of HIV-1 RNA production after the combined treatment prostratin+VPA. Therefore, combined with other kinds of HIV-1 inducers, VPA could have an impact on the decay of latent reservoirs, despite its weak HDAC inhibitor activity. Its combined administration could be even more beneficial for long-term purging therapies than other FDA (Food and Drug Administration)-approved more potent HDAC inhibitors, such as SAHA that exhibits relative toxicities Because VPA is in wide use to treat common chronic neurological and psychiatric disorders and often given simultaneously to HAART for long periods of time to HIV-1-infected individuals, many recent studies aimed at determining VPA potential to accelerate clearance of HIV-1. Whereas two works have suggested that the VPA could be a good candidate to deplete latent infection Our FACS analyses of the J-Lat clones revealed that the proportion of J-Lat cells displaying GFP epifluorescence was synergistically increased by prostratin+HDACI cotreatments compared to treatments with the compounds alone. This implied that the synergistic effect observed following a prostratin+HDACI cotreatment on viral p24 antigen production was due, at least in part, to the recruitment of unresponsive cells into the responsive cell population. However, we cannot exclude that part of this synergistic effect also resulted from a higher level of expression from the already responding cell population. The cells containing HIV-1 promoters, that were reactivable neither by HDACI alone nor by prostratin alone but were reactivable by the combination, are likely further locked in an epigenetic silent state compared to the more easily reactivable promoters, which are responsive to a drug alone. Those J-Lat cells that remain unresponsive to the combined treatment are probably regulated by repressive epigenetic marks that cannot be reversed solely by inducing NF-κB and inhibiting HDAC activity.Among the elements involved in HIV-1 reactivation, NF-κB activity is of paramount importance. Indeed, the two NF-κB-binding sites in the enhancer are critical for LTR promoter activity and important for optimal HIV-1 replication The nucleosome nuc-1 is positioned immediately downstream of the HIV-1 transcription start and is remodeled upon transcriptional activation by Tat and the HDACIs TSA or Trapoxin in the absence of NF-κB stimulation We demonstrated a temporal correlation between the degree of nuc-1 remodeling and the level of transcription in U1 cells by showing that the prostratin+HDACI-induced increase in chromatin remodeling at 2 h postinduction was correlated with an increased RNAPII recruitment to the viral LTR at the same time point and to an increased accumulation of both initiated and elongated transcripts at 4 h postinduction. Expression of full-length HIV-1 transcripts requires the action of the cellular kinase P-TEFb, composed of a catalytic subunit, cyclin-dependent kinase 9 (Cdk9) and a regulatory subunit, cyclinT1. The absence or inactivity of this protein, while generating short viral transcripts, fails to support effective viral replication. P-TEFb mediates transcriptional elongation of the bound polymerase complexes by phosphorylating the C-terminal domain (CTD) of RNAPII. Although P-TEFb is mainly recruited via the viral transactivator Tat, other mechanisms that can ensure P-TEFb recruitment and thereby transcriptional elongation have been described and can account for signal-induced transcription elongation in Tat-defective HIV-1 infected cells, such as the U1 cell line. Notably, Sp1, p65 and histone acetylation can contribute to P-TEFb recruitment to the HIV-1 promoter +-depleted PBMC cultures tested (11 presenting synergistic activation), a combined treatment with prostratin+SAHA reactivated viral expression in 18 out of 26 CD8+-depleted PBMC cultures (13 presenting synergistic activation) and in 7 out of the 9 HLA DR− CD4+ T cell cultures we tested. Supporting our data, two very recent studies, published during the revision of the present paper, have reported that SAHA reactivates HIV-1 from latently-infected cells Our reactivation assays suggested that when combined with prostratin, SAHA could be a more potent HIV-1 reactivating agent than VPA. Indeed, whereas a prostratin+VPA cotreatment reactivated viral expression in 17 out of the 33 CD8+-depleted PBMC cultures, we did not detect any viral outgrowth following treatment with prostratin and HDACIs individually or in combination and no or very weak viral outgrowth following an anti-CD2+anti-CD28 treatment compared to the levels observed with the PBMC cultures presenting viral reactivation after drug treatments. A possible explanation to the variegated response to prostratin+HDACI treatment observed in the CD8+-depleted PBMC cultures could result from an “on-off switching” of transcriptional competence. Local chromatin structure at the site of virus integration within the host genome modulates the level of epigenetic HIV-1 transcriptional repression as well as the ability of the virus to respond to reactivating stimuli Of note, in 17 out of 42 CD8In conclusion, we report a proof-of-concept study for the therapeutic potential coadministration of two different kinds of HIV-1 activators (one acting on the NF-κB pathway and the other acting on the protein acetylation status) aimed at efficient decay of latent reservoirs in presence of HAART. However, we did not observe reactivation of viral replication in all the patient cell cultures tested, thereby emphasizing the importance to identify other combinations involving SAHA, prostratin, prostratin-like compounds with higher potency and/or other kinds HIV-1 inducers (such as inhibitors of histone- and DNA-methyltransferases). In this regard, a recent study has reported the practical synthesis in gram quantities and at low cost of prostratin, 12-deoxyphorbol-13-phenylacetate (DPP) and a variety of new 12-deoxyphorbol analogs, which might be potentially superior clinical candidates against latent HIV-1 2 atmosphere.The monocytic cell line U1 TNFα was purchased from Immunosource. SAHA (suberoylanilide hydroxamic acid) was obtained from Alexis Biochemichals. Prostratin (12-deoxyphorbol-13-acetate) , HC-Toxin ) , SBHA (suberoyl bis-hydroxamic acid) , Scriptaid -N-hydroxyhexanamide) were provided by Tebu-Bio. NaBut (sodium butyrate) , VPA , Depudecin , apicidin (cyclo[(2S)-2-amino-8-oxodecanoyl-1-methoxy-L-tryptophyl-L-isoleucyl-(2R)-2-piperidinecarbonyl]) , TSA (trichostatin A) were purchased from Sigma-Aldrich. PMA (phorbol myristate acetate) , Splitomycin , MS-275 (N-(2-Aminophenyl)-4-[N-(pyridine-3-ylmethoxycarbonyl)aminomethyl] benzamide) , Sirtinol amino]-N-(1-phenethyl)benzamide) , CBHA (m-carboxycinnamic acid bis-hydroxamide) were obtained from Calbiochem. All compounds, resuspended and stored as recommended by the manufacturer, were diluted immediately before use in cell culture medium.HIV-1 production was measured in the U1 and J-Lat 8.4 or 15.4 cell line culture supernatants by determining CA-p24 antigen concentration by an enzyme-linked immunosorbent assay (Innogenetics).Jurkat cells were transfected with the pLTR –luciferase reporter plasmids (1000 ng) ATGCAAATCACTAGAA-3′5′-TGTCGA).Nuclear extracts were prepared and EMSAs with the HIV-1 NF-κB probe were performed as previously described Cytoplasmic extracts were prepared as previously described The indirect end-labeling experiments were performed as previously described + T lymphocytes higher than 300 cells/mm3 of blood. Characteristics of patients from the St-Pierre Hospital and from the Bicêtre Hospital are presented in We selected 52 HIV-1-infected individuals at the St-Pierre Hospital and 9 additional patients at the Bicêtre Hospital on the basis of the following criteria: all volunteers were treated with HAART for at least 1 year, had an undetectable plasma HIV-1 RNA level (<50 copies/ml) for at least 1 year and had a level of CD4Ethical approval was granted by the Human Subject Ethics Committees of the Saint-Pierre Hospital and of the Bicêtre Hospital. All individuals enrolled in the study provided written informed consent for donating blood.+-depleted PBMCs were isolated from fresh whole blood (50 ml) of the HIV-1-infected individuals described above by adding RosetteSep human CD8 depletion mixture (StemCell Technologies) to whole blood samples before density centrifugation on a Ficoll-Hypaque gradient (Pharmacia). HLA DR− CD4+ T lymphocytes were isolated as previously described +-depleted PBMCs and HLA DR− CD4+ T lymphocytes) obtained after isolation varied depending on the patients. In all cases, cells were washed with RPMI, resuspended at 2×106 cells/ml of complete RPMI . As a positive control of reactivation, CD8+-depleted PBMCs were stimulated with anti-CD2+anti-CD8 antibodies used at saturating concentrations CD86 CD8+-depleted PBMCs or 2×106 HLA DR− CD4+ T cells were mock-treated or treated with different compounds. Six days after treatment, culture supernatants were tested for quantitative HIV-1 RNA levels by using the COBAS AmpliPrep/COBAS AMPLICOR HIV-1 MONITOR Test version 1.5, according to the manufacturer's instructions (Roche Diagnostics) (lowest detection limit: 50 copies HIV-1 RNA/ml of plasma).One day after isolation, 6×105′-TGGAAAATCTCTAGCAGTGGC-3′ and RV, 5′-GAGTCCTGCGTCGAGAGATCT-3′) and in the unrelated 18S rRNA DNA region were designed using the software Primer Express 2.0 (Applied Biosystems).ChIP assays were performed using the ChIP assay kit . U1 cells were cross-linked after drug treatments. To detect chromosomal flanking regions, pellets were sonicated (Bioruptor sonicator) to obtain DNA fragments of 100–400 nt. Chromatin immunoprecipitations were performed with an antibody directed against RNAPII . To test aspecific binding to the beads, a purified IgG was used as a control for immunoprecipitation . Quantitative real-time PCR reactions were performed using the MesaGreen qPCR mastermix (Eurogentec). Relative quantification using standard curve method was performed for each primer pair and 96-well Optical Reaction plates were read in an Applied Biosystems AbiPrism 7300 real-time PCR instrument (Absolute Quantification Method). Fold enrichments were calculated as percentages of input values normalized to an unrelated genomic region (18S rRNA DNA) and expressed as fold inductions relative to the values measured in mock-treated U1 cells. Primer sequences used for quantification in a region overlapping the LTR U5 region and the primer binding site region (to avoid interference with the 3'LTR region) . First strand cDNA was synthesized using SuperScript III Reverse Transcriptase (Invitrogen). Quantitative real-time PCR reactions were performed using the MesaGreen qPCR mastermix (Eurogentec). Initiated transcripts were detected with primers tar . Elongated transcripts were detected with three different sets of primers: pol , vif and nef . β-actin mRNA copies were quantified with primers β-actin specific for a 239 bp region in the β-actin mRNA. Quantitative real-time PCR reactions were performed for each primer pair and 96-well Optical Reaction plates were read in an Applied Biosystems StepOnePlus Real-Time PCR System (Comparative Ct (ΔΔCt) Quantification Method).Total RNA samples were isolated using the RNeasy Plus kit (Qiagen) from 1×103 0.1%). The percentage of GFP-positive cells was measured on a CXP cytometer using CXP Software version 1.0 according to the manufacturer's instructions.J-Lat 8.4 or 15.4 cells were mock-treated or treated for 24 h with the different compounds alone or in combination. Recoverded cells were washed twice in PBS, resuspended in PBS containing 4% paraformaldehyde and fixed for 1 h. Cells were next washed twice in PBS and resuspended in FACS buffer , benzamides (B), cyclic tetrapeptides (C), hydroxamic acids (D). At 24 h posttreatment, cellular viability was tested by measuring the mitochondrial dehydrogenase activity with the WST-1 reduction assay. The mock-treated value was arbitrarily set at a value of 100% of cellular viability. Each point is the mean from three separate experiments performed in triplicate. SE are intentionally not represented on the graph for clarity reasons.(0.19 MB TIF)Click here for additional data file.Figure S2Prostratin does not increase HDACI cytotoxicity in CD8+-depleted PBMC cultures from uninfected individuals. CD8+-depleted PBMCs were mock-treated or treated with VPA (2.5 mM), SAHA (2.5 µM), TSA (500 nM), NaBut (5 mM), MS-275 (5 µM), prostratin (5 µM) alone (A) or in combination (B). At 24 h posttreatment, cellular viability was tested by measuring the mitochondrial dehydrogenase activity with the WST-1 reduction assay. A value of 100% of cellular viability was arbitrarily assigned to the mock-treated value (A) or to the prostratin-treated value (B). Each value is the mean +/− SE from three separate experiments performed in triplicate.(0.12 MB TIF)Click here for additional data file.Figure S3Prostratin+HDACI cotreatment induces HIV-1 expression in a higher proportion of cells than the drugs alone. This figure shows as plots the same FACS results that are presented as histograms in (0.18 MB TIF)Click here for additional data file.Figure S4The prostratin+VPA cotreatment causes a more rapid and pronounced nucleosomal remodeling than the compounds alone. (A) Diagram indicating the positions of nucleosomes in the 5′ portion of the HIV-1 genome, the AflII and HinfI cutting sites and the probe used in indirect end-labeling. Bold, lower case letters are assigned to each HinfI cutting site and are located next to the bands on the gel to permit their identification. (B) Nuclei were prepared from U1 cells mock-treated or treated with TNFα (10 ng/ml) (30 min), prostratin (5 µM), VPA (2.5 mM) and prostratin+VPA for 30 min, 1 h or 2 h and digested with HinfI. After DNA purification and in vitro restriction with PstI, DNA samples were analyzed by indirect end-labeling using probe A (93). Size markers have been previously described (93).(0.69 MB TIF)Click here for additional data file.Figure S5The prostratin+VPA cotreatment does not induce levels of acetylated histone H4 higher than the levels observed after the treatments with VPA alone. Acetylated H4 levels in the nuc-1 region were assessed by ChIP experiments using U1 cells mock-treated or treated with prostratin (5 µM), VPA (2.5 mM) and prostratin+VPA for different periods of time. The proteins were cross-linked with formaldehyde for 10 min and DNA sheared. The cross-linked protein/DNA complexes were immunoprecipitated with an anti-Ac-H4 antibody. The protein/DNA cross-links were reversed and the purified DNA was amplified and quantified by real-time PCR using primers amplifying either the nuc-1 region or the vif region. Fold enrichments in the nuc-1 and vif regions were calculated as percentages of input values and expressed as fold inductions relative to the value measured with the nuc-1 primers in mock-treated U1 cells, which was arbitrarily set at a value of 1. Each value is the mean +/− SE from three separate experiments performed in duplicate.(0.11 MB TIF)Click here for additional data file.Text S1Supporting Information of (0.08 MB DOC)Click here for additional data file.Text S2Supporting Information of (0.07 MB DOC)Click here for additional data file.Text S3Supporting Information of (0.08 MB DOC)Click here for additional data file.

KIR genes, generating specialized NK cells that can specifically detect alteration of a particular class I molecule or group of molecules. The probabilistic behavior of human KIR bi-directional promoters is proposed to control the frequency of expression of these variegated genes. Analysis of a panel of donors has revealed the presence of several functionally relevant promoter polymorphisms clustered mainly in the inhibitory KIR family members, especially the KIR3DL1 alleles. We demonstrate for the first time that promoter polymorphisms affecting the strength of competing sense and antisense promoters largely explain the differential frequency of expression of KIR3DL1 allotypes on NK cells. KIR3DL1/S1 subtypes have distinct biological activity and coding region variants of the KIR3DL1/S1 gene strongly influence pathogenesis of HIV/AIDS and other human diseases. We propose that the polymorphisms shown in this study to regulate the frequency of KIR3DL1/S1 subtype expression on NK cells contribute substantially to the phenotypic variation across allotypes with respect to disease resistance.Natural killer (NK) cells play an important role in the detection and elimination of tumors and virus-infected cells by the innate immune system. Human NK cells use cell surface receptors (KIR) for class I MHC to sense alterations of class I on potential target cells. Individual NK cells only express a subset of the available KIR receptor genes in their genome, and individual NK cells express a subset of the available KIR genes, generating specialized NK cells that detect alterations in specific HLA proteins. The mechanism of this unusual selective gene activation was recently shown by our group to be controlled by a probabilistic bi-directional promoter switch that turns on a given gene at a pre-determined frequency in the NK cell population. The current study shows that the properties of the switches in terms of the relative activity of forward (on) versus reverse (off) promoter activity is directly correlated with the frequency at which a given gene is expressed within the NK cell population. These results have important implications for our understanding of the role of NK cells in viral resistance and bone marrow transplants.Natural killer (NK) cells represent a specialized blood cell that plays an important role in the detection of virus-infected or cancer cells. NK cells recognize and kill diseased cells using receptors for self antigens (HLA) that are frequently altered on aberrant cells. The HLA receptors are known as Killer cell Immunoglobulin-like Receptors, or KIR. Humans possess from four to 14 Killer cell Immunoglobulin-like Receptor family (KIR) that recognize HLA class I molecules http://www.ebi.ac.uk/ipd/kir/align.html).Natural killer (NK) cells play an important role in the detection and elimination of tumors and virus-infected cells by the innate immune system KIR genes are located on chromosome 19 in a head to tail cluster with approximately 2 kb separating the polyadenylation signal of one gene from the translation initiation codon of the next. The number of genes present in KIR haplotypes is variable, however four genes are present on virtually all haplotypes, and are thus considered as framework genes. Two major classes of KIR haplotypes have been identified. The A haplotype contains four genes in addition to the framework genes , representing a predominately inhibitory haplotype. There are many B haplotypes, containing various combinations of the activating KIR genes. The A haplotype and a representative B haplotype are shown in The KIR or Ly49 genes can be expressed by a single NK cell in a stochastic manner Individual NK cells only express a subset of the available class I MHC receptors, presumably to generate specialized NK cells that can specifically detect alteration of a particular class I molecule or group of molecules KIR and Ly49 clusters, including bi-directional promoters that are predicted to function as probabilistic switches controlling the probability of gene activation A considerable amount of information relating to the mechanisms controlling expression of the class I receptor genes has been acquired, and several general principles that apply to both the human and mouse systems have emerged. Expression is controlled by a stochastic mechanism; the probability of co-expression of two distinct inhibitory receptors is equal to the product of their individual frequencies, and NK cells appear to turn on class I MHC receptors until a self-reactive inhibitory receptor is present KIR gene family, including differences in haplotypic gene content among individuals KIR genes; however functional polymorphism within the promoter region of KIR genes has only been reported for KIR2DL5 alleles, where loss of an AML-binding site was associated with the lack of KIR2DL5 transcription KIR3DL1 promoter has been reported There is a high degree of polymorphism in the KIR3DL1 alleles have been identified, including an activating allele, KIR3DS1, making the KIR3DL1/S1 locus unique within the cluster . Numerous studies have demonstrated the effect of KIR3DL1 protein polymorphisms on the level of cell surface expression and the HLA recognition properties of the receptors KIR3DL1*028, *053), intermediate , high and null (KIR3DL1*004) A large number of KIR genes indicates that the relative strength of competing sense and antisense promoters may determine the probability of gene expression, similar to the model proposed for the control of Ly49 gene expression by the Pro1 probabilistic switch KIR3DL1 allele in heterozygous KIR3DL1/KIR3DS1 individuals and correlate the frequency of expression with specific promoter polymorphisms. The results reveal for the first time that specific KIR3DL1 promoter polymorphisms affect the frequency of expression, which has consequences in terms of NK cell function in disease resistance.The genetically-linked variability of the frequency of NK cells that express KIR3DL1 was established over 10 years ago KIR genes were chosen for a detailed analysis of allelic variation in the promoter region based on the availability of specific antibodies to study their expression: KIR3DL1 (detected by DX9 and Z27 mAbs); KIR2DS4 (detected by FES172 mAb); KIR2DL3 (detected by ECM41 mAb). Promoter polymorphisms were identified by sequencing PCR-generated clones of the core promoter region from individual donors, as well as analysis of KIR genomic sequences deposited in GenBank. KIR3DL1/S1 and KIR2DS4 genes as well as KIR2DL5 polymorphisms identified in GenBank. The most frequently observed promoter sequence is shared by the KIR3DL1*002, -*007, -*008, -*015 and -*020 alleles (shown as the reference promoter sequence), and single nucleotide polymorphisms (SNPs) are shown for other KIR3DL1 alleles as well as the KIR2DS4 and KIR2DL5 alleles. The KIR2DL1 and KIR2DL3 genes are shown as examples of KIR promoters that were not found to be polymorphic in the donor population. KIR genotyping identified 73 individuals in the NCI-Frederick donor population possessing at least one copy of the KIR2DL3 gene; however, all of the KIR2DL3 promoter sequences were identical. The KIR3DL1*004 promoter is identical to the KIR3DL1*001 promoter, but there may be no functional role for the KIR3DL1*004 allele, since the KIR protein produced by this allele is not expressed on the NK cell surface KIR3DL1/S1 alleles possess SNPs in the YY1, E2F, and Sp1 transcription factor binding sites, predicting functional differences in promoter activity of these alleles. On the other hand, the SNPs present in the KIR2DS4 alleles and the KIR2DL3 promoter are not associated with any predicted transcription factor binding sites, suggesting that the promoter alleles of these genes should have a similar level of activity.Three KIR gene activation is related to the probability of sense or antisense transcription from the proximal promoter KIR proximal promoter alleles to explain the observed differences in the percentage of NK cells that express different alleles of a given KIR gene. We previously observed that the KIR3DL1*001 and KIR3DL1*002 alleles have distinct bi-directional promoter characteristics KIR3DL1/S1 promoter alleles, DNA fragments containing the previously identified core bi-directional promoter region (−229 to −1) KIR3DL1*001, KIR3DL1*002, KIR3DL1*005, and KIR3DS1 genes were cloned into the pGL3 vector in both orientations and the forward and reverse promoter activities were determined in transfected YT-Indy human NK cells. As shown in KIR3DL1 promoter alleles are distinct. Since the ratio of forward to reverse promoter activities should determine the probability of forward transcription and gene activation, the ratio is shown for each allele in the KIR3DS1, KIR3DL1*001 and KIR3DL1*005 alleles counteracts the positive effect of the SNP in the Sp1 site. A recent report has demonstrated that this polymorphism reduces E2F binding, resulting in reduced forward promoter activity KIR3DS1 promoter was highest of the four tested, including that of the KIR3DL1*001 allele. There is an additional SNP in the YY1 site of the KIR3DS1 promoter (T→C), and the YY1 site has been shown to inhibit forward and reverse promoter activities KIR3DS1 relative to KIR3DL1*001 is likely due to a disruptive effect of the additional SNP in the YY1 site unique to the KIR3DS1 promoter.Previous studies have shown that the presence of ligand or competition from other KIR receptor-ligand pairs can influence the percentage of NK cells expressing a given KIR h allele . The KIR alleles ; howeverKIR2DL5*001 promoter indicated that disruption of the YY1 site resulted in a bidirectional element with dominant reverse promoter activity KIR2DL5*003 promoter revealed the presence of an additional polymorphism in the Sp1 site. KIR2DL5*003 to the *001 and *002 alleles. The disruption of the AML-binding site in the non-transcribed KIR2DL5*002 allele generates a promoter with weakened but balanced forward and reverse activity as previously shown for the KIR3DP1 promoter KIR2DL5*003 promoter results in a further decrease in forward promoter activity. A recent report by Estafania et al. KIR2DL5*003 suggests that it will be expressed on an even lower percentage of NK cells than the KIR2DL5*001 gene.Our previous characterization of the KIR2DS4 genes, the SNPs observed were in regions lacking known transcription factor binding sites , the transcription factor binding sites within the core bi-directional KIR promoters are conserved between individual genes and alleles. Modulation of KIR bi-directional promoter activity appears to be due to polymorphisms in the YY1 and Sp1 sites that flank the core promoter region had reduced or undetectable Sp1 binding. The Sp1 site of the KIR2DL5*003 allele bound very strongly to Sp1, consistent with the decreased forward promoter activity of this allele. These results are consistent with the proposed modulation of forward promoter activity by Sp1 binding downstream of the major forward transcription initiation site.Since the analysis of several L2 genes . As showKIR3DL1 promoter polymorphisms, the in vivo levels of antisense transcript were measured by quantitative PCR. Primers specific for KIR3DL1 or KIR3DS1 antisense transcripts were used, along with NKp46 coding region primers to control for the percentage of NK cells present in individual donor's blood. KIR3DL1 alleles that have either strong (KIR3DL1*002) or weak (KIR3DL1*001/*004) antisense promoter activity based on the transfection data shown in KIR3DL1*002). The relationship between the frequency of receptor expression and antisense transcript levels was also studied with individuals carrying two copies (KIR2DL3/KIR2DL3 genotype) revealed a clear additive effect of gene dosage on expression frequency , the predicted expression of two alleles is 2p-p2 (.36−.03) or 33%, in close agreement with the observed frequency of 35%. The effect of two copies of KIR2DS4 on expression frequency could not be determined in this study since most donors possessing only the KIR2DS4*001 allele had a KIR B haplotype on the other chromosome and would not be expected to have two copies of KIR2DS4*001. Like the gene dosage effect of KIR2DL3, KIR3DS1 expression frequency also appears to be additive based on gene copy number. We had previously shown that individuals with two copies of KIR3DS1 have a mean expression frequency of 61% KIR3DS1 allele has a mean expression frequency of 38%.The comparison of KIR2DL3 expression in individuals possessing one copy of the requency . The meaet al.et al.KIR genotype, but the mechanism was not resolved. The current study demonstrates for the first time that SNPs in transcription factor binding sites, which can occur amongst alleles of a single KIR gene, produce differences in the functional activity of the bi-directional KIR promoters that are associated with distinct frequencies of receptor expression.There are undoubtedly many factors that contribute to the generation of the KIR repertoire, including the presence of ligands and competition between inhibitory receptors. Reports by Shilling Ly49 genes, since the reverse promoter activity was similar in all Ly49 genes examined KIR transcription in developing human NK cells antagonizes the ability of sense transcripts from the upstream distal KIR promoter to open the locus, either by direct promoter competition or the production of double-stranded RNA in the KIR proximal promoter region.A correlation between forward promoter activity and frequency of gene expression was observed for the bi-directional Pro1 promoter in the murine Ly49 probabilistic promoter is controlled by competition between overlapping C/EBP and TATA elements at either end of the bi-directional element. In contrast, the core bi-directional KIR promoter is conserved, and the variation in promoter strength between genes and alleles is controlled by flanking YY1 and Sp1 sites. The A→G substitution present in the upstream YY1 site of the KIR2DL1 and KIR2DL5 promoters has previously been shown to abrogate YY1 binding KIR3DS1 gene, and this change is associated with an even higher level of forward promoter activity, but this is offset by an increased level of reverse activity as well. The frequency of KIR3DS1 expression was significantly higher than KIR3DL1*001; however, the analysis of the KIR2DS4 gene suggests that additional factors beyond the characteristics of the KIR proximal promoter may control the frequency of NK cells expressing activating receptors. Although the in vitro transcriptional activities of the KIR2DS4 promoter alleles are similar to the KIR3DL1*002 allele that is expressed on a low frequency of NK cells (∼10%), KIR2DS4 is expressed by 48% of NK cells on average. This discrepancy suggests that the KIR2DS4 and possibly KIR3DS1 subsets of NK cells undergo positive selection that increases the frequency of receptor expression in the NK pool. In this respect, it is worth noting that the mouse activating receptors Ly49D and Ly49H are co-expressed at a higher frequency than predicted by the “product rule”, suggesting that their expression is not governed by stochastic processes alone The variation in sense versus antisense promoter activity of the KIR gene expression patterns. The identification and analysis of KIR promoter polymorphisms in more diverse donor populations together with the development of additional antibodies specific for individual KIR gene products will provide a more complete picture of the degree to which promoter polymorphisms modulate KIR expression frequency. Nevertheless, the information provided in this report is immediately applicable to studies of KIR locus variation on human disease and may explain some of the previous associations in this regard KIR allele/gene. KIR3DL1 allotypes that are expressed at a high level on the NK cell surface KIR3DL1*001 and KIR3DS1, which show high levels of expression frequency are both protective against HIV-1, and KIR3DS1 also shows protection against hepatitis C virus The current study provides the groundwork for further investigation of the role of promoter polymorphisms in http://www.ncifcrf.gov/rdp/). The KIR genotype of each donor was determined as previously described Healthy volunteers were recruited through the NCI-Frederick Research Donor Program used in this study were: PE-conjugated anti-CD158a/h ; anti-CD158b1/b2/j ; anti-CD158e1/e2 ; anti-CD158e1 ; anti-CD158i ; FITC-conjugated anti-CD3 ; APC or PC5-conjugated anti-CD56 ; PE-Alexa Fluor 700-conjugated anti-CD3 . The anti-CD158b2 −CD56+ lymphocytes. KIR3DS1 expression on NK cells was investigated by using DX9 and ZIN276 (Z27) mAbs as previously described The proportion of NK cells expressing a particular KIR receptor was assessed in whole blood by three- or four-color flow cytometry. Briefly, 100 µl of EDTA-treated blood was incubated with the appropriate cocktail of mAbs. Erythrocytes were lysed with an ammonium chloride solution and the remaining cells were analyzed with a FACSort flow cytometer . Events were collected in the lymphocyte gate and analyzed. NK cells were defined as CD3SacI/XhoI or XhoI/HindIII and cloned into pGL3 to generate constructs in both forward and reverse orientations. All constructs were verified by sequencing with specific primers. Sequence analysis was performed with the SeqWeb package at the NCI- Frederick supercomputing center.Promoter fragments were generated by PCR using a gene-specific forward primer starting at −229 and a reverse primer starting at −1 relative to the start codon of the gene. PCR products were cloned into the TOPO-TA vector , and inserts were excised with either 6 cells in 0.5 ml of serum free RPMI medium were transfected with 10 µg of the specific reporter construct plus 0.1 µg of the Renilla luciferase pRL-SV40 vector. Luciferase activity was assayed at 48 hr using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer's instructions. The luciferase activity of the KIR3DL1 promoter constructs was normalized relative to the activity of the Renilla luciferase produced by the pRL-SV40 control vector and each construct was tested in at least three independent experiments.YT-Indy cells were transfected by electroporation with a BTX ECM 830 set at 250 mV, with 3 pulses of 7 ms at an interval of 100 ms. A total of 5×1018 or KIR3DL1/S1-specific- TGGTTTATT(A)GTCACAATTG-3′ RT primers with the Transcriptor First Strand cDNA Synthesis Kit . Taqman real time RT-PCR primers and probes for target genes were: KIR3DL1 antisense transcript Fwd- ATTGTCACAATTGCTCTGAAAACC -3′; Rev- CATGGCTTCCTGGAAATTGCT -3′ and probe: 5′(FAM)-CATGTTAGCACAGATTTTAGGCATCTCGTG -(MGB)3′. NKp46 Fwd- GGCTGTGTCTGAGTCAGAG -3′; Rev- GAGTTCATGTCCGGGATGTAG -3′ and probe 5′(VIC)- CATCTGGGCCGAGCCCCATTTCATG -(MGB)3′. The PCR reactions were performed in 20 µl final volume containing 30 ng of cDNA, 1×Master Mix , 500 nM of each primer and 100 nM of each probe, respectively. The thermal cycling conditions were 40 cycles of PCR amplification . All assays were performed on the same plate in triplicate. Triplicate Ct values were analyzed using the comparative Ct (ΔΔCt) method as described by the manufacturer . The relative amount of KIR3DL1 antisense transcript (2−ΔΔCt) was obtained by normalization to NKp46 and relative to the level of YT-Indy.Total cellular RNA was isolated from peripheral blood mononuclear cells with the RNAqueous-4PCR Kit , and further purified using DNase I according to the manufacturer's instructions. cDNA synthesis was carried out at 55°C using Oligo(dT)trans-epoxysuccinyl-l-leucylamido [4-guanidinobutane], 130 pM bestatin, 1 µM leupeptin, and 0.3 pM aprotinin; Sigma-Aldrich). Eight double-stranded DNA oligonucleotide probes corresponding to the predicted Sp1-binding sequence of the KIR promoter alleles were synthesized by fill-in using the Klenow fragment of DNA polymerase I . Radio-labeled double-stranded oligonucleotides were purified using mini Quick Spin Oligo Columns . DNA-protein binding reactions were performed in a 10 µl mixture containing 10 µg of nuclear protein and 1 µg of poly(dI-dC)poly(dI-dC) (Sigma-Aldrich) in 4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl, 10 mM Tris-HCl (pH 7.5). After a 10-min incubation on ice, samples were incubated with 1 µl 32P-labeled oligonucleotide probe at room temperature for 20 min, and then loaded on a 5% polyacrylamide gel (37∶5∶1). Electrophoresis was performed in 0.5×TBE buffer for 2 hours at 130 V and the gel was visualized by autoradiography after 2 days exposure at −70°C. For antibody supershift experiments, nuclear extracts were incubated with 2 µl of anti-Sp1 antibody for 1 h on ice prior to the addition of 32P- labeled DNA probe. After addition of labeled DNA-probe, the binding reaction was incubated for additional 20 min at room temperature. The human Sp1 recombinant protein was used as control. For competition analyses, unlabeled-competitor probe (Sp1 consensus) and AP2 probes were included in the binding reaction.Nuclear extracts were prepared from YT-Indy cells using the CellLytic NuCLEAR extraction kit . Protein concentration was measured with a Bio-Rad protein assay and samples were stored at −70°C until use. All buffers contained a protease inhibitor cocktail (2 mM 4-(2-aminoethyl) benzenesulfonylfluoride, 1.4 pM U test. The correlations between the level of KIR3DL1 antisense transcript and the frequency of NK cells expressing a given allele were assessed by Spearman's correlation coefficient. All p values reported were two-tailed, with significance defined as p<0.05.Statistical analysis of allele expression frequencies was performed using GraphPad Prism software. Comparison of distributions was performed using a Mann-Whitney

To determine the prevalence of ischemic heart disease and the associated risk factors among the urban population of Siliguri.A cross-sectional survey of a random sample of the population aged ≥40 years old in the Municipal Corporation area of Siliguri. Study variables were age, sex, occupation, addiction, food habit, physical activity, body mass index, blood pressure, and electrocardiogram change.Out of 250 individuals who took part in this study, 29 (11.6%) had ischemic heart disease (IHD) and 118 (47.2%) had hypertension. Males had a higher (13.5%) prevalence of IHD than females (9.4%). About 5% of the patients had asymptomatic IHD. IHD among the study population is significantly associated with hypertension and smoking. Cardiovascular disease, one of the non-communicable diseases, has become a major public health problem in many developing countries. About two-thirds of the global estimated 14.3 million annual cardiovascular disease deaths occur in the developing world. By the year 2015, cardiovascular diseases could be the most important cause of mortality in India. The prevalence of coronary artery disease in India increased from 1% in 1960 to 9.7% in 1995 in urban populations, and in rural populations it has almost doubled in the last decade. of Siliguri was conducted. The sampThere are 47 wards in the Siliguri Municipal Corporation area. Ward number 23 (Dabgram) and 47 (Pati colony) were selected from the 47 wards of Siliguri. The total population of two selected wards was 14,568. From the updated voter list of this ward, all the members who were permanent residents aged ≥ 40 years old were selected. By using the systematic random sampling method, a list of 271 members aged ≥ 40 years old was prepared with names and addresses. They were given a pre-tested, semi-structured questionnaire (the Rose questionnaire from the cardiovascular survey methods of WHO-1982). were also calculated. Hypertension was diagnosed when the systolic blood pressure was 140 mmHg or more and the diastolic blood pressure was 90 mmHg or more, as per the guidelines of the British Hypertension Society. a history of angina or infarction and previously diagnosed disease, (b) an affirmative response to the Rose questionnaire, and (c) electrocardiographic findings, namely Minnesota codes 1-1, 4-1, 5-9, 5-2 or 9-2. The presQuantitative data was entered into EPIINFO software, Version 3.2 and then exported to SPSS software, Version 10.0 for analysis. Data was analyzed and tabulated using frequency distribution tables and proportion. Association between the prevalence of IHD and risk factors were examined using the Chi-square test. EPIINFO software, Version 3.2 was used to calculate Chi-square for the linear trend of change in IHD. Binary logistic regression analysis was done between the predictor variable and dichotomous outcomes (ischemic heart disease or not).P<0.01). The highest prevalence of IHD was found in the ≥ 80 years old group (40.0%) and the lowest prevalence was found in the 40–49 year old group (5.4%). The prevalence of symptomatic IHD was 6.4% and that of asymptomatic IHD was 5.2% [P>0.05).Of the 271 individuals age ≥40 years old enrolled in the study, 250 took part in the study. The mean age of the study population was 52.8 years old (+ 12.6). The mean age of males was 54 years old and the mean age of females was 51.5 years old. Among 250 study subjects, 29 (11.6%) had IHD. The prevalence of IHD significantly increased with an increase in age was higher than Grade 1 (14.4%). Grade 3 hypertension was 6%, Grade 1 isolated systolic hypertension was 5.6%, and Grade 2 isolated systolic hypertension was 2.8% .P<0.01) [P<0.01). The highest prevalence of IHD was found among the severe hypertensive population (26.7%) and the lowest prevalence was found in those patients with normal blood pressure (3.3%). The prevalence of IHD increased with higher BMI (P<0.05). The prevalence was 25% among patients with BMI ≥ 30 and 6.8% among patients with BMI 18.5-23.5.The prevalence of IHD among smokers was higher than among non-smokers (P<0.01) . PrevaleBinary logistic regression analysis shows that 88% of IHD can be explained by predictor variables. Diastolic blood pressure, systolic blood pressure, and smoking habits were significantly associated with IHD, whereas no significant relation was found between age, sex, physical activity, body mass index, or diet habit .This study shows that the prevalence of coronary artery disease was 11.6% in the urban populations, which is lower than the Trivandrum study 13.9%) and the Tirupati study (12.63%). Lower prevalence was reported in Chennai (11%).18 Sex-sp5% and theIn the Jaipur study, a 3.2% prevalence of symptomatic CAD (known coronary artery disease plus Rose-positive angina) was similar to the Delhi survey (3.2%) but higher prevalence (6.4%) was noted in the present study. The SeveThe findings of this study indicate that the prevalence of coronary artery disease and coronary risk factors is high in this urban population in India. Further research is required to document the impact of increased physical activity, change in dietary habit to more quantities of fruits and vegetables and reduced use of poly unsaturated fatty acid, no smoking, and controlling blood pressure and cholesterol as is recommended in the third joint task force guidelines of European and other societies on cardiovascular disease prevention in clinical practice.

