Datasets:

hatakeyama-llm-team

/

PMC

like 0

Hepatocellular carcinoma (HCC) is one of the most worldwide frequent primary carcinomas resulting in the death of many cirrhotic patients. Unfortunately, the molecular mechanisms of this cancer are not well understood; therefore, we need a good model system to study HCC. The dog is recognized as a promising model for human medical research, namely compared with rodents. The objective of this study was to establish and characterize a spontaneous canine tumor cell line as a potential model for studies on HCC.Histomorphological, biochemical, molecular biological and quantitative assays were performed to characterize the canine HCC cell line that originated from a dog with a spontaneous liver tumor. Morphological investigations provided strong evidence for the hepatocytic and neoplastic nature of the cell line, while biochemical assays showed that they produced liver-specific enzymes. PCR analysis confirmed expression of ceruloplasmin, alpha-fetoprotein and serum albumin. Quantitative RT-PCR showed that the canine HCC cell line resembles human HCC based on the measurements of expression profiles of genes involved in cell proliferation and apoptosis.We have developed a novel, spontaneous tumor liver cell line of canine origin that has many characteristics of human HCC. Therefore, the canine HCC cell line might be an excellent model for comparative studies on the molecular pathogenesis of HCC. Hepatocellular carcinoma (HCC) is one of the most worldwide frequent primary tumors in man, with an estimated 564,000 new cases and almost as many deaths in 2000 . It almoHowever, the study of those mechanisms is hampered because the liver tissue of patients with HCC has only limited value and primary hepatocytes are difficult to maintain in culture. Furthermore, primary hepatocytes rapidly lose detoxifying P450 isoenzymes. In addition, and because of the heterogeneity of the molecular genetic changes that can lead to HCC across species, molecular genetic studies in animals have not yet provided a precise general model for the molecular pathogenesis of HCC in humans. The dog is a valuable model for human comparative studies, since it has a comparative life span and habitat and thus similar risk factors and its domestication started over 10,000 years ago [Here, we describe the establishment and morphological, immunohistochemical, biochemical, and molecular characterization of the first canine hepatocyte cell line derived from a spontaneous HCC of a dog. The objective of this study was to investigate whether this cell line could be used as a potential model for studies on human HCC. Therefore, we investigated whether this canine hepatocyte tumor cell line had features similar to human HCC with respect to mutations in the hepatocyte growth factor receptor (c-MET) gene and the differential gene expression of several oncogenes, proto-oncogenes and proteins involved in proliferation, apoptosis and cell survival.The primary neoplasm was histologically characterized by broad trabeculae, 2 – 6 cells in thickness, of well-differentiated hepatocytes and separated by sinusoidal structures lined by endothelium. The hepatocytes had uniform moderately sized nuclei and small nucleoli; mitotic figures were very rare. Regularly areas with marked steatosis or glycogen accumulation within the neoplastic hepatocytes were observed. Locally within this well differentiated tumor there was a carcinomatous area characterized by broad trabeculae of more basophilic cells with large nuclei, moderate anisokaryosis, usually one or more large nucleoli and 3–5 mitotic figures per high power field Figure . The nonDirectly after establishment of the initial cell suspension , the cells appeared pleiomorphic. After approximately 10 weeks of culturing, the cells formed clusters as rounded, vital cells, which are non-adherent. This characteristic has remained ever since. Freezing and re-culturing of the cell line had no effect on cell growth. A 1:10 splitting and medium refreshment of the culture by careful trypsinization once a week (a "passage") is optimal. The tryspinized cell clusters were further cultured with fresh DMEM culture medium. The cells rather grow in these smaller clusters and not as single cells.The cell clusters were collected, fixed and handled as described. As shown in Figure The activity of ALT, GLDH and AST was measured to investigate whether the cHCC cells produced liver characteristic enzymes. In order to compare the amount of hepatic enzymes produced by the cHCC cell line, those measurements were also performed for the widely used human hepatocyte cell line HepG2 (enzyme activity of HepG2 was set at 100%), and the commonly used canine kidney cell line MDCK. The results showed the cHCC cell line produced 25% of the highly liver-specific ALT compared to HepG2, whereas the MDCKs did not produce ALT at all Table . Of anotTo further examine whether the cell line truly consists of hepatocytes, we isolated RNA from the cHCC, made cDNA, and performed PCRs for the gene expression of hepatocyte markers. The cHCCs proved to be PCR-positive for canine serum albumin, alpha-fetoprotein and ceruloplasmin. All obtained products were sequence confirmed.Mutations in exons 15–21 of the c-MET gene have been described in human HCC. A PCR was therefore performed with primers based on this region of the c-MET gene. The products were analyzed and aligned with known canine and human c-MET sequences . At nucleotide position 4089, a thymine (T) instead of an adenine (A) was observed, which resulted in a serine in the cHCC cell line versus a threonine in healthy tissue at codon 1363 (T1363S) . Then, the dog was immediately euthanized.2 and 95% air under a humidified atmosphere in non-coated flasks. It was observed every day for any changes. The medium was refreshed twice a week.Immediately after resection, the liver samples were kept in DMEM culture medium supplemented with 10% fetal calf serum , penicillin and streptomycin and were kept on ice. Under sterile conditions, liver samples of various areas were cut into small pieces (5 × 5 mm) and trypsinized with 30 ml of trypsin/EDTA in a sterile Erlenmeyer flask placed on a stirring platform for 30 minutes. The cell suspensions were filtered with a 70 μm nylon filter . Erythrocytes were lysed from the filtered suspension. The remaining cell suspension was resuspended in DMEM supplemented with 10% FCS and P/S and was cultured at 37°C with 5% CO2 flask with the cHCC cell culture was harvested by transferring the entire contents of the flask to a tube, which was centrifuged for 10 minutes at 1,500 g. The supernatant was replaced by freshly made fixation fluid for 4 hours. For optimal immunohistochemical staining, four different fixatives were used: zinc sulfate formalin, Bouin, Carnoy, and 10% neutral buffered formalin. The fixated cell pellet was transferred to a foam leaf-protected plastic embedding cassette. After fixation, samples were manually dehydrated and embedded in paraffin. Sections (3 μm thick) were cut and stained with hematoxylin and eosin (HE). For immunohistochemical staining, paraffin sections were mounted on poly-L-lysine coated slides, post-fixed into ice-cold acetone fixation fluid for 10 minutes, air dried and stored at room temperature (RT) until use.After 3 weeks of culturing with medium refreshment only and no splitting of the culture, the content of a T80 cm2O2, in methanol, for 30 minutes at RT. After washing with PBS buffer containing 0.1%Tween-20, background staining was blocked by incubating the sections with normal goat serum (1:10 diluted in PBS), for 30 minutes. Sections were incubated overnight at 4°C with the primary antibody HepPar1 diluted 1:50 in PBS. After washing in PBS-Tween, slides were incubated in DAKO EnVision™ + reagent, HRP-labeled for 45 minutes at RT. After washing in PBS buffer, sections were developed using 3,3-diaminobenzidine as chromogen, and counterstained with hematoxylin.For the detection of HepPar1, slides were deparaffinized, immersed in 10 mM Tris, 1 mM EDTA buffer (pH 9), heated in a microwave oven for 10 minutes for antigen retrieval, cooled down for 10 minutes at RT and washed in PBS buffer. Endogenous peroxidase activity was blocked by 0.3% HFor the detection of CK7, the slides were treated as described above but without antigen retrieval, and incubated overnight at 4°C with mouse anti-human CK7, clone OV-TL 12/30 (Dakocytomation), diluted 1:25 in PBS with 1% bovine serum albumin. For both HepPar1 and CK7, formalin-fixed paraffin-embedded canine liver and kidney tissue controls were incubated with and without the primary antibody. In contrast to the cell culture, in the liver tissue antigen retrieval for CK7 was necessary and, therefore, a 40-minute proteinase-K (Dakocytomation) digestion at RT was performed before blocking of the endogenous peroxidase, in methanol.2 flask with the cHCC cell culture was harvested, spun down for 5 minutes at 1,500 g, the cell pellet was washed in 10 ml PBS, centrifuged for 5 minutes at 1,500 g and the cells were resuspended in 1 ml PBS. Two hundred μl of the cell suspension were lysed and homogenized with a pestle in RIPA buffer containing 1% Igepal, 0.6 mM phenylmethylsulfonyl fluoride, 17 μg/ml aprotinine and 1 mM sodium orthovanadate , for 30 minutes on ice. Total protein concentrations were calculated using a Lowry-based assay .The content of a T80 cmFor the liver enzyme measurement, 800 μl of the cell suspension was centrifuged at 12,100 g for 5 minutes. The pellet was lysed in milliQ by vortexing, centrifuged again for 5 minutes at 12,100 g and the supernatant was analyzed in a Beckman Synchron CX7 analyzer. The following enzymes were measured: ALT, AST and GLDH. AST and ALT were measured at 37°C with the Tris-pyridoxal phosphate method with Beckman-Coulter reagent. GLDH was measured with Roche reagent. All samples were subjected to the external quality control mission of the Dutch Foundation for Quality Assessment in Medical Laboratories.2 flask) under standard culturing conditions, as described for the cHCC cell line.As comparison, the widely used human hepatoma cell line HepG2 and MDCK canine kidney cell line (own collection) were used. These were grown to 80–100% confluency according to the manufacturer's instructions. The RNA samples were treated with DNase-I (Qiagen RNase-free DNase kit). In total 3 μg of RNA was incubated with poly (dT) primers at 42°C for 45 min, in a 60 μl reaction, using the reverse transcription system .Taq polymerase (Invitrogen), 2 mM MgCl2 (Invitrogen) and 250 μM of each nucleotide . The PCR conditions were: initial denaturation at 95°C for 4 min, followed by 40 cycles consisting of denaturation at 95°C for 1 minute, annealing at 60°C for 1 minute, elongation at 72°C for 1 min, and, finally, an elongation step at 72°C for 10 min. The PCR products were analyzed on a 1.5% agarose gel, and the DNA fragments were visualized with ethidium bromide. The primers used for these PCRs are depicted in Table To examine whether the cell line consisted of hepatocytes, we isolated total RNA and made cDNA as described above. PCRs were performed to investigate the gene expressions of hepatocyte markers. All reactions were performed in a 50 μl volume with a thermal cycler . Reaction mixtures contained 0.2 μM of each oligonucleotide primer , PCR buffer , 2.5 U of Platinum To investigate mutations in the tyrosine kinase domain of c-MET, a PCR was performed with two overlapping primer sets for this domain Table , both reQuantitative gene expression measurements of the cHCC cell line were compared with a group of four healthy liver tissues. Liver biopsies from the healthy dogs, which included two Cairn terriers (breed of the donor dog), were obtained under local anesthesia with a 16G biopsy needle and immediately snap-frozen and stored at -70°C until further analysis.® green I, BMA, Rockland, ME) was performed in triplicate in a spectrofluorometric thermal cycler . Per reaction, 1.67 μl of cDNA was used in a 50 μl volume containing 1 × manufacturer's buffer, 2 mM MgCl2, 0.5 × SYBR® green I, 200 μM dNTP's, 0.4 μM of each oligonucleotide primer, 1.25 units of AmpliTaq Gold (Applied Biosystems), on 96-well iCycler iQ plates (BioRad). Primers ; AST – aspartate aminotransferase; CK7 – cytokeratin 7; GLDH – glutamate-lactate dehydrogenase; HCC – hepatocellular carcinoma; HepPar1 – hepatocyte paraffin-1; HGF – hepatocyte growth factor; HPRT – hypoxanthine phosphoribosyl transferase; MDCK – Madin-Darby canine kidney cells; ODC – ornithine decarboxcylase; P27KIP – kinase inhibitor protein 27 kDa; PTEN – phosphatase and Tensin homolog deleted on chromosome TEN; SOCS3 – suppressors of cytokine signalling type 3; TGF-alpha – transforming growth factor alpha.SYB carried out the establishment, the biochemical and molecular characterization, and the mutations in c-Met study. BS carried out the quantitative RT-PCR, whereas JY and RK carried out the histomorphological part. TvdI performed the description of the initial tumor. SYB, HFE, TvdI, JR and LC participated in the study design and coordination of the study. All authors read and approved the final manuscript.

A 'spike-in' experiment for Affymetrix GeneChips is described that provides a defined dataset of 3,860 RNA species. A 'best route' combination of analysis methods is presented which allows detection of approximately 70% of true positives before reaching a 10% false discovery rate. As more methods are developed to analyze RNA-profiling data, assessing their performance using control datasets becomes increasingly important.We present a 'spike-in' experiment for Affymetrix GeneChips that provides a defined dataset of 3,860 RNA species, which we use to evaluate analysis options for identifying differentially expressed genes. The experimental design incorporates two novel features. First, to obtain accurate estimates of false-positive and false-negative rates, 100-200 RNAs are spiked in at each fold-change level of interest, ranging from 1.2 to 4-fold. Second, instead of using an uncharacterized background RNA sample, a set of 2,551 RNA species is used as the constant (1x) set, allowing us to know whether any given probe set is truly present or absent. Application of a large number of analysis methods to this dataset reveals clear variation in their ability to identify differentially expressed genes. False-negative and false-positive rates are minimized when the following options are chosen: subtracting nonspecific signal from the PM probe intensities; performing an intensity-dependent normalization at the probe set level; and incorporating a signal intensity-dependent standard deviation in the test statistic.A best-route combination of analysis methods is presented that allows detection of approximately 70% of true positives before reaching a 10% false-discovery rate. We highlight areas in need of improvement, including better estimate of false-discovery rates and decreased false-negative rates. Since their introduction in the mid 1990s , expressThe most useful control datasets to date for evaluating the effectiveness of analysis methods for Affymetrix arrays are cRNA spike-in datasets from Affymetrix and Gene Logic. The Affymetrix Latin square dataset is a serHere we present a new control dataset for the purpose of evaluating methods for identifying differentially expressed genes (DEGs) between two sets of replicated hybridizations to Affymetrix GeneChips. This dataset has several features to facilitate the relative assessment of different analysis options. First, rather than containing a limited number of spiked-in cRNAs, the current dataset has 1309 individual cRNAs that differ by known relative concentrations between the spike-in and control samples. This large number of defined RNAs enables us to generate accurate estimates of false-negative and false-positive rates at each fold-change level. Second, the dataset includes low fold changes, beginning at only a 1.2-fold concentration difference. This is important, as small fold changes can be biologically relevant, yet are frequently overlooked in microarray datasets because of a lack of knowledge as to how reliably such small changes can be detected. Third, our dataset uses a defined background sample of 2,551 RNA species present at identical concentrations in both sets of microarrays, rather than a biological RNA sample of unknown composition. This background RNA population is sufficiently large for normalization purposes, yet also enables us to observe the distribution of truly nonspecific signal from probe sets which correspond to RNAs not present in the sample.versus average log signal intensity (A)), and if necessary, performing a normalization at the probe-set level to center this plot around M = 0; and third, choosing the best test statistic . The cRNAs were divided into two samples - 'constant' (C) and 'spike' (S) - and each sample was hybridized in triplicate to Affymetrix GeneChips . The S sample contains the same cRNAs as the C sample, except that selected groups of approximately 180 cRNAs each are present at a defined increased concentration compared to the C sample clone sOur dataset design provides the rare knowledge of virtually all of the RNA sequences within a complex sample of clones for which only partial sequence was available, and the possible rare mistakenly assigned or contaminated clone). We can therefore evaluate various absent/present call metrics on the basis of their ability to distinguish between the known present and absent RNAs. We investigate this issue at both the probe pair level and probe set level. For the probe pair level assessment, we first identify the probe pairs which we expect to show signal, and those which should not. We thus define two classes of probe pairs: first, perfect probe pairs, whose PM probe matches perfectly to a target RNA sequence, and neither PM nor MM probe matches to any other RNA in the sample with a BLAST E-value cutoff of 1 and word size of 7, and second, empty probe pairs, whose PM and MM probes do not match to any RNA sequence when using the same criteria.2(PM/MM), PM-MM, , and log2(PM) - to distinguish between perfect and empty probe pairs, by calculating receiver-operator characteristics (ROC) curves using the perfect probe pairs as true positives and the empty ones as true negatives. Each point on a curve depicts the specificity and sensitivity for RNA detection, when using a specific value of the corresponding metric as a cutoff for classifying probe sets as present or absent. Instead of depicting the false-positive rate (the fraction of true negatives that are detected as present) on the x-axis, which is customary for these types of graphs, we show the false-discovery rate (the fraction of detected probe sets which are true negatives), which distinguishes between the metrics more effectively for the top-scoring probe sets. Figure 2(PM/MM) and PM-MM, are the most successful at distinguishing perfect from empty probe pairs. This indicates that the PM signal alone is a less effective indicator of RNA presence, probably because the probe hybridization affinity is highly sequence-dependent. However, even with the more successful metrics, only about 60% of the perfect probe sets are detected before reaching a 10% false-discovery rate, indicating that there is still a high level of variability in probe pair sensitivity, even when using the MM signal to estimate the probe hybridization affinity.On the chip, which contains 195,994 probe pairs, there are 50,859 perfect probe pairs and 117,904 empty ones. Observation of the signal for these probe pairs Figure clearly p-values from this test are used to generate the ROC curves in Figure 2(PM/MM), performs best. Therefore, the MM signals are important in generating accurate presence/absence calls. In our dataset, about 85% of the true positives could be detected before having a 10% false-discovery rate. The detection of perfect probe pairs is not improved when we include additional information from replicates. The 15% of probe sets which are called absent may represent truly absent RNAs, owing to failed transcription or labeling . However, as we do not have an independent measure of failed transcription for the individual cRNA sequences in the target sample, we cannot completely rule out the possibility that they are the result of non-responsive probes or a suboptimal absent/present metric that fails to score low-abundance cRNAs. Regardless, as non-responsive probes or missing target cRNAs should affect both the C and S chips identically, these factors should not limit the value of this dataset in making relative assessments of different analysis methods.When signals from the 14 probe pairs in each probe set are combined to create a composite absence/presence call, a much larger fraction of the spiked-in RNA species can be detected reliably. To obtain absent/present calls at the probe-set level, we perform the Wilcoxon signed rank test using each of the metrics listed above . The p-vPerfect Match [gcrma [The first task in analyzing Affymetrix microarrays is to combine the 14 PM and 14 MM probe intensities into a single number ('expression summary') which reflects the concentration of the probe set's target RNA species. Generating this value involves several discrete steps designed to subtract background levels, normalize signal intensities between arrays and correct for nonspecific hybridization. To compare the effectiveness of different analysis packages at each of these steps, we created multiple expression summary datasets using every possible combination of the options described below. Algorithms were chosen for their popularity with microarray researchers and their open-source availability, and were generated using the implementations found in the Bioconductor 'affy' package . Figure ct Match and gcrmh [gcrma ). The coMAS background [RMA) algorithm [An estimate of the background signal, which is the signal due to nonspecific binding of fluorescent molecules or the autofluorescence of the chip surface, was generated using two possible metrics. The ckground is calculgorithm subtractConstant is a global adjustment by a constant value to equalize the chip-wide mean (or median) signal intensity between chips. Constantsubset is the same global adjustment but equalizing the mean intensity for only the probe sets with fold change equal to 1. Invariantset [Invariantsetsubset is the same as invariantset but the rank-invariant set is selected as a subset of the probe sets with fold change equal to 1. Loess normalization [Loesssubset normalization is the same as loess but using only the probe sets with fold change equal to 1. Quantile normalization [Quantilesubset normalization is the same as quantile but normalizes the spiked-in and non-spiked-in probe sets separately.The signal intensities are normalized between chips to allow comparisons between them. Because in our dataset, a large number of RNAs are increased in S versus C (and none are decreased), commonly used methods often result in apparent downregulation for spiked-in probe sets in the 1x change category. We thus added a set of modified normalization methods which used our knowledge of the 1x probe sets. The following different methods were applied. riantset is a nonlization is a nonlization enforcessubtractmm). The second is the method used in MAS 5.0, in which negative values are avoided by estimating the nonspecific signal when the MM value exceeds its corresponding PM intensity [PM only (no correction). The subtractmm and MAS methods are compatible only with the MAS background correction method; that is, it does not make sense to combine these with RMA background correction.We chose three ways to adjust the PM signal intensities to account for nonspecific signal. The first is to subtract the corresponding MM probe signal (ntensity . The thiMAS 5.0); median polish (RMA); or the model-based Li-Wong expression index (dChip). Analyses including the subtractmm PM correction method require dealing with negative values when PM is less than MM, which occurs in about a third of the cases. Within Bioconductor, the Li-Wong estimator can handle negative values, but the other two metrics mostly output 'not applicable' (NA) for the probe set when any of the constituent probe pairs has negative PM - MM. The result for MAS and median polish is NA for about 85% of the probe sets on the chip. To study the consequence of losing so many probe sets, we modified one of these two metrics (median polish) to accept negative (PM - MM) (medianpolishna), and added this metric whenever subtractmm was used.The 14 probe intensity values were combined using one of the following robust estimators: Tukey-biweight when the probe sets in the lowest quartile of signal intensity are filtered out. The expression summary datasets which involve correcting the PM signal by subtracting the MM signal (subtractmm) have the highest correlation coefficient, because low-intensity probe sets have been filtered out during processing, as described above. We therefore suggest that an important feature of a successful microarray analysis is to account for probe sets with low signal intensity, either by filtering them out or by using a signal-dependent metric for significance. Several ways of accomplishing such filtering are described below.For each of the 150 expression summary datasets that we generated, fold changes between the S and C samples were calculated and then compared with the actual fold changes. Most expression summary datasets show good correlation between the observed and actual fold changes [t-statistic has a constant value added to the standard deviation. This constant 'fudge factor' is chosen to minimize the dependence of the t-statistic variance on standard deviation levels. The second is CyberT [basic (Student's) t-statistic. For CyberT and the basic t-test, we performed the tests on the expression summaries after log transformation, as well as on the raw data. As shown in the example ROC curve, the CyberT statistic outperforms the other statistics for the vast majority of expression summary datasets does not effectively filter out these same false-positive probe sets . Upon further inspection, we observed that the SAM algorithm favors using large values for the constant fudge factor, so that the t-statistic depends more on the fold change value, than on the noise level. The basic t-statistic is prone to false positives resulting from artificially low standard deviations, owing to the limited number of replicates in a typical microarray experiment outperforms several other methods. Because the CyberT statistic clearly performs the best, we use only this statistic to compare the options for the other steps in microarray analysis, below.Because a typical microarray experiment contains a large number of hypotheses here 14,010) and a limited number of replicates (in this case three), high false-positive rates are a common problem in identifying DEGs. An important factor in minimizing false positives is to incorporate an appropriate error model into the signal/noise metric. We compared three ys (SAM) , in whic,010 and s Figure . Inspecth Figure . As showy = 0 when necessary. Owing to the significant improvement seen when the second normalization is used, the subsequent figures , or using the MAS 5.0 correction method, is better than using uncorrected or RMA-corrected PM values (PM-only). The MAS 5.0 method performs the best because it does not create any negative values. This result is in apparent conflict with the conclusions of Irizarry et al. [et al. use a test statistic that takes the variance into account, PM-only and MM-corrected methods (MAS) have similar sensitivity/specificity because PM-only does not try to correct for nonspecific hybridization in a probe-specific fashion. In contrast, for the Latin square datasets used in [PM-only works just as well as MM-corrected methods because the contribution of nonspecific hybridization is constant. Therefore, datasets which compare substantially different RNA samples (such as two different tissue types) should probably be processed using the MAS 5.0 method for PM correction.With respect to adjusting the PM probe intensity with an estimate of nonspecific signal, Figure median polish (RMA) and the Tukey Biweight methods (MAS 5.0) perform the best. Figure Figure We were concerned that some of our analyses might be confounded by a possible correlation between low fold change and low expression summary levels, which could affect the interpretations of Figure perfect match and gcrma) to the control dataset. With respect to detecting the true DEGs, these two models perform reasonably well, although slightly less well than the MAS 5.0 PM correction method. When we consider only the low signal DEGs , gcrma outperforms perfect match, and is similar in effectiveness to the top analysis option combinations.Models dependent on probe sequence provide a promising route to improving the accuracy of nonspecific signal measures. Here, we applied two different models , which is the fraction of false positives within a list of genes exceeding a given statistical cutoff. We used our control dataset to compare the actual q-values for the 10 optimal expression summary datasets with q-value estimates from the permutation method implemented in SAM. As shown in Figure q-value calculations using each of the top ten datasets underestimate the actual q-value for a given cutoff. We attempted to reduce the contribution of biases inherent in any given data-processing step by combining the results from the top 10 expression summary datasets. The goal is to pinpoint those genes that are called significant regardless of small changes in the analysis protocol . To identify these 'robustly significant' genes, we created a combined statistic from the top 10 datasets depicted in Figure q-value estimate than any of the individual datasets. However, there is still considerable difference between the estimated and actual q-values. For example, if we estimate q = 0.05, the corresponding CyberT statistic has an actual q = 0.18, and if we estimate q = 0.1, then the actual q = 0.3. Therefore, until more accurate methods for estimating the false-discovery rate are developed, we recommend that a conservative choice of false-discovery rate cutoff be used (for example < 1%) to prevent actual numbers of false-positive DEG calls from being too high.We have identified a set of analysis choices that optimally ranks genes according to significance of differential expression. To decide how many of the top genes to investigate further in follow-up experiments, it would be useful to have accurate estimates of the false-discovery rate (FDR or q) increases from 10% to 30%. Taking an upper acceptable bound for q as 10%, the maximum sensitivity obtained is about 71%. Thus, under the best-performing analysis scheme, roughly 380 (29%) of the 1,309 DEGs are not detected as being differentially expressed, with the number of false positives equaling about 105. At q = 2%, sensitivity reduces to around 60%, meaning that more than 520 DEGs are missed, albeit with fewer than 20 false positives.As the identities and relative concentrations of each of the RNAs in the experiment were known, we were able to assess directly the sensitivity and specificity obtained by the best-performing methods. Examination of the ROC curves in Figure q = 10%, sensitivity is increased to 93% when only cRNAs that differ by twofold or more are considered as DEGs . The reduction in sensitivity is almost wholly due to the low-fold-change genes: less than 50% of DEGs with fold change 1.5, and none of the DEGs with fold change 1.2, are detected at q = 10% , this is likely to prove a very real limitation to detecting DEGs. In cases where pure cell populations can be obtained, for example by laser capture microdissection, the numbers of cells are often small and RNA needs to undergo amplification in order to have enough for hybridization. Here, non-linearities in RNA amplification might also lead to observed fold changes that fall below the twofold level. We used three microarray replicates for this study, as this is frequently the number chosen by experimentalists because of cost and limiting amounts of RNA. One possible extension of this work would be to examine how many replicates are necessary for reliable detection of DEGs at a given fold change level.We have compared a number of popular analysis options for the purpose of identifying differentially expressed genes using an Affymetrix GeneChip control dataset. Clear differences in sensitivity and specificity were observed among the analysis method choices. By trying all possible combinations of options, we could see that choices at some steps of analysis are more critical than at others; for example, the normalization methods that we considered perform similarly, whereas the choice of the PM adjustment method can strongly influence the accuracy of the results. On the basis of our observations, we have chosen a best route for finding DEGs Figure . As any Drosophila Gene Collection release 1.0 cDNA clones [Drosophila arrays (DrosGenome1) using standard Affymetrix protocols. We chose to hybridize each replicate chip from an aliquot of a single C (or S) sample, resulting in technical replication; thus this dataset does not address the noise introduced by the labeling and mixing steps. The clones comprising each pool can be found in Additional data file 8, and the resulting Affymetrix chip intensity files (.CEL) files are available in Additional data files 6-7.PCR products from A clones were genA clones . Each PCThe total amount of labeled cRNA that was added to each chip (approximately 18 μg) was comparable to a typical Affymetrix experiment (20 μg). Although we do not know the individual RNA concentrations, we estimate that these span the average RNA concentration in a biological GeneChip experiment. Our biological RNA samples typically result in about 40% of the probe sets on the DrosGenome1 chip called present, so the mean amount of individual RNA is 20 μg/ = 0.003 μg/RNA. In the C chips, the average concentration of individual RNAs in the different pools range from 0.0008 to 0.007 μg/RNA, so the concentrations are roughly similar to those in a typical experiment. We note, however, that there is no way to ensure that the concentration distribution is truly reflective of a real RNA distribution. This is especially true with respect to the low end of the range, as it is usually unknown how many of the absent genes on an array are truly absent versus weakly expressed and thus poorly detected by the analysis algorithms used. Therefore, our analysis possibly favors methods that perform best when applied to highly expressed genes.et al. [t-statistic variant: for the SAM statistic, false discovery rates from the authors' Excel Add-in software was used, whereas for the CyberT and basic t-statistics, the Bioconductor false-discovery rate implementation was applied, which includes an extra step to enforce monotonicity of the ROC curve. In our experience, this extra step does not qualitatively alter the results. All scripts generated in this study are available for use [All of the analysis was performed using the statistical program R , includiet al. ,32. In aet al. , MAS 5.0et al. , Perfectet al. ,21 and Set al. executab for use ,28.n datasets and Cij, Sij are the logged signals for a given probe set in the jth C and S chips, respectively, in dataset i. The mean signal (for this probe set) for the C chips in dataset i is:Say we have is the number of C chips in dataset i; similarly, the mean signal for the S chips in dataset i is:where The mean fold change over all datasets is:i is based on the CyberT estimate:The modified standard deviation for the C chips in dataset const is the weight for the contribution of the average standard deviation for probe sets with the same average signal intensity as Cij. The modified standard deviation for the S chips in dataset i (sd.Si) is defined analogously. The pooled variance over all 10 datasets is defined as:where The variance between the 10 datasets is defined as:Then the combined statistic was chosen to be:2 fold change) vs A plot for the comparison of two biological samples. Additional data file Additional data is available with the online version of this article. Additional data file contains a figure and explanatory legend showing the degree of overlap between two lists of differentially expressed genes. Additional data file A figure and explanatory legend showing the degree of overlap between two lists of differentially expressed genesClick here for additional data fileAll analysis option combinations used to generate the expression summary datasets in this studyClick here for additional data fileA plot of observed vs actual spiked-in fold changes at the probe levelClick here for additional data file2 fold change) vs A plot for the comparison of two biological samplesAn example of asymmetric M , Affymetrix *.CEL files for the C chips in this datasetClick here for additional data fileA Zip archive containing plain text files (in Affymetrix CEL format), Affymetrix *.CEL files for the S chips in this datasetClick here for additional data fileDetailed information for the individual DGC clones used in this studyClick here for additional data file

Factor analysis is one of the most used statistical techniques to analyze the inter-relationships among symptoms reported by Gulf War veterans. The objective of this study was to apply factor analyses to binary symptom data from the UK study of Gulf War illness and the US Air Force study of Gulf War veterans, and to compare the symptom domains derived from the distinct samples.UK veterans of the 1991 Gulf War , individuals deployed to Bosnia on U.N. peacekeeping operations and Gulf War-era servicemen who were not deployed to the Gulf were surveyed in 1997–1998, and US 1991 Gulf War veterans from four Air Force units were surveyed in 1995 to collect health characteristics including symptoms. Each sample was randomly split in half for exploratory and confirmatory dichotomous factor analyses with promax oblique rotation.Four correlated factors were identified in each of the samples. Three factors overlapped considerably across the UK cohorts. The Gastrointestinal/Urogenital factor in the UK Gulf cohort was noticeably different from the Gastrointestinal factor identified from the Bosnia and Era cohorts. Symptoms from Gulf War UK and U.S cohorts yielded similar Gastrointestinal, Respiratory and Mood-Cognition factors, despite differences in symptom inventories between the two surveys. A Musculoskeletal factor was only elicited from the US Gulf sample.Findings of this report are consistent with those from other factor analysis studies that identified similar symptom dimensions between Gulf and non-Gulf War veterans, except that the Gastrointestinal factor in Gulf veterans included other symptom types. Correlations among factors raise the question as to whether there is a general illness, even if not unique to Gulf veterans, representing the common pathway underlying the identified factors. Hierarchical factor analysis models may be useful to address this issue. Reports that veterans of the 1991 Gulf War were suffering from unexplained signs and symptoms started to appear as early as one year after the conflict . Factor Several studies have applied factor analysis to examine and compare the inter-relationships among symptoms reported by veterans -13. In gWhen symptoms are measured on a continuous scale normally distributed, linear factor analysis can be The objective of this report was to apply dichotomous factor analyses to binary symptom data from two studies, i.e., the UK study of Gulf War illness ,17-19 anThe data used in this report came from two sources: the UK Study of Gulf War illness ,17-19 thDuring the past month, have you suffered from any of the following symptoms?") [current health problems [In the UK study, we considered the analysis of 50 symptoms that occurred in the preceding month ("ptoms?") ,17,18 . Exploratory dichotomous factor analyses were perThe confirmatory dichotomous model specifieOf the 3,454 veterans of the Gulf War, 93.3% were men, 75% were married or living with a partner, 92.5% had regular military status when they were deployed to the Gulf. Their average age was 34.4 years (standard deviation = 6.8). The Bosnia cohort had 1,979 veterans with average age of 29.3 years (standard deviation = 6.7) including 89.4% men, 57.5% married or living with a partner, and 91.1% with regular military status when deployed to Bosnia. The Era cohort included 2,577 veterans and 48.8% regular military status).The US Gulf sample included 1,163 veterans who were 94.0% men, 74.9% married or living with a partner, with an average age of 37.9 years (standard deviation = 8.4).The most common symptoms across all UK groups were feeling unrefreshed after sleep, irritability, headaches, fatigue, sleeping difficulties, forgetfulness, loss of concentration, joint stiffness and flatulence/burping Table . The preThe exploratory sample consisted of 1,783 persons. The scree plot suggested 1 major factor, but it was not clear how many additional factors should be investigated (data available from authors). We removed the first eigenvalue from the plot, to better determine how much each additional factor contributed to the variance, and decided to examine 2 to 5-factor solutions. Although all solutions indicated a good fit between data and model (RMSEA ≤ 0.06), the 2-, and 3- factor models yielded non-interpretable factors, and the 5-factor solution could not be confirmed. Thus, we tested the 4-factor exploratory solution in the confirmatory sample that included 1,671 subjects. We specified the number of factors to be 4, the factor variances to be 1 and the leading symptoms of the first (pain on passing urine), second (loss of concentration), third (unable to breathe deeply enough), and fourth (tingling in fingers and arms) factors. Table The Bosnia Cohort exploratory sample included 1,008 subjects and the confirmatory included 971. A 4-factor solution with 32 symptoms was confirmed . Results for all 1,979 subjects are displayed in Table Although the constructs identified from symptoms reported by Bosnia veterans were similar to those confirmed in the Gulf War veteran sample, we were unable to confirm the Gulf War confirmatory 4-factor solution in the Bosnia sample. Some symptoms from the Gulf cohort Gastrointestinal/Urogenital factor loaded in several Bosnia cohort factors, yielding a structure that was difficult to interpret.There were 1,325 observations in the exploratory and 1,252 in the confirmatory samples. A confirmatory 4-factor model with 26 symptoms and all 2,577 subjects is displayed in Table The overlap of symptom composition across samples was remarkable for the Respiratory, Peripheral Nervous and Mood-Cognition factors Table . The facThe exploratory sample consisted of 590 subjects and the confirmatory included 573. A 4-factor solution with 26 symptoms was confirmed and results for all 1,163 subjects are displayed in Table We could not directly compare the factor structures because the symptom inventories were so different. For example, 3 peripheral nervous symptoms were asked from the UK veterans while the US study included only 1 (numbness or tingling in fingers or toes). Thus, a separate factor could not be derived from the US study. Nevertheless, both UK and US data yielded similar constructs, namely a mixed gastrointestinal factor, a mood-cognition factor, and a respiratory-related factor. The main difference was that the musculoskeletal construct could not be confirmed in the UK Gulf cohort, and it represented a separate factor in the US sample Tables and 5.The objective of this report was to identify and compare syndromes among 4 samples collected from UK ,17-19 anWe identified and confirmed at most 4 correlated factors in each of the samples. Three of the four constructs overlapped considerably across the UK cohorts. These factors were identical to those derived in a linear factor analysis of these data . HoweverIn addition, despite differences in study designs, methods of data collection, military populations and symptom inventories between the UK and US studies of Gulf War veterans, Gastrointestinal, Respiratory and Mood-cognition factors were identified in both UK and US studies. Of note, although joint pain and joint stiffness were measured in both UK and US samples of Gulf War veterans, a Musculoskeletal factor was only elicited as a separate factor from the US data.In general, findings of this report were consistent with those from other studies that used factor analysis of symptoms to compare symptom patterns between Gulf and non-Gulf War veterans ,9-11. HoIn this report, we encountered difficulties confirming the dichotomous factor structures, or reproducing a factor structure in another sample, because many symptoms were rare, which created numerical problems. On the other hand, failure to reproduce factor structures across samples may also be due to different symptom distributions in the samples being considered, as was the case of the UK Gulf and Bosnia cohorts. We also acknowledge the difficulties in analyzing self-report symptom data. However, since the UK and US studies were independent of the military and confidential, we do not believe there was a reason form service personnel to exaggerate symptoms in order to gain compensation or eligibility for veterans.Finally, it must be noted that, in each of the UK or US cohorts, factors were moderately or highly correlated. Correlated factors are complex to interpret because it is difficult to separate their independent effects . This fiIn conclusion, considerable progress has been made in defining medically unexplained illness associated with deployment to the 1991 Gulf War. Our results from independent studies conducted in the UK and US confirmed occurrence of an illness comprised of 4 correlated groups of symptoms (factors) in deployed military personnel from both countries. Similar illness occurred in troops who did not participate in the Gulf War , so we believe that this pattern of symptoms is not unique to Gulf War service nor does it represent a unique illness or "Gulf War syndrome." In fact, similar illnesses to those affecting Gulf War veterans have been noted among veterans of US Civil War and BritNone declared.RN conceived of this analysis was responsible for its execution and had primary responsibility for the manuscript; KI was instrumental in the conception and design of the UK veterans' study and had primary responsibility for its analysis; collaborated in analysis and interpretation of the present data and writing the manuscript; SW was Principal Investigator for the UK veterans' study, Collaborated in the concept of the present study and collaborated in analysis, interpretation and the manuscript; CU collaborated in the UK veteran's study and collaborated in analysis and interpretation of data and drafting the manuscript for this study; LH collaborated in the UK veteran's study and collaborated in analysis and interpretation of data and drafting the manuscript for this study; WCR was Principal Investigator of the US Gulf War study, conceived the idea for the present study, served as Principal Investigator for the present study and collaborated in all aspects of data interpretation and writing the manuscript.

ACTN4 cause an autosomal dominant form of human FSGS. We characterized the biological effect of these mutations by biochemical assays, cell-based studies, and the development of a new mouse model. We found that a fraction of the mutant protein forms large aggregates with a high sedimentation coefficient. Localization of mutant α-actinin-4 in transfected and injected cells, as well as in situ glomeruli, showed aggregates of the mutant protein. Video microscopy showed the mutant α-actinin-4 to be markedly less dynamic than the wild-type protein. We developed a “knockin” mouse model by replacing Actn4 with a copy of the gene bearing an FSGS-associated point mutation. We used cells from these mice to show increased degradation of mutant α-actinin-4, mediated, at least in part, by the ubiquitin–proteasome pathway. We correlate these findings with studies of α-actinin-4 expression in human samples. “Knockin” mice with a disease-associated Actn4 mutation develop a phenotype similar to that observed in humans. Comparison of the phenotype in wild-type, heterozygous, and homozygous Actn4 “knockin” and “knockout” mice, together with our in vitro data, suggests that the phenotypes in mice and humans involve both gain-of-function and loss-of-function mechanisms.Focal segmental glomerulosclerosis (FSGS) is a common pattern of renal injury, seen as both a primary disorder and as a consequence of underlying insults such as diabetes, HIV infection, and hypertension. Point mutations in theα-actinin-4 gene Transgenic experiments in mice suggest that the human kidney disorder, focal segmental glomerulosclerosis (FSGS), is a result of both gain- and loss-of-function mechanisms ACTN4 mutations cause a form of focal segmental glomerulosclerosis (FSGS) . This les (FSGS) .The four α-actinin genes encode highly homologous proteins that normally form approximately 100 kDa head-to-tail homodimers. While the best-defined function of α-actinin-4 is to cross-link and bundle actin filaments, α-actinins have been found to interact with a large and diverse set of other proteins . α-ActinACTN4-associated FSGS is inherited in an autosomal dominant pattern. By contrast, mice homozoygous for Actn4 null alleles have glomerular disease, while heterozygous Actn4 null mice have no readily apparent phenotype .We performed both transfection and nuclear injection studies in a conditionally immortalized podocyte cell line to look at the effect of disease-associated mutations on α-actinin-4 localization. Irrespective of the method used to express the mutant α-actinins in cells, we found altered localization of the mutants. Consistent with the altered sedimentation observed in vitro, mutant α-actinin-4 formed localized aggregates when expressed in cells. We used video microscopy to view the fate of the green fluorescent protein (GFP)–α-actinin-4 after nuclear injection of the cDNA. Similar results were observed in three independent sets of experiments. In each experiment, 15–35 cells were microinjected in the nucleus with plasmid DNA; of these, five to ten cells showed signal at 4–6 h after injection. Consistently, the mutants behaved abnormally, were unevenly distributed in the cell cytoplasm, and were much less dynamic compared with the wild-type proteins . These fActn4+/+, Actn4K228E/+, and Actn4K228E/K228E mice with either wild-type GFP–α-actinin-4 or K228E mutant GFP–α-actinin-4 to generate litters with wild-type, heterozygous, and Actn4K228E/K228E mice. We genotyped mice by testing for the presence or absence of an engineered silent EarI site as described previously following incubation in methionine-deficient medium. In order to trace the newly synthesized 35S-labeled α-actinins, we used an α-actinin-4-specific antibody to immunoprecipitate α-actinin-4 from the cell lysates. (We detected no α-actinin-4 in the cell pellets.) As shown in 35S]methionine for 3 hours (pulse), following incubation in methionine-deficient media, and then incubated the cells in media containing excess cold methionine (chase) for different timepoints to follow the degradation of the newly synthesized α-actinin-4. As shown in We observed decreased mutant α-actinin expression in an immortalized knockin mouse fibroblast homozygous for the broblast D. To helActn4K228/K228E mice, as well as Actn4K228/+ and wild-type littermates. In Actn4K228/K228E mice as old as 13 mo, we saw no abnormalities by light microscopy with periodic acid–Schiff (PAS) and hematoxylin-and-eosin (H & E) staining. All of the 11 Actn4K228/K228E kidneys examined by electron microscopy had abnormalities in podocyte structure. Typically, these consisted of focal areas of foot process effacement . Only 10% (23 of 231) of the offspring of crosses between heterozygous mice were homozygous for the K228E change, suggesting increased peri- or neonatal lethality in the homozygous mice, similar to what we have observed in Actn4 null mice , heterozyogtes for either a null or K228E allele (Actn4+/– and Actn4K228E/+), and homozoygotes for either a null or K228E allele (Actn4–/– and Actn4K228E/K228E). Results were quite variable within each genotypic group of mice (likely reflecting differences in age and genetic background). However, the overall pattern of protein excretion was similar in the Actn4+/+, Actn4+/–, and Actn4K228E/+ mice, while both groups of homozygous mutant mice (Actn4–/– and Actn4K228E/K228E) had significantly greater—and similar—degrees of proteinuria renal failure in adulthood.Human α-actinin-4-associated FSGS is characterized by a dominant pattern of inheritance. Affected individuals typically develop disease in adulthood. Some individuals develop progressive renal failure, others develop moderate proteinuria, while a few show no evidence of kidney dysfunction well into adulthood. This contrasts with other recently elucidated inherited disorders of the podocyte caused by mutations in the slit-diaphragm proteins nephrin and podocin, where disease typically presents in the neonatal period or in childhood and follows a recessive pattern of inheritance . Mice laThese phenotypic differences themselves suggest a different mechanism of disease from what is observed with slit-diaphragm protein defects. Our earlier experiments suggested that mutant α-actinin-4 binds actin filaments more strongly than wild-type α-actinin-4 in vitro. However, this may reflect a propensity toward oligomerization rather than increased F-actin binding per se. The finding that the mutant α-actinin-4 forms aggregates with greatly decreased half-life suggests two possible models to explain the human (and mouse) disease. One model would explain the development of podocyte damage as a direct effect of protein aggregation and the toxic effects of such aggregation, as is observed in several degenerative neurologic conditions such as Alzheimer and Parkinson diseases . The secWe do not regard these models as mutually exclusive. In fact, we believe it likely that the development of disease may involve both of these mechanisms. It is interesting to note that α-actinin-4-mediated kidney disease bears some similarities to the adult-onset neurodegenerative condition Huntington disease. In Huntington disease, dominant mutations that lead to expanded polyglutamine tracts cause neurodegeneration. The mutant huntingtin protein is misfolded and forms aggregates that are thought to have dominant, toxic effects on neuron function . These pACTN4 mutations become increasingly susceptible to minor insults. We note also that mice, unlike humans, express α-actinin-1 in podocytes .We note that, as shown in utations . AlthougActn4 knockin mice have no clear phenotype either by histologic analysis at the light and electron microscopic levels or by analysis of urine protein and serum creatinine. Even at more advanced ages, the Actn4K228E/+ mice appear normal. By contrast, we observe clear glomerular phenotypes in both Actn4–/– and Actn4K228E/K228E mice. Our genetic observations are consistent with our biochemical observations. Specifically, we believe that α-actinin-4 mutations lead to a reduction in normal α-actinin-4 activity and to protein aggregation and that glomerular phenotypes reflect both loss of normal α-actinin-4 function and toxic effects of aggregated α-actinin-4. While the disease observed in homozygous Actn4K228E/K228E mice may primarily reflect loss of function resulting from rapid α-actinin-4 degradation, heterozygous humans may show slow development of podocyte damage from the effects of α-actinin-4 aggregation.As indicated in Is alteration of α-actinin-4 expression or conformation a cause or a mediator of secondary forms of kidney disease? These seem plausible hypotheses given the data presented here, together with results from other investigators showing alterations in α-actinin-4 levels in association with proteinuria in certain animal models . This su2. Differentiated podocytes were cultured in the medium containing no γ-IFN at 37°C. Additional conditionally immortalized podocytes from “knockin” litters were generated exactly as described previously and cultured as described previously . In brieeviously . FibroblFibroblasts were allowed to grow to confluence, then scraped off the tissue culture plate in the presence of cold phosphate-buffered saline (PBS) and spun at 3,000 rpm at 4°C for 10 min. Lymphocytes were isolated from whole blood with Histopaque-1077 solution following the manufacturer's instructions. The pellets were resuspended in ice-cold lysis buffer . We collected the supernatant and estimated the protein concentration using either the Bradford method or equalizing the protein concentration in different lysates by Western blot using β-actin as a standard.We mutated a wild-type pBluescript-GFP-ACTN4 clone using a QuickChange kit to create clones harboring each of three disease-associated mutations . These mSucrose gradients of 5%–20% and 10%–40% were made using a buffer containing 0.02 M Tris–HCl (pH 7.5), 0.15M NaCl, 0.1 mM EDTA, and 0.2 mM of DTT and were internally calibrated with BSA, carbonic anhydrase, and catalase. In vitro translated and radiolabeled wild-type and mutant α-actinin-4 were loaded onto the gradient, centrifuged at 40,000 rpm for 15 h at 4°C, and eluted into 0.2 ml fractions. Eluates were analyzed by SDS-PAGE and autoradiography.35S]Methionine was added to a final concentration of 0.1 mCi to pulse the cells. Cells were pulse labeled for 0, 15, 30, 60, 120, 180, and 240 min. To study the degradation of α-actinin-4, cells were pulsed for 3 h and then chased for 0, 3, 6, 12, 20, 24, and 30 h with excess cold methionine. We used anti-α-actinin-4 antibody recognizing the N-terminus to precipitate α-actinin-4 from the cell lysates. Protein A–sepharose beads were preincubated with the anti-α-actinin-4 antibody for 2 h at 4°C and then incubated with the lysates overnight at 4°C. The beads were washed with lysis buffer and resuspended in SDS-PAGE loading buffer. Samples were resolved on a 10% polyacrylamide gel and visualized by exposure to radiographic film. For lactacystin treatment, cells were first pulsed for 3 h as above, followed by addition of 2.5 μM lactacystin dissolved in DMSO or 0.125% DMSO alone with cold methionine.Immortalized mouse fibroblasts were incubated in methionine-free MEM medium containing 10% FCS and 25 mM HEPES for 20 min at 37°C. [For injection and imaging, cells were cultured on MatTek Corporation 35 mm coverslip dishes in F12 media without phenol red and supplemented with 10 mM HEPES and antibiotics. Plasmid DNA at 0.5–2.0 ng/nl was injected in cell nuclei using a Narishige IM-200 picoliter pressure injection system. OD microcapillary glass pipettes (1.0 mm) were pulled to a fine tip using a Narishige PB-7 needle puller. Cells were maintained at 37°C using a modified Harvard Apparatus microscope incubator mounted on a Nikon Diaphot 300 inverted microscope. Images were collected using a Princeton Instruments MicroMax 1300Y cooled CCD camera . Excitation and emission wavelengths were controlled using dichroic and bandbass filters from Omega Optical and a Sutter Instrument Lambda 10–2 filter wheel image acquisition. Device control and postacquisition processing were done with Isee Imaging Software .To display the changes in GFP–actinin distribution over time, images collected at 1 min intervals were used sequentially as red, green, and blue channels of a RGB composite image. Areas of signal that did not change have equal representation in each of the channels and generate a white signal in the final image. Areas of signal that did change on a minute-to-minute basis are indicated by either a red, green, or blue hue. For example, a region rich in red would indicate an signal present in the first image, but absent in the two sequential images, indicative of a withdraw or loss of signal in that region.Actn4 expression 58Og; Jackson Laboratory, Bar Harbor, Maine, United States). We verified excision of the neomycin resistance cassette by PCR. Heterozygous mice were crossed to obtain mice homozygous for the K228E substitution. Mice were genotyped for the K228E as described previously .Click here for additional data file.Video S2(11.8 MB MOV).Click here for additional data file.Video S3(10.9 MB MOV).Click here for additional data file.ACTN4; also LocusLink ID 81) and NM_021895 and NP_068695 . OMIM numbers are 603278 (FSGS-1) and 604638 (ACTN4).GenBank accession numbers for genes and proteins discussed in this paper are NM_004924 and NP_004915 (human

A major challenge of sensory systems neuroscience is to quantify brain activity underlying perceptual experiences and to explain this activity as the outcome of elemental neuronal response properties. Rats make extremely fine discriminations of texture by “whisking” their vibrissae across an object's surface, yet the neuronal coding underlying texture sensations remains unknown. Measuring whisker vibrations during active whisking across surfaces, we found that each texture results in a unique “kinetic signature” defined by the temporal profile of whisker velocity. We presented these texture-induced vibrations as stimuli while recording responses of first-order sensory neurons and neurons in the whisker area of cerebral cortex. Each texture is encoded by a distinctive, temporally precise firing pattern. To look for the neuronal coding properties that give rise to texture-specific firing patterns, we delivered horizontal and vertical whisker movements that varied randomly in time (“white noise”) and found that the response probabilities of first-order neurons and cortical neurons vary systematically according to whisker speed and direction. We applied the velocity-tuned spike probabilities derived from white noise to the sequence of velocity features in the texture to construct a simulated texture response. The close match between the simulated and real responses indicates that texture coding originates in the selectivity of neurons to elemental kinetic events. Rats move their whiskers rhythmically across surfaces to sense their environment. Textured surfaces induce distinct patterns of vibration in the whiskers that are encoded by central neural activity One goal of sensory systems neuroscience is to understand how the representations of complex, natural stimuli arise from the basic response properties of neurons. The present experiments explore the representation of textures in the rat somatosensory system. Rats have texture discrimination capacities rivaling those of humans . In ratsThere have been no reports concerning the cortical or subcortical neuronal activity generated by whisking along irregular surfaces, and the differences in activity associated with two surfaces remain unknown . HoweverTo answer these questions, the model must be challenged under conditions where the sensory input is precisely controlled and yet resembles what occurs during natural tactile behavior. Guided by this strategy, in anesthetized rats we produced whisker movements across textures while measuring vibrations of the whisker shaft. We then played back the identical vibrations to other rats, and measured the neuronal activity at two stages of the sensory pathway—the first-order neurons that innervate the sensory receptors, and the barrel cortex neurons, which are the first site of cortical integration. Texture discrimination depends on the integrity of the cortical barrels . By measn = 3), we electrically stimulated cranial nerve VII, generating 8-Hz whisking movements [The experimental strategy was to covements ,18 that ovements . MeanwhiH) and vertical (VV) velocity. For VH, whisker protraction (forward movement) is positive and whisker retraction (backward movement) negative. For VV, upward movement is positive and downward movement negative. To better visualize the time-varying frequency content of the velocity profiles, the velocity spectrograms are also plotted consists of six first-order neuron recordings, five cortical cluster recordings, and seven “paired” recordings—simultaneous first-order neuron and cortical cluster. The principal result is that time-varying neuronal activity in the trigeminal ganglion and cortex captured the kinetic features of the texture-induced vibrations. From the same texture library given in Two barrel cortex neuron clusters were recorded simultaneously with the first-order neuron, allowing direct comparison of different stations along the sensory pathway. The selectivity of first-order neurons and cortical clusters for the direction of whisker movement is described in more detail in Xω (referred to in previous publications as Af). The generalization of Xω to the natural, texture-induced vibration is 〈|X|ω〉Ω,Τ, a quantity known as “equivalent noise level” and the first two P280 whisks (0 to 250 ms) of trial 50 is given in In The remarkable response locking of first-order neurons to stimulus features is further highlighted in From these observations we conclude that, under our experimental conditions, the trial-to-trial response variability of first-order neurons is caused exclusively by stimulus jitter, whereas that of cortical neurons results mainly from variations across time in sensory integration, and must emerge at some integration site between the trigeminal ganglion and cortex. A question of current interest is whether the variability in cortical responses results from noise and imprecision in neuronal integration , or elseH and VV varied randomly across time. Responses to noise stimuli allowed us to quantify velocity sensitivity and then to generate simulated spike trains based on the sequence of velocity events in the actual texture-induced vibrations. Finally, comparison between simulated and observed responses reveals the extent to which the responses to natural stimuli are explained by neuronal selectivity to velocity features: If simulated responses closely resemble real responses, we can conclude that neurons are in fact operating on natural texture stimuli according to their tuning to elemental kinetic events.We hypothesize that the firing patterns of first-order and cortical neurons during presentation of textures can be explained by their extraction of elemental features from the complex input signal, and that these elemental features are bursts of high velocity. To test this directly, we presented a “white noise” stimulus in which the two stimulus features VH and VV (white circles) across 5 ms of filtered white noise.Typically, neuronal tuning curves are mapped out using an “unbiased” stimulus—a stimulus that avoids the temporal correlations present in natural stimuli. The first step, therefore, was to map out how first-order and cortical neurons encode whisker kinetic features when these features are extracted from the context of the natural stimulus. We applied a stimulus that varied randomly in velocity—Gaussian velocity noise—and therefore was not constrained by the velocity patterns present in texture trajectories see . Figure 5,R9A . To construct the neuron's “tuning curve” in finer detail, velocity space was subdivided into 20 angular and 10 radial segments. The neuron emitted spikes with increasing probability as velocity increased, but only for restricted directions, preferring high speeds that combined retraction and upward movement . For the simultaneously recorded cortical neuron cluster, spike probabilities in the 5–20-ms poststimulus interval are given in For the first-order neuron Zurvan, spike probabilities in the 1–2-ms postevent interval are given in Can the neurons' responses to complex, natural stimuli be explained as the outcome of these elemental tuning properties? To find out, we projected whisk velocity trajectories upon the white noise-derived tuning curves. One whisk on P280 sandpaper is depicted on both tuning curves. The first observation is that the intersection of the velocity trajectory with the tuning curves explains why the first-order neuron was selective for whisker retraction while the cortical cluster was directionally nonselective see and 5.P(t) and a corresponding raster plot for that trial. The 100-trial raster for one run of the simulation was summated to form a PSTH. The close match between the simulated PSTHs (black) and the real PSTHs precise information about the kinetic features transmitted to the follicle. One kinetic feature is the “equivalent noise level”: Spike counts per whisk both for first-order neurons and for cortical neurons are proportional to the equivalent noise level of the texture-induced vibration. Thus, when texture vibrations differ in this quantity, neuronal spike counts also differ and thereby carry information that could, by itself, separate the textures. By the same token, when texture vibrations have similar equivalent noise levels, spike counts per whisk appear not to carry sufficient information. The second kinetic feature, then, is the temporal sequence of velocity events—distinctive velocity profiles induce distinctive temporal patterns in the spike trains with spike alignment of better than 0.2 ms in the first-order neurons and a few ms in the cortex.The stimulus playback method used here might not produce the identical input to the sensory receptor as occurs during active whisking . The optA classical approach to investigating sensory coding is to map the relationship between well-controlled artificial sensory stimuli and evoked neuronal activity. This can provide a complete description of neuronal feature extraction properties ,25, but In principle, one can bridge the gap between artificial and natural stimuli by (i) measuring neuronal activity during ecologically relevant stimuli, stimuli that are collected from an animal's normal interaction with the environment, (ii) constructing tuning curves under artificial stimulation , and (iii) applying the tuning curves to the natural stimuli to test whether they account for the observed response. Because artificial stimuli only partially cover dimensions of stimulus space present in natural stimuli, and because of neuronal nonlinearity, this procedure typically provides neuronal simulations that match real neuronal output with a correlation of less than 0.5 ,29,30. YAs an alternative to the temporal model outlined here, a spatial model for texture coding has recently been proposed. It begins from the observation that whisker length varies systematically across the anterior-posterior dimension of the rat's snout . When stThe resonance frequency hypothesis predicts that rats would fail to discriminate between surfaces using just a single whisker, yet they have been shown to perform texture discriminations after progressive clippings down to one or two whiskers . Our resExperiments were conducted in accordance with NIH and institutional standards for the care and use of animals in research. Subjects were ten adult male 250–350-g Wistar rats. In one set of anesthetized rats , “electrical whisking” ,18 was gH = 0), avoiding the introduction of any position or velocity discontinuity. A free whisk trial always separated two successive texture trials. A block was composed of five different texture trials (t1–5) with free whisk trials (fw) interspersed, e.g., fw-t3-fw-t5-fw-t1-fw-t2-fw-t4. Before stimulus delivery, signals were low-pass filtered at 500 Hz. All data were manipulated in MATLAB software (http://www.mathworks.com).For each texture, a 50-s continuous record was extracted and sliced into 100 trials of 500 ms, each trial composed of two-dimensional position signals across four 125-ms whisks. For free whisks, a 250-s record was sliced into 500 unique trials. The stimulus set was constructed by splicing trials together at the point of maximum retraction (Vx(t) and the whisker velocity profile asWe sought to quantify the kinetic features that characterized each texture-induced vibration. We refer to the whisker trajectory in one dimension as n)V| also corresponds to the spectrogram of the trajectory in position.Note that Xω [Xω to the texture-induced vibration. X becomes a time-varying spectrum XPrevious studies have shown that, when the stimulus set consists of sinusoidal whisker movements, the spike count per stimulus for cortical neurons is proportional to the product of the sinusoid's amplitude and frequency, Xω ,12. To tT is the entire time domain and Ω is the entire domain of frequency ω.where Xω across all time intervals and all values of ω.This quantity—known as the “equivalent noise level”—represents the average amplitude of white noise velocity that dissipates the same average power as the signal of interest. It serves to characterize the entire kinetic signature by a single quantity, equivalent to mean value of the product H and VV. nτ, the separately measured spectrograms for the two dimensions. The “velocity spectrogram” column in Our experiments measured velocity in two dimensions, Vhttp://www.fh-co.com) into the right trigeminal ganglion according to stereotaxic coordinates. Cortical recordings were obtained by inserting a 100 microelectrode array to a depth of 700–1,000 μm in the left barrel cortex [In a second set of urethane-anesthetized rats, neuronal recordings were made simultaneously from two sites. First-order neurons were recorded by advancing a single electrode in the first-order-only recordings were C3, E1, D6, E6, and γ (twice). The principal whiskers in the cortex-only recordings were A1, B4, E5, and E3 (twice). The principal whiskers in the paired first-order neuron-cortex recordings were δ (twice), E3 (twice), C2 (twice), and E4.Texture stimuli were delivered to a single whisker using a motor constructed from two orthogonal pairs of parallel piezoelectric wafers driven independently by horizontal and vertical signals . The whiH and VV independently from a Gaussian distribution 7,634 times per second. The stimulus was then low-pass filtered (Chebyshev type II) at 500 Hz so as to not exceed the physical capacities of the piezoelectric wafer stimulator . The noise stimulus was presented for 10 min after conclusion of the texture stimuli.We selected V1–8A) and ten radial sectors (1–10R). At each time point, angle corresponds to the direction of whisker movement, while radial distance corresponds to instantaneous speed. The positions of the radial boundaries were chosen to make each segment contain an equal number of instantaneous velocity events: Because velocity had a Gaussian distribution with a mean of zero, high-velocity events were less common, and consequently the radial boundaries were increasingly widely spaced as distance from zero increased.We adopted a method of “forward correlation” between stimulus and response where, for all occurrences of a particular stimulus event, the ensuing neuronal spike trains were averaged to construct a response probability profile for that event. This required subdividing velocity space into discrete segments. In A,R) during the whisk gave an ensuing spike probability profile. To simulate a spike train, a spike was generated in each time bin t (size 0.13 ms) with probability P(t), given by the average of the overlying spike probabilities associated with velocity events in the time window before t . After completion of the simulation, P(t) was normalized so that the overall simulated spike count matched that in the real data; this normalization did not affect the temporal profile of the simulated PSTH.To test whether the complex, texture-induced spike patterns followed directly from the tuning curves, a more elaborate analysis was necessary. Each instantaneous velocity Trajectories of two whisks recorded during contact with sandpaper P280.(B) To test playback, a whisker was inserted in the piezoelectric motor guide tube and whisker displacements were measured by the optical sensor placed adjacent to the insertion point of the whisker. The trace shows recordings of the playback of the same two whisks of part A.(C) Magnified view of the traces indicated in the rectangle in (A) and (B).(161 KB PDF).Click here for additional data file.Video S1http://www.redlake.com). Rat EW3, whisker C3.Each optic sensor channel consisted of a pair of light tubes . The two channels were mounted normal to each other in a metallic ring. Electrical stimulation of cranial nerve VII with 1-V pulses of 100 μs at 200 Hz for 60 ms produced whisker protraction that was followed by a passive 65-ms whisker retraction. The film shows four 125-ms free whisks in the air (8-Hz whisking), consisting of protraction (right to left) and retraction (left to right). Recorded at 500 frames per second with a Motion Scope 500 digital camera .Click here for additional data file.Video S2The motor consists of two pairs of piezoelectric wafers with axes meeting at a mobile joint. The whisker to be stimulated was placed inside the metal tube, which is orthogonal to the joint. The film shows playback of four 125-ms free whisks in the air, consisting of protraction (left to right) and retraction (right to left). Recorded at 500 frames per second.(9.0 MB MOV).Click here for additional data file.

Regulation of gene expression—deciding how much of what proteins are produced in the cell—is controlled by a myriad of different molecules. One type of naturally occurring regulatory molecule is small interfering RNA (siRNA), which selectively disrupts the production of a protein it is programmed to recognize, a process called RNA interference. These short stretches of nucleotides combine with other cellular proteins to form an RNA-induced silencing complex, called RISC, which locates and destroys a targeted messenger RNA—the molecule that carries a protein recipe from the nucleus to the site of production in the cytoplasm. While RNA interference has been widely exploited by researchers as a tool to knock out gene expression and infer the function of missing proteins, very little is known about the mechanisms behind this regulatory process.Recently, biologists have discovered hundreds of other short pieces of regulatory RNA, called microRNAs, in both plants and animals. Like siRNA, they also affect gene expression, through similar, possibly even identical RISC molecules. Animal microRNAs, however, target messenger RNA at a different stage in protein production. Though researchers have determined the sequences of these microRNAs, uncovering their function—that is, which protein they interrupt and, in turn, what the interrupted protein does—has progressed slowly and sporadically without any decisive tool to study them. Only four animal microRNAs have known biological functions, despite the intense level of work going on in this field.O-methyl oligonucleotide, whose sequence mirrors the targeted siRNA or microRNA, could bind and inhibit their function, allowing researchers an unprecedented glimpse at the regulatory roles and mechanisms behind RNA interference.In this issue, György Hutvágner and colleagues report a rapid and reliable method for knocking out both siRNAs and microRNAs and thereby exploring their functions. The authors found that a short stretch of nucleotides, called a 2′-The authors first tested their oligonucleotide design against an siRNA known to interfere with production of the firefly protein, luciferase—this luminescent protein is often used as a “reporter,” lighting up when cells successfully produce the protein. Any interference means the glow is gone. Using extracts from fruitfly embryos as the test-bed, the researchers mixed in the luciferase-associated siRNA and the sequence-specific oligonucleotide. What holds these two molecules together is complementary base-pairing, the same force that holds two molecules of DNA together. As predicted, the oligonucleotide inhibited RISC activity—it could no longer silence the production of luciferase.Because the authors could easily control the concentration of both the siRNA and the oligonucleotide inhibitor in these fly extract experiments, they were able to answer several questions about how these two molecules interact. They found that adding greater and greater concentrations of siRNA molecules did not result in equally great numbers of RISC; the process became saturated, indicating that a protein in the RISC assembly pathway limits production. Furthermore, the authors saw a marked 1:1 relationship between the concentration of the oligonucleotide and the concentration of RISC, indicating that each inhibitor binds to one RISC molecule in order to inactivate, a binding that appears to be irreversible. The results also showed that, though RISC molecules bind to the inhibitor through complementary base-pairing, a very different and more complex interaction is used by RISC molecules to find and bind their natural interference targets.The authors then went on to use the luciferase siRNA to test the function of their oligonucleotide inhibitor in cultured human cells, which had been engineered to contain the luciferase gene. This in vivo experiment, using living and metabolizing cells, showed results similar to those with fruitfly extracts. But the real test for these inhibitors was to use them in a whole animal against a previously identified microRNA where the outcome of its inactivation was already known.let-7, which blocks the production of the protein Lin-41 and is important for proper developmental timing in roundworm larvae. Larvae injected with the oligonucleotide had the exact features of a let-7 deficient worm, showing that the inhibitor did indeed block this microRNA's function. The authors also used the oligonucleotides to provide evidence that two proteins, previously suggested to be involved with let-7, were directly associated with its interfering activity.Hutvágner and colleagues constructed an oligonucleotide inhibitor based on the sequence of a microRNA called Using the technique described here, scientists could make rapid headway toward uncovering the biological functions of hundreds of microRNAs, their accessory RISC proteins, and even the proteins and genes they are programmed to interrupt. Furthermore, finding that RISC production is saturable could have significant implications for genetic studies that use RNA interference to uncover the function of sequenced, but unknown, genes; knowing the minimum required concentration of siRNA, researchers can avoid a buildup and any unwanted cell activity that goes along with it.

The current understanding of organizer formation and neural induction in vertebrate embryos is discussed In what is usually referred to as the most famous experiment in embryology, Xenopus laevis. In the past few years, however, work in other vertebrate and nonvertebrate chordate systems has come to play an important role in the field and has shed light on generalities and differences among chordates. If the present primer uses Xenopus to illustrate the process, it is because it accompanies an article in this issue of PLoS Biology dealing with neural development in this species and Nodal factors and also of WNT the fibroblast growth factor (FGF) signaling pathway plays a major role in this process, and (ii) neural specification starts well before gastrulation and thus before the formation and function of the organizer. Studies on the role of FGF in early tissues . And whi tissues , in view tissues , and the tissues to turn FGF does not seem to behave as a classical organizer-derived neural inducer, however. Maternal FGF mRNA and protein appear to be widely distributed in the early embryo, and at least one FGF family member is expressed primarily in the animal, pre-ectodermal region during blastula stages . A detaiAn exciting recent study shows that exposure of the epiblast (ectoderm) to FGF induces, after a time delay, a transcription factor named Churchill. Churchill expression inhibits cell ingression leading to mesoderm formation; the cells remaining in the epiblast assume a neural fate . The timXenopus, it was long known that the animal region or pre-ectoderm is not uniform or naïve, in that the dorsal, organizer-proximal region is predisposed towards a neural fate region region . They shignaling .Xenopus, as in other vertebrates, takes place before gastrulation and does not require organizer signals; this is not to say that full differentiation and patterning of the nervous system could be achieved without organizer participation.The formation of the vertebrate nervous system thus depends on multiple signaling pathways, such as the FGF, BMP, and WNT signaling cascades, that interact in complex ways e.g., . In cont

Human T-lymphotropic virus type 1 (HTLV-1) proviral load is related to the development of HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP) and has also been shown to be elevated in the peripheral blood in HTLV-1-infected patients with uveitis or alveolitis. Increased proliferation of HTLV-1-infected cells in, or migration of such cells into, the central nervous system is also seen in HAM/TSP. In the present study, we evaluated the proviral load in a cohort of HTLV-1-infected patients with arthritic conditions.HTLV-1 proviral load in the peripheral blood from 12 patients with RA and 6 patients with connective tissue disease was significantly higher than that in matched asymptomatic HTLV-1 carriers, but similar to that in matched HAM/TSP controls. HAM/TSP was seen in one-third of the HTLV-1-infected patients with RA or connective tissue disease, but did not account for the higher proviral load compared to the asymptomatic carrier group. The proviral load was increased in the synovial fluid and tissue from an HTLV-1-infected patient with RA, the values suggesting that the majority of infiltrated cells were HTLV-1-infected. In the peripheral blood from HTLV-1-infected patients with RA or connective tissue disease, HTLV-1 proviral load correlated with the percentages of memory CD4+ T cells and activated T cells, and these percentages were shown to be markedly higher in the synovial fluid than in the peripheral blood in an HTLV-1-infected patient with RA.These biological findings are consistent with a role of the retrovirus in the development of arthritis in HTLV-1-infected patients. A high level of HTLV-1-infected lymphocytes in the peripheral blood and their accumulation in situ might play a central role in the pathogenesis of HTLV-1-associated inflammatory disorders. Alternatively, the autoimmune arthritis, its etiological factors or treatments might secondarily enhance HTLV-1 proviral load. Human T-lymphotropic virus type 1 (HTLV-1) is endemic in southern Japan, intertropical Africa, Melanesia, Latin America, and the Caribbean basin and HTLVThe possibility that HTLV-1 may cause joint disease was initially raised by reports of arthralgia and polyarthritis in patients with adult T-cell leukemia ,11. Poly+ T cells, are the main target of HTLV-1 in vivo and carry the majority of the HTLV-1 proviral load [Several findings support the hypothesis of an etiopathogenic role for HTLV-1 in HAA: ATL-like T lymphocytes have been identified in the synovial fluid and synovial tissue ,18,23; hral load . The HTLral load and the ral load .We postulated that HTLV-1 proviral load might also influence the initiation and course of HAA, and measured this marker in PBMCs from a previously described cohort of HTLV-6 PBMCs ranged from 14,600 to 373,000 in the patients with RA , and the difference remained significant when the analysis focused on the RA subgroup . No differences were observed between the HTLV-1-infected group with RA or connective tissue disease and the matched HAM/TSP controls (P > 0.05 in both Wilcoxon's test and the paired t-test). As expected, the difference between the asymptomatic carriers and the HAM/TSP group was significant .The HTLV-1 proviral load was measured in the peripheral blood of HTLV-1-infected patients with RA or connective tissue disease and in matched asymptomatic and HAM/TSP controls , even when the analysis was restricted to the subgroup with RA alone . The patient with connective tissue disease and uveitis (patient 13) had 18,420 copies per 106 PBMCs. For one of the patients with RA and HAM/TSP (patient 10), 4 consecutive frozen dry pellets of PBMCs from 1996 to 2002 were available; in these, the proviral load was relatively stable at 92,100, 73,600, 143,300, and 106,500 copies per 106 cells, respectively.Of the 12 HTLV-1-infected patients with RA, 4 had HAM/TSP . HTLV-1 proviral load did not correlate with erythrocyte sedimentation rate or C-reactive protein level . No significant difference in HTLV-1 proviral load was seen in patients positive or negative for rheumatoid factor or antinuclear antibody or receiving or not receiving either specific treatments for RA or corticotherapy .No correlation was found between HTLV-1 proviral load and the age of the patient, the duration of illness, or the Ritchie's index score . A positive correlation was found between HTLV-1 proviral load and the percentage of CD4+ T cells expressing HLA-DR (P = 0.008), while the correlation did not reach significance for CD8+ HLA-DR T cells.Lymphocytes subsets and activation status were examined in the peripheral blood of HTLV-1-infected patients with RA or connective tissue disease. When correlations were examined between HTLV-1 proviral load and the percentage of T lymphocytes expressing CD45RO, CD45RA, or HLA-DR in the HTLV-1 infected patients with RA or connective tissue disease Figure , HTLV-1 Lymphocyte distribution and activation were compared in the peripheral blood and synovial fluid of one HTLV-1-infected patient with RA (patient 5). The percentage of CD4+ T cells expressing CD45RO was dramatically increased in the synovial fluid (98%) compared to the peripheral blood (48%), as was the percentage of CD4+ T lymphocytes expressing HLA-DR (94% compared to 18%).The etiology of autoimmune diseases, such as RA or mixed connective tissue disease, has yet to be established, but appears to result from complex interactions between host genetic and environmental factors , and ret+ cells; (3) A high HTLV-1 proviral load was found in the synovial fluid and tissue cells in a patient with RA; (4) In this patient, the percentage of memory and activated CD4+ T cells was higher in the synovial compartment than in the peripheral blood.Nevertheless, the present study provides biological data suggesting a contribution of HTLV-1 to the development of some cases of RA or mixed connective tissue disease. We found that: (1) The circulating HTLV-1 proviral load was higher in HTLV-1-seropositive patients with RA or connective tissue disease than in asymptomatic HTLV-1 carriers and similar to that in patients with HAM/TSP; (2) In the peripheral blood of patients with arthritis, HTLV-1 proviral load correlated with the percentage of memory and activated T CD4The HTLV-1 proviral load is thought to be a major determinant of HTLV-1-associated diseases. The HTLV-1 proviral load is higher in the peripheral blood from patients with HAM/TSP than in blood from asymptomatic carriers . It is aIn HAM/TSP, the HTLV-1 proviral load reaches an equilibrium set-point that is correlated with progression of motor disability, and fluctuates by no more than 2- to 4-fold over a decade . In one + T lymphocytes and the proviral load is reported to correlate with the number of memory T cells [+ T cells expressing CD45RO and negatively with that of CD4+ T cells expressing CD45RA. The HTLV-1 proviral load also correlated positively with the percentage of HLA-DR-expressing T cells. Migration of HTLV-1-infected CD4+ T cells and HTLV-1-specific CD8+ cytotoxic T lymphocytes (CTL) into the central nervous system is a critical step in the pathogenesis of HAM/TSP [+ T cells in the joint fluid of an HTLV-1 carrier with RA supports the hypothesis of a pathogenic involvement of HTLV-1-infected T lymphocytes.The unusually high proviral loads in HTLV-1 infection results mainly from the Tax-driven activation and expansion of infected cells . The HTL T cells . In our HAM/TSP ,32. Simi HAM/TSP ,30. ThusSeveral mechanisms are potentially involved in the occurrence of rheumatological disorders during HTLV-1 infection. Firstly, HTLV-1 infection upregulates the expression of adhesion molecules potentially involved in the migration of lymphocytes into the spinal and joint compartments . SecondlIn conclusion, our data in HTLV-1-infected patients with RA or connective tissue disease are consistent with a role of the proviral load in the development of these rheumatological disorders, although the direction of causality in this interaction remains open to question. HTLV-1 might cause a systemic immune-mediated inflammatory disease potentially involving tissues other than the central nervous system, HAM/TSP being only the major syndrome. The clinical expression of this disease might be determined by the amount of HTLV-1-infected T lymphocytes, their level of activation, and their capacity to accumulate in different body compartments. Further research is needed to increase our knowledge of the molecules involved in the homing of HTLV-1-infected CD4+ T lymphocytes and of anti-HTLV-1-specific CD8+ CTL to different target tissues.The study was performed in Martinique, an island in the lesser Antilles archipelago, with a population of 400,000. Between 1988 and 2001, 280 patients with RA, defined according to the American Rheumatology Association (ARA) criteria, and 335 patients with connective tissue disease were followed on an inpatient or outpatient basis at the Rheumatology Department of the Regional Teaching Hospital. Thirteen (4.6%) of the 280 patients with RA were found to be HTLV-1 seropositive, confirmed by Western blotting and peripheral blood was obtained from 12 of these. In addition, 6 patients with connective tissue disease , who were seropositive for HTLV-1, were included in the study. Samples were collected between September 2001 and June 2002. For one patient, sequential samples cryopreserved since 1996 were available.The mean age at the time of sampling was 63 years for the HTLV-1-seropositive RA patients compared to 60 years for the total RA cohort, while the mean age of the HTLV-1-seropositive patients with connective tissue disease was 58 years. The mean time interval between onset of the auto-immune disease and sampling for HTLV-1 proviral load determination were 8 years and 6 years in the patients with RA and connective tissue disease, respectively. Of the 12 HTLV-1-seropositive RA patients, 4 had HAM/TSP, defined according to the WHO guidelines . Two of Each HTLV-1-infected patient with RA or connective tissue disease was matched for age (± 5 years) and sex with 2 patients with HAM/TSP and 2 asymptomatic HTLV-1 carriers.PBMCs were isolated from EDTA blood by density gradient centrifugation. Synovial fluid samples were obtained by arthrocentesis and synovial tissue was obtained during arthroscopy. The synovial tissue was minced into small pieces, washed with phosphate-buffered saline, and passed through a wire mesh to collect synovial tissue cells. Cells were cryopreserved until use.6 cells using a phenol/chloroform procedure. The HTLV-1 proviral load was quantified using a real-time TaqMan PCR method [pol gene and the dual-labeled TaqMan probe (5' FAM and 3' TAMRA) was located at 4829–4858 bp of the HTLV-1 reference sequence (HTLVATK). Albumin DNA was quantified in parallel to determine the input cell number and was used as an endogenous reference to normalize variations due to differences in the PBMC count or DNA extraction. For both HTLV-1 and the albumin gene, amplifications were performed on 10 μl of DNA extract using the TaqMan PCR Core Reagent kit, data being acquired with the ABI Prism 7700 Sequence Detector System . Standard curves were generated using ten-fold serial dilutions of a double standard plasmid (pcHTLV-ALB) containing one copy of the target regions of both the HTLV-1 pol gene and the cellular albumin gene. The HTLV-1-infected human lymphocyte line MT2 (ECACC 93121518) was used as a control for quantification, the limit for an acceptable result being taken as 2.4–3.3 copies of the HTLV-1 pol gene per cell and the variation between series being normalized on the basis of three copies per MT2 cell. All standard dilutions and control and patient samples were run in duplicate for both HTLV-1 and albumin DNA quantification. Standard curves for HTLV-1 and albumin were accepted when the slope was between -3.322 and -3.743 (corresponding to amplification efficiencies of 100% to 85%) and the correlation coefficient, r2, was >0.992. If the variation between duplicate values of HTLV-1 or albumin DNA copy numbers was greater than 30%, the analysis was repeated. The normalized value for the HTLV-1 proviral load was reported as the HTLV-1 average copy number/albumin average copy number ratio × 106 and expressed as the number of HTLV-1 copies per 106 PBMCs.DNA was extracted from 10R method . SK110/S1), allophycocyanin-conjugated anti-CD4 , peridinin chlorophyll protein-conjugated anti-CD8 , phycoerythrin (PE)-conjugated anti-CD45RO , and PE-conjugated anti-HLA-DR , and PE-conjugated anti-CD45RA . The analyses were performed on a FACSCalibur (BD Biosciences Immunocytometry Systems).Lymphocyte subsets in PBMCs were characterized using a panel of labeled anti-human monoclonal antibodies, consisting of fluorescein isothiocyanate-conjugated anti-CD3 declare that they have no competing interests.MY carried out most of the clinical and experimental work. AL was involved in the molecular biology work and contributed to the design of the study. FD and GL performed the flow cytometry analysis. SO and GJB participated in the neurological and rheumatologic evaluations, respectively. SA supervised the design and the course of the clinical study. RC conceived the study and drafted the manuscript. All authors read and approved the final manuscript.