MN/CA9 is a cancer-related gene, frequently activated in human renal cell carcinomas (RCCs). To reveal the activation mechanism, we investigated the relationship between methylation status of the MN/CA9 promoter region and gene expression using 13 human RCCs, and examined the effect of in vitro CpG methylation on the MN/CA9 promoter activity using a human RCC cell line (SK-RC-44), expressing MN/CA9. MN/CA9 expression was evaluated by RT-PCR and observed in 10 of 13 RCCs (77%). A total of 9 out of 10 MN/CA9-positive RCCs (90%) contained clear cell components. Methylation status of 6 CpGs in the MN/CA9 promoter region was decided by using the bisulfite genomic sequencing protocol. Out of 13 RCCs 9 (69%) showed partial hypomethylation of the CpG at −74 bp, while the other 4 RCCs and 3 normal kidney tissue samples showed complete methylation. Hypomethylation of the CpG at −74 bp was strongly correlated with MN/CA9 expression. Luciferase assay revealed that the MN/CA9 promoter activity was strongly suppressed by methylation of the CpG at −74 bp. These findings suggest that hypomethylation of the CpG at −74 bp in the MN/CA9 promoter region might play an important role in this gene activation of human RCC. © 2001 Cancer Research Campaign http://www.bjcancer.com

Pseudomonas aeruginosa, a ubiquitous Gram-negative bacterium and opportunistic human pathogen, the GacS/GacA two-component system positively controls the transcription of two sRNAs , which are crucial for the expression of genes involved in virulence. In the biocontrol bacterium Pseudomonas fluorescens CHA0, three GacA-controlled sRNAs regulate the response to oxidative stress and the expression of extracellular products including biocontrol factors. RsmX, RsmY and RsmZ contain multiple unpaired GGA motifs and control the expression of target mRNAs at the translational level, by sequestration of translational repressor proteins of the RsmA family.Small RNAs (sRNAs) are widespread among bacteria and have diverse regulatory roles. Most of these sRNAs have been discovered by a combination of computational and experimental methods. In P. aeruginosa. Eight of these regions encode newly identified sRNAs. The intergenic region 1698 was found to specify a novel GacA-controlled sRNA termed RgsA. GacA regulation appeared to be indirect. In P. fluorescens CHA0, an RgsA homolog was also expressed under positive GacA control. This 120-nt sRNA contained a single GGA motif and, unlike RsmX, RsmY and RsmZ, was unable to derepress translation of the hcnA gene (involved in the biosynthesis of the biocontrol factor hydrogen cyanide), but contributed to the bacterium's resistance to hydrogen peroxide. In both P. aeruginosa and P. fluorescens the stress sigma factor RpoS was essential for RgsA expression.A combined computational and experimental approach enabled us to identify 14 intergenic regions encoding sRNAs in Pseudomonas species highlights the complexity of this global regulatory system and suggests that the mode of action of GacA control may be more elaborate than previously suspected. Our results also confirm that several GGA motifs are required in an sRNA for sequestration of the RsmA protein.The discovery of an additional sRNA expressed under GacA control in two Escherichia coli, either fortuitously due to their abundance or by the observation of phenotypes conferred by their overexpression. Some abundant and stable sRNAs were found early in gel electrophoretic analysis. They include 4.5 S RNA, which is implicated in protein export; a component of RNase P, which participates in tRNA processing; and tmRNA, which has an important role in translational quality control [E. coli. Computational searches mainly focused on intergenic regions (IgRs) and were combined with predictions of promoters and of rho-independent transcription terminators [Bacillus subtilis [In bacteria, > 150 non-coding small RNAs (sRNAs) have been described [ control . The majminators ,4. The Qsubtilis .E. coli, the iron-containing superoxide dismutase SodB is regulated by iron availability via the sRNA RyhB, which base-pairs with sodB mRNA. This interaction blocks ribosome access and favors nucleolytic degradation of the mRNA [regulator of secondary metabolism) and CsrA (carbon storage regulator) can act as translational repressors; sRNAs having high affinity for these proteins are therefore able to relieve translational repression by sequestering them [Most bacterial sRNAs studied have regulatory roles in gene expression, occurring in many instances at a post-transcriptional level. In one type of post-transcriptional regulation, which is usually governed by the RNA chaperone Hfq in Gram-negative bacteria, sRNAs interact with specific mRNA targets, thereby modifying the accessibility of the Shine-Dalgarno sequence to the translational machinery and often altering the stability of the mRNA. For instance, in the mRNA . A seconing them .P. fluorescens, the sRNAs RsmX, RsmY and RsmZ were detected by their binding capacity to the regulatory protein RsmA [gacA mutation [E. coli) activates the transcription of these three sRNAs. When they are present in high concentrations, they titrate the RNA-binding proteins RsmA and its homolog RsmE, resulting in enhanced translational expression of genes involved in biocontrol of plant root diseases and in resistance to oxidative stress [P. aeruginosa, the Gac/Rsm system involves two sRNAs, RsmY and RsmZ [rhlI gene, which codes for the enzyme synthesizing the quorum sensing signal N-butanoyl-homoserine lactone [P. aeruginosa led to the discovery of two iron-regulated sRNAs, PrrF1 and PrrF2 [In pseudomonads, few sRNAs have been studied. In ein RsmA ,10, by tein RsmA , or by mmutation . The Gace stress ,14. Bioce stress . In P. aand RsmZ . As part lactone ,18. Furtnd PrrF2 . More rend PrrF2 .Pseudomonas spp., by applying the QRNA method to IgRs of various Pseudomonas spp., combined with a prediction of rho-independent terminators and, where appropriate, putative promoters. Eight sRNAs were newly identified in P. aeruginosa by Northern blotting experiments. By comparing sRNA expression in the wild-type with that in a gacA mutant, we discovered a novel GacA-controlled sRNA termed RgsA. We analyzed its regulation and involvement in biocontrol factor expression and oxidative stress response in P. fluorescens CHA0. Moreover, we show that RgsA expression in P. aeruginosa and P. fluorescens strictly depends on the stress sigma factor RpoS.We have begun to search for new GacA-regulated sRNAs in P. aeruginosa PAO1 on the criterion that sRNA genes should be located in IgRs that are larger than 50 bp. A total of 3168 IgRs fulfilled this condition. We then assumed that functional sRNA sequences should be conserved in closely related species [P. aeruginosa in the genomic sequences of five related pseudomonads . Only those PAO1 IgRs were selected that shared more than 65% sequence identity with a genomic sequence of at least one other pseudomonad. The alignments resulting from the BLAST program were then subjected to QRNA analysis [P. aeruginosa PAO1 genome annotations, sequences whose coding probabilities calculated by QRNA were found to be high were nevertheless retained for further analysis. By applying QRNA in this way, 162 out of the initial 3168 IgRs from P. aeruginosa PAO1 were retained were preferentially chosen for Northern blot analysis. Cultures of P. aeruginosa PAO1 were grown in nutrient yeast broth (NYB) to exponential or stationary phase and total RNA was extracted. Northern blot analysis was carried out with digoxigenin (DIG)-labeled probes, each covering an entire IgR. Among 49 IgRs thus analyzed, 14 were reproducibly found to express sRNAs (Table ffs gene in IgR 888) [rnpB in IgR 2510) [P. aeruginosa (encoded by prrF1 and prrF2 in IgR 2667) [P. aeruginosa sRNAs described by Livny et al. [IgRs occurring in IgR 888) ,25, an RgR 2510) , and PrrgR 2667) . They wey et al. . In thatribC and ribD genes, is a homolog of sroG, a transcript resulting from the cleavage of a riboswitch element found upstream of ribB in E. coli [P. aeruginosa sroG homolog was slightly longer than the sroG transcript in E. coli (147 nt) [P. aeruginosa may be involved in regulation of riboflavin biosynthesis, by analogy with the homologous element in E. coli [E. coli RNA , except for 1559 sRNA, which was not tested in these alternative media. Six regions produced more than one transcript . The 231 E. coli ,29. In fP. aeruginosa gacA mutant PAO6281 by Northern blotting. The 1698 sRNA was the only transcript that showed a significantly decreased expression in the gacA mutant, compared with that in the wild-type PAO1 (data not shown). This 120-nt transcript was further characterized. It was virtually absent from strain PAO1 during the exponential phase, but was produced abundantly in the stationary phase. In the gacA mutant, the expression of the 1698 sRNA was about two-fold lower than in the wild-type .The expression of the 11 sRNAs shown in Figure e Figure , suggeste Figure . We therP. fluorescens CHA0 is conserved in all Pseudomonas strains sequenced to date. In E. coli, the tatD product exhibits Mg-dependent DNase activity, but is not required for protein transport by the Tat pathway, contrary to what was originally expected [The genomic context of the expected .rgsA regulation by GacA during growth, we constructed rgsAPAO1-lacZ and rgsACHA0-lacZ transcriptional fusions in plasmids pME7235 and pME7234, respectively. The primers used for these constructions . In conclusion, transcription of the rgsA gene is probably activated indirectly by GacA and directly by RpoS, which is assumed to bind to the -10 promoter element , no significant difference was observed, compared with the native context (CHA207 containing the empty vector pME6032). Similarly, the rgsACHA0 overexpressing plasmid pME7236 was unable to elevate hcnA'-'lacZ expression in the rsmXYZ triple mutant (CHA1145/pME7236), which was indistinguishable from the strain carrying the vector alone (CHA1145/pME6032) was found in an unpaired region of the RgsA sRNA of strain CHA0 Figure . The Gacorescens . We therpression . We meast Figure . When rg) Figure . In a co5 Figure . In concproteins .P. fluorescens to stress imposed by hydrogen peroxide [rgsA deletion mutant of strain CHA0 and tested its survival after a 30-min exposure to 40 mM H2O2 in NYB with shaking. This experiment was carried out three times with triplicate cultures. Only 69 ± 16% of the mutant cells survived, compared with 94 ± 12% surviving wild type cells. Thus, survival was significantly (P < 0.05) higher in the wild type than in the mutant. Overexpression of rgsA afforded no significant effect. These results suggest that RgsA may contribute to oxidative stress response.The Gac/Rsm cascade modulates the response of peroxide . We consP. aeruginosa and other Pseudomonas spp. The identification of four of these sRNAs can be considered as a validation of the method, as they are either widespread in bacteria or have been previously described in P. aeruginosa [et al. [et al. [et al. [et al. [P. fluorescens Pf0-1 and P. fluorescens Pf-5, and by considering only the most widely conserved candidates we also demanded a higher level of conservation than did Livny et al. [The screening procedure adopted in our study enabled us to find evidence for 15 sRNAs in , PrrF2) . Three a [et al. , and the [et al. , we obta [et al. had used [et al. were noty et al. .P. aeruginosa [RsmY and RsmZ, the RsmA-binding sRNAs previously described in ruginosa ,34, wereruginosa ), just bP. aeruginosa PAO1 and P. fluorescens CHA0 the Gac/Rsm cascade regulates the expression of exoproducts such as HCN. In these organisms, a double rsmY rsmZ and triple rsmX rsmY rsmZ mutant, respectively, have the same exoproduct phenotype as gacA mutants [rpoS expression and, consequently, of the response to oxidative stress [gacA mutants, by comparison with the wild-type strains and its derivatives PAO1-rpoS [gacA::Ω-Sm/Sp) [P. fluorescens CHA0 [gacA::Kmr) [hcnA'-'lacZ) [rpoS) [rsmXYZ, hcnA'-'lacZ) [rgsA, this study). E. coli DH5α [-1 or tetracycline at 25 μg ml-1 (100 μg ml-1 for pseudomonads) were added. For some RNA extractions, strains were also grown in GGP medium [E. coli and P. aeruginosa and 30°C for P. fluorescens. Survival of stationary phase P. fluorescens was assayed in NYB following H2O2 stress as described previously [We used AO1-rpoS and PAO6Ω-Sm/Sp) , P. fluoens CHA0 , CHA89 (cA::Kmr) , CHA207 '-'lacZ) , CHA815 '-'lacZ) and CHA1oli DH5α served fP medium or in MMP medium . To monieviously . StatistDNA manipulations were carried out according to standard procedures . PlasmidlacZ fusion to the rgsA gene from P. fluorescens CHA0, a 510-bp fragment containing the rgsA sRNA promoter was amplified from chromosomal DNA by PCR using primers 1698Fus1 (EcoRI) and 1698Fus2 (BamHI) listed in Additional file R, Stratagene). After sequencing, the fragment was cloned into the shuttle vector pME6016 [rgsACHA0 promoter controlling the expression of the lacZ gene. Similarly, we constructed pME7235 carrying a transcriptional lacZ fusion to the rgsA gene from P. aeruginosa PAO1 using primers 1698Fus3 (EcoRI) and 1698Fus4 (BamHI) and 1698Sur2 (HindIII) .To overexpress rgsA gene in the P. fluorescens CHA0 chromosome was made as follows. A 860-bp fragment containing the upstream region and the rgsA promoter was amplified by PCR with primers 1698DelE (EcoRI) and 1698Del3 (NcoI) and 1698DelX (XbaI) was introduced into CHA0, giving CHA1181.A deletion of the on; Tcr; ). E. col1/pME497 . In thisP. aeruginosa PAO1 genome having a length exceeding 50 bp. The corresponding 3168 sequences were listed in FASTA format and compared by BLASTn to the genome sequences of P. putida KT2440 [P. syringae pv. tomato DC3000 [P. fluorescens SBW25 [P. fluorescens Pf0-1) [P. fluorescens Pf-5 [Pseudomonas strain, were given as input data into the program QRNA [Our screening was limited to the IgRs of the a KT2440 , P. syrio DC3000 , P. fluons SBW25 , P. fluos Pf0-1) , and P. 70) binding sites (TTGACAN(17)TATAAT), RpoN (σ54) binding sites (TGGCACN(5)TTGCW, where W is A or T, based on Barrios et al. [38)-binding sites (TGN(0–2)CCATACT, according to Lacour et al. [P. aeruginosa PAO1 sequencing project site [FUZZNUC, a free access nucleic acid pattern search program , was uses et al. ) or for r et al. ). We user et al. for multr et al. to ident), RpoN σ binding et al. [2, pH 7.5), before mixing with lysis buffer . DIG-labelled probes were obtained as follows: PCR fragments were synthesized with P. aeruginosa or P. fluorescens genomic DNA as the template and pairs of primers listed in the Additional file +, GE-Amersham) and revealed by hybridization with the DIG-labeled probes described above and exposure to a light-sensitive film . 5S rRNA served as loading control. For this purpose, a 5S-rDNA probe was synthesized with primers 5S-rRNA-1 and 5S-rRNA-2 was added to the cultures to avoid cell aggregation. Samples were taken during various growth phases and permeabilized with 5% toluene. β-Galactosidase activities were then measured according to the Miller method [r method .BLAST, Basic Local Alignment Search Tool; CTAB, cetyl-trimethyl-ammonium bromide; DEPC, di-ethyl-pyrocarbonate; DIG, digoxigenin; EDTA, ethylene-di-amine-tetraacetic acid; GGP, iron-limited medium; HCN, hydrogen cyanide; IgR, intergenic region; MME, minimal medium E; NYB, nutrient yeast broth; SRNA, small RNA; URS, upstream regulating sequence; Xgal, 5-bromo-4-chloro-3-indolyl-β-D-galactoside;NG designed and carried out experiments, and drafted manuscript; SH and TJ executed the bioinformatics search; CV, EK and CR performed Northern blots; DH directed research and wrote the manuscript.Intergenic regions. List of IgRs of Pseudomonas aeruginosa PAO1 giving a positive result in QRNA analysis.Click here for filePredicted coordinates of three sRNA genes. Figure showing the predicted coordinates of sRNA genes in IgRs 645, 1887 and 2315.Click here for filePrimers. Primers used in this study for Northern blots and recombinant DNA work.Click here for file

In the crystal structure of the title compound, intra- and inter­molecular hydrogen bonding is found.The degradation of atorvastatin calcium in methanol and hydrogen peroxide results in the crystallization of the title compound, C For related literature, see: Cremer & Pople 1975; Rouleau26H24FNO6 CM r = 465.46 Monoclinic, a = 11.7560 (6) Å b = 11.7489 (6) Å c = 17.0889 (9) Å β = 94.438 (2)°V = 2353.2 (2) Å3 Z = 4 Kα radiation radiationMo −1 μ = 0.10 mmT = 296 (2) K 0.25 × 0.18 × 0.15 mm Bruker Kappa APEXII CCD diffractometerSADABS; Bruker, 2005T min = 0.975, T max = 0.980Absorption correction: multi-scan (14754 measured reflections5340 independent reflectionsI > 2σ(I)3008 reflections with R int = 0.040 R[F 2 > 2σ(F 2)] = 0.049 wR(F 2) = 0.136 S = 1.02 5340 reflections318 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.34 e Å−3 Δρmin = −0.28 e Å−3 Δρ APEX2 (Bruker, 2007APEX2; data reduction: SAINT (Bruker, 2007SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 for Windows (Farrugia, 1997PLATON (Spek, 2003WinGX (Farrugia, 1999PLATON.Data collection: 10.1107/S1600536808022265/nc2108sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808022265/nc2108Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The nitrate ions are linked to the dications though N—H⋯O hydrogen bonds, forming a three-dimensional network.In the title compound, C Å b = 9.6212 (8) Å c = 7.1070 (6) Å β = 115.506 (6)°V = 1003.14 (14) Å3 Z = 4 Kα radiationCu −1 μ = 1.22 mmT = 100 K 0.53 × 0.50 × 0.24 mm Bruker APEX CCD area-detector diffractometerSADABS; Sheldrick, 2007T min = 0.562, T max = 0.761Absorption correction: multi-scan (5278 measured reflections942 independent reflectionsI > 2σ(I)882 reflections with R int = 0.036 R[F 2 > 2σ(F 2)] = 0.033 wR(F 2) = 0.092 S = 1.01 942 reflections84 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.26 e Å−3 Δρmin = −0.20 e Å−3 Δρ SMART used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL.Data collection: 10.1107/S1600536809039166/ci2920sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809039166/ci2920Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Glioblastoma multiforme is the most common and most malignant of astrocytic brain tumors, and is associated with rapid invasion into neighboring tissue. In other tumor types it is well established that such invasion involves a complex interaction between tumor cells and locally produced extracellular matrix. In GBMs, surprisingly little is known about the associated matrix components, in particular the fibrillar proteins such as collagens that are known to play a key role in the invasion of other tumor types.In this study we have used both the Masson's trichrome staining and a high resolution multiple immunofluorescence labeling method to demonstrate that intratumoral fibrillar collagens are an integral part of the extracellular matrix in a subset of GBMs. Correlated with this collagen deposition we observed high level expression of the collagen-binding receptor Endo180 (CD280) in the tumor cells. Further, interrogation of multiple expression array datasets identified Endo180 as one of the most highly upregulated transcripts in grade IV GBMs compared to grade III gliomas. Using promoter analysis studies we show that this increased expression is, in part, mediated via TGF-β signaling. Functionally, we demonstrate that Endo180 serves as the major collagen internalization receptor in GBM cell lines and provide the first evidence that this activity is critical for the invasion of GBM cells through fibrillar collagen matrices.This study demonstrates, for the first time, that fibrillar collagens are extensively deposited in GBMs and that the collagen internalization receptor Endo180 is both highly expressed in these tumors and that it serves to mediate the invasion of tumor cells through collagen-containing matrices. Together these data provide important insights into the mechanism of GBM invasion and identify Endo180 as a potential target to limit matrix turnover by glioma cells and thereby restrict tumor progression. High-grade gliomas are the most common brain tumors in adults, and are characterized by their treatment-refractory nature and poor clinical outcome. They are classified into four grades as defined by the World Health Organization The normal brain ECM has a unique composition consisting mainly of hyaluronan, proteoglycans and tenascin-C and, apart from the basement membrane of the normal brain vasculature, is devoid of rigid protein barriers formed by fibrillar matrix proteins in vivo experiments have demonstrated that Endo180 binds collagens and functions to internalize them for delivery to, and degradation in, the lysosomes In silico analyses of independent gene expression datasets in ONCOMINE™ MRC2) transcripts were significantly upregulated in grade IV gliomas, i.e. GBMs, versus grade III gliomas (th most highly upregulated gene in GBMs versus grade III gliomas (p = 5.56×10−5) . To corrin silico transcript analysis, there was a significantly higher proportion of Endo180 positive cases in grade IV GBM compared to the grade III lesions anaplastic astrocytoma or anaplastic oligodendroglioma .Next we examined a series of 79 grade III and IV glioma cases collected in a tissue microarray (TMA). We observed Endo180 expression in 62/79 (78.5%) samples. In agreement with the Recently, Phillips and colleagues have described three prognostic subclasses of high-grade glioma: proneural, proliferative and mesenchymal MRC2) at 17q23 was detected in 11 glioma cell lines p = 0.0022) Several mechanisms could account for the increased expression of Endo180 in GBMs. We excluded genetic and epigenetic regulation as no genomic amplification of the Endo180 locus ( 0.0022) . This inTumors need to remodel the ECM to physically expand and liberate latent growth factors COL1A1 and COL1A2 genes, respectively. qPCR analysis of a panel of glioma cell lines with variable Endo180 expression demonstrated substantial expression of both COL1A1 and COL1A2 transcripts in a subset of these cell lines as compared to the minor levels detected in normal brain expression in GBM lines was comparable to that in normal human fibroblasts, which are known to produce high levels of collagen 1 and Endo180 protein. Third, the high-grade glioma samples arrayed in the TMA . Finally, to confirm that the tumor-associated collagen detected by Masson's trichrome staining truly represented the deposition of fibrillar collagens, consecutive formalin-fixed paraffin-embedded (FFPE) glioma whole tissue sections were subject to Masson's trichrome staining and triple immunofluorescent labeling with antibodies against collagen I, collagen IV, Endo180 and GFAP (p = 0.0099) . Second, 0.0467) . Using a 0.0099) .The current study shows that Endo180 expression is negligible in the normal brain but highly upregulated in GBMs as revealed by expression array analysis and immunohistochemical staining of patient material. Endo180 is a well-characterized collagen internalization receptor and its extensive expression in GBMs required us to evaluate the collagen content in these tumors. Normal brain ECM is largely devoid of collagens, although some collagen IV can be detected in vascular basement membranes in silico analysis of expression array data confirmed high expression of both TGF-β1 and TGF-β2 and its receptor TGF-β-RI in GBMs (High-grade gliomas (grade III and IV) have been classified into three subclasses on basis of their expression profiles: pro-neural, proliferative and mesenchymal in GBMs . Interes in GBMs , providiin vivo requires that there is a balance between the requirement for a substrate to migrate on and the requirement for a space to migrate through. This study demonstrates, for the first time, that expression of Endo180 on the tumor cells is required for productive invasion into 3D collagen matrices with full clinicopathological data. The age of the patients ranged from 28–80 years . All cas2A, Alexa555 goat-anti-mouse IgG1, and Alexa633 goat-anti-rat IgG (Invitrogen), HRP-conjugated goat-anti-mouse IgG (Jackson Immunoresearch), HRP-conjugated goat-anti-rabbit IgG (Santa Cruz) and APC-conjugated rat anti-mouse IgG1 (BD Biosciences). Human fibroblasts were purchased from the European Collection of Cell Cultures (ECACC). All cell lines were maintained in DMEM with 10% FBS and 2.4 mM L-glutamine. For growth factor stimulation, cells were transferred into low serum medium (DMEM with 1% FBS) for 24 h before treatment for 24 or 72 h with 5 ng/ml recombinant human TGF-β1 (R&D systems), 50 ng/ml PDGF-BB (R&D Systems), or 50 ng/ml EGF (Invitrogen) in DMEM with 1% FBS.Anti-Endo180 mAbs A5/158 and 39.10 directed against the extracellular domain of Endo180 have been previously described and characterized For immunohistochemistry, 3 µm FFPE sections were dewaxed in xylene, rehydrated through a series of graded alcohols to water and subjected to high-temperature antigen retrieval in 0.01 M pH 6.0 citrate target retrieval buffer (Dako). Slides were allowed to cool for 20 min at room temperature and then incubated with anti-Endo180 mAb 39.10 (20 µg/ml) or 1∶1000 anti-GFAP for 1 h at room temperature. Detection was achieved with the Vectastain avidin-biotin complex (ABC) system according to the manufacturer's protocol . Slides were rehydrated through a series of alcohols, cleared in xylene and mounted in 1,3-diethyl-8-phenylxanthine. Adjacent sections were stained with haematoxylin and eosin (H&E) or by the Masson's trichrome technique to visualize collagen fibers. Images were captured on a Leica DMRA2 microscope fitted with a Leica DFC320 camera.A TMA consisting of 79 WHO grade III and IV gliomas was stained with the anti-Endo180 mAb 39.10 and the Masson's trichrome technique. Endo180 positivity was recorded for cores with widespread moderate to strong immunoreactivity, with samples containing only occasional weak staining tumor cells regarded as negative. Cores were considered positive for intratumoral collagen deposition where specific blue/green staining was observed within the tumor mass by the Masson's trichrome, and distinct from staining of the vascular basement membrane.The protocol for the staining of FFPE material for confocal microscopy is described elsewhere 4 cells per well in a 96-well plate overnight. The following day, the media was replaced with fresh media containing hexadimethrine bromide (8 µg/ml) (Sigma) and Mission lentiviral particles (Sigma) TRCN0000029674 (Endo180 shRNA) or TRCN0000068276 (control shRNA) added at a multiplicity of infection (MOI) of 10. Cells were incubated for 12 h before replacing the media with fresh DMEM plus 10% FBS. 36 h later, the medium was replaced with DMEM plus 10% FBS and puromycin (3 µg/ml) and cultured for a further 14 days. Cell populations were then cultured without puromycin.The Endo180 targeting and Endo180 reversed siRNA oligonucleotides, and the protocol for cell transfection has been previously described 5′-AAAAGCTTCCCCGAGCGCGGCGCTCAGT-3′ and for the four forward primers were: hEndo180F-1498bp: 5′-AAAGATCTAGCATTTCTGACCCAACACC-3′, hEndo180F-1146bp: 5′-TCTCAACGTCTCAGTCCTGC-3′, hEndo180F-649bp: 5′-GAGGTAGGGGATGCTAGGCT-3′, hEndo180F-390bp: 5′- GGGAGAGACTGGGAAACAGA-3′. The PCR products were cloned into the luciferase reporter vector, pGL3-basic (Promega) and verified by DNA sequencing. The −140bp/0bp Endo180 promoter fragment was generated by digestion of the pGL3 −1498bp/0bp vector with MscI and SmaI and self-ligating the digested vector. Smad binding elements in −1146bp/0bp Endo180 promoter fragment were mutated using the Quickchange II XL kit (Stratagene) and primers: mutSBE1F 5′-GTAACACTGAGTAACTGTGGATTAACTAACCTTTTATGAAATTTC-3′, mutSBE1R 5′-GAAATTTCATAAAAGGTTAGTTAATCCACAGTTACTCAGTGTTAC-3′, mutSBE2F 5′-GAGTGATGATGCCGAACTTCTGGGACGTCCAG-3′, mutSBE2R 5′-CTGGACGTCCCAGAAGTTCGGCATCATCACTC-3′. The pGL3 CAGA12-Luciferase reporter plasmid has been described previously 2HPO4/NaH2PO4, 1 mM MgCl2, 100 mM 2-mercaptoethanol and 0.67 mg/ml O-nitrophenyl-galactopyranoside. Where indicated, cells were treated with the SMAD3 inhibitor, SIS3 Promoter fragments were generated by PCR with a reverse primer that started at −1 position of the ATG of Endo180 and four different forward primers located at different positions in the Endo180 promoter, generating products of 1498bp, 1145bp, 649bp and 390bp respectively. The sequence for reverse primer hEndo180R-0 bp was 1 for 30 min followed by an APC-conjugated rat anti-mouse IgG1 antibody for 30 min. Cells were washed twice and FACS analyzed in the presence of propidium iodide.Cells were transfected with control or Endo180 siRNA oligonucleotides for 24 h and then treated with or without 5 ng/ml TGF-β1 for 72 h. Cells were then incubated with 20 µg/ml OG-collagen IV (Invitrogen) for 2 h in DMEM plus 1% FBS at 37°C before being harvested using trypsin/EDTA for 5 min at 37°C. Cells were stained on ice with anti-Endo180 mAb A5/158 or mouse IgG4 cells were plated, in the same medium, onto 6.5 mm Transwell inserts that had been pre-coated with 50 µg/ml collagen I . The lower well contained DMEM plus 10% FBS. After 24 h, invaded cells on the underside of the filter were methanol fixed and stained with 1% toluidine blue/1% borax solution. The membrane was excised and three photos were taken of each insert at 10× magnification. Cells were counted using the ImageJ software.For Transwell migration assays, siRNA transfected cells cultured for 24 h in DMEM with 1% FBS were trypsinized and 5×105 glioma cells were plated into 24 well plates containing a 1 ml gel comprising a 1∶1 mix of rat tail collagen type 1 and Matrigel and incubated overnight at 37°C. The following day, the cultures were raised to an air-liquid interface and fed from the underside every two days with DMEM plus 10% FBS and 50 ng/ml EGF (Invitrogen) for 11 days. At the end of the assay, gels were fixed in 4% paraformaldehyde before being formalin-fixed and embedded in paraffin wax. 3 µm sections were taken from the centre of each gel and immunostained with anti-vimentin antibody to detect the glioma cells. Images were analyzed using ImageJ software to count the number of invaded particles containing ≥1 cell (N), the total area invaded (A), and the depth of invasion (D). The invasion index is calculated as N×A×D Collagen gel invasion assays were performed as previously MRC2 probe sets using the Mann-Whitney U test.A profile search for glioblastoma was performed on the ONCOMINE™ database Table S1(0.08 MB PDF)Click here for additional data file.Table S2(0.05 MB PDF)Click here for additional data file.Figure S15′-ATTTTAGTAGTTTAGGAGGAAGTGG-3′. MRC2U-R 5′-TAATTAAAAAACCATCCTAACACA-3′. MRC2M-F 5′-GGATTTTAGTAGTTTAGGAGGAAGC-3′. MRC2M-R 5′-AATAATTAAAAAACCGTCCTAACG-3′. In 18 out of 19 cell lines and in normal brain no promoter methylation was detected. Cell line UW479 showed a methylated promoter status that corresponded with an absence of Endo180 gene transcript as tested by qPCR (see Endo180 promoter methylation. Methylation of Endo180 in intronic region +375bp/+579bp was monitored using a methylation-sensitive PCR (MSP). Briefly, 1 µg of genomic DNA from normal brain and 19 glioma cell lines was subjected to sodium bisulphite conversion using EZ DNA Methylation Kit (Zymo Research) after which MSP was performed in a reaction volume of 20 µl for 40 cycles. Amplification products were resolved on 1.5% agarose gels and visualized under UV illumination to compare unmethylated (U) and methylated (M) amplifications. The following Endo180 primers were used: MRC2U-F qPCR see .(0.29 MB TIF)Click here for additional data file.

Insect odorant binding proteins (OBPs) and chemosensory proteins (CSPs) play an important role in chemical communication of insects. Gene discovery of these proteins is a time-consuming task. In recent years, expressed sequence tags (ESTs) of many insect species have accumulated, thus providing a useful resource for gene discovery.We have developed a computational pipeline to identify OBP and CSP genes from insect ESTs. In total, 752,841 insect ESTs were examined from 54 species covering eight Orders of Insecta. From these ESTs, 142 OBPs and 177 CSPs were identified, of which 117 OBPs and 129 CSPs are new. The complete open reading frames (ORFs) of 88 OBPs and 123 CSPs were obtained by electronic elongation. We randomly chose 26 OBPs from eight species of insects, and 21 CSPs from four species for RT-PCR validation. Twenty two OBPs and 16 CSPs were confirmed by RT-PCR, proving the efficiency and reliability of the algorithm. Together with all family members obtained from the NCBI (OBPs) or the UniProtKB (CSPs), 850 OBPs and 237 CSPs were analyzed for their structural characteristics and evolutionary relationship.A large number of new OBPs and CSPs were found, providing the basis for deeper understanding of these proteins. In addition, the conserved motif and evolutionary analysis provide some new insights into the evolution of insect OBPs and CSPs. Motif pattern fine-tune the functions of OBPs and CSPs, leading to the minor difference in binding sex pheromone or plant volatiles in different insect Orders. Insects are highly successful terrestrial animals that have complicated communication systems. Insect odorant binding proteins (OBPs) play an important role in insect chemical communication. Until recently, it was believed that pheromones and other odors entering the aqueous lumen of chemosensilla, were transported by OBPs to transmembrane odorant receptors (ORs) ,2 and fiDrosophila melanogaster and a new subfamily of OBPs [Apis mellifera has only 21 OBP genes[Aedes aegypti and 11 additional sequences in Anopheles gambiae by developing a specific algorithm [Drosophila genomes, Vieira et al. identified 595 OBP genes and found that purifying selection governs the evolution of the OBP family [Numerous efforts have been made to obtain the sequences of insect OBPs ,12-20 an of OBPs ; MaleszkOBP genes; Zhou etlgorithm . By compP family . In 2006P family . Gong etP family . HoweverP family . RecentlP family .Here, we develop a computational pipeline to identify OBP and CSP genes from insect ESTs of 54 species across eight Orders including Blattaria, Coleoptera, Diptera, Hemiptera, Hymenoptera, Lepidoptera, Orthoptera and Phthiraptera. In total, 117 new OBPs and 129 new CSPs were found, of which 38 genes from eight species were experimentally validated by RT-PCR. In addition, the conserved cysteines patterns, motif patterns and phylogenetic relationship of known OBPs and CSPs were analyzed.We collected 752,841 insect ESTs from the dbEST and consDiabrotica virgifera and 10 in Nasonia giraulti. Fifteen CSPs were predicted in Solenopsis invicta, of which 14 are not reported before, and 10 new CSPs genes were found in Gryllus bimaculatus. However, fewer than five OBPs or CSPs were identified in most species. We plotted the number of identified OBPs or CSPs against the total number of ESTs in each species and could not find any clear relationship (data not shown).In some insects, more than 10 OBPs or CSPs were identified. For example, 29 new OBPs were predicted in The presence of conserved cysteines is a typical feature of OBPs and CSPs. We therefore analyzed the cysteines patterns (C-patterns) of OBPs and CSPs in different Orders Table . GeneralThe conserved motifs are important elements of functional domains. We used the MEME server to discover conserved motifs in OBPs and CSPs. The fulSince a high number of OBP genes have been reported in species of Lepidoptera, we carried out a motif-pattern analysis of GOBPs and PBPs to compare the differences between these two subfamilies. The GOBPs and PBPs were combined into one set of sequences and then submitted to MEME server. Although both GOBPs and PBPs have the same eight motifs, the motif-patterns were quite different Figure . The sevWhen the GOBP sequences of both lepidopteran and dipteran were combined into a set of sequences for motif analysis, we also found that the motif patterns were different between lepidopteran and dipteran GOBPs Figure . Of the The neighbor-joining trees were inferred by MEGA4.0 using the p-distance amino acid model after 1000 bootstrap replicates . In the Most predicted OBPs or CSPs of full length were assembled from several ESTs. To validate the reliability of the computational pipeline, we randomly chose 26 OBPs from eight species and 22 CSPs from four species for RT-PCR validation. To cover a sequence that was as long as possible, the primers were designed at both ends of the transcripts assembled by the CAP3 software. As a result, 22 OBPs and 16 CSPs were successfully amplified by RT-PCR. The PCR results were confirmed by sequencing Figure . Most vaWith only a few insect genomes sequenced, expressed sequence tags (EST) are a good resource for new gene discovery and expression profile analysis. As the cost of sequencing rapidly deceases, an abundance of insect ESTs has become available particularly in recent years, providing an opportunity to discover new OBPs and related genes at large-scale level. In this study, more than 100 new OBPs and CSPs were found from insect ESTs, suggesting that this approach is effective.Although more than 10 OBP or CSP genes were found in some insects, less than five OBPs were identified in most species. Generally, there is no correlation between the number of identified genes and that of ESTs. Though some OBPs and CSPs are ubiquitous or expressed in non-sensory organs, both these two classes of proteins are believed to be abundant in the antennae and other chemosensory organs. Therefore, a high number of ESTs are not enough for finding many OBPs or CSPs if the ESTs were not from the chemosensory organs.In agreement with previous reports, C-patteB. mori can also bind sex pheromone component (bombykol) [As most known PBP and GOBP genes have been identified in the Lepidoptera, we conducted a MEME motif analysis to compare the difference between these two subfamilies of OBP genes. Interestingly, all PBPs have an identical MEME motif pattern as 6-1-2-8-3-4-5-7, though they are more divergent than GOBPs at the protein-sequence level. GOBPs show four different motif patterns, with the most common one being 7-6-1-2-8-3-4-5. To the best of our knowledge, this is the first report of motif difference between GOBP and PBP subfamilies. This difference in the motif pattern might imply a functional difference between PBPs and GOBPs. Meanwhile, it also provides a hint that GOBP genes might have broad functions. Generally, PBPs bind and transport sex pheromones, while GOBPs are involved in sensing plant volatiles. Recent report by Zhou et al. proves that BmorGOBP2 in ombykol) . Althougombykol) . Thus, iIn addition, we found that the C-patterns are similar, whereas the motif patterns are different among diverse Orders. We reasoned that C-pattern is the key structure of OBPs and CSPs, which should be highly conserved. But motif pattern fine-tune the functions of OBPs and CSPs, leading to the minor difference in binding sex pheromone or plant volatiles in different insect Orders.In conclusion, our results indicate that the computational pipeline we used in this study is efficient and reliable in identifying new OBP and CSP genes with insect EST resources. The large number of the newly found OBPs and CSPs in our study provides the basis for functional studies of these proteins. In addition, analysis of protein sequences showed that there is generally no major difference in C-patterns of OBPs or CSPs between different insect Orders, whereas conserved motif patterns are quite different between insect Orders and between the GOBPs and PBPs in Lepidoptera. Together with the evolutionary analysis, the results provide some new insights into the differentiation and evolution of insect OBPs and CSPs.Aphis gossypii), peach aphid (Myzus persicae), brown plant hopper (Nilaparvata lugens) and pea aphid (Acyrthosiphon pisum) were collected from the campus of Nanjing Agricultural University. The Asiatic migratory locust (Locusta migratoria) was bought from an insect rearing factory in Shandong province, China. The American cockroach (Periplaneta americana) was provided by Professor Zhi-Kuan Jiang . The red fire ant (Solenopsis invicta) was collected in Guangdong province with assistance of Professor Wen-Qing Zhang (Sun Yat-Sen University). The two-spotted cricket (Gryllus bimaculatus) was collected in Tianjin City, China.The cotton aphid (http://www.ncbi.nlm.nih.gov/dbEST/ in March 2008. Sequences of known insect OBPs were obtained by searching the GenBank with the keywords "odorant-binding protein AND insecta NOT chemosensory protein NOT (Haemolymph juvenile hormone binding protein OR JHBP)". In total, 837 OBP sequences were downloaded, which covered all reported insect OBPs except for those from Drosophila species. At present, the genome sequences of 12 Drosophila species are available, of which hundreds of OBPs were identified. Because OBP genes share high similarities between different Drosophila species, only OBPs from Drosophila melanogaster were considered for analysis. Finally, 795 OBP sequences remained for further analysis after removing identical sequences. The non-redundant protein sequences (nr) were downloaded from the FTP server of NCBI. In total, 290 CSP sequences were retrieved from the UniProtKB [Insect ESTs were downloaded from the dbEST of NCBI niProtKB ,41.The computational pipeline is shown in Figure Accession numbers of all OBP or CSP sequences used for C-Patten analysis, motif analysis and phylogenetic analysis are listed in the Additional File The protein sequences of OBPs and CSPs were aligned using ClustalX for OBPs and 100 aa for CSPs were regarded as intact ORFs. All OBP and CSP sequences with intact ORF were used for motif discovery and pattern analysis. Parameters used for motif discovery were: minimum width = 6, maximum = 10, maximum number of motif to find = 8. Motif analysis was conducted by using MEME or four cysteines (for CSP) were used in phylogenetic analysis. In total, 114 OBP and 224 CSP sequences were used. The protein sequences were aligned by ClustalX (version 1.83) with default gap-penalty parameters. The evolutionary trees were constructed based on consensus sequence by the MEGA4.0 program ® Total RNA Kit II (Omega) following the manufacturer's instructions. The cDNA template was synthesized with Oligo(dT)18 primer as anchor primers, using M-MLV reverse transcriptase at 37°C for 50 min. The reactions were stopped by heating at 70°C for 15 min. Alternatively, we used AMV reverse transcriptase (Takara) at 42°C for 60 min, and stopped the reactions by cooling on ice for 5 min.The whole bodies of cotton aphids, peach aphids and pea aphids were used for RNA extraction, whereas only the heads with antennae of brown plant hoppers and red fire ants were collected. For the American cockroach, Asiatic migratory locust and two-spotted cricket, the antennae were dissected and used for RNA extraction. The collected tissues were fast-frozen in liquid nitrogen and kept at -70°C until further use. Total RNA was extracted by homogenizing antennae or other tissues in Trizol™ reagent or E.Z.N.A.2, 0.5 mM dNTP, 0.4 μM for each primer and 1.25 U Taq polymerase or EX-Taq polymerase (Takara). PCR products were analyzed by electrophoresis on 1.5% w/v agarose gel in TAE buffer and the resulting bands were visualized with ethidium bromide. DNA purification was performed using the AxyPrep™ PCR Cleanup Kit (Axygen). Purified products were sub-cloned into a T/A plasmid using the pGEM-T easy vector system (Promega) following manufacturer's instructions. The plasmid DNA was used to transform into competent DH5a or Top10 cells. Positive clones were checked by restriction enzyme cleavage sites and PCR. Plasmid extraction was performed by E.Z.N.A.™ Plasmid Mini kit (Omega). The PCR products were sequenced by Bioasia .Gene specific primers across ORF of predicted OBP and CSP genes were designed using "Primer Premier 5.0" for RT-PCR validation. The sequences of these primers are listed in Additional File XY and ZL carried out the informatics works, and participated in manuscript writing; HP carried out the molecular biology experiments and participated in manuscript writing; FS helped in carrying out the informatics work; DS, ZY and LF conceived and designed the study; DS and LF are responsible for manuscript writing. All authors read and approved the final manuscript.An Excel file with the name of "AF1-detail information of predicted OBP and CSP". Items in blue were previously reported and those in black were newly identified by present study. The OBP or CSP names that suffixed with same first number in the first column of the table were from a same sequence, therefore, the total items of OBP and CSP in this file are more than the numbers listed in Table Click here for fileA Text file named by "AF2- nucleotide sequence of identified OBP".Click here for fileA Text file named by "AF3-protein sequence of identified OBP".Click here for fileA Text file named by "AF4- nucleotide sequence of identified CSP".Click here for fileA Text file named by "AF5- protein sequence of identified CSP".Click here for fileAn Excel file named by "AF6-accession numbers of OBP and CSP used for analysis". It shows the names and accession numbers of the proteins used in Figure Click here for fileA Doc file named by "AF7-primers of OBPs and CSPs for RT-PCR validation".Click here for fileA Doc file named by "AF8-evolutionary trees showing the bootstrap values".Click here for file

The two carboxyl groups of isophthalic acid inter­act with neighbouring 4,4′-dipyridyl disulfide mol­ecules through O—H⋯N hydrogen bonds, forming a one-dimensional zigzag chain. Neighbouring chains are linked to each other via π–π stacking inter­actions between the pyridyl rings of adjacent 4,4′-dipyridyl disulfide mol­ecules [centroid-centroid distance = 3.7346 (6) Å], resulting in a layered motif. The dihedral angle between pyridine rings of 84.13 (7)° and the C—S—S—C torsion angle of 91.95 (1)° confirm the gauche conformation of 4,4′-dipyridyl disulfide.In the title 1:1 cocrystal, C Å b = 10.024 (2) Å c = 29.797 (6) Å β = 93.71 (3)°V = 1776.9 (6) Å3 Z = 4 Kα radiationMo −1 μ = 0.33 mmT = 295 K 0.29 × 0.20 × 0.11 mm Rigaku R-AXIS RAPID diffractometerABSCOR; Higashi, 1995T min = 0.920, T max = 0.964Absorption correction: multi-scan (16923 measured reflections4039 independent reflectionsI > 2σ(I)2330 reflections with R int = 0.048 R[F 2 > 2σ(F 2)] = 0.043 wR(F 2) = 0.135 S = 1.08 4039 reflections235 parametersH-atom parameters constrainedmax = 0.30 e Å−3 Δρmin = −0.41 e Å−3 Δρ RAPID-AUTO (Rigaku, 1998RAPID-AUTO; data reduction: CrystalStructure (Rigaku/MSC, 2004SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXL97.Data collection: 10.1107/S1600536809013397/pv2150sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809013397/pv2150Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Oil massage of newborns has been practised for generations in the Indian sub-continent; however, oils may vary from potentially beneficial, e.g. sunflower seed oil, to potentially toxic, e.g. mustard oil. The study was carried out to gain insights into oil-massage practices and acceptability of skin barrier-enhancing emollients in young, preterm Bangladeshi neonates. Preterm infants of <33 weeks gestational age were randomized to high-linoleate sunflower seed oil, Aquaphor Original Emollient Ointment™, or the comparison group . A survey was administered at admission to assess routine skin-care practices prior to admission and at discharge to assess acceptability of emollient therapy during hospitalization. Oil massage was given to 83 (21%) of 405 babies before hospital admission, 86% (71/83) of whom were delivered at home. Application of oil, most commonly mustard oil , was started within one hour of birth in 51 cases (61%) and was applied all over the body one to six (mean 2.2) times before admission. Of infants who received emollient therapy in the hospital, 42% (n=32) of mothers reported that the emollient applied in the hospital was better than that available at home, and only 29% would use the same oil (i.e. mustard oil) in the future as used previously at home. No problems resulted from use of emollient in the hospital. Topical therapy with sunflower seed oil or Aquaphor was perceived by many families to be superior to mustard oil. If caregivers and health professionals can be motivated to use inexpensive, available emollients, such as sunflower seed oil that are beneficial, emollient therapy could have substantial public-health benefit. Oil massage of newborns has been practised routinely for generations throughout the Indian sub-continent and Mediterranean region –7. TradiWhile performing a study to evaluate the effect of topical treatment with skin barrier-enhancing emollients on prevention of nosocomial infections in preterm infants , we alsoThis prospective study was conducted in the Special Care Nursery at Dhaka Shishu (Children) Hospital in a cohort of preterm neonates admitted during December 1998-July 2003. The study was part of the trial of the impact of topical emollient therapy on incidence of nosocomial infections reported previously . NewbornTM) to the entire body surface, except the scalp and face, of infants assigned to the intervention groups three times daily for the first 14 days and then two times daily until discharge. Infants in the control group received the standard skin care for the Special Care Nursery, which did not include any massage or use of topical emollients.A study nurse randomly assigned eligible infants to an intervention group—high-linoleate sunflower seed oil or Aquaphor Original Emollient Ointment™ composed of petrolatum, mineral oil, mineral wax, and lanolin alcohol—or the comparison group . The nurses applied emollient was employed for recording data and validation of dual entries. The SPSS software (version 12.0 for Windows) was used for analysis of data. Results were verified by conducting standard tests for significance (p<0.05), including unpaired Student's t-test and chi-square test, as appropriate.In total, 497 patients were enrolled in the emollient trial, and 405 completed the baseline survey on oil-massage practices prior to admission; 281 died, 64 left the hospital against medical advice, and 31 were lost to follow-up for this study. Thus, 121 families participated in the follow-up study of emollient acceptability. Families who completed the skin-care questionnaire were similar in characteristics to the larger group enrolled in the emollient trial and were balanced across treatment groups (data not shown).Oil massage was given to 83 (20.5%) of the 405 babies before hospital admission; 71 (85.5%) of 83 babies who were treated with emollient were delivered at home, while 77% of those surveyed were delivered in a hospital or clinic. Of those who received an oil massage, the most commonly-used product was mustard oil, which was applied to 73 (88%) of the 83 babies massaged; other products mentioned were coconut oil in eight (9.6%) cases, and olive oil and proprietary baby lotion in one each. Oil used was pure, except in one case in which garlic was added to mustard oil. Application of oil started from just after birth, and in 51 (61.4%) cases, it was applied within one hour of birth; the mean age at application was 4.4 (SD 8.1) hours. Oil was applied one to six times before admission to the hospital, all over the body in 74 (89.2%) of the 83 babies. Eight babies were fed mustard oil, ranging from one to five mL; one baby was fed oil three times, and the others were fed oil just once before admission.Oil was applied for various reasons, principally to keep the baby warm , prevent infections , and improve the condition of the skin or the overall health of the baby . No-one complained of any problem relating to the oil applied. The practice of oil massage was significantly more common among births at home and when the mother was uneducated .TM, n=44; comparison group, n=44). Thirty-two (41.6%) mothers replied that the emollient applied in the hospital was better than what they would have used at home, 10 (13.0%) indicated that they would not have used oil massage at home, and one (1.3%) thought that there was no difference between the oil used in the hospital and the oil they would use at home; 34 (44.1%) did not know.Emollient was applied in 77 of the 121 babies followed up of the 121 mothers indicated that they did not know what they would do, 28.9% would use the same oil as they had used previously at home, and 15.7% definitely would not use the same oil as used at home in the past. The mothers reported no problems with the use of emollient during hospital stay, including no rashes; no relation to vomiting, fever, cough and cold, or any illness; it did not weaken the baby; did not cause the baby to slip from the hands during care; and did not make it more difficult to keep the baby clean.Oil massage is routinely practised in Bangladesh. Results of a previous study among families with children presenting for care at our institution indicated that more than 96% of caregivers had practised oil massage, irrespective of socioeconomic status, place of residence, and whether the infant had been term or preterm . In this

A total of 474 subjects who were free of liver cancer and cirrhosis and were initially selected as controls for previous case–control studies of aflatoxin-induced hepatocarcinogenesis in Taiwan, were employed in this study. Aflatoxin-albumin adducts were determined by competitive enzyme-linked immunosorbent assay, hepatitis B surface antigen and antibodies to hepatitis C virus by enzyme immunoassay, as well as genotypes of glutathione S-transferase M1-1 and T1-1 by polymerase chain reaction. The detection rate of AFB1-albumin adducts was significantly higher in males (42.5%) than in females (21.6%) . The formation of detectable albumin adducts was moderately higher in hepatitis B surface antigen carriers (42.8%) than in non-carriers (36.6%) . In addition, the detection rate of AFB1-albumin adducts tended to increase with the increasing number of null genotypes of glutathione S-transferase M1-1 and glutathione S-transferase T1-1. In conclusion, this cross-sectional study has assessed the relative contributions of environmental exposure and host susceptibility factors in the formation of AFB1-albumin adducts in a well characterised Chinese adult population. This study further emphasises the necessity to reduce aflatoxin exposure in people living in an area endemic for chronic hepatitis B virus infection.Dietary exposure to aflatoxins is one of the major risk factors for hepatocellular carcinoma. Individual susceptibility to aflatoxin-induced hepatocarcinogenesis may be modulated by both genetic and environmental factors affecting metabolism. A cross-sectional study was performed to evaluate determinants of the formation of aflatoxin covalently bound to albumin 87, 966–970. doi:10.1038/sj.bjc.6600584www.bjcancer.comCancer Research UK© 2002 Although chronic infection with hepatitis B virus (HBV) is now regarded as the major cause of HCC in high-incidence areas , or AFP (20 ng ml−1), or a family history of HCC or liver cirrhosis among first degree relatives was referred for the second-stage screening by upper abdominal ultrasonography. The abdominal ultrasonography was performed by board-certified gastroenterologists who were well experienced in ultrasonographic examinations using Toshiba SAL-38B and SSA-240A ultrasonographic apparatus with 3.75 MHZ real-time linear and sector probes .From July 1990 through June 1992, a community-based two-stage liver cancer screening programme was carried out in seven townships in Taiwan. The cohort characteristics and methods of screening and follow-up have been described previously when assaying the equivalent of 200 μg albumin per well was 0.01 fmol μg-1. Samples were assayed by duplicate analysis in duplicate wells. Samples with <20% inhibition were considered non-detectable. Two control samples were analysed with each batch of sera, a pooled sample of plasma from non-smoking US subjects and a positive control of serum from a rat treated with 1.5 mg AFB1.An enzyme-linked immunosorbent assay was used to determine the level of AFBGSTM1-1 genotyping for gene deletion was performed by PCR amplification with primers for exons 6 and 7, which produced a 210 bp band, according to the method of GSTT1-1 genotype was determined using the technique of 1-albumin adducts and various variables. In addition, months of year for blood sample collection were grouped into four seasons in order to evaluate seasonal variations in the detectable levels of AFB1-albumin adducts. All analyses were performed with SAS software and all P values for tests of statistical significance were based on two-tailed probability.Because it was not considered appropriate to assign a value to the undetectable serum level of AFB1-albumin adducts, the adducts level was analysed as a binary rather than continuous variable. Odds ratios (OR) and their 95% confidence intervals (CI), which were derived from logistic regression models, were used to indicate the magnitude of the associations between formation of AFB1-albumin adducts with these demographic characteristics are described in Table 11-albumin adducts among study townships (ranging from 33.3 to 47.5%), seasonality of sample collection (ranging from 36.8 to 43.0%) and age groups (ranging from 26.9 to 40.6%). In contrast, males had significantly higher detection rate of AFB1-albumin adducts than females (42.5 vs 21.6%) with an odds ratio (OR) of 2.7 (95% CI=1.5–5.0).The demographic data concerning the study subjects and the relationship of the positivity of AFB1-albumin adducts in relation to multiple HCC risk factors are summarised in Table 21-albumin adducts were detectable in 42.8% (86 of 201) of HBsAg carriers and 36.6% (100 of 273) of HBsAg non-carriers. The difference in the detection rate was moderately significant between the two groups . This detection rate was higher in study subjects who smoked cigarettes (43.8%) than in those who never smoked cigarettes (35.1%), with a moderately significant OR of 1.4 (95% CI=1.0–2.1). In addition, there were also moderately significant differences in the adduct detection rate depending on GSTM1-1 and GSTT1-1 genotypes; the detection rate was higher in individuals with either GSTM1-1 null (43.0%) or GSTT1-1 null (44.2%) genotype than in those with GSTM1-1 (36.4%) or GSTT1-1 (35.9%) present. The OR of detectable AFB1-albumin adducts associated with GSTM1-1 or GSTT1-1 null genotype was 1.3 (95% CI=1.0–1.9) and 1.4 (95% CI=1.0–2.0), respectively. On the other hand, the detection rate was lower in anti-HCV-positive subjects (30.6%) than negative subjects (41.6%) . There was again a slightly lower detection rate in individuals who consumed alcohol (36.2%) than in those who never drank alcohol (39.9%).Results with regard to the detection rate of AFBGSTM1-1 and GSTT1-1 genotypes on the detectable adduct levels was then analysed and stratified by HBsAg status. In this case the positivity of AFB1-albumin adducts tended to increase with increasing number of the null genotype of GSTM1-1 and GSTT1-1 in both the HBsAg carrier and non-carrier groups, albeit the trend was statistically non-significant . Whereas, no significant association with detectable AFB1-albumin adduct levels was observed for age, anti-HCV positive status, habits of cigarette smoking and alcohol intake, and the null genotype of GSTM1-1 and GSTT1-1.Results of logistic regression analysis of multiple factors associated with the positivity of AFB1 is one of the major risk factors in the multifactorial etiology of HCC . In particular, HBsAg-positive males have 50% higher frequency of detectable adducts than their HBsAg-negative counterpart . The possible association between chronic HBV infection and the increased activation of AFB1 has been examined in epidemiological studies. Two studies of young Gambian children have reported higher AFB1-albumin adduct levels in HBsAg carriers than in non-carriers and GST-θ (GSTT1-1), are important candidates for involvement in susceptibility to aflatoxin-related liver cancer because they may regulate an individual's ability to metabolize the ultimate carcinogen of aflatoxins, the exo-epoxide (1-albumin adducts tended to increase as the number of null genotypes of GSTM1-1 and GSTT1-1 increased. This biological gradient was observed in both HBsAg carriers and non-carriers, albeit the trend was statistically non-significant.Accumulating evidence indicates that genetic polymorphisms in AFB1 macromolecular adducts in humans is still limited. In this study, we have assessed the relative contributions of environmental determinants and host susceptibility factors in the formation of aflatoxin–albumin adducts in a well characterised Chinese adult population. The result of present study suggests that gender and HBsAg carrier status are major determinants of the formation of aflatoxin covalently bound to albumin. This study further emphasises the necessity to reduce aflatoxin exposure in people living in an area endemic for chronic HBV infection.In essence, our knowledge base about determinants of formation of AFB

P = 2.43×10−8 for rs7775228 and 6.73×10−8 for rs10947262). Our results suggest that immunologic mechanism is implicated in the etiology of OA.Osteoarthritis (OA) is a common disease that has a definite genetic component. Only a few OA susceptibility genes that have definite functional evidence and replication of association have been reported, however. Through a genome-wide association study and a replication using a total of ∼4,800 Japanese subjects, we identified two single nucleotide polymorphisms (SNPs) (rs7775228 and rs10947262) associated with susceptibility to knee OA. The two SNPs were in a region containing HLA class II/III genes and their association reached genome-wide significance (combined As the WHO initiative shows, bone and joint diseases are serious problems all over the world, putting us under severe medical, economical and social burden. Osteoarthritis is one of the most common diseases among them. OA affects synovial joints of all over the body, mainly knee, hip, hand and spine. OA is characterized by progressive loss of articular cartilage and, often, proliferation of synovium and bone, which lead to pain, loss of joint function and disability. More than tens of millions patients in the world are suffering from this non-lethal, but intractable disease, and the number is relentlessly increasing; however, its etiological picture remains unclear and we have no fundamental treatment for it.We are living in the “Bone and Joint Decade” . Finally, 459,393 SNPs on autosomal chromosomes passed the QC filters and were further analyzed. Among the SNPs analyzed in the GWAS, we selected top 15 SNPs showing the smallest P values (P<1×10−5) for the replication study using an independent 514 Japanese subjects from a resident cohort. SNPs with minor allele frequency of ≤0.1 in both case and control samples were excluded from the further analysis. In the replication analysis, we genotyped SNPs using the multiplex PCR-based invader assay (Third Wave Technologies) or by direct sequencing of PCR products using ABI 3700 DNA analyzers (Applied Biosystems), or by SNaPshot Multiplex System (Applied Biosystems) according to manufacturers' protocols.For the GWAS, we genotyped 906 patients with OA and 3,396 controls using Illumina HumanHap550v3 Genotyping BeadChip. After excluding seven cases with call rate of <0.98, we applied SNP QC . Age, gender- and BMI-adjusted odds ratios were obtained by logistic regression analysis In the GWAS and replication analyses, we applied Fisher's exact test to two-by-two contingency table in three genetic models: an allele frequency model, a dominant-effect model, and a recessive-effect model. We conducted the meta-analysis using the Mantel-Haenszel method. We examined heterogeneity among studies by using the Breslow-Day test. Significance levels after the Bonferroni correction for multiple testing were For general statistical analysis, we used R statistical environment version 2.6.1 or Microsoft Excel. Drawing the LD map, estimation of haplotype frequencies and analysis of haplotype association were performed by Haploview software.P values (minimum P<1×10−5) were next genotyped in an independent set of 167 Japanese knee OA individuals and 347 Japanese controls from a resident cohort study. Through these studies, only two SNPs, rs7775228 and rs10947262 were significant even after the Bonferroni correction for multiple testing (P = 1.09×10−7) . The twoHLA-DQB1 . AlthougHLA-DQB1 , and SNPApplication of the Cochrane-Armitage test to all the tested SNPs indicated that the genetic inflation factor lambda was 1.08 for GWAS , implyinP = 5.10×10−9).To check the association of rs7775228 and rs10947262 in different ethnic populations, we examined the association of the SNPs with knee OA in two European Caucasian populations from Greece and Spain. We genotyped a total of 813 OA and 1,071 control subjects . We condD' and 2r) between rs7775228 and rs10947262 using the genotype data of Japanese populations (GWAS and the replication study), and found that they were in strong LD with each other . They formed two frequent haplotypes .We estimated the pairwise LD indexes in the HLA class II/III locus associated with susceptibility to knee OA. To our knowledge, this study represents the first GWAS of OA with extensive coverage and definite genome-wide significance even after Bonferroni's correction, which is very conservative. There were no effects of population stratification and confounding factors. Since two groups of controls were used in the GWAS, we evaluated the possibility of genetic heterogeneity between the two groups by a principal component analysis and found it unlikely . AlthougHLA-DQA2 and HLA-DQB1, and within the intron 1 of BTNL2, respectively and play a central role in the immune system by presenting peptides derived from extracellular proteins 2 protein is expressed, but at a very low level in comparison with the HLA-DQA1 protein BTNL2 encodes butyrophilin-like 2, a member of butyrophilin family that shares sequence homology with the B7 co-stimulatory molecules. BTNL2 regulates T-cell activation through unknown receptor, distinct from CD28 and CTLA-4 P value than rs7775228 and rs10947262, or the haplotype may be implicated in the OA susceptibility. An association of sarcoidosis with rs2076530, a coding SNP on exon 5 of the BTNL2 gene has been reported D' = 0.11, 2r = 0).In the NCBI genome database, rs7775228 and rs10947262 located between upstream region of ectively . HLA-DQAHLA-DRA, HLA-DRB1, HLA-DRB3, HLA-DRB4, HLA-DRB5 and HLA-DQA1. HLA-DRA, HLA-DRB1/3/4/5 and HLA-DQA1 encode HLA-DR α, β and HLA-DQ α chains, which could also belong to the HLA class II molecules. HLA-DRB1 is present in all individuals. Allelic variants of HLA-DRB1 are linked with either none or one of the genes HLA-DRB3, HLA-DRB4 and HLA-DRB5HLA-DRB1 is strongly associated with RA. Some subtypes of HLA-DRB1 alleles, such as *0101, *0401, and *0405, is associated with RA The 340-kb region of HLA locus, where the two SNPs are located also includes EDG2 gene encoding lysophosphatidic acid receptor associated with knee OA PTGS2 gene encoding cyclooxygenase-2 involved in risk for knee OA EDG2 and PTGS2 underscore the potential role of inflammatory pathways in the pathogenesis of knee OA.Although OA has generally been considered a non-inflammatory disease, accumulating evidences suggest that this is not the case. Inflammation involving activated T cells in the synovial membrane of OA patients is well documented Several studies have suggested associations of OA with HLA class I and class II alleles. Study on generalized OA revealed association with HLA A1-B8 in Caucasian Figure S1Principal component analysis of GWAS samples. Samples in the GWAS and in HapMap database are analyzed by a program of Smartpca (0.16 MB TIF)Click here for additional data file.

Peripartum cardiomyopathy (PPCM) is a rare form of heart failure with a reported incidence of 1 per 3000 to 1 per 4000 live births and a fatality rate of 20%–50%. Onset is usually between the last month of pregnancy and up to 5 months postpartum in previously healthy women. Although viral, autoimmune and idiopathic factors may be contributory, its etiology remains unknown. PPCM initially presents with signs and symptoms of congestive heart failure and rarely with thrombo-embolic complications. We report an unusual case of PPCM in a previously healthy postpartum woman who presented with an acute abdomen due to unrecognized thromboemboli of the abdominal organs. This case illustrates that abdominal pain in PPCM may not always result from hepatic congestion as previously reported, but may occur as a result of thromboemboli to abdominal organs. Further research is needed to determine the true incidence of thromboemboli in PPCM. Peripartum cardiomyopathy (PPCM) is a rare form of heart failure of unknown cause with a reported incidence of 1 per 3000 to 1 per 4000 live births. Onset is usually between the last month of pregnancy and up to 5 months postpartum in previously healthy women, with a reported fatality rate of 20%–50%. Although viral, autoimmune and idiopathic factors may be contributory, its etiology remains unknown. PPCM usually presents initially with signs and symptoms of heart failure and rarely with thrombo-embolic complications. We report an unusual case of PPCM in a previously healthy woman who presented with an acute abdomen due to multiple thromboemboli.A 24 year old gravida 5 woman with no history of alcohol or drug abuse, and no previous history of cardiovascular disease, presented to the emergency department (ED) 5 months after an uneventful full term spontaneous vaginal delivery followed by tubal ligation. She complained of a severe epigastric and right upper quadrant abdominal pain, nausea and vomiting. Physical examination revealed normal vital signs, epigastric and right upper quadrant tenderness without peritoneal signs. Abdominal ultrasound showed thickened anterior gall bladder wall without stones or sludge and no pericholecystic fluid. Liver enzymes and amylase were within normal limits. She was given analgesics and subsequently discharged from the ED following complete resolution of her symptoms. Three days later she returned with a severe, worsening right upper quadrant and epigatric pain, nausea and shortness of breath. She also complained of left lower extremity and back pains. At this time, her blood pressure was 130/100 mmHg with a heart rate of 100. She had bilaterally decreased air entry on lung examination, intermittent apical third heart sound with a regular rate and rhythm, right upper quadrant and epigastric tenderness, bilateral costovertebral angle tenderness and a negative Murphy's sign. An acute abdominal x-ray series was normal. Chest x-ray is a rare form of dilated cardiomyopathy that is associated with a high maternal morbidity and mortality, reportedly accounting for 4% of maternal deaths in the United States ,2. It isPatients with peripartum cardiomyopathy (PPCM) may rarely be predisposed to thromboembolic phenomenon due to blood stasis resulting from the hypercoagulable state of pregnancy and the depressed left ventricular systolic function typical of this disease. Abdominal pain may not always indicate the presence of hepatic enlargement and congestion as previously believed, but may occur as a result of non-occlusive thromboemboli of the bowel or other abdominal organs as reported in our patient. This may be a further indication for early initiation of anticoagulation to prevent a potential adverse outcome from bowel or other abdominal organ ischemia. Further research is needed to determine the true incidence of thromboemboli in PPCM.PPCM – Peripartum Cardiomyopathy; CT – Computed tomography; ED – Emergency department.The author(s) declare that they have no competing interests.UI, JT and GR conceived of the study, tacked out responsibility for diagnosis of the patient, their evolution and elaborated in the design of this case and draft of the manuscript. UI also retrieved the images while JT edited the final text.All authors read and approved the final manuscript.

Arabidopsis thaliana.New generation sequencing technology has allowed investigation of the small RNA populations of flowering plants at great depth. However, little is known about small RNAs in their reproductive cells, especially in post-meiotic cells of the gametophyte generation. Pollen - the male gametophyte - is the specialised haploid structure that generates and delivers the sperm cells to the female gametes at fertilisation. Whether development and differentiation of the male gametophyte depends on the action of microRNAs and trans-acting siRNAs guiding changes in gene expression is largely unknown. Here we have used 454 sequencing to survey the various small RNA populations present in mature pollen of In this study we detected the presence of 33 different microRNA families in mature pollen and validated the expression levels of 17 selected miRNAs by Q-RT-PCR. The majority of the selected miRNAs showed pollen-enriched expression compared with leaves. Furthermore, we report for the first time the presence of trans-acting siRNAs in pollen. In addition to describing new patterns of expression for known small RNAs in each of these classes, we identified 7 putative novel microRNAs. One of these, ath-MIR2939, targets a pollen-specific F-box transcript and we demonstrate cleavage of its target mRNA in mature pollen.Despite the apparent simplicity of the male gametophyte, comprising just two different cell types, pollen not only utilises many miRNAs and trans-acting siRNAs expressed in the somatic tissues but also expresses novel miRNAs. In flowering plants, small RNAs below 30 nucleotides in size are essential and diverse components of the transcriptome . Since tArabidopsis thaliana and these are known to directly regulate a large number of transcripts, in particular those that encode key regulatory proteins such as transcription factors and F-box proteins that regulate entry of other proteins into the ubiquitin-dependent degradation pathway.MicroRNAs are a distinct class of small RNAs derived from endogenous Pol II-transcribed genes. The transcripts from these genes form fold-back structures or hairpins that are recognised in the nucleus by the protein machinery of the microRNA pathway ,2. TheseTAS loci [TAS transcript. These sites act as recognition points from which further small RNAs are formed [TAS fragments, the TAS RNA is further processed to generate secondary small RNAs [TAS RNAs remains poorly understood [Certain miRNAs do not target coding mRNAs but instead recognise long non-coding transcripts from so-called TAS loci . These me formed . After call RNAs . An RNA-all RNAs ,10. The derstood . Secondaderstood .In plants, further classes of small RNAs are produced from RNAs derived from non-coding regions of the genome by various mechanisms, from both PolII and PolII-independent sources ,14. ThesArabidopsis thaliana. However, until recently much of this work was focused on collectively sequencing the small RNAs from complex aggregates of sporophytic tissues to whole plants from both wild type and mutant lines. Notably absent has been a focus on the reproductive cells and the highly reduced post-meiotic male and female gametophytes (pollen and embryo-sacs). In flowering plants, gametes are not directly formed from the meiotic products but instead arise from a limited number of haploid mitotic divisions. In the male gametophyte, the four products of meiosis each undergo two further mitotic divisions. The first division is highly asymmetric and forms a larger vegetative cell and a smaller generative or germ cell. The germ cell undergoes a further division to form a pair of sperm cells that are suspended within the vegetative cell cytoplasm. In Arabidopsis, mature pollen grains at the point of release from the anthers consist of three cells of these two distinct cell types.Recent innovations in sequencing technology have allAGO5, compared to whole mature pollen [in situ hybridisation [Previous work has questioned whether small RNA pathways are maintained and function as the male gametophyte develops . Howevere pollen . Recent e pollen . A functe pollen . Not onldisation ,21, but disation . Thus, mA. thaliana. We describe the general composition of the small RNA population present in mature pollen and focus on the diversity of microRNAs and tasiRNAs, as these small RNAs have a direct effect on the abundance and translation of target mRNAs. We identify known microRNAs and tasiRNAs and also survey the sequence information for putative novel microRNAs. We independently verify the expression in pollen and relative abundance of selected microRNA sequences identified by 454 sequencing using quantitative RT-PCR. Amongst the candidate novel microRNAs, we confirm that one, named ath-MIR2939, cleaves its predicted target transcript, At3g19890. This corresponds to a pollen-specific F-box family transcript that is significantly enriched in sperm cells. Its discovery supports the assertion that novel miRNAs exist with putative roles in regulating gametophyte-specific transcripts that may be of key importance in reproduction.We have utilised 454 sequencing to explore the diversity of small RNAs in mature pollen of Among the 32139 unique sequences between 15 and 30 nt, the majority are between 19 and 24 nt in length - the usual range size of small RNAs in plants. In terms of sequencing depth, more than 86.5% of these sequences are represented by only 1 read, 12.5% by 2 to 10 reads while the remaining 1% are represented by more than 10 reads. This indicates that our data are mainly qualitative and demand further verification and quantification, at least for specific microRNAs. BLAST analysis on Arabidopsis chromosomes indicates that 41% of the 32139 unique sequences perfectly or nearly perfectly (one mismatch) match the genome, which corresponds to 55% of the total reads , 38 reads (9.6%) for miR172 (targeting AP2 family) and 26 reads (6.6%) for miR159 (targeting MYB/TCP family). Another important category of identified microRNAs targets the PPR protein family with 65 reads (16.4%) for miR158 and 45 (11.4%) for miR161.BLASTN analysis of the 31239 unique sequences with 0, 1 or 2 mismatches led to the identification of 32 known Arabidopsis microRNAs corresponding to 396 reads Table . Some miARGONAUTE1 and ARGONAUTE2 respectively. One single read of miR162 which targets DCL1 has also been detected. MiR773 and miR778 that target methyltransferases are also present. The remaining microRNAs target genes involved in hormone response like AUXIN-RESPONSE FACTORs , genes involved in general metabolism or those having no identified targets.Interestingly, several components of the different epigenetic pathways seem to be targeted by microRNAs in pollen. miR168 (19 reads) and miR403 (7 reads) were detected, targeting TAS genes are also detectable which suggests activity of the tasiRNA pathway, where initial cleavage of the TAS transcripts by these miRNAs is required to initiate tasiRNA biogenesis. Nine of the 33 detected microRNAs were singletons, which leaves open the possibility that their expression levels are either similar, or that the number of sequencing reads in this study was insufficient to resolve differences in their expression levels. Digital gene expression of small RNAs has recently been demonstrated to generate systematic and reproducible biases [miR173 and miR390 (16 reads) that target e biases , highligArabidopsis genome) are likely to represent their corresponding authentic miRNAs. We also detected miR774 by RT-PCR, even though this sequence was absent from our own 454, and indeed all available online datasets http://asrp.cgrb.oregonstate.edu/db/. These data suggest that our sequencing depth provided insufficient coverage to identify all pollen small RNAs. Nevertheless, quantification revealed that the most abundant miRNA in our 454 dataset, miR156, was also detectable by Q-RT-PCR. The relative abundance of all other miRNAs was normalized to miR156 for both miRNA Q-RT-PCR and sequencing data to singletons , and including those showing 1 or 2 sequence mismatches . Those remaining putatively target a translation initiation factor (ath-MIR2936) and MEI1 and a monooxygenase (YUC11) (ath-MIR2935).The use of the MiRCat and Target prediction software permitted us to detect putative new microRNA candidates Table . Seven oin vivo, several of the predicted target mRNAs were tested using a modified 5' RACE procedure that allows detection of uncapped transcripts produced after miRNA-directed cleavage. To validate cleavage, we used gene-specific nested primers located a short distance 3' upstream of the predicted site of small RNA/mRNA binding. Of the putative target mRNAs tested, only one produced a cleavage product that corresponded to the predicted cleavage product from ath-MIR2939 activity . This database predicted the existence of this novel microRNA and its targeting of At3g19890, but also predicted targeting of another F-box transcript, At3g17265. However, we were unable to confirm cleavage of At3g17265 in mature pollen.To validate whether these putative microRNAs actually cleave the computationally predicted target mRNAs SUVH6, which is also targeted by miR778 identified by sequencing. At3g19890 was a confirmed target of ath-MIR2939 but is also predicted to be a target of miR774. Interestingly miR774 was identified as pollen-enriched in Q-RT-PCR analysis are represented, having around 4 to 10 small RNAs matching their sequence, in both strands , MYB/TCP , ARF , AP2 (miR172), and GRF (miR396) there can be no doubt that miRs modulate the expression of many transcription factors during later stages of pollen development.Our results emphasise the potential importance of miRNAs in pollen development and maturation. For example transcriptomic analysis has shown that many transcription factors exhibit dynamic gene expression changes during male gametophyte development ,29 and mArabidopsis thaliana genome alone [FBL17 itself does not appear to be targeted by a microRNA. The presence of miR399, which targets transcripts of the E2-ubiquitin conjugating enzyme family, also supports the idea that small RNA regulation of the protein degradation pathways is important in late pollen. The PPR proteins are another large family with significant roles in plastid and mitochondrial development in plants and pentatricopeptide repeat (PPR) family. F-box family proteins, a large super- family in plants with 694 genes identified in the me alone , have a me alone . Indeed,me alone and receme alone . If theriewed in , and [34iewed in ). Their iewed in ) and RNAiewed in ). The reiewed by ); it is ARGONAUTE2 (AGO2) was also present, although RT-PCRs were not able to detect AGO2 transcripts during male gametophyte development [AGO2 detectable in sperm cells [SUVH5 and SUVH6. These proteins have roles in regulating histone methylation and silencing repeats and transposons [DDM1), the possibility of microRNA-directed down-regulation of these two transcripts is intriguing. Indeed, SUVH5 transcripts decrease from relatively high to undetectable levels after pollen mitosis II during male gametophyte development . TargetA. thaliana for defects in male gametophyte development and function [http://srna-tools.cmp.uea.ac.uk/cgi-bin/input_form.cgi?tool=mircat and a database of computationally predicted miRNAs [The poor sampling of male gametophyte small RNAs to date and the unique gene expression profile of this developmental stage suggested that our dataset was likely to contain novel small RNAs. Further, a recent screen of Ds insertional mutants in function resultedd miRNAs . Criterid miRNAs , and appin vivo at the post-transcriptional level. Additionally, this transcript is also targeted by miR774 which we also detected in mature pollen by Q-RT-PCR, suggesting that post-transcriptional regulation of this transcript may be functionally important during pollen development or fertilisation.To explore whether any of these candidate microRNAs were able to cleave their predicted target transcripts, modified 5' RACE experiments were performed on selected transcripts. Only one such microRNA, ath-MIR2939, was found capable of directing cleavage of its predicted target, an F-box family transcript At3g19890. Predicted to be functional , ath-MIRSSP transcript in Arabidopsis, which is untranslated in the pollen but on transmission to the zygote, is translated and regulates development of the suspensor [Plumbago zeylanica [Our results also reveal the presence of known miRNAs targeting pollen-held transcripts, but without cleavage products being generated. However, this absence of cleavage is understandable in the context of recent work which shows that plant microRNAs can induce translational suppression ,45. In muspensor . Similareylanica .Although this study focused on sequencing the small RNA population from isolated pollen grains, comprising just vegetative and sperm cells, it is clear that the number of reads was insufficiently deep, since many of the microRNAs were represented by just one or two reads, including the novel F-box targeting microRNA that was identified and validated in this study. Q-RT-PCR analysis of a range of pollen microRNAs has also confirmed that the depth of sequencing was not fully representative of the pollen small RNA transcriptome. One reason why this depth of sequencing was not saturating - even for just these two cell types - may be because of the major transcriptomic fluxes which clearly take place during male gametophyte development - affecting both the nucleus and organelles. Smaller RNAs from the degradation of transcripts generated by these events appear to constitute a high proportion of the transcriptome and may dilute out genuine small RNAs. Future work on pollen small RNAs will require a significantly higher number of reads.The study is also limited as only the mature pollen stage of male gametophyte development was sequenced. Our results represent just a snapshot of small RNAs at a time when cell divisions have ceased and development is at a standstill, as the pollen becomes metabolically inactive and dehydrated prior to dispersal. The representation of several miR families only by shorter reads than the mature microRNA points to regulated degradation taking place . To obtaWe have shown that even mature pollen - where male gametophyte development is temporarily arrested and cells are dehydrated prior to dispersal and the commencement of a new developmental programme (pollen tube growth) - shows a remarkable diversity of microRNAs and tasiRNAs. These small RNAs are likely to have contributed to the major transcriptomic changes earlier in development and may also be present to direct changes in transcript abundance and translation during pollen hydration, germination and tube growth - and even at syngamy and in immediate post-fertilisation development. The discovery of apparently pollen-specific microRNAs fulfils the expectation that this stage of development not only requires known somatically-expressed microRNAs but also uses stage-specific small RNAs.Arabidopsis thaliana ecotype Columbia-0 plants were grown in a controlled environment room . Mature pollen from flowering plants of the Columbia ecotype was collected as described in [Nicotiana tabacum 'Petit Havana' were grown to flowering and mature pollen was collected from freshly dehiscing anthers.ribed in . Plants ® method described in [Nicotiana tabacum pollen was extracted using the TRI Reagent® method. The small RNA fraction was isolated using YM-100 size-exclusion filters (Millipore).Total RNA from Arabidopsis mature pollen was extracted using the TRI Reagentribed in . Total RThe Arabidopsis mature pollen small RNA library was built and sequenced using 454 technology by Eurofins MWG using the following procedure:Total RNAs were separated on a denaturating 15% polyacrylamide gel and stained with SYBRgreenII. As a molecular mass standard, a mixture of oligonucleotides with a size range of 19 and 29 nt was used. The small RNA fraction with a length of 19-29 bases was obtained by elution of the RNAs from the excised gel. The eluted RNAs were then precipitated and dissolved in water.The gel-purified small RNAs were first poly(A)-tailed using a poly(A) polymerase followed by ligation of a RNA adapter to the 5' phosphate of small RNAs. First strand cDNA synthesis was then performed using an oligo(dT)-adapter primer and M-MLV-RNase H reverse transcriptase. Incubation temperatures were 42°C for 15 min, followed by 55°C for 5 min. The resulting cDNA was then PCR-amplified (20 cycles) to about 20-30 ng/μL using a high fidelity DNA polymerase.The PCR-amplified cDNAs corresponding to the small RNAs were then sequenced using the 454 Life Sciences (Roche) technology. More than 58000 reads were finally obtained.ftp://ftp.ncbi.nih.gov./genomes/Arabidopsis_thaliana was used to align all unique sequences to the Arabidopsis genome and to estimate the global level of identity or a known transcript ("genic" hit), the best scores for genic and intergenic BLAST searches were compared and assigned based on the higher score. Sequences having identical scores for the two types of genomic locations were classified into an "undetermined" category (See Table 31239 unique sequences derived from 54764 clipped sequences (with 5' and 3' adaptors removed) whose length was between 15 and 30 nt were used for a series of BLAST similarity searches (BLASTN). The BLAST output was analysed using a set of customized Perl/BioPerl scripts. A first set of BLAST searches against the Arabidopsis Chromosome sequences downloaded from the NCBI http://asrp.cgrb.oregonstate.edu/db/. Less stringent parameters were then selected such that incomplete sequences (but perfectly matching the miRNA sequence), as well as sequences showing up to 2 mismatches were considered downloaded from the Arabidopsis Small RNA Project website To detect new microRNAs in our Arabidopsis Col-0 mature pollen sample, we used MiRCat . All thehttp://bioinfo3.noble.org/pssRNAMiner was used [Arabidopsis genome. Using a maximum offset position of 1 and a mapping ambiguity of 6, the software then identified phased small RNA clusters by evaluating P-values of hypergeometric distribution. A minimum p-value of 0.05 was used to detect statistically significant clusters.To detect phased small RNA clusters corresponding to tasiRNAs, the pssRNAMiner software was used . Only smTAS precursors were expressed in mature pollen, RT-PCRs were performed with cDNA synthesized from 2 ng total RNA using a Retroscript kit (Ambion) with random primers, from mature pollen and a mature plant control. Specific primers used to detect TAS transcripts are described in the Additional file To determine whether A. thaliana Col-0 material and generation of 5' RACE cDNA was performed as described in [http://www.ncbi.nlm.nih.gov/VecScreen/. The same modified 5' RACE analysis was extended to cover known miRNA binding sites on the same transcripts, as several of the predicted mRNA targets are validated targets of previously described miRNAs.Isolation of polyA RNA from total RNA of ribed in . To deteWe performed quantitative RT-PCR to validate the relative abundance of microRNAs identified with 454 sequencing in 2 independent samples of Col-0 mature pollen and leaf. Small RNAs from these samples were extracted and isolated using the miRVana kit (Ambion) and corresponding cDNAs were synthesized using the QuantiMiR kit (SBI). Quantitative PCR was performed on a MJ Research Chromo4 machine, using SYBRGreen JumpStart Taq ReadyMix (Sigma-Aldrich). Primers were defined for a subset of 16 known miRNAs and a putatively new miRNA (see Additional file Nicotiana tabacum pollen, using developing floral bud material as control. We amplified N. tabacum homologues of Arabidopsis microRNAs that were found in this study using specific primers (see Additional file N. tabacum small RNAs were designed from described N. tabacum small RNAs or from highly conserved dicotyledonous sequences from MiRBase http://www.mirbase.org/.Small RNA cDNA synthesis and end-point RT-PCRs of miRNAs were performed as described in for 78 nExperimental strategy was jointly devised by DT, GLeT, HGD and RG-D. GLeT and RG-D carried out the bulk of the experimental work and data analysis, assisted in the latter by RS. JER, SH and SM carried out some of the experiments and provided materials and reagents. GLeT and RG-D jointly wrote the manuscript which has been read and approved by all authors.Additional Tables and figures. Table S1: Examples of sequencing mismatches resulting from 454 analysis. Table S2: Microarray expression values of miRNA targets; SUVH6, SUVH5 and F-Box protein family. Table S3: Primers used in this study. Figure S1: MicroRNA amplification by quantitative RT-PCR. Figure S2: SUVH6 transcript cleavage points detected using 5'RACE-PCR. Figure S3: Trans-acting siRNA features of TAS1A, TAS1B, TAS1C and TAS2 transcripts. Figure S4: Expression of TAS precursors in mature plants and mature pollen. Figure S5: Expression of small RNAs in mature bicellular pollen of tobacco.Click here for file