Recent technological advances in high-throughput data collection allow for experimental study of increasingly complex systems on the scale of the whole cellular genome and proteome. Gene network models are needed to interpret the resulting large and complex data sets. Rationally designed perturbations can be used to iteratively refine hypothetical models, suggesting an approach for high-throughput biological system analysis. We introduce an approach to gene network modeling based on a scalable linear variant of fuzzy logic: a framework with greater resolution than Boolean logic models, but which, while still semi-quantitative, does not require the precise parameter measurement needed for chemical kinetics-based modeling.We demonstrated our approach with exhaustive search for fuzzy gene interaction models that best fit transcription measurements by microarray of twelve selected genes regulating the yeast cell cycle. Applying an efficient, universally applicable data normalization and fuzzification scheme, the search converged to a small number of models that individually predict experimental data within an error tolerance. Because only gene transcription levels are used to develop the models, they include both direct and indirect regulation of genes.Biological relationships in the best-fitting fuzzy gene network models successfully recover direct and indirect interactions predicted from previous knowledge to result in transcriptional correlation. Fuzzy models fit on one yeast cell cycle data set robustly predict another experimental data set for the same system. Linear fuzzy gene networks and exhaustive rule search are the first steps towards a framework for an integrated modeling and experiment approach to high-throughput "reverse engineering" of complex biological systems. In partFuzzy logic providesThe problem of rule set combinatorial explosion is addressed by the union rule configuration (URC) developed by Combs and Andrew , which alac operon of E. coli in sets 1 (Low), 2 (Med), and 3 (High) respectively, the estimated numerical result of the evaluation, , is given by the centroid for the points located at -1, 0, and +1 for each set respectively, or method" , with pof(x) = x and f(x) = -x are quantitatively equal to monotonic fuzzy rules, which can be written using notation from the following section as [1 2 3] and [3 2 1] respectively) so it generally will not introduce systematic error in the model.The fuzzy set definition and centroid defuzzification of Equations 1 and 2 were selected to maximize computational efficiency during exhaustive search: all 27 rules can be represented by easily implemented algebraic functions and it is possible to design the implementation to avoid as many costly if/then comparisons as possible. In addition, the scheme perfectly reproduces monotonic linear positive and negative interactions .To apply this scheme for defuzzification and fuzzification scheme, experimental data must be projected on to the interval -1.0 through +1.0. Thus, log base 2 expression ratios are normalized by taking the arctangent of each ratio and dividing by π/2, yielding a symmetric transformation covering the desired interval. Previous work normalized expression ratios by the maximum value found in the experiment or used r. For example, the rule r = [3 2 1] corresponds to the linguistic rules:The fuzzy rule relating the input of a single gene to an ouptut node gene can be expressed as a rule vector Input is Low (1) then Output is High (3)If Input is Med (2) then Output is Med (2)If Input is High (3) then Output is Low (1)If y = [y1 y2 y3] obtained using Equation 1 and the general fuzzy rule r = [r1 r2 r3], the resulting fuzzified expression of the output gene z will be:Given the fuzzified expression of an input gene N input genes acting on the output gene simultaneously. In the linear fuzzy logic scheme, the rule for each input gene is evaluated separately, leading to intermediate outputs zi:In general, node behavior is the result of These intermediate fuzzy values are summed algebraically to obtain the final resulting fuzzy value for node gene expression:3 or 27 possible rules describing the effect of a single gene on another gene. Thus, if there are N input genes for a node, there are 27N total possible rule combinations describing the behavior of the node gene.This result is defuzzified using Equation 2 to evaluate the output of the node. For three fuzzy sets, there are 3M data of the output gene x = {x1,x2,...,xM} asIn general, no rule combination will be an exact fit to real experimental data. Given some tolerance to fitting error, there will be multiple possible rule combinations, representing plausible hypothetical gene network models. In our present work, we define the error of the fit for the is the set of defuzzified numerical predictions and is the mean of the experimental data set x. A perfect fit results in a maximum E of 1.0. This error score was chosen because while it is quantitative, it emphasizes the correlation in qualitative behavior between the fit and prediction instead of the absolute numerical fit, which can be difficult to model with the limited resolution of three fuzzy sets. We can use the fitting error to rank these models, and use rule patterns consistent throughout all plausible models as a basis for constructing the template of a final network model that can be tested experimentally.where G1, G2, G3) with log base 2 expression ratios measured at three different times:As an example to illustrate fuzzy gene networks using a simple rule combination, we consider three genes , Medium (2), and High (3). Consider the following rules for G1 and G2 as input genes to G3:with vectors for each time point containing set membership in Low (G1:G3 = [3 2 1]G2:G3 = [1 2 3]where the rules can be written in English asG1 is Low (1) then G3 is High (3)If G1 is Med (2) then G3 is Med (2)If G1 is High (3) then G3 is Low (1)If G2 is Low (1) then G3 is Low (1)If G2 is Med (2) then G3 is Med (2)If G2 is High (3) then G3 is High (3)If Now, the evaluations of the rules taken individually areG1:G3 = {[0 0.205 0.795] [0 1.0 0] [0.795 0.205 0]}G2:G3 = {[0 0.814 0.186] [0 1.0 0] [0.186 0.814 0]}G3 for the three time points, which can be defuzzified using the point-centroid method (Equation 2) and transformed back to real numbers on :The sum of two intermediate outputs (Equation 3) is the predicted fuzzy behavior of G3 = {[0 1.019 0.981] [0 2.0 0] [0.981 1.019 0]} = {0.491 0 -0.491}These numbers can be transformed back to a Log2 expression ratio by inverting the normalization (multiplying by π/2 and taking the tangent):G3 = {0.97 0 -0.97}G3 to calculate the fit error for this rule combination:Finally, we use Equation 4 and the experimental data for E = 1.0 for a perfect fit.which compares to a maximum 16 possible rule combinations for each of the 12 genes, making the exhaustive search method practically impossible. Thus, the number of possible inputs to a node must have a maximum constraint to make exhaustive search tractable.In general, a possible model for a node can include any combination of the genes available to act as inputs. In the work described here, we consider potential interactions of 12 genes. Thus, a rule for any one gene can include as inputs any combination of any number of up to all 11 other genes. Since each input gene can influence the node by any one of the 27 possible fuzzy rules, there are approximately 10all possible combinations of 1 through 4 of the genes are searched sequentially. For example, in our fitting of rules to CLN3, we considered the following potential input combinations: SIC1 alone, SIC1 and CLN1 together, SIC1-CLN1-CLN2, SIC1-CLN1-CLN2-CLN3, CLN1, CLN1-CLN2, CLN1-CLN2-CLN3, CLN1-CLN2-CLN3-SWI4, CLN2, CLN2-CLN3, etc. If we include all combinations from 1 through 4 of the genes taken from the 11 total possible inputs, then the total search space for each of the 12 genes consists of approximately 108 rules (taking about 10 minutes on a PowerMac G4 using a single 450 MHz processor). Simulation files used to generate all the data presented here are available from the authors upon request.Studies of network topology through the experimentally observed association of proteins suggest that in many cases only few regulatory proteins are observed to directly influence the expression of a gene ,30-32. FBAS originated the concept of applying scalable (URC) fuzzy logic to modeling biological systems, implemented the scheme described within on the data set, and was the primary author. JPF conceived of the approach to use exhaustive search for biological network reconstruction. JNQ and AAQ developed and initially implemented the method of combinatorial input selection for the exhaustive network search, and AAQ contributed to the text. All authors read and approved the final manuscript.Microsoft Excel spreadsheets of simulation results. See descriptive text in the workbook.Click here for file

Methylococcus capsulatus (Bath), obtained by the shotgun sequencing approach. Analysis revealed a 3.3-Mb genome highly specialized for a methanotrophic lifestyle, including redundant pathways predicted to be involved in methanotrophy and duplicated genes for essential enzymes such as the methane monooxygenases. We used phylogenomic analysis, gene order information, and comparative analysis with the partially sequenced methylotroph Methylobacterium extorquens to detect genes of unknown function likely to be involved in methanotrophy and methylotrophy. Genome analysis suggests the ability of M. capsulatus to scavenge copper and to use copper in regulation of methanotrophy, but the exact regulatory mechanisms remain unclear. One of the most surprising outcomes of the project is evidence suggesting the existence of previously unsuspected metabolic flexibility in M. capsulatus, including an ability to grow on sugars, oxidize chemolithotrophic hydrogen and sulfur, and live under reduced oxygen tension, all of which have implications for methanotroph ecology. The availability of the complete genome of M. capsulatus (Bath) deepens our understanding of methanotroph biology and its relationship to global carbon cycles. We have gained evidence for greater metabolic flexibility than was previously known, and for genetic components that may have biotechnological potential.Methanotrophs are ubiquitous bacteria that can use the greenhouse gas methane as a sole carbon and energy source for growth, thus playing major roles in global carbon cycles, and in particular, substantially reducing emissions of biologically generated methane to the atmosphere. Despite their importance, and in contrast to organisms that play roles in other major parts of the carbon cycle such as photosynthesis, no genome-level studies have been published on the biology of methanotrophs. We report the first complete genome sequence to our knowledge from an obligate methanotroph, Methylococcus capsulatus deepens our understanding of methanotroph biology and its relationship to global carbon cyclesMethanotrophs are bacteria that use methane as a sole carbon source. The genome sequence of Methylococcus capsulatus are responsible for the oxidation of biologically generated methane , which are all members of the Gammaproteobacteria, utilize ribulose monophosphate (RuMP) as the primary pathway for formaldehyde assimilation, whereas those of type II, which are all Alphaproteobacteria, use the serine pathway (M. capsulatus (Bath) to obtain a better understanding of the genomic basis of methanotrophy, a globally important microbial process.The powerful tool of whole-genome sequencing has been applied to microorganisms that carry out other important components of the carbon cycle, such as photosynthesis and methns (AM1) , 2004, bM. capsulatus (Bath) comprises a single circular molecule of 3,304,697 bp. General features of the genome and its 3,120 predicted coding sequences (CDSs) are summarized in (gidA) gene(MCA0001), adjacent to the chromosome-partitioning proteins encoded by gidB, parA, and parB and the operon that encodes F1F0 ATP synthase.The genome of M. capsulatus (Bath) genome contains 51 identifiable insertion sequence elements from various families (M. capsulatus (Bath) genome, repeated cycles of duplication and subsequent deletion, or gene conversion. Twenty elements belonging to the IS4 family of insertion sequences . Inteins are rare, but when present are often found in genes associated with nucleotide metabolism, such as ribonucleotide reductases.Two putative prophages were identified in the genome. The Mu-like prophage is unusual in encoding an intein within F (Mu gp30), a cofactor in head assembly. This intein region is most similar to inteins present in several archaeal translation initiation factor IF-2 sequences from the genera M. capsulatus (Bath). The M. capsulatus (Bath) Mu-like prophage could be engineered to resemble the Mu derivatives, which have been excellent tools for random mutagenesis in other species (M. capsulatus proteins) or for manipulating M. capsulatus live vaccine vectors.Bacteriophages have been important tools for genetic manipulation of bacterial genomes, and such tools are currently lacking for species . Conditi species . The putM. capsulatus (Bath), including the methane oxidation pathway, mechanisms for carbon fixation, glycolytic and gluconeogenic conversions, and the tricarboxylic acid (TCA) cycle, from analysis of the genome data. These pathways, together with those known from previous studies, are depicted in M. capsulatus (Bath) that is based on available genome data.We have attempted to predict central metabolic pathways in M. capsulatus is known to possess both a particulate membrane-bound form, pMMO (detected by centrifugation studies and encoded by pmo), and a soluble form, sMMO (encoded by mmo), and these enzymes have been extensively studied (pmoCAB (pmoCAB and a third copy of pmoC (pmoC3) were previously identified , which catalyze the first step of methane oxidation . M. caps studied . The pMM . The transposase (MCA1197) is oriented in the same direction as the mmo genes and, thus, may be transcribed under sMMO-promoting growth conditions. The functions of these sMMO components have been previously determined ((homologs of MxaJGRACKLD) contains a second methanol dehydrogenase–like cluster, mxaFJ, (MCA0299–0300) lacking a homolog of mxaI that normally encodes the small subunit of methanol dehydrogenase. The function of mxaJ is unknown, and it is not clear whether this mxaFJ cluster encodes components active in methanol oxidation. There is a third cluster of genes required for methanol dehydrogenase synthesis, mxaACKL (MCA1527–1530).Methanol is available to adation) , and itsadation) . We haveGRACKLD) . There ilotrophs , 1997b. M. capsulatus +-linked formaldehyde dehydrogenase is active when copper concentrations are low rogenase best matrogenase , could nrogenase helps reM. capsulatus, as was recently found alongside the THMPT pathway in M. extorquens -linked and THMPT-linked pathways of formaldehyde oxidation . In additorquens . In M. e pathway . M. capsM. extorquens, all three are expendable, indicating that this last step in methane oxidation plays a minor role and that formate can be dissimilated in other ways . Multiple formate dehydrogenases occur in other bacteria ; in M. eher ways . The impM. capsulatus exploits different systems under variable environmental conditions . It is plausible that M. capsulatus balances its requirement for formaldehyde-derived carbon and reducing power with the toxicity of formaldehyde by taking advantage of three enzymes for formate oxidation and multiple pathways for formaldehyde oxidation under different environmental conditions. This redundancy has implications for future attempts to manipulate the genes of this pathway; simple knockouts may not be achievable.The genomic redundancy in the set of methane oxidation pathways suggests that M. capsulatus is known to assimilate formaldehyde through the RuMP pathway ; this dual function may have been facilitated by the redundancy resulting from this tandem duplication. The M. capsulatus (Bath) genome appears to contain some parts of the alternative serine pathway of formaldehyde assimilation , reversibly converting glyceraldehyde-3-phosphate to xylulose-5-phosphate, bypassing the typical ribose-5-phosphate to fructose-6-phosphate segment ; cell suactivity , and a gM. capsulatus metabolism, and genomic evidence suggests three potential pathways for serine synthesis not previously described in M. capsulatus: a phosphorylated pathway from glycerate-3-phosphate, a nonphosphorylated pathway from glycerate, and a nonphosphorylated pathway from glycolate-2-phosphate were not identified in the M. capsulatus (Bath) genome, and phosphoserine phosphatase may perform this function as described in Pseudomonas aeruginosa are present, but the latter two may have alternate functions in vitamin B6 biosynthesis or as horuginosa .M. capsulatus (Bath) genome also encodes a putative phosphoglycerate mutase (MCA0753), to interconvert 3- and 2-phosphoglycerate , uses a complete TCA cycle to grow on glucose as its sole carbon and energy source , one complete (MCA1941–1944) and one partial (MCA1924) ATP-binding casette (ABC) family transporter with predicted specificity for sugar uptake were identified. Additionally, components of transporters for peptides (MCA1264 and MCA1268), carboxylates (MCA1872), and a variety of amino acids are present.An incomplete TCA cycle lacking 2-oxoglutarate dehydrogenase activity has been found in nearly all type I methanotrophs, including psulatus . Howeverpression may playy source ; M. capsM. capsulatus (Bath) is able to fix atmospheric nitrogen were previously shown to be contiguous ; this organization has been found in Chlorobium tepidum and some nitrogen-fixing methanogenic Archaea. Two 2Fe-2S ferredoxins (MCA0232 and MCA0238) and two genes identified as conserved hypotheticals (MCA0236–0237) are interspersed with the nif genes in the same orientation. The conserved hypothetical genes share the highest sequence similarity with genes from other organisms capable of nitrogen fixation, suggesting that they also have a role in this process.nitrogen , conferrntiguous , as theyM. capsulatus exhibits considerable versatility in its combined nitrogen conversions, including nitrification and denitrification. Ammonia is oxidized to nitrite by both pMMO and sMMO because of their lack of substrate specificity , suggesting that ammonium is an important nitrogen source for M. capsulatus. Methane oxidation is inhibited by the presence of ammonia and ammonia oxidation is inhibited by methane genome has a relatively large complement of putative c-type cytochromes; 57 proteins containing a heme-binding motif were identified, and 23 of these contain two or more heme-binding motifs. Analysis of the genome reveals electron transport components previously known to be associated with the methane oxidation pathway, such as cytochrome CL (MCA0781), a specific electron acceptor for methanol dehydrogenase. Other novel electron transport components are encoded in several physical locations on the chromosome; there is genomic evidence for chemolithotrophy and the ability to live at a variety of oxygen tensions.The +; and (c) a membrane-bound Ni-Fe hydrogenase (MCA0163–0165). Activity of two hydrogenases (one soluble and one membrane-bound), and the role of molecular hydrogen in driving MMOs, was previously reported and could supply exogenous hydrogen for chemolithotrophic oxidation. The removal of this hydrogen by M. capsulatus metabolism may aid in driving these reactions forward and hence constitute a syntrophic partnership.The genome encodes three predicted hydrogenases: (a) a multisubunit formate hydrogenlyase (MCA1137–1142), most likely involved in the conversion of formate to dihydrogen and carbon dioxide; (b) a soluble cytoplasmic NAD-reducing hydrogenase (MCA2724–2726), which transfers electrons to NADreported . The memreported . The preM. capsulatus (Bath) genome; however, two ferredoxins (MCA0238 and MCA0232) physically located within a cluster of genes encoding proteins involved in nitrogen fixation (see Nitrogen Metabolism section above) more likely serve in this capacity. In aerobes, these carriers are usually reduced by NADH/NADPH, although reverse electron transport could be involved in this organism.Nitrogen fixation requires reducing power, which in aerobes can be supplied by reduced flavodoxin or ferredoxins. There is one candidate flavodoxin present (MCA1697) in the M. capsulatus (Bath) genome encodes homologs of a two-subunit high oxygen-affinity cytochrome d (MCA1105 and MCA1106), which suggests the ability to live under microaerophilic conditions. This evidence for life at low oxygen tensions is supported by the presence of enzymes indicative of fermentative activity genome includes a region of approximately 25 kb (MCA0421–0443) encoding novel proteins related to energy metabolism and hypothetical proteins. The same 25-kb region contains six multiheme c-type cytochromes that are members of the cytochrome c553o family. This previously described family is unique to M. capsulatus (Bath); genome analysis has widened our knowledge of this family from three and the second a signature for fumarate lyase. The genome also encodes homologs to the putidaredoxin family of ferredoxins.A novel monoheme c-type cytochrome (MCA1187) has eight transmembrane-spanning regions and is located near another c-type cytochrome and a proton-translocating pyrophosphatase . This configuration suggests that the monoheme protein has a role in ATP production via chemiosmosis. Two other monoheme CDSs (MCA2188 and MCA2196) are members of a paralogous family similar to a cytochrome found in cis and trans configuration appears to catalyze an alternative dehydratase reaction at the C10 level of fatty acid synthesis, followed by a synthase reaction carried out by 3-oxoacyl-acyl carrier protein (ACP) synthase (MCA2879), resulting in cis-vaccenate . Trans-unsaturated acids are obtained by isomerization of preformed cis-unsaturated fatty acids, to control membrane fluidity; putative fatty acid cis/trans-isomerases were identified in the genome (MCA1585 and MCA1806).The membrane phospholipids of methanotrophs are unique, with mono-unsaturated fatty acids consisting of a series of even- and odd-numbered positional isomers of both the guration . Our anaM. capsulatus is one of only a few prokaryotes known to synthesize sterols de novo (M. capsulatus (Bath) are methylated; genome analysis indicated four putative proteins involved in the conversion of squalene to 4,4-dimethylcholest-8(14)-en-3β-ol . de novo , and it de novo . The maitrans-transferase, the mechanism for converting acetyl-CoA to squalene (the first major intermediate) is not apparent from genome analysis. Instead, M. capsulatus (Bath) contains genes for the alternative mevalonate-independent pathway from glyceraldehyde-3-phosphate and pyruvate , so it is possible that the organism employs the same squalene synthesis pathway found in plants and many Gram-negative bacteria genome reveals several elements that may relate to processing of copper.Copper is known to be important in the regulation of MMO activity; high copper concentrations are essential for the formation of extensive intracytoplasmic membranes and pMMO activity, and copper is thought to play an active role in both the catalytic site and the electron transport chain . In cont(Methylosinus) is known to excrete copper-binding compounds that may scavenge copper; another methylotrophic bacterium ompounds . The NRP+/heavy metal cation antiporters. The two-module and six-domain organization of this PKS is atypical; it contains domains with unknown functions, and its role is difficult to predict. A cation membrane transport system is located near the NRPS, and the 4′-phosphopantetheinyl transferase needed for activation of both PKS and NRPS is also present (MCA1522), indicating that these multimodular enzymes may be active.A single polyketide synthase gene (PKS) (MCA1238) is found adjacent to a gene encoding a sensor protein with diguanylate cyclase and diguanylate phosphodiesterase activities (MCA1237), often found in environmental sensing proteins and HM. capsulatus (Bath) has a large repertoire of 12 P-type cation ATPases, including multiple predicted copper ion pumps, which correlates with the role of copper in regulation of methane oxidation in this organism. There are also 18 resistance/nodulation/cell division–type metal ion and drug efflux pumps; the large number of these pumps, together with a variety of other metal cation uptake and efflux systems, highlight the significance of metal ion homeostasis in M. capsulatus.Escherichia coli, CopA is regulated together with CueO, a multicopper oxidase, by CueR, a member of the MerR-family transcription regulators. No evidence for a CueR homolog was found, indicating a different mechanism of regulation of the copA and cueO genes in M. capsulatus. The genome encodes one potential cusCBA gene cluster (MCA2262–2264), with the cusA candidate having the same copper-binding and transport motif found in the E. coli gene. No indication of homologs of the CusF periplasmic copper chaperone was found. However, it is interesting to note that the cusB candidate (which encodes the CusB outer membrane protein) carries the metal-binding motif typically found in CusF, suggesting that the putative CusB may have a dual function as CusF. No evidence for the CusRS two-component response system regulating the E. coli cusCFBA operon was found in M. capsulatus (Bath).The genome encodes three homologs of P-type ATPases with the characteristic copper-binding P-type ATPase motif , which mM. capsulatus (Bath); the lack of the same full complement of genes and identifiable regulators raises questions about the exact operation of copper regulation and suggests future experiments to resolve this central mechanism.In summary, there are elements of previously studied copper transport and regulation systems in the genome of M. capsulatus possesses an insoluble polysaccharide capsule is somewhat desiccation resistant genome lacks genes for asparaginyl-tRNA synthetase and glutaminyl-tRNA synthetase. However, a heterotrimeric glutamyl-tRNA amidotransferase (MCA0097–0099) is present, suggesting that a single amidotransferase forms asparaginyl-tRNA and glutaminyl-tRNA by transamidation of mischarged aspartyl-tRNA or glutamyl-tRNA, as found previously in many Gram-positive and some Gram-negative bacteria, archaea, and eukaryal organelles exhibits redundancy in many pathways, as described in more detail in the relevant sections above. The redundant genes fall into two categories. The first category comprises those that appear to be lineage-specific duplications (see M. capsulatus (Bath) than to all other complete genomes. In some cases, these genes are found adjacent to each other in the genome, implying that they may have been generated by a tandem duplication, and that they may be transient (tandem arrays are prone to deletion). Other lineage-specific duplications, including those of many genes encoding hypothetical and conserved hypothetical proteins, may not simply be transient mutations and may instead have been maintained because they confer an evolutionary advantage on the organism. The second category contains redundant genes that do not appear to be recently duplicated, and are evolutionarily divergent, suggesting ancient duplications or exogenous acquisition. The divergent phylogeny of these genes is inconsistent with ancient duplication and subsequent vertical transmission, but we cannot determine the origin, direction, and exact path of a possible lateral transfer. Past exchange of genetic material between a methanogen and a methanotroph ancestral to M. capsulatus, whether direct or indirect, is certainly plausible, given their biochemical dependency. The presence of both categories of redundancy for a given enzyme or pathway makes it more plausible that the enzyme or pathway is functionally important and that its redundancy is advantageous to the organism.The genome of ions see , identifM. capsulatus, like some other bacteria , one of which is located at the putative origin of replication. Only one of these genes, that encoding the ATP synthase F1 epsilon subunit, appears to be recently duplicated . Phylogenetic analysis suggests that the other ATP synthase genes are not recently duplicated. Genes of the operon located at the origin of replication (MCA0006–0013) are of a type found only in Gammaproteobacteria or Betaproteobacteria, whereas the nonorigin genes (MCA2699–2708 and MCA1556) are divergent and related to the methanogenic Archaea and C. tepidum. The cooccurrence of the divergent genes in another organism able to fix nitrogen (C. tepidum) suggests that they may be involved in generation of extra ATP required to fix nitrogen.The genome also contains two sets of ATP synthase genes, as has been found in four other completed genomes , which is involved in methionine and selenoamino acid metabolism and has a role in activation of formate dehydrogenase; the GlpG glycogen phosphorylase (MCA0067 and MCA2540), which has a role in starch and sucrose metabolism; and the cell division protein FtsH (MCA0851 and MCA1848), which is a proteolytic regulator of cell division under stress. One of each duplicated pair is most closely related to genes from other Gammaproteobacteria, whereas its partner is either most closely related to genes from cyanobacteria, or occupies a deep-branching position.M. capsulatus suggests that this enzyme is instead functioning in reverse, in THMPT-linked formaldehyde oxidation , an enzyme central to methanogenesis in Archaea. The fact that methanogenesis has not been previously reported in xidation with the incomplete genome data from the methylotroph M. extorquens were used to identify additional novel genes. Phylogenetic profiling identified four genes not previously known to have a role in methane oxidation pathways in M. capsulatus. Two of them (MCA0180 and MCA3022) clustered with the gene that ecodes methylene THF dehydrogenase (transfer of C1 compounds) together with a gene from Pirellula, and the others (MCA0346 and MCA2963) grouped with pmoC3 (oxidation of methane to methanol) and a gene from Nitrosomonas.Phylogenetic profiling and compM. extorquens, which possesses a much larger genome (7.6 Mb) than that of M. capsulatus (Bath) (M. capsulatus (Bath) and M. extorquens (best hits) yielded a total of 572 genes in 88 role categories. The majority of these shared genes are of unknown function. Putative orthologs detected included 24 conserved hypothetical genes. Phylogenetic profiling showed that ten of the 24 occur in a species distribution similar to proteins of the methane oxidation pathway, suggesting that they may also have a role in methane oxidation. Three of the ten were found within methanotrophy gene “islands” (see below), and three had the highest levels of similarity to M. extorquens supporting a putative role in the methane oxidation pathway.Specific comparisons with s (Bath) , revealeM. extorquens, we found orthologs of 69, mostly in the categories of energy and carbon metabolism; the remaining 20 genes found in M. extorquens but not M. capsulatus (Bath) are involved in the metabolism of other C1 compounds not used by M. capsulatus. Many (41 of 69) of these shared methylotrophy genes are clustered on the chromosome into 13 groups, seven of which contain more than three genes, and the largest of which contains nine. Three hypothetical proteins were identified in these clusters, suggesting a role in C1 metabolism.Of the 89 genes putatively involved in methylotrophy in M. capsulatus (Bath) genome has illuminated the genomic basis for the highly specialized methanotrophic lifestyle, including redundant pathways involved in methanotrophy and duplicated genes for essential enzymes such as the MMOs. We used phylogenomic analysis, gene order information, and comparative analysis with a partially sequenced methylotroph to detect genes of unknown function likely to be involved in methanotrophy and methylotrophy. Many methylotrophy genes were found to be clustered in gene islands in both organisms. We found genomic evidence for the organism's ability to acquire copper (including a previously unknown NRPS) and to use copper in regulation of methanotrophy, but the exact regulatory mechanisms remain unclear.Our analysis of the The genome sequence suggests previously unexpected metabolic flexibility, including the ability to oxidize chemolithotrophic hydrogen and sulfur and to live under reduced oxygen tension, both of which have implications for methanotroph ecology. There is a clear need for experimental validation of these genome-based hypotheses.M. capsulatus (Bath) deepens our understanding of methanotroph biology, its relationship to global carbon cycles, and its potential for biotechnological applications, and it provides a set of hypotheses of gene function that can now be experimentally tested. In addition, the annotated genome provides a source of gene probes for detection and differentiation of methanotrophs in environmental samples.The availability of the complete genome of M. capsulatus (Bath) was purchased from National Collection of Industrial and Marine Bacteria as strain NCIMB 11132, and its DNA was isolated as previously described proteins were analyzed using the Automated Phylogenetic Inference System . This system automates the process of sequence similarity, alignment, and phylogenetic inference for each protein in a genome. Sequence alignments and phylogenetic trees were refined using the methods described previously (Identification of putative protein-encoding genes and annotation of the genome were performed as previously described . An initeviously .M. capsulatus [Bath]), and (c) to determine the presence of homologs in different species. Orthologs between the M. capsulatus (Bath) genome and that of M. extorquens were identified by requiring mutual best-hit relationships among all possible pairwise BLASTP comparisons, with some manual corrections. A total of 89 genes involved in methylotrophy in M. extorquens (M. capsulatus (Bath) and M. extorquens. Comparative genome analyses were also performed using the Comprehensive Microbial Resource (Proteins were searched by BLASTP against torquens were obtResource .core of the putative prophage (identified using MUMmer [mom DNA methyltransferase) demarking the 5′ and 3′ boundaries of the region per protein sequence query.Putative prophage regions were defined as containing genes that encode proteins bearing sequence similarity to known phage or prophage proteins. We are using “prophage” to refer to sequences with similarity to lysogenic bacteriophages that have not been experimentally demonstrated to form infectious particles. Additional supporting information included the presence of direct repeats representing the attg MUMmer ), the coe region . Best mae region was imple region , reportihttp://www.ncbi.nlm.nih.gov/Genbank/) accession number for the Methylococcus capsulatus genome discussed in this paper is AE017282.The GenBank (

We strategically selected the GrB ELISPOT assay because GrB is a hallmark effector molecule of cell-mediated destruction of target cells.This study assessed the Granzyme B (GrB) ELISPOT as a viable alternative to the 51Cr-release assays were made using human LAK cells.We optimized the GrB ELISPOT assay using the human-derived TALL-104 cytotoxic cell line as effectors against K562 target cells. Titration studies were performed to assess whether the ELISPOT assay could accurately enumerate the number of GrB-secreting effector cells. TALL-104 were treated with various secretion inhibitors and utilized in the GrB ELISPOT to determine if GrB measured in the ELISPOT was due to degranulation of effector cells. Additionally, CD107a expression on effector cells after effector-target interaction was utilized to further confirm the mechanism of GrB release by TALL-104 and lymphokine-activated killer (LAK) cells. Direct comparisons between the GrB ELISPOT, the IFN-γ ELISPOT and the standard 2+, thereby preventing degranulation. The number of effector cells expressing the degranulation associated glycoprotein CD107a increased after interaction with target cells and correlated with the stimulated release of GrB measured in the ELISPOT assay.Titration studies demonstrated a strong correlation between the number of TALL-104 and LAK effector cells and the number of GrB spots per well. GrB secretion was detectable within 10 min of effector-target contact with optimal secretion observed at 3–4 h; in contrast, optimal IFN-γ secretion was not observed until 24 h. The protein secretion inhibitor, brefeldin A, did not inhibit the release of GrB but did abrogate IFN-γ production by TALL-104 cells. GrB secretion was abrogated by BAPTA-AM ethane-N,N,N', N'-tetraacetic acid tetra(acetoxymethyl) ester), which sequesters intracellular Ca51Cr-release assay to measure MHC non-restricted cytotoxic activity of innate immune cells. Compared to the IFN-γ ELISPOT assay, the GrB ELISPOT may be a more direct measure of cytotoxic cell activity. Because GrB is one of the primary effector molecules in natural killer (NK) cell-mediated killing, detection and enumeration of GrB secreting effector cells can provide valuable insight with regards to innate immunological responses.Because of its high sensitivity and ability to estimate cytotoxic effector cell frequency, the GrB ELISPOT assay is a viable alternative to the TALL-104 cells were resuspended at 2.5 × 105 cells/ml and 2.5 × 104 cells/ml in PBS without divalent cations for BAPTA-AM and brefeldin A treatment, respectively. Cells were pretreated with the indicated concentrations of BAPTA-AM for 45 min or with 5 μg/ml brefeldin A for 1 h at 37°C, washed twice, assessed for viability by trypan blue exclusion, and resuspended at 2.5 × 104 cells/ml in assay media.TALL-104 cells were treated with inhibitors of cellular secretion prior to use in the GrB and IFN-γ ELISPOT assays. Inhibitors used included 1,2-bis-(2-aminophenoxy)ethane-N,N,N', N'-tetraacetic acid tetra(acetoxymethyl) ester , a cell permeant chelator of intracellular Ca51Cr-release assay. Briefly, one million target cells were labeled at 37°C for 1 h with 100 μCi Na251CrO4 . Target cells were washed and resuspended in TCM at 5 × 104 cells/ml. Five thousand target cells per well (100 μl) were added to a 96 well plate following the appropriate number of effector cells (100 μl/well). The defined effector:target (E:T) ratios were plated in triplicate. Cytotoxicity assays were performed at 37°C for 4 h. Percent specific lysis was calculated using the following equation:Cytotoxicity of TALL-104 and LAK cells was assessed using the standard (ER - SR)/(MR - SR) × 100,where ER = experimental release, SR = spontaneous release and MR = maximum release.4 target cells per well (100 μl). After the specified effector-target cell incubation, the plates were washed and 100 μl/well of biotinylated anti-human GrB detecting antibody was added. Plates were incubated for 3 h and 50 μl of Streptavidin-Alkaline Phosphatase was added for 1 h. Spots were visualized with 100 μl/well of BCIP-NBT phosphatase substrate and subjected to automated evaluation using the ImmunoSpot Imaging Analyzer system .Granzyme B secretion was measured using the GrB ELISPOT assay as previously described . BrieflyFor assessing IFN-γ secretion, MultiScreen-IP plates were coated overnight at room temperature with 50 μl/well of anti-human IFN-γ antibody as previously described . After eDegranulation of TALL-104 and LAK cells in response to target cell recognition was assessed by monitoring surface antigen expression of CD107a , a surface antigen transiently present on the cell surface after release of cytolytic granules. Expression of CD107a has been used as a marker to measure degranulation by flow cytometry ,29.5) were resuspended in 400 μl of phenol red-free TCM in polystyrene tubes . PKH67-labeled K562 target cells (1 × 105 cells in 50 μl) were then added to appropriate tubes, the tubes were spun for 30 sec at 500 rpm and incubated for the specified periods in a 37°C water bath. Reactions were quenched with cold PBS and then 20 μl of CD107a-PE-Cy5 (PharMingen) was added. Mouse IgG1-biotin and streptavidin-PE-Cy5 were utilized for controls. Tubes were incubated with antibody for 20 min at room temperature, washed with buffer and analyzed using a FACScan instrument equipped with a 15 mW argon-ion laser. The percent of effector cells expressing CD107a was determined by gating the PKH67 negative (effector cells) population. Within the PKH67 negative gate, CD107a expression was determined from histograms based on forward and side scatter analysis. Effector cells run in the absence of target cells were evaluated for baseline expression of CD107a. The percentage of effector cells induced by target cells to express CD107a was calculated by subtracting background (spontaneous) expression from experimental samples.To distinguish target cells from effector cells, K562 cells were first labeled with PKH67 dye (Sigma) according to the manufacturer's instructions and washed extensively prior to use in the assay. Effector cells (2 × 10t test and Pearson correlation coefficient (R2).Statistical analysis was performed using Student's 2 = 0.98. Therefore, the GrB ELISPOT assay is capable of measuring the frequency of effector cells stimulated to secrete GrB.GrB ELISPOT assays were performed using a constant number of K562 targets and decreasing numbers of TALL-104 effector cells per well. As the number of TALL-104 cells decreased, the resulting number of GrB spots decreased linearly. Limited GrB spots were detected in wells containing TALL-104 alone demonstrating that the ELISPOT assay measured primarily stimulated release of GrB inhibit IFN-γ secretion therefore, the optimal ratios for the ELISPOT assays are below the level of sensitivity of the 51Cr-release assay . EGTA, which sequesters extracellular Ca2+, could also abrogate GrB secretion measured in the ELISPOT assay. However, significantly higher concentrations of EGTA (4–40 mM) than BAPTA-AM were needed to block GrB secretion (data not shown). These data are in good agreement with recently published findings [2+, but not Ca2+ [To confirm that GrB measured in the ELISPOT assay was released via degranulation, effector cells were treated with inhibitors of cellular secretion: brefeldin A, BAPTA-AM and EGTA. Brefeldin A reversibly disrupts protein translocation from the endoplasmic reticulum to the Golgi apparatus, blocking the production and subsequent secretion of newly synthesized proteins . BAPTA-Afindings which denot Ca2+ . Thus, t2 = 0.89). Both the release of GrB and the expression of CD107a was observed as early as 30 min after LAK cells were stimulated with relevant target cells, and increased with extended effector-target cell interaction. These data confirm that the GrB ELISPOT assay is an excellent measure of cytotoxic capacity mediated by effector cell degranulation.Recently, a flow cytometric assay based on CD107a mobilization was developed to measure degranulation of cytolytic cells ,29. CD1051Cr-release assay, they demonstrated higher sensitivity with both TALL-104 and LAK cells as effector cells, data consistent with previous studies [51Cr-release assay measures cytotoxic ability regardless of the mechanisms of the killing. Therefore, unlike the 51Cr-release assay, the ELISPOT assays are both qualitative and quantitative.When the ELISPOT assays were directly compared to the studies ,25,36,3751Cr-release and the GrB ELISPOT assay measure different aspects of cell-mediated killing – target cell death and effector cell function, respectively. A limitation of the GrB ELISPOT assay is that it measures degranulation, not direct target cell lysis. As such, degranulation may not always equate to cell death if target cells contain serpin proteinase inhibitor 9 (PI9), a protein that inhibits the proteolytic activity of GrB, [51Cr-release assay, the GrB ELISPOT provides the precusory frequency of cells with the potential to kill targets. Although a number of flow cytometric assays have been developed to assess target cell cytotoxicity as well as identify the phenotype of the effector cells mediating the immune response, these assays are not as sensitive as the ELISPOT assay.It is important to emphasize that of GrB, or if ef51Cr-release assay [The use of the IFN-γ ELISPOT assay as a surrogate measure for CTL and NK responses has recently gained increased application as an alternative to the se assay ,39-43. Hse assay -48. The se assay ,50. Ther51Cr-release assay to measure granule-mediated cytotoxicity and could be easily adapted to reliably and accurately measure MHC non-restricted cytotoxicity indicative of NK and LAK activity. The GrB ELISPOT assay measured GrB release due to degranulation of stimulated effector cells. Additionally, GrB is a more specific candidate marker than IFN-γ to measure the cytotoxic capacity of innate immune effector cells such as NK cells.Our data demonstrate that the GrB ELISPOT assay is a viable alternative to the standard None declared.KSW and AM designed the study, analyzed the data and drafted the manuscript. KSW carried and prepared the cell lines and performed the majority of the immunogical assays. MWB performed and analyzed the flow cytometric CD107a assay data. SS participated in the design of the study and preparation of the manuscript. TS, DK and MB participated in the design of the study and served as expert advisors. All authors read and approved the final manuscript.

Human resources (HR) constraints have been reported as one of the main barriers to achieving the 2005 global tuberculosis (TB) control targets in 18 of the 22 TB high-burden countries (HBCs); consequently we try to assess the current HR available for TB control in HBCs.A standard questionnaire designed to collect information on staff numbers, skills, training activities and current staff shortages at different health service levels was sent to national TB control programme managers in all HBCs.Nineteen HBCs (86%) replied, and 17 (77%) followed the questionnaire format to provide data. Complete information on staff numbers at all service levels was available from nine countries and data on skill levels and training were complete in six countries. Data showed considerable variations in staff numbers, proportions of trained staff, length of courses and quality of training activities. Eleven HBCs had developed training materials, many used implementation guidelines for training and only three used participatory educational methods. Two countries reported shortages of staff at district health facility level, whereas 14 reported shortages at central level. There was no apparent association between reported staff numbers (and skills) and the country's TB burden or current case detection rates (CDR).There were few readily available data on HR for TB control in HBCs, particularly in the larger ones. The great variations in staff numbers and the poor association between information on workforce, proportion of trained staff, and length and quality of courses suggested a lack of valid information and/or poor data reliability. There is urgent need to support HBCs to develop a comprehensive HR strategy involving short-term and long-term HR development plans and strengthening their HR planning and management capabilities. The performance of health care systems is closely related to the numbers, distribution, knowledge, skills and motivation of its workforce, particularly of those individuals delivering the services . ImproveTuberculosis (TB) constitutes the third most important cause of death and disability among inThe World Health Assembly (WHA), in 1991, pledged countries to achieve detection of at least 70% of estimated infectious TB cases (SS+) and to cure 85% of them by the year 2000 . LikewisLow-income and middle-income countries (LMIC) urgently need a sufficiently large health care staff with appropriate expertise, experience and motivation, working at the right places. Lack of HR strategies, inadequate HR planning and management, poor deployment practices, inflexible contracting arrangements and inability to create new posts or increase salaries resulting from international regulations capping social sector spending have contributed to the global HRH crisis . In addiIn 2003, national TB programme (NTP) managers from 18 of the 22 TB high-burden countries , ranked inadequate HR first within the top five constraints to reaching the WHA global TB control targets [There is very limited published literature on HRH issues, particularly in LMIC and there are both scanty information on methods to assess HR capacity and lack of evidence on how best to evaluate interventions to strengthen and/or build HR capacity . The deaCurrently there is increasing awareness that HRH concerns must be addressed in order to reach the MDGs, to expand access to priority interventions, to promote health systems development and to achieve global health equity ,15. HoweThis paper reports the results of a questionnaire sent to NTP staff in the 22 HBCs to assess the workforce available for TB control , as well as the estimated HR requirements for appropriate TB control in HBCs. It aims to inform the development of more reliable methods of gathering qualitative and quantitative information on HR and to stimulate a long-overdue discussion on HR for TB control issues, so that governments of endemic countries and technical and financial partners can finally begin to address them jointly.NTP managers and country-based WHO staff in the 22 HBCs: Afghanistan, Bangladesh, Brazil, Cambodia, China, Democratic Republic of the Congo, Ethiopia, India, Indonesia, Kenya, Mozambique, Myanmar, Nigeria, Pakistan, Philippines, the Russian Federation, South Africa, Tanzania, Thailand, Uganda, Viet Nam and Zimbabwe. These countries account for more than half of the world's population and approximately 80% of the global TB burdenDiscussions with NTP managers and a literature review on HRH informed the development of a questionnaire to ascertain current staff provision; quality and intensity of training; time and type of personnel involved in performing different TB control activities; and estimated staffing needs at different health service levels. The questionnaire was pilot-tested internally within the Stop TB Department (STB), WHO headquarters, Geneva; and externally with staff from the NTP in Indonesia.The first section of the questionnaire assessed staff numbers and skills. It included open questions about absolute numbers of staff involved in delivering TB control activities at each service level . Skills were assessed using a composite of the proportion of staff receiving training in the previous three years (at each level) and the quality of the training provided – materials) as proxy measures.Section two of the questionnaire addressed estimated HR gap. Since this paper specifically refers to TB control, we estimated the workload involved in adequate TB control in HBCs. Workloads were assessed by means of open questions on the different processes involved in the management of new SS+ patients , the estimated duration of each task and the type of staff involved in delivering them. A series of worksheets containing the different tasks required for TB case management were designed to assist respondents completing the questionnaire and to improve standardization. Capacity of health services at two different CDRs were assessed (current CDR and at the target 70% CDR). Workloads at current CDRs were calculated by multiplying the current numbers of new SS+ patients by the estimated time needed to treat a new SS+ patient; workloads at the 70% CDR were calculated by multiplying the figure corresponding to 70% of the estimated SS+ TB cases for each country by the time needed to treat a new SS+ patient. Eleven hours was used as the time needed to treat a new SS+ patient; this had been estimated previously by a TB experts' consensus .In March 2003, the questionnaire, together with detailed instructions in English, was e-mailed to NTP managers and country-based WHO staff in the 22 HBCs. Three e-mail reminders were sent monthly after the return deadline; follow-up with several countries included e-mail and telephone communications to clarify responses. Data were entered into spreadsheet software for the analysis; qualitative answers were discussed by the authors.Nineteen of the 22 HBCs returned the questionnaire (86% response rate). Two countries provided information on their HR for TB control but did not use the questionnaire format and were thus excluded from the analysis; one country reported that it would take a substantial amount of time to get reliable information from such a large country and provided other readily available HR information; another reported that given the country's current staffing deficits and competing priorities they were unable to complete the survey. Further discussions revealed that some HR information was available in this country, although it was scattered in different sources and lengthy to compile. Both countries requested technical support to assess staffing needs at different levels and to assist their government's HR development programmes. Despite e-mail and telephone remainders, three countries failed to respond.Information on estimated numbers of staff was available from all 17 countries but complete in nine (53%) of them. Staff numbers within the same service level varied considerably between countries; i.e. numbers of staff at provincial level varied from 8704 in one country to 6 staff in two countries (Table Complete information on numbers of staff trained in the previous three years was available in only six countries (35%). There was also great variation in the numbers (or proportions) of trained staff Table . IndonesInformation on length of training courses and development of training materials was also incomplete. Length of courses for staff at the same service level varied greatly between countries; for example, courses for TB coordinators at provincial level (data from 11 countries) varied from 4 to up to 60 days, whereas at district level (information from 10 countries) courses varied from 4 days to 4 months Table . SimilarThe estimated time needed to treat a new SS+ patient is shown in Figure Sixteen countries Table reportedAll countries provided information on their estimated HR gap at district level; nine 53%) countries reported existing staff needs at district level ; for other health care staff, adequate competence is ensured through regular training and supervision. Apart from Indonesia and Viet Nam, there was no correlation between information on numbers of staff, attendance of training courses, length of courses and development of training materials. In general NTP managers in HBCs had limited information on staff attendance of training courses and on the characteristics, duration and intensity of training activities. HBCs need to develop needs-based comprehensive training policies and training strategies for health care staff at all service levels, incorporating pre-service training, re-training, in-service support and continuous professional/career development. Similarly, it is important to emphasize the role of periodic monitoring and supervisory visits as part of the staff continuous education and support processes. Appropriately designed strategies fostering career paths could increase staff motivation and performance; improve staff recruitment, retention and distribution; and even have a positive effect on enlisting of students into training programmes and expaThe quality of training materials was also of concern: many countries used inadequate training tools, few had developed specific modules and even fewer used problem-based learning or participatory methodology to facilitate adequate skill development. The length of courses also varied greatly: while very short courses do not allow the development of skills and competences needed to improve performance, lengthy courses have economic and logistic implications. Differences in the quality and intensity of training could translate into service or performance variations with detrimental effects to programmes and ultimately to patients. There is a need to standardize training in terms of contents, competences, methodologies, course duration and quality of training materials. Improvement and standardization of training curricula and methodologies will facilitate the adoption of a universal standard of care for TB patients in HBCs, leading to a more rational use of the health care workforce, improved staff motivation and productivity and better outcomes for TB patients.Although the majority of countries described deficiencies of staff at central level, few reported shortages in the actual numbers of posts. However, there were concerns about the distribution and/or the skill mix (competences and efficiency) of staff. There was no clear relation between reported data on staff needs and either the TB burden in the country or the actual performance of the NTP. It is of concern that only Uganda and Myanmar reported shortages of staff at current CDRs, whereas countries with very low current CDRs did not. Only five countries projected shortages of staff at the 70% CDR; four of them estimated large numbers of staff required.If the assessment of the HR needs was based on the actual workload, it is possible no substantial gap was determined because most of the current diagnostic and treatment tasks are carried out satisfactorily by existing staff, but an unrecognized HR gap could hamper improvement in case detection rates. The inability of some countries to increase the number of posts because of recruitment ceilings imposed under structural adjustment programmes could lead to countries underreporting their HR gap. Further analysis and recommendations on staff needs at different levels is hindered by the lack of accurate information on numbers, quality and distribution of existing staff.This survey is, to our knowledge, the first attempt to ascertain HR for TB control in HBCs. The response rate was high and responses were analysed in the context of the countries' estimated TB burden and current CDRs.Limitations of the study are evidenced by the great variation in reported staff numbers and the lack of correlation between information on numbers of trained staff, length of courses, development of materials and performance, suggesting a shortage of valid information, poor standardization and/or data reliability.The fact that the questionnaire was in English could have generated some inaccurate answers. Indonesia, for example, reported 100% training completion based on its 2002 training goals rather than in absolute numbers , but countries were re-contacted (by e-mail or telephone) to clarify inconsistent replies. Responses could have been biased towards greater HR needs if countries perceived this as an opportunity to request increased support; however, this did not seem to happen, since few countries reported staff shortages.The performance assessment component of the questionnaire assumed NTP managers could assess the HR gap by comparing existing staff numbers (at different service levels) with the product of the additional SS+ cases by the time spent in diagnostic/treatment activities. Although all the tasks were listed in the questionnaire, the interpretation of what constituted achieving each task was left to NTP managers; this could have affected their estimation of the time required. We are currently developing a more detailed task analysis tool that includes the breakdown of each TB control activity into specific single tasks and a description of what constitutes each task; this will facilitate future studies. Furthermore, this method accounted only for new SS+ cases: in some countries, health facility staff will spend more time dealing with relapses, treatment failures or other TB patients: On the other hand, in some HBCs some tasks are performed by NGOs or the private sector and this was not discounted.Constraints to HR development such as poor HR data quality, lack of a comprehensive national HR plan/strategy and little attention to continuing education programmes were comThe 2nd ad hoc committee on the TB epidemic recommended addressing the health-workforce crisis by collaboratively developing policies to reduce barriers to creating and filling posts in HBCs; increasing staff recruitment and retention by improving working conditions in the health sector; promoting task analysis and HR needs assessments, HR planning and training at country level; and working together with other stakeholders to develop strategies to further mobilize HR for TB control . In gene declare that they have no competing interests.

A decrease in pulmonary surfactant has been suggested to contribute to the lung dysfunction associated with pulmonary inflammation. A number of studies have implicated surfactant clearance as a possible mechanism for altered pool sizes. The objective of the current study was to specifically investigate the mechanisms of surfactant clearance in a rodent model of acute pulmonary inflammation.Inflammation was induced by intrapulmonary instillation of lipopolysaccharide (LPS: 100 μg/kg). Lipid clearance was assessed at 18 and 72 hours post-LPS instillation by intratracheal administration of radiolabel surfactant-like liposomes 2 hours prior to isolation and analysis of inflammatory cells and type II cells.At both 18 and 72 hours after LPS instillation there was significantly less radioactivity recovered in the lavage fluid compared to respective control groups (p < 0.05). At both time points, the number of cells recovered by lavage and their associated radioactivity was greater compared to control groups (p < 0.01). There was no difference in recovery of radioactivity by isolated type II cells or other cells obtained from enzymatic digestion of lung tissue.These results show that increased clearance of surfactant lipids in our model of acute pulmonary inflammation is primarily due to the inflammatory cells recruited to the airspace and not increased uptake by alveolar type II cells. Pulmonary surfactant is a phospholipid-protein complex that lines the inner surface of the lung and is essential for normal pulmonary function. Surfactant acts to promote lung stability by reducing surface tension within the lung, while also protecting against inhaled pathogens. Surfactant is composed of approximately 90% lipids and 10% proteins by weight. The lipid component is primarily phospholipids with phosphatidylcholine (PC) being the most abundant, and the protein component comprised of four surfactant-associated proteins designated SP-A, SP-B, SP-C and SP-D . CollectAlterations of the pulmonary surfactant system, including decreased total surfactant levels, have been implicated in the pathophysiology of acute lung injury. Multiple studies of patients with a variety of lung diseases have shown that surfactant levels are decreased in the inflamed, injured, or infected lung -5. In agex vivo to LPS resulted in the presence of giant lamellar bodies within the type II cells PC was obtained from DuPont New England Nuclear . Elastase for type II cell isolations was purchased from Worthington Biochemicals . Dulbecco's PBS, DMEM, and fetal bovine serum (FBS) were obtained from Life Technologies . Low-endotoxin BSA, O26:B6 Escherichia coli LPS, Rat IgG and all other chemicals were purchased from Sigma . Chloroform and methanol were obtained from EM Science .Dipalmitoylphosphatidylcholine (DPPC), egg phosphatidylcholine (PC), dipalmitoylphosphatidylglycerol (DPPG) and cholesterol were purchased from Avanti Polar Lipids . L-α-dipalmitoyl [2-palmitoyl-9,10-3H-DPPC (12 μCi/mg phospholipid). The lipids were dried under nitrogen, reconstituted in 0.15 M saline and extruded from a French Press cell under 900 psi. This resulted in small unilamellar liposomes at a concentration of approximately 1 mg lipid/ml.Small unilamellar liposomes were prepared with a lipid composition similar to pulmonary surfactant: 52% DPPC, 26% egg PC, 15% DPPG and 7% cholesterol by weight with trace amounts of E. coli LPS) was suspended in 300 μl of sterile 0.15 M saline. Control animals received an equal volume (300 μl) of sterile 0.15 M saline. For instillation, animals were anesthetized with halothane such that they remained unconscious throughout the entire instillation procedure and had no cough reflex upon intubation. Animals were placed on a board at a 45° angle, intubated with an 18-gauge blunt ended catheter and either sterile saline or LPS suspension was instilled followed by five 1 ml boluses of air to facilitate the distribution of the instilled fluid. Two hours prior to killing, liposomes (100 μg lipid) were intratracheally instilled in all groups following the identical instillation procedure. Separate groups of both control and LPS animals were sacrificed at 18 or 72 hours after saline or LPS instillation.Male pathogen-free Sprague Dawley rats were used for the current study. For LPS animals, endotoxin . The lung from the first animal was carefully removed from the thoracic cavity and placed between saline soaked gauze pads while the second lung was perfused and removed in identical fashion. The time for lung perfusion and removal was approximately 10 minutes. After lungs were isolated from both a control and LPS animal, they were lavaged simultaneously with eight 10-ml volumes of EGTA buffer . For each animal the individual lavages were collected and combined to make up the bronchoalveolar lavage fluid (BALF), which was immediately stored on ice. After the lavage procedure, individual lobes were dissected away from the major airways. The lung tissue was then cut into 5 mm pieces in 5 ml calcium buffer and subsequently homogenized with a Polytron PT-MR-2100. After complete homogenization, total lung tissue volume was diluted to 40 ml with calcium buffer and stored on ice. A small aliquot (2 ml) of the total BALF was removed and the remainder was centrifuged at 250 g for 10 minutes at 4°C to generate a pellet that was primarily BALF cells. The cell pellet was subsequently suspended in 10 ml of PBS. Lavage cell numbers were determined by a hemocytometer, viability determined by trypan blue exclusion and cell differential determined by Hemacolor staining of cytospins that were prepared using a Shandon Cytospin 2 centrifuge. Liposome-association in total BALF, cell-free BALF, BALF cells and homogenized lung tissue was determined by scintillation counting.One control animal and one LPS animal were investigated simultaneously, thus all procedures were done in parallel. At 18 or 72 hours after saline or LPS instillation, animals were anesthetized with 0.3 mg of sodium pentobarbital and 700 U of heparin. After loss of toe pinch reflex, the trachea was cannulated and the rat was exsanguinated via transection of the descending aorta. The chest cavity was subsequently opened and the lungs perfused through the pulmonary artery with 40–50 ml of a calcium buffer and once with elastase solution . The lungs were then filled with the elastase solution and suspended in warmed saline (37°C) for 20 minutes. Lung tissue was removed from the major airways, cut into 5-mm pieces and chopped 200 times with sharp scissors in 5 ml of the calcium solution along with 2 mg of DNase. The tissue suspension was added to a flask with 4 ml of FBS and 35 ml of calcium buffer and shaken vigorously for 2 min in a 37°C water bath. The resultant tissue suspension was strained through gauze, and then decreasing sizes of nylon mesh . The cell suspension was centrifuged at 250 g for 10 min at 4°C, the resulting cellular pellet was suspended in 20 ml of warm DMEM (37°C) and incubated on two IgG coated Petri dishes (150 × 15 mm) for 30 minutes at 37°C. After the incubation period, nonadherent cells were removed from the plate, washed once with PBS, suspended in calcium buffer and used for determination of radiolabel recovery associated with Type II cells. The remaining adherent cells were gently scraped off the plate in 5 ml of DMEM and transferred into a polypropylene tube; this population of cells is referred to as "plate cells" and consisted primarily of macrophages and/or neutrophils as described in detail below. The cells were washed once and suspended in calcium buffer for determination of associated radioactivity. A small aliquot from the isolated type II cells and plate cells was saved for differential cell count and viability. Cell purity was determined by counting a minimum of 250 cells from random fields after staining by the Papanicolaou method [A separate cohort of animals was required for type II cell isolation studies. As with the whole lung studies, type II cell isolation was completed for one control and one LPS rat in parallel for both 18- and 72-hour time points after instillation of saline or LPS. The type II cell isolation procedure was described previously with minor modifications of the original protocol ,23. The u method .All data reported are means ± standard error (SE). Repetitions (n) used to calculate means ± SE were from independent experiments, not from replicates within an experiment. An analysis of variance (ANOVA) was used to determine differences between all experimental groups at a specific time point, followed by a Tukey post-hoc test for multiple comparisons. Significance was accepted when p < 0.05.Table Table Figure Figure Additional controls were performed in which animals (n = 2) received radiolabel liposomes followed by whole lung lavage and lung tissue homogenization 5 minutes after the instillation procedure. Mean total lung radiolabel recovery for this control group was 77% suggesting that ~25% of the radiolabel liposomes were lost in the instillation procedure , or possibly were adhered to the airway epithelium. The distribution of the recovered liposomal radioactivity within the 5-minute control lungs was 91% associated with the BALF, 2% associated with BALF cells, and 7% associated with lung tissue.6 to 21.6 × 106 cells with a mean of 17.1 × 106. The purity of this cell fraction averaged greater than 80% type II cells and viability was greater than 95%. Plate cell recovery from the control group ranged from 1.8 × 106 to 4.7 × 106 cells with a mean value of 3.2 × 106. This cell fraction was predominately macrophages and the viability was greater than 90%. For the LPS group at the 18-hour time point, type II cell recovery ranged from 10.6 × 106 to 20.5 × 106 cells and a mean of 16.3 × 106 cells, with a purity greater than 85% type II cells and viability greater than 95%. Plate cells from the LPS 18 group ranged from 2.7 × 106 to 13 × 106 cells with a mean of 6.6 × 106 cells. This cell population consisted primarily of neutrophils and macrophages and viability was greater than 90%. There were no significant differences in cell numbers obtained from control and LPS animals 18 hours after saline or LPS instillation.Table Figure 6 to 40 × 106 cells with a mean of 28.4 × 106. The purity of this cell fraction averaged 75% type II cells and viability was greater than 95%. The number of cells obtained from the plate group ranged from 1.8 × 106to 15.9 × 106 cells with a mean value of 6.2 × 106 with the primary cell type being macrophages with a small percentage of neutrophils and type II cells. Viability for the plate cells were greater than 90%. For the LPS group at the 72-hour time point, type II cell recovery ranged from 19.2 × 106 to 64.6 × 106 cells and a mean of 33.2 × 106 cells, purity greater than 80% type II cells and viability greater than 95%. Plate cells from the LPS 18-hour group ranged from 3.3 × 106 to 16.2 × 106 cells with a mean of 7.8 × 106 cells. This cell population consisted primarily of macrophages and viability was greater than 90%. There were no significant differences in cell recoveries between the control and LPS groups at the 72-hour time point. Of note, there were a greater number of cells recovered from both 72-hour groups compared to both 18-hour groups.Table Figure In the present study, we evaluated the clearance of surfactant-like liposomes at 18 and 72 hours following the intrapulmonary instillation of LPS. At both time points, radiolabel liposomes were instilled two hours prior to killing and the distribution within the lung was determined. Radioactivity was measured in cell-free BALF, isolated BALF cells, whole lung tissue, isolated type II cells and remaining tissue-associated cells. At both time points there was a significant increase in clearance of exogenous liposomes from the airspace and a small decrease in alveolar surfactant phospholipid levels in the LPS groups compared to control groups that received vehicle only. This corresponded with increased radiolabel associated with isolated BALF cells and no difference associated with lung tissue at either time point after LPS instillation compared to controls. There was no difference in liposomal radioactivity associated with isolated type II cells or other tissue cells between both LPS groups and their respective control groups, which was in agreement with whole lung measurements. These data suggest that cells recruited into the airspace as a consequence of the LPS-induced inflammatory response can significantly contribute to increased clearance of surfactant-like liposomes from the airspace Figs. .in vitro [in vitro measurements of lipid uptake, they estimated that neutrophils could account for up to 48% of the observed clearance and could significantly impact surfactant homeostasis. Data from the current study supports this idea by demonstrating that in vivo, neutrophils can indeed contribute to the clearance of surfactant lipids during pulmonary inflammation.Eighteen hours after LPS instillation there was an infiltration of neutrophils into the airspace which resulted in a 10-fold increase in BALF cells. At this time point there was a doubling of total liposomal radioactivity associated with these inflammatory cells compared to alveolar cells recovered from control animals. Neutrophils recruited into alveolar spaces during infection are essential for host defense by phagocytosis and killing of bacteria and other infectious agents. Previous studies have documented that surfactant can in fact modulate neutrophil functions, as surfactant proteins A and D can enhance neutrophil uptake of bacteria . Althougin vitro . Based oin vitro to take up and degrade surfactant lipids and have also been shown in vivo to account for approximately 20% of surfactant lipid clearance in normal lungs [in vitro than macrophages isolated from normal lungs [in vivo data presented in the current study support the theory that activated alveolar macrophages can impact clearance of surfactant lipids.At the 72-hour time point after LPS instillation there was an accumulation of macrophages in the alveolar space that resulted in a 5-fold increase in BALF cells compared to control animals. There was a doubling of radiolabeled phospholipids associated with these alveolar cells and no increase in the amount of radiolabeled phospholipids associated with whole lung tissue. This resulted in a significant increased in clearance of total liposomal radioactivity from the BALF, 72 hours after LPS instillation. Alveolar macrophages have been shown al lungs ,25. Macral lungs , suggestin vitro data had predicted that inflammatory cells (neutrophils and macrophages) could account for a 6 to 13 fold increase in lipid clearance [in vitro study. Although the present in vivo data demonstrated that the inflammatory cells can indeed contribute to increased lipid clearance as suggested previously, the absolute value was considerably less than that predicted from the in vitro studies. Although we do not have an explanation for this quantitative difference between the in vivo and in vitro observations, it is possible that the process of cell isolation in the in vitro study resulted in their activation for subsequent lipid uptake. Alternatively, in vivo, multiple factors can impact total surfactant pool size in addition to clearance by inflammatory cells.Of note, previous learance . In the in vivo, surfactant clearance by type II cells was similar at both 18 and 72 hours after intrapulmonary LPS instillation compared to control groups killed at the same time points . Similar to type II cells, surfactant clearance from these tissue-associated cells isolated from the two LPS groups were similar to their respective control groups. In addition, the clearance attributed to type II cells and tissue-associated cells was similar at both time points for the LPS and control groups. This observation is in agreement with a study by Gurel et al., that documented that alveolar type II cells and tissue macrophages contributed equally to the alveolar clearance of phospholipid in adult mice .in vivo clearance of surfactant lipids by type II cells is unaltered and that the increased clearance of surfactant lipids is primarily due to either neutrophils or macrophages that are recruited to the alveolar space.In conclusion, we demonstrated that after intrapulmonary LPS administration in adult rats, the JLM conceived, designed and performed all aspects of the study, and was the primary participant in its writing. JRW aided in conception and design of study, and participated in its writing.

In the 25 years since they were first discovered, introns have puzzled molecular biologists because of their uncertain function and mysterious origin. Introns are non-coding DNA sequences that reside inside a gene, splitting it into discrete units called exons. The resulting disruption of coding sequence continuity would wreak havoc in protein assembly if eukaryotic cells did not dispose of introns in messenger RNAs—the intermediates in the decoding of gene sequences to produce protein chains—in a now well-described process known as splicing.At first glance, introns may seem like pesky parasites for which eukaryotes have cleverly evolved bypass mechanisms. But introns may also benefit their hosts. Evolutionary advantages of introns include the possibility to create new genes by cutting and pasting exons from existing genes or to diversify the protein output of a single gene by splicing the exons together in different ways. Thus, balancing intron gains and losses clearly has important evolutionary implications for a host.Saccharomyces cerevisiae averages less than one intron per gene, whereas mammalian genes routinely have 10 or more. Whether these differences reflect different propensities for gaining or losing introns is the subject of ongoing debates.Yet different organisms strike that balance differently. The budding yeast Organisms with low intron density display a bias for insertions at the beginning (5′ end) rather than the end (3′ end) of genes. A popular hypothesis is that in these organisms, genes lose their introns through a process that rewrites genomic DNA using as template the messenger RNAs purged of intron sequences. This process might preferentially remove 3′ introns because it relies on an enzyme called reverse transcriptase that can be primed to read RNAs starting at their 3′ end. The hypothesis has gained experimental support in yeast. It also presents the advantage of potentially explaining intron paucity and 5′ position bias in one stroke. In a new study, Cydney Nielsen and her colleagues present evidence that challenges this model.Neurospora crassa, Magnoporthe grisea, Fusarium gramineum, and Aspergillus nidulans) form an evolutionary tree with branching points estimated at 200, 230, and 330 million years ago. While they diverged from yeast some 500 million years ago, they share with yeast a low intron density (one to two introns per gene) and a 5′ position bias. The authors' approach is to tally intron gains and losses during the evolution of these four species and then plot their positions along the genes' length.They address intron dynamics with a genome-wide survey of intron distribution among four Ascomycete fungi with recently completed genome sequences. The four fungi (They identify 3,450 gene regions that are clearly conserved in all four species and harbor an intron in at least one of them. To distinguish intron gains from losses, they rely on a simple parsimony principle, which they refine with additional probability analyses. In brief, an intron present in only one species counts as a gain; an intron absent from one species but present in its closest relative and in a cousin counts as a loss.Nielsen and colleagues record between 150 and 350 intron losses in each lineage. Surprisingly, losses do not occur preferentially at the genes' 3′ end. The authors conclude that while a 3′ reverse transcriptase-based mechanism might be a factor, it cannot be the sole reason for the introns' 5′ bias. The other surprising result is that intron gains occur at almost the same rate as losses in all lineages. Intron gains therefore play an important role in the evolution of even intron-poor genomes. Clearly, intron distribution in fungi owes to forces more complex than simple 3′ intron elimination, forces that the authors propose may also shape evolution of other eukaryotic genomes.

Escherichia coli the protein protects RNA and DNA against damage from methylating agents. 1-methyladenine and 3-methylcytosine are repaired by oxidative demethylation and direct reversal of the methylated base back to its unmethylated form. Genes for AlkB homologues are widespread in nature, and Eukaryotes often have several genes coding for AlkB-like proteins. Similar domains have also been observed in certain plant viruses. The function of the viral domain is unknown, but it has been suggested that it may be involved in protecting the virus against the post-transcriptional gene silencing (PTGS) system found in plants. We wanted to do a phylogenomic mapping of viral AlkB-like domains as a basis for analysing functional aspects of these domains, because this could have some relevance for understanding possible alternative roles of AlkB homologues e.g. in Eukaryotes.AlkB-like proteins are members of the 2-oxoglutarate- and Fe(II)-dependent oxygenase superfamily. In Flexiviridae family. Sequence analysis indicated that the AlkB domains probably are functionally conserved, and that they most likely have been integrated relatively recently into several viral genomes at geographically distinct locations. This pattern seems to be more consistent with increased environmental pressure, e.g. from methylating pesticides, than with interaction with the PTGS system.Profile-based searches of protein sequence libraries showed that AlkB-like domains are found in at least 22 different single-stranded RNA positive-strand plant viruses, but mainly in a subgroup of the The AlkB domain found in viral genomes is most likely a conventional DNA/RNA repair domain that protects the viral RNA genome against methylating compounds from the environment. E. coli, and probably most of its homologues, is involved in repair of alkylation damage in DNA and RNA. It repairs 1-methyladenine and 3-methylcytosine by oxidative demethylation and direct reversal of the methylated base back to its unmethylated form. Recently the protein was identified as a member of the 2-oxoglutarate (2OG)- and Fe(II)-dependent oxygenase superfamily [2+ and 2-oxoglutarate, which is subsequently converted into succinate, CO2 and formaldehyde [The purpose of this study has been to identify domains with homology to AlkB in viral genomes, in order to get a better understanding of distribution and possible function of such domains. The AlkB protein of aldehyde .The 2OG-FeII oxygenase superfamily is widespread in Eukaryotes and bacteria , and is AlkB-like genes are widespread in most types of organisms except Archaea. However, whereas bacteria normally have just one or at most two AlkB homologues , multiceA sequence alignment of known ABHs identifies very few residues as totally conserved, basically just a HxD motif, a H and a RxxxxxR motif. These residues are also conserved in the more general 2OG-FeII oxygenase superfamily as described above, except for the final R. The first three residues (HxD and H) are involved in Fe(II)-coordination, whereas the first R is involved in 2OG-coordination. The final R is most likely involved in AlkB-specific substrate binding.E. coli AlkB and the human AlkB homologue hABH3 may be involved in RNA repair. When expressed in E. coli both AlkB and hABH3 reactivate methylated RNA bacteriophage MS2 in vivo. This illustrates that direct repair may be an important mechanism for maintenance of RNA in living cells [In addition to DNA repair, it has been shown that ng cells . RNA repng cells . Howeverng cells . Consequng cells .AlkB homologues have also been found in plant viruses. It has been suggested that methylation may be used in host-mediated inactivation of viral RNAs, and that AlkB homologues in some plant viruses may be used to counteract such defence mechanisms . Howeverin silico mapping of viruses in which such domains have been found, as well as related viruses.The research project reported here has focused on a better understanding of the distribution and potential function of putative AlkB homology domains by using The general mapping strategy of the project was to identify viral genomes with AlkB homology domains, identify common features of these genomes, and subsequently find additional genomes with similar features, but without AlkB homology domains. This data set could then be used to analyse the properties and distribution of AlkB-like domains in viruses, as a basis for generating hypotheses about the evolution and function of these domains.The PSI-Blast search for viruses in the NCBI nr protein sequence database was initiated with ALKB_ECOLI (NCBI gi113638), restricted to residues 110 to 210 and using the default inclusion threshold of 0.005 on E-values. The chosen residue range corresponds to the most conserved region in AlkB homologues [Allexi, Ampelo, Carla, Fovea, Mandari, Potex, Tricho and Vitiviruses, all of which are known to infect plants [The PSI-Blast search converged after 4 iterations, and included 43 hits below the 0.005 inclusion threshold, from 22 different ssRNA positive-strand viruses. The AlkB homologues were found in viruses belonging to t plants .Grapevine leafroll-associated virus 3 . The search for RdRp was initiated with residue range 1361–1798 from Soil-borne cereal mosaic virus . These sequences were chosen based on the output from the previous AlkB search. This gave a library of protein sequences with either AlkB, MT, HEL or RdRp domains, the general composition of which is illustrated in Figure In all of these viruses the AlkB domain is a part of the replicase polyprotein, which normally consists of a viral methyltransferase domain (MT), a viral helicase domain (HEL) and a RNA-dependent RNA polymerase domain (RdRp). Therefore separate PSI-Blast searches for the individual components of the replicase polyprotein were also initiated. All searches were done with PSI-Blast using the default inclusion threshold . The searches for MT and HEL domains were initiated using residue ranges 449–841 and 1938–2178 respectively from Viral_helicase1 and RNA_dep_RNApol2 in all sequences, corresponding to HEL and RdRp domains, respectively. In addition Vmethyltransf and 2OG-FeII_Oxy, corresponding to MT and 2OG-FeII oxygenase (AlkB) domains, were identified in several sequences. However, for sequences from Flexiviridae and Tymoviridae there was no clear identification of any MT domain by Pfam, although they had been retrieved by PSI-Blast in a search for MT domains. Therefore HMMER was used to build a Pfam type profile for these sequences. A PSI-Blast search was initiated using residues 1–500 of Potato virus M . Twelve representative sequences were selected from the search output, covering Carla, Fovea, Potex, Allexi, Capillo and Maculavirus. Subsequences representing the conserved region according to the PSI-Blast alignment, corresponding to residues 35–378 of the query sequence, were aligned using ClustalX, and a Pfam type profile was generated and calibrated using tools from the HMMER package. The resulting profile was able to identify putative methyltransferase domains in all Flexiviridae and Tymoviridae sequences in the data set.The library of protein sequences was screened for known domains in Pfam. This identified Pfam domains Peptidase_C21, C23, C33, C34, C35 and C41, A1pp and OTU – were also identified in subsets of sequences. A1pp is a member of the Appr-1-p processing enzyme family, and the domain is found in a number of otherwise unrelated proteins, including non-structural proteins of several types of ssRNA viruses. OTU is a member of a family of cysteine proteases that are homologous to the ovarian tumour (otu) gene in Drosophila. Members of this family are found in Eukaryotes, viruses and pathogenic bacteria.Other Pfam domains – Closteroviridae, Flexiviridae and Tymoviridae was then used as input for building a phylogenetic tree with MEGA2. The final tree is shown in Figure The MT, HEL and RdRp domains identified by Pfam as described above were extracted from the library sequences, aligned by ClustalX, and combined into a new alignment consisting of only these domain regions. This turned out to be necessary in order to get robust alignments. The intervening regions between the conserved domains are extremely variable in these sequences, and this tended to confuse alignment programs in the sense that conserved regions were not correctly aligned. The combined sequence alignment of domains from A second alignment was generated from all sequences with AlkB-like domains, using only the regions corresponding to MT, AlkB, HEL and RdRp Pfam domains. The domains were aligned individually, and the combined alignment was used as input for MEGA2. However, this data set did not give a reliable phylogeny (data not shown), and the separate domains of this alignment were therefore analysed individually and compared. This analysis is summarised in Table The alignment of the AlkB domain seemed to be of comparable quality to the other alignments. In fact the AlkB domain had the highest average pairwise sequence identity, as seen in Table 2 = 0.95), MT vs. HEL (r2 = 0.87) and HEL vs. RdRp (r2 = 0.81). The plot of the AlkB domain vs. these three domains for the same set of sequences shows a very low degree of correlation for AlkB vs. RdRp (r2 = 0.10), AlkB vs. MT (r2 = 0.12) and AlkB vs. HEL (r2 = 0.16).The degree of co-evolution was analysed by computing pairwise distances between sequence regions in the alignment of MT, AlkB, HEL and RdRp domains described above. In Figure As mentioned above the genome organisation of these replicase polyprotein sequences seems to be very flexible. In order to analyse domain organisation the location of identified Pfam domains were plotted for a number of sequences, as shown in Figure Xanthomonas, X. axonopodis pv citri and X. campestris pv campestris. Xanthomonas attacks plants such as citrus, beans, grapevine, rice and cotton [Xylella fastidiosa. This bacterium infects a great variety of plants, including grapevine, citrus, periwinkle, almond, oleander and coffee [The results described above may indicate that the AlkB domains have been integrated into the replicase polyprotein relatively recently (see Discussion). In order to test for potential sources selected AlkB domains were compared to non-viral sequences. PSI-Blast was used to search the NCBI nr database, removing all viral hits in the final search report. Most of the remaining top-scoring hits were from bacteria. This included two different strains of d cotton . The sead coffee .-50. Homologues of typical viral domains like the viral peptidases were obviously not found, as all viral database entries were excluded. Very few new similarities were found by these searches. Pepper ringspot virus showed significant similarity to site-specific DNA-methyltransferase from Nostoc sp (E = 1 × 10-74), as well as other cytosine 5C-specific DNA methylases. Bamboo mosaic virus showed similarity to aggregation substance Asa1 from Enterococcus faecalis (E = 6 × 10-34). A small number of additional similarities seemed to be caused by biased sequence properties (e.g. proline-rich regions), and were probably not significant. This included matches against mucin and cadherin-like proteins from Homo sapiens and multidomain presynaptic cytomatrix protein (piccolo) from Rattus norvegicus. In general the variable regions seemed to be truly variable, with very little similarity to other proteins, except for the Pfam domains already identified.Pfam searches obviously will only identify known domain types in protein sequences. In order to identify potential similarities in regions that were not recognised by Pfam, systematic PSI-Blast searches were performed, using the polyprotein regions between the MT and HEL domains and searching against the NCBI database of reference sequences , excludiCarlavirus sequences, Potato virus M (NCBI gi9626090) and Aconitum latent virus (NCBI gi14251191), is shown in Figure Potato virus M is lacking the AlkB domain whereas Aconitum latent virus is lacking the OTU domain. As seen from the dot plot, short regions of similarity close to the diagonal shows that both domains may have been present in an ancestral sequence. However, this region shows a high degree of sequence variation, and as indicated by the dot plot they are almost exclusively mutations. Non-essential or non-functional domains are probably rapidly lost. In this particular case, none of the typical AlkB motifs seem to be conserved in Potato virus M, indicating that this indeed is a non-functional AlkB domain.As seen in Figures NCBI gi926090 andVmethyltransf) did not match any of the putative methyltransferase domains of Flexiviridae and Tymoviridae, despite the fact that they had been identified via PSI-Blast searches starting with known methyltransferases. Therefore an additional Pfam-type profile was generated. It is obviously a possibility that these domains in Flexiviridae and Tymoviridae are not methyltransferases, and that they are false positives from PSI-Blast. However, the essential residues of a typical viral methyltransferase motif are conserved in the alignment of these domains (data not shown) [Bamboo mosaic virus, which belongs to Flexiviridae, the residues H68, D122, R125 and Y213 have been identified as putative active site residues with similarity to the Sindbis virus-like methyltransferase [Bamboo mosaic virus has methyltransferase activity, as it catalyses the transfer of a methyl group from S-adenosylmethionine (AdoMet) to GTP or guanylylimidodiphosphate (GIDP). The corresponding sequence positions are almost completely conserved in the alignment of Flexiviridae and Tymoviridae N-terminal domains. This is most likely significant, as only 7 positions in total are completely conserved in this alignment, which means that the majority of the conserved positions are known to be essential for methyltransferase activity. Work e.g. by Hataya et al. seems to support the assumption that this sequence region is a methyltransferase domain [As described above the Pfam methyltransferase motif (t shown) . In Bambnsferase , and it e domain . It there domain .2+ coordinating H, D and H residues at alignment positions 19, 21 and 91 of Figure Based on the bioinformatic evidence generated here, it seems reasonable to assume that the viral AlkB domains identified by Pfam are functional. All the essential residues found in 2-oxoglutarate- and Fe(II)-dependent oxygenases are conserved, in particular the putative FeFlexiviridae, and in particular to a subset of the Flexiviridae consisting of Viti, Capillo, Tricho, Fovea and Carlavirus. This subset is well separated from the remaining Flexiviridae in the phylogenetic analysis. The split seems to be robust from bootstrap analysis, therefore this family will be discussed here as two subfamilies, Flexiviridae 1 and 2. The same split was observed by Adams et al. in their recent analysis of the Flexiviridae family [Flexiviridae 2. The remaining AlkB domains are found in Flexiviridae 1 (5) and Closteroviridae (2). In general, all the Flexiviridae 2 sequences have at least one extra domain in addition to MT, HEL and RdRp: either AlkB, OTU-like cysteine protease or a peptidase. Most other plant viruses that are included in this survey do not have additional domains, except for Tymoviridae where a peptidase domain seems to be common. For the remaining plant virus families included here (excluding Tymoviridae and Flexiviridae 2), only 14% seem to have additional domains.The Pfam searches show that AlkB domains are found only in a subset of the viral genomes. This subset is phylogenetically consistent may have been the main driving force for spreading the AlkB domain to new genomes. In the first case a large number of individual integrations could have lead to the present situation. If horizontal gene transfer was the main driving force, the initial number of integrations might have been quite small. It is not easy to differentiate between these two situations.If we assume that AlkB domains have been integrated relatively recently, then either Flexiviridae 2 polyproteins . This property may possibly facilitate the insertion of such domains into the viral genome.The map of Pfam motifs in the variable region between the MT and HEL domains in s Figure shows thX. fastidiosa and campestris. It is therefore a reasonable possibility that AlkB domains in plant viruses have originated from bacterial mRNA. It is also possible that the mRNA originated from other vectors or from the host itself, but at the present time this is not easily verified or disproved because of the limited number of insect and plant genomes that have been sequenced.There are many groups of organisms that can act as vectors and spread viruses, including bacteria, fungi, nematodes, arthropods and arachnids. The plant viruses may have acquired the AlkB domain either from the vector or from the host itself. As already mentioned, searching with viral AlkB domains in protein sequence databases resulted mainly in bacterial sequences, including the plant pathogens Cucumber mosaic virus [de novo methylation of nearly all cytosine residues within the region of sequence identity between RNA and DNA [It has previously been suggested that the viral AlkB domain may be involved in protecting the virus against the post-transcriptional gene silencing (PTGS) system of the host . PTGS isic virus . Althougic virus . This RN and DNA . Both RNAs shown here, only a subset of plant viruses have the AlkB domain. However, other viruses may be utilising naturally occurring AlkB proteins in the host. Viruses have to rely on a number of host proteins in order to replicate . In someFlexiviridae. However, the source of these viruses points at another common feature. As seen from the table given in However, there is an alternative hypothesis with respect to the AlkB integration that also has to be considered. As discussed above, the AlkB domain seems to have been integrated relatively recently in viruses found at very different geographical locations, and the only obvious connection seems to be that most viruses belong to a subset of the It could be argued that a more active PTGS system in these plants would give a similar effect. However, in that case we would expect to see more ancient integrations of AlkB domains. It could also be argued that the presence of AlkB domains may be an artefact caused by promiscuous viral domains picking up available mRNA sequences during cultivation of viruses in the laboratory. However, given the large number of different laboratories involved, and the number of different hosts used (data not shown), this seems to be a very unlikely explanation.The hypothesis that environmental compounds, in particular pesticides, may have provoked the integration of AlkB domains into the viral genomes depends upon a high mutation rate and frequent integrations of non-viral domains. The integrations have to be recent, not only in relative terms, compared to other domains in the same genome, but also in absolute terms, compared to the progress of modern agriculture. The integrations also have to be frequent, in the sense that it is likely that integration could have happened several times, in different biotopes.-3 substitutions per site per year [-3 non-synonymous substitutions per site per year, which is considered to be a "moderate" ssRNA mutation rate [-3. In that case, the MT, HEL and RdRp trees shown in Ampelovirus sequences have not been included, as they seem to have diverged from the remaining AlkB-containing viruses at a much earlier stage. If we believe that the AlkB integrations happened after the divergence of most sequence included here, as indicated by the lack of co-evolution in Figure It is difficult to estimate mutation rates in RNA viruses. They evolve very rapidly, and it is often difficult to assign reliable phylogenies. However, recent studies indicate that most ssRNA viruses have a mutation rate close to 10per year , e.g. thion rate . If we aPestivirus may be relevant in this context. There are two biotopes of the pestiviruses, cytopathogenic (cp) and noncytopatogenic (noncp). The host is infected by the noncp form which is converted into the cp form by integration of a fragment of a cellular gene into the viral genome [Although it is generally accepted that viruses frequently use recombination to acquire functionality , it is ll genome . This inl genome , althougl genome . Integral genome . This shde novo integration vs. recombination can be achieved by a closer investigation of the other variable domains, e.g. by looking at how they correlate with the evolution of the AlkB domains.This study has focused on the AlkB domain, mainly as an attempt to get a better understanding of potential functions associated with this domain. However, it is likely that additional information about integration patterns and the relative importance of We believe that the viral AlkB-like domains are conventional repair domains targeted towards the viral RNA. The integration of AlkB domains into viral genomes may have been provoked by environmental methylating agents, e.g. the introduction of DNA/RNA-methylating pesticides in farming. The hypothesis that theFlexiviridae and Tymoviridae was generated from a ClustalX alignment, using hmmbuild and hmmcalibrate from the HMMER package. Visualisation of motif positions in viral sequences was generated directly from the HMMER output files using a local tool as an interface to the GNU [The NCBI nr protein sequence database was searched with PSI-Blast , with th the GNU groff so the GNU . Dot plo the GNU .MT – Methyl transferase; HEL – Helicase; RdRp – RNA-dependent RNA polymerase; ssRNA – Single-stranded RNA; PTGS – Post-transcriptional gene silencing; 2OG – 2-oxoglutarate; (h)ABH – (human) AlkB homologue; OTU – Ovarian tumour-like protein; NJ – Neighbour-joining; ML – Maximum likelihood; SJA – Strict joint assertions.MSB carried out all PSI-Blast searches, generated local (sub)sequence databases, and drafted the initial manuscript. FD conceived the study, carried out HMMER/Pfam searches, and estimated evolutionary distances. Both authors participated on sequence alignment, phylogenetic analysis and writing of the manuscript. Both authors have read and approved the final manuscript.Full listing (with GI numbers) of viral sequences and domains included in the analysis.Click here for fileIndividual NJ and ML trees for relevant domains .Click here for file

The dynamics of nuclear organization, nuclear bodies and RNPs in particular has been the focus of many studies. To understand their function, knowledge of their spatial nuclear position and temporal translocation is essential. Typically, such studies generate a wealth of data that require novel methods in image analysis and computational tools to quantitatively track particle movement on the background of moving cells and shape changing nuclei.We developed a novel 4-D image processing platform (TIKAL) for the work with laser scanning and wide field microscopes. TIKAL provides a registration software for correcting global movements and local deformations of cells as well as 2-D and 3-D tracking software. With this new tool, we studied the dynamics of two different types of nuclear particles, namely nuclear bodies made from GFP-NLS-vimentin and microinjected 0.1 μm – wide polystyrene beads, by live cell time-lapse microscopy combined with single particle tracking and mobility analysis. We now provide a tool for the automatic 3-D analysis of particle movement in parallel with the acquisition of chromatin density data.Kinetic analysis revealed 4 modes of movement: confined obstructed, normal diffusion and directed motion. Particle tracking on the background of stained chromatin revealed that particle movement is directly related to local reorganization of chromatin. Further a direct comparison of particle movement in the nucleoplasm and the cytoplasm exhibited an entirely different kinetic behaviour of vimentin particles in both compartments.The kinetics of nuclear particles were slightly affected by depletion of ATP and significantly disturbed by disruption of actin and microtubule networks. Moreover, the hydration state of the nucleus had a strong impact on the mobility of nuclear bodies since both normal diffusion and directed motion were entirely abolished when cells were challenged with 0.6 M sorbitol. This effect correlated with the compaction of chromatin. We conclude that alteration in chromatin density directly influences the mobility of protein assemblies within the nucleus. Interphase nuclei are structurally highly organized with chromosomes restricted to defined territories. The movKinetic analysis of nuclear bodies requires spatio-temporal microscopic imaging of live cells generating a huge amount of data that is only difficult or impossible to analyze in a standardized way without computational support. The present developments of an Open Microscopy Environment (OME) aims at providing a standardized informatics solution for the storage, management and analysis of light microscopic image data . For quaIn the present study we describe a combined computational and experimental approach to study the dynamic behaviour of nuclear body-like particles formed by GFP-NLS-vimentin in respoXenopus laevis GFP-NLS-vimentin and synthetic particles (polystyrene microspheres) within the nucleoplasm. GFP-NLS-vimentin is deposited at 37°C within the nucleus of stably transfected SW13 cells in multiple discrete bodies (8 – 40). On average the cells contain bodies that are nearly 1 μm in diameter as observed in the light microscope . Additionally, the artificial microspheres have to undergo tedious processing steps such as sonification and centrifugation prior to injection to avoid the formation of aggregates.For the analysis of complex data derived from spatio-temporal imaging of trafficking particles we developed a proprietary image processing platform, TIKAL (see Methods). The platform allows to directly and easily handle complex microscopic data and to dynamically interact with the data set throughout the whole quantitative data analysis steps. The image processing pipeline is initiated by image pre-processing steps including noise reduction followed by object segmentation (for details see Methods).In many cases, cells move and also change their morphology during the observation period. Global movements include translocation and rotation, whereas morphological changes are either caused by global changes in size (affine transformation) or by local deformations. Since any of these transformations overlay the actual movement of nuclear particles within the cell, we corrected for them by rigid transformations (translocation and rotation), affine transformations and by thin-plate spline models Figure , Table 1In summary kinetic changes were most prominent for the directed motion mode. ATP depletion decreased directed motion about 30 % relative to the control group. Treatments with cytochalasin D and nocodazole even showed a 70 % decrease in directed motion relative to the control group. The most striking effect was encountered by treating the cells with sorbitol. Simple diffusion and directed motion were totally abolished whereas the number of particles exhibiting confined diffusion increased by a factor of 7 relative to the control group.In this study we developed comprehensive bioinformatics tools to analyze the kinetic behaviour of small particles in the cell nucleus. For this purpose, fast time-lapse confocal laser scanning microscopy was used to record fluorescent particles in their chromatin environment. Automated image processing algorithms such as image registration and single particle tracking were instrumental to analyze the resulting complex data sets in a most efficient way. Usually, sophisticated image processing methods are widely not accessible for cell biology laboratories working with multi-dimensional data sets. A qualitative, interactive analysis of complex processes in living cells can yield interesting results. However, a quantitative insight into the underlying mechanisms can only be achieved by a rigorous computational analysis. While computational systems have been provided for estimating diffusion and binding constants based on photobleaching experiments of populations of small proteins ,31-33, iWe visualized the different kinetic behaviours of nucleus-injected 100 nm polystyrene microspheres. Furthermore, a stably transfected cell line expressing GFP-NLS-vimentin, which forms nuclear particles in the same size range as microspheres, was used. The majority of nuclear particles moved with obstructed diffusion within distinct corralled regions. This kind of movement was essentially found also for microinjected polystyrene beads. The obstructed diffusion behaviour supports the notion that these particles can diffuse within corrals restricted by dense chromatin regions. Upon chromatin remodelling distinct less dense chromatin regions are formed and enable the particle to move to an adjacent corralled region. We were able to quantitatively assess this phenomenon by measuring the chromatin intensity around an individual particle. Our data show that chromatin intensity decreases prior to a global velocity increase of the particle. Therefore we conclude that the particles do not actively push their way through the chromatin. Moreover, the chromatin itself is able to support or induce the movement of individual particles. The ability of the particle to move from one corral to the next is restricted and regulated by the surrounding chromatin remodelling activities. However, whether local chromatin regions can actively influence the destination of small nuclear particle movement has to be resolved in future investigations. With the present assay we cannot discern whether changes in the velocity of a body simply correlate with the entry of a body into a domain or whether the changes are caused by interaction between a body and the surrounding chromatin domain surfaces.The addition of cellular inhibitors caused significant changes in the diffusional behaviour of nuclear particles. In all treatments a reduction of active transport processes were observed. This suggests that the coordination of nuclear processes such as chromatin remodelling is not solely dependent on single factors such as ATP, i.e. ATP consuming enzymes. Moreover, chromatin regions in interphase nuclei apparently move in a diffusional way , while oThe phenomenon of energy dependent nuclear body movement has been also described in other studies where an anomalous diffusion behaviour and an ATP- and transcription-dependent association of Cajal bodies with chromatin was reported . FurtherA further interesting observation was the reversible formation of chromatin dense regions upon energy depletion. The general effect of this reorganization seems to influence the mobility distribution pattern of the particles only slightly. However, we could observe a significant decrease in directed motion of up to 30 % upon inhibition of energy-depended processes.Furthermore, in order to evaluate the degree of nuclear particle movement with respect to cytoplasmic dynamics, we used the vimentin system to analyze cytoplasmic particle mobility. Mostly active transport processes were observed. Two possible explanations for this phenomenon are suitable. Vimentin, which belongs to the group of intermediate filaments, forms crossbridges to other cellular structures. Since the SW13 cells lack endogenous expression of intermediate filament proteins such as cytokeratins and vimentin, possible interactions with these cytoplasmic intermediate filaments can be omitted. Specific interactions with dynein have been described ,38. HencFrom our data we conclude that the NLS-vimentin system is very suitable for further studies of nuclear architecture. Though we obtained the same results with microinjection assays, the GFP-NLS-vimentin system has significant advantages such as the higher expression efficiency and the fact that the experiments can be performed in a cell system with normal proliferation characteristics.We presented a novel image analysis platform TIKAL that for the first time allows the 4-D tracking of nuclear particles on the background of moving and shape changing objects. TIKAL is complementary to other software systems designed for diffusion studies based on photobleaching experiments. Applying TIKAL we were able to analyze the dynamics of nuclear bodies under various different conditions and thus demonstrated that local chromatin remodelling accounts to a large extent for changes in the dynamics of individual nuclear bodies.Xenopus laevi GFP-NLS-vimentin expression plasmid has been described previously 2> and plotted as <sion (α) ,26 was d). The program consists of a graphical user interface for easy access of the underlying algorithms. The software is written in C/C++ and can be deployed both on Linux and Windows systems. The main components of the program are separated into several main modules, namely a filter, registration, tracking, visualization and data handling module. The filter module contains 2-D and 3-D image processing algorithms such as gamma correction, median, gaussian, anisotropic diffusion filters [TIKAL is an in-house developed platform for multi – purpose image processing . With this platform he was able to perform data analysis and data evaluation. Further, microinjection of cells and nuclei and their respective imaging was carried out by CPB. In additions he assisted MR with imaging and cell culture of the vimentin transfected SW13 cells.MR performed the transfection, culturing, imaging and inhibitor treatment of SW13 cells. Additionally she contributed to the interactive 4-D tracking analysis. CA was involved in planning of this study at an earlier stage. HH supervised the experimental part, whereas RE was responsible for the entire setup and planning of the computational part of this study.

We have solved the three-dimensional crystal structure of the stem-loop II motif (s2m) RNA element of the SARS virus genome to 2.7-Å resolution. SARS and related coronaviruses and astroviruses all possess a motif at the 3′ end of their RNA genomes, called the s2m, whose pathogenic importance is inferred from its rigorous sequence conservation in an otherwise rapidly mutable RNA genome. We find that this extreme conservation is clearly explained by the requirement to form a highly structured RNA whose unique tertiary structure includes a sharp 90° kink of the helix axis and several novel longer-range tertiary interactions. The tertiary base interactions create a tunnel that runs perpendicular to the main helical axis whose interior is negatively charged and binds two magnesium ions. These unusual features likely form interaction surfaces with conserved host cell components or other reactive sites required for virus function. Based on its conservation in viral pathogen genomes and its absence in the human genome, we suggest that these unusual structural features in the s2m RNA element are attractive targets for the design of anti-viral therapeutic agents. Structural genomics has sought to deduce protein function based on three-dimensional homology. Here we have extended this approach to RNA by proposing potential functions for a rigorously conserved set of RNA tertiary structural interactions that occur within the SARS RNA genome itself. Based on tertiary structural comparisons, we propose the s2m RNA binds one or more proteins possessing an oligomer-binding-like fold, and we suggest a possible mechanism for SARS viral RNA hijacking of host protein synthesis, both based upon observed s2m RNA macromolecular mimicry of a relevant ribosomal RNA fold. The SARS RNA genome contains a unique structure that resembles a portion of ribosomal RNA; this may allow the virus to hijack its hosts protein synthesis machinery The virus that causes SARS, like other pathogenic coronaviruses and astroviruses, possesses a linear plus-sense strand RNA genome that has a 5′ methylated cap and 3′ poly-A tail. The viral replicase is translated directly from the genomic sense-strand RNA, and it then creates a full-length complementary (minus-sense strand) copy of the genomic RNA, as well as a nested set of shorter, subgenomic mRNAs having common 3′ UTRs. These 3′ UTRs all share with the genomic SARS RNA a 32-nucleotide element, immediately upstream of the 3′ poly-A tail 2+ ions in the native structure (see cis-[(NH3)2Cl2Pt(IV)]2+ and [Ru(NH3)6]3+ metal complexes that were introduced for heavy atom isomorphous replacement phasing. These highly structured and rigorously conserved features allow us to suggest that SARS pathogenesis might be inhibited by a drug designed to bind to s2m and disrupt one of these structures.G(11), A(12), and A(33), despite their extrusion from the helical base-pair stack, form a well-defined structure that is highly ordered, judging by electron density in the initial map as well as the comparatively low temperature factors these residues have in the refined structure. They conspire with the remaining residues in the asymmetric bubble and the helical region above it to form a rather wide tunnel whose channel runs approximately perpendicular to the main helical axis. The phosphates of G(11) and A(12) are turned inward, creating a negatively charged environment within the tunnel cavity. Consequently, the tunnel forms a binding site for two [Mg modification patterns A of the The intricate three-dimensional structure of the SARS s2m RNA, along with its rigorous sequence conservation, is compelling prima facie evidence for its biological importance in coronaviruses and astroviruses. The structure by itself, however, does not indicate what the function of this motif must be. Hence, comparison of this unique fold with those of known RNA structures is of particular value for formulating testable hypotheses regarding potential biological functions of the s2m RNA. In addition, identification of novel and rigorously conserved tertiary structures that are unique to the viral RNA is of critical importance for future rational design of anti-viral therapeutic agents that specifically target SARS and other coronaviruses and astroviruses.The s2m RNA sequence we crystallized was originally identified from the genomic sense strand within a rigorously conserved region of the 3′ UTR of the RNA. However, because RNA replication and transcription take place via a full-length negative-strand RNA intermediate, it is formally possible that the conserved sequence instead corresponds to a conserved structure at the 5′ end of the anti-sense RNA. We believe this to be improbable because of the energetically unfavorable tertiary structures that would be required to form from the sequence complement. For example, the variant of the energetically stable and rather common GNRA loop structure (GAGUA) would have to be replaced with an energetically unstable and rare CUCAU loop. Similar arguments apply to the other non-Watson–Crick regions of the structure.Crystal packing interactions may potentially distort RNA structures. This effect is sometimes observed for small stem-loop sequences, which often crystallize as duplex dimers rather than as monomeric hairpins. The s2m RNA structure is sufficiently large, and apparently contains enough stabilizing secondary and tertiary interactions, to offset any energetic advantage that might come from crystallizing as a duplex. In addition, the 73% solvent content of the s2m RNA crystals ensures that most of the crystallized RNA is solvent-exposed, rather than involved in extensive packing interactions. At least three inter-molecular contacts are required to form a crystal. The most extensive contact is the base of residue G(11); it stacks upon that of its 2-fold symmetry mate C. It is Crystallographic temperature factors provide direct physical evidence for the relative flexibility or mobility of various regions of a macromolecule. Therefore, based on our chemical probing data, analysis of crystal packing interactions, and consideration of the crystallographic temperature factors, along with the ability to rationalize the sequence conservation pattern and intolerance for nucleotide insertions or deletions based on the structure, we conclude that the crystal structure of s2m is likely to be a close representation of the structure that forms in solution and in the context of the SARS virus RNA genome.Escherichia coli and Thermus thermophilus. However, if we relax the sequence constraints and focus attention upon the conformation of the RNA backbone, we find that the phosphodiester backbone fold accompanying the 90° kink in s2m RNA mimics that found in the 530 stem-loop of 16S ribosomal RNA [The several unique features and unanticipated tertiary contacts we identified in the SARS s2m RNA crystal structure allowed us to reexamine genomic sequences and previously determined RNA tertiary structures for similar motifs with additional constraints imposed by knowledge of the tertiary structure. Our analysis of the human genome, other animal and viral genomes, and the currently available database of RNA three-dimensional structures revealed that the s2m element is found only in astroviruses and coronaviruses; no cellular homologs are immediately apparent. The G(11) to A(33) tertiary contact in the s2m RNA is homologous to the G to A contact in Domain III of the 23S ribosomal RNA, but the context of the interaction in the ribosome is completely different, and the sequence is not conserved between omal RNA , 100 mM Mg(OAc)2, and 20% MPD. Data from a native crystal diffracting to 2.7-Å resolution, and 3.0-Å cis-(NH3)2(Cl)2Pt(IV)–derivative single-wavelength anomalous dispersion data, were collected at Beamline 9.1 at Stanford Synchrotron Radiation Laboratory on a 3 × 3 CCD detector using 0.98-Å wavelength X rays and crystals that were cryoprotected in the reservoir solution spiked with 12% glycerol and maintained at 100 K. The native and platinum derivative data were processed using CCP4's MOSFLM and reduced and scaled within CCP4 version 5.0 [122 but was unambiguous in P6522, permitting the hand of the space group to be determined. A 47-nucleotide poly-C model was built into the SIRAS map using O, the actual nucleotide-sequence register was then confirmed by inspecting the electron density, and residues 1–47 were built in using O [Crystals of a 48-nucleotide T7 RNA transcript containing the conserved s2m RNA element were obtained via hanging-drop vapor diffusion by equilibrating a solution containing equal volumes of the RNA sample and the reservoir solution against 1-ml of the reservoir solution. The RNA sample solution contained 4.5 mg/ml s2m RNA dissolved in 30 mM Tris (pH 7.6), 100 mM NaCl, and 60 mM MgClsion 5.0 ,33. A sision 5.0 . The ini using O . The pho using O , and the using O . All cry using O ,39 and b using O , and wer using O and RNAB using O ,43. Tran using O . Primer using O using a http://www.rcsb.org/pdb/) under accession number 1XJR and are also available with other supplementary materials at http://www.chemistry.ucsc.edu/%7Ewgscott/sars.Coordinates, native and derivative amplitudes, and experimental phases have been deposited in the RCSB Protein Data Bank (The RCSB Protein Data Bank accession number for the SARS s2m RNA structure reported here is 1XJR. The RCSB Protein Data Bank accession numbers for the other protein and RNA structures discussed in this paper are as follows: the 30S ribosome (1J5E), the 30S ribosome in which prokaryotic IF-1 has been added (1HR0), the eukaryotic analog of prokaryotic IF-1 (1D7Q), and the crystal structure of nsp9 (1QZ8 and 1UW7).

Clusters or runs of purines on the mRNA synonymous strand have been found in many different organisms including orthopoxviruses. The purine bias that is exhibited by these clusters can be observed using a purine skew and in the case of poxviruses, these skews can be used to help determine the coding strand of a particular segment of the genome. Combined with previous findings that minor ORFs have lower than average aspartate and glutamate composition and higher than average serine composition, purine content can be used to predict the likelihood of a poxvirus ORF being a "real gene".Using purine skews and a "quality" measure designed to incorporate previous findings about minor ORFs, we have found that in our training case (vaccinia virus strain Copenhagen), 59 of 65 minor ORFs were correctly classified as being minor. Of the 201 major vaccinia ORFs, 192 were correctly classified as being major. Performing a similar analysis with the entomopoxvirus amsacta moorei (AMEV), it was found that 4 major ORFs were incorrectly classified as minor and 9 minor ORFs were incorrectly classified as major. The purine abundance observed for major ORFs in vaccinia virus was found to stem primarily from the first codon position with both the second and third codon positions containing roughly equal amounts of purines and pyrimidines.Purine skews and a "quality" measure can be used to predict functional ORFs and purine skews in particular can be used to determine which of two overlapping ORFs is most likely to be the real gene if neither of the two ORFs has orthologs in other poxviruses. In poxviruses, predicting which ORFs are likely to be expressed (genes) without the use of biochemical analysis usually involves simply choosing a minimum ORF length cut-off and excluding all ORFs that are smaller than the cut-off. Analysis may be extended to include manual inspection of each predicted ORF for the presence of promoter consensus sequences. Excluding ORFs that are smaller in size than the cut-off, however, risks missing genes that are unusually short; during annotation of vaccinia virus strain Copenhagen (VACV-COP) at least three recently verified genes (ranging from 162 bp – 231 bp) were not included in the initial annotation of the complete genome; these genes, VACV-COP A2.5L and G5.5Poxvirus genes are transcribed from both DNA strands and so far have never been shown to overlap more than a few nucleotides. Despite this knowledge, some poxvirus genomes have been liberally annotated so as to include all ORFs above a certain size, irrespective of whether they overlap larger well-characterized genes. Thus, the current GenBank file for VACV-COP contains 202 major ORFs and 64 minor ORFs ,11. The In this paper, it is shown that for the AT rich poxviruses, the purine skews can be used to help predict the synonymous (coding) strand, particularly in regions where smaller ORFs overlap each other on opposite strands of the genome and neither have orthologs in other poxvirus genomes. Furthermore, it is shown that the majority of minor ORFs found in VACV-COP are unlikely to be functional genes and that based on purine content, two of the three genes initially excluded from the annotation of the vaccinia virus genome due to their small size, fit our definition of a major ORF.Figure When the purine skew Figure slopes iIt was previously shown that minor ORFs in VACV-COP tend to have higher than average serine content as well as lower than average aspartate and glutamate content . Based oPlotting the results of this equation, we found that of the 266 ORFs originally predicted in VACV-COP, 6 ORFs were incorrectly classified as being major and 9 ORFs were incorrectly classified as being minor.It was found that the majority of incorrectly classified major ORFs were misclassified because they are small membrane proteins that had a lower aspartate and glutamate content than other major ORFs and that the majority of incorrectly classified minor ORFs were misclassified because they have a lower serine and higher purine percentage compared to other minor ORFs despite the fact that all but one minor ORF (VACV-COP A ORF T) overlap a major ORF on the opposite strand Table . There wA similar analysis was repeated for the genome of amsacta moorei (AMEV), an extremely AT-rich (82%) entomopoxvirus . The AMEIt was found that there were 51 ORFs that had a positive "quality" value and are therefore considered minor. Of these 51 ORFs, 41 ORFs further fit our definition of a minor ORF as they overlapped another larger ORF on the opposite strand and 4 major ORFs were incorrectly classified as minor even though they each have orthologs in other poxviruses and are therefore major Table . The remThere were three ORFs that had been classified as major yet overlapped a larger gene on the opposite or same DNA strand Table . Two of For the analyses shown in figures Thus far we have shown that purine skews can be used to predict the coding strand of poxvirus genomes and that major ORFs in VACV-COP and in AMEV usually contain greater than 50% and 49% purines, respectively. In order to explain this purine richness in genes, the purine (R) to pyrimidine (Y) ratio (R:Y) was calculated for each codon position of each coding and non-coding ORF in VACV-COP. A Student's T-test was used to compare the mean R/Y ratio values for the coding (genes) and non-coding ORFs at each codon position; means were considered statistically different when the p-value was less than 0.05. At the first nucleotide position in the codon, both VACV-COP major and minor ORFs are rich in purines but the major ORFs (genes) have significantly (p < 0.05) higher levels of purines at this position . A second method that can be used in conjunction with purine skews is to calculate the "quality" of each predicted ORF using information from amino acid composition and purine content. For a given ORF, if the results of this calculation are negative the ORF is predicted to be a functional gene, and if the results of the calculation are positive, the ORF is predicted to be minor.By comparing purine to pyrimidine (R/Y) ratios at each codon position of major and minor vaccinia virus ORFs, it was found that the purine abundance seen for major ORFs stems primarily from the first codon position with both the second and third codon positions containing equal amounts of purines and pyrimidines.The software used to create the purine skews (DNAGrapher) and the VOCs database are both available for public use via the web ,15.Purine skews were created using the DNA Grapher feature in VOCs . The DNAThe 202 major ORFs (genes) of VACV-COP were ordered in ascending order according to their start positions on the genome and then plotted according to which strand they are located using Microsoft Excel. The first gene was plotted at position 0 of the y-axis of the graph and a value of either -1 or +1 was added to the next gene on the genome depending on if it was on the bottom or top strand respectively.The analysis of VACV-COP ORFs was performed by plotting the results of the following equation: Ser%-Asp%-Glu%+(50%-AG%) where Ser% is serine percentage, Asp% is aspartate percentage, Glu% is glutamate percentage, AG% is purine percentage and the value of 50% is the average purine content of the VACV-COP genome. The "quality measure" for AMEV ORFs used the following formula: Ser%-Asp%-Glu%+49%-AG%) where the only modification of this formula from VACV-COP was the value of 49% which reflects the average purine content of the AMEV genome. The amino acid composition and purine data was obtained from the VOCs database which is available on the internet as a Java Web Start program %-AG% whe.The results of the equation for each ORF were tabulated, sorted in ascending order and assigned a rank from 1 being the ORF with the most negative value to either 266 in the case of VACV-COP or 292 in the case of AMEV being the ORF with the most positive value. These results of the calculation were plotted on the y-axis and the rank of each ORF was plotted on the x-axis using Microsoft Excel.To analyse the ratio of purines to pyrimidines at each codon position, the total number of each nucleotide at each codon position was first calculated using the codontree program with the BC=A option selected ,18. OnceMD performed all analyses and wrote the manuscript. CU conceived of, and supervised the study, and edited the manuscript.

There is a need for a clear statement of what Evidence-Based Practice (EBP) means, a description of the skills required to practise in an evidence-based manner and a curriculum that outlines the minimum requirements for training health professionals in EBP. This consensus statement is based on current literature and incorporating the experience of delegates attending the 2003 Conference of Evidence-Based Health Care Teachers and Developers ("Signposting the future of EBHC").A variety of definitions of evidence-based practice (EBP) exist. However, definitions are in themselves insufficient to explain the underlying Evidence-Based Practice has evolved in both scope and definition. Evidence-Based Practice (EBP) requires that decisions about health care are based on the best available, current, valid and relevant evidence. These decisions should be made by those receiving care, informed by the tacit and explicit knowledge of those providing care, within the context of available resources.Health care professionals must be able to gain, assess, apply and integrate new knowledge and have the ability to adapt to changing circumstances throughout their professional life. Curricula to deliver these aptitudes need to be grounded in the five-step model of EBP, and informed by ongoing research. Core assessment tools for each of the steps should continue to be developed, validated, and made freely available.All health care professionals need to understand the principles of EBP, recognise EBP in action, implement evidence-based policies, and have a critical attitude to their own practice and to evidence. Without these skills, professionals and organisations will find it difficult to provide 'best practice'. Willing is not enough, we must do" Health care delivered in ignorance of available research evidence, misses important opportunities to benefit patients and may cause significant harm -4. Proviprocesses of EBP and to differentiate between an evidence-based process and evidence-based outcome.A variety of definitions of evidence-based practice (EBP) have been proposed. However, definitions are in themselves insufficient to explain the underlying Towards this goal, we propose three points to clarify and promote the realisation of EBP:1) A clear statement of what EBP means.2) A description of the minimum skill set required to practise in an evidence-based way.3) A curriculum that outlines the minimum standard educational requirements for training health professionals in EBP.This statement was conceived by the delegates of the second international conference of Evidence-Based Health Care Teachers and Developers held in Sicily in September 2003 . In resDuring the last century there has been an exponential growth of research and knowledge ,14. The With this expansion of information, our knowledge should be greater and our practice should be more effective. Unfortunately this is too often not the case . This resome of the uncertainties in this decision process by using the explicit knowledge obtainable from research information. But to do so the research information must be transformed into clinicians' knowledge. Information can be defined as data that has been sorted, analysed, & displayed and communicated through language, graphic displays, or numeric tables. Explicit knowledge is then the meaning people create using this information and its application through action in specific settings [Good practice including effective clinical decision making – step 4 of the EBP process – requires the explicit research evidence and non-research knowledge (tacit knowledge or accumulated wisdom). Clinical decision making is the end point of a process that includes clinical reasoning, problem solving, and awareness of patient and health care context . This prsettings . For exaThe term "Evidence-based medicine" was introduced in the medical literature in 1991 . An origEBP evolved from the application of clinical epidemiology and critical appraisal to explicit decision making within the clinician's daily practice, but this was only one part of the larger process of integration of evidence into practice. Initially there was a paucity of tools and programmes to help health professionals learn evidence-based practice. In response to this need, workshops based on those founded at McMaster by Sackett, Haynes, Guyatt and colleagues were set up around the world. During this period several textbooks on EBP were published accompanied by the development of on-line supportive materials.all knowledge gaps led to early recognition of practical limitations and disenfranchisement amongst some practitioners [Clinical Evidence [The initial focus on critical appraisal led to debate on the practicality of the use of evidence within patient care. In particular, the unrealistic expectation that evidence should be tracked down and critically appraised for itioners . The groitioners . In respitioners , the eviEvidence and secoEvidence have beeEvidence , though The five steps of EBP were first described in 1992 and most1. Translation of uncertainty to an answerable question 2. Systematic retrieval of best evidence available 3. Critical appraisal of evidence for validity, clinical relevance, and applicability 4. Application of results in practice 5. Evaluation of performance This five-step model forms the basis for both clinical practice and teaching EBP, for as Rosenberg and Donald observed, "an immediate attraction of evidence-based medicine is that it integrates medical education with clinical practice" .Different practitioners at different levels of responsibility within evidence-based organisations will require different skills for EBP and different types of evidence. It is a minimum requirement that all practitioners understand the principles of EBP, implement evidence-based policies, and have a critical attitude to their own practice and to evidence. Without these skills and attitidues, health care professionals will find it difficult to provide 'best practice'. Teachers, commissioners, and those in positions of leadership will require appraisal skills that come with higher training and continued use .The wider knowledge and use of these skills will help health professionals meet some of Hurd's list of desired educational outcomes in being• distinguish evidence from propaganda (advertisement)• probability from certainty• data from assertions• rational belief from superstitions• science from folkloreEvidence-based practitioners need additional skills to supplement traditional knowledge. Health care graduates should "be able to gain, assess, apply and integrate new knowledge and have the ability to adapt to changing circumstances throughout their professional life" . Observaconscientious, explicit and judicious use of current best evidence in making decisions about the care of individual patients" [Learning has three components: knowledge, skills and attitudes. It is said that "attitudes are caught, not taught" . Attitudatients" . This pratients" and is aatients" where prThe curriculum framework for EBP should consider the importance of all steps shown in Table The term 'EBM' has evolved into a larger phenomenon, as increasing numbers of practitioners in various disciplines recognise the importance of evidence to inform all types of health care decisions. Furthermore, greater patient choice and complexity of care mean that many professionals practise as a team. In recognition of the importance of a united commitment to the principles of 'best practice', we propose that the term 'evidence-based practice' (EBP) be used to describe all aspects of this discipline.To ensure that future health care users can be assured of receiving 'best practice' regardless of the type or location of the care received, we make the following recommendations for education:1. The professions and their colleges should incorporate the necessary knowledge, skills and attitudes of EBP into their training and registration requirements.2. Curricula to deliver these competencies should be grounded in the "five-step model" Table .3. Further research into the most effective and efficient methods for teaching each step should be fostered, and linked with ongoing systematic reviews on each step.4. Core assessment tools for each of the steps should be developed, validated, and made freely available internationally.all components.5. Courses that claim to teach EBP should have effective methods for teaching and evaluating Evidence-Based Practice (EBP) requires that decisions about health care are based on the best available, current, valid and relevant evidence. These decisions should be made by those receiving care, informed by the tacit and explicit knowledge of those providing care, within the context of available resources.Finally, EBP requires a health care infrastructure committed to best practice, and able to provide full and rapid access to electronic databases at the point of care delivery. We believe that without the skills and resources for all the relevant components of this framework, the practice of a health care professional, or a health care organisation, cannot be said to provide their users with evidence-based care.1. This consensus statement is from an international working group representing both organisations and individual teachers and developers of evidence-based practice.2. Evidence-Based Practice (EBP) requires that decisions about health care are based on the best available, current, valid and relevant evidence. These decisions should be made by those receiving care, informed by the tacit and explicit knowledge of those providing care, within the context of available resources.3. All health care professionals need to understand the principles of EBP, recognise it in action, implement evidence-based policies, and have a critical attitude to their own practice and to evidence. Without these skills professionals will find it difficult to provide 'best practice'.4. The teaching of EBP should, as far as possible, be integrated into the clinical setting and routine care so that students not only learn the principles and skills, but learn how to incorporate these skills with their own life-long learning and patient care.All of the authors have received honoraria for teaching EBP FP is a consultant of Lilly Deutschland GmbH. The International Conferences of EBHC Teachers and Developers do not accept sponsorship from health technologies manufacturers.MD, WS & PG wrote the original draft. AC, JM, KH, FP, AB & JO contributed to the concept and all revised drafts of the statement.The pre-publication history for this paper can be accessed here:

Retinoids are recognized as important regulators of vertebrate development, cell differentiation, and tissue function. Previous studies, performed both in vivo and in vitro, indicate that retinoids influence several reproductive events, including follicular development, oocyte maturation and early embryonic development. The present study evaluated in vitro effects of retinol addition to media containing maturing bovine oocytes and developing embryos in both a low oxygen atmosphere (7%) and under atmospheric oxygen conditions (20%). In the first experiment, abbatoir collected bovine oocytes were matured in the presence or absence of varying concentrations of retinol. After a 22–24 hour maturation period the oocytes were fertilized, denuded 18 hours later and cultured in a modified synthetic oviductal fluid (mSOF) in a humidified atmosphere at 38.5 degrees C, 5% CO2, 7% O2 and 88% N2. Cleavage rates did not differ among control and retinol-treated oocytes in all three experiments. Addition of 5 micromolar retinol to the maturation medium (IVM) tended (p < 0.07) to increase blastocyst formation compared to the controls (21.9% +/- 1.9%). Further analysis revealed when blastocyst development rates fell below 20% in the control groups, 5 micromolar retinol treatment dramatically improved embryonic development, measured by blastocyst/putative zygote rate . The 5 micomolar retinol treatment also enhanced the blastocyst/cleaved rate by nearly 10% . In the second and third experiments addition of 5 micromolar retinol to the embryo culture medium (IVC) under low oxygen conditions did not significantly improve cleavage or blastocyst rates, but 5 micromolar retinol significantly increased blastocyst development under 20% O2 conditions (p < 0.001). These studies demonstrate that supplementation of 5 micromolar retinol to the maturation medium may improve embryonic development of bovine oocytes indicated by their increased blastocyst rate. A significant improvement in the blastocyst development with the 5 micromolar retinol treatment under atmospheric conditions suggests a beneficial antioxidant effect during embryo culture. Vitamin A is essential for reproduction, and deficiencies and excesses may result in embryonic loss and/or congenital defects . Retinoltrans and 9-cis retinoic acid (RA) are natural cellular metabolites of retinol and mediate biological activity through interaction with nuclear retinoic acid receptors (RAR) and retinoid X receptors (RXR), respectively. Ligand-bound RARs and RXRs influence transcription by interacting with response elements in the promoter regions of retinoid-regulated genes [Retinol is transported systemically and intercellularly bound to retinol-binding protein (RBP). Cellular retinol-binding proteins (CRBP) and cellular retinoic acid-binding proteins function in intracellular vitamin A transport, metabolism and homeostasis . All-traed genes . Within ed genes . Concented genes . RBP syned genes ,12.cis RA to in vitro oocyte maturation medium affects trophectoderm differentiation, total cell number and inner cell mass-trophoblast cell ratios, following fertilization in cattle oocytes [The cumulus oocyte complex (COC) may be a target for retinol, since the cells that nurture and communicate with the oocyte, contain transcripts and protein for several RARs and RXRs, RBP and retinaldehyde-2 dehydrogenase (RALDH-2) a metabolizing enzyme . Bovine oocytes ,16. TogeThe mechanism by which retinol or retinoic acid administration influences oocyte maturation and positively impacts early embryonic development is not known and is the subject of much investigation. Retinoic acid may influence oocyte maturation through its effects on FSH or LH receptor expression as demonstrated in porcine and rat 2 and reduced O2 conditions. Results suggest beneficial effects of retinol administration during maturation especially to less competent oocytes, and improved development of embryos cultured under atmospheric oxygen conditions, indicating protection from oxidative stress.In the present study, we investigated the effects of retinol administration to in vitro matured oocytes, and cultured bovine embryos under atmospheric O3, 12 mM HEPES, and supplemented with 2 mM glutamine, 2% fetal bovine serum , and penicillin/streptomycin . Oocyte maturation medium (OMM) consisted of bicarbonate buffered TCM-199 supplemented with 50 μg/mL of gentamycin, purchased from Specialty Media, 5 μg/mL of FSH purchased from Vetrepharm Canada, Inc. , 0.3 μg/mL of luteinizing hormone (LH) that was generously provided by the USDA, Beltsville, MD, 10% FBS, 0.2 μM sodium pyruvate and 2 mM glutamine. Modified Tyrode's Albumin Lactate Pyruvate (TALP) media used in sperm preparation (SP-TALP), removal of cumulus cells from oocytes (HEPES-TALP) and in vitro fertilization (IVF-TALP) were prepared as described by Parrish et al. [All chemicals were purchased from Sigma Chemical Company, St. Louis, MO unless otherwise noted. Bovine oocyte collection medium (OCM) was composed of modified M199, 4.2 mM NaHCOh et al. . In vitrh et al. supplemetrans retinol was dissolved in 100% ethanol, appropriate dilutions made, and aliquots were stored at -80°C until use. Retinol was prepared fresh each month and checked on a spectrophotometer for accuracy. The concentration of ethanol during maturation or culture was less than 0.1%.All-2, ambient air, and saturated humidity.Ovaries from mature, cycling cattle were obtained from an abbatoir and pooled. Cumulus oocyte complexes (COCs) were quickly harvested by slicing follicles (2–5 mm) with a sterile surgical blade, and collecting them in OCM. Intact COCs with homogeneous ooplasm and two or more layers of cumulus cells were selected, washed, and approximately 50 were transferred to 500 μl of pre-equilibrated OMM, and matured for 22–23 hours in a 38.5°C incubator with an atmosphere of 5.0% COg. The pellet was removed and resuspended in SP-TALP and centrifuged for 8 minutes at 460 g. After removal of the supernatant, the sperm sample was reconstituted in 500 μL of IVF-TALP for a final concentration of 1 × 106 spermatozoa/mL. The plate was incubated for 22 hours at 38.5°C in an atmosphere of 5.0% CO2 and ambient air with saturated humidity.Fertilization (Day 0) was performed with combined semen from two bulls of proven fertility prepared according to the method by Parrish and coworkers . Briefly2, 7% O2 and 88% N2 (first and second experiments) with saturated humidity. The mSOF medium was changed every 48 hours. Cleavage was assessed on Day 3 and blastocyst rate was calculated on Day 8.Approximately 18 hours after fertilization putative zygotes were denuded of cumulus cells by vortexing in 500 μl of HEPES-TALP for four minutes (Day 1). Putative zygotes (approximately 35–40) were cultured in 500 μL of mSOF for eight days in a 38.5°C incubator in an atmosphere of 5% COtrans retinol and embryos were allowed to develop under low oxygen conditions. In the second experiment all-trans retinol was added only to embryo culture medium on days 1, 3, 5, and 7, and the embryos developed in a low oxygen atmosphere. In the third experiment embryos were cultured under atmospheric oxygen conditions (air and 5% CO2) and all-trans retinol (0 or 5μM) was added to embryo culture medium on days 1, 3, 5, and 7.In the first experiment maturation medium alone was supplemented with all-Data were analyzed as an incomplete block design , or a randomized block design (experiment 4), blocked on plate using mixed model procedures of SAS . At leasIn the first experiment addition of 5μM retinol during IVM tended to improve (p < 0.07) embryonic development to the blastocyst stage, compared to controls Table . The conFurther analysis of the maturation data Table revealedFurther experiments were conducted during IVC under both low and atmospheric oxygen tensions. Under low oxygen conditions concentrations of 1, 2, and 5μM retinol were not statistically different from controls, and 10μM was deleterious Table . Prelimicis retinoic acid was shown to improve subsequent blastocyst development but high concentrations were detrimental [In the present study, over 3000 bovine oocytes were used to evaluate effects of retinol supplementation during IVM and IVC on embryonic development to the blastocyst stage. Retinol administration during the maturation period alone resulted in concentration-dependent effects. Whereas the presence of 1μM retinol had no effect on development, 5μM retinol tended to improve blastocyst rate of development, at the p < 0.07 level, compared to controls. At a concentration of 10μM, retinol did not significantly improve embryo development compared to controls. In preliminary studies, higher concentrations (100μM) were observed to be cytotoxic (data not shown). Similarly, exposure of bovine oocytes to low concentrations of 9-rimental .A more striking effect on embryonic development (p < 0.02) was observed by supplementation of 5 μM retinol to groups of oocytes with reduced developmental competence in which development of control oocytes to blastocyst was less than 20%. These results indicate that retinol supplementation during maturation may not benefit oocytes competent to progress, but rather, it improves the viability of oocytes that are developmentally challenged. In support of this, we have shown previously that retinol supplementation during maturation improves developmental competence of bovine oocytes compromised by heat stress .Since most transcription in the oocyte occurs prior to maturation during preovulatory development, in vitro culture deprives oocytes of much of this activity. Meiotic inhibitors have been used as a potential means of investigating regulation of oocyte transcription and mRNA processing in vitro . Treatme2 (air and 5% CO2) but not in an atmosphere of low O2 . The present study, and all previous in vitro studies demonstrating a positive effect of retinoid administered during maturation, were performed in an atmosphere of approximately 20% O2 [Retinol supplementation of embryo culture medium dramatically improved development to the blastocyst stage (p < 0.001) when cultured in an atmosphere of approximately 20% Oy 20% O2 ,16,34, ay 20% O2 .2 has been demonstrated to be beneficial to in vitro survival of embryos from a variety of species [Mammalian cells, including the oocyte and those of the early embryo, have evolved several mechanisms to protect against ROS damage and maintain appropriate balances in REDOX reactions. Antioxidants present in the oocyte, embryo and/or its environment include vitamins A (retinol), C and E, pyruvate, glutathione (GSH), hypotaurine, taurine, and cysteamine . Antioxi species .Retinoids participate in a biological antioxidant network, and have been implicated as important regulators of redox signaling pathways ,24. CaroRetinoids may also protect against oxidative damage by maintaining adequate endogenous levels of antioxidant compounds and enzymes. Glutathione is the major non-protein sulphydryl compound found in mammalian cells responsible for strong basal ROS scavenging activity . MaintenResults from the present study indicate that retinol administration during in vitro maturation particularly improved embryonic development in those oocytes that may have been developmentally compromised. Moreover, retinol addition during in vitro culture, under atmospheric conditions, also improved embryonic development compared to those embryos incubated in a 7% oxygen atmosphere. The mechanisms by which retinoids affect the developmental capacity of oocytes and early embryos may include modulation of expression of growth factors and other developmental genes, improving mRNA quality, and direct and/or indirect affects on antioxidant defense mechanisms.TL Performed the experiments under low oxygen conditions, helped to coordinate experiments, and drafted the manuscript.DE Performed the experiments under high oxygen conditions and helped to coordinate experiments.JE Coordinated and assisted in the experimental design.JG Conceived of and coordinated the experiments and drafted the manuscript.

A computationally efficient statistical framework for estimating networks of coexpressed genes is presented that exploits first-order conditional independence relationships among gene expression measurements. Saccharomyces cerevisiae. We demonstrate the biological utility of this approach by showing that a large number of metabolic pathways are coherently represented in the estimated network. We describe a complementary unsupervised graph search algorithm for discovering locally distinct subgraphs of a large weighted graph. We apply this algorithm to our coexpression network model and show that subgraphs found using this approach correspond to particular biological processes or contain representatives of distinct gene families.We describe a computationally efficient statistical framework for estimating networks of coexpressed genes. This framework exploits first-order conditional independence relationships among gene-expression measurements to estimate patterns of association. We use this approach to estimate a coexpression network from microarray gene-expression measurements from That is, the number of variables of interest is very large (thousands to tens of thousands of genes), yet we have relatively few observations upon which to base our inferences and interpretations. Recognizing this, many investigators studying quantitative genomic data have focused on the use of either classical multivariate techniques for dimensionality reduction and ordination or on various types of clustering techniques, such as hierarchical clustering , k-meansustering , self-orustering and othe [et al. ) can allG = {V,E}, composed of vertices and edges . We use the terms 'graph' and 'network' interchangeably throughout this paper. The advantage of network models over common clustering techniques is that they can represent more complex types of relationships among the variables or objects of interest. For example, in distinction to standard hierarchical clustering, in a network model any given gene can have an arbitrary number of 'neighbors' (that is n-ary relationships) allowing for a reasonable description of more complex inter-relationships.An alternate mode of representation that has been applied to the study of whole-genome datasets is network models. These are typically specified in terms of a graph, While network models seem to be a natural representation tool for describing complex biological interactions, they have a number of disadvantages. Analytical frameworks for estimating networks tend to be complex, and the computation of such models can be quite hard (NP-hard in many cases ). CompleTwo major classes of network-estimation techniques have been applied to gene-expression data. The simpler approach is based on the notion of estimating a network of interactions by defining an association threshold for the variables of interest; pairwise interactions that rise above the threshold value are considered significant and are represented by edges in the graph, interactions below this threshold are ignored. Measures of association that have been used in this context include Pearson's product-moment correlation and mutuO(n3). Therefore, the FOCI model is readily computable even for very large datasets.We have developed an analytical framework, called a first-order conditional independence (FOCI) model, that strikes a balance between these two categories of network estimation. Like graphical modeling techniques, we exploit information about conditional independence relationships - hence our method takes into account higher-order multivariate interactions. Our method differs from standard graphical models because rather than trying to account for conditional interactions of all orders, as in Gaussian graphical models, we focus solely on first-order conditional independence relationships. One advantage of limiting our analysis to first-order conditional interactions is that in doing so we avoid some of the problems of power that we encounter if we try to estimate very high-order conditional interactions. Thus this approach, with the appropriate caveats, can be applied to datasets with moderate sample sizes. A second reason for restricting our attention to first-order conditional relationships is computational complexity. The running time required to calculate conditional correlations increases at least exponentially as the order of interactions increases. The running time for calculating first-order interactions is worst case We demonstrate the biological utility of the FOCI network estimation framework by analyzing a genomic dataset representing microarray gene-expression measurements for approximately 5,000 yeast genes. The output of this analysis is a global network representation of coexpression patterns among genes. By comparing our network model with known metabolic pathways we show that many such pathways are well represented within our genomic network. We also describe an unsupervised algorithm for highlighting potentially interesting subgraphs of coexpression networks and we show that the majority of subgraphs extracted using this approach can be shown to correspond to known biological processes, molecular functions or gene families.We used the FOCI network model to estimate a coexpression network for 5,007 yeast open reading frames (ORFs). The data for this analysis are drawn from publicly available microarray measurements of gene expression under a variety of physiological conditions. The FOCI method assumes a linear model of association between variables and computes dependence and independence relationships for pairs of variables up to a first-order conditioning variable. More detailed descriptions of the data and the network estimation algorithm are provided in the Materials and methods section.On the basis of an edge-wise false-positive rate of 0.001 , the estimated network for the yeast expression data has 11,450 edges. It is possible for the FOCI network estimation procedure to yield disconnected subgraphs - that is, groups of genes that are related to each other but not connected to any other genes. However, the yeast coexpression network we estimated includes a single giant connected component with 4,686 vertices and 11,416 edges. The next largest connected component includes only four vertices; thus the GCC represents the relationships among the majority of the genes in the genome. In Figure The mean, median and modal values for vertex degree in the GCC are 4.87, 4 and 2 respectively. That is, each gene shows significant expression relationships to approximately five other genes on average, and the most common form of relationship is to two other genes. Most genes have five or fewer neighbors, but there is a small number of genes (349) with more than 10 neighbors in the FOCI network; the maximum degree in the graph is 28 Figure . Thus, aTo assess the biological relevance of our estimated coexpression network we compared the composition of 38 known metabolic pathways Table to our yp < 0.05; see Materials and methods). Most of the pathways of carbohydrate and amino-acid metabolism that we examined are coherently represented in the FOCI network. Of each of the major categories of metabolic pathways listed in Table We used a pathway query approach to examine 38 metabolic pathways relative to our FOCI network. For each pathway, we computed a quantity called the 'coherence value' that measures how well the pathway is recovered in a given network model . Of the 38 pathways tested, 19 have coherence values that are significant when compared to the distribution of random pathways of the same size , valine, leucine, and isoleucine biosynthesis (10 of 15 genes), methionine metabolism (6 of 13 genes), phenylalanine, tyrosine, and tryptophan metabolism (two subnetworks each of 6 genes). Several coherent subsets of the FOCI network generated by these pathway queries are illustrated in the Additional data file 1.In addition to being consistent with individual pathways, a useful network model should capture interactions between pathways. To explore this issue we queried the FOCI network on combined pathways and again measured its coherence. We illustrate one such combined query based on four related pathways involved in carbohydrate metabolism: glycolysis/gluconeogenesis, pyruvate metabolism, the TCA cycle and the glyoxylate cycle.ICL1 (encoding an isocitrate lyase) and ICL2 (a 2-methylisocitrate lyase).Figure PCK1, DAL7, MDH2, MLS1, ACS1, ACH1, LPD1, MDH1} and the other including {GLO1, GLO2, DLD1, CYB2}. This second set of genes encodes enzymes that participate in a branch of the pyruvate metabolism pathway that leads to the degradation of methylglyoxal -S-lactoyl-glutathione → D-lactaldehyde → D-lactate → pyruvate) [S-lactoyl-glutathione, methyglyoxal is condensed with glutathione [GRX1 (a neighbor of GLO2) and TTR1 (neighbor of CYB2), encode proteins with glutathione transferase activity.In this combined pathway query the TCA cycle, glycolysis/gluconeogenesis, and glyxoylate cycle are each represented primarily by a single two-step connected subgraph . Pyruvate metabolism on the other hand, is represented by at least two distinct subgraphs, one including {yruvate) ,13. In ttathione . InteresFBP1 in the combined query is also interesting. The product of FBP1 is fructose-1,6-bisphosphatase, an enzyme that catalyzes the conversion of beta-d-fructose 1,6-bisphosphate to beta-D-fructose 6-phosphate, a reaction associated with glycolysis. However, in our network it is most closely associated with genes assigned to pyruvate metabolism and the glyoxylate cycle. The neighbors of FBP1 in this query include ICL1, MLS1, SFC1, PCK1 and IDP3. With the exception of IDP3, the promoters of all of these genes (including FBP1) have at least one upstream activation sequence that can be classified as a carbon source-response element (CSRE), and that responds to the transcriptional activator Cat8p [FBP1 in the combined pathway query we find that ACS1, IDP2, SIP4, MDH2, ACH1 and YJL045w have all been shown to have either CSRE-like activation sequences and/or to be at least partially Cat8p dependent [et al. [The position of or Cat8p . This seor Cat8p . Consideependent . The ass [et al. , suggestet al. [YER053c as among the set of genes whose expression levels changed in TCA cycle mutants.The inclusion of a number of other genes in the carbohydrate metabolism subnetwork is consistent with independent evidence from the literature. For example, McCammon et al. identifiLSC1, PTR2, PAD1, OPT2, ARO10 and PSP1 has no clear known relationship.Although many of the associations among groups of genes revealed in these subgraphs can be interpreted either in terms of the query pathways used to construct them or with respect to related pathways, a number of association have no obvious biological interpretation. For example, the tail on the left of the graph in Figure vis-à-vis this prior knowledge. Conversely, one might want to find interesting and distinct subgraphs within the FOCI network without the injection of any prior knowledge and ask whether such subgraphs correspond to particular biological processes or functions. To address this second issue we developed an algorithm to compute 'locally distinct subgraphs' of the yeast FOCI coexpression network as detailed in the Materials and methods section. Briefly, this is an unsupervised graph-search algorithm that defines 'interestingness' in terms of local edge topology and the distribution of local edge weights on the graph. The goal of this algorithm is to find connected subgraphs whose edge-weight distribution is distinct from that of the edges that surround the subgraph; thus, these locally distinct subgraphs can be thought of as those vertices and associated edges that 'stand out' from the background of the larger graph as a whole.The analysis of metabolic pathways described above provides a test of the extent to which known pathways are represented in the FOCI graph. That is, we assumed some prior knowledge about network structure of subsets of genes and asked whether our estimated network is coherent p-values less than 10-5 . This indicates that most locally distinct subgraphs are highly enriched with respect to genes involved in particular biological processes or functions. Members of the 21 largest locally distinct subgraphs are highlighted in Figure We constrained the size of the subgraphs to be between seven and 150 genes, and used squared marginal correlation coefficients as the weighting function on the edges of the FOCI graph. We found 32 locally distinct subgraphs, containing a total of 830 genes ; ribosome biogenesis and assembly (subgraph C); response to stress and carbohydrate metabolism (subgraph K); and sporulation (subgraph N). Several of these subgraphs show very high specificity for genes with particular GO annotations. For example, in subgraphs A and B approximately 97% (32 out of 33) and 95.5% (64 out of 67) of the genes are assigned the GO term 'protein biosynthesis'.Subgraph P is also relatively large and contains many genes with roles in DNA replication and repair. Similarly, 21 of the 34 annotated genes in Subgraph F have a role in protein catabolism. Three medium-sized subgraphs are strongly associated with the mitotic cell cycle and cytokinesis. Other examples of subgraphs with very clear biological roles are subgraph R (histones) and subgraph Z . Subgraph X contains genes with roles in methionine metabolism or transport.STI1, SIS1, HSC82, HSP82, AHA1, SSA1, SSA2, SSA4, KAR2, YPR158w, YLR247c. The other group contains genes primarily involved in carbohydrate metabolism. These two subgroups are connected to each other exclusively through HSP42 and HSP104.Some locally distinct subgraphs can be further decomposed. For example, subgraph K contains at least two subgroups. One of these is composed primarily of genes encoding chaperone proteins: YRF1-2, YRF1-3, YRF1-4, YRF1-5, YRF1-6) correspond to ORFs encoding copies of Y'-helicase protein 1 [YBL113c, YEL077c, YHL050c, YIL177c, YJL225c, YLL066c, YLL067c, YPR204w) assigned to this subgraph also encode helicases. This helicase subgraph is closely associated with subgraph P, which contains numerous genes involved in DNA replication and repair are members of the seripauperin gene family [Three of the locally distinct subgraphs - Q, W and CC - are composed primarily of genes for which there are no GO biological process annotations. Interestingly, the majority of genes assigned to these three groups are found in subtelomeric regions. These three subgraphs are not themselves directly connected in the FOCI graph, so their regulation is not likely to be simply an instance of a regulation of subtelomeric silencing . Subgraprotein 1 . Eight ae family . Anothere family .YAR010c, YBL005w-A, YJR026w, YJR028w, YML040w, YMR046c, YMR051c) all of which are parts of Ty elements, encoding structural components of the retrotransposon machinery [r ~ 0.62). Despite this, the local distribution of edge weights in FOCI graph is such that this group is highlighted as a subgraph of interest. Locally strong subgraphs such as these can also be used as the starting point for further graph search procedures. For example, querying the FOCI network for immediate neighbors of the genes in subgraph FF yields three additional ORFs - YBL101w-A, YBR012w-B, and RAD10. Both YBL101w-A and YBR012w-B are Ty elements, whereas RAD10 encodes an exonuclease with a role in recombination.As a final example, we consider subgraph FF, which is composed of seven ORFs . with a threshold value of ± 0.5. The resulting relevance network has 13,049 edges and a GCC with 1,543 vertices and 12,907 edges. The next largest connected subgraph of the relevance network has seven vertices and seven edges. There are a very large number of connected subgraphs that are composed of pairs or singletons of genes.We estimated a relevance network for the same 5007-gene dataset used to construct the FOCI network. The scoring function employed was To compare the performance of the relevance network with the FOCI network we used the pathway query approach described above to test the coherence of the 38 metabolic pathways described previously. Of the 38 metabolic pathways tested, nine have significant coherence values in the relevance network. These coherent pathways include: glycolysis/gluconeogenesis, the TCA cycle, oxidative phosphorylation, ATP synthesis, purine metabolism, pyrimidine metabolism, methionine metabolism, amino sugar metabolism, starch and sucrose metabolism. Two of these pathways - amino sugar metabolism and starch and sucrose metabolism - are not significantly coherent in the FOCI network. However, there are 12 metabolic pathways that are coherent in the FOCI network but not coherent in the relevance network. On balance, the FOCI network model provides a better estimator of known metabolic pathways than does the relevance network approach.et al. [et al. [et al. [et al. and the website that accompanies their report [To provide a common basis for comparison with hierarchical clustering and Bayesian networks, we explored the dataset of Spellman et al. which in [et al. analyzed [et al. used ther report . For theet al. [On the basis of hierarchical clustering analysis of the 800 cell-cycle-regulated genes, Spellman et al. highlighet al. for descet al. [et al. [Applying our algorithm for finding locally distinct subgraphs to the FOCI graph based on these same data we found 10 locally distinct subgraphs. Seven of these subgraphs correspond to major clusters in the hierarchical cluster analysis . The FOCI analysis additionally shows that this set of genes is linked to another subgraphs that includes AGA2, STE2, MFA1, MFA2 and GFA3. This second set of genes are also involved in conjugation, sexual reproduction, and pheromone response. AGA1 and AGA2 form the bridge between these two subgraphs . These Because hierarchical clustering constrains relationships to take the form of strict partitions or nested partitions, this type of analysis seems best suited to highlight the overall coarse structure of co-regulatory relationships. The FOCI method, because it admits a more complex set of topological relationships, is well suited to capturing both global and local structure of transcriptional interactions.et al. [et al. [STE2-MFA2, CTS1-DSE2(YHR143w), OLE1-FAA4, KIP3-MSB1, SHM2-GCV2, DIP5-ARO9 and SRO4-YOL007c. All of these relationships, with the exception of SRO5-YOL007c, are present in the FOCI analysis of the same data.Graphical models, like the FOCI method, exploit conditional independence relationships to derive a model that can be represented using a graph or network structure. Unlike the FOCI model, general graphical models represent a complete factorization of a multivariate distribution. In the case of Bayesian networks it is also possible to assign directionality to the edges of the network model. However, these advantages come at the cost of complexity - Bayesian networks are costly to compute - and generally this complexity scales exponentially with the number of vertices (genes). The estimation of a FOCI network is computationally much less complex than the estimation of a Bayesian network. Both methods allow for a richer set of potential interactions among genes than does hierarchical clustering. We therefore expect that both methods should be able to highlight biologically interesting interactions, at both local and global scales. Friedman et al. analyzed [et al. and highet al. demonstrated an interaction between ASH1 and FAR1, both of which are known to participate in the mating type switch in yeast. This relationship is absent in the FOCI network. Similarly, the relationship between AGA1 and AGA2 that is highlighted in the FOCI analysis does not appear in the multinomial Bayesian network analysis.Comparisons of the local topology of each network, based on examining the edge relationships for a number of query genes, suggests that the FOCI and Bayesian networks are broadly similar. There are of course, examples of biologically interpretable interactions that are present in the FOCI analysis but not in the Bayesian network and vice versa. For example, using a multinomial model, Friedman per se. While the clusters and patterns of coexpression summarized by the FOCI network may result from particular regulatory dynamics, no causal hypothesis of regulatory interaction is implied by the network.As with all analytical tools, careful consideration of the assumptions underlying the FOCI network method is necessary to understand the limits of the inferences one can draw. For example, our current framework limits consideration to linear relationships as measured by correlations and partial correlations. These assumptions may be relaxed, allowing for other types of distributions and relationships among variables , but there is an inevitable trade-off to be made in terms of computational complexity and statistical power. However, as seen in our analysis, many biologically interesting relationships among gene expression measures appear to be approximately linear. Biologically speaking, it is important to keep in mind that the graphs resulting from a FOCI analysis of gene-expression measurements should properly be considered coexpression or co-regulation networks and not genetic regulatory networks Biology demands that the analytical tools we use for functional genomics should be able to capture and represent complex interactions; practical considerations stemming from the magnitude and scope of genomic data require the use of techniques that are computable and relatively efficient. The FOCI framework we have used for representing genomic coexpression patterns in terms of a weighted graph satisfies both these constraints. FOCI networks are readily computable, even for very large datasets. Comparisons with known metabolic pathways show that many key biological interactions are captured by FOCI networks, and the algorithm we provide for finding locally distinct subgraphs provides a mechanism for discovering novel associations based on local graph topology. The subgraphs and patterns of interactions that we are able to demonstrate based on such analyses are strongly consistent with known biological processes and functions, indicating that the FOCI network method is a powerful tool for summarizing biologically meaningful coexpression patterns. Furthermore, the kinds of interactions captured by network analysis are typically more natural than the clustering family of analyses where biased and unstable results can be forced by the algorithm. Secondary analysis based on the network properties also reveal additional subtle structure. For example, our procedure for finding locally distinct subgraphs reveals associated genes whose pairwise interactions may be globally weak but relatively strong compared to their local interactions. While the results reported here focus on the analysis of gene expression measurements, the FOCI approach can be applied to any type of quantitative data making it a generally suitable technique for exploratory analyses of functional genomic data.The approach we employ to estimate coexpression networks is based on a general statistical technique we have developed for representing the associations among a large number of variables in terms of a weighted, undirected graph. The technique is based on the consideration of so-called 'first-order' conditional independence relationships among variables, hence we call the graphs that result from such analyses first-order conditional independence, FOCI, networks. The network representation that results from a FOCI analysis also has a dual geometrical interpretation in terms of proximity relationships defined with respect to the geometry of correlations and partial correlations. We outline the statistical and geometrical motivations underlying our approach below.G = {V,E}, where the vertex set, V, represents the variables of interest and the edge set, E, represents interactions among the variables. eij is an edge in G, if and only if there is no other variable in the analysis, k(k ≠ k ≠ k) such that or , whereA FOCI network is a graph, is a modified partial correlation between i and j conditioned on k. takes values in the range -1 ≤ ≤ 1. is approximately zero when i and j are independent conditional on k. is positive when the marginal correlation, ρij, and the standard partial correlation, ρij.k, agree in sign, and is negative otherwise. Cases where the marginal and conditional correlations are of opposite sign are examples of 'Simpson's paradox', which usually indicates that there is a lurking or confounding effect of the conditioning variable . If i and j are conditionally independent given k we write this as (i ⊥ j|k). Using an information theoretic interpretation suggested by Lauritzen [i ⊥ j|k) implies that if we observe the variable k, there is no additional information about i that we gain by also observing j (and vice versa). Because the edges of the FOCI network indicate pairs of variables that are not conditionally independent, one can interpret the FOCI graph as a summary of all the pairwise interactions that can not be 'explained away' by any other single variable in the analysis.While true biological interactions may sometimes lead to inverted conditional associations, their interpretation can be complicated; therefore in the analysis presented above, we did not connect edges when the relationships became inverted. However, one can also keep such edges for subsequent analysis if there is reasonable functional justification. When such sign-reversed edges are ignored, we will call this the sign-restricted FOCI network. This definition means that variables auritzen , the staUnlike standard graphical models, a FOCI network does not represent a factorization of a multivariate distribution into the product of simpler distributions. However, below we show that a sign-restricted FOCI graph has a unique geometric interpretation in terms of proximity relationships in the multidimensional space that represents the correlations among variables. This geometric interpretation suggests that the FOCI model should be a generally useful approach for exploratory analyses of very high-dimensional datasets.Our FOCI approach is similar to a framework developed by de Campos and Huete for estiAbove we described the FOCI network model in statistical terms. Here we provide a geometrical interpretation of FOCI graphs. We show that a FOCI network is equivalent to a proximity graph of the variables of interest . More specifically, we demonstrate that a sign-restricted FOCI network is a 'Gabriel graph' in the geometric space that represents the relationships among the variables.B denote an open n-sphere centered at the point x with radius r, and let d denote the Euclidean distance function. Given a set of points, P = {p1 p2, ..., pn}, in an n-dimensional Euclidean space, is an edge in the Gabriel graph if no other point, pk in P falls within the diameter sphere defined by B((pi = pj)/2, d/2). That is, pi and pj are connected in the Gabriel graph if no other point falls within the sphere that has the chord pi, pj as its diameter [A Gabriel graph, introduced by Gabriel and Sokal , is a tydiameter .n-dimensional hypersphere (where n is the number of observations). In this representation, the correlation between two random variables, x and y, is given by the cosine of the angle between their vectors. We will refer to this construction as the 'correlational hypersphere'. The partial correlation between x and y given z is equivalent to the cosine of the angle between the residual vectors obtained by projecting x and y onto z. The vectors x, y and z form the vertices, A, B, and C, of a spherical triangle on that hypersphere with associated angles γ, λ, and φ. Then, ρxy.z = cos(φ), ρxz.y = cos(λ), and ρyz.x = cos(γ) [ρxy.z = 0 for the multivariate normal, is obtained when cos(φ) = 0 . The set of z vectors that satisfy this condition defines a circle on the hypersphere whose diameter is the spherical chord between x and y. If the projection of z onto the hypersphere lies outside of this circle then ρxy.z is positive, inside the circle ρxy.z is negative .One can represent random variables as vectors in the space of the observations . In = cos(γ) . Given ti and j only if no third variable falls within the diameter sphere defined by i and j on the correlational hypersphere, or by the diameter sphere defined by i and -j when rij < 0 . This is the same criteria of proximity that defines a Gabriel graph. A FOCI graph is therefore a summary of relative proximity relationships among the variables of interest, defined with respect to the geometry of correlations when restricted to the cases when the partial correlation signs are consistent with the marginal correlations.The sign-restricted FOCI network construction corresponds to the graph obtained by connecting variables A simple algorithm for estimating a network based on first-order conditional independence relationships is described below. The results of this algorithm can be represented as a graph where the vertices represent the variables of interest (genes) and the edges represent interactions among variables that show at least first-order conditional dependence. A library of functions for estimating FOCI networks, implemented in the Python programming language, is available from the authors on request.We use vanishing partial correlations ,36 to teEstimate marginal associations. For a set of p variables, indexed by i and j, calculate the p × p correlation matrix, C, where Ci,j = corr for all i, j; i = 1...p, j = 1...p.1. Construct saturated graph. Construct a p × p adjacency matrix, G. Let Gi,j = 1 for all i, j.2. Prune zero-order independent edges. For each pair of variables, , if Ci,j <Tcrit <Tcrit), where Tcrit is a threshold value for determining marginal/conditional independence (see below), then set Gi,j = 0. G defines a marginal independence graph.3. Estimate first-order relationships. For each pair of variables in G calculate , the minimum partial correlation between i and j, conditioned on each of the other variables in the analysis taken one at a time. for all k such that i ≠ k and j ≠ k and and are both edges in G. is the sample modified partial correlation coefficient as defined in equation (1).4. Prune first-order independent edges. If <Tcrit or with weights defined by some function of corr or . If we assume multivariate normality we can use Fisher's z-transformation [Tcrit for a given edge-wise false-positive rate. Alternatively, one can define Tcrit by other methods such as via permutation analysis to define a null distribution for . While the FOCI approach requires that one define a critical threshold for determining conditional independence, this threshold is in theory a function of the sample size and the null distribution of rather than the somewhat fuzzier distinction between 'strong' and 'weak' correlation that most pairwise network estimation approaches require.The resulting adjacency matrix ormation to normaSaccharomyces cerevisae. The data used in our analysis are drawn from publicly available microarray measurements of gene expression described in DeRisi et al. [et al. [et al. [2-transformed, duplicate and missing data were removed and any ORFs listed as 'dubious' in the Saccharomyces Genome Database as of December 2003 were filtered out. The final dataset consisted of expression measurements for 5,007 ORFs represented by 87 microarrays , making [et al. , have be [et al. ,10,45. Tp < 0.05). While a majority of the univariate distributions are approximately normal, a significant proportion of the trivariate distributions are clearly not multivariate normal. As a crude test of linearity for bivariate relationships we calculated linear regressions for 10,000 random pairs of gene expression measures (randomly choosing one of the pair as the dependent variables), and performed runs tests [p < 0.05). We therefore conclude that the assumption of quasi-linearity is valid for a large number of the pairwise relationships.As noted above, zero partial correlations are exactly equivalent to conditional independence only for multivariate normal distributions. However, from the perspective of exploratory analyses, the more important assumption is that the relationships among the gene expression measures are predominantly linear. We tested each of these assumptions as follows. We used a Cramer-von Mises statistic to test ns tests for randTcrit, for these data we considered both permutation tests and false-positive rates based on asymptotic expectations for the distribution of first-order partial correlations (see above). Permutation tests were carried out by independently randomizing the values for each gene expression variable such that each gene had the same mean and variance as its original observation vector, but both the marginal and partial correlations had an expected value of zero. We then sampled 1,000 such randomized variables and examined the distribution of for every pair of variables in this sample. For p ≤ 0.001 the permutation test indicates a value of Tcrit ~ 0.3. The asymptotic threshold for p ≤ 0.001 based on Fisher's z-transform is Tcrit ~ 0.3. We used the slightly more conservative value of Tcrit ~ 0.34.Given these observations, in order to define an appropriate partial correlation threshold, We used 38 metabolic pathways as documented in KEGG release 29.0, January 2004 ,49 to teH, is two-step connected in the graph G if no vertex in H is more than two edges away from at least one other element of H. Given a set of genes assigned to a pathway (the query genes), we computed the set of two-step connected subgraphs for the query genes in the GCC of our yeast coexpression network. This procedure yields one or more subgraphs that are composed of query (pathway) genes plus non-query genes that are connected to at least two pathway genes. We used two steps as a criterion for our pathway queries because our estimate of the distribution of path distances whose vertex set completely overlaps P . For cases in which the query pathway is less than perfectly represented in the estimated network we measure the degree of coherence as |FPmax ∩ P| / |P|). We refer this ratio the 'coherence value' of the pathway P in the network of interest. However, we note that in a completely connected graph , every possible pathway query would be maximally coherent but so would any random set of genes. It is therefore necessary to compare the coherence of a given pathway to the distribution of coherence values for random pathways composed of the same number of genes drawn from the same network. We estimated this distribution by using a randomization procedure in which we used 1,000 replicate random pathways to estimate the distribution of coherence values for pathways of different sizes. In Table Suppose we have a set of query genes from a known pathway denoted as We describe an algorithm for extracting a set of 'locally distinct' subgraphs from an edge-weighted graph. We assume that the edge-weights of the graph are measures of the strength of association between the variables of the interest. We define a locally distinct subgraph as a subgraph in which all edges within the subgraph are stronger than edges that connect subgraph vertices to vertices not within the subgraph. Such subgraphs are 'locally distinct' because they are defined not by an absolute threshold on edge strengths, but rather by a consideration of the local topology of the graph and the distribution of edge weights. We describe an algorithm for finding locally distinct subgraphs below.G = {V, E} and w:E → R be an edge-weighted graph where w(e) is the edge weight function, and |V| = p and |E| = q. Define an ordering on E, O(E) = , such that w(ei) ≥ w(ej) for all i ≤ j . Let G(τ)= {V, E(τ)} be a subgraph of G obtained by deleting all edges, e, such that w(e) <eτ. G(τ) an edge-level graph. Also let denote the k connected components of G(τ). Let Ω = C1 ∪ C2 ∪ … Cn. Define Lα,ζ = {l1,l2,...,lm} where li ⊆ Ω, li ∩ lj = (i ≠ j) and α ≤|li|≤ ζ. That is, Lα,ζ is a collection of disjoint subgraphs of G, where every li is a connected component of some G(τ) and the size of li is between α and ζ. We call the elements of Lα,ζ the α,ζ-constrained locally distinct subgraphs of G. We say Lα,ζ is optimal if |li ∪ lj … lm| is maximal and |Lα,ζ| is minimal. Our goal is to find the optimal Lα,ζ for the graph G given the constraints α and ζ. A simple algorithm for calculating the Lα,ζ is as follows:Let L ← , i = 01. let i ≤ q:2. while G(i) and Ci3.  calculate in Ci:4.  for :5.   if l in L:6.    for :7.     if L ← L - {l}8.      9.     i = i + 110. Lα,ζ ← L11. i, we calculate the connected components of the edge-level graph, G(i), and add those components which satisfy the size constraints to the candidate list L. Lines 6-8 of the algorithm serve to eliminate from L any non-maximal components.The algorithm is straightforward. At each iteration, α = 7, ζ = 150. The subgraph search given these constraints yielded 32 locally distinct subgraphs of the estimated yeast FOCI network and additional examples of coherent subgraphs of the FOCI network generated by querying with known metabolic pathwaysClick here for additional data fileA table detailing each of the 32 locally distinct subgraphs generated from the yeast FOCI network via the unsupervised graph search algorithm described in the textClick here for additional data file

To describe immune and endocrine responses in severe hymenoptera hypersensitivity requiring venom immunotherapy (VIT) during in vitro fertilization (IVF).A 39-year old patient was referred for history of multiple miscarriage and a history of insect sting allergy. Four years earlier, she began subcutaneous injection of 100 mcg mixed vespid hymenoptera venom/venom protein every 5–6 weeks. The patient had one livebirth and three first trimester miscarriages. Allergy treatment was maintained for all pregnancies ending in miscarriage, although allergy therapy was discontinued for the pregnancy that resulted in delivery. At our institution ovulation induction incorporated venom immunotherapy (VIT) during IVF, with a reduced VIT dose when pregnancy was first identified. Serum IgE was monitored with estradiol during ovulation induction and early pregnancy. Response to controlled ovarian hyperstimulation was favorable while VIT was continued, with retrieval of 12 oocytes. Serum RAST (yellow jacket) IgE levels fluctuated in a nonlinear fashion (range 36–54%) during gonadotropin therapy and declined after hCG administration. A healthy female infant was delivered at 35 weeks gestation. The patient experienced no untoward effects from any medications during therapy.Our case confirms the safety of VIT in pregnancy, and demonstrates RAST IgE can remain <60% during IVF. With proper monitoring, VIT during IVF can be safe and appropriate for selected patients and does not appear to adversely affect blastocyst implantation, early embryo development or perinatal outcome. Further studies will be needed to develop VIT guidelines specifically applicable to IVF. Insect sting allergies affect approximately 3% of the general population, and patients with insect sting allergy during pregnancy are generally advised to continue venom immunotherapy (VIT). However, there have been no descriptions of VIT during infertility therapy despite increased utilization of the advanced reproductive technologies . In this4P1031 was referred for evaluation and management of recurrent pregnancy loss. Medical history was significant for known carrier state for β-thalassemia. Mild hypothyroidism had been diagnosed in 2002 with immediate initiation of replacement therapy. The patient was a non-smoker, in good general health and had no gynecologic complaint. BMI was 21.7 kg/m2. In 1997, she experienced a severe hypotensive anaphylactic reaction following a yellow jacket sting (Vespula spp.) resulting in a full allergy work-up. The patient began subcutaneous injection of 100 mcg mixed vespid hymenoptera venom/venom protein every 5–6 weeks, which was well tolerated.A 39 year-old Caucasian GAll four conceptions were established without medical assistance, involved the same partner, and were achieved after the hymenoptera hypersensitivity diagnosis. The initial pregnancy occurred three years before presentation and resulted in a first trimester spontaneous abortion. No adjustment was made to the allergy injection regimen during that pregnancy. Fetal cardiac activity was initially present, but was lost at 10 weeks' gestation for unknown reasons. No curettage was performed.One year later, a second pregnancy was established but for this pregnancy hymenoptera venom therapy was discontinued when pregnancy was first recognized (~6 weeks). A 3170 g female infant was delivered vaginally at 40 1/2 weeks' gestation. In 2001 and 2002, the patient established two additional pregnancies and hymenoptera therapy was maintained at 5–6 week intervals for both; both resulted in first trimester spontaneous abortions. For these miscarriages, dilation and curettage was undertaken but no karyotype was performed and no cause for the losses was identified.At our institution, euthyroid status was verified, the thalassemia carrier state was confirmed, and we identified a new homozygous A223V mutation at the methyltetrahydrofolate reductase (MTHFR) locus. Folic acid intake was immediately increased to 800 mcg/d, although a baseline serum homocysteine level was not measured. Factor V Leiden, protein S, protein C, and other coagulation tests were normal, as were karyotypes obtained from both partners. Anticardiolipin, antiphospholipid and antiovarian antibody titres were all negative. However, transvaginal saline uterine sonography revealed a uniform 5 mm echodense lesion consistent with an endometrial polyp. Outpatient hysteroscopic polypectomy was performed without complication. After discussing various infertility therapies and associated success rates given her age, the patient elected to undergo IVF.®, Ferring Pharmaceuticals Inc.; Tarrytown, NY USA and 300 IU/d Gonal-F®, Serono Labs; Norwell, MA USA). Pre-treatment pituitary downregulation was achieved via 5 u/d leuprolide acetate and was continued × 3 d after gonadotropin therapy commenced. No alteration was made in the patient's allergy injection sequence during ovulation induction , and serum yellow jacket RAST IgE measurements were obtained via commercial fluoroimmunoassay including positive and negative controls . While absolute IgE levels remained <0.35 kU/l throughout therapy, percentage IgE results were variable and these data are summarized in Figure In March 2003, the patient began programmed ovarian hyperstimulation using a combined recombinant-FSH+hMG protocol was started on the day of oocyte retrieval. On post-fertilization day three, the ultrasound-guided transfer of four embryos was performed. Immediately following embryo transfer, the patient was placed on oral aspirin (81 mg/d) and subcutaneous heparin . Luteal phase support was administered as daily 50 mg IM progsterone in oil injections.On cycle day 10, subcutaneous hCG was given with serth gestational week. Immunology and perinatology consultants agreed with reduced dose allergy protocol through the third trimester, and hymenoptera venom protein extract (75 mcg) treatment was maintained to 32 weeks gestation. The patient experienced no untoward reaction or hypersensitivity to gonadotropins, VIT, or supplementary progesterone during therapy.Two weeks after embryo transfer, serum hCG was 72 mIU/ml. On May 5, 2003, transvaginal ultrasound confirmed a single intrauterine pregnancy with fetal cardiac rate at 126/min. Progesterone was discontinued at the 10At 32 weeks, obstetrical sonogram suggested reduced amniotic fluid levels and the patient was given intramuscular betamethasone (12 mg/d × 2 days) and placed on bedrest. At this point allergy injections were discontinued since the patient was not outdoors and risk for insect sting was regarded as low. Intravenous oxytocin was started at 35 weeks due to oligohydramnios and resulted in vaginal delivery of a 2495 g female infant. Mother and baby were discharged home after an uncomplicated two-day postpartum course. Allergy injections resumed (100 mcg every 5–6 weeks) when breastfeeding was completed three months later.Overall, the incidence of allergy to insect stings is ~3% in adults , yet theAlthough continuation of allergy therapy during pregnancy is generally recommended , the inti.e., reduction of miscarriage risk).Evaluation of this patient with a history of multiple spontaneous abortions identified additional factors which might contribute to a poor reproductive outcome. Specifically, endometrial polyps and homoIt has been hypothesized that early production of IL-10 associated with VIT may induce T-cell anergy, dampening T helper type 2 response and resulting in a T helper type 1 dominant cytokine response. As the role of T helper 1 type immune response in blastocyst implantation becomes more completely characterized, T helper type 1 function may prove to be important in early placental dysfunction or recurrent pregnancy loss . These pThe authors declare that they have no competing interests.ESS was the principal physician and coordinated the research. SCC, CRK and MP edited the manuscript. MJT was chief embryologist and edited the manuscript.