Nosema bombycis, a parasite of silkworms. It is now appreciated that these organisms are related to the Fungi. Microsporidia infect all major animal groups most often as gastrointestinal pathogens; however they have been reported from every tissue and organ, and their spores are common in environmental sources such as ditch water. Several different genera of these organisms infect humans, but the majority of infections are due to either Enterocytozoon bieneusi or Encephalitozoon species. These pathogens can be difficult to diagnose, but significant progress has been made in the last decade in the development of molecular diagnostic reagents for these organisms. This report reviews the molecular diagnostic tests that have been described for the identification of the microsporidia that infect humans.The Microsporidia are a ubiquitous group of eukaryotic obligate intracellular parasites which were recognized over 100 years ago with the description of The Microsporidia are a phylum of over 1200 species representing at least 150 genera and otheμm [All microsporidia produce an environmentally resistant spore which is capable of extruding its coiled, internal polar filament thereby inoculating its contents into a nearby host cell. Unique in structure and function, identification of the polar filament is diagnostic for the phylum. Due to the small size of the organisms, for example, several of the human-infecting species measure 1–2 μm , diagnosμm .Enterocytozoon bieneusi, the most common microsporidium found in humans, no in vitro culture system exists [While TEM evidence of the polar filament or other ultrastructural features unique to the phylum is considered incontrovertible proof of microsporidiosis, a more specific diagnosis is not always possible on the basis of morphology alone. Especially in the case of closely related species, distinguishing characteristics may arise in only certain developmental stages of the organism, all of which may not be present in a particular clinical sample. While in vitro culture is conceivable as a tool to aid in diagnosis for several human-infecting species, culture methods are laborious, subject to contamination, and usually impractical; moreover, for m exists . Thus, tOver the past decade or so, molecular biology-based procedures have been increasingly used in clinical settings for the diagnosis and characterization of microbial pathogens. These procedures are designed to detect either a nucleic acid sequence or antigen specific to the pathogen. Compared to traditional microscopy- or culture-based methods, molecular methods can offer the following potential advantages: increased sensitivity, by virtue of amplification of signal; greater specificity, when appropriate detection probes are employed; faster time-to-result; and greater ease of interpretation by nonspecialists . While c Nucleic acid-based detection methods utilize synthetic DNA molecules that are specific and complementary to a sequence in the DNA of the pathogen. The earliest methods employed labeled probes which hybridized to pathogen DNA and emitted a detectable signal. Such DNA probe technologies are still in use today, although they have been largely supplanted by methods that amplify the target sequence; of these methods the most commonly utilized is the polymerase chain reaction (PCR) . In PCRTechniques for sample preparation for the molecular diagnosis of microsporidia have been reviewed in detail in Weiss and Vossbrinck . The tecThe isolation and amplification of DNA from stool samples is more challenging, generally requiring mechanical disruption and/or harsh extraction conditions. Successful reported methods include subjection to 0.5% sodium hypochlorite , chitinaEncephalitzoon cuniculi, the first and to-date only microsporidium genome to be completely sequenced. For the closely related species Encephalitozoon hellem, there are 75 entries. Recently, a genomic survey of the essentially noncultivatable pathogen Enterocytozoon bieneusi resulted in the addition of another three-thousand hypothetical genes, some of which are homologs to the genes identified in Enc. cuniculi [In order to apply PCR-based diagnostics to a pathogen, some genetic sequence information must be known in advance. The human-infecting microsporidia are a diverse group of “emerging” pathogens, and the available genetic information on these organisms is limited but ever-increasing. For the majority of the microsporidia GenBank sequence data on their rRNA genes is the only genetic information available. The number of microsporidian genes deposited in GenBank has grown from less than 200 in 1999 (surveyed in ) to almocuniculi . For theVairimorpha necatrix, a pathogen of agricultural pests [Enc. cuniculi, Enc. hellem, Enc. intestinalis, Ent. bieneusi, and Vittaforma corneae for use in diagnostic PCR tests. Due to the availability of sequence information as well as the presence of conserved and variable regions within the rRNA genes, PCR-based methods have typically utilized primers to this gene for the characterization of the microsporidia. The first such report of the use of conserved rRNA primers was of that of the cloning of the small subunit (SSU) rDNA of al pests . Primersiewed in , 34). Thiewed in to be prDiagnostic studies using primers to the various rRNA genes of microsporidia have been reviewed by Weiss and Vossbrinck and FranPCR has also been useful for the identification of the previously unknown microsporidia in human and veterinary infections. Using phylogenetically conserved primers amplifying the small subunit (SSU), large subunit (LSU), and intergenic spacer (IGS) regions, it has been possible to clone and then sequence portions of the rRNA gene of uncharacterized microsporidia from biopsy specimens and reflective of infection intensity (linear range was between 103 and 107 spores/mL). In addition, melting curve analyses of the amplicons readily allowed differentiation of the three Enc. species., which is useful for multiple or unknown infections. In 2003, a real-time PCR assay using primers for Enc. intestinalis small subunit rRNA was used to detect this pathogen from known clinical samples, including stools, urine, tissue biopsies, bronchopulmonary specimens, and blood [Ent. bieneusi, Enc. cuniculi, Enc. hellem, and Enc. intestinalis from both fresh and formalin-fixed stool with primers for the intergenic region and small subunit rRNA of Ent. bieneusi and Encephalitozoon species., respectively [Ent. bieneusi was detected in 30 of 33 known microsporidia-positive samples. The study included a range of negative and positive controls to verify the assay specificity and guard against false negatives due to inhibitors potentially present in stool or to the presence of extraneous DNA, respectively. Several investigators have published diagnostic procedures for microsporidia which use real-time PCR , 54, 56.nd blood , 34. Usind blood , 34. Finin situ hybridization (FISH-) based methods to detect microsporidia. Essentially, FISH technology utilizes a fluorescence-labeled probe that binds to complementary nucleic acid (DNA or RNA) in the specimen [in situ. FISH has been used with probes against the small subunit or intergenic regions of microsporidia rRNA to detect Ent. bieneusi and Enc. hellem [Ent. bieneusi, characteristic staining of parasites in a supranuclear location within jejunal biopsy epithelial cells [A few studies have also utilized fluorescent specimen . In cont. hellem , 51, 52.al cells and staiEnt. bieneusi, Enc. cuniculi, Enc. hellem, and Enc. intestinalis from clinical samples [2 spores per 100 μL of fecal sample. In a survey of 20 fecal samples from AIDS patients suffering from diarrhea of unknown etiology, 12 samples were microsporidia-positive, and all but one were apparently multiply-infected. No masking effect by the more abundant species was evident, and the probe hybridization profile for each species offers a tentative assessment of infection intensity. The printing of four individual microarrays per slide increases the potential throughput of this technique.Of interest is the report of the development of an oligonucleotide microarray to simultaneously detect samples . Such mi samples , 58. Mic samples capitaliin situ on fixed specimens but needs to be examined using fluorescence microscopy. Immunoblot or ELISA tests examine an homogenate of the specimen. Antibodies may be either polyclonal or monoclonal (purified from cell culture supernatants). Antigen-based detection methods such as the immunofluorescence assays (IFAs), ELISA, and immunoblot use antibodies from experimentally immunized animals to recognize characteristic pathogen specific antigens. IFA can be used Ent. bieneusi, Enc. cuniculi, Enc. hellem, and Enc. intestinalis have been developed [A number of monoclonal and polyclonal antibodies against human-infecting microsporidia including eveloped –65. Mosteveloped ), the maSerologic tests such as the enzyme-linked immunosorbent assay (ELISA), immunoblot, and agglutination-based tests , 67 whicBecause many species of microsporidia are enteric pathogens in humans and animals and are transmitted as environmentally resistant spores , it is l2 to 103 spores per milliliter of feces or wastewater were achieved by sucrose-flotation purification followed by DNA extraction using commercial kits and PCR [Waterborne protozoa are usually detected from large-volume water samples by filter-based or centrifugal concentration followed by purification and molecular or microscopic identification of the organism from the concentrated material . Current and PCR , a signi and PCR , 81.Ent. bieneusi-positive [3 viable, aerosolized spores in 30 minutes of occupational or incidental exposure to heavily pigeon excrement-contaminated surfaces. In addition, Mathis et al. [Ent. bieneusi in feces of farm dogs and cats; diagnostic PCR suggested that the strains are closely related to human isolates. These findings support the notion that human microsporidiosis is a zoonotic disease [While waterborne microsporidia likely pose the greater environmental threat, nonaquatic dispersal of microsporidia is also a public health concern. Spores have been identified on fresh produce in Poland such as berries and other fruits, sprouts, and green-leaf vegetables , perhapspositive . Graczykpositive , 84 estis et al. demonstr disease , 88, 89 The potential of molecular diagnostics and particularly nucleic acid-based diagnostics to exceed traditional methods in terms of sensitivity, specificity, speed, and reproducibility has already achieved proof-of-concept for other pathogens , 11. IndIn summary, molecular detection methods for the microsporidia described herein are potentially more sensitive, specific, and depend less on the subjectivity of the observer than traditional microscopy-based methods. Additionally, sophisticated nucleotide-based methods such as real-time PCR and oligonucleotide microarrays are intrinsically higher-throughput and quantitative, enabling simultaneous analysis of specimens for multiple pathogens as well as a tentative assessment of infection intensity. Although the time-to-result and reproducibility in clinical diagnostic settings have yet to be evaluated, a modest learning curve should be expected considering the “emerging” nature of these pathogens (see ). Lookin

Chromosome studies were carried out, by a direct method, in 28 subjects with malignant lymphomas. Lymph node cells were analysed in 24, ascitic fluid sediments in 3 and bone marrow cells in 1. Chromosome abnormalities, both numerical and structural, were found in 12 of 14 cases of well differentiated and poorly differentiated lymphocytic lymphomas, and reticulum cell sarcomas, and in 8 of 14 cases with Hodgkin's disease. The karyotypes were different from case to case and there was no correlation with the histology. In individual cases the abnormalities followed a clonal pattern indicating a common precursor for the abnormal cells. The modal number of chromosomes was near-diploid in the lymphocytic lymphomas and reticulum cell sarcomas.Hodgkin's disease showed two main features; a predominant population of cells with normal karyotype accompanied by a small number of cells of an abnormal clone with a predominantly hypertriploid number of chromosomes. It is suggested that the first population represents mitoses in the surrounding lymphocytes. Its cytogenetic normality is an argument against its neoplastic origin, and they could be components of an inflammatory reaction, the true neoplastic cells being the abnormal reticulum cells.

Standardization of anaesthetic equipment is needed for safe anaesthetic practice. Various organizations and regulatory bodies have been made throughout world to formulate and control standards for anaesthesia equipment including endotracheal tubes. All endotracheal tubes must conform to ASTM standards. This has medico-legal importance also. Regulatory bodies should look after the whole process right from the manufacturers to the actual users. The Indian Society of Anaesthesiologists promotes safe anaesthetic practice, by establishing purchase guidelines for equipments and drugs. It is working in collaboration with World Federation of Societies of Anaesthesiologists. Standards have made anaesthesia and critical care equipment much safer over the years. There is need to form standards for various equipment in India. Likeany equipment, anaesthesia equipment should follow “Standards” in manufacture and use. All over the world Standard protocol is followed for manufacture and use of various anaesthesia equipments. This is required for safety of anaesthesia practice. This is necessary in present Indian scenario considering increasing consumer forum cases against anaesthesiologists. In this article various aspects of standardization process is discussed in brief. Endotracheal tubes are studied as example to think over the matter of standardization. There is need of standardization of endotracheal tubes, which is one of most commonly used equipment used by anaesthesiologists. Various brands of endotracheal tubes studied in this article is not an end in itself but taken as an example. There is not any intention, for proving any particular brand superior or inferior. The article is not intended to judge quality of any particular brand of endotracheal tubes mentioned and studied in the article. Its quality has to be judged by individual anaesthesiologist and regulatory bodies. The purpose of this article is to draw attention of anaesthesiologists in India to bring the role of standardization into thought process, in respect of anaesthesia equipment. Role of Indian Society of Anaesthesiologists is also thought for as a regulatory body for safe anaesthesia practices. It is twenty first century and still there is no standardization.Standard can be defined as “Documented agreements containing technical or performance specifications or other precise criteria to be used consistently as rules, guidelines or definitions of characteristics, to ensure that materials, products, process and services are fit for their intended purposes”Three types of standards in Anaesthesia and Critical care:Safety standards: Minimum requirements for electrical safety and usability.Performance safety standard: Minimum requirement for equipment performance during use.Technical standard: Provide guidance to manufacturers and users for equipment design, construction, performance and use.Process of standardization usually starts when a request from manufacturer, industry association, consumer group, educational institute or governmental body is made, to help with a particular safety, performance or quality issue. Initial drafts are written by working groups or adapted from other countries or from standards of similar equipment. National committee members are asked to comment and vote on it. Standards are developed by technical committees, subcommittees and working groups made up of representatives of manufacturers, equipment users, operators and other interested parties using a consensus approach.Most of anaesthesia and critical care standards are written by ISO TC 121 and its subcommittees, Organisation for International Standardisation Technical Committee 121 and IEC 62-International Electro technical Commission Committee 62. These committees look for suggestions of anaesthesiologists and intensivists, apart from engineers.ISO stands for International Organisation for Standardisation, Founded in Feb 1947, first met in London UK in 1967IEC, International Electrotechnical Commission, originally located in London, the commission moved to its current headquarters in Geneva in 1948There are numerous standards writing committees and organizations across the world. Most countries have a national standards body:In United States: Anesthetic and Critical Care Committee F29 of American Society for Testing and Materials (ASTM) writes the standards. ASTM has a dominant role among standards developers in the USA and claims to be the world's largest developer of standards.In Canada: CSA international (formerly the Canadian Standards Association), is a global leader in development and certification of equipment standards, International Organisation for Standardisation (ISO), the International Electrotechnical Commission (IEC) and the Compressed Gas Association (CGA).In Europe: Committee for European Normalization (CEN) and their marking is CE.In Japan: Japanese Industrial Standards Committee (JISC).Standards in India: Bureau of Indian Standards (BIS) is a member of “International Organisation for Standardisation (ISO)”.This is national standard's body in India; head-quarters is in New Delhi, a member of ISO. It has a training centre is in Noida (U.P.) known as National Institute of Training for Standardisation (NITS). NationalCommittees may decide to change or modify any of International Standards adopted for its own country. Its objectives are-Harmonious development of standardization, marking and quality certification.-Providing new thrust to standardization and quality control.-Evolving national strategy for standards and integrating them with growth & development of production & exports.BIS is engaged in formulation of Indian Standards for medical equipment and hospital planning. The Indian Standard is technically equivalent to ISO/IEC standard.To reduce the discripencies among various manufacturers of Endotracheal tubes (ETTS), the need for minimum standards for safety in the design and construction of medical equipment were recognized across the world.It is medico legally important for physician that he has to act in accordance with specific standards of care established by the profession for protection of the patient against unreasonable risksSafety in anaesthesia practice relates safety in various aspects like use of drugs, procedures and equipments. It involves its make and knowledge of use. Any compromise or deviation from specific standard at any level may introduce risk to patient safety. These deviations can creep in by oversights in design, mistakes in equipment manufacturer or facility construction and the need to produce a usable product for the price the health care system can afford, especially in developing countries. Standards provide similarity in equipment design and materials across different models and different manufacturers. The manufacturer owes his duty of care to the ultimate user and not just to the immediate purchaser. Until recently, anaesthesia and critical care equipment produced by single manufacturer had to adhere to standards of all the countries in which equipment was distributed. This led to the rise in actual price of equipments. Now global standards are being harmonized so that manufacturers in future will only have to manufacture equipment to one international standardThe Global Harmonization Task Force (GHTF) was conceived in 1992 in an effort to respond to growing need for international harmonization in the regulation of medical devices.By standardization, what we are really trying to do is to write the minimum requirements for the “basic safety and essential performance” for medical equipment in general or for a particular deviceEndotracheal tubes (ETT) are one of most commonly used equipment used by anaesthesiologists throughout the world. We will like to discuss issues related with endotracheal tube's standards in Indian perspective.Endotracheal Tubes marketed in India: Does it follow standards?What are different standards for Endotracheal tubes?ASTM standard requires following recommendations to be done and printed on endotracheal tubes- Name or trademark of manufacture or supplier- The words “oral”, “nasal” or “oral/nasal”- Inside (ID) and outside (OD) diameters in millimetres- Tissue toxicity test: Implantation testing (IT) or other, with Notation Z-79 or F-29 (as per testing),- Length (depth) markings in centimetres measured from patient end.- Cautionary note such as ‘Do not reuse’ or ‘Single use only’, if disposable- Radiopaque marker at patient end or along the full length.We collected some of the common brands of Endotracheal tubes available in Indian market and compared them according to ASTM standards. We chose to study one of the most commonly used tube size of 7.5 Endotracheal tubes studied from different manufacturer were compared and following findings were noted:Some of tubes have no markings related with manufacturer / supplier on the tube. Once tube taken out of packages, one can't know which Manufacturer /supplier it belongs to .Many of ETTs have no indication of toxicity test on the tubes.Tubes of same size vary in their length markings at machine end i.e. 26, 27, and 30 cm . Take ofIn spite of considering same internal diameter tubes of 7.5mm, most of the tubes have outer diameter of 10 but one tube has outer diameter of 10.3mm .2 monitoring is not available to confirm correct positioning of tube.Many tubes have ring marking to help position the tube in relation to entry point into trachea i.e. vocal cordsASTM does not comment anything about cuff design (contour) but it becomes important as it changes the contact surface area on trachea and may be of importance. In our study some of the cuffs were oval and some attend circular when inflated outside as shown in Place of Murphy Eye is also not fixed in relation to end of ETT. ASTM does not comment on this.As an expert of the subject of Anaesthesiology it is our duty to keep ourselves updated for different equipments we use. We should know about various international standards of that equipment. As an end user it is our duty to keep the safety of patient at the top priority. Equipment safety is one of important constituent of safety in anesthesia. As a purchaser and policy maker this becomes more important because it deals with multiple users and community as a whole.Various governmental and non-governmental bodies are responsible for making of laws and regulations for the manufacture, use, and maintenance of various medical equipments. However, anaesthesiologists need to encourage their governmental regulatory bodies to encourage manufacturer compliance with specific standards in order to increase patient safety. Other than anaesthesiologists every hospital and organizations should have regulations for purchase and maintenance of various equipment of medical use. Role of Indian Society of Anaesthesiologists becomes important in case of Speciality of Anaesthesia. It is the National anaesthesia society and it promotes safe anaesthetic practice by establishing purchase guidelines for Anaesthesia equipments and drugsWe have taken endotracheal tubes as an example of one of most commonly used simple equipment by anaesthesiologists. Similarly other equipments like various monitors, anaesthesia machines, pipeline etc can be studied in Indian and International scenarios to improve upon our practice of anaesthesia to achieve the goal of safe anaesthesia practice.

Odocoileus hemionus) by analyses of lymph node meta-transcriptomes. cDNA libraries from five individuals and two pools of samples were prepared from retropharyngeal lymph node RNA enriched for polyadenylated RNA and sequenced using Roche-454 Life Sciences technology. Protein-coding and 16S ribosomal RNA (rRNA) sequences were taxonomically profiled using protein and rRNA specific databases. Representatives of all bacterial phyla were detected in the seven libraries based on protein-coding transcripts indicating that viable microbiota were present in lymph nodes. Residents of skin and rumen, and those ubiquitous in mule deer habitat dominated classifiable bacterial species. Based on detection of both rRNA and protein-coding transcripts, we identified two new proteobacterial species; a Helicobacter closely related to Helicobacter cetorum in the Helicobacter pylori/Helicobacter acinonychis complex and an Acinetobacter related to Acinetobacter schindleri. Among viruses, a novel gamma retrovirus and other members of the Poxviridae and Retroviridae were identified. We additionally evaluated bacterial diversity by amplicon sequencing the hypervariable V6 region of 16S rRNA and demonstrate that overall taxonomic diversity is higher with the meta-transcriptomic approach. These data provide the most complete picture to date of the microbial diversity within a wildlife host. Our research advances the use of meta-transcriptomics to study microbiota in wildlife tissues, which will facilitate detection of novel organisms with pathogenic potential to human and animals.The ongoing emergence of human infections originating from wildlife highlights the need for better knowledge of the microbial community in wildlife species where traditional diagnostic approaches are limited. Here we evaluate the microbial biota in healthy mule deer ( Information about the commensal and pathogenic microbial communities associated with host species, including humans, is limited. The endemic microbial community of a healthy host is important to characterize because its perturbation can be a cause of disease With the advent of meta-genomics methods, the entire community of microorganisms that exist in a given environment can potentially be identified. Pyrosequencing and other high throughput sequencing approaches have been applied to determine the microbial population in environmental samples such as soil and seawater The key question behind this study was whether viable microorganisms could be detected within healthy mammalian lymphoid organs by employing massively parallel sequencing coupled with computational techniques able to detect transcripts of microorganisms among the abundant transcripts of the mule deer host. Lymph nodes are the specific replication sites for certain pathogenic viruses and bacteria We evaluated the microbial community in retropharyngeal lymph nodes of mule deer to assess microbial exposure via the oral or respiratory route. Because ungulates browse and receive small punctures from sharp forage, we reasoned that healthy animals would potentially be exposed to microorganisms from their environment or to resident oral and rumen microorganisms that would be cleared in draining nodes. We used mule deer to highlight the utility of this approach in a wildlife host, but the method is broadly applicable to any host species.Our studies document for the first time that there is a community of viable microorganisms in retropharyngeal lymph nodes of healthy wild ungulates. Furthermore, our findings demonstrate the applicability of meta-transcriptomic techniques for the detection of novel bacteria and viruses in internal organs.+ RNA to prepare cDNA libraries and subjected them to pyrosequencing on a Roche GS FLX sequencer (Roche-454 Life Sciences). Properties of sequencing runs are given in Detection of protein-coding and ribosomal RNA transcripts provides strong support for the presence of viable and replicating microorganisms. Therefore, we enriched the total RNA obtained from lymph nodes for poly(A)Bos taurus and other close relatives of mule deer that are represented in the protein database. Approximately 0.3% of the assigned tags were to bacteria. Proteobacteria represented 60% of all bacterial hits; Enterobacteriaceae in the Gammaproteobacteria were the most commonly identified within this group. Firmicutes and Actinobacteria represented 22% and 5% of the identified bacterial taxa. On average, 51% of total transcript-tags could be assigned to known taxa with a bit score cutoff of 50 see . Of the Xylella and Burkholderia were identified in MD 72360, Acidovorax was found in MD 84709, and Bartonella was found in both MD 84709 and MD 84730. Bartonella and Xylella, as well as a member of the beta retroviruses (found in MD 80228 and MD 84709), were identified only in the genomic DNA data, suggesting that they might not represent actively replicating organisms. These findings indicate that meta-transcriptomics may be the preferred method for detecting the viable endemic microbial community in the tissues of healthy animals.Meta-genomics studies evaluating microbial rich communities were pioneered based on genomic DNA sequences Ruminococcus, which is part of the commensal intestinal microbial community of ungulates, was detected in all seven libraries .The most commonly detected microorganisms in the transcriptome libraries comprised intestinal and skin-dwelling bacteria and soil and freshwater bacteria. ibraries . Other bHelicobacter was only detected in the library constructed from MD 257 but there were 12 unique transcript-tags assigned to this genus. More commonly, bacterial taxon identification was based on a single tag. Many of the single transcript-tags came from MD 80228, which had the highest bacterial diversity profile of all libraries analyzed, and from MD 84730. Bacterial genera detected solely in either one or both of these two samples include Acinetobacter, Legionella, Enterobacter, Salmonella, Yersinia, Vibrio, Listeria, Mannheimia, and members of the Corynebacterineae, all of which contain known pathogens. In addition, both specimens depicted by far the highest numbers of reads taxonomically assigned to the family Enterobacteriaceae. The lowest diversity of bacterial genera was found in the MD OCT-pool, which was derived from eight different mule deer. Pooling RNA from several animals potentially increases the representation of transcripts common to all animals but might decrease the ability to detect transcripts that are unique to one animal. Consistent with this, the MD Bonner-pool, which was derived from four animals, provided a broader spectrum of bacterial genera than the MD OCT-pool. Thus, pooling samples did not improve our ability to detect microbial diversity in lymph node samples.The overall bacterial diversity and the number of unique transcripts assigned to each bacterial taxon varied among the samples. Notably, In contrast, viruses were detected in both pooled samples, although the total number of transcript-tags was low. Of the individual libraries, only MD 257 had evidence of viral transcripts . The majhttp://rdp.cme.msu.edu/) we increased the number of bacterial genera identified . These sequences contribute to the ‘no hits’ category in fied see . Abiotro library , of Acin library and S4.Helicobacter in the MD 257 library was particularly compelling because there were 12 unique transcript-tags and one rRNA-tag to this genus. We evaluated the phylogenetic relatedness of the mule deer Helicobacter with other Helicobacter based on four of the protein-coding transcripts and on the single 16S rRNA sequence. All analyses demonstrated that the Helicobacter detected in the mule deer lymph node is a unique organism that affiliates with the H. pylori cluster and a beluga whale (Delphinapterus leucas) The support for cluster . BecauseAcinetobacter detected in MD 80228 based on both 16S rRNA and rpo-β sequences. The number of rpo-β sequences for Acinetobacter in the database is limited. However, we demonstrated that the MD 80228 transcript-tag clustered with those of Acinetobacter The low representation of viral sequences was not unexpected because viruses causing acute infections should be difficult to detect in healthy animals. Retroviruses integrate into the host genome as part of their replication cycle, thus transcription of viral genes can be persistent in infected animals. Overall four transcript-tags were assigned to gamma retroviruses of the family methods . The mulAs an alternative approach to identifying bacterial microorganisms present in lymph node tissue, we utilized amplicon DNA library sequencing technology. The hypervariable region V6 of the 16S rRNA gene was used because it has been reported to differentiate between many bacterial species Acinetobacter, Burkholderia, Corynebacterium, Escherichia, Providencia, Salmonella, Pseudomonas, Ralstonia, Staphylococcus, Streptococcus and Variovorax were identified by both amplicon and cDNA sequencing in MD 257, MD 80228, and/or MD OCT-pool , and the potential pathogens Stenotrophomonas, Rhodococcus, Rothia, and GardnerellaAlthough the overall taxonomic diversity in the V6 rRNA amplicon libraries was lower than that detected in the cDNA transcript libraries, the diversity within bacterial classes was higher. Newly identified genera comprised predominantly environmental soil, sediment and water inhabitants , would be expected to be present in some animals. However, detection of latent herpes virus infection may be difficult because protein-coding transcript levels are low and latent viruses express non-coding RNA Few viruses were identified with our analysis methods. This could represent the paucity of viruses in healthy animals. However, viral detection may be more difficult than bacterial identification using this technology in part due to extensive sequence diversity among viruses in the same family. For example, we were only able to detect the gamma retrovirus because a transcript was present which was homologous to a conserved region of the viral Helicobacter and Acinetobacter. Phylogenetic evaluation of Helicobacter transcripts and 16S rRNA from the MD 257 cDNA library placed this new organism in the Helicobacter pylori/Helicobacter acinonychis/Helicobacter cetorum complex. All members of this complex have been associated with gastritis and peptic ulcer disease in humans and animals Helicobacter is not a mule deer commensal. Of interest in this respect is the high incidence of H. pylori infections and gastric ulcers in American Indian populations from the same geographical area in central Montana Acinetobacter and Pseudomonas were identified in MD 80228 libraries based on all detection methods used . Phylogenetic evaluation of Acinetobacter transcripts and 16S rRNA from the MD 80228 cDNA library placed the respective reads in close relationship to Acinetobacter schindleri. Acinetobacter species are important environmental organisms, however they also are notable pathogens. In particular, Acinetobacter schindleri infections appear to be increasing in prevalence in hospitalized patients In addition to our finding of a novel gamma retrovirus, we also identified new species of In conclusion, our study demonstrates that endemic microbiota can be detected in lymph nodes of healthy animals using meta-transcriptomic approaches. These results suggest that meta-transcriptomic analyses of secondary lymphoid organs could be valuable in monitoring endemic infections in wildlife or livestock as well as in detecting novel infectious organisms with the potential for causing emerging zoonotic or epizootic infectious diseases. Further, these studies have the potential to cast new light on the diversity of life within and among individuals.Retropharyngeal lymph nodes were obtained from a total of seventeen individual Montana mule deer that were presented by hunters to check stations approximately 5 hr (range 2–11 hr) of being shot. Because our samples were obtained from legally killed animals, the study is exempt from Montana State University guidelines governing animal experimentation. Lymph nodes were dissected from animals with sterile scalpel and forceps, and rinsed in 70% ethanol. After dissection from the animal, the lymph nodes were either frozen directly or stored in RNAlater until further processing.Lymph node tissue was taken from mule deer in several geographical regions. The Bonner pool consisted of tissue from four mule deer from a Montana region north of Interstate 90 in proximity to the town Bonner. The OCT-pool consisted of eight animals from an area in the northwest of Montana defined by the towns Olney, Canoe Gulch, and Thompson Falls. Five mule deer from different regions were analyzed individually .+RNA was enriched from total RNA using the MicroPoly(A) Purist Kit . Poly(A)+RNA (0.9–5.0 µg each) was used for cDNA synthesis after elimination of residual contaminating genomic DNA using the Turbo DNA-free Kit . In one case we explored an alternative empirical approach to enrich for rare microbial transcripts, using total RNA of the MD OCT-pool. Reverse transcription and amplification of cDNA was done as described by Cheung and coworkers Lymph node tissue cores were dissected into small pieces and further disrupted, lysed and homogenized using a TissueLyser with steel beads . Genomic DNA was isolated from lymph nodes of four individual Mule deer using either the Genomic DNA Buffer Set with 20/G Genomic-tips or the AllPrep DNA/RNA Mini Kit . Total RNA was isolated using the RNAqueous-Midi Kit . For the Bonner- and OCT-pools, equal quantities of total RNA from lymph nodes of four or eight individual Mule Deer, respectively, were combined. Poly(A)Up to 5.0 µg of cDNA or genomic DNA was subjected directly to preparation of 454-DNA libraries and subsequently to pyrosequencing without any prior PCR or cloning steps. Library preparation and pyrosequencing were performed as described previously -4 to identify transcript RNA-derived tags. To filter repetitive elements, RepeatMasker (http://www.repeatmasker.org) was used to scan the mule deer sequences, with the latest version of Repbase 13.04 The data of individual 454 runs was compared against the NCBI non-redundant protein database (BLASTX-nr) with an e-value of 1ehttp://rdp.cme.msu.edu/) The 16S ribosomal RNA content of the cDNA pyrosequencing reads was analyzed by comparison to the ribosomal database of the Ribosomal Database Project (RDP) version 10 and Sanger sequenced.The cDNA from MD 191, which was used in the MD Bonner pool, and genomic DNA from MD 80228 were subjected to PCR using forward primer rpo-β for Helicobacter and Acinetobacter and of flgK, GDP-D-mannose dehydratase and UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase for Helicobacter from cDNA sequencing, and of env gene for the retrovirus from a PCR product were aligned with the respective homologous sequences available in GenBank using the MEGA version 4 http://tree.bio.ed.ac.uk/software/figtree/).Partial nucleotide sequences of 16S rRNA and www.roche-applied-science.com), 4-base barcode sequences for identifying amplicon products derived from mule deer specimen MD 257, MD OCT-pool, and MD 80228 , and the “universal” V6-specific PCR primer sequences V6F: 5′ TCGATGCAACGCGAAGAA 3′ and V6R: 5′ ACATTTCACAACACGAGCTGACGA 3′ +RNA and cDNA”). The supernatant was cleared of small RNA molecules using the MEGAclear Kit and depleted of host ribosomal RNA performing two cycles of the MICROBEnrich protocol. Subsequent depletion of bacterial ribosomal RNA yielded an RNA sample enriched for bacterial transcripts , which was subjected to cDNA synthesis after elimination of residual contaminating genomic DNA using the Turbo DNA-free Kit .The MD 257 template for amplicon generation was based on the total RNA fraction depleted of poly(A)+RNA (for MD OCT-pool and MD 80228) were used as templates for the generation of 16S rRNA V6 hypervariable region-specific amplicons using the FastStart High Fidelity PCR System . PCR conditions were 50 cycles of 94°C for 30 sec, 55°C for 45 sec and 72°C for 45 sec. The yielded amplicon products were purified using AMPure, and the resulting individual amplicon DNA libraries were clonally amplified by multiplex emulsion PCR followed by sequencing using the GS FLX pyrosequencing platform. The sequencing output data were computationally divided into subsets according to the barcodes (and the corresponding mule deer sample) and the primers A or B.Either cDNA derived from RNA enriched for non-polyadenylated bacterial mRNA (MD 257) or cDNA sequencing library samples derived from reverse transcribed poly(A)Figure S1Comparative MEGAN analysis of (A) MD 80228 and (B) MD OCT-pool transcript-tags analyzed by comparison to the protein database (red) and the ribosomal database (blue), and of amplicon 16S rRNA-tags compared to the ribosomal database (green). Bit score cutoff for the protein database comparison was set at 50, and confidence cutoffs for the ribosomal database comparisons were set at 80% and 80%, respectively.(0.45 MB DOC)Click here for additional data file.Figure S2Helicobacter reference sequences from GenBank. (A) Helicobacter FlgK, (B) Helicobacter GDP-D-mannose dehydratase, (C) Helicobacter UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase.Maximum likelihood trees showing the phylogenetic affiliation of protein-coding transcripts obtained from 454 sequencing with (0.18 MB DOC)Click here for additional data file.Figure S3Map of Montana, USA, depicting the geographical distribution of the mule deer specimen.(8.14 MB DOC)Click here for additional data file.Table S1Properties of Roche-454 GS FLX sequencing runs.(0.42 MB DOC)Click here for additional data file.Table S2Numbers of cDNA transcript-tags and genomic DNA-tags of seven and four mule deer specimen, respectively, assigned to major taxonomic nodes by MEGAN comparison (bit score cutoff set at 50).(0.30 MB DOC)Click here for additional data file.Table S3Numbers of transcript-tags assigned to bacterial taxa by MEGAN comparison for seven mule deer lymph node specimen.(0.73 MB DOC)Click here for additional data file.Table S4Bacterial taxonomic profiles of seven mule deer specimen determined by comparison of cDNA libraries-derived rRNA-tags to the ribosomal database.(0.51 MB DOC)Click here for additional data file.Table S5Bacterial taxonomic profiles of mule deer specimen MD 257, MD 80228, and MD OCT-pool determined by comparison of amplicon 16S rRNA-tags to the ribosomal database.(0.60 MB DOC)Click here for additional data file.

Retroviruses are widely used to transfer genes to mammalian cells efficiently and stably. However, genetic elements required for high-level gene expression are incompatible with standard systems. The retroviral RNA genome is produced by cellular transcription and post-transcriptional processing within packaging cells: Introns present in the retroviral genomic transcript are removed by splicing, while polyadenylation signals lead to the production of ineffective truncated genomes. Furthermore strong enhancer/promoters within the retroviral payload lead to detrimental competition with the retroviral enhancer/promoter.in vitro it is possible to produce infectious retroviral particles carrying a high-level expression cassette that completely prohibits production of infectious retroviral particles by conventional methods.By exploiting a new method of producing the retroviral genome in vitro transcription of the retroviral genome by T7 RNA polymerase.We produced an expression cassette comprising a strong enhancer/promoter, an optimised intron, the GFP open reading frame and a strong polyadenylation signal. This cassette was cloned into both a conventional MMLV retroviral vector and a vector designed to allow in vitro produced uncapped retroviral genomic transcript into the packaging cells did not lead to any detectable GFP expression. However, infectious retrovirus was easily recovered, and when used to infect target primary human cells led to very high GFP expression – up to 3.5 times greater than conventional retroviral LTR-driven expression.When the conventional retroviral vector was transfected into packaging cells, the expression cassette drove strong GFP expression, but no infectious retrovirus was produced. Introduction of the in vitro transcribed retroviral genomic RNA. The applications of this technique are not limited to producing the higher levels of transgene expression demonstrated here. For example, novel reporters with alternatively spliced exon-intron configurations could readily be transduced into virtually any cell. Furthermore, because the in vitro transcripts are not translated within the packaging cells, retroviruses carrying genes lethal to the packaging cells can also be produced.Retroviral vectors carrying an optimized high-level expression cassette do not produce infectious virions when introduced into packaging cells by transfection of DNA. Infectious retrovirus carrying the same cassette is readily produced when packaging cells are transfected with Retroviral vector systems are routinely used as delivery vehicles for efficient and stable gene transfer into mammalian cells . Since tin vitro generated RNA to nucleate retroviral virions, completely circumventing packaging cell genomic transcription and translation promoter . This ex) Figure . pT is sWhen transfected into packaging cells, the standard retroviral vectors (pC) produced high levels of GFP expression as measured by flow cytometry Figure . Howeverin vitro transcription system based vectors (pT) carrying the same CMV expression cassette readily generated infectious virus following transfection of in vitro transcribed RNA genomes into packaging cells. The pT vectors produced no detectable GFP expression in the packaging cells, due to the lack of requisite translation signals (e.g. 5' cap) on the RNA transcripts, a notable advantage of the system . Primarin vitro-transcribed retroviral RNA genomes can be utilized to transfer a high-level expression cassette which includes genetic elements not compatible with commonly used retroviral packaging systems. Using this cassette we observe an increase in expression level of up to 3.5 times in primary human cells, reflecting the provision of an intron and the use of strong enhancer/promoter and polyadenylation signals. The ability to circumvent packaging cell transcription, post-transcriptional editing and translation of the vector genome, while maintaining assembly into virions, effectively addresses the shortcomings of current retroviral systems. Thus, this approach is based on standard molecular biology techniques, yet allows virtually any genetic sequence constellation to be manifested by the integrated retroviral provirus: Strong enhancers/promoters, introns and polyadenylation signals for boosting gene expression; gene reporters that encompass multiple exon-introns; post-transcriptional signal sequences to improve gene trapping; cytotoxic gene expression or shRNA expression cassettes that target essential genes.In this report we demonstrate how Vectors pT-cGreen/neerGc L311/L312) were based on vector L139 pT7RU5mcsSIN, a derivative of LB-G were bas. A T7 poTo generate the uncapped retroviral genomic transcripts, MluI-linearized pT-vector DNA was transcribed with T7 polymerase . RNA was quantified and the quality checked by denaturing agarose gel electrophoresis were transfected into 293-based Phoenix A packaging cells by the standard protocol ,15 whichin vitro transcribed genomic RNA was introduced into the packaging cells using the cationic lipid DMRIE-C . The RNA was mixed with lipid at a ratio of 1 μg RNA to 3.5 μl DMRIE-C in a final volume of 250 μl of serum-free OptiMEM and incubated at room temperature for 20 minutes. Subconfluent (80%) Phoenix-A packaging cells in poly-lysine coated 12-well plates were prepared by rinsing with serum-free medium and 360 μl OptiMEM was added per well. The RNA-lipid mixture was added dropwise to the cells and incubated for 2 hours before the cells were washed and incubated in complete medium. pT virus-containing medium (1 ml) was harvested 18 hours later. Titers were typically approximately 1 × 105 gfu/ml for infection of primary human endothelial cells [The al cells .Primary human umbilical vein endothelial cells were cultured according to the supplier's recommendations. Cells were infected as described . Viral sAll authors participated in the overall study design and writing of the manuscript. MB/DM conducted the experiments in the laboratory of JBL. All authors have read and approved the final manuscript.

The CCP11 project [2] aims to foster bioinformaticsin the UK through conferences, workshops andthe provision of Web resources. In March 2002,CCP11 held a meeting in Manchester, UK, on thefunctional analysis of microarrays. This was part ofManchester BioinformaticsWeek—three consecutiveshort bioinformatics meetings held in the attractivesetting of the Chancellor's Conference Centreat the University of Manchester. The other meetingsin the series were a workshop on ontologiesand the 12th Annual MASAMB Conference.Many delegates were able to attend more thanone meeting, which led to a useful cross-fertilizationof ideas across the bioinformatics community. TheCCP11 meeting shared with MASAMB a strongemphasis on the statistical analysis and interpretationof data—most often image intensity data.