Journal of Autoimmune Diseases is created as an independent open access journal. In addition to the obvious advantages of the open access, the Journal will practice a double-blind reviewing of the manuscripts, which means that both the reviewers and the authors remain anonymous to each other. We believe that such a policy will reduce the influence of personal and other non-scientific factors on the reviewer's decision making.A new online Autoimmune diseases are common and can affect virtually every organ in the body. They range from organ specific diseases such as thyroiditis or type 1 diabetes to life-threatening multi-system diseases such as systemic lupus erythematosus and the systemic vasculitides. Clinicians from every field of medicine may encounter these patients and both generalists and specialists need to keep up to date with clinical and experimental developments in autoimmunity. The advent of targeted therapies for example the anti-TNF-α agents for the treatment of rheumatoid arthritis exemplify the application of basic science research that can lead to effective therapies.Journal of Autoimmune Diseases. There are several journals devoted to autoimmune diseases already, with at least four having the word "autoimmunity" in the title. In addition, a number of immunological journals and journals that specialise in particular diseases publish papers on autoimmunity. So is there a need for yet another journal?Inspired by the publisher, BioMed Central, a group of enthusiastic professionals gathered to launch the Journal of Autoimmune Diseases certainly thinks so. This Journal is one of the new breed of online-only journals which are proving extremely successful. But it is not the magic word "internet' that makes the difference. Two distinct features provided by, BioMed Central and the Editorial Board offer special advantages to readers and authors.The Editorial Board of Journal of Autoimmune Diseases is universally and freely available online to everyone, its authors retain copyright, and it is archived in internationally recognised free repositories such as PubMed Central [The aim of publishing is to share information with the community. Authors are also keen to know that their work is being read. One of the syndromes of authorship has been the little card politely requesting a reprint. This card is sometimes forgotten or filed in the circular filing cabinet thus inducing considerable guilt both in the paper's author and the recipient. The era of reprint requests may be drawing to a close since most of the journals can now be found on-line. However, the access to a paper on-line often requires a subscription or a purchase of an individual article ("pay-per-view"). The high publication costs of printed journals deprive their publishers of the generosity of complete free access, but this tends to limit the dissemination of research. An alternative approach provided by BioMed Central is to make access totally free for everybody, as part of their Open Access policy . It mean Central ; e-Depot Central ; Potsdam Central and INIS Central .Journal of Autoimmune Diseases enables scientists from countries and institutions with limited funds to read the same material as wealthier ones [ier ones . This haier ones .Journal of Autoimmune Diseases aims to provide a high standard of double-blinded peer review, in which the reviewer's name is not disclosed to the authors, and the authors remain anonymous to the reviewers. A few journals already use this system, so why do we believe that this will benefit the scientific community?The We have all come across situations where an honest, laborious piece of work was hard to publish. Some journals reject up to 95% of manuscripts , and thipersonally, a good paper is rejected or additional possibly unnecessary experiments are required which will take a year or two. Unfair rejection can occur due to a conflict of interest, be it personal or financial. For instance, an individual may be rejected on the basis of ethnicity [It is the nature of human beings that if a reviewer does not like you thnicity , so may An unfair acceptance takes place when the reviewer is benevolent to a weak paper that has an outstanding name as the last author. Some authors may successfully exploit this weakness of a reviewer's human being by placing the famous name intentionally. This results in a ghost authorship of which the celebrity may be unaware! One of us remembers an anecdotal conversation he heard a few years ago in one of the universities:Dorit (a secretary to the Professor): Robert? There is a new paper of yours I see on Medline. Do you wish me to update your publication list?Professor: Who are the other authors?(Dorit reads 20 last and first names)Professor: Hm-m-m...I don't know any of these people. What is the title there?(Dorit reads the title)Professor: I don't remember even discussing anything like that or being consulted...Dorit: Should I ignore it then?Professor: Could you print it out for me? I will read it first. If the paper is good enough...Well, then I'll have nothing to do but to add it to my list of publications.What are the remedies then? Two policies that could help to overcome these difficulties are completely open peer review and completely anonymous, or double-blind peer review. In open peer review , the revJournal of Autoimmune Diseases – we all need that important first paper to get going. The Editorial Board has been carefully selected from leading authorities in their own fields to help achieve our ambitious aim of developing a high class international journal that is accessible by all who have internet access and we look forward to receiving your submissions.We hope to attract clinical and basic science reports from leading and innovative authors. We call for established authors to publish with us in order to be easily accessible by all other scientists, to stop fighting with the windmills of the elite journals, to write detailed and clear papers in the unlimited space provided by internet. We would also strongly encourage more junior authors who are making their way in this field to consider publishing high quality science in the

Prior literature has shown that physicians with healthy personal habits are more likely to encourage patients to adopt similar habits. However, despite the possibility that promoting medical student health might therefore efficiently improve patient outcomes, no one has studied whether such promotion happens in medical school. We therefore wished to describe both typical and outstanding personal health promotion environments experienced by students in U.S. medical schools.We collected information through four different modalities: a literature review, written surveys of medical school deans and students, student and dean focus groups, and site visits at and interviews with medical schools with reportedly outstanding student health promotion programs.We found strong correlations between deans' and students' perceptions of their schools' health promotion environments, including consistent support of the idea of schools' encouraging healthy student behaviors, with less consistent follow-through by schools on this concept. Though students seemed to have thought little about the relationships between their own personal and clinical health promotion practices, deans felt strongly that faculty members should model healthy behaviors.Deans' support of the relationship between physicians' personal and clinical health practices, and concern about their institutions' acting on this relationship augurs well for the role of student health promotion in the future of medical education. Deans seem to understand their students' health environment, and believe it could and should be improved; if this is acted on, it could create important positive changes in medical education and in disease prevention. Our purpose was to describe both typical and outstanding personal health promotion environments experienced by medical students in U.S. medical schools. Our interest in health promotion among medical students was based on compelling data showing that physicians who have healthy personal habits are more likely to encourage patients to adopt related habits . HoweverWe collected information through four different modalities: a literature review, a written survey of medical school Deans and students, focus groups of preclinical and clinical medical students and dean, and site visits at and interviews with medical schools with reportedly outstanding student health promotion programs.5–7 Methodology for gathering medical student data in HD has been more fully described elsewhere having a designated person to whom students can turn at any time. That would be a hotline . . . A counselor." Deans generally agreed with the concept of putting a mentoring support system in place. However, both students and deans see few resources in the medical schools directed toward student wellness and what programming that is offered is reactive and small in nature. Both the students and the deans discussed wellness in terms of stress and mental well-being, rather than including physical health factors such as nutrition and exercise. Students felt that the best way to teach prevention would be through skill development and role modeling from faculty who incorporate prevention into their practice. The deans proposed that prevention be integrated throughout the curriculum and not be offered as a separate course; students concurred that more prevention instruction would be optimal and acknowledged that a separate course gives the impression that the content is less important and optional.We visited three medical schools with especially good and abundant practices around medical student health , and several other schools with some activities that seemed also to merit mention. These schools were selected for in-depth interviewing, with the best practices outlined in Table Five being used on medical school campuses.] has typically examined limited populations of medical students regarding personal health promotion, with few assessments of student well-being or of the success of various interventions, so only limited conclusions can be drawn (a situation that will be improved with this and other publications from HD). However, some trends may be emerging, such as students' health practices being good in some spheres [Prior literature [ref spheres , but not spheres and resi spheres ,5, with spheres . Poor me spheres . While m spheres , some st spheres .Medical student and physician health is of inherent interest, but it is especially of concern because of the well-documented link between physicians' personal health practices and their patient counseling practices . DespiteWe found consistent support from both Deans and students for medical schools' encouraging healthy student behaviors, though modest follow-through on this support. Though students seemed to have thought little about the relationships between their own personal and clinical health promotion practices, we were especially impressed with the Deans' unanimity that faculty members should model healthy behaviors. The deans' support of the relationship between physicians' personal and clinical health practices, and concern about their institutions' acting on this relationship bodes well for the role of HD principles in the future of medical education. The correlation between students' and deans' responses suggests that deans understand well their students' health environments. If acted on, this finding (coupled with deans' beliefs that the environment can and should be improved) could create important positive changes in medical education and in disease prevention.The author(s) declare that they have no competing interests.EF co-developed the protocol, helped guide analyses, and drafted and revised the manuscript. JH co-developed the protocol, obtained funding, and helped edit the manuscript. LE co-developed the protocol, performed analyses, and helped edit the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

Leucocyte recruitment and inflammation are key features of high dose radiation-induced tissue injury. The inflammatory response in the gut may be more pronounced following radiotherapy due to its high bacterial load in comparison to the response in other organs. We designed a model to enable us to study the effects of radiation on leucocyte-endothelium interactions and on intestinal microflora in the murine ileum. This model enables us to study specifically the local effects of radiation therapy.A midline laparotomy was performed in male C57/Bl6 mice and a five-centimetre segment of ileum is irradiated using the chamber. Leucocyte responses (rolling and adhesion) were then analysed in ileal venules 2 – 48 hours after high dose irradiation, made possible by an inverted approach using intravital fluorescence microscopy. Furthermore, intestinal microflora, myeloperoxidase (MPO) and cell histology were analysed.Enterobacteriaceae and Lactobacillus decreased significantly after 16 hours. In the radiation groups, the bacterial count showed a progressive increase from 2 to 24 hours after radiation.The highest and most reproducible increase in leucocyte rolling was exhibited 2 hours after high dose irradiation whereas leucocyte adhesion was greatest after 16 hours. Radiation reduced the intestinal microflora count compared to sham animals with a significant decrease in the aerobic count after 2 hours of radiation. Further, the total aerobic counts, This study presents a refinement of a previous method of examining mechanisms of radiation enteropathy, and a new approach at investigating radiation induced leucocyte responses in the ileal microcirculation. Radiation induced maximum leucocyte rolling at 2 hours and adhesion peaked at 16 hours. It also reduces the microflora count, which then starts to increase steadily afterwards. This model may be instrumental in developing strategies against pathological recruitment of leucocytes and changes in intestinal microflora in the small bowel after radiotherapy. The microscopic images were televised using a charge-coupled device video-camera and recorded on videotape (Sony SVT-S3000P S-VHS recorder) for subsequent off-line analysis. To prevent drying during microscopic observations the intestinal segment was placed on a saline moistened cotton gauze and thereafter positioned under the microscope. After a 5-min equilibration period, quantitative measurements were taken. Analysis of leucocyte-endothelium interactions (rolling and adhesion) was made in venules (inner diameter 15–30 μm) with stable resting blood flow. Blood perfusion within individual microvessels was studied after contrast enhancement by eviously .2O2 . Values are expressed as MPO units per g tissue.The enzyme myeloperoxidase (MPO) is abundant in neutrophil leucocytes and has been found to be a reliable marker for the detection of neutrophil accumulation in inflamed tissue. To determine tissue MPO content, radiated ileal tissue was collected, weighed, homogenized in 10 ml 0.5% hexadecyltrimethylammonium bromide, and freeze thawed, after which the MPO activity of the supernatant was assessed. The enzyme activity was determined spectrophotometrically as the MPO-catalysed change in absorbance occurring in the redox reaction of HSamples from the irradiated small intestine were placed in 4% phosphate buffered formaldehyde. Paraffin-embedded samples were sliced and studied under light microscopy after staining with hematoxylin and eosin. At least 3 slides were studied from each specimen in a blinded fashion.Tissue samples from the irradiated small intestine were first placed in 5 ml of sterile transport medium . Samples20 μl blood was mixed with Turk's solution in a 1:10 dilution. Leucocytes were counted and differentiated as polymorphonuclear (PMNL) or mononuclear (MNL) cells in a Burker chamber.P < 0.05.Statistical evaluations were performed using the Kruskal-Wallis one way analysis of variance on ranks for unpaired samples (Dunn's post hoc test was used). For bacterial microflora in comparing 2 groups we used Mann-Whitney Rank sum test, and for the comparison of the different time points within the radiated groups we used One Way ANOVA followed by multiple comparisons versus control group (Dunnett's method). The results are presented as mean values ± SEM. Differences were considered to be significant at i.e. the number of rolling and adherent leucocytes was 2.4 ± 1.2 cells/min and 1.7 ± 1.7 cells/mm, respectively. In contrast, radiation (19 Gy) evoked a marked time-dependent leucocyte response, i.e. a significant increase in both leucocyte rolling and firm adhesion over time . We observed that leucocyte rolling peaked two hours after radiation , whereas leucocyte adhesion was maximum after 16 hours showing a marked response of 59 ± 14 cells/mm . Interestingly, both the leucocyte rolling and adhesion responses to radiation returned to baseline levels 48 hours after radiation . There was no difference in the hemodynamic parameters between the different experimental groups revealed only occasional interactions between leucocytes and the microvascular endothelium, At 2 hours we could not observe any marked differences in the number of inflammatory cell types compared to the controls Figure . At 6 hoEnterobacteriaceae, Lactobacillus and anaerobic counts had decreased two hours after radiation associated with clinical symptoms, was observed. Patients receiving radiotherapy may thus benefit from the intake of oral bacteriotherapy [Endogenous bacterial flora produces nutrients (e.g. short-chain fatty acids) for the mucosa; prevents overgrowth of potentially pathogenic micro-organisms; stimulates the immune system especially the gut-associated lymphoid tissue; helps eliminate toxins from the lumen and participates in intestinal regulation, motility and blood flow . Radiatin number . Bacterin number . Changesn number . Post-ran number . The micotherapy . The impThe histological changes following radiation are both time and dose dependent ,30. SoonNo differences MPO values could be seen between the controls and the radiated groups. This is probably because it is a crude method of measurement and thus may not be sensitive enough to detect early changes of inflammation.This study therefore presents a refinement of previous methods of examining effects of radiation enteropathy, and a new approach at investigating radiation induced leucocyte responses in the ileal microcirculation. This new model may be instrumental in developing strategies against pathological recruitment of leucocytes and changes in intestinal microflora in the small bowel.None declared.LBJ designed the study and participated in construction of the chamber. Performed experimental studies and drafted the manuscript.AAR performed experimental studies and drafted the manuscript.DA participated in the design of the study and construction of the chamber. Performed experimental studies, drafted the manuscript and performed the statistical analysis.LW participated in the radiological design of the study, construction of the chamber and the implementation of radiotherapy.SB participated in the radiological design of the study, chamber and the implementation of radiotherapy.CT participated in the implementation of radiotherapy.NO carried out bacteriological studies.VC performed the histological analysis.HT assisted with issues related to intravital microscopy.BJ conceived of the design, participation in construction of the chamber, co-ordination of the study as well as supervision and draft of the manuscript.The pre-publication history for this paper can be accessed here:

Tumour regression observed in many conditional mouse models following oncogene inactivation provides the impetus to develop, and a platform to preclinically evaluate, novel therapeutics to inactivate specific oncogenes. Inactivating single oncogenes, such as c-Myc, can reverse even advanced tumours. Intriguingly, transient c-Myc inactivation proved sufficient for sustained osteosarcoma regression; the resulting osteocyte differentiation potentially explaining loss of c-Myc's oncogenic properties. But would this apply to other tumours?L over-expression or a favourable microenvironment, respectively. Moreover, tumours progress despite reacquiring a differentiated phenotype and partial loss of vasculature during c-Myc inactivation. Interestingly, reactivating c-Myc in β-cell tumours appears to result not only in further growth of the tumour, but also re-expansion of the accompanying angiogenesis and more pronounced β-cell invasion (adenocarcinoma).We show that brief inactivation of c-Myc does not sustain tumour regression in two distinct tissue types; tumour cells in pancreatic islets and skin epidermis continue to avoid apoptosis after c-Myc reactivation, by virtue of Bcl-xGiven that transient c-Myc inactivation could under some circumstances produce sustained tumour regression, the possible application of this potentially less toxic strategy in treating other tumours has been suggested. We show that brief inactivation of c-Myc fails to sustain tumour regression in two distinct models of tumourigenesis: pancreatic islets and skin epidermis. These findings challenge the potential for cancer therapies aimed at transient oncogene inactivation, at least under those circumstances where tumour cell differentiation and alteration of epigenetic context fail to reinstate apoptosis. Together, these results suggest that treatment schedules will need to be informed by knowledge of the molecular basis and environmental context of any given cancer. The ability to switch expression of a given oncogene 'on' or 'off' ewed in: ,2). Giveewed in: ). Similaewed in: ,5.Several studies using conditional mouse models of various cancers have unexpectedly shown that inactivation of the initiating oncogene is sufficient for reversal not only of the primary tumour but also of invasive and metastatic lesions, many of which contain multiple genetic and epigenetic alterations -18.The tumour regression observed in many of these models following sustained oncogene inactivation provides a powerful platform on which to build a deeper understanding of fundamental tumour biology and with which to preclinically evaluate novel therapeutics to target specific genes. A recent study has shown that brief inactivation 10 days) of c-Myc was sufficient for the sustained regression of c-Myc induced invasive osteogenic sarcomas in transgenic mice ; subsequ0 days ofL overexpression) induced β-cell growth arrest and re-differentiation into mature β-cells, accompanied by the collapse of tumour vasculature and tumour cell mass resulting from apoptosis, despite the constitutive expression of Bcl-xL in the tumour cells 30 cycles, 72°C 10 min 1 cycle. PCR product size: 413 bp. Primers used for the detection of RIP7-Bcl-xL cDNA: (forward) 5' AGC ACT TTC TGC AGA CCT AGC AC 3'; (reverse) 5' CAG CTC CCG GTT GCT CTG AGA C 3'. PCR program: 30 cycles, 72°C 3 min 1 cycle.Heterozygous Hanahan . Littersad libitum.Transgenic mice were housed under barrier conditions with a 12 hour light/dark cycle and access to food and water TAM, was targeted to pancreatic β-cells using a rat insulin promoter, or to suprabasal keratinocytes using the human involucrin promoter. As shown in our previous publications [TAM protein remains inactive due to association of the cells' own hsp90 with the ERTAM. Upon administration of 4-hydroxytamoxifen (4-OHT), hsp90 is displaced allowing association of c-Myc's partner, Max, to form transcriptionally active heterodimers [Expression of the chimeric protein, c-MycERications ,9, the trodimers .TAM protein in pancreatic β-cells of adult transgenic mice, 1 mg of 4-OHT (Sigma) sonicated in peanut oil (1 mg/0.2 ml) was administered daily by IP injection. To activate c-MycERTAM protein in skin epidermis of adult transgenic mice, 1 mg of 4-OHT (Sigma) dissolved in ethanol (1 mg/0.2 ml) was administered daily by topical application to a shaved area of dorsal skin.To activate c-MycERTAM protein was achieved following withdrawal of 4OHT. As c-MycERTAM RNA and protein levels remain unchanged in the presence or absence of 4OHT, Northern and Western blot analysis will not confirm whether the protein is inactive. Thus, to confirm inactivity of the c-MycERTAM protein in pancreatic β-cells, we show reversal of several markers of Myc activation by day 4 of 4OHT withdrawal -growth arrest, re-differentiation, re-establishment of cell-cell contact – by immunohistochemistry (see ref [Inactivation of c-MycER(see ref and ResuTAM protein in skin epidermis was confirmed using immunohistochemistry for markers of re-differentiation (K1 and K14) and growth arrest (see Results section). The tight regulation of the c-MycERTAM protein in skin epidermis was also previously shown in [in situ hybridisation for detection of ODC RNA, a known c-Myc target gene; by day 5 following withdrawal of 4OHT, ODC RNA is no longer detected.Similarly, inactivation of c-MycERshown in using inPancreata or skin were excised from mice and 5–10 mm pieces of tissue were fixed overnight in neutral-buffered formalin, embedded in paraffin wax and sectioned (5–10 μm). Frozen sections were prepared from tissue embedded in OCT and frozen in foil on a bath of dry ice and ethanol. Prior to staining, frozen sections were air-dried and fixed in 4% paraformaldehyde for 15 minutes. Alternatively, for frozen sections, tissue was fixed in 4% paraformaldehyde for 2 hours followed by incubation in 30% sucrose overnight at 4°C. For pancreata analysis, sections (5–10μm) were cut throughout the entire pancreas and every tenth section was selected for histological and immunohistochemical examination. For skin, sections (5–10μm) were cut through two 10 mm pieces of tissue and every tenth section was selected for analysis.Primary antibodies were as follows: rabbit polyclonals Ki-67 (Novacastra) and Nkx6.1 ; rabbit anti-mouse laminin (Sigma); guinea-pig anti-porcine insulin (Dako); rat anti-mouse E-cadherin, (Zymed); rabbit anti-mouse keratin 1 (BabCo); rat anti-mouse CD45 (AbCam). E-cadherin and laminin antibodies were found to label reliably only frozen tissue sections. Other antibodies were effective when used on both paraffin-embedded and frozen sections, although Ki-67 and Nkx6.1 required epitope retrieval by microwaving paraffin-embedded sections at 700 W for 2 × 10 minutes in 0.01 M citrate buffer, pH6.0 (Vector) followed by immersion in cold water.Antibodies were diluted in incubation buffer: PBS/0.5% Triton X-100 containing 1:25 dilution of serum from the same species as the secondary antibody. Primary antibodies for insulin and Ki-67 were applied together to sections for 1 hour. Sections were then incubated in Texas Red-conjugated goat anti-guinea pig Ig secondary antibody together with FITC-conjugated goat anti-rabbit secondary antibody (Vector). After washing, sections were mounted in Vectashield mounting medium (Vector).To detect cells undergoing apoptosis, costaining with TUNEL/insulin, TUNEL/laminin and TUNEL/K1, immunofluorescent staining was performed by applying insulin, laminin or K1 antibodies to sections for 1 hour at room temperature followed by Texas Red-conjugated goat anti-guinea pig (for insulin antibodies) and goat anti-rabbit (for laminin and K1 antibodies) Ig secondary antibody (Vector). TUNEL staining was subsequently performed using ApopTag Fluorescein Direct kit (Chemicon) for frozen tissue sections and ApopTag Fluorescein Indirect kit (Chemicon) for paraffin-embedded tissue sections.SP participated in the design of the study, administered 4OHT to relevant mice, collected tissue, carried out immunohistochemical staining, coordinated and analysed data, drafted the manuscript, and provided part of the funds. SA carried out genotyping, assisted with the administering of 4OHT to mice, collected tissues, cut sections and assisted with capturing of images. LC assisted with genotyping, cutting of sections, and immunohistochemical staining. VI assisted with genotyping and immunohistochemical staining. SZ assisted with genotyping and immunohistochemical staining. MK participated in the design of the study, assisted with the coordination and analyses of data, helped draft the manuscript and provided funding.

Chronic meningitis is defined as symptoms and signs of meningeal inflammation and persisting cerebrospinal fluid abnormalities such as elevated protein level and pleocytosis for at least one month.Neisseria meningitidis group B. The patient made a dramatic recovery with high-dose intravenous ceftriaxone antibiotic therapy for meningococcal meningitis.A 62-year-old woman, of unremarkable past medical history, was admitted to hospital for investigation of a four-week history of vomiting, malaise an associated hyponatraemia. She had a low-grade pyrexia with normal inflammatory markers. A CT brain was unremarkable and a contrast MRI brain revealed sub-acute infarction of the right frontal cortex but with no evidence of meningeal enhancement. Due to increasing confusion and patient clinical deterioration a lumbar puncture was performed at 17 days post admission. This revealed gram-negative coccobacilli in the CSF, which was identified as 1) Chronic bacterial meningitis may present highly atypically, particularly in the older adult. 2) There may be an absent or reduced febrile response, without a rise in inflammatory markers, despite a very unwell patient. 3) Early lumbar puncture is to be encouraged as it is essential to confirm the diagnosis.4) Despite a delayed diagnosis appropriate antibiotic therapy can still lead to a good outcome. Bacterial Meningitis usually presents as an acute illness, predominantly affecting children and young adults. It typically presents with the classical clinical triad of fever, neck stiffness and an altered mental state. However, it may rarely present as a chronic illness, without the classic clinical features noted in acute meningitis.A 62-year-old retired woman was admitted to hospital via her GP for investigation of a four-week history of vomiting and malaise associated with hyponatraemia. She was initially diagnosed as suffering from viral gastroenteritis. However, the vomiting had persisted and had become associated with a mild frontal headache. She had an unremarkable past medical history and was not taking any regular medication. She had never smoked and there was no recent antecedent foreign travel.On examination she appeared clinically dehydrated but otherwise looked well, and was alert and orientated. She was apyrexial and had no rash, photophobia, neck stiffness or stigmata of endocarditis. She had a sinus tachycardia of 104/minute, with normal heart sounds, and a blood pressure of 130/76 mmHg. Chest, abdominal and neurological examinations were unremarkable. She had a plasma sodium of 127 mmol/L (135–145 mmol/L), potassium of 3.4 mmol/L (3.5–5.0 mmol/l), urea 4.8 mmol/L (3.0–6.5 mmol/L) and creatinine of 68 mmol/L (60–125 mmol/L). There was no biochemical evidence of the syndrome of inappropriate antidiuretic hormone (SIADH) production . Serum complement and plasma immunoglobulin levels were unremarkable with no evidence of immunosuppression. In addition, she had a normal full autoimmune profile and thyroid function. Random cortisol level was mildly elevated at 799 nmol/L consistent with a stress response.9/L with a neutrophilia of 10 × 109/L . Her ECG and chest X-ray were normal. Her C-reactive protein (CRP) was slightly elevated at 10 mg/L and erythrocyte sedimentation rate (ESR) was normal at 5 mm/hour. Her Chest X-ray and electrocardiogram were normal. Initial microbiological investigations were normal.Her initial white cell count (WCC) was mildly elevated at 13.0 × 10Initial management consisted of slow intravenous rehydration with normal saline and antiemetic therapy, which led to a mild symptomatic improvement. Upper gastrointestinal endoscopy revealed mild oesophagitis.9/L). However, on day 4 of admission she developed a low-grade pyrexia of 37.5°C, which persisted (<38°C). A CT scan of the head revealed periventricular patchy white matter changes but no features of raised intracranial pressure or space occupying lesion.During the ensuing two weeks her laboratory investigations remained stable . In addition, her nausea and vomiting had failed to fully settle with supportive treatment. The LP results were as follows: cerebrospinal fluid (CSF) appearance was pale yellow and clear; protein = 5.69 g/L (0.15–0.4 g/L); CSF glucose 1.7 mmol/L versus plasma glucose 5.7 mmol/L ; CSF WCC = 106/mL – 99% lymphocytes. Gram's stain revealed gram-negative coccobacilli; acid-fast bacilli were not seen. She was commenced on intravenous ceftriaxone.On day 18 she underwent a lumbar puncture (LP) as she still had a low-grade pyrexia (temperature 37.5°C) and neutrophilia of 9.3 × 10Contrast MRI brain revealed sub-acute infarction of the right frontal cortex but with no evidence of meningeal enhancement. EEG demonstrated slow wave activity, which was consistent with a meningo-encephalitis.Neisseria meningitidis group B, type NT, subtype NT P1.16/nt. She underwent contact tracing and completed a 10-day course of intravenous ceftriaxone. She continued to make a slow but progressive recovery. After a period of rehabilitation and intense physiotherapy she was discharged home 40 days after admission, with mild residual gait ataxia.Within 48 hours of intravenous antibiotics she was more alert, orientated, and sitting out of bed. CSF culture grew gram-negative cocci, which was identified as This case report presents two important clinical concepts: firstly, the presentation of chronic meningitis and secondly, the clinical presentation of bacterial meningitis in the older adult (defined as > 60 years old). The diagnosis was delayed due to the highly atypical clinical presentation .Chronic meningitis is defined as symptoms and signs of meningeal inflammation and persisting cerebrospinal fluid (CSF) abnormalities such as elevated protein level and pleocytosis for at least one month ,3. It afThere are several distinguishing features that may help to differentiate chronic meningitis from adult acute bacterial meningitis table . The claHyponatraemia (as in our patient), whilst very uncommon in acute bacterial meningitis, is seen in the vast majority of cases of chronic meningitis ,11. AlthAcute bacterial meningitis is usually a rapidly progressive and highly lethal disease in older adults . Rapid dGiven the success of childhood immunization, and an increasingly aging population, the proportion of older adults presenting with bacterial meningitis is increasing . There aThe clinical presentation of bacterial meningitis is more variable in the older as compared with the younger adult, with fewer patients manifesting with the classic symptoms of fever, neck stiffness and altered mental state than among younger adults . It has Listeria monocytogenes meningitis or alternative causes such as tuberculous and fungal infection [Our patient's CSF showed a lymphocytosis, raised protein, and low glucose ratio, which are seen in only 10% of bacterial meningitis cases. This CSF profile would normally suggest infection with nfection ,31.Neisseria (N) meningitidis is a leading cause of bacterial meningitis in the Western World and tends to predominate in young adults [N. meningitidis is a gram-negative, aerobic diplococcus. It is classified into serogroups according to the immunological reactivity of their polysaccharides [g adults ,20,25. Ncharides ,20. The charides . Meningocharides -37.This case highlights the diagnostic challenge associated with bacterial meningitis presenting in an older patient. The presentation was made even more difficult owing to the blunted febrile response, the lack of inflammatory response observed in laboratory tests and the chronicity of the patient's symptoms. The diagnosis required thorough investigation during the inpatient stay. Early lumbar puncture is to be encouraged as it is essential to confirm the diagnosis. Despite a delayed diagnosis appropriate antibiotic therapy can still lead to a good outcome.The authors declare that they have no competing interests.MD generated the idea of writing the case report and was the consultant in charge of the patient. CD reviewed the case notes of the patient and wrote the original draft of the case presentation. CB significantly revised the original draft and added the conclusions, references and figures. AH offered considerable help with the manuscript revisions. All authors contributed to the final version of the manuscript.The pre-publication history for this paper can be accessed here:

Inter-individual variation in normal human mammary epithelial cells in response to oxythioquinox (OTQ) is reported. Gene expression signatures resulting from chemical exposures are generally created from analysis of exposures in rat, mouse or other genetically similar animal models, limiting information about inter-individual variations. This study focused on the effect of inter-individual variation in gene expression signatures.p value ≤ 0.05 in three of four cell strains analyzed.Gene expression was studied in primary normal human mammary epithelial cells (NHMECs) derived from four women undergoing reduction mammoplasty [Cooperative Human Tissue Network ]. Gene transcription in each cell strain was analyzed using high-density oligonucleotide DNA microarrays and changes in the expression of selected genes were verified by real-time polymerase chain reaction at extended time points (ABI). DNA microarrays were hybridized to materials prepared from total RNA that was collected after OTQ treatment for 15, 60 and 120 min. RNA was harvested from the vehicle control (DMSO) at 120 min. The gene expression profile included all genes altered by at least a signal log ratio (SLR) of ± 0.6 and p53 polymorphisms. The two strains expressing the major variant of p53 had 83 common genes altered at one or more time point by at least a 0.6 signal log ratio (SLR). The intermediate variant strains showed 105 common genes altered in both strains.RNA species were clustered in various patterns of expression highlighting genes with altered expression in one or more of the cell strains, including metabolic enzymes and transcription factors. Of the clustered RNA species, only 36 were found to be altered at one time point in three or more of the cell strains analyzed . Cluster analysis examined the effects of OTQ on the cells with specific Differential changes in expression of these genes may yield biomarkers that provide insight into inter-individual variation in cancer risk. Further, specific individual patterns of gene expression may help to determine more susceptible populations. Oxythioquinox is a prototypical pesticide that was first used in 1968 on crops such as apples, pears, cucumbers, and gherkins. However, its use was later confined to non-food crops, limiting exposure to nursery and greenhouse employees. OTQ is a member of the quinoxaline class of pesticides, which also includes chlorquinox and thioquinox. Principal agricultural use of OTQ was limited to the states of California, Washington, Florida, New York, Pennsylvania, Ohio and Michigan ,3. Furthin vivo studies in rats found alterations of a variety of metabolic enzymes following OTQ exposures, including alkaline phosphatase pyridine (PhIP) and 7,12-dimethylbenz [a]anthacene (DMBA), and was able to show that while both chemicals altered expression in some genes in a similar fashion, each induced unique gene expression patterns.This study is similar to work currently being carried out to determine gene expression profiles of a variety of environmental agents, including chemicals, physical agents and physiologic stresses -19. The The primary goal of this study was to look for consistent changes common to all donors that could potentially be used as biomarkers of exposure, creating a gene expression profile following OTQ exposure in normal human cells. Given previous research in hepatoxicity, ideally normal human liver cells would have been used as a model system. However, we needed a normal human tissue that was readily accessible. Therefore, gene expression was studied in primary normal human mammary epithelial cells from four different donors in response to OTQ exposure. Current microarray analysis of pesticide exposure focuses on animal studies, not allowing for analysis of inter-individual variation. With the use of microarrays including clinical diagnosis, genetic susceptibility to disease and treatment, the need to determine the potential role of inter-individual variation on gene expression patterns in all potentially exposed tissues. Genes found to be altered in multiple cell strains could be considered biomarkers for individual populations. Given the small number of cell strains used, follow-up analysis in a larger number of samples is required to confirm any potential biomarkers. Biomarkers derived from this study could potentially be used in future epidemiology studies analyzing the effects of pesticide exposure. Further, this gene expression profile could be compared to those of other pesticides and of known carcinogens to develop a more detailed mechanistic definition of these chemicals.2.Primary normal human mammary epithelial cells (NHMECs) were derived from tissues salvaged at reduction mammoplasty obtained though the Cooperative Human Tissue Network . Development and characterization of cell strains was achieved using standard methods . Cells wp53 expression with minimal toxicity at 2 hours with a final concentration of 6.25 μM. Cells were treated by diluting the stock OTQ/DMSO mixture in media and adding this solution to aspirated cells, allowing even exposure to all cells. DMSO (0.001%) alone was used as a vehicle control. At the end of the treatment period, cells were removed for RNA isolation. Cell viability was determined by Trypan Blue exclusion assay.Treatment was performed on cells in passage six at 70% confluency, as routinely performed in our laboratory. Preliminary studies analyzed a range of OTQ concentrations (0 – 12.5 μM) selected based on previous research ,7 and tip53 antibody and incubated overnight at 4°C. The next day, the media was again removed and the secondary antibody was incubated for one hour at room temperature. Slides were washed in triplicate with phosphate buffered saline (PBS) and cover slips were added. Slides were dried for one hour at room temperature before viewing, using the laser scanning confocal microscope BX50 (Olympus), and quantitative analysis was performed pyrene exposure in our laboratory have also found similar results for p53 expression [DNA microarray analysis found no change in pression . The effAlthough inter-individual variation between donors in response to OTQ was evident, there were also some genes found to be increased consistently in all strains by microarray analysis Table . Self-or.SOM clustering was used to show patterns of expression in each cell strain, and followed by further subclustering of those clusters of interest across all cell strains Figure . This ancytochrome P4502A13 (CYP2A13) and dihydrodiol dehydrogenase. Although expression was slightly increased at one time point, the temporal patterns were slightly different , immune response (cyclophilin), and apoptosis (MAD-3). These genes showed a consistent increase in expression following exposure to OTQ (Table MAP kinase kinase), cell metabolism genes , and transcription factors (E1A enhancer).From the full list of genes that fit these criteria, selected genes were chosen due to their potential role in carcinogenesis, whether by cell cycle control, immune response or other specific functions. Functions were described as annotated by NetAffx . These graf oncogene, GADD45, EWS, Cyclin D1) as well as immune response , cell proliferation (TGFβ), and RNA processing (HnRNP F protein).Some genes of interest were variably altered by strain, examples of which are also listed in Table prohibitin, DDH, and CYP2A13 at 24 h showed a decrease in expression in some of the cell strains analyzed. Samples not available for RT-PCR analysis are listed as N/A in Table Real-time PCR was used to confirm and extend results seen by microarray analysis for selected genes. Following the original microarray analysis, patterns of some genes appeared to be changing at the latest time point 120 min), so extended time points were selected (12 and 24 h) to see a more complete expression profile for these genes. Due to limited amount of cDNA, genes were analyzed at 15 min and/or 120 min, and then analyzed at 12 and 24 h by RT-PCR. Extended time points were selected to look at specific genes found altered at the earlier time points. These genes were selected due to their function and/or pattern of expression, and determining their expression pattern at later time points was of interest. Results are shown in Table 0 min, soThe purpose of this study was to determine if microarray analysis of four normal human mammary cell strains with a known haplotype could be used to find biomarkers related to either exposure in general or the specific haplotype in question. The use of only four cell strains was determined to have enough power to provide basic information to lead to further study if necessary. This study would be followed up for specific genes of interest in a larger number of cell strains, preferably bypassing the more expensive and time-consuming microarray analysis for RT-PCR only.DNA microarray analysis was used to profile the cellular response to OTQ, a quinoxaline pesticide. Analysis revealed genes with common response across the four human cell strains studied as well as inter-individual variation in response. Using only four normal human cell strains, our goal was to discover any distinctly altered genes in response to OTQ exposure. Future analysis with a larger number of cell strains will be used to follow-up this analysis on specific genes of interest.The majority of studies looking at gene expression profiles have used animal models, limiting any knowledge obtained to genetically similar organisms. Analysis with normal human cell strains, like those described here, will give more information on inter-individual variation in response to various chemicals. This information will yield clues to the metabolic pathways of the specific chemicals, and this increased knowledge will aid in determining potential hazards in the environment and the workplace. Given the large number of pesticides in use today, further examination of the effect of these chemicals on individuals is warranted.junB and cfos (the AP1 complex). A number of genes involved in carcinogenesis were found altered after exposure to OTQ, both induced and down-regulated. For example, prohibitin expression is found to be up-regulated in most cell strains after OTQ exposure, with similar expression patterns associated with a decrease in cancer incidence [Following exposure to OTQ, NHMECs showed alterations in genes involved in a variety of functions. These included xenobiotic metabolism, transcription, and DNA synthesis. Genes altered as a result of OTQ exposure in all strains analyzed included transcription factors like ncidence .cytochome P4502A13 (CYP2A13) and dihydrodiol dehydrogenase, are involved in xenobiotic metabolism. It has been suggested that CYP2A13 is the main metabolic activator of 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK), a tobacco-specific nitrosamine [CYP2A13 begins to wane at the final time point tested, suggesting this alteration to be somewhat transient. This is an unusual expression pattern for a cytochrome p450, as genes in this family tend to show a gradual increase in induction, and an equally gradual decrease in expression. Further analysis by RT-PCR showed that this p450 was increased at later time points , cyclin D1 (Z29087), and BTF2 (U72649) may further support an association between OTQ exposure, p53 variant status and carcinogenesis [GADD45 transcription in response to DNA damage, which is associated with an increase in cell cycle arrest and DNA damage repair, while increased levels of raf oncogene have been associated with lung carcinogenesis [Inter-individual variation as a result of genetic polymorphisms in genes of interest would focus on specific at-risk worker populations. For example, the four cell strains analyzed in this study have been genotyped for a variety of genes, in particular those involved in cell cycle control and xenobiotic metabolism. Two of the four cell strains selected for analysis are heterozygote for the minor variant haplotype of p53, a cell cycle control gene (cell strains 3 and 4). Although no biological mechanism for the role of this variant in carcinogenesis has been defined, several studies associating this haplotype with various cancers support such role -35. Analogenesis -38. Of togenesis -41.p53 variants in gene expression differences. Due to the expense of microarray analysis, this is performed in only a limited number of cell strains (4), and selected genes will be further analyzed with |RT-PCR in a larger number of cell strains. Over 80 cell strains have been established in our laboratory to date, with half of these having been genotyped for p53. However, given that this haplotype is found only in a limited portion of the population, this varied pattern of expression in key genes in cell cycle control may highlight a specific at-risk population.Given the small number of cell strains used, this analysis needs to be extended to additional cell strains to determine the role of the Searches for similar natural compounds to replace these potentially disruptive chemicals can also use gene expression profiles . ProfileCYP2A13 and dihydrodiol dehydrogenase. The results shown here do not suggest a direct role of OTQ in carcinogenesis. They do, however, suggest OTQ exposure leads to an increase in expression of genes that do play a direct role in carcinogen; metabolism [The overall goal of this project was to create a gene expression profile for OTQ or related pesticide analogues with the hopes of finding genes to be used as potential biomarkers of exposure. This expression profile may also be used to determine the final role of OTQ in carcinogenesis by comparing it to profiles of known carcinogens. It is possible that the main effect of OTQ exposure is not on the direct alterations in many genes, but on alterations in genes potentially involved in carcinogenesis, among them the examples of cancer) ,43.Discovery of genes altered following exposure to OTQ in human cell strains may aid in future epidemiology studies on pesticide exposures. Gene expression profiling can be used to yield genetic biomarkers of exposure that, after validation, could be used in a clinical setting for early determination of organophosphate exposure, increasing early treatment of pesticide illness and thereby increasing the recovery rate of exposed individuals.OTQ, oxythioquinoxDDH, dihydrodiol dehydrogenaseDMSO, dimethylsulfoxideSLR, signal log ratioDMT, Data Mining Tool™MAS, Microarray Suite™SOM, self-organizing mapNHMEC, normal human mammary epithelial cellRT-PCR, real-time polymerase chain reactionNone declared.MRG participated in the design of the study, and performed all experiments. DLW was responsible for the growth and maintenance of all cell strains used. AW conceived of the study and participated in the design and coordination. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

Escherichia coli strain in which RecBCD has been genetically replaced by the bacteriophage λ Red system engages in efficient recombination between its chromosome and linear double-stranded DNA species sharing sequences with the chromosome. Previous studies of this experimental system have focused on a gene replacement-type event, in which a 3.5 kbp dsDNA consisting of the cat gene and flanking lac operon sequences recombines with the E. coli chromosome to generate a chloramphenicol-resistant Lac- recombinant. The dsDNA was delivered into the cell as part of the chromosome of a non-replicating λ vector, from which it was released by the action of a restriction endonuclease in the infected cell. This study characterizes the genetic requirements and outcomes of a variety of additional Red-promoted homologous recombination events producing Lac+ recombinants.An cat was not frequently co-inherited with cat. (5) Recombination between phage sequences in the linear DNA and cryptic prophages in the chromosome was responsible for most of the observed Lac+ recombinants. In addition, observations were made concerning recombination events between the chromosome and circular DNAs: (6) Formation of recombinants depended upon both RecA and, to a lesser extent, Red. (7) The linked tetracycline-resistance marker was frequently co-inherited in this case.A number of observations concerning recombination events between the chromosome and linear DNAs were made: (1) Formation of Lac+ and Lac- recombinants depended upon the same recombination functions. (2) High multiplicity and high chromosome copy number favored Lac+ recombinant formation. (3) The Lac+ recombinants were unstable, segregating Lac- progeny. (4) A tetracycline-resistance marker in a site of the phage chromosome distant from lac and cryptic prophage sequences in the chromosome generates a partial duplication of the bacterial chromosome. When the incoming DNA species is circular rather than linear, cointegrates are the most frequent type of recombinant.The Lac+ recombinants arise from events in which homologous recombination between the incoming linear DNA and both Escherichia coli strain in which RecBCD has been genetically replaced by Red exhibits greatly elevated levels of recombination between its chromosome and short linear double-stranded DNA species sharing sequences with the chromosome [The Red recombination system of bacteriophage λ promotes efficient double strand break repair/recombination. An romosome .cat gene and flanking lac operon sequences recombines with the E. coli chromosome to generate a chloramphenicol-resistant Lac- recombinant [red and the bacterial recombination genes recA, recF, recO, recR, recQ, ruvAB, and ruvC. Large numbers of chloramphenicol-resistant Lac+ recombinants were generated in these crosses as well. In this study, we characterize the Lac+ recombinants and the processes which generate them. Most appear to arise from events in which homologous recombination between the incoming DNA and the chromosome generates a partial duplication of the bacterial chromosome.In previous studies, we have characterized a recombination event, pictured in Figure ombinant -4. The drecA, recF, recO, recR, recQ, ruvAB, and ruvC. Deletion of recG increased the production of both Lac+ and Lac- recombinants. Lac+ recombinants accounted for 10–60% of the total chloramphenicol-resistant offspring of the crosses. These results strongly suggest that formation of the Lac+ recombinants takes place via homologous recombination, though they do not rule out the possibility that non-homologous end joining, or other varieties of "illegitimate" recombination, might be involved as well.Data presented in Table lac::cat sequences would be attached to phage sequences. Heitman et al. [in vivo are rapidly repaired by DNA ligase. The results of previous physical studies with other substituted λ phages cut in vivo by PaeR7 lead to the expectation that the λ lac::cat819 chromosome would be uncut, or only singly cut, much of the time in the infected cell [The reason for considering mechanisms other than homologous recombination in the formation of the Lac+ recombinants is because of the expectation that some of the phage-borne n et al. showed tted cell ,6.lacZ (not shown). When the lac::cat dsDNA was delivered into the cell by a λ vector bearing a tetracycline resistance determinant (Δ nin::tet859 – described below) neither the Lac+ nor Lac- recombinants acquired tetracycline resistance. These findings suggest that the process which formed the recombinants did not involve the entire phage chromosome.Preliminary characterization of the Lac+ recombinants formed in cells which were wild-type for all the recombination functions revealed that most, possibly all, were unstable. When streaked on plates containing chloramphenicol and X-Gal, they segregated Lac- (colorless) progeny at variable frequencies. Southern gel analysis of chromosomal DNA from unstable Lac+ recombinants revealed that some of them were multiploid for lac locus, will produce a Lac+, chloramphenicol-resistant recombinant. Data presented below, in which simpler lac::cat recombining substrates generate Lac+ recombinants at a frequency approximately 1000-fold lower than Lac-, suggest the frequency of spontaneous lac duplications in Red+ but otherwise wild type E. coli is approximately 10-3, consistent with estimates of spontaneous duplication frequency in Salmonella made by Roth et al. [A baseline level of Lac+ recombinants was to be expected in these crosses. The recombination event pictured in Figure h et al. . The Laclac::cat segment were to recombine with more than one chromosome at a time. Further complicating interpretation of the experiment, the cells were infected at a multiplicity of 10 phages per cell.The crosses described above were done by infecting log phase host cells grown in rich medium. Such cells contain multiple copies of their chromosome. Complications might arise if the lac::cat segment and single copies of the bacterial chromosome. As shown in Table To reduce the complexity of the system, we switched to a cross procedure involving low multiplicity infection (0.1 phage per cell) of stationary phase cells. Presumably, under these conditions, most of the events producing chloramphenicol-resistant recombinants take place between single copies of the lac::cat, which are diagrammed in Figure lac::cat819, the progenitor of this series, has two PaeR7 sites. Upon infecting a host cell bearing the Δ recBCD::Ptac-gam-bet-exo-pae-cI substitution, it injects its chromosome, which circularizes. Expression of its lytic genes, including those necessary for phage DNA replication, is blocked by the action of cI repressor. Cutting of its chromosome by the PaeR7 restriction endonuclease in the infected cell releases a 3.5 kbp linear dsDNA, consisting of the cat gene and 1.3 kbp flanks of lac sequences on the right and left. . The ends of the flanking lac sequences match precisely their counterparts in the chromosome.To examine the dependence of Lac- and Lac+ recombinant formation on the structure of the DNA substrate, we constructed variants of λ lac::cat930 and λ lac::cat931 have only single PaeR7 sites, on the right and left, respectively. Cutting by PaeR7 in the infected cell should produce large linear dsDNAs related to the lac::cat819 fragment, but with long tails of non-homologous DNA extending from the left and right sides, respectively. Interestingly, both of these single-cut phages produce recombinants more efficiently than the double-cut λ lac::cat819, in both recG+ and Δ recG backgrounds Some of the λ lac::cat929 chromosomes might be cut by the EcoK restriction endonuclease. The infected cells contained a functional EcoK restriction-modification system. λ lac::cat929 was grown in a similarly EcoK+ host, and therefore was presumably EcoK-modified. However, if the modification were not complete, there might be residual EcoK restriction activity, resulting in 10% of the phage chromosomes being cut. . (2) The production of the recombinants might not be Red-mediated. (3) The linear partner might be a broken bacterial chromosome.Approximately half of the strongly chloramphenicol-resistant recombinants generated by the uncuttable phage λ partner . How, thhsdR, with a tetracycline resistance determinant. This replacement had little effect on the formation of recombinants by λ lac::cat929 . A fourth event, also not shown, involves recombination between λ genes and homologues in cryptic prophages in the E. coli chromosome (discussed below). As suggested in the figure, cointegrates formed by recombination in the right-side lac flank are phenotypically Lac-, while recombination in the left-side lac flank (or other loci) forms Lac+ recombinants. To test this idea, we constructed variants of λ lac::cat missing either or both lac flanks; they are diagrammed in Figure Cointegrates could in principle be formed by four different single reciprocal recombination events between the circular λ cat cassette with 1000 bp homologous flanks was only 10-fold more efficient than one with 40 bp flanks. Their experiments were done with cells which had been subjected to heat shock and electroporation. To test the efficiency of short-flank recombination under less extreme conditions, we constructed a short-flank λ lac::cat variant.The ability of the λ Red system to promote recombination events involving short sequence homologies makes it particularly useful for genetic engineering. Yu et al. reportedlac::cat921 consists of the cat gene flanked by 40 bp sequences corresponding exactly to the terminal 40 bp at each end of the 1.3 kbp flanks of λ lac::cat819. As shown in Table lac::cat921 exhibits a several hundred-fold lower efficiency of recombinant formation than its long-flank counterpart, in both recG+ and Δ recG backgrounds. λ lac::cat921 was similarly inefficient in log phase cells (data not shown). These observations suggest that short-flank recombination may not be a significant activity of the Red system in nature. However, they do not speak to the question of whether long flanks work better because they provide a larger homology target for synapsis, or because they provide non sequence-specific protection, perhaps delaying exonucleolytic degradation of the recombining sequences long enough to permit recombination to take place.The fragment released by PaeR7 from the chromosome of λ lac::cat930, but not by the left side-cut λ lac::cat931 cloning the cat gene from the deletion mutant, along with flanking chromosomal sequences; (3) using the cloned, plasmid-borne flanking sequences, and Red-mediated gap repair, to clone the lac operon in a plasmid; (4) inverting the lac operon, relative to its flanking sequences, in the plasmid; (5) replacing the Δ lac::cat chromosomal allele with the plasmid-borne lac-inv allele.The strategy for inverting the chromosomal lac::cat930 and lac::cat931 alleles were constructed by replacing the left-side and right-side PaeR7 sites, respectively, of pTP819, with XbaI sites. To produce inverted derivatives of these two alleles, the plasmids pTP930 and pTP931 were digested with XbaI and XhoI (a PaeR7 isoschizomer); lac::cat inserts and bla-ori backbone fragments from the two plasmids were exchanged. The inverted alleles were then crossed into phage λ, as described in the Methods section.The single-cut E. coli K-12 [lac::cat930 and λ lac::cat931, and the efficiency of Lac+ recombinant formation by λ lac::cat930, were slightly elevated relative to those in the corresponding AB1157-derived strain.In constructing the chromosomal inversion, we switched genetic backgrounds, from the AB1157-derived strains with which most recombination studies have been done, to MG1655, the sequenced wild type oli K-12 . In the lac-inverted E. coli) were tested for Lac+ recombinant formation. The results are shown in Figure lac::cat930 in lac-wild type, and lac::cat1033 in lac-inv.The eight combinations of normal and inverted phages and bacteria lacking its sequences derived from phage P22 was equally proficient at generating Lac+ recombinants. A derivative missing the left lac flank made Lac+ recombinants almost exclusively; the small number of Lac- recombinants in this case probably represent cointegrates made by uncut plasmid DNA in the fragment preparation.We constructed several other linear DNA substrates to test the generality of the model in Figure ion and λ lac::cat930 (cut right) behave like their counterparts generated by electroporation of linear dsDNAs into Red+ cells: they segregate Lac- chloramphenicol-resistant clones at low frequency, and Lac+ chloramphenicol-sensitives at high frequency (data not shown). In addition, their formation also depends upon the presence of cryptic prophages in the chromosome: λ lac::cat819 was found to produce Lac+ chloramphenicol-resistant recombinants as only 0.13% (average of six measurements) of the total chloramphenicol-resistant progeny in crosses with TP750. These properties suggested both kinds of recombinant might have the same structures as well, but PCR tests of 50 of the phage-generated recombinants with the primers used to demonstrate type I, II, and III recombinants when electroporated directly into cells .One aspect of Lac+ recombinant formation by λ ls Table . How doelac::cat-bearing λ phages and the bacterial chromosome, as well as the mechanism of their formation. Our studies uncovered a diversity of recombinant structures, including complex duplications and cointegrates. Recombination between λ and cryptic prophage sequences in the bacterial chromosome was found to be the most significant mechanism generating Lac+ recombinants. All of the Lac+ recombinants could be generated by homologous recombination events of types which have been previously described. In particular, there was no evidence for end-joining or other non-homologous recombination events. Perhaps the most surprising finding was the high frequency with which large duplications in the bacterial chromosome – up to 1 Mbp – could be generated by the Red system.The bacteriophage λ Red recombination system is of general interest for two main reasons. First, it is an intensively characterized and relatively simple system, which serves as a model for studies of homologous recombination -17. SecoE. coli strain DH5α (λ pir) [hsdR::tet allele in TP842 was constructed by using a Tn 10-containing E. coli strain as template in PCR with primers hsdRut (5'-TTGGACAGGCCCGCACAGCAATGGATTAATAACAATGATGCTCGACATCTTGGTTACCGT-3') and hsdRdt (5'-GCTGAATTTGCCCAGCAGGGTATCGAGATTATCGTCAAAGCGCGGAATAACATCATTTGG-3'). The Δ lac::cat allele in TP872 was constructed by using a Tn 9-containing E. coli strain as template in PCR with primers cat15 (5'-TCTGGTGGCCGGAAGGCGAAGCGGCATGCATTTACGTTGAATGAGACGTTGATCGGCACG-3') and cat16 (5'-AGAGTACATCTCGCCGTTTTTTCTCAATTCATGGTGTACAATTCAGGCGTAGCACCAGGC-3'). (λ pir) was usedcI857 Sam7 containing the nin region genes was cloned into the EcoR1 site of pBR322. In the resulting plasmid, pnin, the nin genes are read clockwise in the conventional map of pBR322. pTP772 was constructed by deleting sequences between the two HindIII sites of pnin. pTP859 was constructed by cutting pTP772 with SacII and ClaI, blunting the ends with T4 DNA polymerase, ligating with NotI linkers (5'-AGCGGCCGCT-3'), cutting with NotI, and ligating with a NotI fragment of pTP857 [tetR and tetA genes of transposon Tn10.An EcoR1 fragment of λ f pTP857 containicat gene is flanked on both sides by lac sequences, PaeR7 sites, and λ sequences (for crossing into the phage), has been described [lac flank and PaeR7 site. pTP922 was constructed by deleting the lac and cat sequences between the two PaeR7 sites in pTP819. . pTP926, pTP927, and pTP928 were constructed by ligating the oligonucleotide 5'-TCGACAGTCTAGACTG-3' into the PaeR7 sites of pTP828, pTP829, and pTP922, respectively, eliminating the PaeR7 sites and replacing them with XbaI sites. pTP929 was constructed by ligating the XbaI-NcoI fragment of pTP926 containing the N-terminal coding sequences of cat and the NcoI-XbaI fragment of pTP927 containing the C-terminal coding sequence of cat into the XbaI site of pTP928. The orientation of the reconstructed cat gene is the same as in pTP819. pTP930 was constructed by ligating together the large ApaI-SacII fragment of pTP929 and the small ApaI-SacII fragment of pTP819. pTP931 was constructed by ligating together the small ApaI-SacII fragment of pTP929 and the large ApaI-SacII fragment of pTP819.pTP819, in which the escribed . pTP828 cat gene from a Tn9-containing E. coli strain with primers 5'-GACGCACTCGAGGCGTTAACCGTCACGAGCATCATCCTCTGCATGGTCAGGCCGGCCACTGGAGCACCTCAAAAACACCA-3' and 5'-GACGCACTCGAGGCACACAGCGCCCAGCCAACACAGCCAAACATCCGCGCGGGCCCGACCGGGTCGAATTTGCTTTCGAA-3'. The presence of the expected sequences from the synthetic oligonucleotides in pTP921 DNA was verified by automated sequencing (data not shown).pTP921 was constructed by ligating together two XhoI-digested DNAs: pTP922 and a PCR product made by amplifying the lac flank only) was constructed by replacing the XbaI-ApaI lacZY segment of pTP930 with a mixture of two oligonucleotides, 5'-CTAGTTGCAAGCTTGGGCC-3' and 5'-CAAGCTTGCAA-3'. pTP989 (right lac flank only) was constructed by replacing the NgoMI-XhoI lacZ segment of pTP930 with a mixture of two oligonucleotides, 5'-CCGGCAAGCTTGCTGGTGGGCAA-3' and 5'-TCGATTGCCACCAGCAAGCTTG-3'. pTP995 (no lac flank) was constructed by ligating together the small NcoI fragment of pTP988 and the large, ori-containing NcoI fragment of pTP989.pTP988 (left cat-containing fragment of pTP930 and the XbaI- and PaeR7-ended ori-containing fragment of pTP931. pTP1033 was constructed by ligating together the XbaI- and PaeR7-ended cat-containing fragment of pTP931 and the XbaI- and PaeR7-ended ori-containing fragment of pTP930.pTP1032 was constructed by ligating together the XbaI- and PaeR7-ended cat gene and flanking sequences from strain TP872 (Δ lac::cat) with primers 5'-CATCATCACGCGGCCGCGACGTTTGCCGCTTCTGAA-3' and 5'-ATCATCCACGCGGCCGCTGCGTTTTGCACCAGTACG-3'. In pTP1016, the cat gene is flanked closely by unique SphI and BsrGI sites. pTP1027 was constructed by electroporating SphI- and BsrGI-digested pTP1016 into strain TP829 (lac+); a plasmid formed by gap repair was isolated. pTP1028 was constructed by ligating SphI-digested pTP1027 with the oligonucleotide 5'-GTTGTACAACCATG-3', converting the SphI site into a BsrGI site. pTP1034 was constructed by cutting pTP1028 with BsrGI, ligating the two fragments back together, and screening for plasmids in which the lac genes were inverted relative to their flanking sequences.pTP1016 was constructed by ligating into the NotI site of pTP809 the NotIpir function, was constructed by ligating together two AatII- and Bam-digested DNA species: a PCR product made by amplifying a Tn10-containing E. coli strain with primers 5'-TCAACGTAAATGCATGGACGTCCTCGACATCTTGGTTACCGT-3' and 5'-TGTACACCATGAATTGGATCCCGCGGAATAACATCATTTGG-3'; and the ori-containing fragment of plasmid pLD54 [lac::cat-containing fragments of pTP819, 930, 931, 1032, and 1033, respectively, into the BamHI site of pTP1029.pTP1029, a tetracycline resistance bearing vector capable of replicating only in cells expressing R6K id pLD54 . pTP1018cat-containing fragment of pTP1051 into the BamHI site of pTP1029.pTP1047 was constructed by ligating the complementary oligonucleotides 5'-TCGTCTAGAGT-3' and 5'-CCGGACTCTAGACGAAGCT-3' between the SacI and NgoMIV sites of pTP1019. pTP1051 was constructed by ligating the complementary oligonucleotides 5'-CAGCATGCAT-3' and 5'-CTAGATGCATGCTGGTAC-3' between the KpnI and XbaI sites of pTP930. pTP1052 was constructed by ligating the complementary oligonucleotides 5'-CAGCATGCAGGGCC-3' and 5'-CTGCATGCTGGTAC-3' between the KpnI and ApaI sites of pTP1019. pTP1053 was constructed by ligating the complementary oligonucleotides 5'-GGCATGCAGGTTCTTTGAGTCCTTTGGGCGGCCGCGGGCC-3' and 5'-CGCGGCCGCCCAAAGGACTCAAAGAACCTGCATGCCGC-3' between the SacII and ApaI sites of pTP1019. pTP1054 was constructed by ligating the complementary oligonucleotides 5'-CCGGCGCGGCCGCAGGTTCTTTGAGTCCTTTGGTGTACAGAGCT-3' and 5'-CTGTACACCAAAGGACTCAAAGAACCTGCGGCCGCG-3' between the NgoMIV and SacI sites of pTP1020. pTP1055 was constructed by ligating the small SphI-NotI fragment of pTP1016 between the SphI and NotI sites of pTP1053. pTP1056 was constructed by ligating the small NotI-BsrGI fragment of pTP1016 between the NotI and BsrGI sites of pTP1054. pTP1057 was constructed by ligating the BamHI Ptac-gam-bet-exo-pae-cI operon flanked by sequences upstream from recC on one side and sequences internal to recD on the other, has been described [cI gene from E. coli strain TP507 with the same primers used in the construction of pTPP822. This construction has the effect of simply deleting the pae genes from pTP822. pTP996 was constructed by deleting the C-terminal coding sequences of bet and the N-terminal coding sequences of exo between the two HpaI sites of pTP978. pTP979 was constructed by ligating together two NcoI- and XbaI-digested DNAs: pTP822 and a PCR product made by amplifying the bla gene from pBR322 with primers 5'-CCACCAATCATCCATGGCGCGGAACCCCTATTTGTTT-3' and 5'-TTGTTGGACGATCTAGAGGTCTGACAGTTACCAATGC-3'. This construction has the effect of replacing pae and cI with bla.pTP822, which bears a synthetic lac::cat819 and λ lac::cat819 nin5 have been described [nin::tet859 was made by crossing λ wild type with plasmid pTP859, infecting a tetracycline-sensitive strain with the resulting lysate, and selecting a tetracycline-resistant lysogen. The Δ nin::tet859 substitution replaces λ bp 40388–43825 with the tetR and tetA genes of transposon Tn 10.λ escribed . λΔ nin:lac::cat921, 929, 930, 931, 988, 989, 995, 1032, and 1033 substitutions were crossed into λ wild type and/or λ Δ nin::tet859. The parent phages were crossed with the cat substitution-bearing plasmids. Phages which had acquired the substitution were either selected by plating on a strain lysogenic for phage P2 (Spi- phenotype), or identified by their clear-plaque morphologies . The structures of the substituted phages were all verified by their ability to generate specific products when used as templates in PCR (not shown).The 4), and shaken with chloroform. Two methods for crosses monitoring recombination between phage-injected DNA and the bacterial chromosome, both previously described, were employed: high-multiplicity infection of log phase cultures [Phages were crossed with plasmids by spotting enough phage to make a confluent zone of lysis on a lawn of a sensitive bacterial strain bearing the parent plasmid. After overnight incubation at 37°C, material from the zone was collected in TM dimethylsulfoxide, 20 mM Tris-HCl pH 8.4, 50 mM KCl, and primers at 0.7 μM. Samples were heated to 95C for 5 min, then put through 30 cycles of 94C for 1 min, 55C for 1 min, 72C for 2–4 min, depending upon the length of the expected products. Primers for demonstrating the type I, II, and III tfa junctions were combined in a single mixture of 4 oligonucleotides: Jsp1 (GTTGAATGGGCGGATGCTAA), Jsp2 (TCTTCCACCAGAAAGCTACC), JncA (TGCCGTGTGAACGGTTTAC), and Jnc2 (TTCTAGCCCCATCATCTGTG). Primers for spanning the ACF-generated duplication and Csj2 (CGAATAGTCGGCTCAACGTGGGTT).The structures of various Red-generated duplications in the PCR: polymerase chain reaction. X-Gal: 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside. IPTG: isopropyl β-D-thiogalactopyranoside. bp: base pairs.ACF carried out the experiments summarized in Table

HTLV-1 is the etiological agent of adult T-cell leukemia (ATL), the neurological syndrome TSP/HAM and certain other clinical disorders. The viral Tax protein is considered to play a central role in the process leading to ATL. Tax modulates the expression of many viral and cellular genes through the CREB/ATF-, SRF- and NF-κB-associated pathways. In addition, Tax employs the CBP/p300 and p/CAF co-activators for implementing the full transcriptional activation competence of each of these pathways. Tax also affects the function of various other regulatory proteins by direct protein-protein interaction. Through these activities Tax sets the infected T-cells into continuous uncontrolled replication and destabilizes their genome by interfering with the function of telomerase and topoisomerase-I and by inhibiting DNA repair. Furthermore, Tax prevents cell cycle arrest and apoptosis that would otherwise be induced by the unrepaired DNA damage and enables, thereby, accumulation of mutations that can contribute to the leukemogenic process. Together, these capacities render Tax highly oncogenic as reflected by its ability to transform rodent fibroblasts and primary human T-cells and to induce tumors in transgenic mice. In this article we discuss these effects of Tax and their apparent contribution to the HTLV-1 associated leukemogenic process. Notably, however, shortly after infection the virus enters into a latent state, in which viral gene expression is low in most of the HTLV-1 carriers' infected T-cells and so is the level of Tax protein, although rare infected cells may still display high viral RNA. This low Tax level is evidently insufficient for exerting its multiple oncogenic effects. Therefore, we propose that the latent virus must be activated, at least temporarily, in order to elevate Tax to its effective level and that during this transient activation state the infected cells may acquire some oncogenic mutations which can enable them to further progress towards ATL even if the activated virus is re-suppressed after a while. We conclude this review by outlining an hypothetical flow of events from the initial virus infection up to the ultimate ATL development and comment on the risk factors leading to ATL development in some people and to TSP/HAM in others. After binding to the CArG box, SRF protein interacts with the ternary complex factors (TCFs), which consequently bind to the upstream Ets box. In addition, SRF requires for its transcriptional activity the CBP/p300 and p/CAF co-activators [HTLV-1 infected and Tax-expressing T-cell lines display increased expression of immediate early genes such as c-Fos, c-Jun, JunB, JunD and Fra-1, which are components of the dimeric transcription factors AP1, Egr-1 and Egr-2 , fra-1 , Krox-20tivators .Tax activates these immediate early genes by interacting with SRF ,78 and wA substantial part of Tax oncogenic potential is attributed to its ability to activate transcription factors of the NF-κB family, since these factors regulate the expression of numerous cellular genes associatIn non-activated state NF-κB factors are trapped in the cytoplasm, tightly associated with inhibitory proteins called IκBs, primarily with IκBα and IκBβ. These inhibitors contain ankyrin repeats through which they bind to the RHD of the NF-κB factors and mask their nuclear localization signal (NLS) . In addi on serine19 and serine23 [ share a 52% amino acid identity and a similar domain structure that includes amino-terminal kinase domain, a dimerization leucine zipper domain, and helix-loop-helix motifs, which are involved in regulating their kinase activity [The cytoplasmic phase includes phosphorylation of IκBα on serine32 and serine36 and of IκBr (NEMO) ,90 Fig. , No. 2b,erine181 ,94. Desperine181 ,95,96. Terine181 ,98 can bind the CBP/p300 and P/CAF coactivators which are essential for the transcriptional competence of p65(RelA):p65(RelA) and p65(RelA):p50 dimers . This bi and maintains, in this manner, a persistent NF-κB transcriptional activation [In addition to its cytoplasmic inhibitory function IκBα plays an important regulatory role in the nucleus too. IκBα has an NLS signal which enables its translocation to the nucleus where it is protected from the signal-induced degradation described above . Within tivation . has also been found to have an important role in the nucleus and IKKα for CBP/p300 The most widely accepted concept is that Tax associates with the IKK complex through the adaptor IKKγ/NEMO subunit. Tax also binds to the upstream kinases, MEKK1 and NIK and enhances their kinase activity. In this manner Tax connects these activated kinases to IKKγ/NEMO and recruits their kinase activity to phosphorylate IKK and IKKβ [b) Tax can bind directly to IKK and IKK and activates their kinase activity independently of their phosphorylation by the upstream signal-induced kinases [c) Tax can bind directly to the IκBs and induce their proteosomal degradation independently of their phosphorylation by IKK [In contrast to the transient NF-κB activation by external signals, NF-κB factors are constitutively activated by HTLV-1 Tax protein in Tax-expressing and HTLV-1-infected cells. Reported studies suggest that Tax may exert this activation in three ways: and IKKβ ,120-122 and IKKβ . b) Tax kinases Fig. 3,,a The mon by IKK ,125 is involved in DNA synthesis and maintenance of the genome stability by participating in DNA repair and chromosome condensation. It alters DNA topology by transiently breaking one strand of the DNA, passing the other strand through the break and finally resealing the break . Tax hasAll the above effects of Tax which enhance mutations and other chromosomal aberrations and interfere with DNA repair should be expected to induce cell cycle arrest or apoptosis. This, in turn, should prevent further progression of the leukemogenic process in the infected cells, unless such cells can, somehow, escape the cell cycle arrest and apoptosis. There is a substantial controversy over the influence of Tax on the cell response to stress insults. While many studies have demonstrated that Tax protects cells from stress-induced cell cycle arrest or apoptosis -186, othNumerous studies have been focused on investigating Tax oncogenic potential in cultured cells and animal models. Most of them used plasmids expressing w.t. Tax or various Tax mutants under the control of HTLV-1 LTR or other different promoters. It was only few years ago that an infectious clone of the entire HTLV-1 genome was constructed and appropriate cell culture techniques were developed to introduce this clone into human primary PBLs. This clone was found as capable of propagating in cultured mammalian cells and to transform primary human T-lymphocytes -197. ThiWAF-1 which prevents apoptosis and enhances the replication of the transformed cells [Tax has been shown to induce neoplastic transformation of the rat fibroblast Rat-1 -203 and ed cells . The cooed cells . It shoued cells . Therefoed cells ,153,165.WAF-1 [A closer insight into the ATL leukemogenesis has been gained through studies using primary human T-lymphocytes. Such experiments have revealed that after infection in culture with HTLV-1 or permanent transfection with Tax, primary human T-cells undergo two stages of cellular changes. In the first stage the cell become immortalized but still remain dependent on IL-2 for their growth . This imWAF-1 and to bWAF-1 . StudiesWAF-1 ,208, othWAF-1 . On the WAF-1 . In addiWAF-1 ,210.In the second stage few IL-2-independent clones of transformed cell emerge. Such transformed cells display an IL-2-independent constitutive activation of the IL-2 receptor (IL-2R) signaling pathway that includes the Janus kinases JAK1 and JAK3, and the signal transducers and activators of transcription STAT3 and STAT5, which are constitutively active in such cells ,211-213.Many of the above changes observed in the HTLV-1/Tax immortalized and transformed primary human T-cells are quite analogous to those found in ATL cells. However, while fresh leukemic cells from ATL patients, as well as cell lines derived from these leukemic cells, are successfully engrafted in SCID mice and their leukemic infiltration to various organs is similar to that seen in ATL patients , primaryTax transgenic mice have been widely used as models for investigating the oncogenic effects of Tax in-vivo, hoping to get closer insight to the ATL leukemogenic process in human . A wide Various modes of tumor induction by the transgenic Tax have been noted so far. Hall et al. have shoAs noted before, continuous Tax expression is required for maintaining the neoplastic phenotype of Rat-1 cells transformed by Tax in culture . In contINK4B and p16INK4A [KIP1 [In view of the above described pleiotropic effects of Tax, which are summarized in Fig. p16INK4A , p27KIP14A [KIP1 , p16 prepared the Fig.ures and together with author 2 (S-K.Y) covered the cited publications and prepared the draft of this review. Author 3 (A.M) designed the outlines of the review and together with the other two authors prepared the final version for submission. All authors read and approved the final manuscript.

It is known that there is an increase in the prevalence of allergy and that allergic diseases have a negative impact on individuals' health-related quality of life (HRQL). However, research in this field is mainly focused on individuals with verified allergy, i.e. leaving out those with self-reported allergy-like conditions but with no doctor-diagnosis. Furthermore, studies on food hypersensitivity and quality of life are scarce. In order to receive information about the extent to which adolescent females and males experience allergy-like conditions and the impact of these conditions on their everyday life, the present study aimed to investigate the magnitude of self-reported allergy-like conditions in adolescence and to evaluate their HRQL. Special focus was put on food hypersensitivity as a specific allergy-like condition and on gender differences.In connection with lessons completed at the children's school, a study-specific questionnaire and the generic instrument SF-36 were distributed to 1488 adolescents, 13–21 years old (response rate 97%).Sixty-four per cent of the respondents reported some kind of allergy-like condition: 46% reported hypersensitivity to defined substances and 51% reported allergic diseases . A total of 19% reported food hypersensitivity. Females more often reported allergy-like conditions compared with males (p < 0.001). The adolescents with allergy-like conditions reported significantly lower HRQL (p < 0.001) in seven of the eight SF-36 health scales compared with adolescents without such conditions, regardless of whether the condition had been doctor-diagnosed or not. Most adolescents suffered from complex allergy-like conditions.The results indicate a need to consider the psychosocial impact of allergy-like conditions during school age. Further research is needed to elucidate the gender differences in this area. A team approach addressing better understanding of how allergy-like conditions impair the HRQL may improve the management of the adolescent's health problems, both in health-care services and in schools. An increase in the prevalence of asthma and atopy during the last two decades is documented for both children and adulIt is well known that there are more individuals with perceived hypersensitivity than individuals with verified/doctor-diagnosed allergy. This is especially true when it comes to perceived food hypersensitivity with up to tenfold higher figures versus verified food allergy ,6. PrevaResearch has demonstrated that allergic diseases have a negative impact on individuals' health-related quality of life (HRQL) and a number of studies describe HRQL-deteriorations in children and adults with asthma -12, eczeAdverse reactions to food constitute an important part of allergy-associated problems, especially among children. Still, studies on food allergy and HRQL are scarce. However, parental perception of physical and psychosocial functioning, measured with the Children's Health Questionnaire (CHQ-PF50), has shown that childhood food allergy has a significant emotional impact on the parent and limits the family activities . It has Previous studies have shown that adolescent males have a higher prevalence of atopy than adolescent females althoughResearch in the allergy field is mainly focused on individuals with verified allergy and their suffering from these conditions, i.e. leaving out those with self-reported allergy-like conditions but with no doctor-diagnosis. Still, one can presume that perceived allergy could have an impact on the health-related quality of life (HRQL) and involve suffering, regardless of verifiable diagnosis.In order to obtain information about the extent to which adolescent females and males themselves experience allergy-like conditions and the impact of these conditions on their everyday life, the present study aimed to investigate the magnitude of self-reported allergy-like conditions in adolescence and to evaluate their HRQL. Special focus was put on food hypersensitivity as a specific allergy-like condition and on gender differences.The present study involved adolescents at the senior level of the nine-year compulsory school and at the upper secondary school in a municipality in the south of Stockholm, Sweden. The socio-demographic distribution of the inhabitants in this municipality was slightly above in socio-economics and slightly below in number of immigrants compared with the country as a whole. A total of 2064 adolescents were registered in the schools at the relevant levels, all with the Swedish language as their school language.One week prior to starting the study (May 2003), an information letter outlining the purpose of the investigation, including an assurance of confidentiality and voluntary participation, was distributed to both the adolescents (n = 2064) and their parents. In connection with lessons at school, the teachers distributed questionnaires to the 1488 adolescents who were present at school. The instructions given by the teachers and the administration of the questionnaires were standardized. Two questionnaires were distributed together in one envelope, with the HRQL-questionnaire (se below) at the top. The adolescents themselves completed the questionnaires during that particular lesson. No other support was offered than the possibility to ask the teacher clarifying questions regarding the wording.After completion of the questionnaires, or in case of renouncing participation, each adolescent put the questionnaires into the envelope, sealed it, and handed it over to the teacher, who forwarded the envelopes to one of the authors (BM). The discrepancy between the number of registered adolescents (n = 2064) and the number, who were actually present when the data was collected (n = 1488), was partly due to the fact that it was close to the summer holiday and graduation and some adolescents attended activities outside school. The school records confirmed their absences. As 37 adolescents had not properly filled in the questionnaires, those were excluded from the study. In total 1451 questionnaires (97%) remained for data analysis. Age ranged between 13 and 21 years (mean 16.2 years), with 99% of the adolescents between 14 and 20 years. In total 696 females and 716 males had reported their gender. For 39 adolescents the gender was not reported.The terminology used in this study is according to ISAAC and EAACA study-specific questionnaire was used to evaluate the magnitude of allergy-like conditions during the past twelve months and to evaluate the frequency of allergy testing. The questionnaire, devised by the authors, was based on relevant literature on similar subjects . Prior t"Are you allergic or hypersensitive to any of the following?" "If you are allergic or hypersensitive to any food items, what reactions or symptoms do you perceive? ."in the past 12 months? (Yes/No)""Have you had asthma, wheezing or whistling in the chest In the past 12 months, have you had recurrent eczema or itchy rash for at least 6 months? (Yes/No)""In the past 12 months, have you had a problem with sneezing, or a runny, or a blocked nose when you did not have a cold? (Yes/No)""In the past 12 months, have you had a problem with itchy-watery eyes when you did not have a cold? (Yes/No)""The questions concerning allergic diseases were taken verbatim from the ISAAC study .The generic instrument Medical Outcome Trust Short Form 36 Health Survey (SF-36) was used to measure HRQL. SF-36 is a well-validated and reliable measure of HRQL in adults and adolescents from the age of 14, and normative data are available for the Swedish population . The SF-For statistical analyses the SPSS 11.0 program was used. SF-36 data was processed by means of an SPSS program provided by the HRQL-group at the University of Gothenburg, Sweden . InternaTo test differences in proportions between groups, the Chi-square test was used. The Student's t-test and, when appropriate, the one-way analysis of variance (ANOVA) were used to assess differences in means between groups. A p-value <0.05 was considered to be statistically significant.This study was approved by the Director of School Administration in Tyresö municipality and by the research ethics committee at Huddinge University Hospital.As shown in Table The adolescents suffered to a large extent from complex allergy-like conditions, i.e. hypersensitivity to multiple offending substances and/or allergic diseases. Fifty per cent of those with hypersensitivity (n = 334/663) reported more than one kind of offending substance and 35% of those who reported allergic diseases (n = 260/739) reported more than one type of disease. Fifty-one per cent of those with allergy-like conditions (n = 471/931) reported both hypersensitivity and allergic disease.Significantly more females than males reported allergy-like conditions Table . In addiOut of the 931 adolescents with allergy-like conditions, 404 (43%) reported that they had been tested for allergy by means of blood test or skin prick test (results not shown). For the majority (n = 324) of these adolescents with self-reported allergy testing, the tests had been performed during their school age years. Sixty-one per cent of those tested (n = 246/404) reported that the test results verified allergy. This figure corresponds to a 17% prevalence of self-reported verified allergy within the whole population of 1451 adolescents.In the group of 271 adolescents reporting food hypersensitivity, 139 (51%) reported allergy test results that verified some kind of allergy, albeit not necessarily food allergy (results not shown).The most common food-induced symptoms were OAS -like symptoms Table , i.e. itOffending food items reported were: nuts (39%), fruit and berries (35%), peanut (32%), almond (22%), tomato (19%), carrot (16%), lactose (12%), vegetables (10%), shellfish (9%), soy (7%), milk (7%), fish (5%) and egg (5%). Substances reported for less than five per cent of the 271 adolescents are not specified. For two food items there were significant gender differences. The offending food items fruit and berries were more commonly reported by females and peanut was more commonly reported by males .A total of 63 adolescents reported food as the only offending substance. However, the majority of the 271 adolescents who reported food hypersensitivity suffered from complex allergy-like conditions that included additional offending substances besides food (77%) as well as allergic diseases (78%). In this group of food hypersensitive adolescents there were significantly more males than females who reported hypersensitivity to furred animals and as regards hypersensitivity to nickel the result was reverse (n = 210/271) to those food hypersensitive adolescents who did not report such conditions (n = 61/271), the groups showed a similar pattern as regards the mental dimension scales of the SF-36, i.e. no statistically significant differences were found. As regards the physical dimension scales, the food hypersensitive adolescents who also reported allergic diseases scored significantly lower on BP (bodily pain) and GH Figure .A comparison within the whole group of adolescents with allergy-like conditions n = 931), i.e. between those who reported only hypersensitivity to any defined environmental substances (A), those who reported only allergic diseases (B), and those who reported both (C), showed that the three groups scored similar on the four health scales representing the mental dimension of the SF-36. As regards the physical dimension, adolescents with allergic diseases only (B) or in combination with hypersensitivity (C) scored lower on the health scales for bodily pain (BP) and general health (GH) compared with those with only hypersensitivity to defined substances (A) showed no significant difference. This is noteworthy, as the physical parameter often is in focus when health-care professionals assess an individual's state of health. However, it has been previously shown that in patients with asthma/wheezing, the link between lung function and HRQL is weak ,12 and tIn the present study we show that in adolescence, significantly more females than males experienced not just asthma/wheezing but also eczema/rash, rhino-conjunctivitis, and hypersensitivity to food, dust/mite and nickel. The females presented more complex allergy-like conditions compared with the males. In addition, females with allergy-like conditions showed more severe HRQL-deterioration compared with the males. It is known that female gender among adults implies a larger report of burden of health problems in general and SF-3Seventeen per cent of the adolescents, of whom the most part were tested during school age, reported positive allergy test results. It can be assumed that there were some additional adolescents with doctor-diagnosed allergy but without verifying test results. Thus, the total of adolescents doctor-diagnosed as having allergy may well be more than 17%. However, in the present study the focus was on self-reported (perceived or verified) allergy-like conditions. The mean SF-36 scores did not differ whether the adolescents reported objectively verified allergy or not. The lack of difference in HRQL was not surprising as a diagnostic test that verifies allergy says nothing about the individuals experience or the severity of the allergic condition.Most food allergies are something that children outgrow and adveFood items constituted a considerable part of the offending substances reported in this study and up to 41% of all adolescents with hypersensitivity specified at least one food item as an offending substance. Professional counselling and diagnostic procedures may to some extent be able to help the adolescents to reduce their food avoidance. Yet, this kind of perceived allergy-like condition – regardless of what the underlying mechanisms were – was evidently associated with HRQL-deterioration and the adolescents' experiences deserve sincere attention. Previous research show that food allergy in a child implies disruption in daily life and HRQL-deterioration for both the child and the family -21.A pattern emerged in this group of food hypersensitive adolescents, showing a great deal of hypersensitivity to pollen, rhino-conjunctivitis and OAS-like symptoms, which is in accordance with the well known cross-reactivity of pollen and food allergens . SignifiMore than half of the adolescents with food hypersensitivity reported positive allergy tests, but as a consequence of how the questions in the survey were asked, it is not known if they were verified as allergic specifically to food. However, a vast majority of the food hypersensitive adolescents did undoubtedly suffer from complex allergy or allergy-like conditions, which included multiple types of hypersensitivity and/or allergic diseases. This should require competence in health-care when trying to tackle the adolescents' multifaceted problems, including food hypersensitivity.The extensive number of adolescents who participated in the present survey, together with a very high answer rate, makes the results reliable. However, the sample of adolescents used in this study may limit the generalizability as the socio-demographic distribution in this particular municipality was slightly above in socio-economics and slightly below in number of immigrants compared with the country as a whole. Additional studies are warranted to confirm the results.The results of the present study emanate exclusively from adolescents' statements. There is always a risk that the respondents involved do not correctly remember things that were asked for in a questionnaire. However, our main interest was in adolescents' experiences of allergy-like conditions during the past twelve months and daily functioning during the past four weeks. Remembering correctly over a longer period of time was only of importance in questions about allergy testing. It seems likely that the adolescents would remember such events as skin prick tests or blood tests during their school age, although tests carried out in early childhood might have been unknown or forgotten.The magnitude of allergic diseases was measured by means of ISAAC-questions. The ISAAC questionnaire, which asks for events during the past 12 months, has been used in many countries all over the world and for many years. Its results constitute basis for international comparisons and it can be considered well validated. However, hypersensitivity items are not included in the ISAAC questionnaire. The questions in the present study about hypersensitivity were developed specifically for the present study and a pilot test was performed. Only lexical adjustments were needed.It could be discussed if the fact that the questionnaires asked for events during two distinct periods: 12 months and 4 weeks (daily functioning/SF-36) might have biased the present results. It is also possible that an allergy-specific HRQL measure instrument would give another picture of the physical scale in relation to allergy-like conditions.The prevalence of self-reported allergy-like conditions among adolescents was high – 64%. Significantly more females than males reported allergy-like conditions and females with allergy-like conditions showed more severe HRQL-deterioration compared with males with such conditions. The results indicate a need to consider not merely physical consequences but also the psychosocial quality of life impact of allergy-like conditions among both females and males. Further research is needed to elucidate the reasons behind the gender differences in this area.Most adolescents suffered from complex allergy-like conditions that included multiple types of hypersensitivity and/or allergic diseases. Food items constituted a considerable part of the offending substances reported. When attending to a young individual who suffers from an allergy-like condition, the whole syndrome should be in focus – not only one specific offending substance, or one specific hypersensitivity or allergic disease. A team approach accompanied by an understanding of how allergy-like conditions impair the quality of life may improve the management of the adolescent's health problems, both in health-care services and in schools.BM and GN conceived of the study. All authors made substantial contributions to conception, planning and design. BM carried out the acquisition, analysis and interpretation of data. BM drafted the manuscript. GN and SA have been involved in revising it critically for important intellectual content. All authors read and approved the final manuscript.

The identification of disease-associated genes using single nucleotide polymorphisms (SNPs) has been increasingly reported. In particular, the Affymetrix Mapping 10 K SNP microarray platform uses one PCR primer to amplify the DNA samples and determine the genotype of more than 10,000 SNPs in the human genome. This provides the opportunity for large scale, rapid and cost-effective genotyping assays for linkage analysis. However, the analysis of such datasets is nontrivial because of the large number of markers, and visualizing the linkage scores in the context of genome maps remains less automated using the current linkage analysis software packages. For example, the haplotyping results are commonly represented in the text format.Here we report the development of a novel software tool called CompareLinkage for automated formatting of the Affymetrix Mapping 10 K genotype data into the "Linkage" format and the subsequent analysis with multi-point linkage software programs such as Merlin and Allegro. The new software has the ability to visualize the results for all these programs in dChip in the context of genome annotations and cytoband information. In addition we implemented a variant of the Lander-Green algorithm in the dChipLinkage module of dChip software (V1.3) to perform parametric linkage analysis and haplotyping of SNP array data. These functions are integrated with the existing modules of dChip to visualize SNP genotype data together with LOD score curves. We have analyzed three families with recessive and dominant diseases using the new software programs and the comparison results are presented and discussed.The CompareLinkage and dChipLinkage software packages are freely available. They provide the visualization tools for high-density oligonucleotide SNP array data, as well as the automated functions for formatting SNP array data for the linkage analysis programs Merlin and Allegro and calling these programs for linkage analysis. The results can be visualized in dChip in the context of genes and cytobands. In addition, a variant of the Lander-Green algorithm is provided that allows parametric linkage analysis and haplotyping. The oligonucleotide Mapping 10 K arrays -4 and thHere we report the development of a new software tool called CompareLinkage that can be used for automated conversion of Mapping 10 K genotype data into the "Linkage" format for linkage analysis in Merlin, GeneHunter and Allegro . In addiTo analyze large pedigrees rapidly and to compare the linkage analysis results of different software packages, we developed a software tool called CompareLinkage to automate the following processes: (1) Converting of Affymetrix Mapping 10 K genotype data, pedigree files and marker information into the "Linkage" format , and detA graphical user interface (GUI) for Windows was also implemented in Java. In this GUI users are allowed to set their own working directory and the location of the Perl interpreter through the "Setting" menu. CompareLinkage's functions of converting file formats and getting dChip input files are incorporated through the "Convert" and "GetCurve" menu Figure . Since cThe Affymetrix Mapping 10 K array CEL files and genotype TXT files can be imported into dChip and visualized along cytobands and genes as previously reported ,11. The v involves the summation over all the possible real genotypes :We implemented a variant of the Lander-Green ,6,16 algi represents the ith of all the possible founder allele configurations and is independent of v. P is 1 since an inheritance vector and founder allele configuration uniquely determines the real genotypes, and P involves comparing the real genotype and observed genotype for all the individuals and multiplying the probability by the error rate of 0.01 for each disagreement and 0.99 for each agreement. We also use the matrix-vector multiplication algorithm and bit reduction due to founder phase symmetry described in [where Fribed in , and theribed in ,17 to spWe use the forward-backward computation in the Lander-Green algorithm to obtain the marginal probability distribution of inheritance vector at each SNP marker position given the data of all the markers on a chromosome. In addition the most likely inheritance vector at each marker given the genotype data of all the markers on this chromosome is calculated . ConditiCompareLinkage can format Affymetrix Mapping 10 K SNP genotype output files and genotype files into the "Linkage" format and convert genome information and pedigree files into the formats suitable for Merlin (Version 0.10.2), GeneHunter (Version 2.1) and Allegro (Version 1.2). CompareLinkage removes all non-informative markers and calls the PedCheck software to detecFigures To do parametric linkage analysis in dChipLinkage, a pedigree file is needed Figure . The fil1. Open dChip.Analysis menu and the Get External Data function to read in the genotype file in the text format with LOD scores of greater than 2.3 Figure and the After the linkage computation is finished, the inferred haplotype information can be visualized. In the haplotype view Figure and 16, We have developed the CompareLinkage software for easy comparison and analysis of genotype datasets with common multi-point linkage analysis software programs. It provides functions such as automated data formatting and the calling of linkage analysis software programs to facilitate comparative linkage analysis. The results can be visualized in a chromosome window in the context of genes, cytobands and SNPs in dChip's user friendly graphical interface. The linkage scores of other linkage software packages can be saved into the dChip score file format through CompareLinkage and viewed in the dChip chromosome viewer. This provides the interface to view other computed statistics such as linkage disequilibrium scores along the chromosomes. We have also implemented a variant of the Lander-Green algorithm as the dChipLinkage module for parametric linkage analysis of small pedigrees. It can analyze all chromosomes for families with up to 18 bits within one hour on a PC with one gigabyte memory. This is useful for recessive and consanguineous families whose bits are often small.The comparison analysis of three Mapping 10 K array data sets show similar results in regions with significant LOD scores across all the four software packages. The regions with concordant LOD/NPL scores should provide more confidence in the candidate disease loci. However, there are clear differences in isolated regions. This emphasizes the challenge of a comparative analysis using different linkage algorithm implementations. We hypothesize that the differences between the software programs in peak locations are attributable to:1. The specific algorithm implementation in each program.2. The difference between parametric – and non-parametric analysis.3. The existence of undetected genotype errors in the data sets which could falsely deflate LOD scores ,22. dChiIn light of the discordance between the results from common linkage software packages and from dChipLinkage, we will validate dChipLinkage implementation using additional datasets and the CompareLinkage software.In summary, the CompareLinkage and dChipLinkage software automate the comparative linkage analysis and visualization using multiple software packages. With these tools users will be able to increase their confidence in candidate regions and can use the visualization tools to explore the disease associated genome regions.Project name: The CompareLinkage software and the dChipLinkage software moduleProject home page: Operating system(s): Windows (dChipLinkge); Windows , Unix (CompareLinkage command line version)Programming language: Visual C++ 6.0 (dChipLinkge); Perl and Java (CompareLinkage software)Other requirements: NoneLicense: None.Any restrictions to use by non-academics: No restrictionsCR, CL and WHW conceived of the study, and participated in its design and coordination. NM and RJHS generated the 5026.10 family data, and MP generated the CR and ER family data. IL implemented the CompareLinkage software and performed the comparative analysis using multiple linkage analysis software packages. JC implemented its graphical user interface (GUI). CL implemented the dChipLinkage module. KH participated in the design and analysis of the study. IL, CR and CL drafted the manuscript. All authors read and approved the final manuscript.

Acetylcholine receptor type ligand-gated ion channels are well known in animals. Homologs are identified in prokaryotes that may act as chemotactic receptors. 2+ ions. They play a central role in fast synaptic signaling in animal nervous systems and so far have not been found outside of the Metazoa.Acetylcholine receptor type ligand-gated ion channels are a superfamily of proteins that include the receptors for major neurotransmitters such as acetylcholine, serotonin, glycine, GABA, glutamate and histamine, and for ZnMethanosarcina. The homology between the animal receptors and the prokaryotic homologs spans the entire length of the former, including both the ligand-binding and channel-forming transmembrane domains. A sequence-structure analysis using the structure of Lymnaea stagnalis acetylcholine-binding protein and the newly detected prokaryotic versions indicates the presence of at least one aromatic residue in the ligand-binding boxes of almost all representatives of the superfamily. Investigation of the domain architectures of the bacterial forms shows that they may often show fusions with other small-molecule-binding domains, such as the periplasmic binding protein superfamily I (PBP-I), Cache and MCP-N domains. Some of the bacterial forms also occur in predicted operons with the genes of the PBP-II superfamily and the Cache domains. Analysis of phyletic patterns suggests that the ART-LGICs are currently absent in all other eukaryotic lineages except animals. Moreover, phylogenetic analysis and conserved sequence motifs also suggest that a subset of the bacterial forms is closer to the metazoan forms.Using sensitive sequence-profile searches we have identified homologs of ART-LGICs in several bacteria and a single archaeal genus, From the information from the bacterial forms we infer that cation-pi or hydrophobic interactions with the ligand are likely to be a pervasive feature of the entire superfamily, even though the individual residues involved in the process may vary. The conservation pattern in the channel-forming transmembrane domains also suggests similar channel-gating mechanisms in the prokaryotic versions. From the distribution of charged residues in the prokaryotic M2 transmembrane segments, we expect that there will be examples of both cation and anion selectivity within the prokaryotic members. Contextual connections suggest that the prokaryotic forms may function as chemotactic receptors for low molecular weight solutes. The phyletic patterns and phylogenetic relationships suggest the possibility that the metazoan receptors emerged through an early lateral transfer from a prokaryotic source, before the divergence of extant metazoan lineages. The flux of ions across excitable cellular membranes is a signaling mechanism that is extensively utilized by organisms from all the three major superkingdoms of life. This directional flow of ions across cellular membranes is mediated by a wide range of ion channels that may be gated by a variety of signals, such as voltage, mechanical forces or chemical first messengers . Ion-depAll the known members of this superfamily possess stereotypic domain architectures, with an all-β amino-terminal ligand-binding domain (LBD) and a carboxy-terminal transmembrane domain comprised of four membrane-spanning helices 4-TM). The members of this superfamily exhibit a pentameric quaternary structure, with the second transmembrane helix from each monomer (helix M2) contributing to the wall of a transmembrane pore through which the ion passes. The animal ART-LGICs may exist as heteropentamers, containing up to four distinct paralogous monomers. The ligand is bound at the dimer interface of two adjacent LBDs, and residues from both subunits form a box-like cavity to accommodate the ligand ,10. In t-TM. The Caenorhabditis elegans MOD-1), allow the flow of anions. Cation or anion selectivity of the channel is principally governed by the charge distribution in the linker between the transmembrane helices M1 and M2 with the glutamate playing a role in cation selection. The anion channels usually have a motif of the form alanine (A)-[RK] with the basic residue participating in anion selection ,12,29. AThe ligand-binding box in ACHB has been termed the aromatic box as it is bounded by multiple aromatic residues Figures , 2. In sFurthermore, an interesting difference is noted in the aromaticity of the positions corresponding to leucine (L) 112 (subunit D) and tryptophan (W) 143 (subunit C) of the ACHB structure between the bacterial and animal sequences in the middle of the region corresponding to the Cys-loop Figure and thesThe conservation of certain key features in both the LBD and the 4-TM domains of the bacterial and eukaryotic receptors suggests that despite their extensive sequence divergence they are likely to share general functional and mechanistic properties. In the pentamer these residues appear to form a continuous ring passing through the top surface of the LBD, and undergo conformational changes in relation the presence of a bound ligand Figure 9]..9].Rhodopseudomonas and one of the three versions from C. hutchinsonii show a simple architecture identical to the animal forms. Some versions, like those from the α-proteobacteria, M. magnetotacticum and B. japonicum, show a further amino-terminal fusion to a domain of the periplasmic binding protein type I (PBP-I) superfamily and Cache domains . This ver Figure . The MCPRhodopseudomonas, there is a similar predicted operon, but instead of a gene for a PBP-II superfamily protein, there is one for a stand-alone Cache domain. This situation parallels the fusion with the Cache domain in some of the receptor versions and these two independent proteins may similarly cooperate functionally.Contextual information in the form of conserved gene neighborhoods or predicted operons in prokaryotes often provides hints to identify gene products that functionally or physically interact or belong to the same pathways or signaling cascades ,44. Acco+ channel in the bacterium Bacillus pseudofirmus in chemotaxis, motility and the regulation of the Na+-cycle [Microbulbifer degradans, the ART-LGIC with a predicted cation selectivity is in a predicted operon with a Na+/H+ symporter, suggesting possible interactions with the Na+ cycle.Taken together, these observations suggest that bacterial ART-LGICs may function as chemotaxis receptors. As most bacterial genomes in which they are present contain only a single member of the ART-LGIC superfamily, it is likely that, in contrast to many of the well studied metazoan receptors, they function as homopentamers. The PBP-I, PBP-II MCP-N and Cache domains that are either fused or operonic with many of the predicted bacterial receptors may help in a preliminary concentration or sensing of amino acids or other small-molecule ligands. These ligands may then bind to the channel's LBD domain and activate an ionic flux across the cell membrane that in turn regulates the motility of the bacterium in response to the ligand. This proposal is analogous to the recently reported activity of a voltage-gated Naa+-cycle . InteresDictyostelium, Entamoeba, apicomplexans or earlier-branching eukaryotic taxa such as Giardia and Trichomonas. Among the prokaryotes, too, they show a highly sporadic distribution: very distantly related taxa may possess similar receptors are markedly more similar in sequence to the eukaryotic forms . The NO receptors of animals share two domains, namely the HNOB and HNOBA, which are involved in heme-dependent NO sensing with several bacterial signaling proteins [Dictyostelium . The pattern of the residues conserved in both the metazoan and bacterial receptors suggests that a common mechanism of channel-gating is likely to operate throughout this superfamily. Furthermore, the ligand-binding box appears to preserve at least one aromatic residue, although its exact position may not necessarily be conserved. The conservation pattern also suggests that a chain of positions leading out on either side from the ligand-binding box may mediate the transmission of the conformational change through the 'top' of the LBD, which may then transmit through the rest of the structure. The charge interactions between the acidic residue in the middle of the Cys-loop region and a basic residue the extreme carboxyl terminus of the LBD, just before the transmembrane domain also appear be universal features that might be involved in the process of channel gating. On the basis of the domain architectures and operon organizations, we predict that the bacterial ART-LGICs are likely to function as chemoreceptors for low-molecular-weight solutes in the environment. Phyletic and phylogenetic analyses suggest that the ancestor of the animal lineage probably acquired a single progenitor from a bacterial source, and it subsequently radiated to give rise to all the Cys-loop receptor subunits of the extant metazoans.The nonredundant (NR) database of protein sequences ) was searched using the BLASTP program . UnfinisProtein structure manipulations were performed using the Swiss-PDB viewer program . ProteinPhylogenetic analysis was carried out using the maximum-likelihood, neighbor-joining, Bayesian inference and minimum evolution (least squares) methods. The MrBayes program was used for the Bayesian inference of phylogeny . The aliThe minimal evolution trees were constructed using the FITCH program of the PThe following additional data are available with the online version of this paper. Additional data file The conservation pattern of the ART-LGIC superfamily plotted onto the three-dimensional structure of the ACHB proteinClick here for additional data fileThe alignment of the proteins in Figure 1Click here for additional data file

Each of the human genes or transcriptional units is likely to contain single nucleotide polymorphisms that may give rise to sequence variation between individuals and tissues on the level of RNA. Based on recent studies, differential expression of the two alleles of heterozygous coding single nucleotide polymorphisms (SNPs) may be frequent for human genes. Methods with high accuracy to be used in a high throughput setting are needed for systematic surveys of expressed sequence variation. In this study we evaluated two formats of multiplexed, microarray based minisequencing for quantitative detection of imbalanced expression of SNP alleles. We used a panel of ten SNPs located in five genes known to be expressed in two endothelial cell lines as our model system.2 values > 0.95 for the majority of the regression lines. According to a two sample t-test, we were able to distinguish 1–9% of a minority SNP allele from a homozygous genotype, with larger variation between SNPs than between assay formats. Six of the SNPs, heterozygous in either of the two cell lines, were genotyped in RNA extracted from the endothelial cells. The coefficient of variation between the fluorescent signals from five parallel reactions was similar for cDNA and genomic DNA. The fluorescence signal intensity ratios measured in the cDNA samples were compared to those in genomic DNA to determine the relative expression levels of the two alleles of each SNP. Four of the six SNPs tested displayed a higher than 1.4-fold difference in allelic ratios between cDNA and genomic DNA. The results were verified by allele-specific oligonucleotide hybridisation and minisequencing in a microtiter plate format.The accuracy and sensitivity of quantitative detection of allelic imbalance was assessed for each SNP by constructing regression lines using a dilution series of mixed samples from individuals of different genotype. Accurate quantification of SNP alleles by both assay formats was evidenced for by RWe conclude that microarray based minisequencing is an accurate and accessible tool for multiplexed screening for imbalanced allelic expression in multiple samples and tissues in parallel. Single nucleotide polymorphisms (SNPs) are highly abundant in the human genome, appearing on average at 0.1% of the nucleotide positions -6. ImbalNon-synonymous SNPs in coding regions of genes may be functional by altering an amino acid, which in turn may affect the structure and function of the encoded protein, while synonymous SNPs may have functional consequences by affecting the stability or folding of mRNA transcripts. Intronic SNPs may give rise to alternatively spliced mRNAs, while SNPs in 5'- or 3'-untranslated mRNA regions may affect the stability or processing of the RNA. Moreover, SNPs in non-protein coding regions of genes that affect binding of regulatory factors may cause imbalanced expression of SNP alleles. This form of genetic variation has been suggested as a common cause of both normal and disease-related inter-individual variation in complex phenotypes . ClearlyOwing to the high sequence specificity of nucleotide incorporation by DNA-polymerases, single nucleotide primer extension has proven to allow quantitative determination of SNPs in genomic DNA in several studies and assay formats . A freqWe are currently using microarray based minisequencing for multiplex genotyping of SNPs. Our custom-made microarrays permit the genotyping of up to 100 SNPs in 80 samples per standard microscope slide, either using immobilised minisequencing primers ,18 or usWe used a panel of ten coding SNPs in five genes to choose the optimal microarray based minisequencing strategy for multiplex, quantitative genotyping of SNPs in DNA and RNA samples. The selected SNPs were located in genes shown by reverse transcriptase PCR analysis to be expressed in one or both of two endothelial cells lines, HUVEC and HAEC that served as our model cell lines in this study (data not shown). We evaluated two formats of microarray based minisequencing by performing five parallel assays with each method for each sample in the evaluation. The SNPs were analysed in both DNA polarities and the evaluation of the methods was based on the DNA polarity yielding the highest signal-to-noise ratio.In Method I, immobilised minisequencing primers are extended with fluorescently labelled ddNTPs in reactions performed on the microarray surface after annealing of the multiplex PCR products to the primers ,21. In M2), which describes how well the regression line fits the data points, was used to assess the accuracy of quantification of the SNP alleles by Methods I and II. As can be seen in Table 2 values are close to one for most of the SNPs analysed, demonstrating little scatter of the data points around the regression line. For Method I, six of the ten SNPs analysed have R2 values ≥ 0.95, while for Method II the R2 values are ≥ 0.95 for eight of the SNPs. Thus, accurate quantification of SNP alleles is possible by both methods. The slopes of the regression lines vary between the ten SNPs as well as between the two methods and endothelin receptor type B (EDNRB rs5351) were heterozygous in the HUVEC cell line. These SNPs were genotyped in cDNA produced from total RNA extracted from the cells with the corresponding gDNA as reference samples using both methods. Table Next, the performance of the two methods in quantitative analysis on the RNA level was assessed. The ten SNPs were first genotyped in genomic DNA (gDNA) from the HUVEC and HAEC cells to identify those SNPs that were heterozygous in either or both cell lines. Three SNPs in the low density lipoprotein receptor gene were heterozygous in the HAEC cell line, and one SNP in each of the genes encoding angiotensin I converting enzyme (ACE rs4331), βTo test that the results on imbalanced allelic expression detected by the multiplexed microarray based methods represents the true biological situation in the cells, we analysed the heterozygous SNPs in five replicate RNA samples prepared from HUVEC or HAEC harvested at different time points from different cell culture flasks. We also analysed the three LDLR SNPs in five replicate reverse transcription reactions from the same RNA sample prepared from HAEC cells. For this analysis we used our first generation solid-phase minisequencing assay for individual SNPs in a microtiter plate format. The concordant cDNA/gDNA ratios from these control experiments from independent cell and RNA samples presented in Table The purpose of our study was to evaluate microarray based minisequencing for multiplexed detection and quantification of imbalanced expression of SNP alleles, as a prelude to further large scale screening for allelic imbalance. We found no significant differences in the performance of our two "in house" methods, minisequencing with primers directly immobilised on the microarrays (Method I) and the It is notable that the largest differences in accuracy and sensitivity were observed between SNPs. Some of the SNP-to-SNP differences are likely due to differences is the accuracy and efficiency of incorporation of the four different fluorescently labelled nucleotide analogues by the DNA polymerase ,26 as weComparison of the relative amounts of the alleles of six SNPs on the RNA (cDNA) level to heterozygote SNPs in genomic DNA revealed four SNPs with imbalanced expression of the two alleles. A three-fold increase in the expression of the T-allele for the SNP rs4331 ACE was the most pronounced difference observed. In our study, 1.4–1.5-fold differences in allelic expression levels were detectable. The sensitivity of detecting a minority allele in our system would allow the distinction between 10-fold reduction in the expression of an allele and monoallelic expression, for example as a result of imprinting. Owing to its potential for high throughput screening of large numbers of samples, we have also performed a preliminary evaluation of the commercial SNPstream genotyping system that also utilises the "tag-array" primer extension strategy in a semi-automated 384-well microtiter plate format for detection of imbalanced allelic expression . The samIt is also reassuring for future large scale detection of imbalanced allelic expression that the accuracy of our methods seemed to be similar for cDNA and genomic DNA. Analysis of replicate RNA samples from different batches of both cell lines using a microtiter plate format of the minisequencing method evidenced for the biological authenticity of the allelic imbalance detected using minisequencing in the microarray format. The data obtained from independent cell samples also indicate an acceptable reproducibility of RNA extraction, RNA storage and cDNA synthesis. Another important factor besides sample to sample variation that may affect the accuracy of the relative allele quantification is the amount of mRNA subjected to the analysis. At a low copy number of mRNA, the stochastic distribution of the RNA templates may be a major source of variation . The reaA similar minisequencing strategy as the one used for determination of imbalanced expression between SNP alleles can also be used for determination of the relative expression levels of highly homologous genes and for Here we demonstrated the applicability of two formats of microarray based minisequencing for detecting imbalanced expression of SNP alleles. The accuracy and sensitivity of both systems allow detection of 1.4- to 10-fold differences in the expression levels of the two alleles of heterozygous SNPs. The microarray-based minisequencing systems utilise widely available reagents and equipment, and can thus easily be established "in-house". Moreover, the system is flexible with respect to number of SNPs and samples to be analyzed. Systematic quantitative screening of genetic diversity on the RNA level in multiple individuals and tissues will be a future approach in the elucidation of the molecular mechanisms that regulate gene expression.DNA samples from 30 volunteer donors were genotyped by Methods I and II to identify individuals of different genotypes for the panel of ten SNPs analysed. The SNPs are described in the section "SNPs and primers" below. DNA 10 ng/μl) from one individual was serially diluted 2:1 into DNA (10 ng/μl) from a second individual, to yield a series of DNA samples with different ratios between the SNP alleles. These mixed DNA samples were used for construction of quantification standard curves. Depending on the genotype of each SNP in the two individuals whose DNA was mixed, dilution series of samples with different allelic ranges were obtained for the ten SNPs, as specified in Table 0 ng/μl f2. Cells from the cultures were harvested at 80% confluence according to the manufacturer's instructions. Total RNA was isolated from the cells using the TRIZOL®Reagent and the RNA samples were stored at -70°C until use. High quality RNA with A260/A280 ratio over 1.9 and intact ribosomal 28S and 18S RNA were used for cDNA synthesis. The RNA samples were treated with 1 U RQ1 RNase-free DNase per μg RNA. Two to 2.5 μg total RNA was subjected to first strand cDNA synthesis using SuperScript™ II reagents in a 20 μl volume. DNA was extracted from the cells using GenElute™ Mammalian Genomic DNA Kit and stored at -20°C until use.Human Umbilical Vein Endothelial Cells (HUVEC) and Human Aortic Endothelial Cells (HAEC) were grown in Medium 200 with Low Serum Growth Supplement at 37°C in a humidified atmosphere of 5% CO® Gold DNA polymerase , 1.5 mM MgCl2, and 0.2–0.3 μM of primers in 50 μl of 10 mM Tris-HCl pH 8.3 and 50 mM KCl. The PCR conditions were initial activation of the enzyme at 95°C for 10 min followed by 35 cycles of 95°C for 1 min, 56°C for 1 min and 72°C for 1 min and a final extension at 72°C for 7 min in a Thermal Cycler PTC225 . The amplified fragments were combined and concentrated to 60 μl using Microcon ® YM-30 Centrifugal Filter Devices .The fragments comprising the SNPs were PCR-amplified in individual reactions using 10–15 ng genomic DNA or one tenth of the cDNA products, 0.2 mM dNTPs, 1U AmpliTaq Ten SNPs located in coding regions of genes known to be expressed in HUVEC and HAEC cells were analysed. Information on the SNPs, including dbSNP ID numbe2-group in their 5'- or 3'-end, respectively. The oligonucleotides were applied in duplicates to the slides at a concentration of 25 μM in 150 mM sodium phosphate pH 8.5 using a ProSys 5510A instrument equipped with one Stealth Micro Spotting pin to minimise the variation between spots in different "subarrays". The oligonucleotides were spotted in an "array-of-arrays" configuration that facilitates analysis of 80 individual samples in parallel on each microscope slide [The minisequencing primers or the complementary tag-oligonucleotides were covalently immobilised on CodeLink™ Activated Slides by the mediation of a NHpe slide . In eachAliquots of 7.5 μl of the concentrated PCR products were analysed in five parallel "subarrays" for each sample, essentially as described previously . The PCRFive parallel reactions with a 4.5 μl aliquot of the concentrated PCR products were analysed for each sample, as described in detail in . Excess ® DNA polymerase and the minisequencing primer was added. The extension reaction was allowed to proceed for 10 min at 50°C. The extended primers were released with alkali and the amount of incorporated tritium labelled nucleotide was measured.PCR was run with one of the primers biotinylated. The biotinylated PCR products were immobilised in a microtiter plate coated with streptavidin and the unbiotinylated strand was removed with alkali treatment ,15. The Primers and probes for the TaqMan assays were designed by Applied Biosystems as Assay-by-Design (rs1042719 ADRB2 and rs5925 LDLR) or Assay-on-Demand (rs1433099 LDLR) service. The probes for the two alleles were labelled with the reporter dyes FAM and VIC respectively. The sequences of the primers and probes for the SNPs rs5925 LDLR and rs 1042719 ADRB2 are found in . The priReal time quantitative PCR was run in 25 μl TaqMan Universal PCR Master Mix (Applied Biosystems) with 200 nM of both labelled TaqMan probes, 900 nM PCR-primers and 10 ng genomic DNA or one tenth of the cDNA products. The PCR conditions were initial activation of the enzyme at 95°C for 10 min followed by 60 cycles of 95°C for 15 sec and 60°C for 1 min in a ABI7000 instrument .The signal intensity ratios were calculated based on normalised ΔRn fluorescence values obtained from the assay during the exponential phase of PCR. The ΔRn values were retrieved from cycle 38 for the SNP rs1042719 ADRB2, cycle 42 for the SNP rs5925 LDLR and cycle 43 for the SNP rs1433099 LDLR. Imbalanced expression of the SNP alleles was determined by a t-test as described below.® Express instrument with the excitation lasers Blue Argon 488 nm, Green HeNe 543.8 nm, Yellow HeNe 594 nm and Red HeNe 632.8 nm with the laser power set to 80% and the photomultiplier tube gain adjusted to obtain equal signal intensities from reaction control spots for all four spectra. The fluorescence signals were extracted using the QuantArray ® analysis 3.1 software . The mean of the fluorescence signals for the duplicate spots was corrected for the average background in each "sub-array" separately. The data was handled and interpreted using the Microsoft ® Excel program.In Methods I and II fluorescence was measured using a ScanArray 2) were assigned by linear regression analysis of the relationship between the signal intensity ratios determined from the minisequencing assay and the known allelic ratios in the mixed samples for the quantification standard curves. Two-sample t-tests with two-tailed significance levels assuming unequal variance were performed to determine the lowest level of detection of a specific allele for the quantification standard curves and to evaluate the imbalanced expression of the two alleles of the SNPs in the cell lines.The genotype for each individual SNP was assigned by calculating a ratio between the fluorescence signals for the two alleles. Coefficients of determination (RUL participated in the design of the study and in RNA and DNA extraction, and performed all the laboratory work involving "in-house" minisequencing methods, performed the statistical calculations and drafted the manuscript. MF cultured the cells, performed RNA and DNA extraction, performed the assays with the reference method, and provided input to the manuscript. AD performed the assays using the SNPstream system. A-CS conceived the study, participated in its design, coordination and in preparation of the manuscript. All authors read and approved the final manuscript.Additional file1 is a pdf-file with information on the SNPs, including dbSNP ID number, nucleotide variation and the sequences of the primers and probes used in the microarray based minisequencing and TaqMan assays respectively.Click here for file

The primate brain processes a remarkably diverse array of visual cues to recognize objects in dynamic settings crammed with unfamiliar objects. Not surprisingly, repeated viewing aids recognition, but how the brain orchestrates this experience-driven improvement is unclear. Visual input to the brain travels from the eye to the primary visual cortex (V1), at the back of the brain. From there, signals are sent to nearby extrastriate cortical areas, which process “early” visual cues. Both the “lower level” extrastriate cortex and “higher level” inferior temporal (IT) cortex are important for object recognition in primates. In monkeys and humans, lesions in the IT cortex severely affect the ability to recognize objects.In these higher-level cortical regions, neurons carry more information about an object after subjects learn to recognize that object. This modified neural activity is thought to reflect internal representations of specific aspects of the learned task—such as learned recognition of three-dimensional objects—and these representations often remain stable even though certain features of the visual stimulus—such as size or image degradation—change. With recent evidence suggesting that lower level brain regions like the primary visual cortex are also capable of learning-related modifications, it appears that both early and higher brain areas of the “ventral visual stream” benefit from learning. It is not clear, however, how learning modifies these discrete brain regions to coordinate this processing.By training monkeys to recognize degraded images, Gregor Rainer, Han Lee, and Nikos Logothetis of the Max Planck Institute for Biological Cybernetics in Germany have identified a subset of neurons that compensate for indistinct visual inputs by coordinating disparate regions in the brain. The monkeys' improved performance, they propose, stems from the informational enrichment of a subset of lower level neurons. Along with an increase in learning-induced firing activity, V4 neurons—extrastriate cortical neurons associated with detecting visual input of intermediate complexity—encode more information about relevant details to resolve indeterminate visual cues. V4 neurons likely interact with higher cortical levels to help the monkeys interpret the degraded indeterminate images as something recognizable.The researchers presented the monkeys with different “natural” images, including pictures of birds and humans, then subjected the images to different levels of “stimulus degradation”—making them harder to read by adding varying amounts of visual noise. Using this approach, the researchers could record the activity of the V4 neurons as the monkeys were presented with the different images. The monkeys viewed a sample image and then signaled whether a second image, presented after a brief delay, was a match or not. When Rainer et al. analyzed the activity of the V4 neurons associated with the different images, they found there was no significant change in the activity or information conveyed by V4 neurons associated with novel or undegraded familiar images. On the other hand, learning not only significantly improved the monkeys' ability to recognize degraded stimuli but also increased both the activity and informational encoding of the V4 neurons.But how did individual V4 neurons facilitate this enhanced ability to recognize degraded stimuli? After identifying a subset of neurons that showed enriched neural activity in response to degraded or indeterminate stimuli, the researchers studied the monkeys' eye movements to determine any behaviors that might explain why monkeys performed better with familiar degraded stimuli. They mapped the monkeys' eye movements while allowing them to freely view the different familiar and novel images—but this time with just two coherence levels (undegraded and 45% coherent). There was substantially more overlap, in terms of where the monkeys looked for the 45% and 100% coherent images after learning. This suggests that monkeys learned to focus their attention on particular salient features, and were thus better able to identify degraded versions of these images.Neurons in the V4 area appear to be recruited to distinguish the relevant visual signal from the visual noise, and thus play a critical role in resolving indeterminate stimuli when salient features are present. These results, together with previous studies showing the sensitivity of prefrontal cortex neurons to novel stimuli, indicate that the prefrontal cortex processes novel stimuli while the V4-rich extrastriate visual areas convey details about hard to decipher images. It may be that as the V4 neurons refine their competence through learning, they also support the ability of the prefrontal cortex to process different but similar visual cues. Vision is a dynamic process, Rainer et al. conclude, characterized by ongoing interactions between stimulus-driven brain regions and feedback from higher-order cognitive regions.

Tag-deleted SV40-derived vectors (rSV40s), since they do not elicit neutralizing antibody responses, and so can be given multiply without loss of transduction efficiency.A vaccine that elicits durable, powerful anti-HIV immunity remains an elusive goal. In these studies we tested whether multiple treatments with viral vector-delivered HIV envelope antigen (gp120), with and without IL-15, could help to approach that goal. For this purpose, we used recombinant SV(gp120) carried the coding sequences for HIV-1NL4-3 Env, and SV(mIL-15) carried the cDNA for mouse IL-15. Singly, and in combination, these two vectors were given monthly to BALB/cJ mice. Cytotoxic immunity and cytotoxic memory were tested in direct cytotoxicity assays using unselected effector cells. Antibody vs. gp120 was measured in a binding assay. In both cases, targets were P815 cells that were stably transfected with gp120.Multiple injections of SV(gp120) elicited powerful anti-gp120 cytolytic activity (>70% specific lysis) by unselected spleen cells. Cells from multiply-immunized mice that were rested 1 year after their last injections still showed >60% gp120-specific lysis. Anti-gp120 antibody was first detected after 2 monthly injections of SV(gp120) and remained elevated thereafter. Adding SV(mIL-15) to the immunization regimen dramatically accelerated the development of memory cytolytic responses, with ≥ 50% specific lysis seen 1 month after two treatments. IL-15 did not alter the development of antibody responses.Thus, rSV40s encoding antigens and immunostimulatory cytokines may be useful tools for priming and/or boosting immune responses against HIV. The development of an effective vaccine against HIV has been hindered by a variety of problems. The high mutation rate of the virus itself is such that it represents a moving antigenic target during the course of an infection -4. FurthCompared to administration of protein antigen or naked DNA, an infectious vector could be more effective at enhancing antibody and cytotoxic responses against a transgene product. Application of such a strategy, however, has been often complicated by the development of neutralizing immune responses, principally antibodies, against vector coat antigens -10. ThesTag-deleted SV40-derived gene delivery vectors (rSV40s) for immunization. Several studies have shown, both directly and indirectly, that rSV40 vectors do not elicit detectable neutralizing antibodies , to yield prSVmIL-15. Virus was made from this plasmid in COS-7 cells as previously reported minus [c.p.m. 51Cr released by SV(HBS)-immune lymphocytes from gp120-expressing P815 cells]}, divided by [c.p.m. 51Cr released by Triton X-100 from gp120-expressing P815 cells]. The same calculations were done for lysis of wild type P815 cells by gp120-immune and control-immune effector populations. These numbers were then subtracted from the calculated 51Cr release above to determine the gp120-specific lysis of target cells by SV(gp120)-immunized effector cells.% specific P815 cells were transduced with SV(mIL-15) ×1 at m.o.i. = 100. Culture supernatants were harvested at several times post-transduction, and stored at -80°C. At day 6 post-transduction, a well of cells was harvested and lysed ). Remaining wells were activated non-specifically with 5 mg/ml Con A, and supernatants harvested at various times thereafter. 3 days after con A stimulation, cells were lysed as described above. 50 μg of each culture supernatant or lysate were loaded on a 4–20% Tris-HCl gradient gels . 50 ng recombinant human IL-15 was used as a positive control. Samples were electrophoresed, and blotted to PVDF membranes . Blots were blocked overnight at 4°C with 5% milk in PBS + Tween-20 (0.05%). Rabbit anti-mouse IL-15 was used as primary antibody, (diluted 1:500 with PBS-Tween), for 2 h at 37°C. Horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG was used at 1:10,000 dilution in PBS-Tween, for 1 h at room temperature. Signal was detected with chemiluminescence reagent COS-1 cells were infected with SV(mIL15) or SVLUC (carrying luciferase) as a negative control. 24 h later, the media were changed and cells incubated 48 h in 500 μl of RPMI 10% serum/well. Fresh mouse spleen cells (5000/well) then cultured 48 h with 100 μl of cell supernatant + 100 μl of RPMI 10% serum. IFNγ ELISA (Pharmingen) was performed on the supernatant from these cultures.Methods). We used flow cytometry to identify the clone most strongly positive for cell membrane gp120. Compared to other stably-transfected clones, "clone 24" expressed gp120 at the cell membrane best (data not shown). VCB41-infected and SV(gp120)-transduced P815 cells also expressed substantial cell membrane gp120. Control wtP815 cells, or P815 cells infected with wt VV did not (data not shown).P815 cells stably transfected to express HIVNL4-3 gp120 were selected and cloned by limiting dilution )-immunized rSV40-immunized mice vs. clone 24 cells. Thus, data presented below reflect gp120-specific responses against clone 24.Methods. Specific binding antibody activity was first statistically significant, compared to prebleed sera 2 weeks after the second inoculation of SV(gp120) and reached a plateau after the third inoculation , and their sera were assayed for reactivity vs. gp120 by CELISA. The details of this cell-based ELISA, or CELISA, as described in 20, and tAn effective anti-lentiviral immunization regimen should generate cytotoxic memory cells. To see if SVgp120) treatment could do this, mice were immunized once with SV(gp120) IP, then sacrificed 1 month later, without further treatment. In order to lyse target cells, committed cytotoxic cells require activation. However, to avoid antigen-specific selection and specific stimulation only of gp120-reactive cytotoxic cells, splenic lymphocytes were non-specifically stimulated by overnight incubation with Con A. A single immunization with SV(gp120) alone elicited only weak memory lytic responses (≤ 10% specific lysis) against gp120-expressing target cells one month after the first, then were assayed the same way one month later for anti-gp120 cytolytic activity. These mice made stronger specific memory responses (15–20% specific lysis) than did animals given only a single inoculation gp120-specific cytolytic responses (mean specific lysis of 61% ± 4.2).To test whether SV(gp120) could elicit very long term cytotoxic lymphocyte memory, mice were immunized monthly ×8 with SV(gp120) IP. A final IP inoculation with SV(gp120) was given Methods, using rabbit antibody vs. murine IL-15 , and lower levels were seen with 2 injections, we tried to accelerate development of such responses using IL-15, delivered by transduction. To determine if IL-15 could be expressed by transduction, P815 cells were transduced with SV(mIL-15) at m.o.i. = 100. Culture supernatants were harvested 36, 72 and 144 hours later, at which point the cultured cells were activated with Con A. Culture supernatants were collected at 24 and 72 hours post-activation. Supernatants were assayed for IL-15 secretion by Western analysis as described in The functionality of the IL-15 produced in this fashion was tested by exploiting the ability of IL-15 to elicit production of IFN-γ by lymphocytes. Thus, CV-1 and COS-7 cells (African green monkey kidney cells) were transduced by SV(mIL-15), then cultured for 72 hrs. Control cultures of the same cells were transduced with SVLUC (carrying luciferase as a transgene). Normal mouse spleen cells were cultured for 42 hrs in 200 μl of the resulting culture supernatants. Production of IFN-γ by the spleen cells was measured by ELISA. Supernatants from COS-7 and CV-1 cells elicited respectively 2056 ± 363 pg/ml and 880 ± 196 pg/ml IFN-γ. Supernatants from SVLUC-transduced cells did not elicit detectable interferon secretion by spleen cells (<20 pg/ml).9 IU of rSV40: one group was given SV(mIL-15) alone, and one group SV(gp120) alone. Three other groups received both SV(mIL-15) and SV(gp120): either SV(mIL-15) followed 3 days later by SV(gp120), or SV(gp120) first, followed by SV(mIL-15). The final group was given both SV(mIL-15) and SV(gp120) simultaneously. The 3 day separation between the two vectors was used because of the strength of the signal for secreted IL-15 by Western blotting at 72 hours post-stimulation (see above). One month later, unselected spleen cells were assayed as described above for cytolytic activity against gp120-expressing clone 24 cells.To determine whether coordinate administration of SV(mIL-15) plus SV(gp120) improved cytolytic responses against gp120, mice were given two sets of injections IP, one month apart. Normal BALB/c mice received IP with 10Adding IL-15 to the immunization regimen greatly increased gp120-specific cytolytic responses Figure . Also, tMethods.Mice receiving SV(mIL-15) and/or SV(gp120) ) according to the schedules outlined above were tested to determine the effect, if any, of such co-administration in anti-gp120 serum antibody responses. CELISA and calculation of gp120-specific antibody binding were performed as described in Slight binding antibody activity was detected 2 weeks after the first inoculation(s), in all SV(gp120) recipient groups. Levels of SV(gp120)-induced groups made detectable antibody responses were not appreciably affected by coadministration of SV(mIL-15) (data not shown).in vivo. Our results here demonstrate several important strengths of using rSV40 vectors to immunize against lentiviral antigens: Among these are the ability of the vector to be administered multiple times without eliciting neutralizing responses [51Cr-release assays: unselected lymphoid organ populations were added directly to labeled target cells at low E:T ratios, and specific 51Cr release was measured.In this study, we used rSV40 vectors to elicit HIV-1NL4-3 gp120-specific cytotoxic lymphocyte and antibody responses. We have observed that these vectors may be administered repeatedly to boost those responses. Further studies also suggested that such responses are durable esponses -13, and 51Cr release observed in the current studies were extensively controlled to ascertain the antigen-specificity of the cytolysis observed: background lysis of wild type P815 cells was subtracted, as was lysis by lymphocytes from mice immunized with an irrelevant rSV40 vector. We also found that cytolysis increased with increasing numbers of immunizations, which is not a characteristic of NK cell-mediated lysis.Analysis to confirm CD8 expression, or expression of other CTL markers was not performed on the effector cells. However, it is unlikely that these data reflect the cytotoxic activity of NK cells. NK cytolytic activity is non-specific and does not increase with repeated immunization. The patterns of in vivo, we tested whether cytotoxic lymphocyte activity elicited by SV(gp120) immunization, was detectable one month after inoculation. Thus, cytolytic responses, assayed one month after a second injection, were ≈ 20%, which is comparable to those of splenic cytotoxic cells assayed four days following a third inoculation (data not shown). Further, mice given multiple injections of SV(gp120), then rested for one year, gave ≈ 70% specific lysis when challenged with SV(gp120). Therefore, SV(gp120) administration may thus favor development of cytotoxic lymphocyte memory.Since a key goal for a vaccine against HIV is to generate immune responses that are durable In an attempt to accelerate and to improve upon these specific cytotoxic and particularly cytotoxic memory responses, we co-immunized mice with SV(gp120) and a rSV40 carrying mouse IL-15. IL-15 promotes cytotoxic lymphocyte responses, and in particular, cytotoxic memory responses ,24. The in vitro. Furthermore, low effector:target ratios (20:1 and 10:1) were used in these assays. Our immunization protocols tested both simultaneous and staggered administration of rSV40s carrying HIV-1NL4-3 gp120 and murine IL-15.Accordingly, our analysis of the contribution by IL-15 to cytotoxic responses, focused mainly on the ability of SV(mIL-15) to augment specific cytotoxic responses of spleen cells from animals rested 1 month following immunization. Because quiescent cytotoxic T cells are not strong effectors, we non-specifically activated the splenocytes prior to assay with Con A. Non-specific activation was used to avoid specifically enriching effector cell population for gp120-specific cells IL-15 co-immunization dramatically accelerated cytotoxic responses, depending on the immunization regimen used: Animals given SV(mIL-15) alone made no gp120-specific cytolytic responses. Mice receiving 2 treatments with a mixture of SV(gp120) and SV(mIL-15) gave much higher specific lysis, depending on the coadministration regimen, as compared to those receiving SV(gp120) alone (≈ 10% specific lysis). Thus, among mice given staggered injections of SV(mIL-15) and SV(gp120), the order of cytokine administration greatly affected the response: if SV(gp120)was given first, no detectable gp120-specific cytolysis was observed. However, if the cytokine was given first, followed 3 days later by SV(gp120), ≥ 60% specific lysis was seen at both 20:1 and 10:1 effector:target ratios.Why the order of cytokine administration should affect antigen-specific responses so dramatically is not yet clear. Cytokine given after, or together with antigen, may have insufficient time to augment cytotoxic responses. In addition, Western analysis of IL-15 production showed that IL-15 secretion was not detectable in supernatants beyond 36 hours, but could be stimulated subsequently. Thus, a specific, possibly brief, window for IL-15 expression and secretion may need to be attained, in order for its effects on gp120-specific responses to be detectable. We observed very high levels of specific lysis by these unselected effector populations following just two tandem injections of SV(mIL-15) followed by SV(gp120).The strong anti-lentiviral cytolytic responses we report were observed in a strain of mouse, BALB/cJ, that generally mounts relatively weak type 1 T cell responses. The finding of >60% cytolysis with two administrations of SV(gp120) + SV(mIL-15), suggests that a strategy similar to that described herein may be helpful in individuals who would generate relatively low cytolytic responses.Serum antibody levels assayed by CELISA where SV(gp120) was administered alone, multiple times, were detectable after two immunizations, and continued to increase up to week 4 following the third immunization. These responses were not further enhanced by subsequent boosting immunizations. While specific antibody responses against gp120 were detected in all experimental groups following SV(gp120) and SV(mIL-15) co-immunization, IL-15 co-administration did not augment anti-gp120 antibody levels, compared to gp120 alone. This was to be expected, since IL-15 reportedly acts primarily on T cell and NK cell functions, rather than on humoral immune responses.Our data argue in favor of using IL-15 as an adjuvant for antigen-specific immune responses, particularly cytotoxic lymphocyte responses. We also demonstrate that a single transgene, administered multiple times (>3), may be very effective at eliciting both humoral and cell-mediated responses. These results thus both corroborate and extend our previous observations ,14,32, aRecombinant SV40-derived gene-delivery vectors, being transparent to the immune system, can be given multiple times to prime and boost immune responses against the delivered antigens. Anti-vector immunity does not overwhelm responses against the target antigens. As well, these vectors elicit very high levels of antibody, and especially cell-meditated immunity. Finally, combining the delivery of rSV40s bearing antigens with those bearing cytokines such as IL-15 can enhance levels of immunity, particularly long-term immunity. Clearly, much work remains. However, this approach offers promise as a strategy to immunize against pathogens for which classical approaches have not been adequately effective.None declared.HJM devised all the assay systems for cell- and antibody-mediated immunity against lentiviral antigens, performed all the immunization studies and assays. HM also wrote this manuscript. PYT generated the SV(gp120) construct. MV and PF generated the SV(mIL-15) and SVLUC constructs described here and performed the ELISA for IFNγ stimulated by SV(mIL-15). DSS is the Principal Investigator for this work, oversaw and planned the experimental strategies, worked with HJM in interpreting the experimental data and writing the manuscript.

Homo sapiens, followed by sampling humans from different ethnic backgrounds, and chimpanzees, we have identified 27 NUMTs that are specific to humans and must have colonized human chromosomes in the last 4–6 million years. Thus, we measured the fixation rate of NUMTs in the human genome. Six such NUMTs show insertion polymorphism and provide a useful set of DNA markers for human population genetics. We also found that during recent human evolution, Chromosomes 18 and Y have been more susceptible to colonization by NUMTs. Surprisingly, 23 out of 27 human-specific NUMTs are inserted in known or predicted genes, mainly in introns. Some individuals carry a NUMT insertion in a tumor-suppressor gene and in a putative angiogenesis inhibitor. Therefore in humans, but not in yeast, NUMT integrations preferentially target coding or regulatory sequences. This is indeed the case for novel insertions associated with human diseases and those driven by environmental insults. We thus propose a mutagenic phenomenon that may be responsible for a variety of genetic diseases in humans and suggest that genetic or environmental factors that increase the frequency of chromosome breaks provide the impetus for the continued colonization of the human genome by mitochondrial DNA.Integration of mitochondrial DNA fragments into nuclear chromosomes is an ongoing process that shapes nuclear genomes. In yeast this process depends on double-strand-break repair. Since NUMTs lack amplification and specific integration mechanisms, they represent the prototype of exogenous insertions in the nucleus. From sequence analysis of the genome of DNA from mitochondria has regularly inserted into the human nuclear genome. Some insertions are polymorphic, revealing that the invasion of the human genome is an ongoing process Insertion of new sequences into nuclear DNA has a major impact on its architecture and is an important mechanism for the evolution of eukaryotic genomes. Moreover, when targeted to gene loci, these insertions can be mutagenic, and in humans this process contributes to a number of diseases . The freDNA fragments of mitochondrial origin, originating from both coding and noncoding regions, are found as sequence fossils in the nuclear genomes of various eukaryotes . HoweverHomo sapiens, experimental approaches that compare individuals within this species and its closest relative, the chimpanzee, can be undertaken .Our updated analysis (data not shown) reveals that the majority of these NUMTs correspond to those previously documented . HoweverTo determine whether sequences of mitochondrial origin were actually integrated in the human nuclear genome, and were not a result of contamination of DNA library preparations, we selected 42 NUMTs for analysis in human samples. Our choice included the 36 NUMTs with the highest identity (91% to 100%) to the mtDNA, one NUMT having the longest stretch of DNA with high identity (88%), one NUMT corresponding to the highly variable region of the mtDNA (D-loop) , and fouIn summary, results from two amplification strategies and from sequencing demonstrated that these NUMTs were indeed present at the expected chromosomal location and that they are bona fide mt sequences residing in the human nuclear genome.The colonization of human populations by various NUMTs revealed striking disparities. Thirty-five NUMTs were present in homozygous form in all individuals tested see . InteresInterestingly, one or more of these six NUMTs were detected among individuals within each ethnic group, indicating that their insertion in the nuclear genome occurred soon after the origin of modern humans and that they represent the most recent integrations of our studied cases. Despite the limited sampling size , the frequency of alleles carrying the insertion varies greatly according to the NUMT . For each locus, one to three chimpanzee individuals were analyzed. Forty-two out of 42 primer pairs successfully amplified the target site also in chimpanzees because of the high sequence identity of the two genomes (average 98.7%) are unlikely to be human-specific. This results in an average of one NUMT integration in the germline for each 180,000 y, in the last 4–6 million years (Myr). Interestingly, one fourth of these NUMTs show insertion polymorphism . Only the 98.7%) . All of The distribution of human-specific NUMTs in human chromosomes is not proportional either to the chromosome size or to the total number of NUMTs present in the chromosome . In ChroQ8N7L5 into two, and the NUMT itself becomes a new intron , a species closely related to humans and whose evolutionary relationship with humans has been widely investigated, is an ideal candidate for a comparative analysis. Moreover, the high level of identity (more than 98%) between the two species (H. sapiens. For NUMTs fixed in the human genome (not displaying insertion polymorphism), we do not expect this value to increase significantly, since our analysis was made on essentially the entire human genome.An important question concerning the integration of DNA sequences in the nuclear genome is their rate of colonization. For exogenous sequences like NUMTs, this has not been investigated in vivo. To determine the extent of colonization of a given genome, it is necessary to compare the insertions within this genome with those of a closely related species. To date, a comprehensive analysis of the presence of NUMTs has been done for several complete nuclear genomes , but the species allows tH. sapiens and have integrated in the human genome in the last 4–6 Myr, after the split of the two species from their common ancestor (Homo erectus out of Africa (1.7 Myr ago). Living humans would still be polymorphic for these NUMTs, as a result of interbreeding of the nonmodern human populations with modern humans are specific to ancestor . This coancestor . Howevern humans . On the n humans . In thisCompared to 28 NUMT insertions in the human nuclear genome in the last 4–6 Myr, it has been calculated that about 5,000 new insertion events of Alu repeats have occurred in the human genome in the same timescale “BLAST the Human Genome” server (http://www.ncbi.nlm.nih.gov/genome/seq/page.cgi?F=HsBlast.html&&ORG=Hs). The blastn program was used with default parameters on April 24, 2003. Only output parameters were changed to 1,000 descriptive lines and to 1,000 segment alignments. In a few cases were obtained as purified DNA from Coriell Institute . Purified chimpanzee DNA, obtained either from tissues or from fecal material, was a kind gift from J.-P. Vartanian at the Pasteur Institute . For both PCR strategies described in the text, primer sequences are available upon request. Cell lysis was performed by incubating fresh cells overnight at 55 °C in a Tris-EDTA buffer (pH 8.5) in the presence of 200 μg/ml of proteinase K. PCR amplification was performed with 30 cycles of denaturation (1′ at 94 °C), annealing (1′ at 68 °C), and DNA synthesis (3′ at 72 °C) using Invitrogen −8 mutations per nucleotide per generation, or 1.25 × 10−9 mutations per nucleotide per year, assuming a generation time of 20 y , where d is the frequency of sequence divergence between the NUMT and present mtDNA sequence. As an example, for a sequence 300 bp long, 94% identity to mtDNA corresponds approximately to an insertion time of 3.3 Myr, and 96% to 2.2 Myr.The age of insertion of NUMTs was estimated using, as reference, the sequence divergence of the NUMT from the mtDNA. We assumed that the NUMT, when inserted into the nuclear genome was identical to the corresponding mt sequence. We also assumed that, once inserted into the nuclear genome, the NUMT mutated at the same rate as the nuclear genome, μN, which corresponds, for noncoding sequences, to 2.5 × 10 of 20 y . By compe D-loop . Thus, fTable S1(53 KB DOC).Click here for additional data file.Table S2(63 KB DOC).Click here for additional data file.http://www.ncbi.nlm.nih.gov/genome/seq/page.cgi?F=HsBlast.html&&ORG=Hs) accession number for the human mtDNA sequence is AB055387.The NCBI (

Extramedullary myelomas (plasmacytoma) are malignant proliferations of plasma cells in the absence of bone involvement. When they occur in the soft tissue they usually involve the upper respiratory tract and oral cavity. Extramedullary plasmacytomas of breast are uncommon.A 70 year-old woman with bilateral breast masses underwent excisional biopsy for suspected primary carcinoma that subsequently proved to be a recurrence from extramedullary plasmacytoma of the mediastinum. This was diagnosed and treated 5-years prior to appearance of breast lumps.Though uncommon, considering the possibility of metastatic carcinoma and primary, secondary or recurrent lymphoproliferative disease presenting as a breast mass may avoid unnecessary surgeries. Extramedullary myelomas (plasmacytoma) are malignant proliferations of plasma cells in the absence of bone involvement. When occur in the soft tissue, it usually involve the upper respiratory tract and oral cavity . PlasmacThis report describes a patient with bilateral breast masses who underwent excision biopsy for suspected primary carcinoma that subsequently proved to be a recurrence from extramedullary plasmacytoma of mediastinum treated 5 years ago. To the best of our knowledge, this is the first case report of bilateral recurrence of a primary extramedullary plasmacytoma in breast tissues after a long disease-free interval.A 70 year-old woman with a one-month history of bilateral breast masses was referred to our cancer center for surgical evaluation. There was no associated breast pain, skin change or nipple discharge. There was no history of bone pain, weight loss, fatigue, fever or other systemic complaints and no family history of breast cancer. Significant past medical history included treatment for an extramedullary retrosternal plasmacytoma 5-years prior this admission.At the time of the initial work-up for the retrosternal mass, immunoelectrophoresis showed no evidence for hyperproteinemia or paraproteinemia. Whole body bone scan was negative and a bone marrow biopsy revealed less than 5% of plasma cells. Therefore, multiple myeloma was excluded by nuclear medicine, laboratory and histology studies. The patient underwent radiation therapy (40 Gy with fraction size of 200 cGy delivered over 4 weeks) followed by chemotherapy with cyclophosphamide, cisplatin and prednisolone. The patient was followed by laboratory tests, chest roentgenography, and computed tomography annually. A bone scintigraphy was carried out after 2 years and showed no uptake patient was thereafter lost to follow-up.Five years after initial diagnosis of extramedullary plasmacytoma the patient presented with bilateral breast masses. Physical examination revealed a 3.5 cm × 2.5 cm, mass in the upper inner quadrant of the right breast and a similar 5.0 cm × 4.5 cm mass in the lower inner quadrant of the left breast. No asymmetry, skin dimpling or signs of inflammation were present. There was no axillary or supraclavicular lymphadenopathy.Mammography confirmed a well-defined 3.2 cm oval-shaped mass in the upper inner quadrant of the right breast, and a lobulated 5.5 cm density in lower inner quadrant of the left breast without any tissue distortion, inflammation and fibrotic reaction.Figure There we99 bone scan and skull and pelvic X-rays) did not show any pathological changes. There was no evidence of anemia, hypercalcemia or renal insufficiency. However, the patient refused a second bone marrow biopsy.Excisional biopsy of the masses revealed a 5.0 (left) and 3.0 (right) well-defined, capsulated gritty mass surrounded by normal breast tissue. There was no extension from the capsulated masses to pectoral muscles or chest wall. Histopathological examination showed high-grade tumors composed of immature and mature plasma cells. Mitosis, necrosis, nuclear pleomorphism and binucleated and multinucleated plasma cells were seen. Figure AdditionImmunohistochemical studies were performed on the paraffin embedded tissues to determine if the infiltrate had monoclonal character. The tumor cells were diffusely and strongly positive for lambda chains but negative for kappa chains. Figure The tumor cells were weakly positive for monoclonal mouse anti human placental V538C, and plasma cell markers (CD138). Nuclear prognostic marker (Ki67) showed 50% to 80% nuclear expression indicative of high proliferative activity and suggesting a plasmacytic tumor with anaplastic components Figure . Other iA retrospective microscopic review of the mediastinal mass showed similar morphology to the breast tumor. Hence, the histological diagnosis of recurrent plasmacytoma was made.The patient was treated with oral Melfalan and Prednisone. The patient has been disease free for twenty months after treatment and has showed no evidence of recurrence in the mediastinum, breast or any other region.Primary soft tissue extramedullary plasmacytoma (SEP) is uncommon and is defined as a malignant tumor of plasma cells arising in the soft tissue in the absence of bone involvement. It can occur in any organ as a solitary form of plasma cell neoplasm . AlthougWhen plasmacytoma originates from soft tissues, like the case presented here, the disease is usually associated with a relatively mild clinical behavior and long survival, suggesting that it is a truly different disease entity compared to other plasma cell tumors .et al (1999) reported that solitary extramedullary (soft tissue) plasmacytomas (SEP) are less common than solitary bone plasmocytoma (SBP), and have a better prognosis as the majority can be cured by local radiotherapy [Dimopoulos otherapy .et al (1999) reported local recurrence rates of less than 5% after radiotherapy [et al (1990) noted that the risk of distant relapse is more than 30%, which is significantly less than that seen with SBP [Liebross otherapy . Mayr etwith SBP . Progreswith SBP .Involvement of the breast with SEP is uncommon and may occur either as a solitary primary tumor or as evidence of disseminated multiple myeloma . Our patOur patient did not have any prior breast aspiration cytology. There are many tumors, which may present with plasmacytoid appearance on aspiration cytology. Tumors such as small ductal carcinoma and lobular carcinoma of breast, metastatic carcinoid, metastatic melanoma and some lymphomas may represent with uncohesive group of cells with eccentric nuclei resembling plasma cells. Hence, a plasmacytoma (with anaplastic plasma cells) may be readily mistaken for carcinoma (or other undifferentiated neoplasm) not only clinically, but also on cytological examination. This would justify excision biopsy and the use of an extended immunohistochemical panel to include such markers as cytokeratin and S-100 in the assessments. To help the cytopathologist avoid misinterpretation, clinical history and presentation are extremely helpful. Most of the errors in histopathology and cytopathology diagnosis occur when pathologist is not aware of medical history of the patient and unusual clinical presentation.This case emphasizes the importance of distinguishing a plasmacytoma of the breast from primary mammary carcinomas and other benign lesions to avoid unnecessary surgery and provide the appropriate treatment and adjuvant therapy.AK carried out excision biopsies and drafted the manuscript.MJZ did the histopathological examination and contributed to the pathological content of the manuscript.SKR is the pathologist who confirmed the diagnosis and prepared the immunohistochemical stains and illustrations. He also contributed to pathological content of the manuscriptMN followed-up the patient and contributed to the manuscript preparationAll authors read and approved the final manuscript.