The paper presents the Motor Function Neurological Assessment (MFNU), as a tool for identifying typical motor function problems in children with Attention Deficit Hyperactivity Disorder (ADHD). The study investigated motor functions in boys diagnosed with Hyperkinetic Disorder . HKD corresponds to the ADHD-combined (ADHD-C) diagnosis in the DSM-IV. The paper addresses the ability of the instrument to discriminate between non-medicated boys with HKD and a control group consisting of normal non-referred boys without any clinical significant ADHD symptoms.25 drug-naïve boys, aged 8–12 years and recently diagnosed as HKD F90.0, were compared with 27 controls, all boys in the same age range, on 17 MFNU subtests, and with a 'Total score' parameter.On the individual subtests 80–96% (median 88%) of the ADHD group showed 'moderate' to 'severe' problems, compared to 0–44% (median 14.8%) within the control group. The percentage of 'severe problems' ranged from 44–84%, (median 64%) in the ADHD group, and 0–44% (median 0%) in the control group. The highly significant differences found between the groups on all subtests, and on the Total score scores, indicated that the MFNU had a high discriminative power when children with ADHD and normal controls were compared. The Total score parameter seemed to be a meaningful discriminator of a common underlying factor of the 17 subtests used in the study.The study confirms our clinical findings that the MFNU measures a consistent pattern of motor function problems in children with HKD, and that these problems are rarely represented in individuals without ADHD. Further research is needed to investigate to what extent the MFNU taps motor problems that are truly specific to ADHD, in contrast to motor problems common to children with DCD or other clinical problems. The Motor Function Neurological Assessment (abbreviated MFNU in the Norwegian edition of 'Motorisk Funksjonsnevrologisk Undersøkelse') has been developed over a 25 year period based on clinical observations and assessments of children referred for evaluation of possible Attention Deficit Hyperactivity Disorder (ADHD). The individual subtests were for a large part based on a wide representation of established tests of motor functions in children . The selWhen parents and teachers were asked to describe the individual children problems besides ADHD symptoms, they rarely mentioned problems with motor skills. On the contrary, motor skills were very often rated as major assets. Our experience is in accordance with Fliers et al. . They foA close examination of the specific motor tasks involved in the MFNU subtests indicated that the children had problems with motor inhibition. The children with ADHD also displayed increased muscle tone in the gross movement muscles (e.g. m. Iliopsoas and m. Latissimus dorsi) restricting movements of shoulders, arms and thorax. In most cases we found little or no training effect even after prolonged training periods focusing on the special tasks involved in the subtests. We also observed marked improvements in performance on the MFNU 1 1/2 hour after administration of central stimulants . When the physiological effect of the stimulant subsided, the motor problems returned undiminished. We observed this pattern even in individuals who had been medicated with MPH for many years . An examThe definition of ADHD used in Norway, and in our work, is based on the International Classification of Diseases ICD-10) diagnosis hyperkinetic disorders . HKD usually arises in the first 5 years of life. Six or more symptoms of inattention, three or more symptoms of hyperactivity and one or more symptoms of impulsiveness are necessary for the diagnosis diagnosi. The AmeIn its definition of HKD the ICD-10 states that: "Impairment of cognitive functions is common, and specific delays in motor and language development are disproportionately frequent." . There iPitcher et al. have demAn overlap of 30–50% has been reported between ADHD and the DCD diagnosis ,26,27. DRasmussen and Gillberg found thStray and StraMotor inhibition problems typically reported in the ADHD literature are mainly associated with higher order executive functions like motor planning, timing and evaluation . Our cliAltered brain activity is found in the right inferior frontal cortex, left sensorimotor cortex, and bilateral cerebellum and the vermis as well as in the right anterior cingulated cortex, left sensorimotor cortex, and bilateral brainstem in children with ADHD during resting-state . BerquinProblems with motor inhibition are observed with the MFNU both at the fine and gross motor level through varying motor tasks performed by the child, and in examinations of passive movements. A typical characteristic is increased muscular tone when flexion-extension movements are repeated several times in succession, resulting in a restricted movement range and in jerkiness of the movement. Such a restriction can be illustrated by the subtest 'Thumb movement' is partly connected to the reticular formation in the brainstem . Stray and StraThrough the development period of the MFNU motor inOur research questions were:To what extent do children with ADHD-C/HKD show motor problems, as measured by the MFNU, and how well does the test discriminate between children with ADHD and normal controls? We hypothesized that children with ADHD-C/HKD would display consistently high problem scores, and show significantly more motor problems on all the subtests of the MFNU, used in this study, compared to children without ADHD.Fifty-two boys, all Caucasian Norwegians, participated in the study. Informed consent was given by the parents. Twenty-five drug naïve boys, aged 8–12 , out-patients of the Child Psychiatry Department of the Regional Hospital in Kristiansand participated to this study. They were recently diagnosed as HKD F90.0 .Twenty-seven boys, all Caucasian Norwegians, aged 8–11 years (Mean age 9.5 SD 1.1) without ADHD were recruited from two local schools, one for young and one for older children, to the control group. The schools were located in a suburban area with a predominantly Caucasian, low middle class population with no known history of socio-cultural problems. Written permission was obtained from the Local Education Authority of the municipality. A letter with information about the project, and Barkley's DSM-IV rating scale of ADHD was distWISC-R testing was not carried out in the control group due to resource constraints. Time restrictions and the special recruitment procedures applied, involving only freshly diagnosed children, prohibited a close matching of age between the groups. This resulted in a slightly older ADHD group, difference between mean age = 0.7 years, p < .05. Matching of socio-economic background was not performed for the same reasons.The MFNU was developed by the first author during the 1990-ies in close collaboration with well-educated and specialized personnel trained within the fields of ADHD, learning and behavioral problems. Some of the subtests were originally developed, and some are modified versions of subtests of the Danish 'Funksjonsnevrologisk Undersøgelse (FNU)' . The subIn MFNU a qualitatively based scoring system is used. The test is performed in a very "dynamic" and interactional way with no limits concerning time and number of attempts in order to focus the attention of the child ,9.Most of the subtests of the MFNU within the total set of subtests making tThe MFNU is described in detail in a user manual and an accompanying DVD . Table 1MFNU is scored on a sheet applying a ranked 3-category format 0-1-2). The subtests are scored according to the criteria in Table . The subNormally when evaluating test-retest changes in performance with the MFNU a 7-category scoring system is used . This syPreliminary inter-rater reliability analyses have shown high to very high degree of agreement among raters on all subtests (Cohen's Kappa ranging from 0.67 to 1.00) [The present study involved two assessments with MFNU for all children 'Assessment 1' (A1) and 'Repeated assessment' (A2), with at an interval of at least 1 day . The repeated assessment (A2) was performed in order to investigate possible training effects due to repeated testing. To prevent possible negative test results due to distraction or to emotional reactions to an unfamiliar situation, the ADHD group was given a preliminary session introducing the test situation and the different subtests to the parents and child. The assessment of the ADHD group took place at the hospital with the parents being present.The control group was assessed at school. Practical restraints prohibited a preliminary consultation and participation of the parents during the assessment. Practical considerations and limited resources made it necessary to test the ADHD- and control group in different environments, thus prohibiting a blinded design. The subjects were assessed individually by a physiotherapist (the first author of this article) and videotaped by the physician (the fourth author). The videotapes were rated at a later point in time by a physiotherapist with no prior experience with the children. This physiotherapist had long experience both with administering the MFNU and with video rating MFNU sessions. To evaluate differences in performance between the two sessions, two parallel monitors were used. One scoring sheet was used for both assessments.The statistic analyses were carried out using SPSS software 15.0. Descriptive statistics were used on data from each subtest in the ADHD and control group in order to view the percent distribution of the scoring categories (0-1-2) and on the variable 'Total score' which is the sum of the scores on 17 subtests. 'Total score' ranged from 0 – 34. The non-parametric Mann-Whitney U-test was used to compare the ranked scores of the ADHD and control group on each of the 17 subtest. Since the data were not assumed to be normally distributed, the Mann-Whitney test was used to compare the ADHD- and control group on the 'Total score'. Pearsons Chi square test was used, due to the small group sizes, when examining possible effects of age on motor performance. A Cronbach alpha analysis was performed to establish the internal consistency of the total set of subtests. The Wilcoxon Signed Rank Test for related samples was used to compare changes in performance on repeated measurements.The study was approved by The Norwegian Data Inspectorate, The Regional Committee for Medical Research Ethics, the research committee and the director of medicine at the Department of Child Psychiatry, Sørlandet Hospital, Kristiansand, Norway, and the school authorities at the municipality of Songdalen, Norway, where the control group was recruited.The ADHD group showed a high percentage of 'severe problems' (score 2) in most of the subtests, most pronounced in the 'Passive abduction of hip' subtests 13–14) with a 'severe' score in 80–84% of the cases. When the 'moderate problems' and 'severe' scores (score 1 and 2) were combined, the ADHD group presented problems within a range of 80% to 96% . The control group typically presented few, if any severe problems , while the rest of the subtests showed p < .001. The differences were most pronounced in the youngest children (8–10 years). However, significant differences were also obtained between the older children with ADHD and the control group on all the subtests except for 'Catch ball' (see Table When split into two age groups (12 subjects were < 11 and 13 were > = 11 years) the older ADHD group performed significantly better than the younger group on two subtests, 'Reciprocal coordination' and 'Walking' (p < .05 using Pearsons Chi square test).Table Figure Mann-Whitney U-tests showed that the ADHD group (Median = 28) had significantly more motor problems than the control group (Median = 1) both on A1: U = 26.6, p < .0001, and on A2: ADHD group (Median = 29), control group (Median = 1): U = 8.5, p < .0001. Cohen's δ of the 'Total score' between the groups on A1 was 1.67.Wilcoxon signed ranks tests were performed on each subtest score and 'Total score' of the A1 and the A2. No significant improvement was obtained on individual subtests or for the 'Total score' within the ADHD group. For the control group a minor, but significant improvement was found for the 'Total score' (p < .05). Motor problems in the control group were most frequent on the subtests '07 Catch ball' and on '03–04 Diadochokinesis', and least frequent on the 'Passive movement' (13–16) and on the 'Extension' subtests (10–12). In the control group, the two subjects with the highest 'Total score' score (14 and 20), both referred for physiotherapy after the study, showed little or no problems on the passive movement subtests and only moderate problems on the extension subtests. In the ADHD group the strongest differences from the control group were found on the 'Passive movement' and 'Extension' subtests.Our hypothesis that there is a discriminative power of the MFNU between boys aged 8–12 years with ADHD (HKD F90.0) and controls without ADHD was strongly supported by the test data across all subtests. Most of the ADHD-subjects achieved a marked to severe 'Total score'. While there were subjects in the control group who showed problems on some of the subtests, the problems appeared on fewer subtests and with less severity than in children in the ADHD group. There were no significant improvements in performance from A1 to A2 within the ADHD group. The high incidence of motor problems within the ADHD group, on all subtests of the MFNU, and the lack of training effect from repeated exposures to the subtests was consistent with our previous clinical observations.The passive movement subtests (13–16) discriminated strongly between the groups. These results seem to confirm our clinical observations that high muscle tone and neuromuscular inhibition problems seen in ADHD are not associated with inattention or impulsivity. Problems involved in the passive movement- and extension tests are not part of the criteria for DCD. These subtests were specifically designed for the MFNU, and are not included in standard motor assessment batteries. On the item 'Passive movement of the right foot' 100% of the controls showed no restriction against the passive movement, whereas 92% of ADHD group had a score of 1 or 2 on this item.repeated movements are emphasized in many subtests in order to reveal increasing inhibition problems when the movements are performed repeatedly. These aspects of motor inhibition problems are usually not assessed in traditional standardised tests, increasing the likelihood of overlooking significant problems.We found that motor problems are present in a higher percentage in the ADHD group . LLS receive 9%, TS 3% and SI 3% royalties.LLS has been the main contributor both in conception, design, acquisition, analysis and interpretation of data. She also is the main contributor in the drafting of the manuscript.TS has been involved in the analysis and interpretation of data, and in the drafting and revision of the manuscript.SI has been a contributor in the conception, design and revision of the manuscript.AR has been a contributor to the conception, design and acquisition of data.BE has contributed to the conception, design, interpretation of data and in revising the drafts of the manuscripts. He has given final approval of the version to be published.FET has been involved in the data analysis and in final revision and approval of the manuscript.Thumb movement ADHD no medication. This movie shows the MFNU subtest 'Thumb movement' performed by a child diagnosed with ADHD-C/HKD. The child had not received MPH the current day or the day before. The move is from the DVD accompanying the MFNU manual [U manual .Click here for fileThumb movement ADHD with MPH. This movie shows the MFNU subtest 'Thumb movement' performed by a child diagnosed with ADHD-C/HKD. The movie was made 1 1/2 after medication with 10. mg MPH on the same day as the previous movie. The move is from the DVD accompanying the MFNU manual [U manual .Click here for file01_Dynamic balance – 2 legs. This movie shows the MFNU subtest 01 'Dynamic balance – 2 legs' performed by a child without ADHD or motor problems. The move is from the DVD accompanying the MFNU manual [U manual .Click here for file02_Dynamic balance – 1 leg. This movie shows the MFNU subtest 02 'Dynamic balance – 1 leg' performed by a child without ADHD or motor problems. The movie is from the DVD accompanying the MFNU manual [U manual .Click here for file03 and 04_Diadochokinesis – right and left. This movie shows the MFNU subtests 03 and 04 'Diadochokinesis – right' and 'Diadochokinesis – left' performed by a child without ADHD or motor problems. The move is from the DVD accompanying the MFNU manual [U manual .Click here for file05_Reciprocal coordination. This movie shows the MFNU subtest 05 'Reciprocal coordination' performed by a child without ADHD or motor problems. The move is from the DVD accompanying the MFNU manual [U manual .Click here for file06_Thumb movement. This movie shows the MFNU subtest 06 'Thumb movement' performed by a child without ADHD or motor problems. The movie is from the DVD accompanying the MFNU manual [U manual .Click here for file07_Throw ball. This movie shows the MFNU subtest 07 'Throw ball' performed by a child without ADHD or motor problems. The movie is from the DVD accompanying the MFNU manual [U manual .Click here for file08_Catch ball. This movie shows the MFNU subtest 08 'Catch ball' performed by a child without ADHD or motor problems. The movie is from the DVD accompanying the MFNU manual [U manual .Click here for file09_Walking. This movie shows the MFNU subtest 09 'Walking' performed by a child without ADHD or motor problems. The movie is from the DVD accompanying the MFNU manual [Click here for file10_Lifting arm. This movie shows the MFNU subtest 10 'Lifting arm' performed by a child without ADHD or motor problems. The movie is from the DVD accompanying the MFNU manual [U manual .Click here for file11_Lifting leg. This movie shows the MFNU subtest 11 'Lifting leg' performed by a child without ADHD or motor problems. The movie is from the DVD accompanying the MFNU manual [U manual .Click here for file12_Flying. This movie shows the MFNU subtest 12 'Flying' performed by a child without ADHD or motor problems. The movie is from the DVD accompanying the MFNU manual [U manual .Click here for file13 and 14_Passive abduction – right and left hip. This movie shows the MFNU subtests 13 and 14 'Passive abduction – right hip' and Passive abduction – left hip' performed by a child without ADHD or motor problems. The movie is from the DVD accompanying the MFNU manual [U manual .Click here for file15 and 16_ Passive movement – right foot and left foot. This movie shows the MFNU subtests 15 and 16 'Passive movement – right foot and left foot' performed by a child without ADHD or motor problems. The movie is from the DVD accompanying the MFNU manual [U manual .Click here for file17_Synkinesis. This movie shows the MFNU subtest 17 'Synkinesis'performed by a child without ADHD or motor problems. The movie is from the DVD accompanying the MFNU manual [U manual .Click here for file

Renal disease is one of the top 10 leading causes of death, and the incidence of end-stage renal disease in Taiwan is the highest in the world. Many dietitians consider the diet of plant origin consumed by vegans to be ‘lighter’ and ‘more healthful’ than the diet of both plant and animal origin consumed by omnivores. Dietary protein has significant effects on renal functions. The study explored the effects of both the diets on renal functions. The study subjects included 102 Buddhist nun vegetarians and an equal number of matched control group (omnivores). A cross-sectional study was performed to investigate the effects of the diet of plant origin and the diet of both plant and animal origin on renal functions. There was no difference in the renal functions between the two groups. However, systolic blood pressure, blood urea nitrogen, serum sodium, glucose, cholesterol levels, and urinary specific gravity were lower in the vegetarian group. Although these results were compatible with general concepts regarding diet of plant origin, after adjusting for age, the duration of intake of this diet had no effect on the renal functions. Based on the findings, it is concluded that the renal functions, in terms of the estimated glomerular filtration rate, were not different between the vegetarians and the omnivores. In the last few years, renal disease has become one of the 10 leading causes of death in Taiwan. Results of an analysis of the United States Renal Data System (USRDS) showed that the incidence rates of reported end-stage renal disease (ESRD) in 2007 were the highest in Taiwan, at 415 per million population, followed by Mexico, the United States, Japan, and Turkey, at 372, 361, 285, and 229 per million population respectively , and education level-matched vegetarian to omnivorous female subjects. The final number of the study subjects included 102 vegetarians and 102 omnivores. Subjects diagnosed with chronic renal diseases in both vegetarian and non-vegetarian groups were excluded.We collected fasting blood samples for studying both routine biochemical screening of renal disorders and lipid profile. The study used the Olympus AU-2700 and the SYSMEX XE-2100 to measure the biochemical components. These measurements included blood urea nitrogen (BUN), serum creatinine, sodium, potassium, chloride, calcium, phosphorus, uric acid, albumin, fasting plasma glucose, triglycerides, and total cholesterol. The Medical Laboratory of the Chung Shan Medical University Hospital analyzed all the samples.We used serum creatinine, age, and gender to calculate the estimated glomerular filtration rate (eGFR) according to the equation of simplified modification of diet in renal disease (MDRD) . Table 1The Bureau of Health standards for Taiwan considers a BMI of >24 to be normal and BMI of <18 to be abnormal. Systolic blood pressure of >130 mmHg and/or diastolic blood pressure of >80 mmHg is defined as high blood pressure. Hyperglycaemia is defined as fasting plasma glucose of >100 mg/dL while hypertriglyceridaemia is defined as serum triglycerides of >150 mg/dL. Hypercholesteraemia is the serum total cholesterol of >200 mg/dL. Serum creatinine and BUN are elevated if the serum levels are >1.3 mg/dL and >20 mg/dL respectively. A serum sodium level of >145 mEq/L is seen as hypernatraemia. Hyperuricaemia is serum uric acid of >6 mg/dL. Abnormal urine is an elevated specific gravity (>1.020) of urine, proteinuria, haematuria, and pyuria when urine dipstick chemical analysis showed 1+ of protein, occult blood, or leukocyte esterase.t-test, regression model, and chi-square analysis. Data were analyzed using the SPSS software (version 12).The study used descriptive analysis, Each group had 102 female subjects, and their mean age was 46.6 years . Of the 2 in the vegetarian group and 79.0 mL/minute/1.73 m2 in the omnivorous group without any significant difference.The proportion of subjects with hypernatraemia and hypercholesteraemia was significantly (p<0.05) lower in the vegetarian group. Other biochemical parameters, including hyperuricaemia, hyperglycaemia, hypertriglyceridaemia, and eGFR, did not show any significant differences.The proportion of subjects with elevated urinary specific gravity was significantly lower in the vegetarian group . However, other parameters, including proteinuria, haematuria, pyuria, and bacteriuria, were not different.The results indicated that the diet of vegetarians might have affected some parameters. et al. in Taiwan showed blood pressure, cholesterol level, and glucose level to be significantly lower in female vegetarians when compared those in female omnivores. However, this was not evident in male subjects (et al. (A few studies have explored the effects of diets consumed by vegetarians and omnivores on the nutrition status. Results of a study by Ko subjects . The presubjects ,14. In a (et al. .Diastolic blood pressure was significantly higher in the vegetarian group that was discordant with the previously-mentioned Ko study that demonstrated significance only in the female group . TherefoAnother study in Thailand revealed a significantly-lower level of BUN, BUN/creatinine ratio, and a lower urinary protein excretion rate in vegetarians . Our stuThe results of the present study showed that renal functions were not different between the vegetarians and the omnivores. Systolic blood pressure, BUN and sodium, glucose, cholesterol levels, and urinary specific gravity were lower in the vegetarian group. Although these results are compatible with general expectations, after adjusting for age, diet had no effect on renal function. On the other hand, there was a slightly-higher diastolic blood pressure in the vegetarian group. The vegetarians appeared to have lower systolic blood pressure, BUN, BUN/creatinine ratio, sodium, and fasting plasma glucose. Further research should continue to monitor and study the meanings of these parameters.

In the crystal structure, weak inter­molecular C—H⋯O hydrogen bonds link mol­ecules into chains propagating along the b axis.In the title mol­ecule, C Åb = 12.951 (3) Åc = 22.457 (5) ÅV = 2791.3 (10) Å3Z = 8Kα radiationMo −1μ = 3.13 mmT = 153 K0.22 × 0.18 × 0.12 mmBruker P4 diffractometerXSCANS; Bruker, 1999Tmin = 0.546, Tmax = 0.705Absorption correction: gaussian (17640 measured reflections2460 independent reflectionsI > 2σ(I)2127 reflections with Rint = 0.043R[F2 > 2σ(F2)] = 0.032wR(F2) = 0.083S = 1.092460 reflections174 parametersH-atom parameters constrainedmax = 0.56 e Å−3Δρmin = −0.63 e Å−3ΔρXSCANS used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536809047151/cv2652sup1.cifCrystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809047151/cv2652Isup2.hklStructure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:

Helicobacter pylori (H. pylori), was recently proposed to stimulate c-Met phosphorylation dependent upon interaction of c-Met with the bacterial CagA protein required for H. pylori-induced cancer cell motility and invasion.The hepatocyte growth factor (HGF) receptor, c-Met, is strongly implicated in late-stage cancer progression and poor patient prognosis. The stomach pathogen, In this report, we employed short hairpin RNA (shRNA), western blot analysis using antibodies recognizing phosphorylation at discrete c-Met residues, and immunofluorescence microscopy to investigate the CagA-c-Met interaction.H. pylori-induced cell motility, suggesting that c-Met was not required for motility. Surprisingly, c-Met knockdown did not reduce the level of an H. pylori-induced protein recognized by a phospho-c-Met antibody. This 125 kD protein was 10 kD smaller than c-Met, suggesting that H. pylori did not phosphorylate c-Met but cross-reacted with another protein. This hypothesis was confirmed when c-Met phosphorylation inhibitors did not lower the levels of the bacteria-induced 125 kD protein, and c-Met immunoprecipitation (IP) did not detect this 125 kD protein from H. pylori-treated lysates. This protein was identified as a product of antibody cross reactivity with phosphorylated CagA. We also confirmed that CagA interacts with c-Met, but this interaction may have caused previous authors to misinterpret phosphorylated CagA as c-Met phosphorylation. Finally, pretreatment with the proteasomal inhibitor, lactacystin, caused prolonged HGF-induced c-Met phosphorylation and facilitated a CagA-negative H. pylori to stimulate AGS cell motility, suggesting that sustained c-Met phosphorylation compensates for the loss of CagA-dependent signaling.The data showed that shRNA-mediated c-Met knockdown did not reduce H. pylori stimulates cancer cell motility independent of the c-Met receptor. We further hypothesize that although H. pylori does not target c-Met, the bacteria may still utilize c-Met effector signaling to stimulate CagA-independent cancer cell motility, which may provide a further mechanism of H. pylori-dependent gastric cancer progression.These data demonstrate that Helicobacter pylori (H. pylori).[H. pylori-mediated disease progression, including gastritis, mucosal ulceration, and gastric cancer, is dependent upon the bacterial components expressed. The cag pathogenicity island (cag PAI) contains 32 genes that mostly encode components of a putative type IV secretion system (TFSS), which facilitates transfer of bacterial products into host cells. The CagA protein is also expressed from the cag PAI, and is the only known protein to be delivered through the TFSS into epithelial cells.[Each year approximately 800,000 people are diagnosed with and 700,000 people die from gastric cancer, the second leading cause of cancer-related deaths worldwide.2 Many fa pylori).4 H. pyloal cells. On transal cells.–9 CagA tal cells.–13The MET proto-oncogene encodes c-Met, a transmembrane tyrosine kinase receptor that binds to hepatocyte growth factor (HGF), a potent mitogenic and motogenic factor. Dysregul18H. pylori strains.[et al, reported that c-Met was phosphorylated in response to coculture with CagA+ H. pylori, although the mechanism of c-Met activation was not elucidated.[H. pylori, and that this interaction is necessary for the motile phenotype to occur.[H. pylori-induced cell invasion requires c-Met activity.[H. pylori may not only play a role in gastric carcinogenesis, but also in the progression of the tumor to the later stages of invasion and metastasis through the CagA-dependent activation of the c-Met receptor.Previous data indicated that cancer cells exhibited a “hummingbird” phenotype indicative of EMT in response to coculture with CagA+ strains. Churin eucidated. This groto occur. The dataactivity. These reH. pylori-dependent cell motility. Surprisingly, shRNA-mediated c-Met knockdown did not block H. pylori-induced cancer cell motility or phosphorylation of a protein 10 kD smaller than c-Met as detected by western blot analysis. Additionally, a c-Met pharmacological inhibitor also failed to block H. pylori-stimulated phosphorylation of this 125 kD protein. These data suggest that c-Met is not required for H. pylori-induced cell motility, and further experiments led us to conclude that although CagA and c-Met interact, H. pylori does not target c-Met activation to induce cancer cell motility. We also provide an explanation of how a previous group misinterpreted phosphorylated CagA for phosphorylated c-Met.In this study, we investigated the role of c-Met in H. pylori, we present evidence suggesting that sustained c-Met phosphorylation, which is detected in the majority of gastric adenocarcinomas, can rescue cell motility in response to H. pylori CagA-negative strains. Based on this observation, c-Met may still influence H. pylori-associated gastric cancer cell motility and tumor progression in vivo.Although c-Met is not targeted by AGS gastric adenocarcinoma cells were cultured in Ham's F-12 as previously described. DU145 prμM) or overnight prior to the addition of bacteria. Human recombinant HGF was obtained from EMD Biosciences , and used at a concentration of 33 ng/mL.The pharmacological inhibitor SU11274 was obtained from EMD Biosciences ; sodium orthovanadate from Fisher Scientific ; and lactacystin from Sigma . For experiments, cells were pretreated with inhibitors for one hour ; 11637 ; and Tx30a , were obtained from ATCC and grown on trypticase soy agar plates supplemented with 5% adult defibrinated bovine blood at 37°C in 5% CO2 overnight prior to use in experiments. H. pylori mutant strains with disrupted cagA (60190ΔcagA), cagE (60190ΔcagE), and vacA (60190ΔvacA) genes were a kind gift from Dr. Richard Peek . These strains were grown on the same plates as wild-type bacteria, but under kanamycin selection (50 μg/mL). Bacteria were passaged daily, and fresh bacteria were thawed on a monthly basis.The fx monochrome CCD camera with IPLab 3.7 for Windows software package . Images were then processed with ImageJ software (NIH).Infection of AGS and DU145 cells and scatter assays were performed as previously described. All micrY1234/35 , total c-Met , or phospho-c-MetY1230/34/35 were used. The membranes were stripped using western re-probe . Densitometric analysis was performed using ImageJ software (NIH).The lysates from cells cocultured with bacteria were collected as previously described. AntibodiAssay derived from colloidal gold phagokinetic assay as described previously.27μg/mL).The stable AGS and DU145 cell lines expressing shRNAs and targeting c-Met were generated using MISSION shRNA lentivirus particles (Sigma) according to the manufacturer's protocol, and were briefly described previously. The MISSμM lactacystin, 10 mM NaF), rocked at 4°C for one hour, and cell debris was pelleted by centrifugation. Conversely, lysates were collected using a more strident lysis buffer , 2 mM sodium orthovanadate, 10 μM lactacystin, 10 mM NaF) that prevented Co-IP (unpublished data). Supernatants were pre-cleared for one hour with protein A/protein G plus agarose and normal IgG . Lysates were then incubated with the primary antibody overnight at 4°C. Agarose was added for four hours and pelleted by centrifugation, and pellets and supernatants were boiled in protein loading buffer for 5 min prior to western blot analysis. The antibodies used were CagA or c-Met .For co-immunoprecipitation (Co-IP) experiments, cells were collected in ice-cold lysis buffer , 2 mM sodium orthovanadate, 10 H. pylori-induced cancer cell motility, we generated AGS cells that stably expressed shRNAs targeting c-Met (shMET). These cells exhibited a reduction of 90–95% in c-Met expression compared to AGS cells stably expressing shRNAs targeting GFP (shGFP) as a control [H. pylori 60190 [H. pylori-stimulated cell motility, we applied a colloidal gold motility assay to our overnight coculture experiments.[H. pylori-stimulated cell motility in shMET cells compared to WT and shGFP cells. These data suggest that H. pylori stimulates cell motility independent of c-Met.To investigate the role of c-Met in control . Surprisri 60190 . To deteeriments. Briefly,H. pylori-stimulated c-Met phosphorylation in a CagA-dependent manner.[H. pylori strain stimulated c-Met phosphorylation in a CagA-dependent manner, AGS gastric cancer cells were cocultured for two hours with H. pylori 60190 , Tx30a , or isogenic mutants of H. pylori 60190 lacking functional cagA (60190ΔcagA), cagE , or vacA (60190ΔvacA). Lysates were then collected, and phosphorylation of the c-Met tyrosine kinase domain residues 1234 and 1235, indicative of receptor activation, was detected by Western blot analysis using a commercial antibody specific to phosphorylation at these residues (pMET (Y1234/35); Cell Signaling). As shown in cagA and 60190ΔcagE lysates suggested a requirement for CagA delivery into host cells via the TFSS.A single report suggested that t manner. To deterH. pylori-induced phosphorylation of the 125 kD protein in a much more sustained fashion [Figures H. pylori-induced phospho-protein in both DU145 [H. pylori stimulates sustained phosphorylation of a cleaved version of c-Met, or 2) that this 125 kD band detected using a phospho-c-Met-specific antibody is not c-Met. The next section will present data supporting the second possibility.The c-Met receptor migrating at 135 kDa was phosphorylated within 5 min upon addition to HGF in AGS cells; phosphorylation peaked 10 min, and was attenuated over the next 60 min . While D Figures and C. Oth DU145 and AGS th DU145 . These oHGF stimulates rapid, but transient, c-Met phosphorylation. AGS cells were treated with HGF, and lysates were collected at the indicated time points. Phospho-c-Met was detected by Western blot analysis using the phospho-c-Met (Y1234/35) antibody. Tubulin was probed as a load controlH. pylori-induced cell morphological changes and motility, these cells were employed to determine if c-Met expression knockdown prevented the appearance of the 125 kD H. pylori-induced phospho-protein. The western blot analysis of AGS shMET lysates revealed no change in levels of the phospho-125 kD protein (using the phospho-c-Met (Y1234/35) antibody) as compared to shGFP cells after one hour in the presence of H. pylori 60190 [Since AGS shMET cells exhibited no change in ri 60190 , suggestH. pylori-dependent 125 kD phospho-protein in shMET DU145 prostate tumor cells. Based on the signal seen for the 125 kD band, one could also argue that we see less of the 125 kD protein in shMET cells. But a second, more representative blot [H. pylori 60190 stimulated the morphological changes in shCtrl DU145 cells indicative of motility, while shMET cells did not respond morphologically to HGF, but still scattered in response to H. pylori coculture [H. pylori neither requires nor stimulates c-Met activation to induce cell motility. The following sections will further demonstrate that the 125 kD phospho-protein is not c-Met, but is in fact phosphorylated CagA that is recognized by a cross reactive antibody generated against phospho-Met.To determine if this result was cell-specific, and to address HGF-mediated signaling in shMET cells, we generated DU145 prostate cancer cells that stably express the shRNAs targeting c-Met (shMET). ive blot and densive blot . Finallyoculture . These dH. pylori specific 125 kD phospho-protein is not c-Met, AGS parental cells were cocultured with H. pylori 60190 or H. pylori 60190ΔcagA for one hour alone or in the presence of HGF. Lysates were then analyzed by Western blot analysis for c-Met phosphorylation at Y1234/35 [H. pylori-induced 125 kD phospho-protein required bacterial production of CagA for detection, as the CagA mutant strain was unable to stimulate phosphorylation of this protein. Furthermore, the addition of HGF to cells cocultured with H. pylori 60190 resulted in the detection of both the 135 kD HGF-dependent and the 125 kD H. pylori-dependent protein. These data further suggest that the 135 kD phospho-Met is still present in cell exposed to HGF and H. pylori, implying the 125 kD protein is not a cleavage product of c-Met.To further demonstrate that the Y1234/35 . The H. H. pylori, lysates were collected, and c-Met was immunoprecipitated under conditions that prevented protein Co-IP (see Methods). In H. pylori supernatant; further suggesting that H. pylori does not target the c-Met receptor.Additionally, if the 125 kD protein was a truncated form of c-Met, then both the 135 and 125 kD proteins would be identified by IP using a specific c-Met antibody. To test this, AGS cells were pretreated with HGF or H. pylori. As shown in H. pylori-induced 125 kD phospho-protein was still detected using higher concentrations of the c-Met inhibitor.Next, cells were pretreated with the c-Met kinase inhibitor, SU11274, prior to treatment with HGF or H. pylori-treated lysates by Western blot analysis using another commercially-available phospho-c-Met antibody . As shown in H. pylori-induced 125 kD band was only detected using the Cell Signaling antibody, suggesting that the antibody is cross reacting with another protein.Our data strongly suggest that the 125 kD phospho-protein is not c-Met, although the protein was detected by Western blot analysis using Cell Signaling antibodies presumed to be specific to phosphorylated amino acids found only in c-Met. To test if the 125 kD protein is a product of cross reactivity, we examined the presence of phosphorylated proteins in HGF- or et al., described H. pylori-induced c-Met phosphorylation using serum-starved AGS cells cultured in RPMI growth medium.[H. pylori-dependent c-Met phosphorylation, AGS cells cultured in either complete or serum-free RPMI or Ham's F12 were cocultured with H. pylori 60190 for one hour, and Western blot analysis was performed to detect phosphorylated c-Met with the Biosource antibody. H. pylori-stimulated c-Met phosphorylation, since neither the presence of serum nor the change in growth medium caused detection of c-Met phosphorylation using the phospho-c-Met-specific antibody from Biosource.Churin, h medium. Our inabH. pylori does not target c-Met, we next investigated the identity of the 125 kD band detected using the Cell Signaling phospho-c-Met antibodies. Based on our data that the appearance of this phospho-protein was CagA-dependent [Figures H. pylori-treated cells using the Cell Signaling phospho-c-Met (Y1234/35)-specific antibody (left panel). Membranes were then stripped and probed for total CagA (right panel). The similar migration observed between the H. pylori-dependent 125 kD protein and CagA suggested that the lower molecular weight band detected using the phospho-c-Met antibody is a product of antibody cross-reactivity to CagA. This conclusion was supported by an experiment in which CagA was immunoprecipitated from lysates of AGS shGFP and shMET cells cocultured with H. pylori 60190 [H. pylori, and this protein correlated in size with the immunoprecipitated CagA.Since these data suggest that Figures and 4A ari 60190 . WesternH. pylori strains (60190 or 11637) for one hour, and lysates were then analyzed by western blot analysis for c-Met phosphorylation and CagA size. As shown in H. pylori 11637 exhibited a phospho-protein similar in size to the HGF-induced phospho-c-Met band (135 kD) and larger than the 60190-associated band (125 kD). This blot was then stripped and probed for total c-Met, and we detected no change in c-Met size in all lysates, demonstrating that H. pylori does not modify the size of c-Met. We also probed for total CagA on these blots, which indicated that the size difference between 60190 and 11637 correlates with the H. pylori-associated band size differences detected with the Cell Signaling antibody. These data strongly suggest that the phospho-protein induced by CagA+ helicobacter strains is a product of antibody cross-reactivity to the CagA protein, which varies in size between different bacterial strains.The CagA protein varies in size, based on the number of EPIYA tyrosine phosphorylation motifs between strains, which in turn influence the ability of CagA to associate with and stimulate host signaling pathways.29 To furH. pylori-dependent c-Met phosphorylation by Western blot analysis of c-Met immunoprecipitates using phospho-tyrosine-specific antibodies.[H. pylori 11637 was similar in size to phosphorylated c-Met. Since c-Met and CagA interact, these data suggest that phosphorylated CagA, which co-immunoprecipitates with c-Met, may be wrongly identified as phosphorylated c-Met if the bacterial strain used shows a CagA variant similar in size to c-Met.As noted previously, we detect phosphorylated c-Met at specific residues by Western blot analysis of whole cell lysates using antibodies specific to c-Met phosphorylation at discrete residues. The previous authors detected both HGF- and tibodies.25 Becaustibodies., we deteH. pylori neither targets c-Met nor requires receptor activation for cell motility, we propose that H. pylori may still utilize c-Met signaling to stimulate cancer cell motility. In DU145 cells, HGF treatment causes transient c-Met phosphorylation and cell scattering indicative of cell motility [Figures While we conclude that Figures and 3C. Figures and 6B. Figures –32 There Figures . LactacySince, we could now prolong HGF-induced c-Met phosphorylation in AGS cells, we pretreated cells with DMSO or lactacystin, prior to the addition of HGF, to determine if we could rescue HGF-mediated cell scattering. As shown in H. pylori-induced cell motility occurs through the combination of CagA-dependent and CagA-independent signaling.[H. pylori CagA-independent signaling complemented sustained c-Met signaling to induce cell scattering. In cagA alone or with lactacystin was unable to rescue cell scattering, sustained HGF-dependent c-Met phosphorylation by lactacystin treatment facilitated 60190ΔcagA-dependent cell scattering. These data suggest that sustained c-Met phosphorylation can complement CagA-independent signaling to stimulate gastric cancer cell motility.We previously reported that ignaling. ThereforH. pylori does not require c-Met for induction of cancer cell motility and this bacterium does not stimulate c-Met activation. Furthermore, we demonstrate that this bacterium, in a CagA-dependent fashion, this bacterium, stimulates phosphorylation of a 125 kD protein detected by a phospho-c-Met antibody, but this protein appears to be phospho-CagA and the antibody is cross-reactive. These conclusions are based on the following lines of evidence: 1) shRNA-mediated knockdown of c-Met (greater than 90%) in AGS cells did not prevent H. pylori-induced scattering or increases in cell motility; 2) shRNA-mediated c-Met knockdown affected HGF-induced c-Met phosphorylation and morphological changes in DU145 prostate tumor cells indicative of motility, but the loss of 95% of c-Met expression did not affect H. pylori-induced scattering and motility; 3) using an antibody generated to phospho-c-Met, an H. pylori-dependent phospho-protein was detected by Western blot analysis, but this protein was approximately 10 kD smaller than the band induced by HGF using a phospho-c-Met-specific antibody; 4) the kinetics of phosphorylation of the 125 kD protein was significantly different than HGF-mediated c-Met phosphorylation kinetics; 5) the 125 kD protein was not a truncated form of c-Met, since the band was still detected in shMET cells, and the addition of HGF to H. pylori-treated cells produced the HGF-phosphorylated 135 kD protein along with the 125 kD H. pylori-induced phosphorylated protein; 6) the c-Met kinase inhibitor, SU11274, failed to prevent H. pylori-dependent phosphorylation of the 125 kD protein, but completely inhibited HGF-induced c-Met phosphorylation; 7) c-Met IP from lysates of HGF- or H. pylori-treated cells identified the 135 kD phospho-c-Met band in HGF lysates, but not the 125 kD band in H. pylori lysates, while IP of CagA recovered the 125 kD phospho-protein; 8) the Biosource phospho-c-Met antibody did not recognize the 125 kD phospho-protein, but recognized HGF-induced phospho-c-Met and 9) the 125 kD H. pylori-associated protein correlated with the size of the H. pylori 60190 CagA variant. CagA size differs between bacterial strains, and strain 11637 encodes a CagA variant similar in size to c-Met. Consistent with this, Western blot analysis using the Cell Signaling antibody identified a phosphorylated protein in an H. pylori 11637 lysate similar in size to HGF-stimulated phospho-c-Met, suggesting that this protein is phospho-CagA and not phospho-c-Met.In this report, we demonstrate that et al, showed that transient c-Met siRNA transfection of HeLa cells inhibited H. pylori-dependent cell scattering[H. pylori-induced cell scattering and motility.Churin cattering and threH. pylori 11637 lysate exhibits a phospho-tyrosine band similar in size to phospho-c-Met in HGF-treated lysates. Since the strain used in the previous study, P1, encodes a CagA variant between 130 and 140 kD in size, it is likely that the authors interpreted phosphorylated CagA, which co-immunoprecipitates with c-Met and is tyrosine-phosphorylated, with phosphorylated c-Met.[et al, also showed that H. pylori stimulates c-Met phosphorylation, but the phospho-c-Met band was again detected by IP of total c-Met and phospho-tyrosine immunoblot.[The previous authors also detected a phosphorylated protein, similar in size to c-Met, by immunoprecipitating total c-Met and probing for phospho-tyrosine. They concluded that this protein was c-Met, but it is feasible that they were actually detecting phosphorylated CagA migrating at the same molecular weight as c-Met. This group also showed that CagA co-immunoprecipitated with c-Met, a result that we confirmed. We also showed that an ed c-Met. The repomunoblot.H. pylori could promote gastric cancer progression to metastatic disease. Since our data clearly shows that H. pylori does not target c-Met, how can CagA promote cancer cell motility? One hypothesis we tested was that H. pylori targeted Ron, a receptor tyrosine kinase closely related to c-Met. By Western blot analysis, though, we concluded that H. pylori did not stimulate Ron activation (results not shown). CagA is known to associate with downstream effectors of receptor tyrosine kinase signaling, such as Grb2 and SHP-2, and interaction of CagA with either Grb2 or SHP-2 was required for H. pylori-induced cancer cell motility.[Drosophila mutants lacking Gab rescued photoreceptor development.[As c-Met plays an important role in the progression of many solid tumors, the report that CagA interacted with and activated c-Met suggested that motility.11 Both oelopment. These daAnother possible CagA target that mediates morphological changes and motility is c-Abl, a nonreceptor tyrosine kinase that interacts with CagA and plays a role in CagA phosphorylation.9 Evidenc8935Cortactin is an actin-binding protein and a substrate of Src, which represents another possible target that mediates CagA-dependent signaling, necessary for motility. CagA has been shown to dephosphorylate Src, which leads to cortactin deregulation and actin cytoskeletal changes. ThereforH. pylori does not stimulate c-Met receptor activation, data presented in this report suggest that activated c-Met may allow CagA-negative H. pylori strains to induce cancer cell motility. The TFSS was shown recently to interact with the β1 integrin, causing activation of the integrin signaling pathway and facilitating CagA translocation and phosphorylation.[1 integrin also leads to downstream activation of JNK and paxillin, both of which are required for H. pylori-induced cell motility.[H. pylori stimulates gastric cancer cell motility through a combination of CagA-dependent and CagA-independent signaling. Because increased c-Met activity correlates with late stage cancers and poor patient prognosis, our data that sustained c-Met phosphorylation rescues CagA-negative H. pylori-induced cell scattering suggest two important insights into the molecular events that may play a role in H. pylori-induced gastric cancer progression. First, since CagA is known to interact with downstream adaptors and effectors of c-Met stimulation, it has been suggested that CagA acts as a docking site to short-circuit c-Met signaling independent of ligand.[H. pylori strains are Cag PAI+, the high rate of mutation and infection with multiple strains may allow for not only Cag PAI+, but also CagA-negative strains to promote tumor cell motility.[H. pylori strains in the stomach may play a role in gastric cancer progression to metastatic disease than previously suggested.Although, we conclude that rylation. We previmotility. These daf ligand.40 Indeedmotility. Thus, a H. pylori stimulates c-Met phosphorylation in a CagA-dependent manner, and that c-Met is required for H. pylori-induced cancer cell motility.[H. pylori does not require c-Met to stimulate a motile phenotype in at least two different cell-lines. Furthermore, we show that CagA associates with c-Met, but H. pylori does not cause phosphorylation of the receptor. We propose that because CagA is tyrosine phosphorylated and can be similar in size to c-Met, the previous reports misinterpreted phosphorylated CagA as phospho-c-Met based on the published protocol. Although H. pylori does not specifically target c-Met, we show that sustained activation of the receptor rescues cell scattering induced by a CagA-negative H. pylori mutant (60190ΔcagA), suggesting that H. pylori utilizes c-Met downstream signaling to stimulate cell motility.The data from previous reports suggest that motility.25 Employ

Analytical and Bioanalytical Chemistry, presents data on four common sweeteners found in German water and demonstrates the persistence of these additives. Two, acesulfame and sucralose, were remarkably resistant to treatment by conventional sewage treatment plants as well as by a more advanced soil aquifer treatment plant, report environmental engineer Marco Scheurer and colleagues from the Water Technology Center in Karlsruhe.Artificial sweeteners are widespread in European sewage treatment plant effluent, waterways, groundwater, and even drinking water, a growing body of research demonstrates. One of the latest studies, published in the July 2009 issue of In samples taken from four German rivers, concentrations of ace‐sulfame exceeded 2 μg/L, whereas concentrations of sucralose, cyclamate, and saccharin were an order of magnitude lower. Coauthor Frank T. Lange, an analytical chemist, notes that a person would have to drink 2–3 L of water with sweetener concentrations similar to those of the German rivers every day for years before they would consume the amount contained in a single sweetener tablet (the concentrations detected in water were well below human taste thresholds). Three other sweeteners—aspartame, neotame, and neohesperidin dihydrochalcone—were not detected in any of the samples.Marine Chemistry—also show sucralose in Arizona wastewater treatment plant effluent and several downstream rivers, as well as in coastal and Gulf Stream waters off the southeastern United States.The findings echo those of four recent studies documenting artificial sweeteners in sewage treatment plant effluent and waterways throughout Europe. Preliminary results from two separate studies—one unpublished and one accepted 11 September 2009 for publication in Acesulfame and sucralose, which is sold in the United States as Splenda®, have proven to be the most commonly found and resilient sugar substitutes. They are added to a wide variety of foods, beverages, pharmaceuticals, and toiletries, and they pass through the human body virtually unchanged. Cyclamate and saccharin are much less persistent. Cyclamate has been banned in the United States since 1970 as a possible human carcinogen, but the Food and Drug Administration is considering reapproval. And although saccharin has been found to cause cancer in rats, it is considered safe for human consumption.All the sources interviewed for this article agree there’s little risk that acesulfame and sucralose in drinking water will cause human health problems. The implications for the aquatic environment are less clear, however. Because these sweeteners have been classified as safe for human consumption, they have undergone virtually no environmental testing. Yet the remarkable persistence of acesulfame and sucralose gives some experts pause, given that environmental concentrations will likely rise over time with continued consumption.Henrik Kylin, an environmental chemist at the Norwegian Institute for Air Research and a coauthor of a study on sucralose presented at the Society of Environmental Toxicology and Chemistry Europe 17th Annual Meeting in 2007, points out that sucralose mimics sucrose, a structurally similar molecule involved in biological functions from the regulation of genes related to photosynthesis to feeding cues in zooplankton. “If those [functions] are affected, you may end up with serious ecosystem effects,” he says.Plant, Cell & Environment, that sucralose at least partially inhibited sucrose transport in sugarcane. “There are very many vascular plants in the aquatic ecosystem,” he says, “and if they are [similarly] affected, it would affect very many other organisms.”Kylin is also concerned by the finding, reported in the October 2006 issue of Rosa Krajmalnik‐Brown, an assistant professor of environmental biotechnology at Arizona State University, has been working for more than two years to identify a microorganism that can degrade sucralose and hasn’t found one yet—although she says she’s not giving up. Still, there may be a bright side to sweeteners’ persistence: Scheurer and other researchers have proposed using them as markers for detecting wastewater spills—a welcome finding for scientists who have long sought a failsafe marker.