Quantitative proteomics is an emerging field that encompasses multiplexed measurement of many known proteins in groups of experimental samples in order to identify differences between groups. Antibody arrays are a novel technology that is increasingly being used for quantitative proteomics studies due to highly multiplexed content, scalability, matrix flexibility and economy of sample consumption. Key applications of antibody arrays in quantitative proteomics studies are identification of novel diagnostic assays, biomarker discovery in trials of new drugs, and validation of qualitative proteomics discoveries. These applications require performance benchmarking, standardization and specification.Six dual-antibody, sandwich immunoassay arrays that measure 170 serum or plasma proteins were developed and experimental procedures refined in more than thirty quantitative proteomics studies. This report provides detailed information and specification for manufacture, qualification, assay automation, performance, assay validation and data processing for antibody arrays in large scale quantitative proteomics studies.The present report describes development of first generation standards for antibody arrays in quantitative proteomics. Specifically, it describes the requirements of a comprehensive validation program to identify and minimize antibody cross reaction under highly multiplexed conditions; provides the rationale for the application of standardized statistical approaches to manage the data output of highly replicated assays; defines design requirements for controls to normalize sample replicate measurements; emphasizes the importance of stringent quality control testing of reagents and antibody microarrays; recommends the use of real-time monitors to evaluate sensitivity, dynamic range and platform precision; and presents survey procedures to reveal the significance of biomarker findings. Traditional immunoassay platforms have very limited multiplexing capability and high sample volume requirement. The development and application of high throughput, multiplex immunoassays that measure hundreds of known proteins in complex biological matrices, is becoming a significant tool for quantitative proteomics studies, diagnostic discovery and biomarker-assisted drug development [reviewed in -4]. Two Unique, general considerations in assembling multiplexed immunoassays include: Requirements for elimination of assay cross-reactivity; configuration of multi-analyte sensitivities; achievement of dynamic ranges appropriate for biological relevance when performed in diverse matrices and biological states; and optimization of reagent manufacturing and chip production to achieve acceptable reproducibility. In contrast to traditional monoplex enzyme-linked immunoassays, generally agreed specifications and standards for antibody microarrays have not yet been formulated. A number of recent articles have started to examine certain of these issues ,6,7.Microarray immunoassays performed on planar glass slides and employing signal enhancement with rolling circle amplification (RCA), have been developed by several groups and have demonstrated usefulness in measurements of temporal and dose-dependent changes in a variety of immunological model systems and human diseases ,2,8-16; -16; 8-16I. Analytes in an applied sample bind to capture antibodies immobilized on a silanized glass surface.II. Applied secondary biotinylated detector antibodies bind to captured analytes, creating a highly specific immune complex.III. Biotinylated detector antibodies bound to the immune complex are detected with a universal anti-biotin antibody. The latter is conjugated to primer oligonucleotides that are pre-annealed to a complementary circular oligonucleotide.IV. DNA polymerase extends the 3' ends of primers around the circles, resulting in long, single stranded RCA products that remain attached to the complex.The RCA product, composed of tandem DNA repeats complementary to the circle sequence, is detected by hybridization with cyanine 5 (Cy5)-labeled complementary oligonucleotides.The present report describes initial development of standardized operating procedures, quality controls and standards for microarray immunoassays performed on planar glass slides using signal enhancement with RCA. These metrics have been tested for use in generation of data with adequate sensitivity, reproducibility and assay performance for biomarker discovery -14,16, P, P16, PaTo demonstrate the feasibility of using a multiplex immunoassay system to measure protein levels in complex biological matrices, the performance of dual-antibody, sandwich immunoassay arrays performed on planar glass slides with RCA signal enhancement was evaluated for specificity, sensitivity, reproducibility and accuracy using standardized titrations, spiked biological matrices and clinical samples. Array performance was evaluated based on ability to: measure analytes across a broad dynamic range at sufficiently low coefficients of variation (CVs); detect proteins at levels requisite to capture biologically relevant expression differences; confirm reliability of methods to normalize data to minimize platform imprecision and demonstrate the utility of generating standard curves to convert analyte MFI (mean fluorescence intensity) data into mass unit information.An advantage of arrays is the ability to measure each analyte multiple times, enhancing precision. Capture antibody spots were printed in quadruplicate on planar glass slides providing redundancy of individual analyte measurements. Data redaction was applied to raw immunoassay data to improve data quality by eliminating outlier data points. Outliers were identified by employing two subsequent statistical approaches in a step-wise manner.First, the Bland-Altman plot was used. Bland-Altman plots are often used in DNA microarray analysis to identify differences and/or replicate outliers. This involves plotting the difference between the logarithm of intensities of two replicates (M) versus the average of logarithm of intensities (A) for each analyte within an individual array . Thus, there will be 6 MvA plots for each data set to reflect the 170 analytes positioned across 6 arrays. Each MvA plot will contain 3*Ns*Na points, where 3 reflects the number of possible unique pair wise combinations of the three replicates, Ns represents the number of samples and Na defines the number of analytes measured on a given array. An example of an MvA plot produced in a project comprising 150 clinical serum samples for Array 4 with 37 analytes is shown in Figure 2) is examined for each plot. Each plot contains Na data points, where Na reflects the number of analytes. Plots with R2 values <0.95 are examined to identify the cause of the poor correlation. We have identified two major sources of poor correlation: incorrect positioning of the capture grid during image quantitation and general aberrations in image spot quality. Assigning the specific source of low correlation is accomplished by tracing back to the image data. In the case of grid misplacement, suspect data images are re-quantified. Poor correlations due to aberrant spot morphology/intensity are manually examined and removed from data set. If the R2 value does not improve as a result of outlier removal, the replicate is redacted from the data set. The sample is considered passed if there are two replicates with R2 >= 0.95. The pass rate is defined as the number of passed samples divided by the total number of samples. A run of an array is considered to be passed if 85% of the samples have two or more passed replicates.The second step of data reduction involves a linear correlation analysis. Pair-wise correlation analysis is done between all replicates of individual sample. Figure 2 values < 0.95. This process reduces throughput of data redaction, particularly on large data sets. Table In our experience, applying the MvA statistical approach first, followed by the linear correlation analysis is an efficient process to identify outliers without compromising data throughput. Since, MvA plots can be generated quickly, it allows for relatively fast redaction of significant outliers using an objective semi-automated approach. In contrast, the sample correlation analysis is considerably more labor intensive and currently requires manual investigation of each scatter plot with RIn general, for data sets with more than 40 samples, outlier removal only demonstrated small improvements in reducing average CVs across all samples. The most significant impact of outlier removal is on improving reproducibility across the three replicates of the individual samples. In our experience, outlier removal has been shown to reduce individual sample replicate CVs by 2–3 fold. This effect is directly related to improving sample correlation pass rates by by 10–20%.Many systematic factors can modify spot intensity during the process of measurement. Normalization is the process of reducing the effects of systematic variation on spot intensity. Normalization in DNA microarrays typically involves adjusting distributional summaries of data from each chip to common reference values. For example, one assumption could be that the average signal from each protein chip should be the same, as with DNA microarrays and the difference between replicate values is due to systematic variability in the measurement process. Unfortunately, the nature of protein antibody microarrays, configured with a multiplex of individual capture and detector antibodies, is more specialized and differentiated than that of a DNA microarray. Use of a single reference factor derived from a global value is not sufficiently refined to take into account the difference in platform configuration. In the current report, the organization of protein microarrays allows the measurement of up to 16 samples per slide (chip). This is very different from DNA microarrays where one chip represents the total collection of measured values for an individual sample.To accommodate the differences inherent to the platform, we have applied a normalization strategy based on the three major sources of technical variability observed in our system. The first type of variability relates to spot-to-spot differences observed between quadruplicate spots of the individual analytes printed within a sample well. The second level of variability can be described as the difference in measurements between wells within the same slide. The third element of variability represents the variability observed between sample wells compared across different slides. We found that slide-to-slide variability is the largest source of variation accounting for more than 70% of the total measurement imprecision (data not shown). Thus the goal of normalization is to reduce the imprecision of slide-to-slide measurement error since this represents the major source of platform variability.Normalization is performed using a system of standard controls to reduce the effect of slide-to-slide variability. A series of four standard control samples are run in 4 wells of each slide. Each control sample represents a cocktail of the full repertoire of analytes for the given array tittered at 4 specific concentrations. The standards have been optimized at concentrations to capture measurements across the linear range of detection for each analyte. The global average of total analyte signal for the four prepared controls is calculated across all slides run in a batch. An adjustment factor is created for each slide that reflects the difference between global intensity average for all slides and the individual intensity average based on the controls from the individual slide. The averaged pixel intensity of each spot on the slide is scaled by the adjustment factor.As an example, the average value of the adjustment factor was evaluated across a batch of 33 slides and found to have a value of 1.33+/- 0.47. The primary benefit of normalization was in reducing the replicate sample CVs. Figure A 15-point series of standardized titrations containing recombinant proteins diluted in buffer were used to evaluate platform precision. This assessment was used in the quality control of each slide lot prior to release, as well as within each client project to verify run-time analyte performance. Six replicates for each point were run in the quality control testing of each slide lot and six replicates of each point were run within each client study to generate standard curves. CVs were evaluated for each concentration of analyte across six slides. Average CVs were calculated for each analyte. Statistical summaries of CV distribution across all array 2 analytes using the standardized 15-point standard titration series are shown in Table A variance decomposition analysis was performed to reveal the extent to which platform error influenced the ability to identify biomarkers. The variance component assigned to platform error was typically found to be an order of magnitude lower than the average inter-individual variation. Figure The left panel of Figure A performance assessment of individual analytes was conducted to determine the utility of each analyte across multiple projects covering diverse disease areas. Each analyte was evaluated according to the percentage of clinical samples that fell within (W), below (B) or above (A) the linear range of detection. Tables ,7,8,9,10The development of an antibody array featuring 25–40 novel immunoassays requires extensive validation related to the comprehensive assessment of antibody cross reactivity, definition of analyte minimal detection limits (MDL) and establishing robust assay performance. Each antibody array must be validated for use with several matrices, since the latter may have different ambient analyte levels or cross-reactivity profiles.Analyte sensitivity was assessed to identify analytes lacking adequate performance for retention on an array. Additional experiments were performed to determine the endogenous levels of each analyte. For analytes without previously reported biological values, the "0 × n" assays indicated the approximate ambient analyte level. Testing across multiple biological matrices was required, since different matrices affected the detection of analyte specific signals. The "0 × n" experiments also revealed the level of non-specific background which was influenced by the total concentration of antibody load in the detector mix. In our experience, certain plasma matrices were also more likely to generate high background when compared to matched serum samples. The impact of high generalized background is a reduced sample pass rate. When background was observed, the total detector antibody concentration could often be reduced to minimize background noise. Ultimately, a balance between reduction in background and enhancement of sensitivity was required to achieve maximal analyte performance in a mutiplex configuration.The results of the 1 × (n-1) assays identified analytes that demonstrated cross-reaction between the captured analyte and the complex detector mix prepared without the cognate detector antibody. Binding between the spiked analyte and the cognate capture that generated signal, indicated a cross-reaction to one or more non-cognate detector antibodies contained within the complex mix. In cases where non-cognate detector signal was observed, an additional series of experiments were run with the corresponding analyte tested against each of the individual detectors to identify the cross-reacting detector antibody. Since cross reaction is an additive process, the outcome of the cross reaction assessment allowed for adjustments to be made to achieve a balance between maximizing content with multiplexed array specificity. The 0 × (n-1) assays were run to provide a baseline of MFI values to compare to the results obtained in the 1 × (n-1). In addition, the 0 × (n-1) experiments also served to screen the various biological matrices for cross-reactivity with endogenous proteins.2 values obtained between the two conditions provided a measurement of the accuracy of the multiplexed system.Serum MDLs were typically found to be higher than buffer MDLs due to the presence of endogenous analyte, potential analyte-binding proteins present in the biological matrix and other possible matrix-related interferences. The assay conditions used to stress test the system under conditions of high analyte load were designed to identify cross-reaction thresholds for each of the individual analytes. MFI cut off values were used to identify significant increases in non-cognate signal that warranted removal of a feature from the array. The results provide a certain utility in predicting array performance under conditions where sample analyte concentrations exceed reported biological levels. Examples might include patient samples tested under diseased states, elevated analytes produced in stimulated cell culture supernatants or in samples exhibiting a strong drug response. The final validation involved measuring the accuracy of the multiplex assay when challenged with a high concentration of analyte. Figure Thirty years of widespread use of conventional, monoplex immunoassays has established firm benchmarks for performance in protein measurement. In the present paper, we have examined several, unique but general considerations in assembling multiplexed immunoassays with performance similar to conventional monoplex immunoassays. These include development of a comprehensive validation program to identify and minimize antibody cross reaction under highly multiplexed conditions; application of standardized statistical approaches for data handling for highly replicated assays; inclusion of standardized samples in each run to normalize sample replicate measurements; quality control of reagents and antibody microarrays; implementation of real-time monitors to evaluate sensitivity, dynamic range and platform precision; and initial procedures for identification of specific, significant immunoassay results in biomarker discovery projects involving clinical samples. Each of these will be discussed briefly.An array validation program represents the foundation of tests required to establish robust assay performance in a multiplexed environment. The most significant component in array validation is the comprehensive evaluation of cross reactivity. The vast majority of the ~5000 commonly available antibody pairs available today have not previously been evaluated for cross reactivity in a multiplexed environment. Therefore, the recommended program should include procedures that identify analytes demonstrating cross reactivity with immobilized capture antibodies as well as cross reaction that might manifest between the secondary detector antibody with a non-cognate analyte or non-specific binding to an immobilized capture agent.The performance of analytes in a multiplexed configuration should be benchmarked against the baseline, monoplex performance. This multiplexed immunoassay comparison with baseline performance, together with minimal standards for multiplexed cross-reactivity, permits determination of the practical, optimal number of array elements that can be successfully combined. In our experience, using dual-antibody, sandwich immunoassays, planar glass slides and RCA signal amplification, protein micorarrays can generally accommodate multiplexing of 25–35 analytes without an appreciable drop in individual analyte sensitivity or performance. Specifically, we have described development of six different dual-antibody sandwich immunoassay arrays, each containing 25–37 sandwich immunoassays. Since cross reactivity is an additive process, the ultimate goal is to achieve a balance between maximal multiplexing and monoplex-like performance. With exhaustive selection for antibodies without cross-reactivity in multiplexed format, it is possible to multiplex 50 sandwich immunoassays. However, this exercise is very expensive. In our experience, suspension arrays, alternative microarray surface substrates and attachment chemistries do not offer significant advantages in multiplexing while maintaining performance. We have not evaluated the impact of novel, affinity ligands on multiplexing.Additional array validation for cross-reactivity should include "stress-testing" under high analyte load to reflect conditions where analytes may be significantly over-expressed. In our experience, levels of induction of proteins in common biological matrices can be very large following drug administration or in disease states, and may induce cross-reactivity that is not observed in testing within normal biological analyte levels.Finally, array validation should be performed across all common sample matrices to examine effects on assay performance associated with endogenous analyte, matrix specific analyte binding proteins or other matrix-specific inhibitors. Absence of cross-reactivity for an immunoassay in one matrix does not always imply absence of cross-reactivity in others. The matrices for which the antibody microarrays described herein have been validated include isotonic buffers, serum, citrate plasma, heparin plasma, EDTA plasma, cell culture supernatants, amniotic fluid, sputum, and exhaled breath condensates. Several of the arrays have also been validated for use with ex vivo treated whole blood. EDTA plasma and ex vivo treated whole blood had higher levels of background signal and lower sample pass rates than other matrices.2> 0.95 range were eliminated. In order for data from sample replicates to pass and be admitted into the final data set, the overall sample replicate-to-replicate correlation for the 25–37 analytes of the array was required to have an R2> 0.95. Experience in multiplexed immunoassay measurements in samples across more than 30 research projects indicated the R2 value >0.95 to be routinely achievable and associated with high quality replicate data. In each project, the data lost through these two sequential redaction procedures was typically less than 5% of the total original data. An additional quality metric to assess the overall run performance was that at least two of the three replicates must have passed for 85% of the total samples. Runs falling short of this metric were failed and subject to repeat. The typical run fail rate was less than 3%.A significant advantage of array-based immunoassays is the ability to measure each analyte in a sample many times. Removal of outlier replicates is obligatory for microarray assays due to signal-related and morphology-based artefacts typically associated with dispersing small volumes of material on a solid substrate in a microarray format. Application of standardized statistical approaches for data redaction is superior to manual inspection and removal of outliers since operator-dependent subjectivity is minimized and throughput is greatly increased. The data redaction procedures described herein employed two, separate steps: Bland-Altman plots and linear correlation analysis. Bland-Altman plots were employed first and identified 99% confidence intervals for all collected data points. This enabled rapid identification and elimination of the outlying 1% of the data with minimal human intervention. This was determined to be an objective, reproducible redaction procedure that greatly reduced time and effort associated with the subsequent, second data redaction step of linear correlation analysis. Linear correlation analysis required performance of 3 replicate assays on each sample, and manual inspection of the series of 3 scatter plots generated from pair-wise correlations of these 3 sample replicates. Individual replicate points for each specific analyte that fell outside the RWithin-run controls were employed to account for the effects of systematic variation in replicate measurements. Variation was identified at three levels based on the unique configuration of the 16 sample well microarray chip. The lowest level of variability was observed between the quadruplicate spots of an individual analyte measured within a single sample well. The next level of variation was described as the difference between replicate analyte values measured in different wells located within the same slide. The highest level of variation was associated with measurements taken from a single sample applied to multiple wells positioned across different slides within a run. Since slide-to-slide variation demonstrated the highest system variation, a series of four controls were designed to minimize the impact on sample replicate measurements. The four controls contained all analytes for that array at four concentrations spread across the dynamic range. The four controls were run on every slide within a project and used to generate a global average of total analyte signal. Based on the global average, each individual slide was assigned an adjustment factor to compensate for the slide specific intensity bias. The analyte signal from each individual slide could then be scaled by the adjustment factor to normalize the intensity values between the sample replicates positioned across different slides. In addition, it is possible to use a blocking experimental design, intentionally positioning sample replicates across different slides and different slide locations to eliminate the potential for a slide-specific or location-specific intensity bias. An example of the latter might have been the well at the corner of a slide. Replicate measurements in conjunction with a mechanism to normalize systemic variation results in the production of high quality data required for maximal sensitivity in the identification of significant differences between samples in multiplexed immunoassays. An additional benefit of inclusion of standardized controls run across all slides of every project is the ability to standardize data, for example in mass units, and enable data comparisons between runs, between days and between projects. Such comparisons are necessary when projects constitute large numbers of samples or when it is desired to create a relational database of assay results. Our platform described herein, for example, can perform triplicate measurements on up to 200 samples in a single run.Quality control of approximately 1200 individual reagents is necessary in order to provide consistent performance of 170 immunoassays on the array platform described herein. These reagents, unfortunately, have widely different shelf life and storage conditions. Stringent quality control procedures specifying performance metrics associated with these reagents were required to achieve reproducible array performance across hundreds of slide lots and reagent sets. Each new lot of a given component was benchmarked to an earlier lot to verify performance. Analyte intensity, dose-response curve, LLD/ULD absolute values, dynamic range and background signal were evaluated in fuctional tests performed on all assay components. Historical performance was monitored by comparing running averages obtained from earlier lots to prevent performance change over time. These procedures were made practical by assembling cocktails of reagents for each step in an assay, dispensing these in single-use aliquots, establishing optimal storage conditions and shelf life, and performing regular quality checks on aliquots. Implementation of such procedures required use of a laboratory information management system.The utility of integrating real-time platform performance monitors cannot be understated. Given the complex nature and potential instability of biological reagents associated with a multiplex antibody array, it is critical have a program in place to evaluate performance beyond the quality control release. Real time monitors measure performance of controls under conditions identical to the test samples and reflect a second level verification of assay performance. Our test system employed a series of monitors to capture precision metrics that would create a flag to review the data if the specifications were not met. The requirements included mean coefficients of variation of assay values for controls be less than 15% and for sample replicates be less than 25% for project samples run within a batch. Failure to achieve these metrics indicated a problem related to the performance of the manufactured slides and/or reagents or a technical failure associated with sample handling or assay execution. 15-point standardized titrations were also performed on 6 slides in every run in order to captured detail related to analyte dynamic range, LLQ/ULQ values, dose response behaviour, and background signal that provided a comprehensive assessment of real time platform performance. The detail of the performance assessment was included in final reports for each project to verify data quality and generate confidence in the data generated from a highly complex assay.Evaluating data generated from multiplexed immunoassays for utility in systematic identification of significant differences between samples, or "biomarker discovery", is an important step in understanding the true platform performance. One of the procedures that revealed the sensitivity of the platform for biomarker discovery was variance decomposition analysis for each project. Variance decomposition analysis examines the magnitude of individual components of platform variation and how they compare to analyte variation between samples or individuals. In our experience the platform error of the system described herein was generally an order of magnitude lower than the heterogeneity observed between samples or individuals of the same test group. The utility of this test is in revealing the extent to which platform error impacts the ability to discover moderate expression level differences between samples that are reflective of biological change. Platforms with lower precision will have less sensitivity for detection of relevant differences between samples and will discovery only a subset of the markers that would have been identified with a more precise system.Finally, a global performance assessment should be performed across multiple projects covering diverse disease areas to gain a solid understanding of the platform utility. An evaluation of this type can be used to identify assays that will not identify differences in expression between samples because they are not sufficiently sensitive, unable to generate sufficient dynamic range given the window of expression, or reveal high endogenous abundance producing assay saturation artefacts. In addition, specific assays that have appropriate sensitivity and dynamic range may be constitutively expressed and therefore poor biomarker candidate analytes for certain disease or treatment effect studies. This analysis may be used to direct efforts to continue to optimize the survey platform in order to generate the highest value in identifying biomarkers using a quantitative proteomic approach.Protein microarrays offer the ability to simultaneously survey multiple protein markers in an effort to develop expression profile changes across multiple protein analytes for potential use in diagnosis, prognosis, and measurement of therapeutic efficacy. The current report details certain minimal standards, use of which was found to be necessary to generate the requisite specificity, sensitivity and reproducibility to discover biomarkers. Results revealed that a multiplex system could be operated with high analyte specificity, adequate detection sensitivity and sufficiently broad dynamic range to capture expression differences across diverse disease and therapeutic areas.Raw soda-lime glass slides (1" × 3") prepared with a Teflon mask configured to provide 16 individual sample wells and an etched barcode for traceability were subjected to visual inspection to identify imperfections that might translate into printing and/or scanning artifacts. Slides with scratches, surface contamination or defects in the applied Teflon mask were identified through a visual examination using a long wavelength inspection lamp equipped with a 532 nm filter. The inspection also failed slides that did not meet stringent dimensional specifications, required for downstream printing and automated assay conditions.Slides passing the visual inspection were silanized with 3-cyanopropyltriethoxysilane according to procedures previously described . MeasureCapture antibodies prepared as previously described were priEach printed array contained 256 spots representing 64 individual elements printed in quadruplicate. Each array contained 25–40 capture antibodies spread across production chips 1–6, generating a panel of 170 survey analytes. The balance of the elements was reserved for internal assay controls. Each printed array contained multiple copies of an element called BLANK, containing the components used in capture antibody preparation. Blanks were used to survey non-specific sample background within each well. Other printed controls included a series of biotinylated mouse IgG calibration standards to monitor RCA signal amplification and a third control that acted as a monitor for spot contamination resulting from carry-over between sequentially printed features.Preparations of standardized multiplex analyte titration series were manufactured using recombinant analytes diluted in buffer that covered the range from 12 pg/mL up to 81 ng/mL at 14 discrete points along with two zero analyte buffer blanks. These titration points were distributed among the sixteen available wells on a slide . Manual immersion washes were substituted with pipette delivered solutions finely tuned to control pipette tip aspiration and delivery position above printed slide wells and to carefully control liquid application and aspiration speeds to minimize disruption to the assembled immunosandwich complex. Incubation times were increased from 30 to 45 minutes for two of the assay steps and the number and volume of washes between steps increased from 2 to 4–5 and from 20 uL to 30 uL respectively. A Tecan LS200 unit was used to scan the slides. Microarray images were quantified using image capture software (ImageGrabber) developed in-house.Frozen serum samples from over 800 clinical patients were thawed, centrifuged to remove particulate matter and mixed with 0.25 mg/ml Heteroblock (Omega), 0.25 mg/ml IIR (Bioreclamation) and 0.1% Tween-20 prior to the assay. Twenty microliters of serum was applied to each well.2(Rep1/Rep2) versus the average of the log intensities (A=log2((Rep1*Rep2))/2) for each of the replicates across all analytes. Patterns were visualized using fitted curves from robust local regression with applied visual cues to identify a 99% confidence interval. All outliers in the MvA plot outside of the interval were automatically removed from analysis. The MvA scatter plots also allowed the user to highlight subsets of points on the plot and investigate patterns of intensity differences observed between replicate values. In cases where redaction of an entire replicate was too stringent, individual spots could be removed using an in-house developed software tool (Terminator) to visually inspect aberrant data points. Data redaction using this method was performed on a limited basis to remove individual spot outliers with poor circularity, non-uniform pixel intensity or missing spots.Data points producing outlier events as a result of missing spots, spots with poor morphology, or printed features demonstrating high pixel outliers were removed using a combination of automated and manual methods. MvA plots, were generated by plotting the difference of the log intensities (M=log2) value cutoff. An ideal microarray, when compared to its identical replicate, would have a R2 value of 1. Any comparison producing values lower than the cutoff would result in at least one failed replicate. Individual sample correlations were generated by plotting analyte MFI values from each replicate against the other replicates individually covering all combinations of replicates over the 25–37 analytes within the array. The R2 values obtained for the three plots were manually reviewed to identify failed sample replicates. Only sample replicates with R2 values >0.95 for replicates run within a day or R2 values >0.90 for replicates run across multiple days passed the correlation QC. A summary of the overall sample replicate pass rate monitored the number of failed replicates observed across each of the individual arrays. Project performance specifications required that >85% of all study samples had at least 2 reported replicates.As a quantitative QC measure, data review included a sample replicate correlation assessment with a predefined correlation coefficient scale to generate within-slide titration curves. Linear regression coefficients (slope and intercept) were calculated between individual titration curves from each slide to generate an "average" titration curve. Calculated slope and intercept were used to transform averaged analyte values for each sample well. Data normalization was performed on the data set after outlier removal.A standardized precision assessment was performed on each run to monitor assay performance with respect to; within well variation (based on mean coefficient of variation (CV) observed between quadruplicate printed spots for all features across all sample wells of a project) and between-slide variation . The mean and median CVs with standard deviations were also metrics included in the precision assessment. The precision assessment was performed as a quality control using the 15-point titration calibrators to qualify new slide lots and generate quality metrics for each client project.Mean fluorescent intensity (MFI) values, on a logarithmic scale, from the 3 replicate measurements of the 15 point standard titration series were used to generate precision profiles to define the upper and lower limit of quantitation within a predefined concentration CV . To do tThe VARCOMP procedure of SAS (SAS Institute), was used to obtain estimates of the variance components in a mixed model. The fixed effect variable represents variance observed in different groups in the study, for example groups of healthy versus diseased individuals. Random effects were represented by unique sample identifiers nested within levels of a fixed variable. This component of variance represented within-group differences associated with patient-to-patient variability or disease heterogeneity. The residual variance represented the platform error.Assay sensitivity was determined in two series of experiments. Initial testing to identify analyte cross-reactivity was performed in a configuration where all printed capture antibodies are surveyed in a "1 × n" format, representing a single recombinant analyte tested against all (n) detectors across multiple matrices . Capture antibodies that revealed binding to non-cognate antigens were removed or replaced with suitable alternatives. Analytes that demonstrated low signal across all matrices were removed. If signals were low in buffer, a comparison was made with signals obtained in serum or plasma to determine if the endogenous analyte level was detectable and determine if depressed signals were due to analyte instability in a non-biological matrix. Assessment of analyte endogenous level was performed using a "0 × n" format where unadulterated serum and plasma are assayed with the full complement of detector antibodies for a given array.Two conditions were examined to study potential cross-reactivity between the complex detector antibody mixture and the immobilized capture analyte. The first condition included a 1 × (n-1) format in which 1 analyte was tested in the presence of all detectors minus the detector antibody specific to the added analyte (n-1). In the case of an array containing 40 printed features, 40 unique detector antibody cocktails are prepared containing 39 of the detector antibodies found in the complex mix, with each mix containing all but one of the 40 corresponding detectors. The 40 individual reaction mixes are added to specific arrays after the arrays were incubated with the antigen corresponding to the missing detector. The second condition represented the 0 × (n-1) format where no analyte was added in the presence of all detectors minus the detector specific to the analyte under examination. In each case the analytes were spiked in buffer, serum, and plasma at a fixed analyte concentration of 50 ng/ml.Single analyte titrations were prepared in buffer, serum and plasma to assign a minimum detection limit (MDL) for each analyte based on a 95% confidence interval above background. The format of the experiments included an n × n design, where all analytes were run in the presence of all detectors. Then, using a 1 × n format, where only one antigen was added to an assay containing all detectors (n), each analyte was tested at 0X, 10X, 50X, and 100X MDL across the same test matrices to identify non-cognate cross-reaction under high analyte load. Additional antigen titration experiments were run to compare the performance achieved in the presence of a single antigen (1 × n) to one in which all analytes were present (n × n).MFI: Mean Fluorescence Intensity.RCA: Rolling Circle Amplification.CV: Coefficient of Variation2: correlation coefficientRLLQ: lower limit of quantitationULQ: upper limit of quantitationMDL: minimal detection limitsSD: standard deviationL.T. Perlee, J. Christiansen, B. Grimwade, S. Lejnine, V. Tchernev and M. Sorette were employees of Molecular Staging, Inc. and D.D. Patel and S.F. Kingsmore have received consulting fees.RD oversaw the manufacturing of reagents, JC established standardized quality control testing procedures, MS implemented assay automation and oversaw all clinical testing. BG was responsible for data curation, SL performed statistical analysis. MM and WS contributed to array develoment. SFK, VTT and DDP were involved in study design, LTP in project execution and LTP, SL, JC and SFK in manuscript preparation.

Antimicrobial resistance is particularly harmful to infectious disease management in low-income countries since expensive second-line drugs are not readily available. The objective of this study was to implement and evaluate a computerized system for surveillance of antimicrobial resistance at a tertiary hospital in Tanzania.A computerized surveillance system for antimicrobial susceptibility (WHONET) was implemented at the national referral hospital in Tanzania in 1998. The antimicrobial susceptibilities of all clinical bacterial isolates received during an 18 months' period were recorded and analyzed.The surveillance system was successfully implemented at the hospital. This activity increased the focus on antimicrobial resistance issues and on laboratory quality assurance issues. The study identified specific nosocomial problems in the hospital and led to the initiation of other prospective studies on prevalence and antimicrobial susceptibility of bacterial infections. Furthermore, the study provided useful data on antimicrobial patterns in bacterial isolates from the hospital. Gram-negative bacteria displayed high rates of resistance to common inexpensive antibiotics such as ampicillin, tetracycline and trimethoprim-sulfamethoxazole, leaving fluoroquinolones as the only reliable oral drugs against common Gram-negative bacilli. Gentamicin and third generation cephalosporins remain useful for parenteral therapy.The surveillance system is a low-cost tool to generate valuable information on antimicrobial resistance, which can be used to prepare locally applicable recommendations on antimicrobial use. The system pinpoints relevant nosocomial problems and can be used to efficiently plan further research. The surveillance system also functions as a quality assurance tool, bringing attention to methodological issues in identification and susceptibility testing. Exaggerated and irrational use of drugs, availability of antibiotics without prescription, the use of pharmaceuticals of doubtful quality and the HIV epidemic may all contribute to the current worldwide surge in antimicrobial drug resistance. Emerging resistance to antimicrobial drugs increases morbidity and mortality by hampering the provision of effective chemotherapy, and makes treatment more costly -3. The sIt is widely held that surveillance of antimicrobial susceptibility is fundamental to combat the emergence of resistance . SurveilThis paper describes the experience with the implementation of a computerized surveillance system for antimicrobial drug susceptibility at Tanzania's major referral hospital, and its use to analyze the susceptibility patterns of 7621 consecutively recorded clinical bacterial isolates.The study was performed at Muhimbili National Hospital (MNH), Dar es Salaam, Tanzania. With more than 1000 beds, MNH is the largest hospital in the country and serves as a national referral and university teaching hospital, as well as a primary and referral hospital for a population of approximately 3.6 million in the Dar es Salaam area. The Department of Microbiology and Immunology at MNH examines specimens from inpatients and outpatients at MNH, and from a number of nearby hospitals. Bacteriological cultures are performed on more than 23,000 specimens per year.st 1998 to December 31st 1999 were recorded and analyzed. The specimens examined included urine, pus/secretions , blood, cerebrospinal fluid, other body fluids, stools and other specimens. Mycobacteria and anaerobic bacteria were not included in the study. Apart from the WHONET software, we used Stata 8.0 for Macintosh to evaluate differences of proportions by Fisher's exact test .A free-of-charge software for the surveillance of antimicrobial resistance was implS. aureus NCTC 6571, E. coli NCTC 10418 or Pseudomonas aeruginosa NCTC 10662. The isolates showing intermediate resistance were few and were grouped together with sensitive isolates for the purpose of data analysis. Either methicillin or oxacillin disks were used to test for methicillin-resistance in S. aureus, the results being considered equivalent and interchangeable in the data analysis. ß-Lactamase testing was not routinely performed. The susceptibility of pneumococci to penicillin was examined by the use of penicillin 2 μg disks. Commercially produced antibiotic disks, mostly obtained from Oxoid Limited, were used, however, in some instances, antibiotic disks, prepared locally were used due to financial constraints. The Department of Microbiology and Immunology participates in an external quality assessment program in bacteriology led by the World Health Organization-collaborating centre, the National Institute for Communicable Diseases (NICD), Johannesburg, South Africa. The Department of Microbiology and Immunology at our hospital receives bacterial strains from NICD, performs species identification and antimicrobial susceptibility testing, and report the results back to NICD.The specimens were cultured and the bacterial isolates identified using standard microbiological methods as described in Mackie & McCartney Practical Medical Microbiology . SusceptWe evaluated the strengths and shortcomings of the surveillance system in our setting, particularly in terms of how well it performed in its main application areas, providing locally applicable data to guide empiric therapy, monitoring antimicrobial susceptibility trends, detecting the emergence and spread of new resistance traits and as a tool for quality assurance. We also assessed the cost-implications of implementing the surveillance program in our setting. We considered direct costs, such as the purchase of equipment, and indirect costs, such as those related to the running of the laboratory, including human resources. We also comment on the benefits of the surveillance system related to both direct patient care and long-term implications of containing antimicrobial resistance.Bacillus spp. were recovered from 22.0% (n = 447) and 6.9% (n = 141) of the blood cultures, respectively. Furthermore, five Candida spp. isolates and one Cryptococcus neoformans were recovered. Among the 49 Salmonella isolates, two were identified as S. Typhi, 16 as S. Typhimurium, 16 as S. Paratyphi B and one each as S. Paratyphi C, S. Enteritidis and S. Arizonae. Twelve Salmonella isolates were not serotyped. Among the 41gonococcal isolates, 28 (68.3%) were from genital swabs. Eleven (26.8%) gonococcal isolates were obtained from the neonatal ward, out of which 4 were specified as from eye discharge.A total of 7617 bacterial isolates were registered during the study period, of which 67.4% (n = 5134) were Gram-negative and 32.6% (n = 2483) Gram-positive. Table Specimens from inpatients and outpatients contributed to 53.2% and 31.9% of the isolates, respectively. A further 6.0% were obtained from specimens from other hospitals in Dar es Salaam, while 8.8% were obtained from other or unknown locations. Among the isolates from inpatients, 36.5% were obtained from the Department of Pediatrics, 28.4% from the neonatal section and 8.1% from the other pediatric wards. The other isolates came from the Departments of Surgery (22.4%), Internal Medicine (16.6%), Obstetrics and Gynecology (9.8%), the Intensive Care Unit (4.9%) and other locations . For 4900 isolates, the age or the estimated age group of the patient was known. Of these, 23.6% (n = 1155) were from neonates (≤ 1 month old), 6.8% (n = 335) from children aged one month to seven years, and 69.6% (n = 3410) from adults or children older than 8 years.Salmonella isolates (data not shown). The majority of Pseudomonas aeruginosa isolates was susceptibility-tested to gentamicin only, to which 4.3% (15/350) were resistant. Among the isolates of Neisseria gonorrhoeae, 70.0% were resistant to penicillin, 45.2% to tetracycline, 59.3% to trimethoprim-sulfamethoxazole, 5.9% to erythromycin and none was resistant to spectinomycin, fluoroquinolones or amoxicillin-clavulanate (data not shown).Tables E. coli from inpatients than in those from outpatients as shown in Table Klebsiella spp. from inpatients were more frequently resistant to gentamicin and trimethoprim-sulfamethoxazole than isolates from outpatients.Comparison of resistance patterns of isolates obtained from inpatients and outpatients at MNH did not show large differences. However, ampicillin resistance was more frequent in urinary isolates of Klebsiella spp. were indeed more frequently resistant to gentamicin than those from other specimen types. A significantly greater proportion of blood culture isolates of S. aureus were resistant to tetracycline than among those from other specimen types, whereas for penicillin the isolates from blood cultures were resistant in a lower proportion than the others.Comparison of resistance patterns in isolates blood cultures with those from other specimen types showed apparent great differences for some drugs, however, in most cases the number of blood culture isolates were few and did not show statistically significant differences. However, as shown in Table A great number of bacterial isolates were recorded in the system. All age groups and both inpatients and outpatients were represented in the study. More than a third of the isolates were from outpatient populations from the Dar es Salaam area, however we cannot exclude the possibility of a selection bias in favour of patients with infections caused by resistant organisms, since many patients get treatment at primary health facilities before reaching MNH. We do not know how well the rural population is represented in this material, but we assume that the outpatients in the study are mostly from the Dar es Salaam area. Ten percent of the isolates represented systemic infections, i.e. isolates from blood cultures and spinal fluid. The susceptibility test results were recorded as interpreted values (i.e. "R" (resistance), "I" (Intermediate) or "S" (susceptible)) and not as inhibition zone diameters. In this study, no molecular techniques were available for the detection of resistance genotypes and evaluation of genetic relatedness of bacterial isolates.The direct cost of implementing the surveillance system was limited to the purchase of a computer at approximately 1000 Euro. However, less expensive second-hand computers would be sufficient. The software was downloaded free of charge from the WHO website. The indirect costs of running this surveillance program are related to human sources for operating the software, including data entry and analysis, and the costs of the susceptibility testing activities. It is difficult to separate these indirect costs from the costs of running the daily laboratory activities. In our setting, a laboratory technologist from the department took on the task of operating the software in addition to her regular duties. In our experience, for a hospital of our size, it is recommendable to allocate approximately 50% of a laboratory technologist position to operating the surveillance software. In our setting, this would translate into a monthly cost of approximately 100 Euro for the department. The surveillance system is dependent on susceptibility testing of acceptable quality. The susceptibility testing incurs costs related to human resources and the purchase of laboratory reagents including antimicrobial disks and agar media. Implementing a surveillance system may increase these costs by focusing on the importance of quality reagents. However, since the susceptibility testing activities are an integral activity of the department, which would have been performed regardless of the surveillance system, we choose not to attribute their costs to the surveillance system in this context. The benefits of a surveillance system are difficult to quantify, but are of potentially great magnitude. Foremost, surveillance data may improve empiric therapy for infections and thus save lives and reduce suffering. It may reduce treatment costs by enabling the use of the least expensive effective drugs. Additionally, surveillance systems may contribute to containing or reducing antimicrobial resistance, which in the long term perspective may have great benefits in reducing morbidity and mortality, and diminish the need for expensive second-line antimicrobial agents.The strengths and weaknesses are elaborated on in the Discussion part.Experience from the World Health Organization's External quality assurance system for antimicrobial susceptibility testing has shown that disk diffusion testing is suitable for routine surveillance . HoweverE. coli, Klebsiella spp., Proteus spp. and Salmonella. Chloramphenicol may fail to cure as much as a quarter of infections caused by Salmonella and half or more of infections caused by E. coli, Klebsiella spp. and Proteus spp. Fluoroquinolones appear to be the only reliable drugs for oral treatment of infections caused by common Gram-negative bacilli, whereas gentamicin and third-generation cephalosporins remain useful for parenteral therapy.Consistent with observations from a number of other countries in the region -15 and eS. aureus, consistent with previous data from the same hospital [The study showed a very low prevalence of methicillin-resistant hospital ,18. Whilhospital . It is rhospital -21. Whilhospital ,23, the hospital from 199Recommendations for antibiotic treatment of serious bacterial infections such as bloodstream infections and meningitis should preferably be based on knowledge of the prevalence and antimicrobial susceptibility patterns of pathogens isolated from blood and spinal fluid. While a fair number of bacterial isolates were tested in the current study, the number of blood culture isolates was limited . As shown in Table E. coli and gentamicin and trimethoprim-sulfamethoxazole resistance in Klebsiella spp. were more frequent in urinary isolates from inpatients than from outpatients. Apart from that, there were no dramatic differences between isolates from inpatients and outpatients. The data from the study should be representative for both the hospital setting and to some degree the population in Dar es Salaam. However, the majority of the population of Tanzania lives in rural areas, where resistance patterns may be substantially different. Thus one should be cautious to extrapolate the results of the current study to be valid for populations in the countryside.It is important to specify for which population the surveillance data are valid. At our hospital, specimens from both inpatients and outpatients were examined. The hospital is to a great extent used as a primary hospital for the population in the Dar es Salaam area. However, among the cases coming to the hospital, there may be a degree of selection of patients with infections caused by resistant microbes, since many patients rely on health centers and pharmacies to cure simple ailments, and only come to the hospital when primary treatment fails. The study found that a few resistance traits, such as ampicillin resistance in E. coli has increased from zero in 1978–79 [E. coli has increased from 2% in the late seventies [Certain trends in antimicrobial susceptibility could be identified by comparison with data from other studies. While resistance to ampicillin, tetracycline and sulfonamides in Gram-negative bacteria was frequent already in the seventies ,27, it i 1978–79 and 8% ieventies to 20% aeventies .E. coli and Klebsiella spp. were tested for susceptibility to third-generation cephalosporins and other methods for detection of ESBL were not available.Resistance to gentamicin is common in Gram-negative bacteria with extended-spectrum beta-lactamases (ESBL), sometimes in as much as 96% of isolates . Such anP. aeruginosa the rate of gentamicin-resistance has increased, from zero in the seventies [S. aureus isolates in this study. However, the rate of tetracycline resistance (49%) was lower than reported from the same hospital in 1979 (57%) and 1982 (74%) [Vibrio cholerae, the use of the drug was subsequently greatly reduced, and this may have contributed to a concurrent decline in the rate of tetracycline-resistance in an unrelated species such as S. aureus.Also in eventies to 4% in82 (74%) . In the 82 (74%) . Due to For meaningful comparison of data from different studies, whether from the same or different laboratories, the same method of susceptibility testing should preferably be employed. In our laboratory, the same method has been used for a number of years. The WHONET software features a number of sophisticated ways to analyze susceptibility information based on the measurements of inhibition zone diameters. Recording the diameter of the inhibition zones in disk diffusion testing is generally recommended , and mayFurthermore, variations over time in the battery of antibiotics tested makes comparison of data less useful. Laboratories in low-income countries are sometimes vulnerable to this because of unreliable supplies of antibiotic discs.S. aureus and ESBL in Gram-negative bacteria. The current surveillance indicated that methicillin-resistance is rare in S. aureus at the hospital. Ideally this should be confirmed with PCR-based methods to detect the mecA gene. Likewise, the disk diffusion testing showed the presence of resistance to ceftazidime in Gram-negative isolates, albeit at a low rate, which calls for further investigation with regard to the possible presence of ESBL. Our laboratory did not employ molecular methods for detection of resistance genes on a routine basis, but a recent study showed low prevalence of methicillin-resistant S. aureus (MRSA) [Disk diffusion testing may give indications of emerging resistance traits such as methicillin-resistance in s (MRSA) . ResistaKlebsiella spp., which may suggest possible nosocomial spread. The analysis of antibiograms did not produce convincing evidence of clonal patterns spread of bacterial isolates, possibly partly due to the variations in the battery of antibiotics tested. Molecular methods for the evaluation of the genetic relatedness of bacteria were not available in this study.The WHONET software is well suited to analyze antibiograms in order to detect suspicious nosocomial outbreaks. These functions too are dependant on the use of a consistent battery of test drugs, and also works better when results are entered as actual values for MIC or zone diameters, as opposed to the interpreted value . In our hospital, comparison of resistance rates did not show dramatic variation between isolates from inpatients and outpatients. The exception was a trend for more frequent gentamicin-resistance in inpatient isolates of Gram-negative bacteria, particularly in vitro methods are followed, and only in Europe the number is at least ten [In vivo clinical assessment is of great importance in understanding bacterial drug resistance and the gold standard for evaluating resistance in malaria parasite. The multitude of methods employed for antimicrobial susceptibility testing has to some extent hampered the meaningful sharing and comparison of resistance data among countries. Recently, much work has been done in Europe to harmonize resistance surveillance efforts across country borders [In 2002 a total of 880 laboratories in 76 countries across the world used the software, including 41 laboratories in 4 African countries. The WHONET system has been implemented at MNH since 1998. Unfortunately, there is no international consensus on a recommended method for antimicrobial susceptibility testing. Worldwide at least twelve different east ten . Furthereast ten . In addi borders ,34. WhilStreptococcus pyogenes were reported as resistant to penicillin. This was subsequently double-checked, and consulting the laboratory bench-book we found that clerical errors were the explanation for this. The use of the surveillance software enabled the easy detection, investigation and correction of such errors, and consequently may contribute to increase the attention to quality issues and generally improve the performance of the lab. The current surveillance project highlighted some methodological issues, most of which were caused by budgetary limitations, such as the occasional use of locally made antibiotic disks and limitations in the identification of organisms due to lack of reagents.The implementation of the surveillance system brought focus on methodological issues, including microbial identification and susceptibility. The WHONET software has built-in functions to alert the operator if isolates with unexpected resistance patterns are entered. During the surveillance exercise in our laboratory, it was discovered that four isolates of Routine surveillance makes use of available large data sets at little additional cost and may be representative for a greater part of the population. However, often it is necessary to supplement the routine surveillance with ad hoc studies aimed at investigating particular problems. While ad hoc studies generally are more expensive to conduct, they allow for the use of more advanced and expensive laboratory methods and are better at targeting particular populations of interest. The current surveillance study identified a need for more data from bloodstream infections in order to provide reliable guidance for the treatment of serious bacterial infections. As a consequence of this, we started a study of bloodstream infections with the pediatric department at the hospital. Another laboratory-based research was started to ascertain the finding that methicillin-resistance in staphylococci is still relatively infrequent at this hospital.) in Tanzania.Resistance surveillance is a platform from which to promote focus on antimicrobial resistance issues, both within the hospital and the medical community, but also among the general population. In conjunction with the surveillance exercise, we have highlighted issues regarding antimicrobials and resistance in local newspaper letters , and theThe study suggests that laboratories, which perform susceptibility testing, can gain useful information on antimicrobial susceptibility with a minimal budget. As appropriate software can be obtained free-of-charge, the main cost of the surveillance system is associated with purchasing a computer. However, there are other, indirect costs, which may be attributed to the surveillance program depending on the situation of the laboratory, such as running costs for microbiologic procedures, including susceptibility testing. Particularly, it is important to ensure availability of antimicrobial discs of satisfactory quality. A susceptibility surveillance system also implies the need for some additional human resources for data entry and analysis. In our experience, it is recommendable to allocate approximately 50% of a laboratory technologist position to this task. While the WHONET program is excellent for entry, analysis and reporting of resistance data, the software is not intended to function as a complete patient management system for the laboratory. Data can be transferred from other databases into WHONET by the use of a complementary software called BacLink . However, in laboratories such as ours, where the management of patients' laboratory tests is handled manually via register-books, the data must be punched into WHONET by hand. Since the WHONET database is not used directly for patient management, the surveillance activity tends to become less integrated in the clinical routine work than it should. Thus, although the program performs its task very well, in a long-term perspective, a surveillance system that is integrated with a patient management system might be more sustainable. It is difficult to quantify the potential benefits of a well-functioning surveillance system. However, we are fully convinced that the modest costs of the surveillance program are highly justified since the data generated may improve empiric therapy, help contain or prevent the further emergence of antimicrobial resistance, decrease the need for expensive second-line antimicrobial drugs and, ultimately, save lives and reduce suffering.It is imperative to preserve the effectiveness of common antibiotics by promoting rational use of antibiotics based on sound knowledge of local resistance patterns. In a hospital with bacteriology services, the implementation of a computerized surveillance system is a low-cost tool to make use of available resistance data. In our hospital, the resistance surveillance system has generated information on resistance patterns that is useful as guidance for empiric therapy of infections. It can help alert clinicians of trends of antimicrobial resistance, guide drug-policy decisions and facilitate rational use of drugs to prevent the further emergence of antimicrobial resistance. The surveillance system has also served as a quality assurance tool and led to increased focus on antimicrobial resistance and prudent use of drugs. There is need for more data from blood cultures for reliable guidance for the treatment of severe, systemic bacterial infections. For antibiotic policy recommendations to be applicable for the general population, more information is needed from outpatients and rural areas.There is limited information on antimicrobial resistance trends on the African continent. Only four African countries use the WHONET system for antimicrobial resistance surveillance, although some countries may use other similar software. Recently much work has been done to establish consensus and a more standardized approach to resistance surveillance in Europe . SusceptThe authors declare that they have no competing interests.BB was the principal investigator, participated in the planning and execution of the study, performed data entry and data analysis, and was the main responsible author. DSMM, WU, SYM and AD participated in the planning of the study and contributed to the writing process. MM contributed to designing the WHONET database, performed data entry and microbiological work, and contributed to the writing process. SH participated in the writing. NL was the project coordinator and participated in planning, data analysis and writing.The pre-publication history for this paper can be accessed here:

Birds have smaller average genome sizes than other tetrapod classes, and it has been proposed that a relatively low frequency of repeating DNA is one factor in reduction of avian genome sizes.Gallus gallus) autosomes were quantified and compared with those in human autosomes. In the chicken 10.3% of the genome was occupied by DNA repeats, in contrast to 44.9% in human. In the chicken, the percentage of a chromosome occupied by repeats was positively correlated with chromosome length, but even the largest chicken chromosomes had repeat densities much lower than those in human, indicating that avoidance of repeats in the chicken is not confined to minichromosomes. When 294 simple sequence repeat types shared between chicken and human genomes were compared, mean repeat array length and maximum repeat array length were significantly lower in the chicken than in human.DNA repeat arrays in the sequenced portion of the chicken (The fact that the chicken simple sequence repeat arrays were consistently smaller than arrays of the same type in human is evidence that the reduction in repeat array length in the chicken has involved numerous independent evolutionary events. This implies that reduction of DNA repeats in birds is the result of adaptive evolution. Reduction of DNA repeats on minichromosomes may be an adaptation to permit chiasma formation and alignment of small chromosomes. However, the fact that repeat array lengths are consistently reduced on the largest chicken chromosomes supports the hypothesis that other selective factors are at work, presumably related to the reduction of cell size and consequent advantages for the energetic demands of flight. Genomes sizes (as measured by the DNA mass per diploid nucleus) are smaller on average in birds than in other tetrapod classes, and genome sizes within the class Aves show less variation than those of other tetrapod classes ,2. It haAn alternative to the hypothesis that the reduced genome size is adaptive is the hypothesis that it resulted from an event of genomic DNA loss that was fixed in the ancestor of all birds due to genetic drift. The fixation of even a deleterious mutation is possible if the population undergoes an extreme bottleneck . Some auGallus gallus) and human (Homo sapiens) genes. They found that corresponding introns were significantly shorter in chickens, indicating that numerous independent deletions have occurred in the introns of birds. These results support the hypothesis that genome size reduction in birds is adaptive, since it is unlikely that such a large number of independent deletion events were due to chance alone. Additional evidence in support of the adaptive hypothesis is provided by the observation that a secondary increase in genome size has occurred in avian lineages which have become flightless or have reduced flying ability [In order to decide whether genome reduction in birds was adaptive or due to a random event, Hughes and Hughes compared ability .It has been suggested that an important factor in genome size reduction in birds has been that birds have lower levels of repetitive DNA than other vertebrates . GenomesThe sequencing of a substantial portion of the chicken genome has made it possible to examine quantitatively the distribution of repeating sequences on different chromosomes in the genome. Here we compare the distribution of repeats on 28 sequenced autosomes of chicken with that on the 22 human autosomes in order to test the hypothesis that reduction in repeat density in the avian genome has occurred as a result of adaptive evolution.The characteristics of repeat arrays on the 28 sequenced chicken chromosomes are summarized in Table In the chicken genome, there was a significant positive correlation between chromosome length and the percentage of the chromosome occupied by repeats (% repeats) based on reassociation kinetics ,12. By c% based oMoreover, when simple sequence repeat array types shared between chicken and human genomes were compared, mean repeat array length and maximum repeat array length were significantly lower in the chicken than in human. The fact that these differences occurred consistently in nearly 300 distinct array types is evidence that the reduction in repeat arrays in the chicken has involved numerous independent evolutionary events. Mutational changes to simple sequence repeat arrays typically involve slippage events that either decrease or increase the number of repeat units . The facThere were substantial differences among chicken chromosomes with respect to the percentage of the chromosome occupied by repeats, and % repeats increased significantly as a function of chromosome length. This trend implies that the avian genome is characterized by an especially pronounced avoidance of longer repeats on the smaller chromosomes. This finding is consistent with the hypothesis of Burt that theHowever, even the largest chicken chromosomes had repeat densities much lower than human chromosomes of similar length Figure . This imGallus gallus) genome assembly was downloaded from Ensembl web site at . Only autosomes were used in the analyses; data were available for chromosomes 1 through 24, 26, 27, 28 and 32. We extracted Ensembl annotations of the features of repeat arrays . The human genome assembly ) was downloaded via the UCSC Genome Browser . Repeat information based on the RepeatMasker annotations was extracted from the UCSC genome annotation database. Only autosomes (chromosomes 1 through 22) were used. For both chicken and human, repeats tallied included simple sequence repeats, class I elements, class II elements, low-complexity regions, and satellite regions. In addition, we compared between genomes a set of 294 simple sequence repeats which were present in both genomes; i.e., repeats of the same short nucleotide motif were present in both genomes. For these 294 repeat types, mean, minimum and maximum length of repeat arrays were compared in pairwise fashion between human and chicken.The chicken (HP gathered and summarized the data. ALH conducted statistical analyses and wrote the manuscript. Both authors read and approved the final manuscript.

Several problems exist with current methods used to align DNA sequences for comparative sequence analysis. Most dynamic programming algorithms assume that conserved sequence elements are collinear. This assumption appears valid when comparing orthologous protein coding sequences. Functional constraints on proteins provide strong selective pressure against sequence inversions, and minimize sequence duplications and feature shuffling. For non-coding sequences this collinearity assumption is often invalid. For example, enhancers contain clusters of transcription factor binding sites that change in number, orientation, and spacing during evolution yet the enhancer retains its activity. Dot plot analysis is often used to estimate non-coding sequence relatedness. Yet dot plots do not actually align sequences and thus cannot account well for base insertions or deletions. Moreover, they lack an adequate statistical framework for comparing sequence relatedness and are limited to pairwise comparisons. Lastly, dot plots and dynamic programming text outputs fail to provide an intuitive means for visualizing DNA alignments.). GATA uses the NCBI-BLASTN program and extensive post-processing to identify all small sub-alignments above a low cut-off score. These are graphed as two shaded boxes, one for each sequence, connected by a line using the coordinate system of their parent sequence. Shading and colour are used to indicate score and orientation. A variety of options exist for querying, modifying and retrieving conserved sequence elements. Extensive gene annotation can be added to both sequences using a standardized General Feature Format (GFF) file.To address some of these issues, we created a stand alone, platform independent, graphic alignment tool for comparative sequence analysis (GATA GATA uses the NCBI-BLASTN program in conjunction with post-processing to exhaustively align two DNA sequences. It provides researchers with a fine-grained alignment and visualization tool aptly suited for non-coding, 0–200 kb, pairwise, sequence analysis. It functions independent of sequence feature ordering or orientation, and readily visualizes both large and small sequence inversions, duplications, and segment shuffling. Since the alignment is visual and does not contain gaps, gene annotation can be added to both sequences to create a thoroughly descriptive picture of DNA conservation that is well suited for comparative sequence analysis. The most widely used methods for aligning DNA sequences rely on dynamic programming algorithms initially developed by Smith-Waterman and Needleman-Wunsch ,2. TheseWhen aligning protein coding sequences, dynamic programming works quite well. Evolution exerts significant functional constraint on protein coding sequences. When an inversion, duplication or segment-shuffling event occurs, the protein is often compromised by truncation due to the introduction of frame shifts and stop codons. These deleterious mutations are typically lost and not observed in the surviving population. When aligning this type of constrained sequence element, dynamic programming works quite well.Functional non-coding sequences do not appear to be as constrained in the ordering of elements as protein coding sequences -6. CompaGATA employs a two tiered architecture in aligning DNA sequences. GATAligner executes and processed BLASTN output. GATAPlotter displays the processed alignments and annotation from GATAligner.The GATAligner application figure uses theOur initial goal was to create a high resolution sequence alignment and visualization tool to use in identifying small sequence rearrangements, like those associated with evolving non-coding regulatory DNA. We initially divided the first sequence into overlapping windows offset by one base pair. A Smith-Waterman dynamic programming algorithm was then used to align each window against the entire second sequence. Windows were scored, merged, and saved as above. Although this method is more rigorous than using BLASTN, it took 20–50 times as long, and did not produce significantly different results (data not shown). It should be noted that BLASTN requires seven consecutive identical bases to align two sequences. Thus in rare cases, some windows will be missed, for example, GGGGGGcTTTTTTaCCCCCCgAAAAAA versus GGGGGGaTTTTTTgCCCCCCtAAAAAA.The GATAPlotter application figure takes suGATAPlotter also has the capability to display extensive gene annotation for one or both input sequences. The principle component of gene annotation rendering by GATA is the "GeneGroup" figure . Each GeDrosophila melanogaster and D. pseudoobscura. Figure To illustrate the types of rearrangements GATA can distinguish, examine figures Several related alignment and visualization tools have proven useful in comparative sequence analysis. Dot plot analysis can be used to identify duplications and inversions. Programs such as Dotter, JDotter, Dotlet, and Family Relations -16 generOne program that is proving quite useful in avoiding the collinearity problem while still using a dynamic programming algorithm is Shuffle LAGAN . AlignmeOne of the major challenges facing bioinformaticians is the development of alignment and visualization tools for multi-species comparative sequence analysis. Within the fly community alone, 12 divergent species of diptera and hymenoptera will be sequenced within 3 years. A variety of higher eukaryotes including human, mouse, rat, dog, chimp, cow, chicken, opossum, and platypus have or are in the process of being completely sequenced. How can one visualize the alignment and species-specific annotation for 12 orthologs of a particular gene or a genomic segment? The GATA alignment paradigm is well suited to this challenge and will play a prominent role in GATA's development.As comparative sequence analysis accelerates, scientists need more sophisticated alignment and visualization tools to define the evolutionary relationships and functional significance between particular orthologous sequences. This is especially true for regulatory, non-coding DNA that can show significant small-scale rearrangements. These new tools must incorporate detailed annotation alongside views of sequence conservation while providing easy access to the underlying sequence information. GATA provides one such solution.Project name:GATA, graphic alignment tool for comparative sequence analysis.Project home pages: and Operating system(s):Platform independentProgramming language:JavaOther requirements:Java 1.4 or higherLicense:GNU GPLAny restrictions to use by non-academics:NoneDAN designed and constructed the GATA programs with advice and supervision from MBE.

Dyslipidemia has been associated with hypertension. The present study explored if polymorphisms in genes encoding proteins in lipid metabolism could be used as predictors for the individual response to antihypertensive treatment.1-adrenergic receptor blocker atenolol for twelve weeks.Ten single nucleotide polymorphisms (SNP) in genes related to lipid metabolism were analysed by a microarray based minisequencing system in DNA samples from ninety-seven hypertensive subjects randomised to treatment with either 150 mg of the angiotensin II type 1 receptor blocker irbesartan or 50 mg of the βThe reduction in blood pressure was similar in both treatment groups. The SNP C711T in the apolipoprotein B gene was associated with the blood pressure response to irbesartan with an average reduction of 19 mmHg in the individuals carrying the C-allele, but not to atenolol. The C16730T polymorphism in the low density lipoprotein receptor gene predicted the change in systolic blood pressure in the atenolol group with an average reduction of 14 mmHg in the individuals carrying the C-allele.Polymorphisms in genes encoding proteins in the lipid metabolism are associated with the response to antihypertensive treatment in a drug specific pattern. These results highlight the potential use of pharmacogenetics as a guide for individualised antihypertensive treatment, and also the role of lipids in blood pressure control. Hypertension is a complex trait caused by multiple environmental and genetic factors interacting through the cardiac, vascular and endothelial systems. Several drug classes with different mechanisms of action, including inhibitors of the renin-angiotensin-aldosterone system (RAAS), calcium channel blockers, adrenergic receptor blockers and diuretics, are available for treatment of hypertension. However, the response to antihypertensive treatment is highly variable between individuals, which makes it difficult to predict the efficacy of a specific drug in the individual patient -3. CurreTwin studies have estimated that as much as half of the variability in blood pressure levels between individuals is due to genetic factors ,8. Based1-adrenergic receptor blocker atenolol [The RAAS and the sympathetic nervous system play key roles in blood pressure regulation. We have earlier shown that polymorphisms in the angiotensin converting enzyme gene and a SNatenolol . DyslipiWe have recently developed a microarray based minisequencing system for parallel genotyping of multiple SNPs in blood pressure regulating candidate genes . Here we1-adrenergic receptor blocker atenolol once daily as monotherapy. The dose was doubled after six weeks if the diastolic blood pressure was ≥ 90 mmHg. Blood pressure was measured by trained nurses using a mercury sphygmomanometer, after the patients had rested for at least 10 min in the seated position. Left ventricular hypertrophy was defined as left ventricular mass index of > 131 g/m2 for men and > 100 g/m2 for women, assessed by echocardiography. The data presented relates to the change in blood pressure after 12 weeks of treatment. For details on the SILVHIA trial, see Malmqvist etal [DNA extracted from blood samples from 97 hypertensive patients from the double blind parallel group "Swedish Irbesartan Left Ventricular Hypertrophy Investigation versus Atenolol" (SILVHIA) trial were anaist etal . Baselin) and the SNP Consortium databases and validated in a pooled DNA sample representing the Swedish population. A subset of these SNPs located in genes involved in lipid metabolism and that were polymorphic in the Swedish population were included in the study presented here, together with one additional SNP in the apolipoprotein A-V gene. See Table In our previous study , 98 SNPsFragments comprising the SNPs were amplified in multiplex PCR described previously . A microAnalysis of covariance (ANCOVA) with each SNP as factor, baseline blood pressure as covariate and the change in blood pressure as response, was performed. The analyses were performed by treatment group and blood pressure measurement (systolic and diastolic blood pressures). Correction for multiple testing was performed by calculation of critical p-values corresponding to a nominal type I error of 5% using a permutation test . Two taiWe explored possible associations between individual genotypes of ten SNPs and reduction in systolic and diastolic blood pressure as response to treatment with atenolol or irbesartan Figure in samplCorrection for multiple testing using a permutation test yielded The SNP C711T in the apolipoprotein B gene is located in the coding region of the gene, and alters a threonine residue to an isoleucine residue in the protein. This SNP is located in the amino-terminal part of the enzyme and has been suggested to affect the dimerisation of apolipoprotein B and low density lipoprotein during cholesterol transport . The C16We have recently found circulating apolipoprotein B to be the most powerful predictor of endothelium-dependent vasodilation of the commonly used markers of cholesterol metabolism . It is nIn our earlier exploratory study, 74 SNPs with a minor allele frequency over 5%, including nine of the SNPs analysed here were tested as predictors of blood pressure regulation in the SILVHIA study samples using a multiple regression model . The maiA remaining weakness in our study is the small number of samples available for analysis, which does not allow detection of small to medium size gene effects, and results in uncertain estimation of the the magnitude of the effects detected. Moreover, in a small study there is the risk of a non-representative group of patients with respect to gender, age, and genotype distribution. Despite these limitations, we detected a significant effect of the SNP C711T in the apolipoprotein B gene and the SNP C16730T in the low density lipoprotein receptor after correction for multiple testing. The pharmacogenetically interesting results from our study need to be replicated in other studies.As the C711T SNP in the apolipoprotein B gene predicted response to treatment with irbesartan, and the C16730T SNP in the low density lipoprotein receptor gene appeared to predict response to atenolol treatment, our results point at possible use of SNPs in genes encoding components of lipid metabolism in pharmacogenetic panels for selecting the optimal drug for each patient. To our knowledge our study is the first one to investigate the relationship between polymorphisms in genes involved in lipid metabolism and the response to antihypertensive treatment.The authors declare that they have no competing interests.UL performed the development of genotyping technology, genotyping lab work, interpretation of data and had a substantial role in writing the manuscript. LL provided clinical expertise, participated in selection of candidate genes and contributed to writing. LK provided clinical expertise, established a database of the SILVHIA phenotypes, and in writing. LB performed the statistical analysis. TK provided the SILVHIA samples and contributed to writing the manuscript. A-CS contributed by planning and supervision of the project, and to writing the manuscript.The pre-publication history for this paper can be accessed here:

Hirudo medicinalis, has been used in plastic and reconstructive surgery, to relieve venous congestion and to improve the microrevascularization of flaps. In many countries, wild leeches are still provided from local markets and utilised with antibiotic prophylaxies. In this research, results of identification of bacteria in the transport fluid is reported, oral and intestinal floras and the antibiograms of the identified microorganisms are investigated. Also, to avoid possible infections, the ability of hypochloric acid, a disinfectant, to suppress the relevant microorganisms without changing the life style and behavior of leeches in terms of sucking function, is investigated.Medicinal leech, ppm concentrations in different groups of 25 leeches. Finally, 20 leeches were applied atraumatically to the bleeding areas of rats, the duration of suction was determined and compared statistically between the leeches treated and not treated with hypochloric acid solution.Bacterial identifications and antibiograms of oral and intestinal flora and transport medium were performed for 10 leeches. The optimum concentration of hypochloric acid which eliminated microorganisms without affecting the viability and sucking function of the leeches were determined by dilution of hypochloric acid to 100, 50, 25, 12.5, 6.25 Aeromonas hydrophilia was the most commonly identified microorganism and found to be resistant to first generation cephalosporins, frequently used in prophylaxis at surgical wards. In the next stages of the study, the leeches were subjected to a series of diluted hypochloric acid solutions. Although disinfection of the transport material and suppression of the oral flora of hirudo medicinalis were successful in 100, 50, 25, 12.5, 6.25 ppm concentrations; 12.5 ppm solution was the greatest concentration in which hirudo medicinalis could survive and sucking function was not affected significantly.External decontamination of wild leeches with 12.5 ppm hypochloric acid enables bacterial suppression without causing negative effects on leech sucking function and life. Hirudo medicinalis, has been used with increasing frequency during the past few decades for salvage of venous compromised pedicled flaps, microvascular free-tissue transfers and replantations. Although the therapeutic use of leeches in medicine dates back 50 BC; for centuries they were collected from various water supplies and utilised under septic conditions with the risk of wound infection and infestation. The supply of leeches was modernized by medicinal leech farm set up in the 1970s [The medicinal leech, Aeromonas is the most common microorganism in leech infections and may cause a wide spectrum of deseases such as cellulitis, ocular infections, arthritis, myocarditis, peritonitis, meningitis, bacteremia and sepsis [Today, leech therapy is indicated in plastic and reconstructive surgery, to relieve venous congestion and to improve the microrevascularization of flaps Fig ,2,3,4 ord sepsis . In manyIn the first stage of the study, bacterial content of the transport fluid of leeches that were bought from local markets were studied, also oral and intestinal flora cultures and antibiograms of the identified microorganisms were performed subsequently.In the next stages hypochloric acid, a disinfectant, was tested on animals that were not bred in specific laboratories, to suppress the relevant microorganisms in order to avoid possible infections, without changing the life style and behavior of leeches in terms of sucking function.This study was approved by the Animal Care and Ethics Committee of our institution.A. hydro/caviae and A. sobria for definite identification. Since bacterial growth was observed in specimens taken from oral and intestinal flora or transport fluid of all animals except one ; antibiograms for aeromonas isolates were performed.Ten leeches were obtained with their 100 cc original water from different stores. Their sizes varied between 6–10 cm in length and 0, 5 – 1, 5 cm in width. They were transported in sterile boxes immersed in the water which the animals were kept at the market. For 2 days they were observed at room temperature. Specimens were taken and smears from transport fluids were prepared. All leeches were held with sterile gloves and prepared in sterile conditions. Specimens were obtained from their mouth with the help of sterile cotton – swab. After traction was applied between the mouth and posterior muscular organ, the animal was cleaned with alcoholic solution of povidone-iodine, as described by Hokelek et al. [ppm solutions were prepared by adding apropriate amounts of hypochloric acid into the transport fluids of 25 leeches seperately with five animals in each concentration group. After 10 minutes of contact with hypochloric acid solutions at 20°C, smears were taken from mouths and transport fluids of each leech under sterile conditions with cotton-swabs. Cotton-swabs were put into a neutralizing media (lecithinized agar media) because they could also contain disinfectant fluid which would prevent microorganism reproduction. Then the neutralized smears were planted into MacConkey and blood agar [ppm solutions lost their muscular activity and died ;the leeches which were treated with 12.5 and 6.25 ppm hypochloric acid solutions were alive. Bacterial growth was not observed in either concentration group for the specimens taken from oral flora and transport fluid, however bacterial cultures were positive for in specimens taken from the intestine or crop. Of these microorganisms, bacterial colonies for Aeromonas spp were counted. To compare the changes in the number of Aeromonas colonies in leech intestinal flora induced with the application of hypochloric acid, the intestine of five new leeches were exposed as described for Stage 1. Based on the findings of Stage 2, a concentration of 12.5 ppm was chosen for Stage 3 studies.30 leeches from different stores were obtained and transported in different sterile boxes with their 100 cc original water as in stage 1. On the following day, samples were taken from transport fluids and oral region and planted in MacConkey and blood agar. Twenty five leeches, which had bacterial growth in either oral flora or transport water were used for the second stage. 100, 50, 25, 12.5, 6.25 ood agar . The leeppm hypochloric acid solution was prepared with the transport fluids. After waiting for 10 min at 20°C temperature, smears were taken from the oral floras and fluids again. All leeches were put into boxes containing distilled water and watched for survival and blood suction function on sedated rats (ketamine 30 mg/kg and xylazine 10 mg/kg). After shaving dorsal region of 20 rats, 2 mm long skin incissions were done in order to produce bleeding. The leeches were applied to the bleeding areas atraumatically and the duration of suction was determined and compared statistically (ANOVA) between the leeches treated and not treated with hypochloric acid solution. Statistical significance was presumed at p < 0.05.20 leeches were obtained with their 100 cc original water from different stores and equally divided into two groups. One group was treated with hypochloric acid while the others had no treatment at all. After taking specimens from the transport fluids and oral floras, for 10 leeches 12.5 aeromonas species, peudomonas species, acinetobacter species, sphingobacterium species) was observed. In one media, Gram (+) growth was seen :meticilline susceptible coagulase (-) staphylococcus. Dominant microorganisms were aeromonas species, Table Aeromonas spp. was investigated by using conventional methods and a commercial kit ID 32 GN ATB System (BioMérieux). In this study, with this system the results were obtained as A. hydro/caviae, A. sobria, A. salmonicidia and A. spp, with the latter nomenclature designating all other Aeromonas species. The most commonly encountered agents, A. hydro/caviae and A. sobria underwent further biochemical studies, as suggested by Abbott, et al.[A. hydro/caviae was in fact A. hydrophila, and A. sobria was in fact A. veronii biovar sobria , intestinal flora in 9 animals (90%) and transport media in 5 animals (50%). In one leech, no growth was observed in either oral, intestinal and transport fluid cultures. In all culture media, 4 different gram (-) bacterial growth however the difference between control group and 6.25 ppm group was not significant.Fluid and oral flora cultures that were prepared before hypochloric acid application showed multiple microorganism growth, as it was in stage 1. After adding hypochloric acid there was no growth in transport fluid and oral media cultures in either concentration so that no identification and antibiogram study could be performed. After 10 minutes in hypochloric acid solution, leeches were taken to sterile containers which contained distilled water. The muscle activity of all leeches that had been treated in 100 All the leeches survived while hyperactivity followed by hypoactivity was seen in the group of leeches treated with hypochloric acid. In this group, two of the leeches never made suction but the other eight leeches sucked the bleeding area for 5–16 min (mean 12.2 ± 3.8). Non hypochloric acid treated group sucked for 9–22 min (mean 15.5 ± 4.4) and the difference between two groups was not significant .Aeromonas spp) were observed. After hypochloric acid application no growth was observed in any of the specimens taken from animals, therefore no identifications or antibiograms could be performed.In 70 % of cultures that were prepared from transport fluids of leeches and in 50% of cultures that were prepared from oral floras of leeches before hypochloric acid application, bacterial growth rods, Acinetobacter Iwofii and A sobria were isolated. All of the isolates were sensitive to ciprofloxacine, cefotaxime, ceftazidime, gentamycine and trimetoprim-sulfamethoxasole [Aeromonas hydrophylia colonies which produced inducable betalactamase. In case of infections with these species, beta lactam antibiotics except carbapenems should not be used.In countries, where special farms for medicinal leeches do not exist, animals obtained from markets should be studied for their floras and antibiotic susceptibilities. Eroğlu et al. investigated the floras and the antibiotic susceptibility of leeches in Black Sea region. Most commonly hoxasole . LikewisIn addition, we aimed to supress possible bacterial contamination of the transport media and oral floras of leeches but not intestinal flora because of the endosymbiotic relationship of the aeromonas and leech, with hypochloric acid solutions at disinfectant concentrations that does not affect the life style of leeches.Aeromonas spp. are sensitive for 12 hours but could not eradicate aeromonas from the intestines [Investigators have attempted to disinfect the guts of leeches before they are placed on patients by placing the ectoparasites in % 0.02 chlorhexidine for 15 seconds or in antibiotic solutions (tetracycline or cefoperazone solutions) for 12 hours, but these attempts were unsuccessful [testines .We preferred hypochloric acid which is an ideal disinfectant and has a wide antibacterial spectrum for desired purpose. Chlorine in the form of hypochloric acid exhibits rapid microbicidal activity by inhibiting of key enzymatic reactions within the cell and eventual protein denaturation. It has a rapid bactericidal effect and can dissolve in water. However, it has some disadvantages as it irritates mucosal membranes, has interactions with some chemicals and metals .ppm concentrations on pseudomonas was achieved within 10 min exposure [Aeromonas spp. cause similar nosocomial infections and has similar antibiotic susceptibility with pseudomonas spp. Therefore, in the second stage of our study, beginning with 100 ppm, we applied decreasing concentrations of hypochloric acid in transportation fluids, observed bacterial growth by taking specimens from transport material and oral flora of hirudo medicinalis. We tried to find the dilution ratio that was closest to 100 ppm, suppresing oral flora and transfer liquid and also allowing the leech to survive with normal function. As a result of the second stage of the study we found out that concentration to be 12.5 ppm.It was showed that bactericidal effect of hypochloric acid of 100 exposure . AeromonIn the third stage, we observed that mean sucking duration of the hypochloric acid treated group was shorter than the other group but the difference was not significant (12.2 min & 15.5 min respectively). However hypochloric acid had successful disinfection effect for transport liquid and oral flora. In our opinion, such a decrease in duration of sucking function can be preferable to infection possibility. Since leeches are much cheaper than antibiotics, it is logical to use them once, after treating with hypochloric acid, and never utilise them again.We do not advise to use "full-up" leeches over and over again by putting them in hypertonic solutions to force them vomitting because if they regurgitate, the intestinal flora can readly contaminate the environment where the leeches are kept and cause infection eventually. Although the oral flora and transport enviroment studies do not really address the problem since excretory contamination is probably the major factor in leech infections ; we believe that to take any measure in order to decrease the infection risk during utilisation of ordinary leeches is valuable.ppm hypochloric acid solution with transport fluids of ordinary leeches obtained from the local market for 10 minutes and then taking the leeches gently from water before application can prevent possible infections caused by contamination from leech oral flora and transport medium.We can comment that preparation of 12.5 None declared.AA and SVK participated in design of the study, involved in the dissections of leeches. EH and ST participated in the design of the study and writing of the manuscript.HN, NG and BO involved in the antibiogram tests. SNK participated in design of the study.The pre-publication history for this paper can be accessed here:

Stevie Wonder and Ray Charles are often cited as evidence that blindness confers superior musical ability. Wonder lost his sight after an incubator-related oxygen overdose during infancy; Charles lost his as a boy to glaucoma. It's impossible to know whether sight would have compromised their success, but many gifted musicians, from Jose Feliciano to Rahsaan Roland Kirk, lost their sight at an early age.A number of human studies show that blind persons perform nonvisual tasks better than those with sight. Neuroimaging studies of blind persons performing nonvisual tasks, including hearing, show activity in brain areas normally associated with vision. But much remains to be learned about the nature and extent of this phenomenon: how these “visual areas” are used, the mechanisms that generate individual differences , and the neural processes that underlie it.The task of localizing sound—which requires integrating information available to one ear only or information derived from comparing sounds binaurally—is particularly suited to investigating the neural remapping that seems to follow vision loss. In a previous study, Franco Lepore and colleagues showed that people who lost their sight at an early age could localize sound, particularly from monaural cues, better than those who could see. These findings suggested that areas of the brain normally dedicated to processing visual stimuli might play a role in processing sound in these individuals. In a new report, Lepore and colleagues use functional imaging studies to investigate the functional relationship between neural activity and enhanced hearing abilities in the blind, and find a strong correlation between superior sound localization skills and increased activity in the brain's visual center.The authors hypothesized that if visual cortex recruitment bolstered auditory function in some individuals, then visual cortex activity would correlate with individual differences in performance, and the degree of activity should predict such differences. Nineteen people—seven sighted and twelve who lost their sight at an early age—were placed in an echo-free chamber and asked to indicate where a sound was coming from, using either one or both ears. The participants then performed the same tasks within a positron emission tomography (PET) machine, which measures brain activity through changes in cerebral blood flow (CBF).Five of the blind participants could accurately localize sounds monaurally; most of the sighted could not. Only the blind individuals with superior localization skills showed increased CBF in the visual cortex while performing monaural localization tasks. Interestingly, during binaural localization, the sighted participants showed decreased CBF in visual cortical areas. This decrease comports with previous studies showing that engaging one brain center—say, the temporal lobe, which processes sound—inhibits activation of others—such as the occipital lobe, which processes visual cues. These inhibitions appear to be absent in blind persons, though it's not clear why. It could be that blind persons don't need such inhibitions, the authors speculate, or maybe unrestricted access to the visual center serves to compensate for vision loss by boosting nonvisual senses.Whether the enhanced auditory performance reported here simply reflects increased efficiency of auditory processing or indicates “supranormal” powers, Lepore and colleagues argue that their results show that the visual cortex is “specifically recruited to process subtle monaural cues more effectively.” It will be interesting to learn whether blind persons can recruit visual centers for other auditory tasks or to help them navigate the world without sight. Such studies would be vital for tailoring sensory support to suit individual needs and maybe even suggest ways to facilitate the neural cross talk that enhances auditory performance. But don't expect such innovations to recreate the likes of Rahsaan Kirk or Ray Charles anytime soon.

A systematic search among the latter for a fusogenic activity had led to the identification of two bona fide genes, named syncytin-1 and syncytin-2, most probably co-opted by primate genomes for a placental function related to the formation of the syncytiotrophoblast by cell-cell fusion. Here, we show that one of the newly identified envelope gene, named envP(b), is fusogenic in an ex vivo assay, but that its expression – as quantified by real-time RT-PCR on a large panel of human tissues – is ubiquitous, albeit with a rather low value in most tissues. Conversely, the second envelope gene, named envV, discloses a placenta-specific expression, but is not fusogenic in any of the cells tested. Altogether, these results suggest that at least one of these env genes may play a role in placentation, but most probably through a process different from that of the two previously identified syncytins.A recent These sequences share strong similarities with present-day retroviruses, and are the proviral remnants of ancestral germ-line infections by active retroviruses, which have thereafter been transmitted in a Mendelian manner (reviewed in -3). The ectively ,8. The sh genome . The seqenv gene, namely on the alignment of a conserved domain of the transmembrane (TM) subunit [env gene is closely related to that of MER66, MER84 and Z69907 families. This gene seems to be part of a very degenerate proviral structure, with only the LTR being identifiable . 3' LTRs are also found just downstream of the envelope genes . The analysis of the PBS (Primer Binding Site) region located downstream of the two 5' LTRs of this family reveals a high degree of homology to the PBS for Val-tRNA , are clribed in ).env genes with an open reading frame would be amplified among all the envelope genes of a given family, by positioning them within domains of maximal divergence between the coding and the non-coding copies. For the HERV-V coding envelope, the primer pair was designed in the 3' part of the gene, where the two envV genes are the most divergent (79% identity in the last 200 nt). An additional primer pair was also designed to monitore the expression of the truncated HERV-V env gene. To assess the specificity of each primer pair for the corresponding env gene, the PCR products obtained upon amplification of genomic DNA were cloned into a pGEM-T vector and 6 clones per amplicon were sequenced. In each case, the 6 sequences corresponded to the expected env gene. Analysis of the expression level of the coding envP(b) and envV genes was achieved on a series of 19 healthy human tissues, and the results are represented in Figure envV was found to be placenta-specific. Interestingly, the truncated envelope of the HERV-V family is highly expressed in the placenta as well, but poorly in other tissues (data not shown). EnvP(b) expression, on the other hand, was observed at a rather low level in almost all the tissues tested, without any specificity for the placenta.To determine whether these two genes could play a role in human placentation, we then characterized their expression pattern and fusogenic properties, as previously performed for the 16 coding envelope genes already identified . To get env genes of the human genome tested in [envW (syncytin-1) and envFRD (syncytin-2), had been found to be fusogenic in an ex vivo assay. As these two env genes were highly and specifically expressed in the placenta, it was suggested that they are involved in a major physiological process within this organ, namely fusion of the cytotrophoblast cells to form the syncytiotrophoblast layer. The two newly identified env genes were therefore similarly tested. To do so, they were first cloned and introduced into a eukaryotic expression vector. The envP(b) gene was PCR-amplified from the DNA of BAC RP11-828K24 by using a proofreading DNA polymerase and running a 15-cycle PCR reaction, whereas the envV gene -not available as BAC DNA- was PCR amplified from the genomic DNA of a Caucasian individual using the Expand long template enzyme mix (Roche Applied Science). Both env genes were then assayed for cell-cell fusion on a large panel of mammalian cells using a transient transfection assay and two clones from each construct. As shown in Figure envP(b), and in none of them for envV. The truncated envelope protein member of the HERV-V family was also tested and, as expected, was not fusogenic (data not shown). In some respect, these results are surprising. Indeed, the putative protein encoded by envP(b) is fusogenic despite the absence of a canonical fusion peptide, i.e. of a hydrophobic region located at the N-terminus of the putative TM subunit, just downstream of the SU-TM cleavage site . To check that the lack of fusogenicity of the latter gene is not due to a fortuitous gene polymorphism of the envV gene from the selected individual, we PCR-amplified, cloned and assayed the envV gene from two other individuals (for both the complete and the truncated envV genes): no cell-cell fusion was observed either (data not shown). Finally, we identified and cloned the chimpanzee orthologous envV gene (which is fully coding as well): neither did it display any fusogenic activity in our assay (data not shown).Among the 16 coding ested in , only twenvV and envP(b) genes are most probably not "syncytin-like" genes, sensu stricto. Additional experiments should now be devised to assess their role -if any- in human physiology.In conclusion, the present analysis shows, rather paradoxically, that the envelope protein with fusogenic properties is not placenta-specific, whereas the one which is exclusively expressed in the placenta -a characteristic pattern of the two previously described fusogenic syncytin-1 and syncytin-2 gene products- is not fusogenic. In this respect, these results suggest that the two newly identified HERV, human endogenous retrovirus; TM, transmembrane; LTR, Long Terminal Repeat; PBS, Primer Binding Site.The author(s) declare that they have no competing interests.env genes and the cell-cell fusion assays.SB carried out the cloning of the NdP analyzed the sequences, constructed the phylogenetic tree, designed and carried out the Real-Time RT-PCR experiments, and drafted the manuscript.TH conceived the study.

Doctors and researchers often look for the rapid proliferation of T cell populations, key defensive players in the immune system, as a telltale sign that the body is working hard to fend off a foreign threat. Every one of these circulating white blood cells carries a T cell receptor (TCR) that binds to a specific protein, or antigen, when displayed on the surface of a cell. A match between TCR and displayed antigen results in the cell's death and the subsequent expansion of T cell clones, all programmed to recognize the original offending protein. Some TCRs bind and expand in response to pathogenic antigens, such as viral or bacterial proteins. But T cells can also react and proliferate inappropriately in response to the body's own proteins, leading to destructive autoimmune diseases such as multiple sclerosis, which is characterized by immune system attacks on nervous tissue. Self-recognizing TCRs, however, can also target and destroy tumors—though full activation of these T cells is inconsistent and poorly understood.PLoS Biology, Frances Crawford and colleagues have developed a novel method for rapidly identifying TCR mimotopes—peptide sequences similar or identical to epitopes that also elicit the immune response—which can be used to determine the antigen of a given T cell population.Identifying the particular antigen behind an exploding population of T cells is invaluable for finding the source of autoimmune diseases and studying immune responses to cancer. But it's a laborious and time-consuming process, as researchers are faced with the prospect of sifting through millions upon millions of possible matches between TCRs and their prospective antigen epitopes—the part of the antigenic molecule to which the receptor binds. Now, as they report in this issue of Working backwards, the team started off with two different T cell clones that had been previously selected for with a known antigen—a peptide called p3K. One clone was derived from mice genetically engineered to have broadly reactive T cells; the other, a conventional clone, was much more sensitive to the precise molecular structure of p3K.Crawford and colleagues then created a “peptide library” comprising more than 30,000 baculoviruses (viruses that selectively target insect cells), each one carrying a slightly different version of the p3K gene, varied in regions of the peptide known to be important for TCR binding. These p3K genes were embedded within a major histocompatibility complex (MHC) gene—a type of cell surface protein that holds displayed antigens and is also important for proper TCR recognition. The team then unleashed their virus library onto insect cells that, once infected, began to produce the specific peptide–MHC complexes encoded on the viral DNA. The insect cells then shuttled these proteins to their surfaces, resulting in a vast array of cells that each displayed a unique variant of the p3K–MHC complex. This “display library” was then incubated with fluorescently labeled TCRs from the two different clones. By observing and isolating the insect cells that lit up, the researchers could see which of the thousands of cells displaying peptide–MHC possessed a mimotope capable of binding a TCR. Because the genetic information about the displayed complex was still stored within the virus-infected cell, the researchers could determine the full peptide sequence responsible for the identified mimotopes.Confirming the effectiveness of their method, the results of the fluorescence experiments echoed the authors' original characterizations about the two populations of T cells. The broadly reactive TCR bound to several different uniquely displayed complexes; it had 20 mimotopes. The conventional TCR, however, bound only to one peptide–MHC complex, an almost perfect match to the original p3K peptide. Though this study was based on a known antigen and epitope , the baculovirus display library technique described here could easily be used on T cell populations with unknown antigens. With such a tool, researchers could, for example, identify the antigens connected with tumor-fighting T cells and, through inoculation, possibly induce the production of similar T cells in cancer patients who lack them.

Disturbances in the immune system has been described in Turner syndrome, with an association to low levels of IgG and IgM and decreased levels of T- and B-lymphocytes. Also different autoimmune diseases have been connected to Turner syndrome , thyroiditis being the most common.Besides the typical features of Turner syndrome ear problems are common .Levels of IgG, IgA, IgM, IgD and the four IgG subclasses as well as T- and B-lymphocyte subpopulations were investigated in 15 girls with Turners syndrome to examine whether an immunodeficiency may be the cause of their high incidence of otitis media. No major immunological deficiency was found that could explain the increased incidence of otitis media in the young Turner girls. Recurrent otitis media is often a problem in children with Turner syndrome (TS) ,2. More TS is caused by the presence of only one normally functioning X-chromosome. The other sex chromosome can be missing or abnormal and mosaicism is often present. Occurring in one of every 2000 female births, TS is one of our most common sex chromosome abnormalities . TS is cImmunological disturbances have previously been described in TS, with an association to reduced levels of serum IgG and IgM, increased IgA and decreased levels of circulating T- and B-lymphocytes. However, the results have not been conclusive -12.2 deficiency commonly develop recurrent acute otitis media. It is believed that these infections are secondary to impaired antibody response, rather than Eustachian tube dysfunction [In the normal population children with IgGfunction . As immuThe aim of this study was to investigate immunoglobulin and lymphocyte subpopulations in girls with Turners syndrome to examine whether an immunodeficiency may be the cause of their high incidence of otitis media. Immunotherapy would then be a possible treatment.Blood samples from patients with the diagnosis TS, genetically confirmed, were investigated according to the Swedish ethical record no 88–265.Analyses regarding immunoglobulin- and lymhpocyte subpopulations were performed in 15 girls, aged 5–17 years (median age 11 years), randomly selected from all girls in this age group with TS attending the Karolinska Hospital, Stockholm . Of these 53% (n = 8) had suffered from repeated attacks of otitis media. All TS girls had been treated with growth hormones and their karyotypes were: 45, X (n = 8); 45, X/46, XX (n = 4); 45, X/46, X, i(Xq) (n = 2); and 45, X/46, X, r(X) (n = 1) (r = ring chromosome).A medical history was attained, focusing on autoimmune diseases, previous and current ear diseases and other infectious diseases, ear operations, and hearing problems.9/L) were analysed in a Coulter MicroDiff II (Beckman-Coulter). The differential leukocyte counts and percentages were obtained by 2-color FACS-analysis with CD14/CD45 markers. The number and percentage of lymphocyte subpopulations were obtained by standardized 2- or 3-color FACS-analysis on Epics XL or Elite flowcytometer (Beckman-Coulter) using commercial reagents. CD19+ was marker for B-cells and CD3+ for T-cells, CD3+CD4+ for helper T-cells, CD3+CD8+ for cytotoxic T-cells, CD56+CD3- for NK-cells and HLA-DR+ for activated T-cell subsets. The ratio of CD4+/CD8+ was also calculated. The monoclonal antibody clones used were: UCHT1 (CD3+), SFCI12T4D11/T4 (CD4+), SFCI21Thy2D3/T8 (CD8+), 116/Mo2 (CD14+), 89B/B4 (CD19+), KC56 (CD45+), NKH1 (CD56+) and 9-49/I3 (HLA-DR+), all from Cytostat, Beckman-Coulter. All FACS-analyses were performed at the routine laboratory, Department of Clinical Immunology, Karolinska Hospital and the results were compared to age-related in-house and published reference ranges (5 to 95 percentiles) [+CD3- for which an adult reference was used (10–90 percentile).Leukocyte counts -allotyping of IgG2 were analysed by standard methods and compared to age related reference ranges used at the routine laboratory, Department of Clinical Immunology, Karolinska Hospital, Stockholm.Hemolytic complement , IgA antibodies to gliadin and endomysium, IgG antibodies to pneumococcal polysaccharide and tetanus toxoid antigen, the serum concentrations (g/L) of circulating IgA, IgG, IgM, IgD, IgGMedians of continuous parameters were compared between groups by Mann-Whitney U-test and correlations were performed by Spearman rank analysis. A two-tailed p < 0.05 was considered significant.+ and CD8+ T-cells (HLA-DR+). However, the CD4+/CD8+ ratio was in the lower range (girls aged ≥10), with one girl having a very low ratio (0.6).The leukocyte counts as well as the absolute counts and percentages of lymphocytes, monocytes, and granulocytes were within normal limits for all 15 Turner girls. Likewise most girls had normal counts and percentages of lymphocyte subpopulations as compared to the 5 to 95% percentiles age-related reference ranges Fig. and 1b iHemolytic complement was within normal limits for all 15 Turner girls.1 (10.2 and 10.8 g/L), one with low IgG2 (0.4 g/L) and two girls with low IgG4 (<0.01 g/L).The serum concentrations of IgG, IgA, IgM, IgD and the four IgG subclasses were for most Turner girls within the age-related 95% confidence intervals Fig. . The excThe frequency of homozygous G2m(23)-negative Turner girls was 33% (5/15).Normal levels of IgG antibodies to tetanus toxoid and polysaccharide antigen were detected among most Turner girls, except for two respectively one, having too low levels. Slightly elevated IgA antibodies to gliadin were observed in 3 (20%) girls, whereas no IgA antibodies to endomysium could be detected in any of the 15 girls.+ (p = 0.0053) and CD4+HLA-DR+ (p = 0.035), as well as the percentage of CD19+ (p = 0.023). Also IgG2 increased with age (p = 0.05). These findings are in line with the reference literature for the normal population [When comparing girls aged <10 years (n = 4) and ≥10 years (n = 11) the following parameters were found to be influenced by age with decreased values among the older girls: total counts of leukocytes (p = 0.0093), lymphocytes (p < 0.05), monocytes (p = 0.0093), granulocytes (p = 0.015), CD19pulation .+ T-cells (p = 0.0087), CD4+ T-cells (p = 0.012) and CD4+HLA-DR+ (p = 0.05) as well as in the percentage of CD3+ T-cells (p = 0.05) in otitis prone (n = 5) compared to otitis free (n = 6) Turner girls was shown. No such differences were noticed for any immunoglobulin levels, antibody titers, CD4+/CD8+-ratio or CD8+, CD19+, CD56+CD3- lymphocyte subpopulations.The girls with TS were divided into two groups according to their history of recurrent otitis media. As age influenced some of the parameters we only considered girls ≥10 years old (n = 11). Significant increases in absolute counts of lymphocytes (p = 0.004), CD3Any apparent influence, of the different karyotypes, on any of the parameters studied was not observed within the group.In this study no major derangement in the immune status was found among the girls with TS. Normal levels of most lymphocyte- and immunoglobulin subpopulations were registered. The few outliers noted must be considered as a normal individual variation.+/CD8+ ratio in the lower range [+ population. Although, the patients were few, we noticed some differences between the otitis prone and otitis free Turner girls. The elevated counts of lymphocytes, CD3+, CD4+ cells and CD4+HLA-DR+ cells seen among the otitis prone girls, probably reflects a secondary effect of an activated immune system involving T-helper cells, rather than any immune deficient state. Moreover, the levels of IgG antibodies to pneumococcal polysaccharide antigen, which are important in the defense of bacteria, were normal. A homozygous lack of the IgG2m(23) allotype was seen in 33% of the girls, which is the same frequency as in the normal population [2. In the study group a negative IgG2m(23) allotype was not correlated to a positive history of recurrent otitis media, neither could the different karyotypes be associated to the levels of immunoglobulin- or lymphocyte subpopulations. Perhaps the cause of the repeated attacks of otitis media in Turners syndrome is not to be found in the periphery, but rather more locally. Even if earlier computed tomography scans of the temporal bone have not shown any abnormalities [However, as described in an earlier study of Turner girls, the present study confirmed a CD4er range , supposepulation . A negatmalities . The SHOmalities . As the Our findings of normal immunoglobulin- and lymphocyte subpopulations are not entirely in concordance with some earlier studies, where a reduction of circulating IgM and IgG as well as T- and B-lymphocytes has been observed ,10. HoweIn conclusion, we did not find any major immunological deficiency in immunoglobulins or lymphocyte subpopulations that could explain the increased incidence of otitis media observed in girls with TS. Therefore, treatment with immunotherapy is not an option in this patient group. Further studies are warranted to elucidate local pathology, both from an immunological and anatomical point of view.AES participated in the design of the study, performed the statistical analysis and drafted the manuscript. LS participated in the design of the study and collected the blood samples. CGMM performed the statistical analysis. MH participated in the design and coordination of the study and collected the blood samples.All authors read and approved the final manuscript.