There was a significant inverse relationship between the extent to which BCF samples inhibited hydrolysis in MCF-7 cells and stimulated it in MDA-MB-231 cells. BCF stimulated E1S formation in MCF-7 cells while inhibiting formation in MDA-MB-231 cells. No difference in the ability of BCF from British or Hungarian women to inhibit or stimulate E1S hydrolysis was detected in ER+ or ER– breast cancer cells. In contrast, BCF from British women stimulated E1S formation in ER+ cells (median 82%) to a significantly greater extent (P< 0.01) than BCF from Hungarian women (median 33%). The role that E1S has in breast cancer development remains unclear. The greater stimulation of E1S formation by BCF from British women, who have a higher risk of breast cancer than Hungarian women, suggests that it may act as a storage form of oestrogen within cells that can be activated by oestrone sulphatase. © 2000 Cancer Research CampaignWomen with gross cystic breast disease may have an increased risk of breast cancer. In this study the ability of breast cyst fluid (BCF), obtained from British or Hungarian women, to modulate oestrone sulphate (E1S) formation or hydrolysis, has been examined. For this, oestrogen receptor-positive (ER+) MCF-7 or MDA-MB-231 (ER–) breast cancer cells were employed. The formation and hydrolysis of E1S was measured using radiometric techniques. BCF from British and Hungarian women mainly inhibited E1S hydrolysis in MCF-7 cells while stimulating hydrolysis in MDA-MB-231 cells. The extent of inhibition or stimulation of E1S hydrolysis in these cells was related to the Na

Quantitative polymerase chain reaction (QPCR) is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile.We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method.We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays. Quantitative polymerase chain reaction (QPCR) has become a widely applied technique for quantitative gene expression analysis ,2. The tTms were in the same range, as well as their GC contents. Short amplicons (60–350 bp) were favored during primer selection, but in some cases 100–800 bp amplicons were also considered when the design criteria could not be met for shorter amplicons.Several online resources have been described that can be used to design primers for PCR and QPCR -25 and a contains primers for most known human and mouse genes appeared between 17 and 27 cycles and their Tms were between 80°C and 90°C.A collection of primer pairs from PrimerBank covering most known mouse genes was tested by QPCR, agarose gel electrophoresis, sequencing and BLAST. An overview of the procedure used for primer validation can be seen in Figure d length ,31. FromAgarose gel electrophoresis was used to confirm the correct size of the PCR product, and sequencing and BLAST were used to confirm that the expected transcript had been amplified. All successfully sequenced samples (24476) were BLAST analyzed. From the primer validation procedure, primer pairs were grouped into successful or failed, according to the analysis criteria. From 26855 primer pairs tested 17483 (65.1%) primer pairs, corresponding to 18324 transcripts, were found to be successful by QPCR, agarose gel, sequencing and BLAST analysis. 22189 (82.6%) primer pairs were successful based on agarose gel electrophoresis analysis and 19453 (72.4%) primer pairs were successful based on BLAST analysis. Primer pairs which failed based on the experimental validation procedure can be grouped into various types. Table Tm and location on the gene, can be found in PrimerBank, as well as alternative primer pairs designed for these transcripts.A few representative examples of primer pairs are described [see Additional files . See Figure Tm. cDNA and amplicon sequences, and validation data can be viewed by clicking on the appropriate links. All validation data can be accessed from PrimerBank, since the validation criteria may be different from the criteria of the users. Also, users can use a BLAST tool found on the PrimerBank homepage of the agarose gel failed reactions. These may represent undocumented transcripts or splice isoforms that could have been amplified in addition to or instead of the expected transcripts. For the reactions that failed because no amplification had taken place, the template sequences may not have been present or present in very low copy number.EcoRI/BamHI digestion used here) can be used for reduction of the complexity of the DNA and thus higher amplification rates. We matched 864 primer pairs to mouse genome sequences obtained from the UCSC genome browser. The remainder of the sequences could not be matched, probably because they were located on exon junctions. 640 of these primer pairs have no EcoRI/BamHI restriction sites in their expected PCR amplicons, and were used with EcoRI/BamHI digested DNA template to prepare the validation reactions. We tested 192 representative samples, from the 1745 total number of failed primer pair samples, whose expected PCR amplicon lengths range from 60 bp to 123 bp and whose amplicons have no EcoRI/BamHI restriction sites. 50 ng EcoRI/BamHI digested 129 mouse ES cell genomic DNA was used per 25 μl PCR reaction.From the high-throughput PrimerBank mouse primer pair validation, 1745 samples (6.5%) failed because of no amplification, as seen from the QPCR amplification plots. From the gene description information we found several to belong to olfactory receptors, vomeronasal receptors, transcription factors and low abundance transcripts while others were of unknown function or RIKEN sequences (data not shown). In order to investigate the possibility that the templates for the failed amplification primer pairs were not expressed in the cDNA sample used, we repeated these reactions using genomic DNA as a template. It can be difficult to achieve amplification using genomic DNA as template in general, due to its complexity. However, it can be used successfully if technical difficulties are overcome and can be useful as a universal template as it contains a copy of all genes, and the same amount of template is present for all single-copy genes . We haveThe amplification plots of all 192 samples (2 × 96 well plates) are shown here [see Additional files EcoRI/BamHI restriction sites in their sequences. Both forward and reverse primers were chosen to be on the same exon in order to amplify the same template on genomic DNA. EcoRI/BamHI digested 129 mouse ES cell genomic DNA was used as template. After digestion the DNA was purified for PCR by phenol extraction and ethanol/salt precipitation. 50 ng of DNA template was used per 25 μl PCR reaction, which was found by optimization experiments to give a reasonable Ct value.We next set out to determine the uniformity of amplification using fully validated PrimerBank primer pairs ie. primer pairs that had been successful in all steps of the validation procedure. 96 primer pairs were chosen with expected PCR amplicon length ranging from 80 bp to 120 bp and containing no Tm on the Ct was also studied, by plotting the Tm values against the Ct, and again no correlation was found was also plotted as a frequency distribution and did not pass the statistical normality test (data not shown).See Figure EcoRI/BamHI digested genomic DNA) that were used for the uniformity of amplification test. The coefficients of variation for each 96 well plate assay are all < 0.1 and the average coefficient of variation for all assays is 0.07 [see Additional file In order to determine the technical reproducibility of the QPCRs, five 96 well plate assays were prepared using the same technical procedure. Reactions were set up using the same 96 primer pairs and DNA template instrument and by OD260 reading using the Spectra Max Plus Spectrophotometer (Molecular Devices). Forward and reverse primer mixtures were normalized to 2 μM of each primer for use in QPCR.Universal Mouse Reference total RNA (Stratagene) was used for the preparation of the cDNA sample. Reverse transcription using random hexamers was performed using the Superscript First-Strand Synthesis System for RT-PCR (Invitrogen). Based on the recommended protocol, 20 μg of total RNA was used for each reaction and cDNA samples prepared were in a final volume of 84 μl. The quality of the individual first strand cDNA preparations was tested in a QPCR reaction using mouse actin primers .QPCRs were performed in polypropylene 96 well plates on the ABI PRISM 7000 Sequence Detection System and ABI 7300 Real-Time PCR System (both from Applied Biosystems). SYBR Green PCR Master mix (Applied Biosystems) or Absolute Q-PCR SYBR Green ROX mix (ABgene) were used. For each reaction, 12.5 μl of the 2× SYBR Green PCR mix were added to 2.5 μl of 2 μM forward and reverse primer mix , 1 μl of cDNA and made to 25 μl with water. The Biomek FX Laboratory Automation Workstation (Beckman Coulter), as well as manual pipetting, was used to prepare the reactions. PCR conditions used were the following: 50°C for 2 minutes (step 1), 95°C for 10 minutes (for Applied Biosystems PCR mix) or for 15 minutes (for ABgene PCR mix) (step 2), 95°C for 15 seconds, 60°C for 30 seconds, 72°C for 30 seconds . In some QPCRs an additional elongation step was added at 72°C for 10 minutes (step 4). Dissociation curves were obtained by heating and cooling the samples at: 95°C for 15 seconds, 60°C for 30 seconds, 95°C for 15 seconds. DNA was renatured for agarose gel electrophoresis using the following conditions: 50°C for 2 minutes (step 1), 95°C for 15 seconds, 60°C for 30 seconds (step 2 – repeated one more time) and 72°C for 5 minutes (ABI PRISM 7000 Sequence Detection System) or 95°C for 30 seconds, 60°C for 2 minutes .PCR products were purified using Standard Performa 96 well plates and QuickStep 2 SOPE resin (both from EDGE BioSystems), following the recommended procedure.For each sample 10 μl of 2× Orange G loading buffer (composition shown below) was added to 5 μl of the purified PCR product and made to 20 μl with water. Samples were prepared in 96 well plates using the Biomek FX Laboratory Automation Workstation (Beckman Coulter) and using the same instrument applied to 2% agarose 96 well E-gels (Invitrogen). For 10× Orange G loading buffer, a solution of 30% Ficoll 400 (AlfaAesar), 10 mM EDTA (Sigma) was prepared and Orange G dye (Fisher Scientific) was added for color. E-Gel Low Range Quantitative DNA Ladder (Invitrogen) was used as a marker for PCR product size. The gels were run for 12 minutes on the E-Gel 96 Base (Invitrogen) and analyzed using the E-Editor Software (Invitrogen).Purified QPCR products were sequenced at Sequencing Core lab of Center for Computational and Integrative Biology at Massachusetts General Hospital.Sequences obtained were BLAST analyzed as batch sets against the NCBI database . In ordeEcoRI and BamHI restriction enzymes. Digests were made by adding 20 μl EcoRI buffer (10×) (New England Biolabs), 20 μl 10× BSA, 4 μg DNA, 40 U BamHI (New England Biolabs), 40 U EcoRI (New England Biolabs) and water to 200 μl total volume. Digests were incubated at 37°C for 4 hours and 30 minutes and heat inactivated at 75°C for 10 minutes. The digested DNA was phenol extracted and ethanol/salt precipitated. DNA pellets were resuspended in TE pH 8.0.129 Embryonic Stem cell mouse genomic DNA (isolated by ethanol precipitation) was used. The DNA was digested completely using BamHI/EcoRI digested genomic DNA and made to 25 μl with water. The following PCR conditions were used: 50°C for 2 minutes (step 1), 95°C for 15 minutes (step 2), 95°C for 15 seconds, 60°C for 30 seconds, 72°C for 30 seconds , 72°C for 10 minutes (step 4). Dissociation curves were obtained by heating and cooling the samples at: 95°C for 15 seconds, 60°C for 30 seconds, 95°C for 15 seconds.QPCRs were performed in polypropylene 96 well plates on the ABI 7300 Real-Time PCR System (Applied Biosystems). For each reaction, 12.5 μl of Absolute Q-PCR SYBR Green ROX mix (ABgene) were added to 2.5 μl of 2 μM forward and reverse primer mix , 1 μl of 50 ng/μl 2, 200 μg/ml BSA, 0.2% Triton X-100, 400 μM dNTP mix, 2.5 M betaine), 4 μl of 5 μM forward and reverse primer mix, DNA template, 1 μl Taq polymerase and water to 100 μl. The PCR conditions used were the following: 95°C for 3 minutes (step 1), 95°C for 15 seconds, 60°C for 30 seconds, 72°C for 30 seconds , 72°C for 10 minutes (step 3).Amplicons were prepared large-scale by PCR, in two steps. For the first step PCR, 75 μl PCR reactions were prepared for each sample. For each reaction, 37.5 μl Absolute Q-PCR SYBR Green ROX mix (ABgene) were added to 3 μl of 5 μM primer pair mix , 3 μl universal mouse cDNA (see: 'preparation of cDNA sample' section in methods) and made up to 75 μl with water. The following PCR conditions were used: 95°C for 15 minutes (step1), 95°C for 15 seconds, 60°C for 30 seconds, 72°C for 30 seconds , 72°C for 10 minutes (step 3). The PCR products were purified using the MinElute PCR purification kit (Qiagen). Purified amplicons were used as templates in large-scale 40× 100 μl PCRs, each reaction containing 50 μl 2× LC1v3 buffer , following the recommended procedure. Amplicon concentrations were determined by taking OD260 readings of each preparation using the ND-1000 Spectrophotometer (Nanodrop). The average value was taken and the OD260 reading from a no DNA template control was subtracted, in order to remove the contribution from primers and buffer components to the spectrophotometric absorption.DNA samples in 1× Absolute Q-PCR SYBR Green ROX mix (ABgene) were pipetted into OptiPlate-96F black 96 well plates (Perkin Elmer). SYBR Green I fluorescence was detected using the Analyst AD fluorescence plate reader (Molecular Devices) by excitation at 485 nm and emission at 530 nm (505 nm dichroic mirror).5 μl of 10 mM dNTP solution were added to 95 μl water and the OD260 readings were taken using the Spectra Max Plus Spectrophotometer (Molecular Devices).Mouse genome sequences were downloaded from the UCSC genome browser and the AS designed and performed the experiments, analyzed experimental data and prepared the manuscript. XW designed the primer algorithm. HW and SD provided bioinformatics support. TT performed the automation experiments. BS designed and directed the experiments and prepared the manuscript. All authors have read and approved the final manuscript.Five representative examples of primer pairs that were successful throughout the validation procedure.Click here for fileFive representative examples of primer pairs that failed based on agarose gel analysis.Click here for fileFive representative examples of primer pairs that failed based on BLAST analysis.Click here for fileInformation for mouse primer pairs from PrimerBank tested using QPCR.Click here for fileNCBI BLAST analysis of successfully sequenced PCR products.Click here for fileValidation of 96 PrimerBank primer pairs which had failed QPCR during the high-throughput validation procedure.Click here for fileValidation of 96 PrimerBank primer pairs which had failed QPCR during the high-throughput validation procedure.Click here for fileAnalysis of technical replicate experiments.Click here for fileAnalysis of individual primer pairs from technical replicate experiments.Click here for fileFrequency distributions of log normal data from five technical replicate tests.Click here for fileComparison of pipetting variation between manual and robotic liquid transfer.Click here for fileAmplicons used for SYBR Green I sequence specificity experiments.Click here for fileSYBR Green I binding to dsDNA of increasing length and AT%.Click here for fileAmplification efficiency estimation from single reaction kinetics data.Click here for fileAmplification efficiency estimation using analytical and standard curve methods.Click here for fileOne-way ANOVA test to determine if amplification efficiency varies significantly between different PrimerBank primer pairs.Click here for filePrimerBank primer pair groups used for one-way ANOVA analysis.Click here for file

West Nile (WN) virus was found throughout New York State in 2000, with the epicenter in New York City and surrounding counties. We tested 3,403 dead birds and 9,954 mosquito pools for WN virus during the transmission season. Sixty-three avian species, representing 30 families and 14 orders, tested positive for WN virus. The highest proportion of dead birds that tested positive for WN virus was in American Crows in the epicenter . Eight mosquito species, representing four genera, were positive for WN virus. The minimum infection rate per 1,000 mosquitoes (MIR) was highest for Culex pipiens in the epicenter: 3.53 for the entire season and 7.49 for the peak week of August 13. Staten Island had the highest MIR (11.42 for Cx. pipiens), which was associated with the highest proportion of dead American Crows that tested positive for WN virus and the highest number of human cases (n=10).

To evaluate the efficacy and tolerability of flexible-dose fesoterodine in subjects with overactive bladder (OAB) who were dissatisfied with previous tolterodine treatment.This was a 12-week, open-label, flexible-dose study of adults with OAB (≥ 8 micturitions and ≥ 3 urgency episodes per 24 h) who had been treated with tolterodine (immediate- or extended-release) for OAB within 2 years of screening and reported dissatisfaction with tolterodine treatment. Subjects received fesoterodine 4 mg once daily for 4 weeks; thereafter, daily dosage was maintained at 4 mg or increased to 8 mg based on the subject’s and physician’s subjective assessment of efficacy and tolerability. Subjects completed 5-day diaries, the Patient Perception of Bladder Condition (PPBC) and the Overactive Bladder Questionnaire (OAB-q) at baseline and week 12 and rated treatment satisfaction at week 12 using the Treatment Satisfaction Question (TSQ). Safety and tolerability were assessed.Among 516 subjects treated, approximately 50% opted for dose escalation to 8 mg at week 4. Significant improvements from baseline to week 12 were observed in micturitions, urgency urinary incontinence episodes, micturition-related urgency episodes and severe micturition-related urgency episodes per 24 h . Approximately 80% of subjects who responded to the TSQ at week 12 reported satisfaction with treatment; 38% reported being very satisfied. Using the PPBC, 83% of subjects reported improvement at week 12 with 59% reporting improvement ≥ 2 points. Significant improvements from baseline (p< 0.0001) exceeding the minimally important difference (10 points) were observed in OAB-q Symptom Bother and Health-Related Quality of Life (HRQL) scales and all four HRQL domains. Dry mouth (23%) and constipation (5%) were the most common adverse events; no safety issues were identified.Flexible-dose fesoterodine significantly improved OAB symptoms, HRQL, and rates of treatment satisfaction and was well tolerated in subjects with OAB who were dissatisfied with prior tolterodine therapy. Fixed-dose clinical trials have shown that fesoterodine 4 or 8 mg once daily significantly improves bladder diary variables and measures of health-related quality of life compared with placebo and that fesoterodine is generally well tolerated.This is the first flexible-dose trial of fesoterodine. Dose escalation was based on subject and physician assessment of efficacy and tolerability, which mimics clinical practice. Flexible-dose fesoterodine was associated with a high rate of self-reported treatment satisfaction, produced significant improvements in bladder diary variables and measures of symptom bother and health-related quality of life, and was generally well tolerated.Overactive bladder (OAB) is defined by urgency, with or without urgency incontinence, usually with increased daytime frequency and nocturia . OAB is Fesoterodine is an antimuscarinic developed for the treatment of the symptoms of OAB. Fesoterodine is rapidly and extensively converted by non-specific esterases to its active metabolite, 5-hydroxymethyl tolterodine (5-HMT), which is also the active metabolite of tolterodine . The oxiTwo previous randomised, double-blind, placebo-controlled, fixed-dose phase 3 studies demonstrated that fesoterodine 4 or 8 mg once daily (qd) significantly improves OAB symptoms and measures of health-related quality of life (HRQL) compared with placebo –12. MoreThe primary objective of this open-label study was to assess the effect of a flexible-dosing regimen of fesoterodine on OAB symptoms and treatment satisfaction in subjects with OAB who were dissatisfied with previous tolterodine or tolterodine extended release (ER) treatment. Secondary objectives included evaluating the effect on measures of HRQL and other patient-reported outcomes as well as the safety and tolerability of fesoterodine therapy.In this 12-week, multicentre, open-label, single-arm, flexible-dose study, the effect of fesoterodine on OAB symptoms and treatment satisfaction was assessed in adult subjects with OAB who were dissatisfied with previous tolterodine or tolterodine ER therapy. This study was conducted at 80 centres worldwide, with centres in Asia, Europe, and North and Central America. The study was conducted in accordance with the Good Clinical Practice guidelines and the Declaration of Helsinki. The protocol was approved by the respective Institutional Review Boards/Independent Ethics Committees, and all subjects provided written informed consent before the start of the study.Baseline OAB symptoms were assessed using a 5-day bladder diary during a 2-week screening period, before which any previous antimuscarinic medication was stopped. Subjects rated the sensation associated with each micturition or urgency urinary incontinence (UUI) episode in the diary using the five-point Urinary Sensation Scale . All enrEligible subjects were men and women aged ≥ 18 years with self-reported OAB symptoms for ≥ 3 months before screening with a mean micturition frequency of ≥ 8 micturitions per 24 h and mean number of urgency episodes ≥ 3 per 24 h in a 5-day bladder diary at baseline (urgency episodes were defined as those with a USS rating ≥ 3). Subjects had to rate their bladder condition as causing at least ‘some moderate problems’ on the Patient Perception of Bladder Condition (PPBC) questionnaire at baseline. Subjects were also required to have been treated with tolterodine or tolterodine ER for OAB within 2 years of screening and to report being ‘somewhat dissatisfied’ or ‘very dissatisfied’ with tolterodine treatment on the Treatment Satisfaction Question (TSQ), a single item from the validated Overactive Bladder Satisfaction Questionnaire ; subject:‘My bladder causes me no (1), very minor (2), minor (3), moderate (4), severe (5) or many severe (6) problems’. The UPS is a three-point scale; response options include: ‘usually not able to hold urine’ (1), ‘usually able to hold urine if I go to the toilet immediately’ (2) and ‘usually able to finish what I am doing before going to the toilet’ (3). The OAB-q comprises an eight-item Symptom Bother scale and a 25-item HRQL scale with 4 domains . Safety and tolerability were assessed.To assess efficacy, subjects completed 5-day bladder diaries at baseline and at 12 weeks. Subjects recorded the time of every micturition and rated the sensation associated with each micturition using the five-point USS. Subjects rated satisfaction with fesoterodine treatment at week 12 using the TSQ. Subjects also completed several validated OAB-specific questionnaires at baseline and week 12, including the PPBC , the UrgPrimary end-points were change from baseline to week 12 in number of micturitions, number of UUI episodes (among subjects with a baseline UUI > 0), and number of micturition-related urgency episodes (defined as those with a USS rating ≥ 3) per 24 h and the percentage of subjects reporting treatment satisfaction at week 12 (‘very satisfied’ or ‘somewhat satisfied’ on the TSQ).Secondary bladder diary end-points included change from baseline to week 12 in nocturnal micturitions, severe micturition-related urgency episodes (defined as those with a UUS rating of ≥ 4), and frequency-urgency sum per 24 h. Additional secondary end-points included change from baseline in PPBC, UPS and OAB-q scores at week 12.All adverse events (AEs), whether directly observed by the investigator, reported by the subject or resulting from investigator questioning of the subject regarding their tolerance of study treatment, were recorded during the entire study period. The causality (based on the investigator’s assessment), severity and outcome of each AE were recorded.t-tests at the 5% significance level were used to analyse efficacy end-points. Tolerability analyses were performed based on the data from all subjects who took at least one dose of study drug. Subjects were not stratified by titration status for the assessment of efficacy or tolerability.A sample size of 400 subjects was calculated to provide a 5% level of precision in the 95% CI for the percentage of subjects reporting treatment satisfaction at week 12. The other primary end-points were powered for 95%, resulting in an overall power of 85%. Statistical analyses of all efficacy variables at week 12 were performed using the full analysis set . The last valid postbaseline observation was carried forward to handle missing efficacy data at week 12. Descriptive statistics and two-sided paired n= 22; 19%) of the men and three-fifths of the women. In addition to prior treatment with tolterodine or tolterodine ER, 216 subjects (42%) had received ≥ 1 other antimuscarinic prior to study enrolment. Notably, 67% of all male subjects in the study reported a history of benign prostatic hyperplasia. Eleven subjects included in this study did not report being dissatisfied with prior tolterodine treatment at the beginning of the study; inclusion of these 11 major protocol violators did not materially affect the study results.Subject disposition is shown in Of the 516 subjects who received at least 1 dose of study drug and had at least one postbaseline assessment, 255 opted for dose escalation to fesoterodine 8 mg at week 4. The remaining subjects continued receiving the 4-mg dose.Statistically significant improvements from baseline to week 12 were observed in mean number of micturitions, UUI episodes and urgency episodes in 2%, and were unchanged in the remaining subjects. The proportion of subjects who reported that they were usually not able to hold their urine was reduced from 25% at baseline to 6% after 12 weeks. The proportion of subjects who reported being able to finish what they were doing before going to the toilet was increased from 6.8% at baseline to 41% after 12 weeks (Mean UPS scores improved significantly from 1.8 at baseline to 2.4 at week 12 (p< 0.0001). UPS scores improved in 49% of subjects, deteriorated (12 weeks .The mean change in OAB-q Symptom Bother score (29-point improvement) from baseline to week 12 was statistically significant and constipation (5%) were the most frequently reported AEs ; most ofThis is the first phase 3b study of fesoterodine and the first fesoterodine study to employ flexible dosing. The results presented here show that flexible-dose fesoterodine significantly improved several bladder diary variables as well as subjects’ assessment of their bladder-related problems, urgency, symptom bother and HRQL in subjects who reported dissatisfaction with previous tolterodine treatment. Additionally, approximately 80% of respondents in the current study reported satisfaction with fesoterodine treatment at week 12. These findings were expected considering the results of two previous fixed-dose placebo-controlled phase 3 clinical trials that demonstrated significantly greater improvements in bladder diary variables and HRQL measures and significantly greater rates of self-reported treatment response in subjects who received fesoterodine 4 or 8 mg compared with those who received placebo –12. Fesopost hoc analysis of the two phase 3 trials showed that fesoterodine 8 mg was significantly more efficacious than fesoterodine 4 mg in improving UUI episodes, mean voided volume per micturition, continent days per week (extrapolated from 3-day diaries), and subject-reported Treatment Response at week 12, indicating an apparent efficacy dose–response effect on these end-points in this population or predict which reasons might lead to dissatisfaction.This was an open-label study. Open-label trials reflect clinical practice; however, they have inherent limitations. For example, open-label studies are unable to account for placebo effects, which are often substantial in randomised placebo-controlled clinical trials of antimuscarinics for OAB . AnotherWhen used with a flexible-dosing regimen in this open-label study, fesoterodine significantly improved OAB symptoms and HRQL measures and reduced OAB-related symptom bother in subjects with OAB who had been dissatisfied with previous tolterodine or tolterodine ER treatment. Approximately 80% of subjects reported treatment satisfaction and about 50% of subjects opted to receive the higher 8-mg dose after initial 4-mg treatment. Fesoterodine was well tolerated.

DFNB31), the gene encoding whirlin, is responsible for nonsyndromic hearing loss and Usher syndrome type II (USH2D). We screened DFNB31 in a large cohort of patients with different clinical subtypes of Usher syndrome (USH) to determine the prevalence of DFNB31 mutations among USH patients.It has been demonstrated that mutations in deafness, autosomal recessive 31 are predicted to impair whirlin structure and function, suggesting eventual pathogenicity. No putatively pathogenic mutation was found in the second allele of patients with these mutations.DFNB31 is not a major cause of USH. This syndrome follows an autosomal recessive pattern of inheritance and is characterized by retinitis pigmentosa (RP), sensorineural hearing impairment, and in some cases vestibular dysfunction. Three clinical types can be distinguished ) and an amino acid highly conserved up to the fruit fly (considering 13 species). The physicochemical difference between Arg and Ser was found to be moderate since a Grantham distance of 110 (0–215) was obtained. Also this variation was located in the PDZ3 domain.These nine variants were analyzed using the RESCUE-ESE program. The change c.1148C>A (p.T383N), found in two unrelated USH2 patients from the Netherlands, creates four new putative ESE sites, whereas c.1339G>A (p.D447H), detected in one USH2 patient from Hungary, suppresses one existing ESE sequence and creates two new putative ESE sites. The remaining variants were not found to affect any ESE site.These nine rare missense variants were further evaluated for an effect on exonic splice enhancers by using the These changes were also analyzed with NNSPLICE and Splice View, but neither was found to affect, create, or eliminate any donor or acceptor splice site.rs766835), c.2419–16T>C, and c.2644–157C>T , and four were predicted to create or abrogate splice sites .A total of 38 different variants were found in the By the introduction of p.R350W and p.R882S, uncharged amino acids may affect the three-dimensional structure of the protein, which is important for the adequate function of interacting domains. Furthermore, both the amino acids R350 and R882 were well conserved throughout evolution, indicating these residues have an important role in protein structure and function. All these factors point to a possible pathologic effect for these two variants.Segregation analysis for the variants p.R350W, p.G769G, p.T383N, and p.D447H could not be performed. In some cases, we only had a DNA sample from a patient without any family history. In other cases, the patient was a sporadic case and segregation analysis did not reveal any information about the pathogenicity of the variant . We found variant p.R882S in a sporadic Spanish USH2 patient together with the variant p.S648Y. Segregation analysis for these changes was performed in healthy relatives and revealed that both variants were located on the same allele. In addition, p.R882S and p.S648Y were present in the patient, in his healthy brother and sister, and in his two healthy children.DFNB31, which may contain mutations in the second allele of patients with a potentially pathogenic mutation on one allele, we performed an in silico search by using Geneid , N-SCAN and we also searched in the UCSC Genome Browser , but no additional exons were predicted in the DFNB31 locus.To explore the possibility of yet unidentified exons of DFNB31 mutations in 195 unrelated USH patients. However, total or partial gene deletions and duplications can escape the screening method applied herein and therefore cannot be excluded. Our results indicate a minor causative role for DFNB31 in Usher syndrome. However, modifying effects of the variants we detected might contribute to the phenotype of Usher syndrome.In summary, this study did not reveal evidence for the involvement of DFNB31 mutations may also be causative for nonsyndromic retinal degenerations. This remains to be confirmed.Regarding the implication of this gene in nonsyndromic hearing loss, the studies performed so far also indicate that DFNB31 is a rare form of deafness ,20. We p

The cell packing is dominated by bifurcated attractive N—Hδ+⋯δ−H—B inter­actions.The title compound, C Å b = 8.638 (3) Å c = 7.360 (3) Å β = 97.892 (8)°V = 577.7 (4) Å3 Z = 4 Kα radiationMo −1 μ = 0.05 mmT = 93 K 0.45 × 0.25 × 0.03 mm Bruker–Nonius APEXII CCD area-detector diffractometerAbsorption correction: none846 measured reflections846 independent reflectionsI > 2σ(I)503 reflections with R int = 0.060 R[F 2 > 2σ(F 2)] = 0.051 wR(F 2) = 0.138 S = 1.00 846 reflections57 parametersH-atom parameters constrainedmax = 0.14 e Å−3 Δρmin = −0.14 e Å−3 Δρ APEX2 used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 (Farrugia, 1997Mercury (Macrae et al., 2006SHELXL97 and PLATON (Spek, 2009Data collection: 10.1107/S160053680901887X/bt2953sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S160053680901887X/bt2953Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Focal adhesion kinase (FAK) functions in cell migration and signaling through activation of the mitogen-activated protein kinase (MAPK) signaling cascade. Neuronal function of FAK has been suggested to control axonal branching; however, the underlying mechanism in this process is not clear.Drosophila FAK gene, Fak56. Null Fak56 mutants display overgrowth of larval neuromuscular junctions (NMJs). Localization of phospho-FAK and rescue experiments suggest that Fak56 is required in presynapses to restrict NMJ growth. Genetic analyses imply that FAK mediates the signaling pathway of the integrin αPS3βν heterodimer and functions redundantly with Src. At NMJs, Fak56 downregulates ERK activity, as shown by diphospho-ERK accumulation in Fak56 mutants, and suppression of Fak56 mutant NMJ phenotypes by reducing ERK activity.We have generated mutants for the We conclude that Fak56 is required to restrict NMJ growth during NMJ development. Fak56 mediates an extracellular signal through the integrin receptor. Unlike its conventional role in activating MAPK/ERK, Fak56 suppresses ERK activation in this process. These results suggest that Fak56 mediates a specific neuronal signaling pathway distinct from that in other cellular processes. Drosophila, various integrin subunits have been shown to function in motor axon pathfinding and target recognition, and synaptic morphogenesis at neuromuscular junctions (NMJs) , FasII and dp-ERK-1/2 . Alexa 488-, Cy3- and Cy5-conjugated secondary antibodies and TRITC-phalloidin were used (Jackson ImmunoResearch).In all experiments, wandering late third instar larvae were dissected for analysis of NMJ phenotypes. After dissection, tissues were incubated in fixative solution for 20 minutes. For immunostaining, primary antibodies used were against synaptotagmin , HRP conjugated with TRITC , FAK . (A) Cumulative frequency plot reveals a significant shift in the distribution of mEJP amplitudes. (B) Representative traces and mean amplitudes of EJPs in wild-type and Fak56N30/K24.Electrophysiological recording of postsynaptic currents from wild-type and Click here for filesax4, witA12 and med13) for BMP signaling components into elav>Fak56RNAi.BMP/Gbb signaling-independent mechanism of Fak56 in NMJ growth. No alternations of NMJ phenotypes were detected by introducing mutant alleles (Click here for fileFak56CG1 mutant embryos. Expressions of phospho-ERK appear grossly normal during Drosophila embryogenesis.ERK phosphorylation in Click here for file

The artery of Percheron is a solitary trunk representing an uncommon anatomic variant that provides bilateral arterial supply to the paramedian thalami and the rostral midbrain. Occlusion of this artery results in bilateral thalamic and mesencephalic infarctions. The clinical diagnosis is difficult because the complex anatomy causes large clinical variability. We report a case of a comatose patient with normal early head-computed tomography and magnetic resonance imaging. A bilateral paramedian thalamic infarct due to an occlusion of the artery of Percheron was revealed two days later by a new head computed tomography. To our knowledge, this is the first report in the literature of a symptomatic patient presenting an acute Percheron stroke with normal early brain magnetic resonance imaging. Our case indicates that a normal initial magnetic resonance imaging cannot formally eliminate the diagnosis of acute stroke of the artery of Percheron. We discuss the causes of noncontributive brain magnetic resonance imaging at the onset of this acute Percheron stroke and the alternative diagnosis and therapy methods. Percheron described four normal variations of the neurovascular anatomy of the thalami and midbrain . The medWe report a case of a patient admitted for coma without evident cause and normal early imaging by head computed tomography (CT) and MRI. A new head CT two days later revealed a bilateral paramedian thalamic infarct at the origin of the initial symptoms.-weighted fluid-attenuated inversion recovery (FLAIR) images , but with poor therapeutic observance. He was found comatose by the prehospital team. On examination, the patient had the following initial vital signs: temperature 36.4°C, pulse 78 beats/min, respiratory rate 16 breaths/min, and blood pressure 148/87 mmHg. On neurological examination, the Glasgow coma-scale score was 7 with localizing pain being the best motor response and no opening of eyes or verbal response. Pupillary light reflex in the right eye was 4 mm nonreactive and that in the left eye was 3 mm reactive. The deep tendon reflexes were present and symmetric. Babinski sign was found on both feet. Capillary blood glucose was found to be 123 mg/dL. The electrocardiogram showed atrial fibrillation, with no abnormal repolarization. He was intubated and mechanically ventilated and then brought to the emergency department. The initial head CT, performed 65 minutes after loss of consciousness, showed no acute hemorrhage or other abnormality. To eliminate an acute ischemic infarction, a brain MRI was then performed 95 minutes after the onset symptoms. It did not reveal significant acute infarction signals: no lesion was found on diffusion-weighted (DW) images , on appa) images . The T2*A new head CT was performed 48 hours later . It reveBithalamic paramedian infarcts are rare, and it is painful to suspect them because of the complex anatomy causing large clinical variability –7. The fSeveral reasons can explain the MRI results. The imaging was achieved with a head and neck antenna, which is probably less precise on this part of the brain compared with a head antenna. In addition, the brain MRI, performed 95 minutes after the onset of symptoms, was probably done earlier than in other reported cases. This demonstrates that modern neuroimaging is extremely valuable in making a positive diagnosis but normal imaging studies alone, however, do not exclude a vascular etiology. Small lesion size, brainstem lesions, small cortical lesions, and DW-imaging performed within a few hours after stroke onset are features associated with a particular risk of false-negative DW-images , 11. In In conclusion, our case indicates that a normal initial MRI cannot formally eliminate the diagnosis of acute stroke of the artery of Percheron, especially if performed very early or if the technical conditions are not optimal. These findings suggest the presentation of acute rostral brain stem stroke accompanied by a nonconclusive brain MRI should encourage to perform a new brain imaging by MRI within therapeutic times or should consider doing interventional explorations focused on the vertebrobasilar territory. On that basis, intravenous or in situ thrombolytic therapy should be performed. Interventional explorations focused on the vertebrobasilar territory have not been evaluated but may allow to confirm the diagnosis of Percheron artery lesion. However, only one successful case has been described. Anytime the initial imaging is normal, new brain imaging by MRI or CT scan should be performed within the first 48 hours.