A detailed description of the aims and methods of the Bioconductor project, an initiative for the collaborative creation of extensible software for computational biology and bioinformatics. The Bioconductor project is an initiative for the collaborative creation of extensible software for computational biology and bioinformatics. The goals of the project include: fostering collaborative development and widespread use of innovative software, reducing barriers to entry into interdisciplinary scientific research, and promoting the achievement of remote reproducibility of research results. We describe details of our aims and methods, identify current challenges, compare Bioconductor to other open bioinformatics projects, and provide working examples. The Bioconductor project is an inAmong the many challenges that arise for both statisticians and biologists are tasks of data acquisition, data management, data transformation, data modeling, combining different data sources, making use of evolving machine learning methods, and developing new modeling strategies suitable to CBB. We have emphasized transparency, reproducibility, and efficiency of development in our response to these challenges. Fundamental to all these tasks is the need for software; ideas alone cannot solve the substantial problems that arise.The primary motivations for an open-source computing environment for statistical genomics are transparency, pursuit of reproducibility and efficiency of development.a priori how sensitive the ultimate analyses are to variations or errors in the many steps in the pipeline. Credible work in this domain requires exposure of the entire process.High-throughput methodologies in CBB are extremely complex, and many steps are involved in the conversion of information from low-level information structures to statistical databases of expression measures coupled with design and covariate data. It is not possible to say Experimental protocols in molecular biology are fully published lists of ingredients and algorithms for creating specific substances or processes. Accuracy of an experimental claim can be checked by complete obedience to the protocol. This standard should be adopted for algorithmic work in CBB. Portable source code should accompany each published analysis, coupled with the data on which the analysis is based.By development, we refer not only to the development of the specific computing resource but to the development of computing methods in CBB as a whole. Software and data resources in an open-source environment can be read by interested investigators, and can be modified and extended to achieve new functionalities. Novices can use the open sources as learning materials. This is particularly effective when good documentation protocols are established. The open-source approach thus aids in recruitment and training of future generations of scientists and software developers.The rest of this article is devoted to describing the computing science methodology underlying Bioconductor. The main sections detail design methods and specific coding and deployment approaches, describe specific unmet challenges and review limitations and future aims. We then consider a number of other open-source projects that provide software solutions for CBB and end with an example of how one might use Bioconductor software to analyze microarray data.The software development strategy we have adopted has several precedents. In the mid-1980s Richard Stallman started the Free Software Foundation and the GNU project as an atOne of the key success factors of the Linux kernel is its modular design, which allows for independent and parallel development of code in a virIn this section, we review seven topics important to establishment of a scientific open source software project and discuss them from a CBB point of view: language selection, infrastructure resources, design strategies and commitments, distributed development and recruitment of developers, reuse of exogenous resources, publication and licensure of code, and documentation.CBB poses a wide range of challenges, and any software development project will need to consider which specific aspects it will address. For the Bioconductor project we wanted to focus initially on bioinformatics problems. In particular we were interested in data management and analysis problems associated with DNA microarrays. This orientation necessitated a programming environment that had good numerical capabilities, flexible visualization capabilities, access to databases and a wide range of statistical and mathematical algorithms. Our collective experience with R suggested that its range of well-implemented statistical and visualization tools would decrease development and distribution time for robust software for CBB. We also note that R is gaining widespread usage within the CBB community independently of the Bioconductor Project. Many other bioinformatics projects and researchers have found R to be a good language and toolset with which to work. Examples include the Spot system , MAANOVAR is a high-level interpreted language in which one can easily and quickly prototype new computational methods. These methods may not run quickly in the interpreted implementation, and those that are successful and that get widely used will often need to be re-implemented to run faster. This is often a good compromise; we can explore lots of concepts easily and put more effort into those that are successful.The R environment includes a well established system for packaging together related software components and documentation. There is a great deal of support in the language for creating, testing, and distributing software in the form of 'packages'. Using a package system lets us develop different software modules and distribute them with clear notions of protocol compliance, test-based validation, version identification, and package interdependencies. The packaging system has been adopted by hundreds of developers around the world and lies at the heart of the Comprehensive R Archive Network, where several hundred independent but interoperable packages addressing a wide range of statistical analysis and visualization objectives may be downloaded as open source.The complexity of problems in CBB is often translated into a need for many different software tools to attack a single problem. Thus, many software packages are used for a single analysis. To secure reliable package interoperability, we have adopted a formal object-oriented programming discipline, as encoded in the 'S4' system of formal classes and methods . The BioAccess to data from on-line sources is an essential part of most CBB projects. R has a well developed and tested set of functions and packages that provide access to different databases and to web resources . There is also a package for dealing with XML , availabAmong the statistical and numerical algorithms provided by R are its random number generators and machine learning algorithms. These have been well tested and are known to be reliable. The Bioconductor Project has been able to adapt these to the requirements in CBB with minimal effort. It is also worth noting that a number of innovations and extensions based on work of researchers involved in the Bioconductor project have been flowing back to the authors of these packages.Among the strengths of R are its data and model visualization capabilities. Like many other areas of R these capabilities are still evolving. We have been able to quickly develop plots to render genes at their chromosomal locations, a heatmap function, along with many other graphical tools. There are clear needs to make many of these plots interactive so that users can query them and navigate through them and our future plans involve such developments.snow and rpvm simplify the development of portable interpreted code for computing on a Beowulf or similar computational cluster of workstations. These tools provide simple interfaces that allow for high-level experimentation in parallel computation by computing on functions and environments in concurrent R sessions on possibly heterogeneous machines. The snow package provides a higher level of abstraction that is independent of the communication technology such as the message-passing interface (MPI) "HUMAN"> x$accession[1] "P09651"> unlist(x$get_keywords)[1] "Nuclear protein" "RNA-binding"[3] "Repeat" "Ribonucleoprotein"[5] "Methylation" "Transport"...RSPerl is not a Bioconductor-supported utility, and that installation of the BioPerl and RSPerl resources to allow interoperation can be complicated.The .PerlPackage command brings the BioPerl modules into scope. .Perl invokes the BioPerl get_sequence subroutine with arguments "swiss" and "ROA1_HUMAN". The resulting R object is a reference to a perl hash. RSPerl infrastructure permits interrogation of the hash via the $ operator. Note that Key differences between the Bioconductor and BioPerl projects concern scope, approaches to distribution, documentation and testing, and important details of object-oriented design.BioPerl is clearly slanted towards processing of sequence data and interfacing to sequence databases, with support for sequence visualization and queries for external annotation. Bioconductor is slanted towards statistical analysis of microarray experiments, with major concerns for array preprocessing, quality control, within- and between-array normalization, binding of covariate and design data to expression data, and downstream inference on biological and clinical questions. Bioconductor has packages devoted to diverse microarray manufacturing and analysis paradigms and to other high-throughput assays of interest in computational biology, including serial analysis of gene expression (SAGE), array comparative genomic hybridization (arrayCGH), and proteomic time-of-flight (SELDI-TOF) data. We say the projects are 'slanted' towards these concerns because it is clear that both projects ultimately aim to support general research activities in computational biology.perl -MCPAN -e shell. This process supports automated retrieval of requested packages and dependencies, but is not triggered by runtime events. Bioconductor has extended the CRAN distribution functionalities so that packages can be obtained and installed 'just in time', as required by a computational request. For both Perl and R, software modules and packages are structured collections of files, some of which are source code, some of which are documents about the code. The relationship between documentation and testing is somewhat tighter in Bioconductor than in BioPerl. Manual pages and vignettes in Bioconductor include executable code. Failure of the code in a man page or vignette is a quality-control event; experimentation with executable code in manual pages (through the example function of R) is useful for learning about software behavior. In Perl, tests occupy separate programs and are not typically integrated with documentation.BioPerl inherits the distribution paradigm supported by CPAN. Software modules can be acquired and installed interactively using, for example Both R and Perl are extensible computer languages. Thus it is possible to introduce software infrastructure supporting different approaches to object-oriented programming (OOP) in various ways in both languages.R's core developers have provided two distinct approaches to OOP in R. These approaches are named S3 and S4. In S3, any object can be assigned to a class (or sequence of classes) simply by setting the class name as the value of the object's class attribute. Class hierarchies are defined implicitly at the object level. Generic methods are defined as ordinary functions and class-specific methods are dispatched according to the class of the object being passed as an argument. In S4, formal definition of class structure is supported, and class hierarchy is explicitly defined in class definitions . Class iClass::Multimethod module can be used to allow multiple dispatch behavior of generic subroutines. The specific classes of objects identified in BioPerl are targeted at sequence data , location data , and an important class of objects called interface objects, which are classes whose names end in 'I'. These objects define what methods can be called on objects of specified classes, but do not implement any methods.OOP methodology in Perl has a substantial history and is extensively employed in BioPerl. The basic approach to OOP in Perl seems to resemble S3 more than S4, in that Perl's bless operation can associate any perl data instance with any class. The CPAN Other open bioinformatics projects have intentions and methods that are closely linked with those of Bioconductor.SJava interface lmFit from the limma package, which can assess differential expression between many different groups and conditions simultaneously. The function lmFit accepts a model matrix which describes the experimental design and produces an output object of class MArrayLM which stores the fitted model information for each gene. The fitted model object is further processed by the eBayes function to produce empirical Bayes test statistics for each gene, including moderated t-statistics, p-values and log-odds of differential expression. The log2-fold changes, average intensites and Holm-adjusted p-values are displayed for the top 10 genes < 0.05> esetSel <- eset There are 165 genes selected for further analysis. A heat map produced by the heatmap function from R allows us to visualize the differential action of these genes between the two groups of patients. Note how the different software modules can be integrated to provide a very rich data-analysis environment. Figure t-test. Many of these questions are normally addressed in terms of a hypergeometric distribution, but they can also be thought of as two-way or multi-way tables, and alternate statistical tests can be applied to the resulting data.We can carry out many other tests, for example, whether genes encoded on a particular chromosome (or perhaps on a specific strand of a chromosome) are over-represented amongst those selected by moderated GOHyperG is found in the GOstats package. It carries out a hypergeometric test for an overabundance of genes in our selected list of genes for each term in the GO graph that is induced by these genes annotation in conjunction with these data. We first identify the set of unique LocusLink identifiers among our selected Affymetrix probes. The function s Figure .p-value found was 1.1e-8 and it corresponds to the term, "MHC class II receptor activity". We see that six of the 12 genes with this GO annotation have been selected. Had we used a slightly less conservative gene selection method then the number of selected genes in this GO annotation would have been even higher.The smallest hgu95av2, with those for their array and the basic principles and code are unchanged.Reproducing the above results for any other species or chip for which an annotation package was available would require almost no changes to the code. The analyst need only substitute the references to the data package, Similarly, substitution of other algorithms or statistical tests is possible as the data analyst has access to the full and complete source code. All tools are modifiable at the source level to suit local requirements.We have detailed the approach to software development taken by the Bioconductor project. Bioconductor has been operational for about three years now and in that time it has become a prominent software project for CBB. We argue that the success of the project is due to many factors. These include the choice of R as the main development language, the adoption of standard practices of software design and a belief that the creation of software infrastructure is an important and essential component of a successful project of this size.The group dynamic has also been an important factor in the success of Bioconductor. A willingness to work together, to see that cooperation and coordination in software development yields substantial benefits for the developers and the users and encouraging others to join and contribute to the project are also major factors in our success.To date the project provides the following resources: an online repository for obtaining software, data and metadata, papers, and training materials; a development team that coordinates the discussion of software strategies and development; a user community that provides software testing, suggested improvements and self-help; more than 80 software packages, hundreds of metadata packages and a number of experimental data packages.At this point it is worth considering the future. While many of the packages we have developed have been aimed at particular problems, there have been others that were designed to support future developments. And that future seems very interesting. Many of the new problems we are encountering in CBB are not easily addressed by technology transfer, but rather require new statistical methods and software tools. We hope that we can encourage more statisticians to become involved in this area of research and to orient themselves and their research to the mixture of methodology and software development that is necessary in this field.In conclusion we would like to note that the Bioconductor Project has many developers, not all of whom are authors of this paper, and all have their own objectives and goals. The views presented here are not intended to be comprehensive nor prescriptive but rather to present our collective experiences and the authors' shared goals. In a very simplified version these can be summarized in the view that coordinated cooperative software development is the appropriate mechanism for fostering good research in CBB.

We report here the identification of a nonsense alternative transcript of the fumarylacetoacetate hydrolase of the The del100 and del231 transcripts arise due to minor alternative splicing pathways and del100 is likely subjected to nonsense-mediated mRNA decay. However the remaining amount of transcript seems sufficient to produce a protein in different human tissues. This suggests that NMD has a broader role than simply eliminating aberrant transcripts and when coupled to alternative splicing, may act to modulate gene expression, by allowing the production of low amounts of protein. Caenorhabditis elegans [in silico analyses show that 35% of EST-suggested alternative transcripts contain PTCs [Cells have evolved surveillance mechanisms to ensure the fidelity of gene expression. One such mechanism, nonsense-mediated mRNA decay (NMD), was discovered about twenty years ago in yeast and then elegans ,10. The elegans ,10. This elegans ) is also elegans -14. It w elegans ,15,16. F elegans . The res elegans . This ne elegans . This coain PTCs . Alternaain PTCs , and in ain PTCs . Whetherfah coding gene located on chromosome 15 in the q23-q25 region [fah gene, including 7 nonsense mutations [per se. Interestingly, del100 has skipped exon 8 and as a consequence, the reading frame is shifted, with the appearance of several new PTCs. This transcript is therefore likely subjected to NMD, as suggested by a block of translation by cycloheximide. However, the amount of nonsense transcript which escapes NMD seems to be sufficient to produce a protein of 31-kDa, detected in several human tissues. This report suggests that NMD may allow for the production of low amounts of protein.Fumarylacetoacetate hydrolase is the last enzyme of the tyrosine catabolic pathway. A deficiency in FAH causes hereditary tyrosinemia type I , the most severe disease of the pathway . This in5 region spans ovutations -26. Whilfah gene at nucleotide position 786 and is frequent in the Finnish population [fah gene. The first one, del100, lacks exon 8 , which weakens the donor splice site of exon 9 . Becausefah gene, rather than resulting from the presence of the W262X mutation.Altogether, these data strongly argue in favor of del100 and del231 being minor alternative transcripts of the fah gene raised the question whether they resulted from errors of the splicing apparatus and were unproductive alternative transcripts or whether they could produce protein products with potential physiological roles. There is presently no reported indication for the existence of additional FAH isoforms. The DEL231 open reading frame is identical to FAH, except for the missing region encoded by the skipped exons 8 and 9 and corresponding to amino acids 203 to 280 . To verify if the nonsense del100 transcript was subjected to NMD, lymphoblastoid cells were treated with cycloheximide Figure an inhibDel100 and del231 were originally identified while studying the impact of NMD on hereditary tyrosinemia type I. During the characterization of the effects of the W262X mutation on FAH mRNA metabolism , we detefah gene. However, it remained to see whether they were unproductive splice isoforms or whether they could code for protein isoforms. The del231 transcript retains an unchanged open reading frame when compared to FAH. The putative DEL231 protein would be similar to FAH except for the lower molecular weight (about 35-kDa), due to the missing region encoded by exons 8 and 9. We have been unable to detect a protein species of the size that could correspond to DEL231 using an antibody against full-length FAH. Whether this reflects the absence of such a protein or its presence in a very low amount undetectable with the presently available antibodies remains unknown. The latter explanation seems plausible since the del231 transcript, although not subjected to NMD, is much less abundant that the full-length FAH transcript or del100, as it is barely detected in W262X cells with the RT76 and RT025 primers . RNA from human normal liver was extracted using the RNAqueous kit (Ambion). 1 μg RNA was reverse transcribed using an oligo(dT) and Stratascript (Stratagene). FAH cDNA was amplified from exons 6 to 14 using the following primers: RT76 (5'-CGT GCC TCC TCT GTC GTG-3') and RT025 (5'-GGG AAT TCT GTC ACT GAA TGG CGG AC-3'). Sense primers were designed to specifically amplify del100 and del231. RT84 (5'-TGG AGC TGG AAA TGC ACG-3') spans the exon 7 to exon 9 junction, whereas RT85 (5'-TGG AGC TGG AAA TGG ACC-3') spans the exon 7 to exon 10 junction. Amplification of the alternative transcripts with RT84 or RT85 was performed using HotStart (Qiagen) and PCR conditions were optimized in order to minimize nonspecific hybridization of the primers. Moreover, for each amplification (the FAH transcripts and RAR), the kinetic of the reactions were performed and the number of cycles used for each PCR was in the exponential phase.Total RNA was extracted from 5·10Analysis of the cycloheximide treatment was done as previously described .An antiserum against the C-terminal part of the DEL100 protein was raised in mouse. The antigen is the C-terminal part (the last 67 amino acids) of the DEL100 protein and is different from FAH or the DEL231 protein. FAH cDNA was amplified from exon 9 to exon 14 using the primers hFAHsstermdel100 (5'-CGG GAT CCC TGC AGC ACG AGA CAT TCA GAA GTG G-3') and RT025 with Expand High Fidelity. The PCR product was inserted into pET30a (Novagen) at the BamHI and EcoRI sites, in order to express the reading frame of the C-terminal part of the DEL100 protein. The His-Tag fusion protein used for immunization was purified by affinity chromatography on a Ni-NTA column (Qiagen) in denaturing conditions with 6 M urea.Escherichia coli as previously described [The anti-hFAH monoclonal antibody was raised against the N-terminus of the protein. The 161 residue peptide was obtained by cutting the pET30a-FAH vector with theescribed and puriescribed .Cells were harvested and lysed in 1 × SDS sample buffer . Human tissues obtained at autopsy and stored at -70°C until used were hom2HPO4, pH 8.2.In some experiments, the mouse antiserum against the DEL100 protein was adsorbed on the recombinant His-tag C-terminal protein blotted on nitrocellulose. After an overnight incubation at 4°C, the non-adsorbed fraction was removed and conserved for further characterization. The adsorbed antibody fraction (affinity purified) was eluted using 1 ml of glycine-HCl 0.1 M, pH 2.8 and the pH immediately neutralized by adding 100 μl of 1 M Kin vitro transcription-translation using the TNT coupled reticulocyte lysate system (Promega) according to the manufacturer's recommendations. 25 μl of the reaction were used for immunoprecipitation using the anti-Myc antibody as follows: the anti-Myc (1/100) was incubated 1 hour with protein A-sepharose beads (Sigma). The antibody was next immobilized on the beads using 20 mM dimethyl pimedilate (Sigma) in 0.2 M borate sodium (pH 9.0) for 30 min at room temperature. The reaction was stopped by washing the beads twice in 0.2 M ethanolamine and incubation in this solution for 2 hours at room temperature. The antigen (25 μl of the in vitro translated DEL100-Myc protein) was incubated with the beads for two hours at 4°C in a dilution buffer containing 10 mM Tris-HCl pH 8.0, 1 mM EDTA and 10% glycerol. The immunoprecipitated protein was eluted by adding 25 μl of SDS loading buffer . Samples were electrophoresed on SDS-15% polyacrylamide gels and proteins transferred to a nitrocellulose membrane. The anti-Myc was used at a dilution of 1/2,000 and the anti-DEL100 antiserum at a dilution of 1/1,000.The del100 cDNA was obtained by RT-PCR on total RNA extracted from W262X/W262X cells using ND1 (5' CCC AAG CTT CAG CAT GTC CTT CAT CCC GGT GG 3') and ND2 (5' TGC TCT AGA TTT ATT TGT CAC TGA ATG GCG G 3'). The amplification products were cloned into pDrive (Qiagen) and different clones were sequenced. One clone containing the del100 cDNA was used for further cloning. It was amplified using 5'del100-Eco (5' GGA ATT CCA GCA TGT CCT TCA TCC 3') and ND2. The amplified fragment was digested with EcoRI and XbaI and ligated into EcoRI-XbaI-digested pcDNA3-myc RANGAP, replacing the insert coding for RANGAP. pcDNA3-mycRANGAP was kindly provided by Dr M. J. Matunis The construct was used for coupled CHX, cycloheximide; ESE, exonic splicing enhancer; FAH, fumarylacetoacetate hydrolase; HTI, hereditary tyrosinemia type I; Ig, immunoglobulin; NMD, nonsense-mediated mRNA decay; PCR, polymerase chain reaction; PTB, polypyrimidine tract binding protein; PTC, premature termination codon; RAR, retinoic acid receptor; RT, reverse transcription; RUST, regulated unproductive splicing and translation; TcR, T-cell receptor.ND carried out the experiments and wrote the manuscript. AM participated in the design of the study. JFBL participated in the cloning of Del100 into pcDNA3. AB raised the mAb directed against the N-terminal part of the FAH protein. RMT participated in the design, coordination of the study, and in the writing of the manuscript.

We therefore performed whole-cell patch clamp recordings from neurons in the caudal third of the pretectal nuclear complex in frontal brain slices obtained from 3 to 6 week old hooded rats and tried to classify pretectal neurons electrophysiologically.Neurons in the mammalian pretectum are involved in the control of various visual and oculomotor tasks. Because functionally independent pretectal cell populations show a wide variation of response types to visual stimulation in vitro. These cells had more positive resting potentials and higher input resistances than cells that were not spontaneously active. The maintained firing of spontaneously active pretectal cells was characterized by only small variances in interspike intervals and thus showed a regular temporal patterning. The firing rate was directly correlated to the membrane potential. Removing excitatory inputs by blockade of AMPA and/or NMDA receptors did not change the spontaneous activity. Simultaneous blockade of excitatory and inhibitory synaptic input by a substitution of extracellular calcium with cobalt neither changed the firing rate nor its temporal patterning. Each action potential was preceeded by a depolarizing inward current which was insensitive to calcium removal but which disappeared in the presence of tetrodotoxin.Pretectal neurons showed various response types to intracellular depolarizations, including bursting and regular firing behavior. One population of pretectal nuclear complex neurons could be particularly distinguished from others because they displayed spontaneous activity Our results indicate that a specific subpopulation of pretectal neurons is capable of generating maintained activity in the absence of any external synaptic input. This maintained activity depends on a sodium conductance and is independent from calcium currents. Neurons in the mammalian pretectal nuclear complex (PNC) are involved in the control of various oculomotor reflexes, like the pupillary light reflex and the optokinetic reflex (OKR). Pupil constriction is controlled by neurons in the olivary pretectal nucleus that project bilaterally to the Edinger-Westphal nucleus -7. Slow in vivo. Thus, neurons involved in the pupillary light reflex respond tonically to the overall retinal luminance . Becausin vitro. Furthermore, because the timing of postsynaptic spikes with respect to their presynaptic input might be of considerable functional importance for saccade-related neurons such cells should exhibit lower input resistance than neurons for which spike time precision is less important. Low input resistances allow faster depolarization of the postsynaptic membrane and, hence, less temporal variance or "jitter" between presynaptic and postsynaptic spikes will occur. However, spontaneously active PNC cells on average showed higher input resistances in our sample and we therefore do not think that they represent saccade-related PNC neurons.Neurons found in NOT and PPN include various functional cell populations. One of them has been associated with the generation of slow phase eye movements during OKR while others seem to transfer visual information linked to the execution of saccadic eye movements. Cells from these latter populations are all characterized by short duration, high frequency burst responses to fast image motions or rapid eye movements ,34-36,57in vivo when appropriately stimulated by low speed horizontal movements of whole field visual stimuli. In all mammals studied, neurons in the right PNC are excited by rightward stimulus motion and control eye movements to the right, while neurons in the left PNC are activated by leftward stimulus motion and control eye movements to the left [in vitro, it will be necessary to identify the postsynaptic targets of the spontaneously active PNC neurons.On the other hand, cells that control compensatory eye movements during OKN are characterized by tonic firing the left ,27-33. Tthe left . Howeverthe left ,59. Becain vitro. The spontaneous firing depends on a sodium conductance and is independent from afferent synaptic input. Although the postsynaptic target and, consequently, the functional role of the spontaneously active PNC cells remain to be determined it is reasonable to assume that these cells also show spontaneous activity in vivo. Therefore, one likely candidate to represent spontaneously active cells in vivo are PNC neurons that are involved in the generation of slow compensatory eye movements during optokinetic nystagmus. If this is true, spontaneous firing might help to maintain an activity balance between neurons in the right and in the left PNC and thus stabilize eye position in the absence of retinal image motion.We have been able to demonstrate a specific population of neurons in the PNC that is capable of generating spontaneous activity Guidelines for the Use of Animals in Neuroscience Research of the Society for Neuroscience. Animals were deeply anesthetized with halothane and a subcutaneous injection of ketamine (100 mg/kg body weight) and thiazine hydrochloride (1 mg/kg), and transcardially perfused with ice-cold artificial cerebro-spinal fluid (ACSF) containing (in mM), NaCl 123, KCl 2.5, NaH2PO4 1, NaHCO3 26, MgSO4 1.3, CaCl2 1.8, glucose 11, that was continuously gassed with 5% CO2 / 95% O2. After the brain had been removed from the skull, 350 μ m-thick coronal slices were cut on a vibratome in ice cold ACSF. Three to four single slices that included the caudal PNC were obtained from each experimental animal. Slices were kept in ACSF at 36°C for at least one hour to allow recovery from the slicing procedure. For recording, they were transferred to a submerged type recording chamber where they were superfused at 3 ml/min with ACSF at 34°C during patch clamp experiments.Acute brain slices were obtained from 3 to 6 week-old Long-Evans hooded rats of either sex that had been raised at the institute's own colony. All experimental procedures were in strict compliance with governmental regulations and in accordance with the 2 4, Na2ATP 4, Na3GTP 0.4, EGTA 0.5, to which 0.5% biocytin was added for morphological single cell reconstruction. Measured membrane potentials were corrected for the junction potential of -10 mV.Whole-cell recordings from neurons in the caudo-lateral PNC were performed under visual guidance using infrared differential interference videomicroscopy . For recPostsynaptic responses were evoked with a concentric bipolar stimulation electrode placed in the optic tract (OT) at the lateral PNC border. Electrical stimuli delivered were 0.5 to 2 mA in amplitude and had a duration of 100 to 500 μs. The neuronal signals were amplified and filtered using an EPC9 amplifier , digitized at 20 kHz, and displayed, stored, and analyzed using PULSE/PULSEFIT software . Unless otherwise stated, postsynaptic current responses evoked by OT stimuli were averaged over three consecutive stimulus applications. All drug effects are given as mean values ± standard deviation, they were statistically tested for significance using the Student's t-test.All drugs used were obtained from Sigma-Aldrich and were bath applied. A10-minute application time proved sufficient to achieve stable responses. Application of 20 μM 6-Cyano-7-nitroquinoxaline-2,3-dione (CNQX) was used to block AMPA receptors. Either 50 μM APV or 2 mM kynurenic acid were used to block NMDA receptors. Na currents were suppressed by application of 1 μM tetrodotoxin (TTX).At the end of each recording session, slices were immersion fixed in 4% parafomaldehyde in 0.1 M phosphate buffer, pH 7.4, at 4°C. After at least 24 h in fixative, slices were processed using standard histochemical techniques for visualization of biocytin with 3,3-diaminobenzidine . Morphological reconstruction of stained cells was done with the aid of a camera lucida.NP participated in the design of the study and executed all aspects including data collection, analysis and drafting the manuscript. MS initially designed the study, assisted with data collection and analysis, and edited the manuscript. Both authors read and approved the final manuscript.

The interferon (IFN)-induced, dsRNA-dependent serine/threonine protein kinase, PKR, plays a key regulatory role in the IFN-mediated anti-viral response by blocking translation in the infected cell by phosphorylating the alpha subunit of elongation factor 2 (eIF2). The human immunodeficiency virus type 1 (HIV-1) evades the anti-viral IFN response through the binding of one of its major transcriptional regulatory proteins, Tat, to PKR. HIV-1 Tat acts as a substrate homologue for the enzyme, competing with eIF2α, and inhibiting the translational block. It has been shown that during the interaction with PKR, Tat becomes phosphorylated at three residues: serine 62, threonine 64 and serine 68. We have investigated the effect of this phosphorylation on the function of Tat in viral transcription. HIV-1 Tat activates transcription elongation by first binding to TAR RNA, a stem-loop structure found at the 5' end of all viral transcripts. Our results showed faster, greater and stronger binding of Tat to TAR RNA after phosphorylation by PKR.In vitro phosphorylation experiments with a series of bacterial expression constructs carrying the wild-type tat gene or mutants of the gene with alanine substitutions at one, two, or all three of the serine/threonine PKR phosphorylation sites, showed that these were subject to different levels of phosphorylation by PKR and displayed distinct kinetic behaviour. These results also suggested a cooperative role for the phosphorylation of S68 in conjunction with S62 and T64. We examined the effect of phosphorylation on Tat-mediated transactivation of the HIV-1 LTR in vivo with a series of analogous mammalian expression constructs. Co-transfection experiments showed a gradual reduction in transactivation as the number of mutated phosphorylation sites increased, and a 4-fold decrease in LTR transactivation with the Tat triple mutant that could not be phosphorylated by PKR. Furthermore, the transfection data also suggested that the presence of S68 is necessary for optimal Tat-mediated transactivation.We have investigated the effect of phosphorylation on Tat-mediated transactivation. Our results showed faster, greater and stronger binding of Tat to TAR RNA after phosphorylation by PKR. These results support the hypothesis that phosphorylation of Tat may be important for its function in HIV-1 LTR transactivation. Furthermore, the presence of increasing levels of IFN in the serum of AIDS patients while viral replication continues and the disease progresses [Since its isolation in 1983 , human iin vitro , it has ogresses -7 indicaIn response to viral infection, IFN induces a number of genes including the dsRNA-dependent protein kinase R (PKR). PKR exerts its anti-viral activity by phosphorylating the alpha subunit of translation initiation factor 2 (eIF2α), which results in the shut-down of protein synthesis in the cell . The impHIV-1 Tat is a 14 kDa viral protein involved in the regulation of HIV-1 transcriptional elongation -26 and iWhile a number of reports have shown that PKR and Tat protein interact, and furthermore, that Tat is phosphorylated by PKR, none have yet addressed the issue of the functional consequences for the phosphorylation of the Tat protein. Here we examine the phosphorylation of Tat by PKR and its effect on TAR RNA binding and HIV-1 transcription, and show that the phosphorylation of Tat results in Tat protein binding more strongly to TAR RNA. Removal of the residues reported to be phosphorylated by PKR resulted in decreased Tat phosphorylation and a significant loss of Tat-mediated transcriptional activity.We first confirmed the capability of our PKR preparation immunoprecipitated from HeLa cells to phosphorylate synthetic Tat protein (aa 1–86) Figure , and we in vitro using PKR previously immunoprecipitated from HeLa cells. An electrophoretic mobility shift assay (EMSA) was performed to observe any difference in the binding of Tat-N and Tat-P to TAR RNA and normal Tat (Tat-N) to bind to HIV-1 TAR RNA. Synthetic Tat protein (aa 1–86) was phosphorylated A Figure . It can As Tat-P appeared to bind more readily to TAR, we next investigated the differences in the binding efficiency of Tat-N and Tat-P with TAR RNA. EMSA were performed in the presence of increasing concentrations of NaCl (from 25–1000 mM). The progressive dissociation of the Tat-N-TAR RNA complex with increasing concentrations of salt in the buffer was observed , and the time required to reach half-maximal phosphorylation (K0.5) Figure .max) for S62, T64 and T68 of 98.6%, 87.5% and 81.6% respectively compared to the wild type (Pmax = 82.8%) and K0.5 values of 10.9 min, 5.2 min and 0.8 min (wild-type = 5.5 min). This observation was also applicable to the Tat S62A.T64A mutant, which exhibited 87% phosphorylation . However, the percentage of phosphorylation at 15 minutes for the other double mutants and for the triple mutant decreased to 68% for Tat T64A.S68A, 48% for Tat S62A.S68A, and 56% for Tat S62A.T64A.S68A. These values also correlated well with the higher Pmax values and K0.5 values for each mutant, indicating slower, less efficient and non-specific phosphorylation.Phosphorylation of the single mutants was rapid and specific with maximal phosphorylation values .The absence of S62 in combination with S68 also had a marked effect on transactivation, reducing it 2.5-fold. On the other hand, the absence of S62 in combination with T64 reduced transactivation 1.8-fold. This suggests that the absence of S62 and T64 either singly or in combination is not as important for Tat-mediated transactivation as when these residues are absent in combination with S68, and may indicate a more important role for S68 in Tat transactivation. These data correlate with observations previously obtained in PKR phosphorylation experiments with these Tat mutants.HIV-1 inhibits the antiviral effects of IFN by the direct binding of its Tat protein to PKR . In the The binding of Tat and TAR RNA is a necessary step for Tat to mediate viral transcription elongation -35. In eHowever, the precise mechanism by which phosphorylated Tat accomplishes this remains to be elucidated. It may be that the phosphorylation of Tat changes its secondary structure. This may result in an increased net positive charge by either exposing basic amino acids or masking negative amino acids, and this increases the attraction to negatively charged RNA, as in the case of cAMP response element binding protein (CREB) phosphorylation by protein kinase A and glycogen synthase kinase-3 . On the in vivo with a series of mammalian expression constructs carrying the wild-type tat gene or mutants of the gene with alanine substitutions at one, two, or all three of the serine/threonine PKR phosphorylation sites. Firstly, we investigated the in vitro phosphorylation of Tat by PKR using Tat proteins expressed and purified from analogous bacterial expression constructs. These were subject to different levels of phosphorylation by PKR and displayed distinct kinetic behaviour. Nonlinear regression analysis of the proteins indicated that PKR could not phosphorylate S62 or T64 alone in the absence of S68. These results suggest a cooperative role for the phosphorylation of S68 in conjunction with S62 and T64, although the mechanism involved and the reason for cooperation require further investigation. Overall, a gradual reduction in phosphorylation was observed as the number of mutated phosphorylation sites increased, and any phosphorylation observed with the triple mutant was shown to be non-specific, thus confirming previous published results identifying S62, T64 and S68 as the only PKR phosphorylation sites [We examined the effect of phosphorylation on Tat-mediated transactivation of the HIV-1 LTR on sites . Howeverin vitro phosphorylation data and support the hypothesis that phosphorylation of Tat may be important for its function in HIV-1 LTR transactivation.Co-transfection experiments with the mammalian expression constructs showed a 4-fold decrease in LTR transactivation with the Tat triple mutant which could not be phosphorylated by PKR. A gradual reduction in transactivation was observed as the number of mutated phosphorylation sites increased – a 2-fold reduction with the removal of one site, and 2.5-fold with the removal of two sites. Furthermore, the transfection data also suggested that the presence of S68 is necessary for optimal Tat-mediated transactivation, since its absence in conjunction with one or both of the other residues yielded the lowest levels of transcription. These results were in agreement with the It is relevant to note that even in the absence of all three PKR phosphorylation sites the level of transcription was still 3-fold above baseline. This may imply that Tat can still transactivate in the absence of PKR phosphorylation, although at much reduced efficiency, and/or that the protein may be phosphorylated by other kinases at other sites, for example, PKC which phosphorylates Tat at S46 . AlternaThe mechanism by which the absence or presence of phosphorylation affects transactivation still requires further investigation. It could be that the introduction of an increasing number of mutations in the region 62–68 which lies next to the nuclear localization signal (aa 49–58) leads to conformational changes that prevent the protein from entering the nucleus. However, HIV-1 subtype C viruses which are rapidly expanding, carry mutations in Tat R57S and G63Q within and close to the basic domain, and yet exhibit increased transcriptional activity . On the Overall, these results suggest that the phosphorylation of Tat by PKR plays a key role in the ability of Tat to transactivate the HIV-1 LTR, allowing the virus to use the natural antiviral responses mediated by interferon to further its own replication. This may, in part, explain the observation of increasing IFN levels in patients with advanced AIDS. The gradual reduction in transactivation observed with the decreasing absence of phosphorylation residues suggest that the presence of all PKR phosphorylation sites within the protein may be required for the optimal function of Tat in transactivation, and that the absence of S68, especially when in combination with T64, has a greater negative impact on transactivation.in vitro transcription of TAR RNA after digestion with HinD III. A β-actin luciferase reporter gene plasmid was used as a transfection control to normalize transfection efficiency and was provided by Assoc. Prof. Nick Saunders, CICR, University of Queensland, Brisbane. The pHIV-LTR-CAT construct used in transfection experiments, the destination vector, pET-DEST42 , and the pET-DEST42-Tat86 construct were a gift from Dr. David Harrich, QIMR, Brisbane. The mammalian expression vector, pcDNA3.2-DEST was purchased from Invitrogen and was used as the destination vector for the construction of the Tat86 wild-type and mutant constructs.The plasmid, pTZ18-TAR80 was a kind gift from Dr. E. Blair, and was used for Synthetic HIV-1 Tat(1–86) protein was a gift from Dr. E. Blair. The protein is a chemically synthesized, full-length HIV-1(Bru) Tat (amino acids 1–86). Histidine-tagged HIV-1 Tat86 was expressed in BL21(DE3)pLysS cells and purified in the laboratory of Dr. David Harrich, QIMR, Brisbane. Histidine-tagged HIV-1 Tat86 phosphorylation mutants were prepared as described elsewhere in this method.PKR was prepared as described elsewhere in this method.tat gene at the three PKR phosphorylation sites: serine 62, threonine 64 and serine 68, by site-directed mutagenesis using complementary synthetic oligonucleotide primers encoding the mutation of the residue, or residues, to alanine. The reaction for site-directed mutagenesis contained 32 μL distilled water, 5 μL Pfu I 10X reaction buffer , 100 ng pET-DEST42-Tat86, 5 μL 5' oligonucleotide primer at a concentration of 25 ng/μL, 1 μL 10 mM dNTP mix, and 3 Units Pfu I DNA polymerase . The reaction was subjected to PCR with the following cycling conditions: 95°C for 30 seconds, 18 cycles at 95°C for 30 seconds/55°C for 1 minute/68°C for 15 minutes, hold at 4°C. Electrocompetent JM109 cells were prepared in the laboratory and transformed with 2 μL of PCR reaction. Minipreps were prepared from selected ampicillin-resistant colonies and sequenced to confirm the mutation in the construct.Bacterial expression constructs were prepared using the prokaryotic expression vector, pET-DEST42-Tat86. Mutations were introduced in the tat genes from pET-DEST42-Tat86 wild type and mutants to the mammalian expression vector, pcDNA3.2-DEST, according to the protocol supplied by the manufacturer.Mammalian expression constructs were prepared using Gateway Cloning Technology to transfer the mutated 600 was 0.6. The culture was inoculated with IPTG to a final concentration of 200 μg/mL and incubation was continued for a further 2 hours. Cells were pelleted; the pellet was resuspended in 2 volumes of 6 M guanidine-HCl, pH 8.0 and incubated at room temperature overnight. The suspension was centrifuged at 14500 × g for 20 minutes, and the supernatant was centrifuged at 100 000 × g for 30 minutes. The supernatant was loaded onto a 1 mL equilibrated, packed resin . To equilibrate, the resin was washed twice with 10 mL of Milli-Q water and charged by incubating with 5 mL of 0.3 M CoCl2 at room temperature for 5 minutes. The resin was then washed extensively with water, and equilibrated in 6 M guanidine-HCl, pH 8.0. The HIS-tagged protein was allowed to bind to the resin by incubation on a rocking platform, at room temperature, for 1 hour. The resin was then sedimented at 700 × g for 2 minutes, and washed with 6 M guanidine-HCl, pH 8.0 for 5 minutes. The resin was sedimented as above and washed with 6 M guanidine-HCl, pH 6.0 for 5 minutes. The resin was loaded onto an empty column , and the wash allowed to flow through. The HIS-tagged protein was eluted with 4 mL of 6 M guanidine-HCl, pH 4.0, and collected in 500 μL fractions. Fractions were dialysed in 0.1 mM DTT in PBS, at room temperature, overnight, and then centrifuged at 14500 × g for 2 minutes. To identify fractions containing the HIS-tagged protein, 5–20 μL aliquots were analysed by 15% SDS-PAGE and stained with Coomassie blue. Fractions containing protein were assayed for protein concentration , and by Western blot against a 1:1000 dilution of monoclonal anti-poly HISTIDINE Clone HIS-1 antibody . Aliquots of fractions were stored at -80°C in 10 mM DTT in PBS.Competent BL21(DE3)pLysS cells were transformed with 1 μL of pET-DEST42-His-Tat86 wild-type or mutants, and plated. A single ampicillin resistant colony was resuspended in 10 mL of LB broth/amp and incubated overnight at 37°C. This culture was added to 500 mL of LB broth/amp and incubated in an orbital shaker, at 37°C until the OD2 flasks were lysed in 1 mL of Buffer 1 , and centrifuged at 13500 × g for 30 minutes at 4°C. The supernatant was incubated in ice, for 30 minutes, with 2 μL of a 1:10 dilution of specific monoclonal antibody 71/10 , and then at 4°C overnight with 65 μL of protein G-sepharose , with continuous rotation. Protein G-sepharose-PKR was sedimented, washed three times with Buffer 1, and three times with DBGA . PKR was activated by incubating 120 μL of this suspension with 80 μL of DBGB (DBGA + 2.5 mM MnCl2), synthetic dsRNA to a final concentration of 0.5 μg/mL, and 20 μL of 2 mg/mL ATP , at 30°C for 15 minutes.PKR was purified from HeLa cell extracts as described previously . Briefly32P-ATP . For measuring the extent of phosphorylation of the mutant Tat proteins, phosphorylation was stopped after 2, 5, 10, 15, 30, 45, and 60 minutes by the addition of protein loading buffer. Samples were analysed by 15% SDS-PAGE, and proteins were visualized by autoradiography, and scanning densitometry in a STORM 860 phosphorimager with ImageQuant® software .Phosphorylation reactions for Tat proteins contained 2 μg of HIV-1 Tat, unless otherwise indicated in the figure legend, 6 μL of activated PKR suspension, and DBGA to a final volume of 12 μL. Phosphorylation was performed at 30°C for 1 hour, unless otherwise stated, in the presence of 2 μCi of γ-in vitro transcription system according to the protocol supplied with the kit. HIV-1 Tat was phosphorylated (Tat-P) with activated PKR for 1 hour, as described above, or in the absence of γ-32P-ATP (Tat-N). Tat-P and Tat-N were allowed to equilibrate at 30°C for 10 minutes in Binding Buffer , before incubating at 30°C for 10 minutes with 2.5 × 105 cpm of 32P-TAR RNA. The Tat-TAR RNA complexes were separated on a 5% acrylamide/0.25X TBE gel , for 3–4 hours, at 10 mA, and visualized by autoradiography.TAR RNA was synthesized from 0.8 μg of pTZ18TAR80 using a commercial 5 cells/mL. Each well was seeded with 2 mL of this cell suspension, and incubated at 37°C/5% CO2 for 24 hours or until the cell monolayer was 80–90% confluent. A solution of 625 μL of serum-free medium and 10 μg of total DNA was mixed with 600 μL of serum-free medium containing 25 μL of Lipofectamine 2000 , and incubated at room temperature for 20 minutes. The cells were washed twice with serum-free medium, inoculated with the DNA-Lipofectamine mixture, and incubated at 37°C for 6 hours. The DNA solution was replaced with complete medium and the cells wee incubated as above for 24 hours. The cells were harvested and assayed for CAT activity using the CAT ELISA kit according to the protocol supplied with the kit, for luciferase activity using the Luciferase Assay System according to the supplied protocol, and for protein concentration .Transfections were performed in duplicate in 6-well plates. HeLa cells were diluted in Modified Eagle's Medium supplemented with 10% foetal bovine serum , antibiotics and glutamine , to yield 5 × 10The author(s) declare that they have no competing interests.LEM was responsible for the experiments described and contributed to the drafting of the manuscript. TW performed the optimization experiments for the phosphorylation of Tat by PKR. DH participated in the design of the study, provided reagents and critically read the manuscript. NAJM conceived and coordinated the study, and contributed to the drafting of the manuscript.

Are evolutionary changes in gene expression determined mostly by natural selection or by random forces? It's been some 150 years since Charles Darwin proposed that organisms adapt to their environment through the process of natural selection, yet the debate still rages, particularly at the molecular level. Darwinian selection was challenged in 1983 by the Kimura neutral theory of molecular evolution, which argues that the majority of differences in DNA (nucleotide) and protein (amino acid) sequences within and between species have only minor or no selective effect and that these differences arise through mostly random processes. Mutations at the nucleotide level occur randomly and regularly. Some of them survive through generations, resulting in “fixed” evolutionary changes between species. Two potential mechanisms can lead to the fixation of a particular change: natural selection, which favors changes that convey a selective advantage, and stochastic (random) events, such as genetic drift .DNA mutations can lead to changes in gene expression levels, some of which may convey a selective advantage to an organism and therefore become fixed via natural selection. But since variation is produced at the genotype level, while selection is thought to operate largely at the phenotype level , it is reasonable to expect selection to be less apparent at the level of DNA sequence, and by extension, at the level of gene expression. Microarray technology has made it possible to systematically study expression levels of thousands of transcripts (the RNA copies of DNA that are translated into amino acid sequences) and to ask whether most changes of gene expression fixed during evolution between species result from selective or stochastic processes.To investigate this question, Philipp Khaitovich and colleagues analyzed the observed transcriptome differences among primate and mouse species as well as among various brain regions within a species. The team started out by analyzing the expression levels of some 12,000 genes in the prefrontal cortex of various primates, including humans. If evolutionary changes are caused by chance and not by natural selection, they will accumulate as a function of time rather than as a function of physical or behavioral changes in the organism. And that's what the authors found: the changes in gene expression among the species progressed linearly with time, suggesting that gene expression in primate brains evolved in large part from random processes introducing selectively neutral, or biologically insignificant, changes.According to neutral evolution theory, the same forces determine the rate of evolution both within and between species because similar random processes are at work on both levels. Consequently, genes that vary more within species should be more likely to vary between species. Comparing the expression levels of genes according to their variation within humans, the authors showed that genes with high variation among humans changed significantly faster between species than genes with low variation among humans. The authors also compared changes observed in genes to changes observed in pseudogenes and found no significant difference between the two, suggesting again that most expression changes have no functional significance.While their analysis cannot exclude a role for natural selection, all the results are consistent with a neutral model of transcriptome evolution. This means that the majority of gene expression differences within and between species are not functional adaptations but selectively neutral and that we won't be able to explain species differences based on variation in gene expression in general.In addition to examining differences in gene expression in a particular tissue between species, the authors also discuss the evolution of different tissues within a species. The human brain is composed of regions that differ in function and histology (microscopic structure). Each of these regions acquired a functional or histological difference that separated it from its sister regions at some point in our evolutionary past. The authors show that the amount of change between regions correlates with tissue-divergence times estimated by other methods. If this finding applies for other tissues within and outside the brain, it could provide a method to reconstruct the evolution of tissues within a species.

Increasingly researchers are turning to the use of haplotype analysis as a tool in population studies, the investigation of linkage disequilibrium, and candidate gene analysis. When the phase of the data is unknown, computational methods, in particular those employing the Expectation-Maximisation (EM) algorithm, are frequently used for estimating the phase and frequency of the underlying haplotypes. These methods have proved very successful, predicting the phase-known frequencies from data for which the phase is unknown with a high degree of accuracy. Recently there has been much speculation as to the effect of unknown, or missing allelic data – a common phenomenon even with modern automated DNA analysis techniques – on the performance of EM-based methods. To this end an EM-based program, modified to accommodate missing data, has been developed, incorporating non-parametric bootstrapping for the calculation of accurate confidence intervals.Here we present the results of the analyses of various data sets in which randomly selected known alleles have been relabelled as missing. Remarkably, we find that the absence of up to 30% of the data in both biallelic and multiallelic data sets with moderate to strong levels of linkage disequilibrium can be tolerated. Additionally, the frequencies of haplotypes which predominate in the complete data analysis remain essentially the same after the addition of the random noise caused by missing data.These findings have important implications for the area of data gathering. It may be concluded that small levels of drop out in the data do not affect the overall accuracy of haplotype analysis perceptibly, and that, given recent findings on the effect of inaccurate data, ambiguous data points are best treated as unknown. Haplotype analysis has become a valuable tool for researchers in population genetics. In particular, the value attached to the prediction of the constituent haplotypes of a given sample and their frequency of occurrence is such that a variety of methods have been developed for this purpose. Many of these methods, however, depend on knowledge of the phase of the data supplied. In general, genotypic data from polymorphic loci are ascertained phase-unknown. Various methods for determining the gametic phase exist. With sufficient data from the genotyping of family members, definitive haplotypes may be inferred. However, in particular for late-onset disorders, these data may be difficult or even impossible to obtain. At the laboratory level, techniques such as chromosomal isolation or long-range PCR may be uReliable computational techniques for the estimation of haplotype frequencies have been around for some time, and extensive studies of the accuracy of the EM-based methods have been carried out ,8, but uTwo sources of data were used for the principal part of this study. The first is real single nucleotide polymorphism (SNP) data; the second is multiallelic data generated via population generation software. Three additional sets of data containing 10%, 20% and 30% missing alleles respectively were generated from each of the two original sets. The process of generation is described in the Methods section. HFE was carried out on the eight data sets listed above. In each case 1,000 bootstrap iterations were performed for each HFE analysis and the 95% CIs about the point results were selected. For the sake of clarity the results from analyses of the 20% unknown alleles data sets have been omitted from the displayed graphs. Further tests were performed to investigate the effect of sample size upon the quality of the results. To this end two sets of progressively smaller data sets, with and without missing alleles, were generated from the SNP and multiallelic data sets, and HFE was carried out. The method of selecting these data is outlined in the Methods section.An additional data set, unrelated to those previously described, consisting of data from five SNP loci was generated for the purposes of performing tests on data with weak LD between the loci. A further data set with 10% missing alleles was generated from these additional data.D [Figure D ,11 givenhi and are the haplotype frequencies derived from the phase-known and phase-unknown data respectively, and N is the number of possible haplotypes in the sample. As these data are from seven biallelic loci, N = 27 = 128 in this case. The results are displayed in Table D as the percentage of unknown alleles in the sample increases. In each case it is the percentage increase relative to the complete data value that is measured. Three haplotypes absent from the phase-known data set appear in the results of the HFE analysis of the complete data. Their frequencies are 2.3 × 10-3, 1.4 × 10-3, and 1.1 × 10-3. Of the haplotypes present in the phase-known data, only one haplotype appears with a frequency less than these, the given frequency being 9.3 × 10-4. Figure D is recorded. The subsequent percentage increases going from 10% to 20% and 20% to 30% unknown alleles are 22% and 16%, respectively, of the value of D for the complete data. Figure where D , was measured. As the allele counts at each of the seven loci are 8, 2, 2, 9, 2, 5, and 2 respectively, the sum in Equation 1 is over the N = 5760 possible haplotypes in the sample. The results are displayed in Table D as the percentage of unknown alleles in the sample increases is also recorded.Similar computations to those carried out for the SNP data sets were carried out for the four multiallelic data sets. Figure -6 as a result of the HFE analysis. 29 of these do not appear in the phase-known data, with the most common of these having a frequency of 2.187 × 10-3. 68 haplotypes in the phase-known data display a frequency greater than this. As with the SNP case, Figure D with the 10% and 20% missing data cases to those of Table D going from 20% to 30% unknown alleles comes to 40% of the value of D for the complete data. In Figure 129 distinct haplotypes were estimated to have a frequency of greater than 10Similarly to the SNP case, Figures D results for each were displayed in Table D were those derived from the respective smaller samples . As may be expected, in all cases we see an increase in D as we move from the complete data to the data sets with missing alleles. D also is seen to increase as the sample size decreases. However, what is of note is the pattern involved. For the seven loci SNP case, the percentage increase in D from complete to missing data itself increases monotonically as the sample size is reduced. A similar pattern is not observed in the multiallelic data.Investigations were made into the effect of the sample size on the performance of the HFE method when 10% of the data was missing. Three further data sets of sizes 300, 100 and 50 individuals were generated by random selection from the original seven loci SNP and multiallelic sets. From these data, six additional sets with 10% missing alleles were created. HFE was performed upon these additional data, and the D' [D readings for this particular case. Here we see a large percentage increase of 60% in D as we move from the complete data to 10% missing data.Fallin and Schork illustraD' was founThe results displayed here show the impact of the addition of increasing quantities of missing alleles on the quality of haplotype frequency estimates. Studying Figure D and the RCI, used here to quantify the degradation in the quality of the results with increasing percentages of unknown alleles. Tables D is an absolute measure of the performance of the algorithm, as the phase-known data are available for each data set and thus the exact sample haplotype frequencies are known. This discrepancy is to be expected; D is a sum over all possible haplotypes and there exist only 128 (27) possible haplotypes for the seven loci SNP data, whereas the multiallelic data, as noted in the Results section, have 5760 possible haplotypes. Also, it is not surprising that haplotype frequencies estimated from the multiallelic data set are found to be less accurate than those estimated from SNPs, given the more complex nature of the data. The RCI is a relative measure, and illustrates not so much the accuracy of the algorithm, rather the effect of additional missing data. The results displayed in Tables D . Interestingly, the results for the multiallelic data set were achieved despite departure from Hardy-Weinberg equilibrium (HWE) at two of the seven loci (see Methods section). Although this technique relies on the assumption of HWE, Niu et al. [Although study of the illustrated graphs suggests that the impact of missing data is more pronounced with the more complex multiallelic data sets, Tables u et al. have demnly 128 2 possibleD observed when 10% of the seven loci SNP data is relabelled as missing does not change substantially as the size of the sample reduces. For the full sample of 536 individuals, the percentage jump in D moving from the complete data to 10% missing data is approximately 35%. For the sample of size 300, this increase is 37%. Likewise for the samples of size 100 and 50, the increases are 41% and 47% respectively. However, for the multiallelic data, we see a contrasting trend. The percentage jump in D decreases rather than increases with increasing missing data proportions. Inspection of Tables D when moving from the complete data to 10% missing data for the full sample of 500 individuals is approximately 42%, whereas for the sample of size 300 this drops to 32%. The recorded increase for the sample of size 100, 5%, is even more striking. , and any conclusions drawn from analysis of this case would be highly suspect). Thus no definitive conclusions may be made as to the effect of missing data as the sample size is reduced, other that to say that the matching between the phase-known and phase-unknown frequencies deteriorates with falling sample size, as would be expected.The investigation into the effect of smaller sample sizes has produced some surprising results. Comparing Table D for the complete data is comparable to that of the seven loci SNP data with 30% missing alleles. It should also be borne in mind that, as the weak LD data set features only five SNP loci, the sum for D is over a mere 32 possible haplotypes, as compared to 128 for the seven loci SNP data, emphasising the fall-off in accuracy. Also of note is the similarity in the sample sizes -500 in the weak LD case, and 536 in the moderate to strong LD case. Moving to the 10% missing allele case, we witness a further 60% drop in accuracy, a considerably greater percentage that was observed for the medium to high LD data sets, a result which again calls into question the reliability of the method in the presence of weak LD.Table Here we show that the EM method, with the modifications to the implementation for complete data detailed here, can generate accurate estimates of haplotype frequencies even when large amounts of data are missing, in this case up to 30%. Moreover, using this method, the degree of accuracy can easily be estimated using conventional bootstrapping approaches. This is of considerable importance in the design of experiments, as it is therefore obvious that small levels of drop out in the data for whatever reason do not affect the overall accuracy of the approach perceptibly. Furthermore, considering the strongly deleterious effects of even small amounts of inaccurate data , this anD' was found to be ≥ 0.9 for all intervals but the third and fifth, where D' ≤ 0.25. As HWE is assumed for HFE, each locus was tested and found to be in HWE.The data used in this part of the study are derived from a genetic investigation of cystic fibrosis sufferers . The hapin silico. The number of distinct alleles at each locus ranged from two to nine. A trait marker was introduced between the 3rd and 4th loci for 10 of the 50 founders. The population was evolved for thirty generations as an isolated group with random mating. The birth rate per couple was binomially distributed, with a range of zero to ten offspring and a mean of 2.5. 500 individuals bearing the trait were randomly selected from the final generation for analysis. As with the SNP data, the level of LD across the interval was measured. D' was found to lie between 0.5 and 0.8 for all adjacent loci except between the second and third loci where D' = 1.0 and the fifth and sixth where D' = 0.24. A test for HWE [An initial population of fifty individuals with data from seven loci spaced 1 cM apart was generated for HWE was perfThe data sets of reduced size used in this analysis were generated from the original seven loci SNP and multiallelic data sets via a random sampling process. The process was identical for both. Initially 300 individuals were chosen from the original data. Following this, 100 individuals were chosen from the newly created set of size 300. Finally 50 individuals were chosen from the set of size 100. In each case the selection process was random and done without replacement. From each of these six smaller data sets, six additional sets of data with 10% missing alleles were generated by the process outlined below.in silico specifically for the testing of the performance of the HFE algorithm in low LD circumstances. D' was found to range between 0.117 and 0.014 for all adjacent loci. The data were also tested for HWE. The first locus was found to be marginally not in HWE (P = 0.0465), with excess homozygosity in evidence. All other loci were found to be in HWE.A population of 500 individuals with data from five SNP loci was generated The HFE algorithm assumes that the input data are phase-unknown, and thus no alteration was necessary to the sample data sets which were phase-known before input. Comparison tests on the phase-known data, and phase-unknown data generated from the phase-known data via a process of phase-randomisation have confirmed that no bias is introduced by the use of phase-known data (results not shown).Data sets containing unknown alleles were generated from the original data via the following procedure:1. Each individual is selected in turn.2. For each locus a random number between 0 and 100 is generated.3. If this random number falls below the desired percentage of unknowns, both of the individual's alleles at the locus in question are redefined as unknown. This ensures that all unknowns appear in homologous pairs.4. The process is repeated until all loci for all individuals are exhausted.Thus the desired percentage of unknown alleles is achieved globally, and the percentage of missing data at each locus may vary. Three additional sets of data were generated from each of the two original sets in this way, with 10%, 20% and 30% missing data respectively, giving eight data sets in all for the principal component of the study.For known gametic phase, HFE is a straightforward process of counting the constituent haplotypes in the sample. For the case where the gametic phase is unknown, maximum-likelihood haplotype frequencies are computed using the EM algorithm. The particular implementation used here for the finding of the haplotype frequencies is similar to that outlined by Excoffier and Slatkin . The opecj possible genotypes consistent with this phenotype whereMissing data in a sample necessitate alterations to the implementation for complete data of the EM-based algorithm. When all alleles in an individual are known, there exist sj is the number of heterozygous loci in phenotype j. However, when unknown alleles appear at a locus, the situation is considerably more complex. In this case each unknown allele may take on the identity of any of the alleles observed at that locus. We require that unknown alleles always appear in pairs – the amplification of one allele only would result in the appearance of a homozygote which may bias results. Thus if there are Ni distinct alleles (forms) observed at locus i in the entire sample, the number of possible complete phenotypes consistent with the observed phenotype is increased by a factor of Ni(Ni + 1)/2 by the presence of an unknown site. This factor is the number of ways of selecting two alleles from a pool of Ni distinct alleles when repetition is allowed. Thus the number of possible complete phenotypes given by phenotype j is given byand M is the number of loci in the sample andwhere Ni is the number of distinct alleles observed in the sample at locus i. For each possible complete phenotype i of the κj complete phenotypes possible for individual j, there exist ci possible genotypes, as given by Equation 2. Thus the number possible complete genotypes for phenotype j is given bywhere Pj of the jth phenotype, assuming random mating, is given by:Then, following , the proPi(hkhl)is the probability of the ith genotype made up of haplotypes k and l, andwhere pk and pl are the population frequencies of the kth and lth haplotypes.where tth step of the EM iterative process, the probability of resolving each phenotype into the different possible genotypes is given by:At the nj is the number of individuals with phenotype j, and n is the total number of individuals in the sample. Thus nj/n is the proportion of the total sample that has phenotype j, and Pj(hkhl)/Pj is the conditional probability of the particular genotype given the phenotype.where The haplotype frequencies are then computed using a form of gene-counting ,17 :N is the number of globally distinct haplotypes (the number of different possible haplotypes in the sample), is the frequency of haplotype v, m is the number of distinct phenotypes in the sample, and εiv is equal to the number of times haplotype v appears in genotype i.where The technique of bootstrapping was usedEDK carried out the main programming work, performed the tests and drafted the manuscript. FS designed the population generation tool and assisted in the programming effort. RM assisted in the drafting of the manuscript and provided the SNP data. All authors read and approved the final manuscript.

Prostate-specific membrane antigen (PSMA) is a well characterized prostate-specific tumor associated antigen. Its expression is elevated in prostate carcinoma, particularly in metastatic and recurrent lesions. These observations suggest that PSMA can be used as immune target to induce tumor cell-specific recognition by the host and, consequently tumor rejection. We utilized a DNA-based vaccine to specifically enhance PSMA expression. An immune modulator, such as CpG oligodeoxynucleotides which promote Th1-type immune responses was combined to increase the efficacy of tumor recognition and elimination.PSMA encoding full-length PSMA was constructed. C57BL/6 mice were immunized with endotoxin-free pCDNA3.1-PSMA alone or in combination with CpG oligodeoxynucleotides by intramuscular injection. After 4 immunizations, PSMA specific antibodies and cytotoxic T lymphocyte reactivity were measured. Immunized C57BL/6 mice were also challenged subcutaneously with B16 cells transfected with PSMA to evaluate suppression of tumor growth.A eukaryotic expression plasmid pCDNA3.1-Vaccine-specific cytotoxic T lymphocytes reactive with B16 cells expressing PSMA could be induced with this treatment schedule. Immune protection was observed in vaccinated mice as indicated by increased tumor growth in the control group (100%) compared with the groups vaccinated with DNA alone (66.7%) or DNA plus CpG oligodeoxynucleotides (50%) respectively. Average tumor volume was smaller in vaccinated groups and tumor-free survival time was prolonged by the vaccination.The current findings suggest that specific anti-tumor immune response can be induced by DNA vaccines expressing PSMA. In addition, the suppression of in vivo growth of tumor cells expressing PSMA was augmented by CpG oligodeoxynucleotides. This strategy may provide a new venue for the treatment of carcinoma of prostate after failure of standard therapy. Carcinoma of prostate is the most common cancer in males in America, ranking as the second most common leading cause of cancer-related deaths, just after carcinoma of the lung. In addition, the incidence and mortality of carcinoma of prostate are increasing in China. Although surgery and radiation therapy remain the primary choice for localized stage of carcinoma of prostate, there is no effective treatment for patients who develop recurrences or those who have metastatic disease at the time of diagnosis. Therefore, there is an urgent need for new types of treatment.Strategies that stimulate the ability of the immune system to recognize and destroy cancer cells via selective killing mechanisms have shown promise in the treatment of cancer. DNA vaccines offer several potential advantages for the immunotherapy of cancer. Proteins encoded by DNA vaccines are expressed in the cytoplasm and presented through the endogenous processing pathway associated with MHC Class I molecules, thereafter leading to the activation of CD8 + cytotoxic T lymphocytes (CTL) ,2, whichProstate specific membrane antigen (PSMA), a well-established prostate specific tumor associated antigen (TAA), is 100 kD type II transmembrane glucoprotein. It is predominantly expressed in the prostate gland, minimal levels of expression in brain tissue, jejunum and proximal kidney tubules ,5. Its emilieu [A number of strategies are under evaluation to enhance the potency of DNA vaccines, some of which involves broad stimulation of the immune system using immunomodulatory agents. Synthetic CpG oligodeoxynucleotides have immunological effects similar to those seen with bacterial DNA and represent promising vaccine adjuvants, which promote T helper1 (Th1)-type immune responses . Unmethymilieu , which fmilieu -17. ThesC57BL/6 mice (H-2b) were bred and kept under pathogen-free conditions. Male mice were used at 12 to 16 weeks of age. All animal experiments were performed in an approved protocol and in accordance with recommendations for the proper care and use of laboratory animals.The murine melanoma B16 cell was purchased from the Type Culture Collection of the Chinese Academy of Sciences and cultured in RPMI-1640 medium supplemented with 10% (v/v) heat-inactivated fetal bovine serum , penicillin G (100 U/ml), and streptomycin (100 μg/ml).The COS-7 cell line was cultured in DMEM medium (Life Technologies) supplemented with 10% (v/v) heat-inactivated fetal bovine serum, sodium pyruvate (1 mM), penicillin (100 U/ml) and streptomycin (100 μg/ml).The monoclonal antibody 4A12 specific for an extra-cellular epitope of PSMA was previously described . The β-aGACGTTCCTGACGTT (CpG motifs were shown underlined) with the backbone phosphorothioate stabilized. CpG oligodeoxynucleotides were synthesized by Sangon , reconstituted in sterile pyrogen-free water and diluted in phosphate buffered saline for in vivo injections.CpG oligodeoxynucleotides 1826 chosen according to published data -21 had tPSMA encoding full-length PSMA was constructed by cloning the BamH I /Xho I fragment of pBluescipt-PSMA as described previously [The eukaryotic expression plasmid pCDNA3.1-eviously into thePSMA or an empty (mock) vector by the mediation of liposome Tfx-20™ according to the manufacturer's instructions. Briefly, COS-7 cells were cultured in six-well tissue culture plates with a coverslip in each well and grown to 50–70% confluence. 1.5 μg plasmid DNA was mixed with 4.5 μl Tfx-20™ and diluted in 1000 μl serum-free DMEM medium before addition to cells. After 20 minutes of incubation, DNA-liposome complex was added to the cells and incubated for 6 hours at 5% CO2, 37°C. Complete DMEM medium containing 10% fetal bovine serum was added to the cells and incubated overnight, and then the medium was replaced with complete DMEM medium. After 2 days, the cells were fixed in cold acetone for 10 minutes at 4°C followed by extensive washing with phosphate buffered saline. The cells were incubated with anti-PSMA monoclonal antibody 4A12 for 1 hour at 37°C, subsequently incubated with FITC-labeled goat anti-mouse IgG (1:40) for 1 hour at 37°C. After thorough washing, the coverslips were mounted and observed with a fluorescence microscope.COS-7 cells were transfected with pCDNA3.1-PSMA or empty vector by the mediation of 6 μl liposome Tfx-20™ as above. After 2 days of culture, the cells were reseeded into a 10 cm-dish and cultured for other 2 days, complete RPMI-1640 medium containing 1000 μg/ml G418 (Life Technologies) was added to the culture. After 20 days of selection, all non-transfected cells died and discrete clones were visible in transfected cells. These clones were expanded in the presence of 400 μg/ml G418, positive cells expressing PSMA were identified as follows.The B16 murine melanoma cells were transfected with 2 μg of pCDNA3.1-2 (25 mM), 1 unit of Taq. The PCR reaction conditions included 5 minutes of initial denaturation at 94°C followed by 30 cycles of 30 seconds at 94°C, 1 minute at 62°C, 1 minute at 72°C and 10 minutes of final extension at 72°C. The 358 bp fragment was resolved on 2% agarose gel. GAPDH was also detected as internal reference.Total RNA was extracted from mock-transfected or transfected B16 cells using Trizol (Life Technologies) and dissolved in RNase free water. 2 μg of total RNA was transcribed into cDNA using AMV reverse transcriptase (Promega). Briefly, the total RNA was mixed with 1 μl oligo (dT) primers (0.1 μg/ μl), 4 μl RT Buffer (5×), 2 μl dNTPs (10 mM), 1 μl AMV reverse transcriptase and diethypyrocarbonate-treated water to a final volume of 20 μl. The cDNA synthesis was performed using the following PCR parameters: 37°C for 1 hour then 10 minutes at 95°C. Synthesized cDNA was used as template for PCR. The sequence of the primers used were 5'- CGAGGAGGG ATGGTG TT-3' (forward) and 5'-TGTTGTGGCTGCTTGAG-3' (reverse). PCR was carried out in a 10 μl aliquot containing 0.5 μl cDNA, 0.5 μl each primer (10 μM), 1 μl dNTPs (2 mM), 1 μl Taq buffer (10×), 0.8 μl MgClThe transfected and mock-transfected B16 cells were harvested and lysed with lysis buffer , 5 mM EDTA, 0.5% NP-40, 1 mM phenylmethylsulfonyl fluoride, 1 μg/mL aprotinin, 1 μg/mL leupeptin) for 30 min at 4°C, cell debris were removed by centrifugation. Cell lysates were heated at 100°C for 3 minutes, the samples were loaded on 6% SDS-PAGE for electrophoresis. After electrophoresis, the proteins were transferred to polyvinylidene difluoride membranes using semi-humid transferring system . The polyvinylidene difluoride membranes were blocked with Tris-buffered solution containing 5% (w/v) non-fat milk for 1 hour at room temperature. For detection of protein, the polyvinylidene difluoride membranes were probed with anti-PSMA monoclonal antibody 4A12 and monoclonal antibody to β-actin (1:50) respectively for 1 hour at room temperature then overnight at 4°C, after then the membranes were incubated with horse anti-mouse IgG-HRP conjugate for 1 hour at 37°C, ABC complex for 1 hour at 37°C subsequently. The bands were visualized with 3,3'-diaminobenzidine substrate solution .PSMA and pCDNA3.1 were purified with EndoFree plasmid Maxi Kit . Three groups including 6 mice each were immunized: DNA vaccination group, CpG oligodeoxynucleotides and DNA vaccine co-administration group (hereafter referred to as CpG+DNA vaccination) and control group receiving empty plasmid. All mice were injected with 0.25% lidocaine in the quadriceps femoris muscle 3 days before vaccination in order to improve the uptaking of plasmids by muscles. The mice then received bilateral intramuscular injection with 50 μg of plasmid in the regenerating muscles. Mice in the DNA vaccination group were immunized with endotoxin-free pCDNA3.1-PSMA, mice in CpG+DNA vaccination group were further immunized with 25 μg of CpG oligodeoxynucleotides in the same location 3 days after DNA plasmid immunization, as control, mice were injected with pCDNA3.1 plasmid. All mice were boosted every 4 weeks for 3 times.Plasmids pCDNA3.1-Two weeks after the last immunization, the mice were bled and serum antibodies were measured by solid phase enzyme-linked immunosorbent assay (ELISA). Briefly, bacterially expressed fusion protein containing PSMA-derived fragment was coated on 96-well plates. The plates were blocked with 5% bovine serum albumin in phosphate buffered saline overnight at 4°C. The sera from C57BL/6 mice were serially diluted in phosphate buffered saline with 5% bovine serum albumin and then 100 μl of diluted serum was added into each well. The plates were incubated at 37°C for 1 hour, 100 μl of a 1:3000 dilution of goat anti-mouse IgG-HRP conjugate was added into each well and incubated for 1 hour at 37°C, then 100 μl tetramethyl benzidine (TMB) chromagen/substrate solution was added to each well. The plates were read and the absorbance at 450 nm (A450) was measured by microplate reader.7 lymphocytes (responders) were incubated in 6-well plates with 2 × 106 stimulator cells in the presence of 50 IU/ml recombinant murine IL-2 and 2 μg/ml ConA. After 6 days of culture, the re-stimulated cells were harvested and separated from the dead cells. Target cells (B16-PSMA) and re-stimulated lymphocytes (effector cells) were resuspended in phenol red-free RPMI-1640 medium supplemented with 5% new born calf serum, 5 × 103 target cells and various number of effector cells were added into individual flat-bottom wells in 96-well plates. The cells were incubated at 37°C overnight. 50 μl per well of supernatant was transferred to fresh 96-well plates. CTL reactivity was assessed by measuring lactate dehydrogenase (LDH) release using a Cytotox 96 assay kit (Promega). Controls were setup on each plate for spontaneous LDH release by target and effector cells. A parallel experiment using B16 cells transfected with pCDNA3.1 as target cells was also performed to test the specificity of lysis. All experiments were performed in triplicate. Percent lysis was calculated according to manufacturer's instructions.Two weeks after the last immunization, mice were sacrificed. Their spleens were removed and teased apart in serum-free RPMI-1640 media, the lymphocytes were collected and cultured in RPMI-1640 medium supplemented with 10% heat-inactivated fetal bovine serum, 50 IU/ml recombinant murine IL-2 and 2 μg/ml ConA for 2 days. B16 stimulator cells expressing PSMA (B16-PSMA) were prepared in complete RPMI-1640 medium containing 50 μg/ml mitomycin C for 1 hour at 37°C. Two × 105 cells were subcutaneously injected into the left lateral flank of mice. The time to the development of tumor was recorded. After tumors became detectable, their volume was measured two-dimensionally with a caliper along the longest axis (x) and the axis perpendicular to the longest axis (y) every second days. The volume of tumors was estimated by the following formula:C57BL/6 mice were divided into 3 groups and immunized as above. B16-PSMA cells were trypsinized and resuspended in phosphate buffered saline, 2 × 102Volume = π/6 × x × yAfter 26 days, when tumor reached 20 mm in their largest axis, the mice bearing tumors were sacrificed. Tumors were removed and weighed.P < 0.05 were considered significant.The data from ELISA and CTL assays are expressed as means ± SD and are representative of at least three different experiments. Comparisons between individual data points were made using ANOVA or student's t-test. In the tumor challenge experiment, the primary endpoint was time of tumor appearance. Tumor-free survival time was compared by the Kaplan-Meier method and log-rank statistic. -PSMA was introduced into COS7 cells. The cells were the incubated with anti-PSMA monoclonal antibody and goat anti-mouse IgG-FITC conjugate. The immunofluorescence assay demonstrated that the reactivity was present in the cytoplasm of COS7 cells transfected with pCDNA3.1-PSMA but not in mock-transfected cells, thus indicating that pCDNA3.1-PSMA could express protein in mammalian cells . However, titers were similar between the DNA vaccine and the CpG+DNA vaccination groups (P > 0.05), suggesting that CpG oligodeoxynucleotides did not augment the antigen-specific humoral immunity . More importantly, CTL reactivity was significantly enhanced in mice treated with CpG oligodeoxynucleotides compared with DNA vaccine alone at E:T ratios of 40:1, 20:1 Figure .PSMA or empty vector, and then challenged with B16-PSMA cells. Protection was observed in pCDNA3.1-PSMA vaccinated mice with decrease of tumor incidence. After 26 days, all mice in the control group developed tumors while 2 (2/6) and 3 tumor-free mice (3/6) were observed in the DNA and in the CpG + DNA vaccination groups respectively. Kaplan-Meier curves showed that the tumor-free survival interval was 19.67 ± 2.24 days in the DNA vaccination group, 22.33 ± 1.61 days in the CpG +DNA vaccination group and 13.17 ± 1.01 in the control group , so was the difference between CpG+DNA vaccination group and control group (P = 0.0016). Tumor-free survival time was longer in CpG+DNA vaccination group than DNA vaccination group, but the difference was of no statistical significance (P = 0.49). This observation may be associated with the small number in each group.C57BL/6 mice (n= 6/group) were vaccinated with pCDNA3.1-oup Fig. . The difPSMA vaccination, the individual tumors were consistently smaller than those in the control group and the analysis of tumor growth kinetics indicated that the tumor growth was significantly slower in the CpG +DNA vaccination group compared to the other two groups . Moreover, the difference between DNA vaccination group and CpG +DNA vaccination group was statistically significant .The volume of the tumors in the control group was consistently larger than in other two groups Fig. and the Although treatments are available for organ-confined carcinoma of prostate, there is no effective approach to treat recurrent disease after androgen deprivation therapy fails. New approaches are required to treat this incurable disease. DNA vaccination enables maintenance of tumor antigen expression at the vaccination site and results in immune responses in the host, therefore, shedding light on the treatment of cancer. It has been reported that tumor growth is suppressed when tumor cells are implanted in mice previously immunized with DNA vaccines encoding tumor antigens -25.PSMA is a well-defined prostate-restricted tumor associated antigen whose expression is significantly elevated in carcinoma of prostate, especially in advanced stages. The expression of PSMA is down-regulated by androgen, after androgen deprivation therapy, its expression is strongly elevated,26-28, TThe purpose of our work was to delineate new ways to induce immune responses by DNA vaccination. In this study, all mice immunized with DNA vaccine expressing PSMA generated PSMA specific antibodies at a low level, which may result from the small amount of antigen expressed by plasmid in vivo. What is noteworthy is that all immunized mice developed CTL reactivity to B16-PSMA which led to suppression of tumor growth. In addition, although some tumors developed in some treated mice, they were consistently smaller in the control group. These findings suggest that DNA vaccines expressing PSMA could elicit immune response against tumor cells expressing the target molecule.Although DNA vaccines provide a convenient and effective approach to elicit cellular immunity, clinical outcomes have not been satisfactory, mainly because tumor-specific CTL elicited by the vaccines are insufficient to suppress cancer progression. CD8+ CTLs constitute one of the most important arms of the immune system, exhibiting the capacity of recognizing and destroying cancerous cells,33. A vaSynthetic CpG oligodeoxynucleotides represent a promising adjuvant. The predominant effect of CpG oligodeoxynucleotides exposure is the promotion of Th1-type immune responses. Professional antigen presenting uptake CpG oligodeoxynucleotides and become activated with increased expression of MHC and co-stimulatory molecules -38 that CpG oligodeoxynucleotides 1826 is a potent enhancer of Th1-type immune responses and may benefit anti-cancer therapy -43. We, Consistent with previous reports, this study suggests that CpG oligodeoxynucleotides enhance cellular immunity. The activity of CTL against PSMA expressing cells in the CpG +DNA vaccination group was significantly higher than in the DNA vaccination group. Furthermore, tumor challenge experiments demonstrated a potentiation of the suppressive effects on the growth of tumor cells expressing PSMA. These findings indicate that CpG oligodeoxynucleotides should be a powerful adjuvant in the context of DNA-based vaccination.In this study, we designed a DNA vaccine expressing prostate specific membrane antigen (PSMA) and utilized CpG oligodeoxynucleotides to promote Th1-type immune response. We discovered that the constructed vaccine generated anti-tumor reactivity against malignant cells expressing PSMA that was enhanced by CpG oligodeoxynucleotides co-administration. This strategy may provide a new venue for the treatment of carcinoma of prostate, particularly for recurrent disease after hormone therapy fails.None declared.R.J.Q participated in the design of the study and carried out plasmid DNA transfection, RT-PCR, immunofluorescence assay, DNA vaccination, lymphocyte stimulations, cytotoxicity assays, and completed the preparation of the manuscript. Z.L participated in the design of the study and carried out the construction of the expression plasmid, western blotting, and histological analysis and assisted in the preparation of the manuscript. C.Q carried out cell culture, L.H carried out RNA extraction, Z.L carried out ELISA. Z.H.G conceived of the study, participated in its design and coordination, and helped draft the manuscript. All authors read and approved the final manuscript.