Subclinical lung function alterations can sometimes be discovered in asthmatic patients under clinical control. This study aimed to identify the burden of asthmatic children with subclinical airways abnormalities who may benefit from an adjustment in asthma therapy. 134 6-to-17-year-old asthmatic children were enrolled. Of them, 98 presented apparently under clinical control disease and all performed spirometry before and after bronchodilation: 17 (17.3%) had a positive bronchodilation test, in addition to significantly lower lung function indexes as compared to those with under-control asthma who had a negative bronchodilation test. These patients were randomized and re-evaluated: patients (n=8) receiving an adjustment in their therapy showed an improvement in lung function tests and quality of life indexes as compared to 7 without therapy adjustment. In conclusion, a substantial number of apparently-under-control asthmatic children show airways alterations that can be improved by adjusting their therapy, which also seems to enhance their quality of life. Asthma is the most frequent chronic disease in childhood and its prevalence is increasing ,2, but o1) measures the best lung function that can be achieved by bronchodilator therapy on the day of the visit [1 indicates bronchial obstruction.Lung function testing and the measurement of bronchodilation responsiveness are recommended for the diagnosis of asthma and for its monitoring over time . The poshe visit ; a subopSeveral studies confirm that lung function can be altered even in patients whose disease is judged to be under control according to their symptoms referral and the use of reliever medications ,7,9. ColIt seems that taking into account only the symptoms as referred by the children or their parents in order to judge asthma control is insufficient -9. The p134 children aged 6 to 17, who had been consecutively referred to the Allergology. Outpatient section of our clinic between November 2005 and October 2006, were included, all having a diagnosis of allergic asthma which had been established previously.1; 7) absence of bronchospasm at auscultation. Therapy prior to the visit was recorded.All the patients underwent a clinical examination to assess their asthma severity according to the GINA guidelines , and the1 before and after bronchodilation expressed as a percentage change relative to the baseline values (deltaFEV1): the test was considered positive when deltaFEV1 was ≥12% [1 ≥12% instead of ≥15% to increase the sensibility of the test.All the patients performed a spirometry by means of a Multispiro SA/100 spirometer . The best of a minimum of three recordings was chosen and a bronchodilation test was done by the administration of 200 mcg of dry salbutamol powder and repetition of the spirometry 15 minutes later. Spirometric indices were expressed as percentage of the predicted values (Polgar revisited) . The reswas ≥12% ,12, 13. Parietaria judaica) and perennial allergens involved in allergic asthma .A Skin Prick Test was performed to establish possible sensitization to the main seasonal .Data were examined by means of SPSS 13.0 for Windows . Student’s t-test and linear regression were used. Results were considered significant for a p value ≤0.05.This research was conducted in accordance with the principles of the Declaration of Helsinki. Written informed consent was obtained from parents before the children were included in the study.1 ≥12%. This allowed us to divide our population into three different groups, one including patients with their asthma under control and with a negative bronchodilation test, the second consisting of children with controlled asthma but a positive bronchodilation test and the third including patients with uncontrolled asthma. Table 1 describes the main clinical and functional characteristics of our population. Table 2 shows the results of spirometry, bronchodilation test, Skin Prick Test and PAQLQ scores.According to our parameters, the asthma was under control in 98 children (73.1%), but not in the remaining 36 (26.9%). Of the 98 children with controlled disease, 17 (17.3%) had a positive bronchodilation test, meaning a deltaFEV1 and the ratio between FEV1 and the forced vital capacity (FVC) differed significantly (p≤0.001 and p≤0.005 respectively) between patients with apparently under control asthma (with a positive or negative response to the bronchodilation test) and patients with not-controlled asthma.Firstly, differences in spirometric data between different groups in our population were examined. Results of t-test showed that FEV1 and FEV1/FVC differed significantly (p≤0.05 and p≤0.01 respectively) between patients with asthma under control and a positive or negative response to the bronchodilation test. No significant differences were found in FVC between these groups. FEV1 and FEV1/FVC were not significantly different (p=0.180 and p=0.785 respectively) between patients with asthma under control but a positive bronchodilation test and patients with uncontrolled asthma.Moreover, FEVAnalysis of the differences in HRQL between groups showed that PAQLQ scores were similar in all children with asthma under control independently of bronchodilation test results, but a statistically significant difference was found between the scores of children with controlled asthma and a positive bronchodilation test, and children with uncontrolled disease (p≤0.01).3).Examination of the allergic condition in the population did not highlight differences between the three groups regarding positive Skin Prick Test to the main allergens involved in allergic asthma had an adjustment in their asthma therapy, consisting of the introduction of or increase in inhaled corticosteroids (ICS), which have been shown to provide an improvement in airway responsiveness and asthma control . Remaini1 after salbutamol ≥12% .Fifteen children were re-evaluated after 1 to 4 months, 8 of whom had had their therapy adjusted and 7 had not. Control of spirometry showed that 7 (87.5%) of the 8 children with a change in their therapy had a negative response to the bronchodilation test and 1 (12.5%) had a positive response, whereas among the patients with no change in asthma therapy 3 (42.9%) had a negative bronchodilation test, and the remaining 4 (57.1%) had an increase in FEVThe same group of patients completed the PAQLQ again at the second visit. Median values showed an improvement in HRQL in those children who had been treated with ICS , and a worsening in children whose therapy had not been modified (6.73 and 6.39), but differences are not statistically significant. The examination of the subscales of the questionnaire indicates that 5 out of 8 children who had been treated with ICS had an improvement in the “activity limitations” domain, whereas only 2 out of 7 children who had not been treated with ICS showed this enhancement.The main goal in the management of the asthmatic child is to obtain control of the disease, but subclinical alterations can be occasionally revealed in the lung function of asthmatic patients under apparent clinical control. No specific guidelines could be found about the approach to this problem, even if several studies reported such discrepancies, and the fact that asthma control is poorly judged when symptoms alone are considered has already been stated ,8,16-19.Korhonen in 1999 evaluated the treatment policy for asthmatic children in the area of Kuopio, Finland . PEF, spOur study shows a prevalence of 17.3% of positive bronchodilation tests in a group of asthmatic children who were in a symptom-free period, indicating an occult bronchial obstruction. The lung function of these children was more similar to that of children with uncontrolled asthma than to the one of those with controlled asthma and a negative bronchodilation test.The reasons why these children are asymptomatic despite having pulmonary function impairment can be multiple. First of all, an underlying, but still subclinical, pathological process in the airways could be hypothesized, similarly to what happens in some patients with apparently outgrown disease -22. SecoWe believe that patients with a positive response to the bronchodilation test even in the absence of symptoms should be regarded as undertreated. Our data on lung function after treatment figure show an The administration of the PAQLQ did not reveal any differences in HRQL between children with under-control asthma but a different response to bronchodilation. All of them, however, had a significantly better HRQL than children with uncontrolled disease. Although HRQL evaluation does not help to identify patients in need of further therapy, it is interesting to note that controlled patients with a positive bronchodilation test have some characteristics in common with those well controlled and not respondent to bronchodilation, while they are more similar to uncontrolled children for other features (lung function).However, PAQLQ re-administration in the 15 children who repeated spirometry because of the discrepancy between clinical and functional data indicates an improvement in HRQL in those who underwent ICS therapy or had an augmentation in the dosage. Their activity limitations seem to be the most concerned, because 5 children out of 8 improved in this domain of the questionnaire.The first studies which identified such discrepancies between lung function and clinical control were conducted 20 to 30 years ago. Even if since then new drugs have been developed, asthma has been widely studied and its diagnosis and treatment have generally improved, the point of asymptomatic airways alterations is still up-to-date. Adequate treatment prevents pulmonary function from worsening: in persistent asthma, ICS suppress airway inflammation, reduce airway hyperresponsiveness, improve asthma control and prevent symptoms . PersistUndertreated patients are exposed to a worse progression of asthma severity and the bronchodilation test, even in the absence of Nitric Oxide measurements, seems to identify those children who are in need of a reassessment of their therapy. Moreover, our results indicate that the pharmacological treatment of an occult bronchial obstruction helps improving HRQL.In conclusion, we believe that it is advisable to perform spirometry in asthmatic children in order to provide adequate therapy for their actual lung condition, which can be revealed by the bronchodilation test. Establishing asthma control solely on the basis of clinical parameters could be insufficient. In the absence of Nitric Oxide measurements, spirometry is a simple examination which is normally performable in every pneumologic or allergologic outpatient clinic and allows an evaluation of the bronchial obstruction status of the lung of the asthmatic school-aged child without any further, expensive investigation.

A novel technique of automatically selecting the best pairs of features and sampling techniques to predict the stage of prostate cancer is proposed in this study. The problem of class imbalance, which is prominent in most medical data sets is also addressed here. Three feature subsets obtained by the use of principal components analysis (PCA), genetic algorithm (GA) and rough sets (RS) based approaches were also used in the study. The performance of under-sampling, synthetic minority over-sampling technique (SMOTE) and a combination of the two were also investigated and the performance of the obtained models was compared. To combine the classifier outputs, we used the Dempster-Shafer (DS) theory, whereas the actual choice of combined models was made using a GA. We found that the best performance for the overall system resulted from the use of under sampled data combined with rough sets based features modeled as a support vector machine (SVM). The Canadian Cancer Society estimates about 72,700 cancer deaths, of which 3500 are in men with prostate cancer.Typically, medical doctors assess the clinical and the pathological data about the individual patient to assign a cancer stage and to choose the most appropriate treatment procedure. This is also known as clinical decision making and it is a complex process. Cancer staging performed by a doctor involves weighing multiple variables and processing information gathered by patient examination and by conducting various tests. However, this process may be subjective and therefore depends heavily on the doctor’s experience, skills and knowledge. Machine learning techniques can also be employed to learn and model the underlying theory when provided with relevant information and data. A variety of statistical, probabilistic and optimization tools under the umbrella of machine learning can be used to learn from past examples and a number of information systems have been developed to aid the clinical decision-making process.2An automated cancer staging system was developed and is described in this paper. A classifier based framework was used to draw a distinction between two primary stages of the disease: organ-confined disease and extraprostatic disease. The classifier was modeled using past data from patients diagnosed with prostate cancer who are selected to undergo surgery (or prostatectomy). One of the key issues with such data sets is the class imbalance, resulting from the number of patients with organ-confined disease, which considerably exceeds the number of patients with extraprostatic disease. Data imbalances pose problems when less observed patterns are of higher relevance, because most of the machine learning techniques tend to generalize the patterns observed over the majority of data and ignore those observed over smaller portions of the data.There are a number of machine learning techniques that can be used to develop a classifier, but it is well known that specific techniques are more suitable for certain domains. That is, for a particular problem, specific techniques have superior performance, while other techniques are only able to produce mediocre or acceptable results. Even within one problem domain, different techniques can differ in the efficiency for different ranges of the problem space. This leads to the conclusion that it is most appropriate when solving a problem, such as the one considered here, to primarily rely on actual data and information about the problem, rather than trying to generalize the performance of certain machine learning techniques in a generic manner.Lately, a number of machine learning based tools have been developed for cancer diagnosis and prediction. And a majority of this work can be categorized into those which are heavily dependant upon expert domain knowledge or on extensive historic data. Garzotto et al.In this paper, we propose a novel system which selects the features automatically and couples appropriate techniques in order to maximize the system performance. Specifically, performance of three re-sampling techniques and three feature selection techniques were evaluated. A GA is used to search for optimal pairs of feature selection and sampling techniques; where optimality is based on the performance of the system. Once such pairs are identified, respective classifiers are developed and a DS method2.Staging and analysis of prostate cancer may be regarded as a function of the information (predictors) gathered during the diagnosis of every patient. Data from a total of 1174 patients with prostate cancer positive biopsies matched with their radical prostatectomies were used for this study. All specimens were processed in one laboratory between 07/2000 and 04/2005 and were reported using standard synoptic reports. The biopsy and the prostatectomy data were collected from the information system (Cerner) of the Calgary Laboratory Services. Various biopsy predictors that were considered are: Patient Age, Primary Gleason Grade, Secondary Gleason Grade, Biopsy Gleason Score, Prostate Specific Antigen (PSA), PSA Density (PSAD), Digital Rectal Exam (DRE), Transrectal Ultrasound (TRUS), Gland Volume, Number of Positive Cores, Total percent of Cores Involvement, and Total Cancer Length in mm. Prostatectomy data included: Disease Stage (pTNM), Primary Gleason Grade, Secondary Gleason Grade, Prostatectomy Gleason Score, Tumor Volume, Seminal Vesicle Involvement, Surgical Resection Margin Status, and Pelvic Lymph Node Involvement. The prostate cancer dataset contained multiple stages for the disease, and thereby the stage data was converted into a binary format where extraprostatic disease represented by stages pT3 and pT4 was denoted by 1 and the organ-confined disease represented by stage pT2 was represented with a 0. 3.A classifier’s performance typically reflects how well it can discriminate between the objects belonging to different classes (two in this case). But the proposed system is expected to play a critical role, particularly for patients where treatment modality may have a substantial impact on the post-treatment prognosis and survival. Therefore, in terms of the classification performance, the cost of wrongly classifying a patient with extraprostatic disease is much higher than the cost of wrongly classifying one in the organ-confined stage. Conventional measures of performance therefore will not provide a relevant estimate of the classifier performance; therefore an ROC curve and the area under the curve (AUC) were used as performance indices in this study.An ROC curve is obtained by plotting the true positive rate (TPR) against the false positive rate (FPR) for varying decision thresholds. As shown in TP against the cost of FP, and each threshold setting provides a pair. A series of such pairs produced by varying the decision threshold are used to plot the ROC curve. The ideal point on the ROC curve would be where all positive examples are classified correctly and no negative examples are misclassified as positive. is the point where all the examples are predicted as negative. corresponds to classifying all examples as positive.The decision threshold or boundary for binary classification refers to a threshold, below which the object is classified as negative and above which it is classified as positive. Such a threshold can be adjusted to trade off the cost of One should note that, depending on the outcome of misclassification, ideal decision thresholds may vary. For example, if the cost of misclassifying a patient with extraprostatic disease is lower than misclassifying a patient with organ-confined disease, then a reciprocal ROC curve (to the one discussed above) will be preferred. But in this study, a classifier with an ROC tending towards the top-left of the graph indicates better performance than the ones with a lower ROC. In addition, ROC curves for different classifiers tend to intersect each other; in which case AUC is used as an alternate metric. AUC ranges between the interval and greater the value of AUC, better is the technique. The AUC of a classifier is equivalent to the probability that the classifier will rank a randomly chosen positive example higher than a randomly chosen negative example. AUC as a measure has been proved to be equivalent of the Wilcoxon test statistic4.The proposed system consists of four major parts: feature extraction, data sampling, classification and classifier fusion. Feature extraction helps identify the most prominent features in the search space thereby reducing the required computational and interpretational effort. Data sampling provides a mechanism to eliminate the bias or imbalance that exists in the data by over-sampling the minority class or under- sampling the majority class or a selective combination of both. Feature extraction and sampling enable the implementation of a classifier in order to model the class disparity in the data. A GA is then used to identify compatible sets of features, sampling techniques and classifiers in order to maximize the performance of subsequent DS classifier fusion. The adopted methods are individually described in the following subsections.Features extracted or selected from the input data, can be categorized into continuous, discrete or projected features. Existing processes of selecting features can be classified as: those based on statistical information, those based on empirical information and those based on search in the sample space. Following this approach, three techniques associated with the major types of features have been adopted. Selection of RS based discretized features relies on empirical information about the system, PCA based transformed feature selection relies on the statistics of the data and GA based continuous feature selection relies on intelligent search through the sample space.1.x, y) form an indiscernible pair over the attribute a, only if a(x) = a(y); and assuming that ∈ Ra, then Ra would be called the a-indiscernibility relation and denoted by the symbol INDa. Given that, a lower approximation set consists of all objects which can certainly be classified as elements of X over an indiscernibility relation R, i.e.Rough Set TheoryThe lower approximation set is also known as the Positive region i.e.U |IND(D). The dependency of decision variable D on independent variable R is given as:The significance of a variable is then expressed as a function of the dependency (γ) of a variable in classifying the objects into the classes of U| denotes the cardinality of set U, i.e. the number of elements contained in that set. The significance of a variable a is the increase of dependency between the independent variables and the decision variable after the addition of a, i.e.where |Because dependency (defined by Equation 3) only considers the number of rules that cover various instances and not the number of instances that each of the rules represents, a parameterized average support heuristic method has been adopted to include both, the number of rules and the number of instances supporting each rule in computing the average support function (similar to the measure of dependency), given as:di is a possible value of decision variable D, and S = max{|[x]IND(R)|:[X]IND(R) ⊂ POSR (D = di)} indicates the maximal size of the equivalence classes included in the positive region of {D = di}i.e. the support of the most significant rule for the decision class {D = di}. The significance of a variable (Equation 4) is redefined as:where 2.X denotes a {n × p} matrix for n instances of a system represented through a p-dimensional feature space. Applying PCA begins by first normalizing X into a feature set with zero mean and unit variance. PCA aims to transform this p-dimension into an m-dimensional feature space where m ≤ p, but typically the first few components represent the largest portion (∼90%) of the original information, therefore effectively using only the first m* (≪ p) components. The correlation matrix SX of X is given as:PCAY represents the {n × m} matrix for n instances of a system represented through a reduced m-dimensional feature space, the transformation is achieved by weighting the original features using m number of principal components. The m components are identified as the eigenvectors corresponding to the first m largest eigenvalues of the correlation matrix SX. The transformation of the feature space is therefore given as:If Vm is a {p × m} matrix made up of the m eigenvectors. Singular value decomposition of X is performed as:where U is column-orthogonal matrix of size {n × p}, L is a square diagonal matrix of size {p × p} where the diagonal elements are square roots of the eigenvalues of the correlation matrix SX and V is also a square matrix of size {p × p} where the columns correspond to the eigenvectors of the correlation matrix. Vm consists of the first m eigenvectors in V. The number of principal components or eigenvectors (m) is determined as per a set threshold.where 3.GAB.Two re-sampling methods are often used in order to overcome an imbalance; one is to under-sample the majority class to match the size of the minority class and the other is to over-sample the minority class to match the size of the majority class. Over-sampling and under-sampling techniques have been previously evaluated for imbalanced datasets,18k nearest neighbors in the minority class. The synthetic examples are created in the following manner:SMOTE is an over-sampling of the minority class by creating “synthetic” examples. SMOTE is actually an interpolation approach where the synthetic examples are created along the line segments joining the example under consideration and any/all of its k nearest neighbors in the minority class.For each minority class example, find its m < k) examples from the k nearest neighbors depending upon the over-sampling amount. For instance, if the required over-sampling amount is 200%, then only 2 neighbors are randomly selected from the k nearest neighbors.Randomly choose m under-sampling 2) SMOTE and 3) combined under-sampling and SMOTE in the multi-classifier fusion diagnosis system.C.Classification, an operation of assigning an unknown sample to one of the output classes can typically be performed by either fitting a model around the independent variables or through averaging or majority voting. In order to exemplify the proposed system for both types, we used SVM, which identifies a nonlinear model of the input variables, and KNN, which is based on majority voting.1.SVMk equal sized intervals or bins. Given an example x, place it in a bin according to its decision value. The conditional probability of x is estimated as:The decision value produced by SVM is not the estimate of posterior probability. Here, the binning technique is used to transform the output of the SVM into calibrated probability.n is the number of training examples that fall within the bin, m is the number of positive examples among these n training examples.where 2.k nearest training examples in the feature space. KNN classifies a new example by first calculating the distances of the new example from all other examples in the training set, and then selects k nearest training examples. The class of the new example is the most frequent class label presented among the k nearest examples:KNNs is the number of classes, ki is the number of examples belonging to class ωi among the k nearest examples, ∑ki = k; i = 1… s. The output of KNN classifier is not probability. For the two-class problem, the conditional probability can be directly estimated as:where k1 is the number of positive examples among the k nearest neighbors of x and SMOTE in the multi-classifier fusion diagnosis system.where D.A1… Am} is a set of all propositions under consideration and its power set 2Θ is formed by all possible subset of Θ, including the empty set Ø, a one-element subset {Ai} is called a singleton and a subset {Ak, Al} represents a proposition denoting the disjunction Ak ∪ Al . DS theory assigns a numerical value to each subset of the power set 2Θ using mass function or basic probability assignment m: 2Θ → . The mass function has the following properties:Suppose the universal set Θ = {A ∈2Θ that satisfy the condition m(A) > 0 are called the focal elements of mass function m. Since a subset A is the disjunction of all its elements. If the proposition B ⊆ A is true, then the proposition A is also true. Hence, given a subset A, the belief bel (A) is defined as the sum of all the masses of its subsets:Subsets bel(A) indicates the degree that evidence supports the proposition A. When two evidences exist, there will be two different mass functions m1 and m2. If these two evidences are independent of each other, then the two mass functions can be combined into a new mass function m using Dempster’s ruleThe belief value wherem1(A1) and m2 (A2) are in conflict with each other. So K is also called the conflict measure. If K = 0, the combination of m1 and m2 does not exist, it means m1 and m2 are totally contradictory. When more than two evidences exist, the mass function can be combined by sequentially using the formula:is a normalizing factor, which measures how much Ai. Proposition A1 denotes that input example x is negative, and proposition A2 denotes that input example x is positive. The power set 2Θ = {Ø, {A1}, {A2}, {A1, A2}}. The key step in the DS fusion process is to assign a basic probability assignment (BPA) to each subset of 2Θ. After calibrating, if the outputs of each of the classifiers as conditional probabilities p (Ai|x), let Dk (x) = denote the output of classifier ck, then dk,1(x) + dk,2(x) = 1; k = 1, 2. Given classifier ck, assign the BPA values of subset {A1} and {A2} as:For the prostate cancer stage prediction problem, there are two exhaustive and mutually exclusive propositions mk(Ai) indicates the degree of belief that proposition Ai is true, provided by classifier ck, k = 1, 2. Combining the evidence provided by the individual classifiers, the belief value of each proposition is given as:where m is the combined mass function calculated by the sequential use equation (hello)where The final decision is made according to the approach dealing with the imbalanced data. If re-sampling is used in the fused diagnosis system, the final decision is made by assigning the label of the class with the largest belief value:If the imbalance is dealt with by changing the decision threshold, the class of the example is determined by changing the threshold on belief value of the positive class:T is the threshold.where 5.Experiments were done to assess the performance of all of the feature extractor-sampling-classifier pairs. The available data set was divided into two: one for building the models and the other to test the developed models. Appropriate ratio of the training and testing data sizes for SVM was identified by running different trials as shown in p (c(x) = 1|x). ROC curve for the fused classifier is created by changing the threshold on belief value of the positive class. The outputs of SVM and KNN are then fused using DS fusion approach and ROC curves are plotted for the individual classifiers pairs. Each pair of is a point on the ROC curve. For individual classifiers, ROC curves are created by changing the threshold on conditional probability ssifiers –14. AUC To show the effect of combining multiple sets of features and the effect of combining different types of sampling, DS fusion of the classifier outputs was performed over various combinations of sampling and feature selection methods. The following notation was adopted to refer to the classifiers developed in this study;Notation: ‘C’ – ‘F’ – ‘S’.where ‘C’ represents the type of classifier used, i.e. {SVM, KNN}; ‘F’ represents the type of feature selection tool used, i.e. {R (rough sets), P , G } and ‘S’ represents the type of data sampling adopted, i.e. {U (under sampling), S (SMOTE), US (under-sampling + SMOTE)}. Therefore SVM-P-S would imply the classifier based on SVM trained over PCA features obtained from SMOTE sampled data.It is evident in B.x set of classifiers for best fused performance were identified, the AUC (of ROC for changing thresholds) was determined for the test samples alone. The results for the overall performance from all model combinations obtained by fusing 2, 3, 4 and 5 models are shown in Methodology proposed in this study relies on the use of GA to identify the most optimal set of classifiers for fusion, where fitness is defined as the overall fused performance. A total of 18 models (9 each for SVM and KNN with variations in the sampling method and features) were developed, and GA was used to choose the best set of fusion classifiers. Once an In order to contrast the performance of the proposed method with existing techniques, a C4.5 decision tree and a two-layer neural network have been additionally developed using the same data. C4.5, similar to the likes of expert systems and nomograms, is a simple and transparent technique which can also be regarded as means of knowledge representation. ANN, similar to the likes of SVM and nonlinear regression, on the other hand is a complex nonlinear model. These two models have been chosen to represent the majority of present day classifiers. As can be observed from 6.A number of such techniques have been reported in the literature and these techniques perform very well for individual datasets that the techniques have been built for. Data used in the previous section is a large, unbiased and consecutive patient cohort originating from one institution. Therefore it should be comparable to other current patient data obtained from patients who undergo prostatectomy in the larger North American centers. Although currently we have no access to data sets from different hospitals, we present the results of applying the proposed method to three different cancer datasets to testify that the proposed method is generic in applicability and that it outperforms other existing techniques, Firstly, we considered a simulated prostate cancer (SimPCa) dataset. 1000 patient records were synthetically generated using a combination of the under-sampling and SMOTE methods. It was ensured that the overall statistics of the data remained consistent with the dataset reported in The other two datasets considered for this purpose have been adopted from the University of California-Irvine data repository. Using the two public datasets we demonstrate that the proposed method compares favorably to the existing techniques. The Wisconsin Breast Cancer (BCa) dataIt can be observed from the above For the lung cancer data, KNN and SVM have a similar performance. The combination of under-sampling and SMOTE with PCA feature extraction had the best performance for SVM as a standalone classifier, whereas the combination of SMOTE and PCA feature extraction had the best performance for a single KNN based classifier. GA optimization yielded a four model fusion as shown in 7.A number of classifier models based on KNN and SVM have been developed to test the automatic prediction of cancer stage using different features and data samples. We propose a novel approach of using a GA to select the best models and to combine their outputs using the DS theory. Owing to DS fusion and GA optimization, the overall performance improved in all tested models. In particular, three sampling and three feature selection methods have been employed in this study. Under-sampling and rough sets based features were identified to be most useful in improving overall performance of the system.

Adherence is crucial for public health program effectiveness, though the benefits of increasing adherence must ultimately be weighed against the associated costs. We sought to determine the relationship between investment in community health worker (CHW) home visits and increased attendance at cervical cancer screening appointments in Cape Town, South Africa.We conducted an observational study of 5,258 CHW home visits made in 2003–4 as part of a community-based screening program. We estimated the functional relationship between spending on these visits and increased appointment attendance (adherence). Increased adherence was noted after each subsequent CHW visit. The costs of making the CHW visits was based on resource use including both personnel time and vehicle-related expenses valued in 2004 Rand. The CHW program cost R194,018, with 1,576 additional appointments attended. Adherence increased from 74% to 90%; 55% to 87%; 48% to 77%; and 56% to 80% for 6-, 12-, 24-, and 36-month appointments. Average per-woman costs increased by R14–R47. The majority of this increase occurred with the first 2 CHW visits .We found that study data can be used for program planning, identifying spending levels that achieve adherence targets given budgetary constraints. The results, derived from a single disease program, are retrospective, and should be prospectively replicated. Health programs aimed at diseases such as HIV/AIDS, tuberculosis, type 2 diabetes, hypertension, and cancer, require individuals to return repeatedly to sites of clinical care in order to be effective Increasing adherence requires potentially substantial monetary expenditure beyond those needed to deliver the direct services of the health program. Understanding the relationship between this investment and the benefit of increased adherence is important when planning health care programs. In the planning phase, alternatives to population-based data must be sought to support decision making and budgeting prior to implementation.In South Africa, cervical cancer is the leading cause of cancer and cancer mortality, a pattern still faced by developing countries worldwide – cervical cancer being one of the two leading causes of cancer death among women, with an estimated 270,000 deaths annually To support decision making relating to cervical cancer screening in South Africa, this analysis focuses on the relationship of monetary expenditure and a key element of prevention effectiveness – adherence – in the context of a large community-based screening program in resource poor, peri-urban areas near Cape Town. Our analysis extends previously published work The screening program and community health worker (CHW) home visit program we analyze here have been described previously The screening study was approved by the institutional review boards of Columbia University and the University of Cape Town . All participants provided written informed consent. The study was conducted according to the principles expressed in the Declaration of Helsinki.Women in the screening study have a series of scheduled follow-up appointments in which they receive cervical cancer screening tests. Women testing positive receive diagnostic colposcopy and biopsy as well as treatment and referral based on the results of these diagnostic tests. For women who do not return spontaneously for their scheduled appointments, groups of CHWs drive through the community making home visits to reschedule appointments and encourage attendance, with CHW visits repeated until return is achieved or further participation is declined. Women participating in the screening study with 6-, 12-, 24-, or 36-month appointments scheduled in 2003–4 were considered eligible for inclusion in this analysis.We estimated the cost of the entire CHW home visit program which made visits both to women enrolled in the study and to other women receiving services from the larger screening program. We adopted an ingredients-based approach to costing. We identified the types of resources used: 1) CHW time spent driving and making home visits, 2) fuel used during CHW visits, 3) maintenance and depreciation of the vehicles. For each resource type, we then assigned a monetary value for a unit quantity. Finally, the number of units used and unit values were multiplied and then summed to produce a total cost estimate. All costs are presented in 2004 Rand (R) with prices from other years adjusted to 2004 levels based on the South African Gross Domestic Product deflator In the program, CHW home visits were grouped into trips, with a trip being defined as leaving the clinic, driving a circuit through the community making multiple home visits, and returning to the clinic. The total amount of CHW time per home visit equaled the number of CHWs on the trip multiplied by the duration of the trip divided by the number of home visits. CHW time was valued at R2,500 per month for a 1,840 hour work year (R16.3 per hour). Fuel and vehicle maintenance costs were derived directly from the project's cost accounting system. Vehicle depreciation was based on purchase price, excluding taxes and duties, and used a five-year straight-line formula assuming a 3% discount rate and no resale value Attendance for scheduled appointments was classified into three categories: 1) spontaneous, on-time return; 2) late return with CHW visit(s); 3) no return despite CHW visits. Two sources of data were used to classify appointment attendance. First, the study appointments database indicated the date when individuals attended appointments compared to their scheduled dates. Second, weekly CHW summary logbooks were transcribed and verified against individual CHW visit reports to create an electronic database of CHW home visits. By linking the databases, we identified on-time versus late attendance and how many CHW visits preceded appointment attendance.In the study, CHW home visits continued until a woman returned or declined further participation. In addition to analyzing the cost of CHW visits relative to return rates as observed, we considered hypothetical alternative policies for CHW visits. Specifically, we asked how much would be spent and what level of appointment attendance achieved if each woman could receive no more than a fixed number of CHW visits for a given appointment type. For this analysis, we assumed that CHW visits caused additional appointment attendance and that those women who did not return after receiving the maximum number of CHW visits allowed under a given policy would not return spontaneously afterwards.Under these assumptions, we constructed response functions relating spending (the independent variable) to appointment attendance (the dependent variable) via CHW visits. For each appointment type, we sequentially imposed hypothetical policies where the maximum number of CHW visits was set at higher and higher levels. For each policy, we used the observed data to estimate the additional percentage of all women eligible for that appointment type who returned with no more than the maximum number of CHW visits allowed by the policy. Based on the number of additional CHW visits performed under the policy, we also calculated the additional cost. Taken together, these quantities formed the response functions for each appointment type. Each function's input was spending per woman on CHW visits with the output being the percentage of women who returned for their appointments.Intercooled Stata 8.2 was used for all statistical analyses. Linking and classification of study databases and CHW logbook databases were performed using Excel 2003's Visual Basic for Applications .In 2003–4, 981 CHW trips were conducted. The mean number of women visited per trip was 5.4 , and the mean number of CHWs who went on each visit was 2.9 . The mean time spent visiting each woman during a trip was 21.9 minutes . This implies that the 5,258 CHW visits conducted required 5,566 hours of CHW time driving throughout the community and visiting women in their homes.Over the 2 year period, the value of CHW time spent making home visits was R91,399, while fuel, vehicle maintenance, and depreciation costs attributable to CHW visits were R37,704, R28,130, and R36,785, respectively. In total, the CHW home visits cost R194,018 with a cost per CHW home visit of R36.6.Of the 5,258 CHW visits conducted, 4,617 visits were made for women enrolled in the study, identified via the study database linkage, with the remainder targeting women receiving screening services through the program but not enrolled in this study. Subsequent results are reported solely for enrolled women.The number of CHW visits required for each appointment type was: 338, 1,680, 1,928, and 671 for the 6, 12, 24, and 36 month appointments, respectively . The totIn the context of this South African cervical cancer screening program, high levels of repeated attendance (>75%) were achieved at scheduled screening appointments using community health worker (CHW) home visits. For follow-up appointments scheduled 1 to 3 years after initial screening, CHW home visits represented an appreciable additional cost (above R35 per woman screened). As cervical cancer prevention programs that achieve high adherence can be both effective and cost-effective An important limitation is the generalizability from this study to current South African cervical cancer screening policy. While our study evaluates participant adherence over a 3 year follow-up period, current South African recommendations involve screening at 10 year intervals . In our study, adherence without intervention declined as the interval between screening appointments lengthened, and it is quite possible that the level of adherence after 10 years would be very low. Such low adherence would certainly require some intervention. However, it could be that the effectiveness of a CHW-based adherence program after 10 years would be low or simply be more costly given the large portion of screened individuals that might require CHW visits. Interestingly, Goldie et al. find that using screening intervals of 5 years appears more effective and cost-effective than screening every 10 years in South Africa While the costs and adherence observed in the context of the study accurately reflect the experience in one peri-urban center in South Africa, other locations and interventions may result in different costs and impact of CHW visits on adherence. For example, in a pre-post community-based study, the use of intensive pre-counseling by CHWs was associated with an increase of more than 50% in the proportion of women choosing voluntary counseling and testing for HIV, compared to shorter, standard nurse-provided counseling. Similarly, it was associated with increases in self-reported consistent condom use over 1 and 6 month periods (increased 10% and 5% respectively) . In another local program providing CHW home visits and basic nursing care for people living with HIV/AIDS, orphans, and the elderly We note that alternatives to CHW home visits such as cell phone-based interventions were not tested in the study, though, in theory, they could be more effective and/or less costly than CHW visits. While phone ownership was quite low in our sample of 35–65 year old women, cell phone subscriptions have nearly tripled in South Africa since 2003, making the use of cell phones an important feature for a variety of services offered to relatively resource poor individuals in South Africa and elsewhere It is important to emphasize that the response functions relating costs due to CHW visits and appointment attendance are based on hypothetical policies of making no more than a given number of CHW visits for a given woman and appointment type. Such policies were not prospectively tested in the screening population to produce observed counterfactuals. However, the patterns of return for appointments across appointment types are plausible – earlier appointments with shorter time periods between clinical contacts (6-month and 12-month appointments) have greater spontaneous attendance and/or greater responsiveness to the first CHW home visit compared to 24- and 36-month appointments . AdditioAdherence response functions can be used in a variety of ways. First policymakers can calculate how, under a fixed budget, different intervals between clinical contacts may lead to different rates of appointment attendance. Alternatively, for a target level of appointment attendance, the associated cost can be computed. For model-based cost-effectiveness analyses, levels of adherence are entered as a parameter based on initial assumptions. The impact of the adherence parameter on model-simulated outcomes is typically explored via sensitivity analyses in which the level of adherence is varied systematically. However, as we demonstrate, different levels of adherence can be achieved through different, non-linear levels of program expenditure, and thus sensitivity analyses of adherence could be improved by simultaneously varying the level of adherence and its associated costs based on response functions like those we have estimated here.Substantial improvements in appointment attendance can be achieved in a South African cervical cancer screening context using community health worker home visits. As home visits require money and resources that could be used to provide other healthcare services, seeking to maximize attendance while controlling expenditure is both important and prudent. In this context, we illustrate a method for estimating the relationship between monetary investment in subprograms focusing on adherence and observed increases in adherence, using data from a longitudinal, community-based demonstration project. Such an approach may be useful for public health program planning and budgeting across a broad range of diseases and country settings.

To examine the trend of "mobile only" households, and households that have a mobile phone or landline telephone listed in the telephone directory, and to describe these groups by various socio-demographic and health indicators.Representative face-to-face population health surveys of South Australians, aged 15 years and over, were conducted in 1999, 2004, 2006, 2007 and 2008 . Self-reported information on mobile phone ownership and usage (1999 to 2008) and listings in White Pages telephone directory (2006 to 2008), and landline telephone connection and listings in the White Pages (1999 to 2008), was provided by participants. Additional information was collected on self-reported health conditions and health-related risk behaviours.Mobile only households have been steadily increasing from 1.4% in 1999 to 8.7% in 2008. In terms of sampling frame for telephone surveys, 68.7% of South Australian households in 2008 had at least a mobile phone or landline telephone listed in the White Pages . The proportion of mobile only households was highest among young people, unemployed, people who were separated, divorced or never married, low income households, low SES areas, rural areas, current smokers, current asthma or people in the normal weight range. The proportion with landlines or mobiles telephone numbers listed in the White Pages telephone directory was highest among older people, married or in a defacto relationship or widowed, low SES areas, rural areas, people classified as overweight, or those diagnosed with arthritis or osteoporosis.The rate of mobile only households has been increasing in Australia and is following worldwide trends, but has not reached the high levels seen internationally (12% to 52%). In general, the impact of mobile telephones on current sampling frames (exclusion or non-listing of mobile only households or not listed in the White Pages directory) may have a low impact on health estimates obtained using telephone surveys. However, researchers need to be aware that mobile only households are distinctly different to households with a landline connection, and the increase in the number of mobile-only households is not uniform across all groups in the community. Listing in the White Pages directory continues to decrease and only a small proportion of mobile only households are listed. Researchers need to be aware of these telephone sampling issues when considering telephone surveys. With the rapid changes to the telecommunications industry, it is unknown whether telephone surveys can continue to be used to reliably collect representative information regarding health status and health risk behaviours. Telephone surveys, traditionally using landline telephones, have been used to collect and monitor health-related information over the last 30 years -3 and haIn Australia, for the last decade, the coverage of households with a telephone connected (landline) and the adequacy of the sampling frame(s) have been a concern for those involved in epidemiologically-sound telephone surveys. The proportion of people who do not have a landline telephone connected in the household is not uniformly distributed in the population,11 and tSince the early 2000 s, international trends have seen households change to new telecommunications technologies, whereby individuals in the household are solely contactable by mobile phones or other means such as Voice over Internet Protocol (VoIP), not by the traditional landline telephone. This has negatively impacted on telephone surveys and sampling methodologies. International studies have shown a dramatic increase in mobile only households (those not having a landline telephone connected to the household). In 2006, 11.8% of households in the United States , 52% in As a result of these rapid changes both in Australia and worldwide, determining an adequate sampling frame to include these non-traditional telephone numbers and to demarcate geographic locations, is becoming increasingly important. This paper presents how two factors impact household telephone surveys in Australia; the presence of mobile only individuals and the lack of full enumeration of telephone numbers in a telephone directory. Mobile only households are not covered in the RDD sampling frame and unlisted telephone numbers (landlines and mobiles) are not covered in the EWP telephone directory. Both samplings frames exclude people with no mobiles or landline telephones. The aim of this study is to examine the trend of mobile only households and households that have a mobile telephone or landline telephone listing in the EWP, and to describe these groups by various socio-demographics and health indicators to determine the potential bias due to non-coverage in the sample in the Australian context.Questions regarding landline telephone, mobile, and internet connections were included in the 1999, 2004, 2006, 2007 and 2008 South Australian Health Omnibus Surveys (HOS),19. HOS Questions about landline telephone connection and listing in the EWP were included in the 1999, 2004, 2006, 2007 and 2008 surveys. These surveys also included questions on mobile phone ownership and usage in the household. Additional questions on mobile phone listing in the EWP, and future landline and mobile phone ownership plans were included in 2006, 2007 and 2008.Identical demographic variables included in each survey were age, sex, area of residence, country of birth, education level, marital status, gross annual household income, and work status. The Index of Relative Social Disadvantage (IRSD) developed by the ABS was also calculated to identify the geographical areas that were relatively disadvantaged. The IRSChronic conditions included medically confirmed diabetes, current asthma, arthritis and osteoporosis. Self-reported health risk factor data included smoking status and body mass index (BMI) which was derived from self-reported weight and height and recoded into four categories . Mobile The questionnaire and methodology for these surveys were approved by the Human Research Ethics Committee of the South Australian Department of Health .2 test for trend was used for mobile only households, households with landline telephone only connections and households with both a landline telephone connection and mobile. A comparison between 2006, 2007 and 2008 using χ2 tests for trend was undertaken to assess for change in various socio-demographic and health-related variables between mobile only households and households with a landline or a mobile telephone number listed in the EWP.Data analysis was conducted using SPSS for Windows Version 15.0. The conventional p value of 0.05 was used as the criterion for statistical significance. To compare prevalence over time (from 1999 to 2008), χ2 tests were undertaken for 2006, 2007 and 2008, to assess mobile only households, and households with a landline or a mobile telephone number listed in the EWP on a range of socio-demographic and health-related variables.Separate univariate analyses using χ2trend = 177.01, p < 0.001). There was a statistically significant decline in the proportion of households with landline telephone only connections from 44.6% in 1999 to 6.9% in 2008, and a statistically significant increase in households with both a landline telephone connection and mobile from 52.7% in 1999 to 83.8% in 2008.Table 2trend = 18.6, p < 0.001). Hence, 68.7% of South Australian households in 2008 had at least a mobile phone and/or landline telephone listed in the EWP . Of households with both a mobile and landline telephone connected, 7.4% had their mobile number listed in 2008 (7.3% in both 2006 and 2007). Examination of households with a landline telephone connection revealed that 77.0% of these households in 2006, 76.3% in 2007 and 74.1% in 2008, had their landline telephone numbers listed in the EWP Table were exaWhen examined by selected demographics for 2006, 2007 and 2008 , is not as high as other international studies: 11.8% in the United States and 17% From this study, using LA-RDD methodology to generate a sampling frame to include unlisted landline telephone numbers excludes mobile only households as well as households with no landline telephone connection which is 9% of the population. This could be considered small and one There are some data quality and collection issues that need to be taken into account when including mobile telephones into the sample frame. One is the location or the situation of the respondent at the time of the interview: respondents may choose not to answer a call to save battery life; answering a call which may incur a cost to both the respondent and the researcher ; and safety and legal issues, eg the respondent may be driving and using their mobile at the same time which is illegal in Australia . A studyFurthermore, the selection of the respondent differs between mobile and landline telephones. The mobile telephone is usually individually owned and accessed by that one individual most of the time, compared to landline telephones that belong to a household which may be accessed by one or more people. Hence, consideration needs to be given when sampling strategies in terms of randomly selecting a single person to interview versus a number of eligible people in a household .This study has highlighted the need to acquire a representative sampling frame and sampling methodology for household telephone (landline) surveys that minimises selection bias and is efficient in terms of administration and cost. With landline telephone numbers, the majority of the telephone numbers are listed in the EWP and the prefix of the telephone numbers are geographically based. Mobile telephones are the opposite; they are rarely listed (7.3% of mobile telephone users found in this study) and the number structure does not provide any details of geographical location, hence making it difficult to generate a sampling frame similar to current cost effective RDD methods. The large proportional difference in the EWP directory listing between landline and mobile telephone numbers would be mainly due to the options provided to the owners: owners of landline telephone need to pay to have their telephone numbers not listed in the EWP, and owners of mobile telephone need to pay to have their mobile telephone numbers in the EWP. Hence EWP samples are likely to continue to have a small proportion (6.9% in 2008) of mobile only households in the sampling frame. According to these results, if the option is to sample from the EWP, approximately 30% of the population will be excluded, particularly young people, those who have never married, those who reside in rural areas, people on lower income levels, the unemployed and students. In terms of health indicators, people in the normal weight range and current smokers could be under-represented.Another emerging technology that has not been examined in this study is VoIP (Voice over Internet Protocol). In Australia, the impact of VoIP on sampling frames is not known. VoIP is seen as a cost effective system that utilises broadband data lines. Similar to mobile phones, the structure of VoIP telephone numbers are not geographically based and owners have the option of listing their VoIP telephone number in the EWP directory. More research is required on the uptake of VoIP including usage and impact on sampling frames.The results of this study are potentially biased due to survey non-response. The response rates from these surveys (51.9% to 70.6%) could be considered moderately acceptable for a population survey of this kind. With increasingly inaccessible buildings (eg locked gates), busy lifestyles, and security and privacy concerns, an ongoing impact on response rates is expected, following patterns and trends interstate and overseas . The unwWhat does this mean for telephone (landline) surveys? Researchers need to be aware of the rapid changes in the telecommunication industry that potentially have an impact on collecting representative and reliable data on health-related issues using household telephone (landline) surveys. Studies like this are important because of the increasing need to monitor public health issues in a timely manner in an environment with limited and sometimes conflicting resources. Within these limits, there is a need to determine valid and reliable methods to verify the health estimates used for policy, planning of resources, and evaluation of health promotion interventions. Further research is needed in the area of mobile telephones such as how often the mobile is turned on, whether telephone calls are made more on the mobile or landline, and the likelihood of completing a health survey on a mobile telephone. Further Australian research is also required in terms of different weighting or post-survey adjustment strategies (eg raking) , improveCoverage of households with a telephone connected (landline) and the adequacy of the sampling frame(s) have been a concern for those involved in epidemiologically-sound telephone surveys. The rate of mobile only households in South Australia has been increasing and is following worldwide trends but has not reached the high levels seen internationally (12% to 52%). Presently, the impact of mobile telephones on current sampling frames (exclusion of mobile only households or non-listings in the White Pages directory) may be small in relation to the health estimates obtained using telephone surveys. However, researchers need to be aware that mobile only households have distinctly different characteristics compared to households with a landline connection and the increase in the number of mobile-only households is not uniform across all groups in the community. Listing in the White Pages directory is continuing to decrease and only a small proportion of mobile only households are listed. Researchers need to be aware of these telephone sampling issues when considering telephone surveys.ABS: Australian Bureau of Statistics; BMI: Body Mass Index; CD: Collector Districts; EWP: Electronic White Pages; IRSD: Index of Relative Social Disadvantage; LA-RDD: List-assisted Random Digit Dialling; RDD: Random Digit Dialling; SPSS: Statistical Package for Social Sciences; VOIP: Voice over Internet ProtocolThe authors declare that they have no competing interests.EDG was responsible for the intellectual planning of the project, conception and design of the study, oversight of the Health Omnibus Survey, analysis of data, and interpretation of the data, and drafting of the article. AT was responsible for the intellectual planning of the project, oversight of the Health Omnibus Survey, interpretation of the data and revising of the paper for critical important intellectual content. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2288/10/77/prepub

Campylobacter was isolated from patients' stool samples. We conducted an investigation to identify the source and describe the extent of the outbreak.On 7 May 2007 the medical officer in Røros (population 5600) reported 15 patients with gastroenteritis. Three days later he estimated hundreds being ill. Untreated tap water from a groundwater source was suspected as the vehicle and chlorination was started 11 May. Campylobacter isolates were typed by AFLP for genetic similarity at the Norwegian Institute of Public Health. Local authorities conducted the environmental investigation.We undertook a retrospective cohort study among a random sample of customers of Røros and neighbouring Holtålen waterworks. Holtålen, which has a different water source, was used as a control city. We conducted telephone interviews to gather data on illness from all household members. One randomly selected household member was asked about detailed exposure history. The regional hospital laboratory tested patients' stools for enteropathogens. 2 for trend = 8.1, p = 0.004). Campylobacter with identical AFLP was isolated from 25 out of 26 submitted stool samples. No pathogens were detected in water samples. We identified several events that might have caused pressure fall and influx of contaminated water into the water distribution system. On two occasions, pressure fall was noticed and parts of the distribution system were outdated.We identified 105 cases among 340 individuals from Røros and Holtålen (Attack Rate = 31%). Tap water consumption was the only exposure associated with illness. Among randomly selected household members from Røros, a dose-response relationship was observed in daily consumed glasses of tap water (χThe investigation confirmed a waterborne outbreak of campylobacteriosis in Røros. Although no single event was identified as the cause of contamination, this outbreak illustrates the vulnerability of water distribution systems. Good quality source water alone is not enough to ensure water safety. For a better risk management, more focus should be put on the distribution system security. Waterworks personnel should monitor the pressure regularly; reduce the leakage by upgrading the distribution network and use chlorination when conducting maintenance work. Untreated groundwater is used in waterworks in many countries -4, incluThe Norwegian drinking water regulations require two independent hygienic barriers in a drinking water supply system. Hygienic barriers are defined as "natural or man-made obstacles preventing occurrence of infectious, chemical or physical particles in the water so that they no longer represent any health risk". Most coIn Norway, groundwater is used as a source in 37% of the waterworks. These usually small waterworks supply 10% of the population, on average about 700 persons each . In the Campylobacter is the most commonly reported bacterial cause of gastroenteritis in many developed countries [Campylobacter is carried in the intestinal tract of all types of domestic livestock and many wild animals, including birds. The source of infection frequently remains unknown [ountries with a lountries . Finding unknown .Campylobacter infection are notifiable to the Norwegian Surveillance System for Communicable Diseases [Campylobacter is the most common bacterial gastrointestinal infection in Norway [Campylobacter can survive 2–4 weeks in water, depending on the origin of the strain [Sporadic cases with laboratory confirmed Diseases . Campylon Norway . It was n Norway . Drinkinn Norway . Other in Norway . Campyloe strain .Campylobacter spp.On Monday 7 May 2007, the municipal medical officer in Røros notified the Norwegian Institute of Public Health (NIPH) about 10 patients with gastroenteritis who had consulted Røros municipal health centre during the weekend. Røros is a small town, situated in mid-Norway. Its municipality has 5600 inhabitants. According to the medical officer, the estimated number of cases rose to a few hundreds in the three following days, and tap water was suspected to be the vehicle of infection. Five patients' stool samples were positive for The local Food Safety Authority, the Municipal Health Authority and NIPH conducted an outbreak investigation to identify the source of the outbreak and implement preventive measures.3) to provide necessary pressure for households in the higher areas of Røros (RH zone). The lower area of Røros (RL zone) receives water directly from the common tank, through gravity. The RH zone is mainly a residential area and the RL zone includes the town centre. The water is not chlorinated or disinfected in any way before reaching the customers.The municipal waterworks, which supplies Røros town, provides 3600 people with tap water. Groundwater comes into the system from two wells drilled into an aquifer under an island in a lake northeast of Røros Figure . Two maiA small neighbouring community has a separate waterworks that supplies 600 people (Holtålen waterworks).On 10 and 11 May we interviewed patients with gastrointestinal symptoms presenting at the municipal health centre in Røros using a standard trawling questionnaire. We asked them about common exposures for food and waterborne gastroenteritis.To assess water as a risk factor, we conducted a retrospective cohort study on a random sample of customers from Røros and Holtålen waterworks. We aimed at selecting 40 households from each waterworks zone . We obtained a list of all waterworks customers which we randomized using Excel. We used this list to phone the customers' households for an interview. In case of no response, the next household on the list was called.To estimate the overall attack rate, we collected basic information from all household members: age and sex, experiencing symptoms of gastroenteritis since 1 May, duration of illness and whether or not they consulted a doctor. The date 1 May was selected based on the dates of onset reported in the pilot study. One household member from each household – the person with the nearest upcoming birthday – was selected to provide details on possible exposures during the first week in May (= "a selected household member"). The exposures included food exposures such as eating raw vegetables, dairy products and poultry; restaurants, venues, travelling, work place, amount and location of tap water consumed. We also asked whether they had noticed any tap water abnormalities such as air in the pipes or discolorations during the same period.OR experiencing at least two of the following symptoms of acute gastroenteritis lasting at least two days in the same time period: nausea, vomiting, stomach cramps or pain, flatulence, blood in the stool and fever. We excluded those who recently travelled abroad, those with unknown date of gastroenteritis symptoms onset and those whose illness started before 1 May 2007 from the analysis.A case was defined as a person living in Røros or Holtålen municipality with diarrhoea (passing three or more loose stools in one day) from 1 to 14 May 2007 2 for linear trend.The data were entered into an EpiData database and analysis was performed using Excel and Stata 9. The gender and age distribution of our cohort sample was compared with that of the general population in Røros for representativeness. We calculated water and food specific attack rates (AR), relative risks (RR), 95% confidence intervals (95% CI) and Fisher's exact p-value for the various exposures. We measured the association between the drinking water consumption and the risk of disease using the χIn agreement with the International Guidelines for Ethical Review of Epidemiological Studies by the Council for International Organisations of Medical Sciences (CIOMS) (1991), investigations of acute infectious diseases outbreaks are considered an urgent public health task in Norway under the Infectious Disease Control Act and regulations and are exempted from approval by the ethical review board.To rapidly assess the attack rate in the different supply zones (RH and RL), we phoned and asked 11 institutions (six kindergartens and five nursing homes) about the occurrence of gastroenteritis among the employees or children/residents. We assumed children and residents in the institutions to be less mobile and therefore more likely to be exposed to tap water from only one of the two supply zones.Campylobacter on charcoal cefoperazone desoxycholate agar in a microaerophilic atmosphere at 42°C for two days. Typical colonies including oxidase positive, hippurate positive, motile short rods were identified as Campylobacter jejuni. The Campylobacter isolates were sent to the NIPH for genotyping using amplified fragment length polymorphism (AFLP)[Giardia lamblia and Clostridium difficile toxin A/B using enzyme immuno assay or polymerase chain reaction [Cryptosporidium oocysts and Giardia cysts on previously frozen samples was done at the Norwegian School of Veterinary Science.Stool samples were collected from some of the symptomatic patients at Røros and Holtålen municipal health centres. Culture and biochemical identification of bacterial enteropathogens were done according to standard microbiological methods at St. Olavs Hospital in Trondheim ,15. The sm (AFLP),17. The reaction ,19. MicrWaterworks personnel take weekly routine water samples from seven different locations in Røros according to their risk assessment strategy. Weekly samples are tested for total bacterial count, coliform bacteria, turbidity and colour. Quarterly samples are additionally tested for intestinal enterococci, pH and conductivity. All tests are performed according to the standard methods described in the national legislation for waterworks .During the outbreak, the waterworks personnel took additional samples from different locations in the water distribution system. Samples taken on 11 May were additionally tested for Campylobacter according to the national standard method (NS-ISO 17995).The local Food Safety Authority and the waterworks personnel thoroughly inspected the Røros waterworks, including the wells, the reservoirs and the distribution system. They assessed recent maintenance work and events which could have caused contamination.All 15 patients included in the pilot study reported onset of gastrointestinal symptoms from May 3–7, 2007. All of them received water from Røros waterworks and drank water at home in the week before the illness onset. They did not share any other common exposures .We recruited 101 households from Røros (59 from the RH zone and 42 from the RL zone) and 40 from Holtålen in the cohort study, with a total of 345 household members. Of these, five were excluded from the analysis due to unknown illness status or because the criteria for our case definition were not fulfilled. Among the 340 household members, 105 met the case definition, accounting for attack rate (AR) of 31%. The AR was 42% among customers of Røros waterworks (RH + RL) alone and 3% among customers of the neighbouring Holtdålen waterworks . The median age of the cases was 40 years (range 0–85). The majority of cases presented with diarrhoea ; two of them reported blood in the stool. Among the ten cases not reporting diarrhoea, all reported stomach cramps or pain and one or more of the following symptoms: flatulence (7/10), fever (6/10), headache (3/10) and nausea (2/10). In 81 (77%) of the cases, the symptoms lasted three days or more; mean and median duration was five days (range 1–14 days). Diarrhoea (90%) and stomach cramps (77%) were the most prevalent symptoms, followed by fever (48%). Nine cases (9%) reported vomiting and six (6%) consulted a physician.Campylobacter infection acquired in Røros during the time of the outbreak were hospitalized. A year after the outbreak the municipal medical officer reported one confirmed case of reactive arthritis in a 7 year old boy and about 10 patients with arthralgias. According to data available surveillance database for children under 15 years old and personal communication with municipal medical officer) no diagnoses of Guillain-Barré syndrome, a rare severe acute polyneuropathy, were made. No deaths were reported as a consequence of this outbreak in The Cause of Death Register.According to the Norwegian Surveillance System of Communicable diseases , seven pOnly selected household members (one per household) were asked about detailed exposures, therefore 101 persons provided these details. Water consumption among selected household members in the first week of May is shown in Table 2 for linear trend = 8.1; p = 0.004, Figure Among the 101 selected household members, the risk of illness increased with the amount of daily consumed tap water and its culture showed no growth of Campylobacter. All 38 samples tested for norovirus were negative.Out of 38 samples cultured for Clostridium difficile toxin A/B, one was toxin positive and negative for Campylobacter.Of eight samples tested for Giardia lamblia and all were negative. Microscopy of 18 available samples at the Norwegian School of Veterinary Science revealed two samples with Cryptosporidium parvum and one with Giardia lamblia. Out of these 18 samples, 15 were positive for Campylobacter jejuni, including the one sample positive for Giardia.Thirty two specimens were examined for The main part of Røros waterworks was constructed in 1979. The piping is of variable age, with some parts dating from 1910, and of variable materials. The supply to the lower area of Røros starts with 300 m of wooden main pipes from 1942. Considerable amount of leakage from Røros waterworks was reported in 2006 to the Waterworks registry at NIPH: 40% of the water was lost before reaching the customers .Both wells and the common collecting tank are well protected. Our investigation established it would be possible for birds to enter through the ventilation of the elevated reservoir Figure and thisE.coli), routine weekly water samples were satisfactory in the years preceding the outbreak.With the exception of two occasions in 2005 and 2006 with samples positive for coliform bacteria with more than 1000 L/min was caused by tap water, contaminated with Campylobacter, late complications of the infection such as reactive arthritis arthritis [This outbreak is among the largest waterborne outbreaks reported in Norway ,18. In orthritis and Guilrthritis may add Campylobacter positive samples suggest a common source outbreak. Three out of 18 samples tested for parasites were positive, therefore sewage contamination, which usually causes outbreaks with several pathogens [Campylobacter strains were identical, we believe other detected pathogens in the stool samples represent sporadic cases and the contamination was most likely caused by a livestock source or bird excrements rather than sewage.Detailed data on response rate in our cohort study are missing, but we estimate less than 10% of the people contacted declined a phone interview. The epidemic curve Figure and the athogens cannot bCampylobacter infection is 2–5 days [Campylobacter is uncommon [Since the average incubation period for 2–5 days , the mosuncommon and sincWe were not able to demonstrate a difference in attack rates between the higher and the lower area of Røros, even with the help of the additional study among institutions. Since the daily activities of most people in the RH zone include working, shopping or attending school in the RL zone, a possible difference would be difficult to detect.Campylobacter was not isolated from Røros waterworks samples taken on 11 May – a little more than one week after the probable contamination event. This bacteria can be difficult to detect in water samples, even if a contamination is strongly suspected [uspected ,10,24. Tuspected .A previous retrospective community based survey using self reported illness to estimate the size of waterborne outbreaks has been criticized by Hunter and Syed . The autWaterborne outbreaks have been shown to result from several concurrent faulty factors. To ensure good drinking water risk management, critical barriers such as water treatment, source protection, distribution security and monitoring/response capabilities are needed . The groCampylobacter has not been shown to be an important component in biofilms [Wood, used as a piping material, enables the aggregation of microorganisms, which form "biofilms". biofilms , althougbiofilms .Campylobacter . A recent study from South-western Norway has shown a 26% prevalence of C. jejuni in Norwegian cattle [Leakages in the system represent an increased risk of gastrointestinal illness among waterworks customers . Low pren cattle . Standinn cattle .Routine chlorination is required when waterworks personnel conduct maintenance work. We recommend additional water samples to be taken in such cases to make sure the water quality is not affected. Improved training of waterworks personnel might lower the risk of negligence in the future.In Røros, additional effort needs to be made to diminish the leakage problem, which makes the system vulnerable to pressure fall and contamination. Regular monitoring of the pressure has now been established. The wooden piping has been scheduled to be changed with cast iron piping in the summer of 2008. All fire valves were secured with lids to prevent contamination. Further plans to upgrade the system have been made. The firemen were advised to change their weekly emergency practice to allow more time for filling their tanks to avoid sudden pressure drop in the system.Drinking water safety is largely taken for granted in affluent countries and a stWe describe a large waterborne outbreak of gastrointestinal disease in Røros traced to a waterworks with well protected groundwater source and with established regular water sampling and monitoring. Our investigation discovered several faults in the distribution system, which challenged the distribution security. Similar waterborne outbreaks in Scandinavia with larThe authors declare that they have no competing interests.IJ participated in the study design, data gathering, data entering and analysis and drafted the manuscript; KB participated in study design, data gathering and analysis, communication with local authorities and drafting of the manuscript, LV participated in study design, data gathering and communication with laboratory and local authorities, HL was leading the local investigation and participated in data gathering, TF participated in the environmental investigations and communicated with the local press, RH evaluated and reported the results of the laboratory analyses for local and national authorities and participated in drafting the manuscript regarding microbiology, KN participated in the study design, carried out the statistical analysis and drafting of the manuscript.The pre-publication history for this paper can be accessed here:

The CDX2 transcription factor is expressed in intestinal epithelium and is markedly down-regulated in colon tumours. Furthermore, Cdx2 heterozygous null mice develop multiple intestinal tumours. In this present study, we have investigated CDX2 as a potential candidate gene for sporadic CRC by a thorough search of all exons and exon/intron boundaries for DNA polymorphisms and rare variants in a panel of CRC tumours. 6 polymorphisms were identified and the haplotypes determined. In addition two rare variants were found, one of which was only identified in DNA from a CRC case. Loss of heterozygosity was observed in 3 out of 28 informative CRC cases. A possible association between particular haplotypes and tumour progression was also suggested by the data. In addition a preliminary analysis of the relative expression of CDX2 alleles in tumour/normal tissue suggested some variation in the levels, however further analysis is required before any conclusions can be drawn. While CDX2 mutations predisposing to sporadic CRC have not been identified, this study has established that loss of CDX2 contributes towards the progression of some sporadic CRC tumours. © 2001 Cancer Research Campaign http://www.bjcancer.comAccumulation of mutations in tumour suppressor genes and oncogenes has been proposed to underlie the initiation and progression of sporadic colorectal cancer (CRC). Evidence is accumulating to suggest that the

These perfusates were also analysed using nuclear magnetic resonance (NMR) spectroscopy to identify putative sex-differences in other liver-derived metabolites. Effects of insulin were monitored by analysis of Akt-phosphorylation, gene expression and HGO after s.c. insulin injections.Genes involved in hepatic metabolism have a sex-different expression in rodents. To test whether male and female rat livers differ regarding lipid and carbohydrate metabolism, whole-genome transcript profiles were generated and these were complemented by measurements of hepatic lipid and glycogen content, fatty acid (FA) oxidation rates and hepatic glucose output (HGO). The latter was determined in perfusates from Out of approximately 3 500 gene products being detected in liver, 11% were significantly higher in females, and 11% were higher in males. Many transcripts for the production of triglycerides (TG), cholesterol and VLDL particles were female-predominant, whereas genes for FA oxidation, gluconeogenesis and glycogen synthesis were male-predominant. Sex-differences in mRNA levels related to metabolism were more pronounced during mild starvation (12 h fasting), as compared to the postabsorptive state (4 h fasting). No sex-differences were observed regarding hepatic TG content, FA oxidation rates or blood levels of ketone bodies or glucose. However, males had higher hepatic glycogen content and higher HGO, as well as higher ratios of insulin to glucagon levels. Based on NMR spectroscopy, liver-derived lactate was also higher in males. HGO was inhibited by insulin in parallel with increased phosphorylation of Akt, without any sex-differences in insulin sensitivity. However, the degree of Thr172-phosphorylated AMP kinase (AMPK) was higher in females, indicating a higher degree of AMPK-dependent actions.Taken together, males had higher ratios of insulin to glucagon levels, higher levels of glycogen, lower degree of AMPK phosphorylation, higher expression of gluconeogenic genes and higher hepatic glucose output. Possibly these sex-differences reflect a higher ability for the healthy male rat liver to respond to increased energy demands. In most mammalian species post-pubertal growth, body size and body composition are sexually dimorphic . Muscle The prevalence of early abnormalities of glucose metabolism has been estimated to be higher in men than in premenopausal women . Since wTo gain a deeper insight into the sex-differentiated activities of the liver, we and otheThe liver has a major role in energy storage after a meal, as well as in the release of fuel molecules during situations such as starvation. Based on previous studies in both humans and animals , males mGlycogen storage, release of glucose and ketone bodies are major functions of the liver that differ depending on the metabolic state of the individual. In this study we aimed to substantiate the hypothesis that healthy (lean) male and female rat livers differ regarding these functions. We believe that this could provide a basis for an improved understanding of which mechanisms that might be involved in the development of sex-different disease linked to the liver. Male and female rats, fed standard diet and fasted for either 4 h or 12 h, were compared regarding hepatic gene expression, lipid and glycogen content, fatty acid (FA) oxidation rate, release of glucose and ketone bodies. Furthermore, liver perfusates were analysed using nuclear magnetic resonance (NMR) spectroscopy to identify putative sex-differences in other liver-derived metabolites.Sex-dependent effects on hepatic gene expression in non-fasted male and female rats: Seven-week-old male (n = 5) and female (n = 5) Sprague-Dawley (SD) rats (Scanbur BK) were maintained under standardized conditions with free access to regular rodent chow and water. Rats were sacrificed around noon, livers removed and frozen in liquid nitrogen. These livers were used for transcript profiling only.Effects of 4 h and 12 h fasting in male and female rats: Seven-week-old male (n = 16) and female (n = 16) SD rats (Scanbur BK) were maintained as described above. Food was removed early in the morning (7 a.m.) or late in the evening (11 p.m.), so that the animals were without food for either 4 h (absorptive state) or 12 h (post-absorptive state). Body weights were not significantly altered by this short period of food deprivation .To determine rapid hepatic insulin responses, rats were injected intraperitoneally (i.p.) with insulin , at a dose of 5 mU/g body weight, or saline only. After 40 minutes of treatment rats were sacrificed, blood drawn from vena cava, livers removed and frozen in liquid nitrogen. As described below, separate animals (n = 32) were used for measurements of hepatic glucose output . All animal experiments were approved by the regional Ethics Committee on Animal Experiments.Blood was collected from vena cava in 10-mL tubes containing 17.5 mg EDTA . Plasma was obtained by centrifugation at 3000 g for 10 min. The resulting supernatants were removed and analysed for insulin, glucagon (RIA kits from Millipore), corticosterone (EIA kit from Diagnostic Systems Laboratories). Levels of blood glucose and ketone bodies were anlysed in a drop of blood collected from the tip of the tail using a Precision Xtra glucometer and test strips (Abbot Scandinavia).http://www.ncbi.nlm.nih.gov/geo/) using the series entry GSE20601.Microarrays containing 70 mer oligonucleotide probes for 27 649 rat protein-coding genes were fabricated and used to obtain transcript profiles, as described previously . Each hyTotal hepatic RNA was isolated, cDNA generated and gene expression quantified, as described previously . The priCellular lipids were extracted from rat liver using chloroform and methanol , using the Folch method . The ext2SO4 to stop the reaction. The absorbance of glucose was read at 540 nm. In parallel, different concentrations of rabbit liver glycogen type III (Sigma-Aldrich) were treated as the samples and used as standard curve. Samples were analysed in duplicate and the results determined as μg glycogen per μg protein. The Bradford protein assay was used to measure the concentration of protein (Bio-Rad Laboratories).Liver homogenates (10%) were extracted in 80% ethanol to remove glucose. An aliquot of each homogenate was mixed with amyloglucosidase (Roche Applied Science) and incubated at 60°C for 15 minutes to degrade glycogen into glucose residuals. The samples were diluted and incubated with 1 ml of Glucose Assay Reagent at 37°C for 30 min, followed by the addition of 1 ml 12 N Hin situ for 15 minutes without recirculation in a 37°C cabinet via the portal vein using Krebs-Henseleit bicarbonate buffer, pH 7.4, which was equilibrated with 95% O2 and 5% CO2 as described previously [Rats were anesthetized with an intraperitoneal injection of ketamine at a dose of 60-70 μg/g body weight. Livers were perfused eviously . No gluc3VO4, 10 mM NaF, 1 μg/ml of aprotinin, leupeptin, and pepstatin), using a polytrone PT-2000 (Kinematica AG), followed by 20 minutes of centrifugation (12 000 g). The resulting supernatants were collected and subjected to protein analyses. The degree of insulin signalling was analysed by measuring the degree of insulin-dependent phosphorylation of Akt. Akt activation was determined by analysing the amount of phosphorylated Akt (p-Akt-Ser473) in relation to total Akt, using commercially available ELISA kits (Biosource). Samples were analysed in triplicate and the results determined as unit p-Akt per ng total Akt. The degree of AMPK phosphorylation was determined by immunoblotting as described before [Whole liver cell lysates were obtained by homogenizing 1 g of liver in 3 ml RIPA buffer to a final DSA concentration of 0.36 mM and kept at 6°C until analysis. The NMR spectroscopic measurements were made on a Bruker 600 MHz instrument operating at 600.23 MHz, equipped with a 5 mm inverse probe and a SampleJet sample changer. 1H-NMR spectra were acquired using a Carr-Purcell-Meiboom-Gill (CPMG) spin-echo sequence to attenuate broad signals arising from macromolecular components [Liver perfusate samples were generated as described above, and 500 μl from the third fraction was mixed with 50 μL standard solution of Hexa deutero-4,4-Dimethyl-4-silapentane-1-ammonium trifluoroacetate (DSA), purchased from Onyx Scientific Ltd , and Dmponents . 512 tramponents ,28. Metamponents .1H-NMR metabolite data with low quantification quality, normality could not be assumed and Friedman's non-parametric test was utilized to determine effect of insulin treatment or sex effect. Where indicated, groups were also compared using Student's t-test. P-values < 0.05 were considered significant.Two-way ANOVA was performed to determine whether there were significant effects of sex, fasting or insulin treatment on measured variables or whether there was a significant interaction i) between sex and fasting or ii) between sex and insulin. Subsequently, if the interaction was found to be significant, one-way ANOVA was conducted and multiple comparisons with Fisher's Least Significant Difference (LSD) test was employed to compare i) 4h-fasted males and females and the 12 h fasting effect, or ii) saline-treated males and females and the insulin effect in males and females. For http://www.ncbi.nlm.nih.gov/geo/) using the series entry GSE20601.Whole-genome rat oligo microarrays were used to identify genes with a sex-different expression in rat liver. Out of 27 649 genes printed on the arrays, approximately 3 500 were detected in liver. With a 5% false discovery rate and a cut-off at 1.5-fold difference, 383 (11%) transcripts among these were higher in females, and 399 (11%) transcripts were significantly higher in males. The differentially expressed gene products were grouped into functional categories to enable an overview of sex-differences within metabolic pathways. Results related to lipid and carbohydrate turnover are listed in table Among the transcripts of relevance for hepatic lipid and carbohydrate metabolism , as determined by whole-genome microarrays, but only a fraction of these are listed in table Many gene products from metabolic pathways are regulated in response to starvation. To investigate whether males and females respond differently to this type of metabolic stress, a new set of rats were fasted for either 4 h (absorptive state) or 12 h (post-absorptive state) and compared regarding hepatic gene expression. Ten gene products of relevance for lipid and carbohydrate metabolism were selected for this purpose and measured by RT-PCR. Seven of those were identified from Table Hepatic triglyceride (TG) content, FA oxidation rate, and ketone bodies in blood were analysed in 4 and 12h-fasted males and females. Two-way ANOVA revealed that 12h-fasted animals had higher FA oxidation rates and ketone levels , without any sex-fasting interaction figure .in situ perfusion of the liver in the absence of gluconeogenic precursors [HGO was determined by ecursors . Interes1H-NMR spectroscopy. A typical NMR spectrum acquired from rat liver perfusates is shown in figure The sex-different rate of hepatic glucose output reported above was obtained by determining glucose levels in liver perfusates by the glucose oxidase method using a glucose analyzer. To explore the possibility that other low molecular weight compounds might be leaving the liver in a sex-dependent manner, the perfusates were also analysed using 1H-NMR spectroscopy . This indicates that male and female rat livers were equally sensitive to insulin and that the sex-difference in HGO was maintained upon insulin treatment.To evaluate the physiological significance of the herein described measurements of hepatic glucose production, the animals were injected (i.p.) with insulin 40 min before initiating liver perfusions. As shown in figure Apart from glucose, other liver-derived analytes were also shown to be reduced in perfusates upon insulin treatment table . Two-wayTo test whether male and female livers respond equally well to insulin at the level of insulin receptor signalling, the responses to insulin were compared between male and female rats regarding Akt-phosphorylation (Ser473) and gene expression. No sex-difference could be observed in the degree of Akt-phosphorylation 40 min after insulin treatment, using an ELISA assay figure . The ratOverall, glycogen levels are increased in response to insulin and decreased by glucagon, whereas the opposite is true for gluconeogenesis. In addition, glucocorticoids influence tissue responses to insulin (inhibiting) and glucagon (stimulating). To find an explanation for the higher glycogen content in male rats, plasma levels of insulin, glucagon and corticosterone were determined. No significant sex- or fasting-related differences in glucagon or insulin were observed table , whereasde novo lipid synthesis, facilitates FA oxidation and down-regulates genes for gluconeogenesis. To determine whether sex-differences in insulin to glucagon ratios, glycogen levels, HGO rates and transcripts for gluconeogenesis might be related to differences in AMPK activity, we assessed AMPK phosphorylation (Thr172) in male and female livers. As shown in figure AMP kinase (AMPK) is an important energy sensor and regulator of cellular fuel metabolism that is under the control of AMP/ATP ratios , glycogetion Thr12 in maleIn the present study, we examined whether healthy male and female rats differ regarding hepatic lipid and carbohydrate metabolism. Starting at the level of gene expression by comparing sex-dependent transcript profiles from liver, it was evident that the capacity for different metabolic pathways might differ between males and females. Many genes for the production of TG, cholesterol and VLDL particles were found to be female-predominant, whereas genes for FA oxidation were more expressed in males. In line with this, female rats have previously been shown to have higher rates of hepatic FA uptake ,30, esteAmong the transcripts showing the biggest difference between males and females, CD36 has been implicated as an important player in the context of hepatic FA uptake. CD36 is increased during situations of increased hepatic lipid content ,45,46 buThe peroxisome proliferator-activated receptor α (PPARα) is a lipid-activated transcription factor that controls a variety of genes in several pathways of lipid metabolism ,49. Duri-/-), TG accumulated in liver and the animals died from hypoglycemia. This happened in 100% of the males but only in 25% of the females. Thus, female mice seem to be less dependent on mitochondrial lipid oxidation. The mechanisms behind these sex differences are not known, but the metabolic phenotype of male PPARα-/- mice was rescued by a 2-week pre-treatment with estrogen [An interesting sex-difference related to PPARα and fuel metabolism has been described in mice, where females have much better chances of surviving in a model of defect mitochondrial FA oxidation . When miestrogen .-/- mice develop fatty liver and hypoglycemia [Apart from controlling cellular lipid utilization, PPARα is also an important mediator of gluconeogenesis -57. Glucglycemia . Since P1H-NMR spectroscopy analysis on rat liver perfusates has to our knowledge not been performed before. Using DSA as internal standard (instead of the more common TSP or DSS) enabled absolute concentrations of metabolites to be determined (20). Using this approach, glucose, lactate, glycerol, propionate, several amino acids and ketone bodies (3-hydroxybuturate and acetoacetate) were identified as being released from the liver. 1H-NMR spectroscopy can be used to measure all kinds of small molecule metabolites simultaneously but is relatively insensitive compared to mass spectrometry-based techniques. Since NMR is close to being a universal detector, the identified metabolites are likely to be the most abundant liver-derived endogenous compounds, at least in 12h-fasted rats. Quantitative analysis verified that perfusates generated from male livers contained more glucose than female perfusates. Liver-derived lactate was also higher in males, and there was a trend towards higher levels of glycerol and the glucogenic amino acids glutamine and glutamate in males. This indicates that the male liver is more active in producing and exporting not only glucose but also metabolites important for glucose production.A sex-difference in hepatic glucose output has as far as we know not been described before, but there are reports on male-predominant hepatic glycogen content, G6Pase and PEPCThe secretion of GH is sexually dimorphic in rats and otheThere is an established link between gluconeogenesis and glycogen synthesis, meaning that a higher rate of glucose production from e.g. amino acids, lactate or glycerol will also lead to a greater capacity to synthesise glycogen. A similar pattern of mRNA expression was observed for UGP2 as for the glucogenic enzymes GOT1, G6Pase and PEPCK, suggesting a common mechanism of regulation. Further experiments are required to determine whether this explains the male-predominant content of glycogen. Another interesting sex-difference was observed regarding plasma levels of insulin and glucagon. Male rats had higher ratios of plasma insulin to glucagon levels, which might also contribute to higher glycogen content in males. In spite of this sex-difference in insulin to glucagon ratios, blood glucose concentrations were the same in male and female rats, which might be interpreted as male rats being less sensitive to insulin. It should also be noted that AMPK was Thr172-phosphorylated to lower degrees in male livers, indicative of higher activity through glucogenic pathways as compared to females. Recent studies have revealed that glycogen can block the activity of AMPK as well as the upstream AMPK kinases LKB1 and CaMKKβ . WhetherThe suppressive effect of insulin on hepatic Angptl4 has to our knowledge not been described before and deserves further studies. Angptl4 is a blood-borne hormone directly involved in regulating glucose homeostasis, lipid metabolism, and insulin sensitivity . HepaticAlthough we believe that our findings reflect true sex-differences within the liver, we realize that study limitations exist. The significance of the sex differences described here may thus be confounded by differences in e.g. body composition, dietary intake, sensitivity to nutrients, composition and differentiation of the liver, as well as in dynamics of metabolism. However, efforts were made to reduce such confounding factors by recording essential parameters related body and tissue weights and expression analysis of house-keeping genes. Since sex-differences in the liver are related to actions of sex-steroids one may predict that a complete analysis of the metabolome would detect differences in sex-steroids/metabolites. In the present study we did not detect changes in steroids because we used techniques that were not sensitive enough to detect this part of the metabolome.It is evident that fuel metabolism differs between male and female animals, but also between men and women ,78,79. ICG took part in the design of the study, carried out animal experiments, real-time PCR analyses, FA oxidation, glucose, glycogen, AMPK and hormone determinations. KY was responsible for liver perfusions and HGO determinations. EW and JL contributed with NMR spectroscopy and statistical analysis. LC performed microarray analysis and triglyceride determinations. CGG, KB and GN took part in the design of the study and helped to draft the manuscript. PTE participated in design and coordination of the study, took part in animal experiments and drafted the manuscript. All authors read and approved the final manuscript.

Retroviral insertional mutagenesis provides an effective forward genetic method for identifying genes involved in essential cellular pathways. A Chinese hamster ovary cell line mutant resistant to several bacterial ADP-ribosylating was obtained by this approach. The toxins used catalyze ADP-ribosylation of eukaryotic elongation factor 2 (eEF-2), block protein synthesis, and cause cell death. Strikingly, in the CHO PR328 mutant cells, the eEF-2 substrate of these ADP-ribosylating toxins was found to be modified, but the cells remained viable. A systematic study of these cells revealed the presence of a structural mutation in one allele of the eEF-2 gene. This mutation, Gly717Arg, is close to His715, the residue that is modified to become diphthamide. This Arg substitution prevents diphthamide biosynthesis at His715, rendering the mutated eEF-2 non-responsive to ADP-ribosylating toxins, while having no apparent effect on protein synthesis. Thus, CHO PR328 cells are heterozygous, having wild type and mutant eEF-2 alleles, with the latter allowing the cells to survive even in the presence of ADP-ribosylating toxins. Here, we report the comprehensive characterization of these cells. Pseudomonas exotoxin A (ETA), cholix toxin of Vibrio cholerae, and FP59, an anthrax toxin-derived fusion protein extensively used in this laboratory Diphthamide is a post-translationally modified histidine residue found exclusively in eukaryotic translation elongation factor 2 (eEF-2) Vibrio cholerae also has the same enzymatic activity, but little is known about its receptor and the mechanism by which it reaches the cytosol DT and ETA were the first two ADP-ribosylating toxins identified and biochemically characterized This laboratory has exploited the potency of the ADP-ribosylating toxins as a tool in characterizing the anthrax toxins. Thus, we routinely use a chimeric toxin termed fusion protein 59 (FP59), which utilizes the anthrax toxin receptor and translocation mechanism to deliver the ADP-ribosylating domain of ETA to the cytosol of cells In earlier studies that sought to identify the anthrax toxin receptor, retroviral insertional mutagenesis was performed with CHO WTP4 cells, and clones were selected for resistance to PA + FP59 CHO PR328 cells were obtained from parental CHO WTP4 cells following selection with a combination of anthrax PA and fusion protein FP59 To determine whether the CHO PR328 cells contain eEF-2 that can be ADP-ribosylated, the cells were treated with DT or ETA for 1 h and then cell lysates were separated on native PAGE followed by western blotting with anti-eEF-2 antibodies. We previously showed that the added negative charge of ADP-ribose causes ADP-ribosylated eEF-2 to migrate faster than unmodified eEF-2 on native PAGE in vitro ADP-ribosylation. If in contrast, the FP59 was trapped in vesicular compartments and degraded over time, then it would produce more biotin-ADP-ribose-eEF-2 at early than late times. The former result was observed . To examine the long-term response of the cells, they were treated with PA plus FP59 for 48 h as in and thenWe previously used retroviral insertional mutagenesis to identify genes involved in the action of anthrax toxin on cells Southern blotting showed that CHO PR328 cells did not contain any retroviral insertions (data not shown) indicating the presence of a spontaneous mutation in these cells. Given the large size of the mammalian genome, any random forward mutational selection must examine a very large number of cells to find the rare mutation that causes the desired phenotype. Applying a phenotypic selection to such a large population will inevitably lead to simultaneous selection of spontaneous mutations, which is clearly what occurred in the present case.Several previous reports described structural gene mutations in eEF-2 which block the post-translational modification of His715 to diphthamide without seriously decreasing the ability of eEF-2 to participate in protein synthesis The amino acid sequence of eEF-2 around His715 and the presence of the diphthamide side chain are both conserved in all eukaryotes . This prPA, LF, FP59, DT, ETA, and PA mutant proteins were produced in our laboratory as described previously 570 values for each well, and percent viability was calculated relative to wells that were not treated with toxin.Cells were grown in α-minimal essential medium (MEM) supplemented with 8% fetal bovine serum, 25 mM HEPES, 2 mM glutamine and 50 µg/ml gentamicin at 37°C in 5% CO2. For cytotoxicity assays, cells were sub-cultured in 96-well plates one day prior to experiments as described previously The detection of toxin-induced ADP-ribosylation of eEF-2 in intact cells was performed as previously described Alternatively, to assess ADP-ribosylation of eEF-2 in extracts of cells previously treated with toxin, the eEF-2 that was not already modified was quantitated by reaction with biotinylated NAD Activity of beta-lactamase was measured using the fluorogenic substrate, CCF2/AM (Invitrogen) as described previously 5′-GTCGCCCAACAAGCACAACCG-3′ and reverse primer 5′-GGGACTGT GGATCCCTAATGATGATGATGATGATGCAGTTTGTCCAGGAAGTTGTCCAGT-3′ were used to amplify a 796-bp product of eEF-2 cDNA. An annealing temperature used for PCR was 61°C. The RT-PCR product was purified with PureLink PCR purification kit and digested with MboII restriction enzyme for 2 h. Digested DNA samples were subjected to agarose gel electrophoresis to identify the size of DNA fragments.RNA was extracted using TRIZol reagent (Invitrogen) as per the guidelines. cDNA was synthesized using Superscript according to the instructions. RT-PCR was carried out to amplify the eEF-2 cDNA. Forward primer File S1Supplementary materials text.(0.06 MB DOC)Click here for additional data file.Figure S1Effect of PA mutants and inhibitors on toxin-induced ADP-ribosylation of eEF-2 in CHO WTP4 and CHO PR328 cells. (A) Cells were treated with FP59 in combination with PA or PA mutants (each 100 ng/ml) for 1 h and then replaced with fresh media. For inhibitor studies, cells were treated with PA + FP59 in the presence of inhibitors for 1 h and then fresh media replaced toxin. For inhibitors studies with ammonium chloride and bafilomycin, cells were pre-incubated with the respective inhibitors and same inhibitor concentration was maintained during and post-toxin treatment. After a further incubation of 3 h, cell lysates were prepared and equal amounts of protein were loaded on native PAGE followed by western blotting. The membrane was probed with antibody against the carboxy-terminus of eEF-2 of human origin and scanned on Infrared Imager. (B) Toxin-induced ADP-ribosylation in cytosol of CHO PR328 cells. Cells were incubated with FP59 in combination with PA or PA mutant (1 µg/ml each) for 45 min and then fresh media replaced the toxin medium. After an additional incubation of 2.5 h, cytosol was prepared from cells using a hypotonic solution of sucrose. Equal amounts of protein were separated on native PAGE followed by blotting with antibody against the carboxy-terminus of eEF-2 of human origin. Lower panel shows the SDS-PAGE and western blot of same samples and same antibodies to show the equal amount of proteins.(0.60 MB PPT)Click here for additional data file.Figure S2Anthrax lethal toxin-induced cleavage of MEK1 in CHO WTP4 and CHO PR328 cells. Cells were treated with PA + LF (1 µg/ml each) for indicated time periods and then lysates were prepared using RIPA buffer having protease inhibitors. Equal amounts of samples were subjected to SDS-PAGE and western blotting with anti-MEK1-NT antibodies.(0.23 MB PPT)Click here for additional data file.Figure S3Sequence analysis of eEF-2. Protein sequences for eEF-2 from different organisms were obtained from available databases and aligned using clustal W software. Accession no. for eEF-2 sequences are- Cricetulus griseus (GenBank: AAB60497.1); Rattus norvegicus (NCBI Reference Sequence: NP_058941.1); Homo sapiens (GenBank- CAA35829.1); Drosophila melanogaster (Swiss-Prot: P13060.4); Saccharomyces cerevisiae (NCBI ref. no.: NP_014776.1) and Methanococcus vannielii (Swiss-Prot: P09604.2). Arrow points to the His715 residue that is modified to make the diphthamide residue. “*” below the multiple alignment shows the strictly conserved amino acids between different organisms. “ ↓” denote the reported mutation sites . As is evident, the region around the diphthamide site is quite conserved among various organisms and most of the mutations reported lie within this loop. Only one other mutation far from this region is reported, but based on the three-dimensional structure of homologous proteins this residue is also located very close to the diphthamide region.(0.12 MB PPT)Click here for additional data file.