ABCCB and KCNJ11" on page 45, and the Supporting Information Tables S1 and S2.One of the variants associated with increased diabetes risk was incorrectly indicated throughout this article. The A1369S variant in the gene ABCCB should have been written S1369A. The alanine variant is associated with increased risk. This mistake affects Tables 2 and 4, the text of the article in the section entitled "The full text XML and HTML versions of the article, and the supporting Tables S1 and S2 have been corrected online.

An important goal of DNA microarray research is to develop tools to diagnose cancer more accurately based on the genetic profile of a tumor. There are several existing techniques in the literature for performing this type of diagnosis. Unfortunately, most of these techniques assume that different subtypes of cancer are already known to exist. Their utility is limited when such subtypes have not been previously identified. Although methods for identifying such subtypes exist, these methods do not work well for all datasets. It would be desirable to develop a procedure to find such subtypes that is applicable in a wide variety of circumstances. Even if no information is known about possible subtypes of a certain form of cancer, clinical information about the patients, such as their survival time, is often available. In this study, we develop some procedures that utilize both the gene expression data and the clinical data to identify subtypes of cancer and use this knowledge to diagnose future patients. These procedures were successfully applied to several publicly available datasets. We present diagnostic procedures that accurately predict the survival of future patients based on the gene expression profile and survival times of previous patients. This has the potential to be a powerful tool for diagnosing and treating cancer. Procedures that utilize both gene expression data and clinical data to identify subtypes of cancer can provide more accurate prognoses When a patient is diagnosed with cancer, various clinical parameters are used to assess the patient's risk profile. However, patients with a similar prognosis frequently respond very differently to the same treatment. This may occur because two apparently similar tumors are actually completely different diseases at the molecular level .The main example discussed in this paper concerns diffuse large B-cell lymphoma (DLBCL). This is the most common type of lymphoma in adults, and it can be treated by chemotherapy in only approximately 40% of patients . SeveralIf different subtypes of cancer are known to exist, there are a variety of existing techniques that can be used to identify which subtype is present in a given patient . HoweverThere are two main approaches in the literature to identify such subtypes. One approach uses unsupervised learning techniques, such as hierarchical clustering, to identify patient subgroups. This type of procedure is called “unsupervised” since it does not use any of the clinical information about the patient. The subgroups are identified using only the gene expression data. For an overview of unsupervised learning techniques, see Hierarchical clustering has succThe second approach to identifying subtypes of cancer is based exclusively on the clinical data. For example, patients can be assigned to a “low-risk” or a “high-risk” subgroup based on whether they were still alive or whether their tumor had metastasized after a certain amount of time. This approach has also been used successfully to develop procedures to diagnose patients .However, by dividing the patients into subgroups based on their survival times, the resulting subgroups may not be biologically meaningful. Suppose, for example, that there are two tumor cell types. Suppose further that patients with cell type 2 live slightly longer than patients with cell type 1 but that there is considerable overlap between the two groups . Assume To overcome these difficulties, we propose a novel procedure that combines both the gene expression data and the clinical data to identify cancer subtypes. The crux of the idea is to use the clinical data to identify a list of genes that correlate with the clinical variable of interest and then apply unsupervised clustering techniques to this subset of the genes.For instance, in many studies, the survival times of the patients are known even though no tumor subtypes have been identified . We can Once such a list of significant genes is compiled, there are several methods we can use to identify clinical subgroups. We can apply clustering techniques to identify subgroups of patients with similar expression profiles. Once such subgroups are identified, we can apply existing supervised learning techniques to classify future patients into the appropriate subgroup. In this study, we will use the “nearest shrunken centroids” procedure of Sometimes, however, a continuous predictor of survival is desired. We also describe a supervised version of principal components analysis that can be used to calculate a continuous risk score for a given patient and identify subtypes of cancer. The resulting predictor performs very well when applied to several published datasets.These two methods will produce satisfactory results in most datasets. However, we will describe some variations of these methods that can sometimes improve their performance. When we cluster a dataset using only a subset of the genes, it is important that we choose the correct subset of genes. Choosing the genes with the largest Cox scores is generally a good strategy, but this procedure sometimes selects some spurious genes. We will show that one can use partial least squares (PLS) to compute a “corrected” Cox score. Selecting the genes with the largest “corrected” Cox scores can produce better clusters than selecting genes with largest raw Cox scores. Additionally, we will describe two other continuous predictors of survival that we will call β˜ and γ^. For some problems, they are better predictors than the continuous predictor based on supervised principal components . These mThere are also related methods for predicting the survival of cancer patients using gene expression data. Moreover, in many applications, we would like to identify which genes are the best predictors of survival. These genes could be analyzed in the laboratory to attempt to discover how they influence survival. They could also be used to develop a diagnostic test based on immunostaining or reverse transcriptase PCR. For these applications, it is important to have a predictor of survival that is based on a small subset of the genes. This is another important advantage of our methods over existing methods.p genes for each patient. (Note that 𝓃 ≫ p.) We assume that there are several different types (classes) of cancer, each of which responds differently to treatment, and each of which is distinct at the molecular level. Therefore, given a set of 𝓃 patients with different classes of cancer, we wish to train a classifier that can diagnose which type of cancer a future patient has, given the expression levels of the patient's p genes. We will show that it is possible to identify such subgroups using the semi-supervised learning techniques described in the previous paragraph, and that identification of such subgroups can enable us to predict the clinical outcome of cancer more accurately.Our goal is to identify subtypes of cancer that are both clinically relevant and biologically meaningful. Suppose that we have 𝓃 patients, and we measure the expression level of As noted in the Introduction, we needed to assign each patient to a subgroup before we could apply nearest shrunken centroids. First, we applied an unsupervised 2-means clustering procedure to the DLBCL data of p-value of 0.416. Thus, conventional clustering techniques failed to identify subgroups that differed with respect to their survival times. Subgroups identified using hierarchical clustering also did not differ with respect to survival (data not shown).We compared the survival times of the two subgroups using a log-rank test. The log-rank test statistic was 0.7, with a corresponding p-value of the log-rank test was 0.03.We assigned each patient in the training data to either a “low-risk” or “high-risk” subgroup based on their survival time . A plot of the two resulting survival curves is shown in Recall that when we performed 2-means clustering on the patients in the test data using all 7,399 genes and used a log-rank test to compare the survival times of the patients in the two resulting clusters, the result was not significant. To test our new clustering method, we calculated the Cox scores of all 7,399 genes based on the 160 training observations and ranked the genes from largest to smallest based on their absolute Cox scores. We then clustered the 80 test observations using only the 25 top-scoring genes. This time, the log-rank statistic comparing the survival times of the two clusters was highly significant . This predictor is stronger than the discrete predictor shown in R2 = 0.08, likelihood ratio test statistic = 6.7, 1 d.f., p = 0.00966).Thus far, all of our examples have been based on the DLBCL data of Unfortunately, the expression levels of only 70 genes were available for the 292 patient dataset, making it difficult to test our methodology. However, we were able to apply our supervised principal components method. The expression levels of approximately 25,000 genes were available for the earlier study (consisting of 78 patients). After applying crossvalidation, we selected a model consisting of eight genes, five of which were included among the 70 genes in the larger dataset. Thus, we fit a supervised principal components model using these five genes and applied it to the dataset of 292 patients.R2 statistic for each model. R2 measures the percentage of the variation in survival time that is explained by the model. Thus, when comparing models, one would prefer the model with the larger R2 statistic.) We see that our supervised principal components method produced a stronger predictor of metastasis than the procedure described in The results are shown in R2 calculated using all 292 patients are inflated, since part of the dataset used to validate the model was also used to train the model. We include these results merely to demonstrate the greater predictive power of our methodology. Moreover, we repeated these calculations using only the 234 patients that were not included in the earlier study to ensure that our results were still valid.).We applied the methods discussed above to identify these subgroups for the simulated dataset. This simulation was repeated ten times. The results are shown in R2 was zero for each iteration. If we had chosen a smaller value of the tuning parameter Δ, the procedure would have performed better, although not significantly better.) The continuous predictor based on supervised principal components performed nearly as well as the methods based on semi-supervised clustering.In the first simulation, we found that the fully supervised and the fully unsupervised methods produced much worse results than the semi-supervised methods. , so a diagnosis based on this procedure is likely to be inaccurate.Supervised clustering methods can overcome these problems. We have seen that if we selected significant genes prior to clustering the data, we could identify clusters that were clinically relevant. We have also seen how knowledge of these clusters could be used to diagnose future patients.This supervised clustering methodology is a useful prognostic tool. It is also easy to interpret. However, it has certain shortcomings as well. Recall our conceptual model shown in X as a predictor of patient survival. The chosen subset contained the genes with the largest Cox scores. This method could also be used to detect cancer subtypes, since the principal components will presumably capture the variation that exists between subtypes. It is also capable of identifying variation within these subtypes, which, as discussed above, cannot be identified using supervised clustering. We showed that this procedure could produce a stronger predictor of survival than the discrete predictor based on supervised clustering.One possible such predictor is our supervised principal components procedure. This procedure used the principal components of a subset of the expression matrix p = 0.05) for all four datasets, which was not true for any of the other methods. Finally, if we consider only discrete predictors of survival, our semi-supervised clustering methods performed better than the other models on at least three of the four datasets.We compared our methods to several previously published methods for predicting survival based on microarray data. In general, our methods performed significantly better than these existing methods. In particular, our supervised principal components method gave the best results on three of the four datasets. Furthermore, each of our proposed methods was a significant predictor of survival for a given patient is essential to treat cancer successfully. If the risk of metastasis is high, the cancer must be treated aggressively; if the risk is low, milder forms of treatment can be used. Using DNA microarrays, researchers have successfully identified subtypes of cancer that can be used to assess a patient's risk profile. Our results show that semi-supervised learning methods can identify these subtypes of cancer and predict patient survival better than existing methods. Thus, we believe they can be a powerful tool for diagnosing and treating cancer and other genetic diseases.The nearest shrunken centroids procedure calculates the mean expression of each gene within each class. Then it shrinks these centroids toward the overall mean for that gene by a fixed quantity, Δ. Diagonal linear discriminant analysis (LDA) is then applied to the genes that survive the thresholding. Details are given in We created two classes by cutting the survival times at the median survival time (2.8 y). Any patient who lived longer than 2.8 y was considered to be a “low-risk” patient, and any patient that lived less than 2.8 y was considered to be a “high-risk” patient. In this manner, we assigned a class label to each observation in the training data.Unfortunately, many of the patients' survival times were censored, meaning that the individual left the study before the study was completed. When this occurs, we do not know how long the patient survived; we only know how long the patient remained in the study prior to being lost to follow-up.If an observation is censored, we may not know to which class it belongs. For example, suppose that the median survival time is 2.8 y, but that a patient left the study after 1.7 y. If the patient died in the interval between 1.7 y and 2.8 y, then the patient should be assigned to the “high-risk” group. Otherwise, the patient should be assigned to the “low-risk” group. However, there is no way to determine which possibility is correct.T denote the survival time of this patient. Then, using the Kaplan-Meier curve, we can estimate p(T>50) and p(T>20). Then we can estimate p(T>50|T>20) as follows:Based on the Kaplan-Meier survival curve for all the patients, we can estimate the probability that a censored case survives a specified length of time . For exaand, of course,In this manner, we can estimate the probability that each censored observation belongs to the “low-risk” and “high-risk” classes, respectively.However, it is still unclear how we would train our classifier based on this information. Nearest shrunken centroids is a modified version of LDA. It is described in detail in xi}yi}g represent the number of discrete classes to which the yis may belong. When we perform LDA when all of the yis are known, the problem is to fit the mixture modelLet {i is a Gaussian density function, and the θis correspond to the mean of the observations in each class. The πis correspond to “prior” probabilities that an observation belongs to class 𝒾.) In this case, we must fit this model on the basis of the classified (uncensored) training data, which we denote by t, and the unclassified (censored) feature vectors x𝒿 , which we denote by t𝓊. ′ denotes the vector of all unknown parameters.) as missing data. It turns out to be very simple in the case of LDA. The E-step is effected here simply by replacing each unobserved indicator variable 𝓏ij by its expectation conditional on xj. That is, 𝓏ij is replaced by the estimate of the posterior probability that the 𝒿th entity with feature vector xj belongs to Gi . We takei and μi in the M-step are equally simple:The estimates of πandwherei is the posterior probability that the 𝒿th entity with feature vector xj belongs to Gi, or, in other words,In these expressions, τWe continue these imputations until the algorithm converges. In practice, one imputation seems to be sufficient for most problems, since each imputation is computationally intensive, and additional imputations did not seem to change the results significantly.We calculated the Cox scores of each gene based on the 160 training observations, and obtained a list of the most significant genes. Then we performed 2-means clustering on these 160 observations using the genes with the largest absolute Cox scores and obtained two subgroups. We repeated this procedure multiple times with different numbers of genes. For each such clustering, we trained a nearest shrunken centroid classifier to assign future patients to one subgroup or the other and examined the crossvalidation error rate.G of possible values of Γ. (2) Let pmin = 1 and emin = 1. (3) For each Γ in G, do the following: (4) Perform k-means clustering using only those genes with absolute Cox scores greater than Γ. (5) Perform a log-rank test to test the hypothesis that the k clusters have different survival rates. Call the p-value of this test p. (6) If p≥pmin, then return to step 3. (7) Fit a nearest shrunken centroids model based on the clusters obtained in step 3. Calculate the minimum crossvalidation error rate across all values of the shrinkage parameter, and call it e. (8) If e<emin, then let Γbest = Γ, and return to step 3. Otherwise return to step 3 without changing the value of Γbest. The optimal value of Γ is taken to be the value of Γbest when this procedure terminates.The problem of choosing the number of genes on which to perform the clustering is more complicated than it appears. The obvious way to choose the optimal number of genes on which to cluster is to simply minimize the crossvalidation error rate of the nearest shrunken centroids model based on the clustering. This works up to a certain point. It is possible that the clustering procedure will identify a cluster that is unrelated to survival. Thus, we needed to build a safeguard against this possibility into our procedure. After performing clustering based on a given set of high-scoring genes, we performed a log-rank test to determine if the resulting clusters differed with respect to survival. If they did not, the clustering was discarded without further analysis. An outline of the procedure follows: (1) Choose a set Several comments about this procedure are in order. First, note that we did not recalculate the Cox scores at each fold of the crossvalidation procedure. We calculated them only once, using all of the patients in the dataset. There are several reasons for doing this. Recalculating the Cox scores at each fold would be extremely expensive computationally. Moreover, we found that the Cox score of a given gene varied depending on the number of patients (and which patients) we included in the model. Thus, if a given value of Γ produced a low crossvalidation error rate, there was no guarantee that a model based on the full dataset using this value of Γ would produce good results, since the model based on the full dataset may use a different list of genes. Other studies have found that using the entire dataset to produce a “significant gene list” prior to performing crossvalidation can produce more accurate predictions .G was left unspecified in the procedure. The choice of which (and how many) possible values of Γ to include in G depends on the problem at hand, as well as the computational power available. As a default, we recommend trying 100 evenly spaced values of Γ between the 90th percentile of the Cox scores and the maximum of the Cox scores. However, the optimal Γbest varies greatly from dataset to dataset, so we recommend trying several different forms of G if adequate computing power exists.Also, the set p-value of the log-rank test after performing the original clustering, we insisted not only that the p-value be significant, but also that it be lower than the best p-value obtained thus far. The reasons for this are twofold. First, experience suggests that if a given set of genes produces a good clustering on the training data , then it is likely to produce a good clustering on the test data. Moreover, this speeds up the algorithm substantially. Calculating the nearest shrunken centroids crossvalidation error rate for a given clustering is the slowest part of the procedure; the time required to perform the clustering and calculate the log-rank statistic is insignificant in comparison. Thus, by only considering clusterings which produce a log-rank statistic with a small p-value, we allow the set G to be much larger than would be feasible otherwise.Furthermore, note that when we calculated the k was unspecified in the procedure. We have experimented with some algorithms to choose the value of k automatically, but without success. If possible, we recommend that the value of k be chosen based on prior biological knowledge. If this is not possible, we recommend trying several different small values of k and choosing the one that gives the best results. Finally, the number of clusters X be the p×n matrix of expression values, for p genes and n patients. Let xij denote the expression level of the 𝒾th gene in the 𝒿th patient. Assume that each patient has one of two possible underlying tumor types. Without loss of generality, assume that patients 1, …,m have tumor type 1, and that patients m + 1,…,n have tumor type 2. Then assume that the genetic profiles of the two tumor types are distinct from one another, which is equivalent to assuming that the joint distribution of is different for 1 ≤ 𝒿 ≤ 𝓂 than it is for 𝓂 + 1 ≤ 𝒿 ≤ 𝓃. Thus, if we choose constants {ai}jxija will be different for 1 ≤ 𝒿 ≤ 𝓂 than it is for 𝓂 + 1 ≤ 𝒿 ≤ 𝓃. Hence, assuming that variation in gene expression accounts for variation in survival, we would expect that TXu1 captures a large percentage of the variation in survival. For each Γ in G, split the training data into k random partitions . For most problems (and for the rest of this discussion), we can let k = 10. (3) For each crossvalidation fold, take a singular value decomposition of X, leaving out one of the 10 partitions for validation purposes. Use only those genes with absolute Cox scores greater than Γ. (4) Calculate υ^ for the 10% of the data that was withheld, as described above. (5) Fit a Cox proportional hazards model to υ^, and calculate the chi-square statistic for the log-rank test associated with this model. Denote the chi-square statistic for the 𝒾th crossvalidation fold by 𝓌i. (6) Average the 𝓌is over the 10 crossvalidation folds. Call this average 𝓌Γ. (7) If 𝓌Γ is greater than the value of 𝓌Γ∗, then let Γ∗ = Γ and 𝓌Γ∗ = 𝓌Γ. (8) Return to step 2. The set G is left unspecified in the procedure. As a default, we recommend trying 30 evenly spaced values of Γ between the 90th percentile of the Cox scores and the maximum of the Cox scores, although this recommendation is somewhat arbitrary.To choose the optimal value of Γ, we employ the following procedure: (1) Choose a set V (rather than simply taking the first column of V). Suppose we wish to find a predictor based on the first k columns of V. We can perform the following procedure: (1) Let X denote the training data. Take the singular value decomposition of X = TUDV as described above (after selecting an appropriate subset of the genes). (2) Fit a Cox proportional hazards model using the first k columns of V as predictors. (3) Calculate the matrix V^I for the test data using k columns of V^I using the Cox regression coefficients obtained in step 2. Use the resulting sum as a continuous predictor of survival.In some cases, we can improve the predictive power of our model by taking a linear combination of several columns of http://cran.r-project.org/. R source code for the procedures described in this paper are available from the authors upon request .Click here for additional data file.Data S2This file contains R functions for implementing the procedures we have described in our study.(6 KB TXT).Click here for additional data file.Data S3This file contains the R source code that we used to perform the first simulation study in our paper.(31 KB TXT).Click here for additional data file.Data S4This file contains the R source code that we used to perform the second simulation study in our paper.(39 KB TXT).Click here for additional data file.Dataset S1The gene expression data for the breast cancer study of (2.9 MB CSV).Click here for additional data file.Dataset S2The names of each of the 4,751 genes in the study of (74 KB CSV).Click here for additional data file.Dataset S3The clinical data for the study of (1 KB CSV).Click here for additional data file.Dataset S4The gene expression data for the 70 genes in the breast cancer study of (141 KB CSV).Click here for additional data file.Dataset S5The names of the 70 genes in the study of (1 KB CSV).Click here for additional data file.Dataset S6A single column that is 1 if the patient was included in the earlier study (that of (1 KB CSV).Click here for additional data file.Dataset S7The clinical data for the study of (5 KB CSV).Click here for additional data file.Dataset S8The gene expression data for the DLBCL study of (24.38 MB CSV).Click here for additional data file.Dataset S9The clinical data for the study of (2 KB CSV).Click here for additional data file.Dataset S10This is the gene expression data for the lung cancer dataset of (5.39 MB TXT).Click here for additional data file.Dataset S11This is the clinical data for the lung cancer dataset of (1 KB TXT).Click here for additional data file.Dataset S12This is the gene expression data for the AML dataset of (9.96 MB TXT).Click here for additional data file.Dataset S13This is the clinical data for the AML dataset of (1 KB TXT).Click here for additional data file.Figure S1(8.26 MB TIFF).Click here for additional data file.Figure S2(8.33 MB TIFF).Click here for additional data file.Figure S3(8.42 MB TIFF).Click here for additional data file.Protocol S1(28 KB TEX).Click here for additional data file.

There is great variation in the Accident and Emergency workload and location of Urology services in UK hospitals. This study investigated the relationship of the initial management of acute renal colic with the department workload plus local facilities including location of X-ray and urology services in UK Accident and Emergency (A&E) departments.small); 30,000 to 50,000 (medium); 50,000 to 80,000 (large) and >80,000 (very large) patients per year. One third of departments were selected in each group leading to a sample size of 106. A questionnaire was administered. Associations between categorical variables were investigated using the chi-squared test and when not valid, Fisher's Exact test was employed. Differences between groups in ordinal variables were investigated using the Mann-Whitney test.A&E departments in each of the 11 UK Deanery regions were stratified based on departmental workload, namely <30,000 (P = 0.003); with 57.1% of the small departments performing none and at least 82.8% of units in the other categories performing at least one. Of those departments with X-ray facilities in or adjacent to the department, 63% performed an intravenous urography (IVU) compared to 25% of those departments without (P = 0.026). Of those departments with on-site urology services, 86% performed at least one radiological investigation compared to 52% of units without such services (P = 0.001). Department workload was associated with the first choice analgesia (P = 0.011). Of the small departments, 64.3% used NSAIDs, 21.4% used parenteral opiates and 14.3% used neither. In comparison, NSAIDS were used by at least 87%, and opiates by at most 12.5% of units in each of the other three categories of department workload.All questionnaires were returned. Twenty-nine units (27.4%) did not perform any radiological investigation on renal colic patients. The number of radiological investigations that were available to departments was associated with workload (Over a quarter of UK A&E departments did not perform any radiological investigations and some departments do not even offer renal colic patients any analgesia. Patient management was associated with departmental workload, location of X-ray and Urology services. National guidelines are needed to ensure optimum care for all patients. Upon presentation to the A&E department, suspected acute renal colic patients must have a clinical examination and radiological investigations to confirm the diagnosis. Without radiological investigations, life-threatening conditions such as abdominal aortic aneurysm and ectopic pregnancy may be misdiagnosed as renal colic. However, a delay in the diagnosis is possible as the facilities needed for the diagnosis are sometimes not based in the same hospital as the A&E department. In the UK, great variation exists between Accident and Emergency services in their workload as measured by the number of new patients seen per year. Larger Small- less than 30,000, Medium- 30,000 to 50,000, Large -50,000 to 80,000 and Very Large-more than 80,000. For each of the four-workload categories in each of the 11 Deanery regions, every third unit was selected resulting in a total of 106 (34.1%) departments.The handbook of the British Association for Accident and Emergency lists a total of 311 A&E departments in the UK.Of the 106 departments, a total of 94 (88.7%) had X-ray facilities located in the department. A greater proportion of those departments that have X-ray facilities within their premises used the Intra-Venous Urogram (IVU) option compared to those departments without these facilities that were available to units was categorised as none, one and two or more. Those departments that had urology on-site had more radiological options available than those without P = 0.00 .The relationship between department workload and the average number of films used when an IVU was performed is shown in Table P = 0.089). However, at least half of the large and the very large units used USS compared to less than 30% of the departments in the small and medium sized categories could perform a CT scan compared to less than 10% of the units in each of the small, medium and large categories.The relationship between department workload and if a CT scan was available just missed statistical significance (P = 0.003) of the very large departments had at least two options available.A total of 29 units (27.4%) did not perform any radiological investigations. The relationship between the total number of investigations available and department workload was statistically significant (P = 0.011) of the small departments and one large department; one of these small units plus the large department reported using codydramol (a combination of paracetamol with dihydrocodeine). Of the 106 departments, 91 (85.8%) used NSAIDs including 86 (81.1%) – diclofenac and five (4.7%)- ketorolac as the first choice analgesia. Of the 86 departments that used diclofenac, 68 (79.1%) routinely used the intra-muscular route, 17 (19.7%) the rectal route and one (1.2%) administered it orally.There was a statistically significant relationship between department workload and the first choice analgesia: either NSAIDs (Diclofenac or Ketorolac) or parenteral opiates did not perform any radiological investigation did not perform any radiological investigation. The concern is greatest for those departments in the The first choice analgesic used by most units is NSAIDS in keeping with the literature; more departments, however, need to adopt the use of the rectal route for diclofenac in order to avoid the potential complication of the intra-muscular route. The low percentage of departments using parenteral opiates as first-choice analgesic is encouraging as parenteral opiates are better used as second choice in view of the unavoidable delay that occurs before their administration.The practice in over a quarter of A&E departments in the UK is below standard. There is significant association with departmental workload and location of services such as radiology and Urology relative to A&E. We suggest that national guidelines be developed for the management of acute renal colic in A&E departments to ensure optimum care for all patients. Subsequent to the implementation of any guidelines, we suggest that UK practice is regularly reviewed.The author(s) declare that they have no competing interests.TAL undertook the literature search, designed the questionnaire, participated in the collection and analysis of data, and wrote the paper. PMS undertook the statistical analysis and contributed to the writing of the paper. NN initiated the research, participated in data collection and contributed to the paper. CS performed the initial stratification and selection of units for the study. NP participated in data collection.1. Name of hospital: ____________________________________________2. Where is X-ray located? Within or adjacent to A&E □Distant □3. Where are urology services located? Same Site as A&E □Separate Site from A&E □4. Are the following investigations performed on suspected cases of renal colic?a) Urinalysis No □ Yes □b) IVU No □ Yes □If IVU is performed, please indicate how many films are used □c) CT No □ Yes □d) USS No □ Yes □e) Nuclear Medicine No □ Yes □5. Which of the following analgesics are given on presentation?a) Codydramol Other Oral No □ Yes □b) NSAIDS No □ Yes □If NSAIDS used; which one: (indicate route below)i. Intra-muscular □ii. Oral □iii. Rectal □iv. Intra-venous □c) Parenteral opiate No □ Yes □If parenteral opiates are used then please indicate if first or second choice:i. First choice □ii. Second choice □The pre-publication history for this paper can be accessed here:

Celiac disease is a small intestinal inflammatory disorder characterized by malabsorption, nutrient deficiency, and a range of clinical manifestations. It is caused by an inappropriate immune response to dietary gluten and is treated with a gluten-free diet. Recent feeding studies have indicated oats to be safe for celiac disease patients, and oats are now often included in the celiac disease diet. This study aimed to investigate whether oat intolerance exists in celiac disease and to characterize the cells and processes underlying this intolerance.We selected for study nine adults with celiac disease who had a history of oats exposure. Four of the patients had clinical symptoms on an oats-containing diet, and three of these four patients had intestinal inflammation typical of celiac disease at the time of oats exposure. We established oats-avenin-specific and -reactive intestinal T-cell lines from these three patients, as well as from two other patients who appeared to tolerate oats. The avenin-reactive T-cell lines recognized avenin peptides in the context of HLA-DQ2. These peptides have sequences rich in proline and glutamine residues closely resembling wheat gluten epitopes. Deamidation (glutamine→glutamic acid conversion) by tissue transglutaminase was involved in the avenin epitope formation.We conclude that some celiac disease patients have avenin-reactive mucosal T-cells that can cause mucosal inflammation. Oat intolerance may be a reason for villous atrophy and inflammation in patients with celiac disease who are eating oats but otherwise are adhering to a strict gluten-free diet. Clinical follow-up of celiac disease patients eating oats is advisable. Are oats safe for patients with celiac disease? Some patients studied here have an immune response to the oat protein avenin and show disease symptoms Celiac disease is a chronic inflammatory condition caused by an inappropriate immune response of intestinal T-cells reactive to gluten proteins of wheat and similar prolamin proteins of related cereals . The majOats have traditionally been excluded from the gluten-free diet. Several feeding studies, however, have indicated that patients with celiac disease and dermatitis herpetiformis tolerate oats without signs of intestinal inflammation –9. Of noIt remains to be proven that all celiac disease patients tolerate oats following long-term exposure. A recent study of 39 Finnish patients randomized to eat a gluten-free diet with 50 g of oats daily or a standard gluten-free diet for 1 y reported more intestinal symptoms and more gut inflammation in the group of patients eating oats, although the mucosal integrity was not disturbed . In an oWe studied nine adults with celiac disease who had a history of exposure to pure oats. The oats were derived from a quality-controlled production line and were shown to be free from contamination of other cereals as described elsewhere . The selWe took small intestinal biopsies from the horizontal part of the duodenum by gastroduodenoscopy using an Olympus GIF-IT140 scope and scored them according to the modified Marsh criteria . Intraep4HCO3 and digested with chymotrypsin. Gluten and gliadin (ethanol-soluble proteins of gluten) were isolated from household wheat flour and digested with chymotrypsin as described [Oat grains were ground and the flour was washed twice with water-saturated 1-butanol. The pellet was dissolved in 45% ethanol overnight and centrifuged. The avenin fraction was precipitated from the supernatant by adding two volumes of 1.5 M NaCl. The precipitate was dissolved either in 0.01 M acetic acid (pH 1.8) and digested with pepsin and subsequently trypsin (pH 7.8) or in 2 M urea /0.01 M NHescribed .Avenin peptides were synthesized on a robotic system using Fmoc/OtBu chemistry and 2-chlorotrityl resin . The identity of the peptides was confirmed by electrospray mass spectrometry, and purity was analyzed by reverse-phase HPLC.2, respectively, at 37 °C for 2 h.Treatment of the peptides with guinea pig and human recombinant TG2 was performed in the presence of 1 and 2 mM CaClThe generation of T-cell lines, T-cell cloning, and T-cell proliferation assays were performed as described elsewhere . Single A pepsin-trypsin digest of avenin was separated by gel filtration , and a fraction containing T-cell stimulatory fragments was further separated by reverse-phase HPLC using an acetonitrile gradient from 5% to 40% with 1%/min and from 40% to 64% with 3%/min .http://www.matrixscience.com).Electrospray ionization tandem mass spectrometry was performed on a quadrupole time-of-flight hybrid mass spectrometer . For spraying, needles were typically held at 900 V towards a skimmer cone (40 V). In collision-induced dissociation of selected peptide ions , the generated characteristic b- and y-type fragment ions were detNine adults with celiac disease who had a history of exposure to oats assessed to be free from contamination of other cereals were studied. In some cases they came for gastroduodenoscopy for clinical reasons, in other cases, they agreed to come for research reasons. The characteristics of the patients are given in Responses to TG2-treated avenin were detected in the polyclonal T-cell lines derived from the avenin-challenged biopsies from all three patients who had clinical and histopathological signs of oat intolerance . IntestiTo identify the T-cell stimulatory peptides, we initially studied an avenin-specific T-cell line TCL CD422.2.4) isolated from the oat-intolerant patient CD422. The T-cells weakly recognized one gel filtration fraction (#25) of a pepsin-trypsin digest of avenin. This fraction was further separated by reverse-phase HPLC, and retested for T-cell recognition A and 2B.2.2.4 isoFour avenin peptides and interferes with absorption of nutrients from food. Patients with celiac disease do not tolerate a protein called gluten, which is found in wheat, rye, and barley. When people with celiac disease eat foods containing gluten, their immune system responds by damaging the small intestine. The disease is quite serious in some patients, but eating a strictly gluten-free diet can eliminate all of the symptoms. Unfortunately, wheat, barley, and rye products like flour are found in many common foods, and patients have to avoid them for the rest of their lives. Previous studies suggested that oats were safe for patients with celiac disease, and as a result, they often form part of a gluten-free diet.Contrary to other studies, this one demonstrates that oats intolerance does exist in some patients with celiac disease. These patients have an immune reaction to oats that is similar to the reaction most celiac disease patients have to wheat, barley, and rye.It appears that oats are not safe for all patients with celiac disease. Patients who eat oats as part of a gluten-free diet should discuss their diet and any symptoms with their doctors; doctors should keep in mind that patients might develop symptoms when they eat oats.The researchers studied only a small number of patients, and this study cannot tell us how common oats intolerance is among celiac disease patients.http://digestive.niddk.nih.gov/ddiseases/pubs/celiac/US National Institutes of Diabetes, Digestive, and Kidney Disorders: http://www.celiac.org/Celiac Disease Foundation: http://www.gluten.net/The Gluten Intolerance Group: http://www.celiac.com/The Celiac Disease Foundation:

In free community science, where large numbers of scientists participate as volunteers in a single project, the ideal of scientific cooperation finds a new expression. Free community science was inspired by the free software movement, which itself was inspired by the application of the ideal of scientific cooperation, as it was applied to software development by the operating system developers of the Massachusetts Institute of Technology Artificial Intelligence Lab in the 1970s. This ideal has suffered for two decades from corporate pressure to privatize science, so it is very gratifying to see that the free software movement can today help reinvigorate the principle that inspired it.The ideal of scientific cooperation goes beyond the conduct of individual projects. Scientific cooperation is also being reinvigorated today through the open-access movement, which promotes the public's freedom to redistribute scientific and scholarly articles. In the age of the computer networks, the best way to disseminate scientific writing is by making it freely accessible to all and letting everyone redistribute it. I give a vote of thanks to the Public Library of Science for leading the campaign that is now gaining momentum. When research funding agencies pressure journals to allow free redistribution of new articles they fund, they should apply this demand to the old articles “owned” by the same publishers—not just to papers published starting today.Journal editors can promote scientific cooperation by adopting standards requiring internet publication of the supporting data and software for the articles they publish. The software and the data will be useful for other research. Moreover, research carried out using software cannot be checked or evaluated properly by other scientists unless they can read the source code that was used.A significant impediment to publication and cooperation comes from university patent policies. Many universities hope to strike it rich with patents, but this is as foolish as playing the lottery, since most “technology licensing offices” don't even cover their operating costs. Like the Red Queen, these universities are running hard to stay in the same place. Society should recognize that funding university research through patents is folly, and should fund it directly, as in the past. Meanwhile, laws that encourage universities to seek patents at the expense of cooperation in research should be changed.Another impediment comes from strings attached to corporate research funding. Universities or their public funding agencies should ensure private sponsors cannot block research they do not like. These sponsors must never have the power to veto or delay publication of results—or to intimidate the researchers. Thus, sponsors whose interests could be hurt by publication of certain possible results must never be in a position to cut the funding for a specific research group.The free software movement, the free redistribution policy of this journal, and the practice of free community science for developing diagnostic disease classifications are all

A combination of microarray data with extensive genome annotations resulted in a set of 28,456 experimentally supported transcripts, providing the first experiment-driven annotation of the human genome. Computational and microarray-based experimental approaches were used to generate a comprehensive transcript index for the human genome. Oligonucleotide probes designed from approximately 50,000 known and predicted transcript sequences from the human genome were used to survey transcription from a diverse set of 60 tissues and cell lines using ink-jet microarrays. Further, expression activity over at least six conditions was more generally assessed using genomic tiling arrays consisting of probes tiled through a repeat-masked version of the genomic sequence making up chromosomes 20 and 22.The combination of microarray data with extensive genome annotations resulted in a set of 28,456 experimentally supported transcripts. This set of high-confidence transcripts represents the first experimentally driven annotation of the human genome. In addition, the results from genomic tiling suggest that a large amount of transcription exists outside of annotated regions of the genome and serves as an example of how this activity could be measured on a genome-wide scale.These data represent one of the most comprehensive assessments of transcriptional activity in the human genome and provide an atlas of human gene expression over a unique set of gene predictions. Before the annotation of the human genome is considered complete, however, the previously unannotated transcriptional activity throughout the genome must be fully characterized. The completion of the sequencing of the human, mouse and other genomes has enabled efforts to extensively annotate these genomes using a combination of computational and experimental approaches. Generating a comprehensive list of transcripts coupled with basic information on where the different transcripts are expressed is an important first step towards annotating a genome once it has been fully sequenced. The task of identifying the transcribed regions of a sequenced genome is complicated by the fact that transcripts are composed of multiple short exons that are distributed over much larger regions of genomic DNA. This challenge is underscored by the widely divergent predictions of the number of genes in the human genome. For example, direct clustering of human expressed sequence tag (EST) sequences has predicted as many as 120,000 genes , and a het al. [Several recent studies have highlighted the limitations of relying solely on computational approaches to identify genes in the draft of the human genome -13. Furtet al. also indet al. . They deab initio prediction programs operate by recognizing coding potential in stretches of genomic sequence, where the recognition capability of these programs depends on a training set of known coding regions [ab initio prediction programs or assembled from EST data are also inaccurate or incomplete much of the time [ab initio prediction programs perform well at identifying known genes, predictions that do not use existing expressed sequence and protein data often miss exons, incorrectly identify exon boundaries, and fail to accurately detect the 3' and 5' untranslated regions UTRs [Most current methods in widespread use for identifying novel genes in genomic sequence depend on sequence similarity to expressed sequence and protein data. For example, regions . Therefothe time -12. Whilons UTRs . Similarons UTRs . These dons UTRs , but cloons UTRs .Arabidopsis thaliana and Escherichia coli genomes. The recent sequencing and analysis of the mouse genome indicates extensive homology between intergenic regions of the human and mouse genomes, further highlighting the potential for other classes of transcribed regions [Recently, several groups have used microarrays to test computational gene predictions experimentally and to tile across genomic sequence to discover the transcribed regions in the human and other genomes -12,15-17 regions . Interes regions .In the study reported here, we describe hybridization results generated from two large microarray-based gene-expression experiments involving predicted transcript arrays spanning the entire human genome and a comprehensive set of genomic tiling arrays for human chromosomes 20 and 22. mRNA samples collected from a diversity of conditions were amplified using a strand-specific labeling protocol that was optimized to generate full-length copies of the transcripts. Analyses of the resulting hybridization data from both sets of arrays revealed widespread transcriptional activity in both known or high-confidence predicted genes, as well as regions outside current annotations. The results from this analysis are summarized with respect to published genes on chromosomes 20 and 22 in addition to our own extensive set of genome alignments and gene predictions. Combining computational and experimental approaches has allowed us to generate a comprehensive transcript index for the human genome, which has been a valuable resource for guiding our array design and full-length cloning efforts. In addition, the expression data from the 60 conditions provides a comprehensive atlas of human gene expression over a unique set of gene predictions .ab initio gene-finding algorithms tend to have a high false-positive rate when applied at a low-stringency setting to cast as broad a discovery net as possible. Second, gene-finding algorithms are trained on known protein-coding genes, which may limit their ability to detect truly novel classes of transcribed sequences.Figure The second step towards the CTI is the use of two different types of microarrays to address these limitations Figure . First, ab initio gene predictions. The process resulted in mapping 91% of the well characterized genes found in the RefSeq database [To generate the PTI, three distinct computational analysis steps were executed in parallel: predictions based on similarity to expressed sequences from human and mouse; predictions based on similarity to all known proteins; and database , a percedatabase ,3. The mab initio predictions. The categories, in decreasing order of support, are as follows: (1) known genes, taken as the set of 11,214 human genes represented in the RefSeq database when the arrays were designed; (2) ab initio gene models with expressed sequence and protein support; (3) ab initio gene models with expressed sequence support; (4) ab initio gene models with protein support; (5) alignments of expressed sequence and protein data; (6) alignments of expressed sequence data, requiring at least two overlapping expressed sequences; (7) ab initio gene models with no expressed sequence or protein support; and (8) alignments of protein data. Because of the limitations discussed in the previous section, we considered predictions with a single line of evidence (categories 6-8) as low confidence.All locus projections were classified into one of eight categories on the basis of the level of underlying evidence from expressed sequence similarity, protein similarity and Table ab initio gene-finding algorithms [We previously described a high-throughput, experimental procedure to validate predicted exons and assemble exons into genes by using co-regulated expression over a diversity of conditions . Here wegorithms ,25,26 agWe used an enhanced version of a previously described gene-detection algorithm to analyze the predicted transcript array dataset . BasicalThe sensitivity of our procedure was assessed by computing the EVG detection rate for those Sanger genes that overlap predictions (locus projections) represented in our PTI Table . The aveThis 20% false-negative rate is the result of a complex mixture of issues, including limitations in our EVG-detection algorithm, limitations in the probe design step, lack of expression in the conditions profiled, and/or alternative splicing events. While the EVG-detection algorithm provides an efficient method to assemble probes into transcript units, the detection capabilities of this model could be expected to improve as the number of samples and the number of probes targeting any given transcript increases. The use of four probes per predicted transcript was determined to be sufficient for detection of most transcripts, as supported by the overall detection rate of known genes, although in many cases the probe design step was limited by our ability to find four high-quality probes per transcript. For many transcripts, there were not four nonoverlapping probes predicted to have good hybridization characteristics for the microarray experiment carried out here. The 60 samples were chosen to represent a broad array of tissue types, as an exhaustive list of human tissues is impossible to obtain. Because no replicate tissues/cell lines were run for any of the 60 chosen samples, we relied on the replication inherent in monitoring the same transcripts over 60 different conditions. In this case, genes expressed in multiple samples provide the replication necessary to increase our confidence in the detections. However, there are clear limitations in not replicating tissues/cell lines, as genes may be expressed in only a single condition or may be switched on only under certain physiological conditions or only during a certain stages of development. In such cases, we would have reduced power to detect these genes.Genes in the lower-confidence categories of our PTI annotations, which are not typically considered genes by Sanger, were detected at a significantly reduced rate. Interestingly, of the 337 (188 +149) higher-confidence transcripts on chromosomes 20 and 22 that did not intersect with Sanger genes, 47 (or 14%) were detected as EVGs ).However, before we can make claims to the discovery potential for this method over the entire genome, we need to assess the false-positive detection rates. To this end, we defined as false positives all detections made in regions with support by only a single gene model that fell outside Sanger-annotated genes on chromosomes 20 and 22. Applying this definition over all transcripts in our PTI leads to a false-positive rate of 3% (11 out of 406). Because we cannot exclude the possibility that some of the transcripts supported by a single gene model represent real genes, we consider this false-detection rate as an upper bound on the actual false-positive rate. Accepting that the Sanger annotations represent the gold standard for chromosome 22, we detected 70% of all Sanger-annotated genes, while only 4% of the chromosome 22 locus projections that did not intersect Sanger genes were detected by our procedure, highlighting the sensitivity and specificity of this approach. In addition, the enrichment for EVG detections in Sanger genes versus the non-Sanger PTI on chromosomes 20 and 22 was extremely significant with a ab initio gene predictions ever undertaken. We can use the false-positive and negative rates derived above to assess the discovery potential on that part of the genome that has not been as extensively characterized as chromosomes 20 and 22. First, we note that our detection rates over the genome were similar to that given for chromosomes 20 and 22. That is, 75% of the category 1 genes (RefSeq genes) were detected over the entire genome, compared to 80% for chromosomes 20 and 22. In total, 15,642 genes in the PTI were experimentally validated using this array-based approach. Assuming the false-positive rate of 3% defined above and a conservative false-negative rate of 30%, defined as the percentage of Sanger genes we failed to detect on chromosomes 20 and 22, these data suggest there are close to 21,675 potential coding genes represented in our PTI set. Because our PTI misses close to 10% of the Sanger genes, we corrected this number for those genes not represented in this set and provide an estimate of the total number of protein-coding genes in the human genome supported by our data to be approximately 25,000. This number is consistent with estimates given in the current release (22.34d.1) of the Ensembl database [Summarizing EVG data over the entire genome and assessing the discovery potential. The last column of Table database ,29.However, we caution that the estimate provided is based solely on the data described here, and that orthogonal sources of data continueab initio prediction). These 2,093 transcripts represent a rich source of potential discoveries in our PTI. To assess the potential biological functions of this novel gene set, we annotated translations of this set by searching the domains represented in the Protein Families database (Pfam) [From Table e (Pfam) . The seae (Pfam) codes aset al. [Because multiple probes in each of the approximate 50,000 predicted genes in the human genome have been monitored over 60 different tissues and cell lines, the EVG data represent a significant atlas of human gene expression that is now publicly available . For eacet al. to proviTo complement the use of PTI arrays, we constructed a set of genome tiling arrays comprised of 60 mer oligonucleotide probes tiled in 30 base-pair steps through both strands of human chromosomes 20 and 22. Repetitive sequences identified by RepeatMasker were ignored for probe design. These genome tiling arrays allow for an unbiased view of the transcriptional activity outside of known and predicted genes on these two chromosomes. mRNA from six (chromosome 20) or eight (chromosome 22) conditions was amplified and hybridized to the tiling arrays .Figure e Figure , the tilEWSR1 gene. In contrast to the first example, this gene has intense transcriptional activity outside of the annotated exons. Specifically, the EWSR1 gene has 43 potentially false-positive calls out of 203 intron probes. However, the EST data and alternative splicing predictions strongly suggest that these probes represent biologically relevant transcriptional activity. As with the KDELR3 gene, EWRS1 is annotated by RefSeq as having two transcripts: NM_005243 and NM_013986. The Acembly predictions identify four additional alternative splice forms; most noteworthy among these are EWSR1.b and EWSR.g, shown in Figure EWSR1 gene that essentially divide the largest transcript into two transcripts, suggesting that multiple promoter and transcription-stop signals are present in this gene. The tiling data depicted in Figure EWSR.b and EWSR.g predicted alternative splice forms, providing experimental support that these predictions represent actual isoforms of this gene. In fact, these data may provide a more accurate representation of the putative structure of this gene, as they support multiple alternatively spliced transcripts in this gene, beyond what has already been annotated in the RefSeq database. In all, 5% of the probes detected as expressed in intronic sequence mapped to predicted alternative splice forms. Given the extent of alternative splicing that is yet to be characterized [Figure cterized , we belip-value for this enrichment using the Fisher exact test is less than 10-15). To estimate the upper bound of false-positive calls, we counted as false-positive events each probe identified as expressed by the detection process, but falling within an annotated intron of the RefSeq genes we detected as expressed. This resulted in an estimated false-positive rate of 1.3%.Our genome tiling arrays consisted of 2,119,794 and 1,201,632 probes for chromosomes 20 and 22, respectively. Of these, 1,615,034 probes fell into Sanger gene regions, with 239,542 probes actually overlapping Sanger exons. Under stringent criteria 64,241 probes were detected as expressed, with 34,245 of these falling within Sanger exons, 18,551 falling within Sanger introns, and 15,835 probes falling completely outside all Sanger annotations. This widespread transcriptional activity outside annotated regions of the human genome is consistent with other reports from multiple species ,12,15,16As indicated in Figure For those probes falling outside all Sanger genes, we again made use of our custom genome annotations to help interpret the extent of transcriptional activity in these regions. Table One further advantage of the tiling data is that they can be used to discriminate between transcribed and non-transcribed sequences conserved between human and mouse, or between any other pair of species. Figure ab initio methods, sequencing of EST libraries, full-length gene cloning projects, and comparative analyses between fully sequenced genomes of different species. However, we are still a long way from having a comprehensive set of annotations for the human and other genomes. There is need for new high-throughput experimental approaches to accelerate the process of annotating sequenced genomes in a comprehensive and accurate fashion. Toward this goal, we have used two microarray-based experimental approaches to provide evidence of widespread transcription activity outside of any known or predicted genes in the human genome. We have also provided experimental support for many ab initio predicted genes that have no other or minimal experimental sequence support, suggesting a small but significant class of genes that have evaded all other forms of experimental detection. Similar identifications have been made recently in the first extensive comparative analysis between mouse and human genomes [A complete understanding of the human genome will only come after all genes have been identified and the functions of those genes have been determined. There has been much recent progress in defining the human transcriptome with genomes . Despite genomes ,40. FinaWe have used the expression data for the approximate 50,000 predicted transcripts hybridized to 60 diverse conditions in combination with genomic tiling data to generate a CTI containing 28,456 experimentally supported transcripts. The transcripts represented in the CTI include all computational predictions with two or more lines of evidence from our PTI , in addition to the overlapping set of 15,642 transcripts detected as EVGs. This resulting comprehensive list of known and predicted transcripts provides the starting point for large-scale systematic studies to determine the biological function of genes in both normal and disease states. The primary goal of the CTI is to allow researchers to focus experimental efforts on a comprehensive set of genes that are likely to be real.It is of note that between the time the predicted transcript arrays were designed and annotated using the custom genome annotations described above, and the time this work was published, more than 6,000 genes were added to the RefSeq collection. These newer RefSeq genes were represented by 5,100 locus projections in our original PTI that were not classified in the RefSeq category. Interestingly, 4,212 were detected as EVGs in the present analysis and had already been included in our CTI, a validation rate slightly greater than 82%. Only 19% of the non-RefSeq genes in our PTI had been detected as EVGs and a mouse gene index (MGI). Clustering and alignment were performed with the DoubleTwist Clustering and Alignment Tools (CAT) . Input d-20 for human sequences and 10-8 for mouse sequences. For human UniGene and HGI, we refined only those BLAST hits where the target sequence showed greater than or equal to 92% identity to the genomic sequence over 75 bp. For human RefSeq, we refined hits with greater than or equal to 95% identity, and for MGI, RefSeq, and UniGene, we refined hits with greater than or equal to 80% identity. These thresholds were empirically determined to provide good sensitivity in aligning most sequences to the genome while limiting multiple alignments past those expected from paralogs present in the human genome. In all cases percent identity was measured over 75 bp. Individual sim4 exons of questionable confidence were then removed on the basis of percent identity and length thresholds. All sequence databases were downloaded from GenBank August, 2001.Human and mouse UniGene and RefSeq, MGI, and HGI sequences were aligned with the genome first by BLASTN 2.2.1 , followe-5. Adjacent protein alignments from a single protein were grouped together as a prediction whenever the protein sequence coordinates of the alignments were consistent in direction and did not significantly overlap.The GenBank nonredundant protein database (downloaded 25 August 2001) was aligned to the genomic sequence with BLASTX 2.2.1 using anab initio gene-prediction algorithms were run independently across the entire genome assembly to augment alignment-based gene identification methods. GrailEXP 4.0, GENSCAN 1.0, and FGENESH version 1.c were run with default parameters for human sequence. GrailEXP used expressed sequence evidence from RefSeq, UniGene and DoubleTwist HGI to refine gene predictions. FGENESH+ was run with protein sequences from BLASTX with E-score lower than 10-5. When multiple protein alignments overlapped, all overlapping protein sequences were clustered with BLASTClust [GrailEXP 4.0 , GENSCANASTClust and the Locus projections contained the union of all exons from all overlapping predictions in a contiguous region of the chromosome that were derived from sequence alignments or gene-finding algorithms. Predictions to a given strand of the genomic sequence that overlapped by even a single nucleotide were grouped into a single locus projection (antisense transcripts were not considered in defining the locus projections). The criteria for grouping predictions were intentionally kept loose, given that the intent was to include as many potential exons as possible in a given genomic region, and then use the experimental microarray-based approach to elucidate the actual gene structure. These merged overlapping predictions defined the 5' and 3' ends of the locus projections. Overlapping predicted exons were merged to form an exon prediction of maximal extent. Low-quality predicted exons from sim4 alignments that contained a high percentage of A or T were removed. We also removed sim4-predicted exons that overlapped two or more predicted exons from another sim4 alignment. Additionally, 3' sim4 and 3' or 5' FGENESH+ predicted exons that were short and/or distant from internal predicted exons were removed. Finally, locus projections that contained mRNAs from RefSeq were split at the 5' end of the RefSeq sequence.ab initio gene model.Locus projections supported by expressed sequences alone could be portions of 3' or 5' UTRs of genes included in the other gene-prediction categories described in the text. To minimize the consequences of this potential artifact, we used a UTR filter to exclude locus projections from the expressed sequence alone category that were within 20 kb of a locus projection supported by an ab initio; expressed sequence + ab initio; protein + ab initio; expressed sequence + protein; ab initio alone; protein alone; expressed sequence alone. FGENESH+ predictions were counted as protein + ab initio. For the ab initio category, predictions from at least two of FGENESH, GENSCAN and GrailEXP were required to overlap in at least one exon to be merged.All data were loaded into a relational database to count and categorize locus projections. At least one type of evidence was assigned to each predicted exon for each locus projection. Multiple types of evidence were assigned to a merged predicted exon if there was overlap between predicted exons of different types for at least 1% of the length of the merged exon prediction. One of the eight evidence categories discussed in the text was assigned to each exon on the basis of the combination of types of evidence. Locus projections inherited the highest-ranking evidence category of their constituent exons. Evidence categories were ranked in the following order: Refseq (highest); expressed sequence + protein + Escherichia coli contamination and human non-coding RNA and mitochrondrial DNA contamination using Scylla (Paracel). For genomic tiling arrays, 60 mer probes were then selected from unmasked regions of both forward and reverse complement strands at uniform 30-base intervals. For predicted transcript arrays, up to four oligonucleotide probes were selected from the unmasked regions of each transcript using a multistep process.Input sequences for probe selection were masked for vector, interspersed repeats, simple repeats, poly(A) tails, Saccharomyces cerevisiae were added to the 3' ends of probes shorter than 60 nucleotides so that they had a total length of 60 bases when printed onto the arrays.The first step in the probe-selection process was the generation of a pool of candidate probes 60 nucleotides long (60 mers), where each probe was required to fall entirely within an exon from the set of exons under consideration. If there were fewer than four 60 mers then all 50 mers were considered as well. If there were fewer than four 50 mers or 60 mers then all 40 mers were considered, and so on. Stilts composed of sequence from The second step in the probe-selection process was the classification and reduction of the probe pool on the basis of base composition and related filters. Probes were sorted into four classes on the basis of several criteria, including A, G, C and T content, GC content, the length of the longest homopolymeric run and the number of A residues at the 5' end. For example, a probe had to have GC content between 35 and 45% to be in class 1, between 15 and 55% to be in class 2, and between 10 and 60% to be in class 3. After all classifications were made, probes from lower-quality classes were discarded, keeping the number of probes per gene greater than 15. In cases where a pair of probes was overlapping by more than 50 bases, only a single probe was chosen.The final step in the probe-selection process identified probes with minimal overlap, and predicted cross-hybridization and desirable positions in the transcript sequence. Cross-hybridization prediction was based on BLAST searching of the full collection of transcript sequences . Probes All arrays included a set of standard control probes which were used for image processing and quality control. Each array also included 30 randomly distributed copies of each of 51 negative-control probes. These probes were selected for their low intensities in previous human hybridizations. The negative controls local to each experimental probe were used for background correction. Non-control probes were added to each array such that all probes for a given input sequence were grouped together and ordered by their position on the sequence.Hybridization material was generated through a random-priming amplification procedure using primers with a random sequence at the 3' end and fixed motif at the 5' end. This amplification procedure has been fully described and has 10 (expression ratio) where the expression ratio was taken to be the ratio between normalized, background-corrected intensity values for the two channels (red and green) for each spot on the predicted transcript arrays. An independent normalization routine was carried out on the tiling data as described [Array images were processed as described to obtaiescribed to correProbes from each computationally determined locus were analyzed for coordinated expression over 60 tissues by adapting an additive, probe-specific model initially developed to estimate gene expression indices . The modyij = μ + φj + θi + εj,yij represent the mlratio measurements for sample pair i and probe j in the current transcriptional model, μ is the grand mean term, φi is the probe-specific term for probe j in the model, θi is the sample-specific term for sample i, and εj is the probe-specific error term, which is taken to be normally distributed with mean 0 and variance . Given the above representation for an observed mlratio value, the likelihood for a single probe over N condition pairs is simplywhere the M probes comprising the current model:From this, the likelihood for a given transcriptional model, where a transcriptional model in this context is defined as a set of probes that are adjacent to one another in the genomic sequence and that co-regulate over a number of conditions, is easily seen to be the product of the individual probe likelihoods defined above over the The maximum likelihood estimates for the parameters of this model are obtained using standard optimization techniques.ab initio prediction that fell outside annotated Sanger genes on chromosomes 20 and 22. False negatives were defined as Sanger genes on chromosome 20 and 22 that were not detected. Probe sets with a maximum likelihood statistic greater than 100 and an r2 value for fit of data to the model greater than 0.8 were considered high-confidence candidates for EVGs.With the likelihood model described above, probe groups making up a transcriptional model were formed by iteratively considering whether neighboring probes (within a PTI member based on genomic location) of a given probe improved the fit of the model just described. This was determined by examining the likelihood ratio statistics between the current, best transcriptional model with or without an additional probe included in the model. Thresholds for the likelihood ratio test statistic and the different model parameters were empirically determined to minimize false-positive and false-negative rates. False positives were estimated by the detection of PTI members supported by only a single p-value < 0.01) in at least 10% of the samples; or significantly differentially expressed in at least 10% of the condition pairs, were considered validated.For each high-confidence EVG candidate, probes were further assessed by considering the number of conditions in which the absolute intensity of the probe was seen to be significantly above background, and the number of times the probe was seen significantly differentially expressed. Candidate EVGs with at least one probe that was: significantly above background .Hidden Markov model Pfam (HMMPfam) domain predictions were run on six-frame translations of the PTIs using the HFRAME software from Paracel with an E-value cutoff of 0.01 and frameshift penalty of -12. Information on Pfam domains The following additional data is available with the online version of this paper and at . AdditioA complete list of 48,614 transcripts in the PTI that were represented on the set of predicted transcript arraysClick here for additional data fileA complete list of 60 tissues and cell lines hybridized to the predicted transcript arraysClick here for additional data fileA list of six tissues and cell lines hybridized to the chromosome 20 genomic tiling arraysClick here for additional data fileThe eight tissues and cell lines hybridized to the chromosome 22 genomic tiling arraysClick here for additional data fileA comparison of EVG predictions with RefSeq sequencesPClick here for additional data file

Malaria is one of the oldest and deadliest infectious diseases in humans. Many mathematical models of malaria have been developed during the past century, and applied to potential interventions. However, malaria remains uncontrolled and is increasing in many areas, as are vector and parasite resistance to insecticides and drugs.Anopheles population dynamics and their relations to the environment. One of its main strengths is that it is based on both biological and environmental variables.This study presents a simulation model of African malaria vectors. This individual-based model incorporates current knowledge of the mechanisms underlying Anopheles biology about which knowledge is lacking. One simulation showed several patterns similar to those seen in the field, and made it possible to examine different analyses and hypotheses for these patterns; sensitivity analyses on temperature, moisture, predation and preliminary investigations of nutrient competition were also conducted.The model made it possible to structure existing knowledge, assembled in a comprehensive review of the literature, and also pointed out important aspects of basic Anopheles population dynamics in general and also a better understanding of the dynamics in specific local geographic environments. It points out many important areas for new investigations that will be critical to effective, efficient, sustainable interventions.Although based on some mathematical formulae and parameters, this new tool has been developed in order to be as explicit as possible, transparent in use, close to reality and amenable to direct use by field workers. It allows a better understanding of the mechanisms underlying Plasmodium, disables and kills more people than any other infectious disease." by d by dAn. CD(t) >CDf = 1 + UFirstGon + G     (5)UFirstGon has been set to 0.5 for An. gambiae. All subsequent gonotrophic cycles follow equation 4.An. funestus ):):UEgg isN' = N·(0.5 + 0.5·Cweight)     (22)The male-female ratio at emergence from the pupa stage is assumed to be 1:1.A simple example is used to show how the model can help to achieve a better understanding of vector population dynamics and determine key underlying factors. In particular, the influence of temperature, moisture, predation and nutrient competition on adult abundance is investigated. The example is taken as a small cluster of six houses, each with five residents, and a total of three oviposition sites will remain constant.Here Although the focus is the first major peak in adult abundance, the analysis could be transposed to any period. Interventions that take effect in two periods are compared, the first beginning on May 6, 2000, at the beginning of the first major peak, and the second beginning 15 days later, on May 21, 2000. A successful one-time larval control intervention is simulated by imposing 80% mortality on all larvae present during 10 consecutive days. An adult control intervention that consists of spraying surfaces inside houses with residual insecticide is simulated by imposing 75% mortality on blood feeding adults during a 25-day period.Figure Similarly, for an adult-control effort figure , the latIn this analysis the same conditions are considered as the preceding section but the potential impact of the control interventions on predators is also taken into account. In the case of the larval control intervention, 80% mortality in the predator population is assumed, as was observed by . The preAnopheles within houses, but spiders in particular are thought to be very efficient in preying on mosquitoes. Here the impact of the destruction of these predators is investigated under an assumption that they represent an adult mosquito mortality of 5%. It is also assumed that the predator-pressure returns to its normal level after a time lag of 21 days.To the best of our knowledge, no study has focused on predators on adult Figures Figure The lack of predator pressure allows a much quicker reconstruction of the larval population.For the adult control intervention, the curves in figure Figure Anopheles population dynamics in an explicit, transparent way. It focuses on five basic factors, two of them abiotic – temperature and moisture – and three biotic – nutrient competition, predation or death by disease, and dispersal.This model integrates important mechanisms underlying Little of the published literature takes into account the effects of temperature on vector populations. It may be that temperature shows little fluctuation compared to countries with marked seasonality, but most African regions like Kenya exhibit temperature fluctuations ranging from 16°C to 35°C, which can be critical. Futhermore, temperature range is a key determinant for species dispersal and is, therefore, of high epidemiological importance: the species have different vectorial capacities and require different control programs., ΔHH and ΔHL, should reflect the sensitivity of each species to temperature changes in temperate, high and low temperature areas respectively, and thus could be highly informative. Many studies focus on vector breeding site characteristics, which the model addresses simply in terms of moisture. As yet no particular variables have been found to be crucial determinants of breeding site selection or success, but when these are determined, the model can implement them relatively easily. The transient patterns of breeding sites are taken into account as key determinants of predator and vector disease dynamics, however.Each parameter in equation 2 is individually related to the slopes of the curves for each stage of insect development , and thAnopheles dispersal, though this is clearly a critical factor. Here simple random dispersal has been used, but it may be possible to implement a more sophisticated dispersal algorithm soon.Nutrient competition is considered one of the major regulators of vector populations. Here the carrying capacity concept is used to allow both intra-and inter-species competition. Very few studies of vector predators and pathogens have been undertaken to date, but some literature suggests that this may also be an important determinant, so it has been incorporated accordingly. Little is known about Anopheles biology is needed: if nothing else, the model provides an organized view of the huge gaps in the existing information. A framework has been developed by exploiting what is available, but, at this point, far too many parameters and mechanisms involve arbitrary values or estimates.Thus, a basic tool has been developed for use by field workers and will be vastly improved by their efforts. First, more complete and precise data on Nonetheless, as an example, a vector population was simulated for a 20-month period, from May 1, 2000 to December 31, 2001, with meteorological data from Kilifi in Kenya and it was possible to roughly assess the sensitivity of vector population dynamics to four of the five basic factors – temperature, moisture, competition, and predation. The focus was on adult abundance curves.Temperature is very important to the adult abundance curve and, particularly, to the occurrence of the initial peak after a drought period; this may be critical for control purposes. Moisture is a key determinant of particular high peaks that occur not only after a drought period but throughout the year for temporary breeding sites. These peaks were attributed to the lower larval mortality proceeding from lower predation and disease pressure.These peaks may be of great epidemiological importance, in that they could bring malaria prevalence in humans above a threshold at which relatively high transmission could occur despite a low vector density. One concern with such large fluctuations is that the proportion of people susceptible may be very high at the beginning of the peak period. Furthermore, the earliest emergent adult mosquitoes may have a higher vectorial capacity; with almost no food competition, their weight is greater, which implies a longer life . With diAnopheles, the resulting de-regulation may backfire, producing a vicious cycle that leads to ever-increasing insecticide use. This further supports the argument that great improvements in our understanding of Anopheles ecology and population dynamics are needed.Preliminary results on species competition suggest the existence of competitive exclusion, i.e. the survival of only one species in a given habitat, which highlights the necessity of niche differentiation for species coexistence. The example also suggests that if insecticides impact populations of predators on The model is based on the data and knowledge currently available, and it can reproduce some broad, diverse patterns found in the field; its mechanisms and rules are explicit, and they allow us to provide detailed analyses and explanations of vector population dynamics. However, it requires considerable, continued application in the field to improve the data and our understanding of the underlying mechanisms. This is exactly the plan for subsequent research, to contribute to improved control of the scourge of malaria.Table 1. A description of the geographical area with the pools and houses.2. Climate information for the period considered.Anopheles vector population dynamics, and highlight crucial elements that are missing.This model made it possible to structure existing knowledge of The data and other information currently available made it possible to build a model that can reproduce diverse patterns found in the field. It incorporates explicit mechanisms and rules that can provide detailed analyses and explanations, and thus is a tool to help the malaria research and intervention community gain a better understanding of vector dynamics.The model should be greatly improved as more precise data and hypotheses become available and as it is applied in the field.• JMD contributed conceptualisation and design of the model, main literature review and authorship of the paper.• CM contributed conceptual and data input, review and comments.• GK, BK, JB and JC contributed conceptual input, review and comments.• JD, PB, HM, JG and AT contributed review and comments.• FEM contributed the initial concept and general supervision.All authors read and approved the manuscript.

Viruses, bacteria, and other pathogens betray their presence in the body through exterior proteins, distinct to each strain. To prepare for the multitude of potential infectious agents, developing B-cells shuffle their genes to produce as many as a billion different antibodies, one to match almost any foreign protein. Upon infection, a limited subset of these antibodies will recognize a particular pathogen and mobilize a larger, targeted immune response. B-cells producing the “recognizing” antibody refine and test genetic modifications, adjusting the antibody's fit to the foreign entity. B-cells compete for the best match, or highest affinity; the winners survive to produce more cells and more antibodies against the invader.B-cells require an enzyme called activation-induced cytidine deaminase (AID) to develop the most effective antibody. AID generates mutations in the highly variable target-recognition region of an antibody. Removing the AID gene prevents antibody refinement in mature human and mouse B-cells—which use a process called somatic hypermutation to alter single nucleotides in the antibody gene—as well as chicken cells that use a different process called gene conversion to produce variation. Unlike the single nucleotide changes caused by hypermutation, gene conversion modifies an antibody by swapping part of its antigen-binding region for a replacement gene segment. Preference for hypermutation versus gene conversion varies across species, and can even vary within a species. B-cells in chickens use gene conversion through adolescence, when the cells move from a hindgut organ called the bursa into the spleen, where hypermutation takes over.It is unclear precisely how AID induces either somatic hypermutation or gene conversion, and how it chooses one over the other. Several recent studies suggest that AID's effectiveness may depend on damage to a single DNA base—specifically, changing a cytidine to uracil, which AID can do in either DNA or RNA.To test whether AID causes hypermutation and gene conversion through a common pathway, Jean-Marie Buerstedde and colleagues at the National Research Center for Environment and Health in Munich, Germany, deleted the donor genes that supply replacement segments for gene conversion in chicken bursa cells. The cells not only stopped performing gene conversion; they revved up single nucleotide mutations in a pattern that looked suspiciously like somatic hypermutation. The mutations targeted hotspots for gene conversion, suggesting that hypermutation and gene conversion share common starting points along antibody genes. This paper adds evidence that AID functions by swapping a single DNA base to induce multiple modes of gene shuffling and refinement in B-cells.

Olfactory receptor (OR) genes constitute the molecular basis for the sense of smell and are encoded by the largest gene family in mammalian genomes. Previous studies suggested that the proportion of pseudogenes in the OR gene family is significantly larger in humans than in other apes and significantly larger in apes than in the mouse. To investigate the process of degeneration of the olfactory repertoire in primates, we estimated the proportion of OR pseudogenes in 19 primate species by surveying randomly chosen subsets of 100 OR genes from each species. We find that apes, Old World monkeys and one New World monkey, the howler monkey, have a significantly higher proportion of OR pseudogenes than do other New World monkeys or the lemur (a prosimian). Strikingly, the howler monkey is also the only New World monkey to possess full trichromatic vision, along with Old World monkeys and apes. Our findings suggest that the deterioration of the olfactory repertoire occurred concomitant with the acquisition of full trichromatic color vision in primates. Examination of olfactory receptor genes in 19 primate species suggests that the olfactory repertoire lost complexity as our ancestors acquired full-color vision Olfactory receptor (OR) genes provide the basis for the sense of smell and, witInterestingly, approximately 60% of human OR genes carry one or more coding region disruptions and are therefore considered pseudogenes . In nonhAlthough the causes are unclear, it seems reasonable to speculate that the high fraction of OR pseudogenes in apes reflects a decreased reliance on the sense of smell in species for whom auditory and visual cues may be more important e.g., . We wereOwing to the high levels of DNA sequence divergence among the primate species in our sample, orthologous OR genes could not be amplified by primers designed based on human sequences . InsteadWe therefore proceeded to sequence 100 genes from 18 nonhuman primates using these primer pairs. Since the genome sequence is not available for these species, we were not able to compare the familial composition of our samples of OR genes to that of the full OR repertoires. However, with the exception of OR families 3, 11, 12, and 55 , we identified OR genes from all families in all species . MoreoveWe then tabulated the proportion of OR pseudogenes in each species . Consistp < 0.02 for the difference between the howler monkey and the NWM with the second highest proportion of pseudogenes, the Wooly monkey, as assessed by a Fisher's exact test [FET]). Thus, it appears that a deterioration of the olfactory repertoire occurred in all apes and OWMs as well as, independently, in the howler monkey lineage.We further found that the proportion of OR pseudogenes in OWMs (29.3% ± 2.4%) is very similar to that of nonhuman apes (33.0% ± 0.8%), but notably higher than that of NWMs (18.4% ± 5.6%). One NWM species, the howler monkey, was a conspicuous exception, with an elevated proportion of OR pseudogenes, similar to that of OWMs and apes (31.0%) and signStrikingly, a second phenotype is shared only by the howler monkey, OWMs, and apes: full (or “routine”) trichromatic color vision. In primates, trichromatic color vision is accomplished by three opsin genes whose products are pigments sensitive to short, medium, or long wavelength ranges of visible light . In OWMsp < 10−4, or, excluding humans from the full trichromatic group, p < 10−3, as assessed by a Mann–Whitney U test). This p value is only indicative since the species lineages are not all independent. However, if significance is instead assessed by a FET for all pairwise comparisons of species with full trichromatic color vision and without, the difference is again striking: 94 out of 96 comparisons are significant at the 5% level. Thus, the evolution of full trichromatic vision coincided with an increase in the fraction of OR pseudogenes, indicative of a deterioration of the sense of smell.While OWMs, apes, and the howler monkey carry 32.5% ± 6.3% OR pseudogenes in their OR gene repertoire, species without full trichromatic vision have 16.7% ± 1.0%, significantly fewer . As a consequence of these biases, estimates of the proportion of pseudogenes in human and mouse obtained with these primers .We first tested an existing set of primers, used by primers differ sWe proceeded by designing new pairs of degenerate primers for the OR gene family by using the program HYDEN . The fir2, 50 mM KCl, 10 mM Tris (pH 8.3), 2 U of Taq DNA polymerase, and 50 ng of genomic DNA. Conditions for the PCR amplification from all species were as follows: 35 cycles of denaturation at 94°C, annealing at a gradient temperature of 48°C to 60°C, and extension at 72°C, each step for 1 min. The first step of denaturation and the last step of extension were 3 min each. The PCR products were separated and visualized in a 1% agarose gel. From each amplification set (a given primer pair in a given species), all successful products were mixed and subjected to cloning using a TA cloning kit . Cloning was followed by a touchdown PCR using the vector primers for amplifications from isolated bacterial colonies. Products were purified using the High Pure PCR Product Purification Kit (Boehringer). Sequencing reactions were performed in both directions on PCR products, using the vector primers and the dye-terminator cycle sequencing kit on an ABI 3700 automated sequencer (Perkin Elmer).Each primer pair was used to amplify a set of eight reactions in each species using a temperature-gradient PCR. The use of several annealing temperatures for each species yielded a greater diversity of amplified OR genes. PCR was performed in a total volume of 25 μl, containing 0.2 μM of each deoxynucleotide , 50 pmol of each primer, 1.5 mM MgClhttp://genome.ucsc.edu/). In every case, the best hit was a human OR gene. This analysis was also used to insure that none of the genes were an artifact of (“jumping”) PCR fusion. Finally, each consensus sequence was searched for an uninterrupted open reading frame (ORF) in all six possible frames. If an uninterrupted ORF was found, the gene was annotated as intact. If no ORF was identified, the gene was annotated as a pseudogene. This approach probably results in an underestimate of the proportion of pseudogenes, as not all OR genes with an intact coding region are functional. Mutations in promoter or control regions of OR genes may lead to reduced or no expression. Similarly, radical missense mutations in highly conserved positions of the OR protein may result in dysfunction , the data were edited and assembled using the Sequencher program, version 4.0 . Assembly of the clones was done using a similarity cutoff of 98%. This cutoff ensures that Taq-generated mutations that may have been sequenced in individual clones are not counted as independent genes. Clones that were collapsed to the same contig by the assembly process were counted as one gene. Once 25 and 75 genes (independent contigs) were identified from PC1 and PC2 primer pairs, respectively, a majority consensus was generated for each gene. In order to confirm that only OR genes were amplified from all the species, we used the consensus sequences of all genes from all species as queries in a BLAT search against the human genome sequence (function . Althoughttp://www.ncbi.nlm.nih.gov/Genbank/) as accession numbers AY448037–AY449380 and AY454789–AY455274.Sequences for all OR genes from all primate species were deposited to GenBank (

While significant strides have been made in health research, the incorporation of research evidence into healthcare decision-making has been marginal. The purpose of this paper is to provide an overview of how the utility of health services research can be improved through the use of theory. Integrating theory into health services research can improve research methodology and encourage stronger collaboration with decision-makers.Recognizing the importance of theory calls for new expectations in the practice of health services research. These include: the formation of interdisciplinary research teams; broadening the training for those who will practice health services research; and supportive organizational conditions that promote collaboration between researchers and decision makers. Further, funding bodies can provide a significant role in guiding and supporting the use of theory in the practice of health services research.Institutions and researchers should incorporate the use of theory if health services research is to fulfill its potential for improving the delivery of health care. While significant strides have been made in medical research over the past several decades, many research results considered important by researchers and expert committees are not being used by health care practitioners. While the value of health services research must be judged by its validity, its utility cannot be taken for granted. There has been an assumption that when research information is available it will be accessed, appraised and then applied . HoweverThe gap between research evidence and its' incorporation into practice has led to an increase in research in how to bring new knowledge to bear on everyday health care. Factors influencing the adoption of research evidence have been studied extensively -5. PersoIn recent years a number of researchers have advocated a greater role for the use of theory in strengthening the practice of research -12. HoweTheory provides a systematic view of a phenomena by specifying the relations among variables and propositions with the purpose to explain or predict phenomena that occurs in the world ,17. In hTheory offers many advantages to the health services researcher. Theory helps to identify the appropriate study question and target group; clarify methods and measurement issues; provide more detailed and informative descriptions on characteristics of the intervention and supportive implementation conditions; uncover unintended effects; assist in analysis and interpretation of results; and, the successful application of an intervention to different settings ,12.Theory-driven studies are addressing the challenge of both decision-makers and funding agencies to move beyond simplistic explanations of significance in health services research. Decision-makers are seeking explanations about how an intervention works and whether it will work in a fashion similar to the intervention that was evaluated when applied to a different environment ,12,20.Despite these potential benefits, there are a number of reasons offered as to why there has been a failure to integrate theory into research. Ironically, clinical randomized control trials have discouraged the use of theory in health services research. Given the genesis of clinical trial methodology, this may derive, in part, from the very origins of epidemiology, whereby John Snow allegedly ended an epidemic of cholera by removing the handle from the Broad Street water pump, even though he had no concept of what actually caused cholera. By ignoring the need for theory, Snow was able to overcome the fact that the theories he would have needed had not yet been elucidated. Similarly, we know that lung cancer incidence can be reduced by elimination of cigarette smoking, even though we do not know exactly how cigarette smoke causes lung cancer. Experimental trials often determine intervention effects without considering how the component features of an intervention work together to bring about study outcomes ,15,21. TAdopting a theory-driven approach in health services research is not without its challenges. Given the typical training of researchers and the uni-disciplinary nature of the practice the first challenge is the capacity of researchers to engage in theory driven research. Second, a theory driven approach requires organizational conditions that support researchers and decision makers collaborating in the development and testing of theory. Finally, theory development and testing is cumulative in nature, encouraging researchers to pursue a programmatic approach in research. This approach has implications on how funding agencies support health services research. Despite the potential challenges, a theory based approach offers promise for a greater understanding on what happens when interventions work to address social/health problems.Collaborative research partnerships between academic researchers and decision-makers describe a relationship and process between individuals from different backgrounds, who together, develop an integrative cooperative approach to resolve a research problem . It has Collaborative practice has also been identified as a key strategy in facilitating a theory driven approach. Weiss recommenViewing program stakeholders as a key source in developing theory in health services research demands stronger collaboration between researchers and program decision makers . In thisThe role and impact of the researcher and the research process in practice settings have received greater attention in other fields such as program evaluation, nursing, anthropology and community psychology. For example, core principles of community psychology practice include: a) consistency of goals and values between the researcher and the setting, and b) the notion that interventions should have the potential for being "institutionalized" or systematically established within the setting in such a way that strengthens the natural resources of the setting -27. RathRecognizing the importance of theory calls for new expectations in the practice of health services research. There are a number of challenges that must be met in order for these perspectives to gain acceptance in the health services research community.Evolving perspectives on the practice of health services research require recognition that few disciplines are able to span the breadth of responsibilities associated with the research process. To date there has been a tendency for health services research to be practiced as a uni-discipline where clinical disciplines tend to practice separately from the social science disciplines. A priority is to encourage the formation of research teams that are inter-disciplinary. Pursuing this agenda will promote the formation of research teams that may include: business, anthropology, sociology, psychology, education, engineering, nursing and medicine. Combined disciplinary skills would, in a complementary fashion, address the breadth of skills required in a more complex research environment that includes the development and testing of theory.A second point concerns broadening the training for those who will practice health services research. By and large, academic training has focused on methodological issues. While a focus on research methods has made an important contribution to the practice of health services research, relying on research methods as a core curriculum has led to limitations in the training of health services researchers such as inadequate attention to the value of theory driven research. As health services research expands its methodological repertoire beyond the classical randomized control trial, researchers face increased ambiguity in attributing the source of intervention impact. It is in this circumstance that theory can guide health services researchers in understanding the causal linkages within an intervention. Further, students are educated in separate departments with little planned, formal activity across disciplines, which discourages co-operative approaches to research and service -35. EducCollaboration between researchers and decision-makers are contingent upon supportive organizational conditions for both partners. Researchers have, and most likely will continue to operate from university-based settings where incentives for promotion and tenure can act as barriers to changes in the practice of health services research ,36. MostFunding bodies have the potential to play a significant role in guiding and integrating these considerations into health services research. Research sponsors can develop evaluation criteria that encourage the application of theory. As an example, the Agency for Healthcare Research and Quality (AHRQ) in the USA funded an initiative (Translating Research into Practice) to identify sustainable and reproducible strategies that will: 1) accelerate the impact of health services research on direct patient care; and 2) improve the outcomes, quality, effectiveness, efficiency, and/or cost effectiveness of care through partnerships between health care organizations and researchers . FurtherThis paper has examined the importance of theory in health services research. We have argued that by strengthening the role of theory encourages collaborative practice between researchers and decision-makers. It has been noted that a theory driven approach in health services research is not without its challenges. However, given the modest advances towards incorporating research evidence into healthcare decisions, a theory driven approach is well worth the effort. The implication of this approach for health services research is that it has impact on the training and practice of health services research. Institutions and researchers should consider this emerging model of practice if health services research is to fulfill its potential for improving the delivery of care.The authors declare that there are no competing interests. Disclaimer: The opinions expressed are the authors' and do not necessarily represent official policy of AHRQ or the Department of Health and Human ServicesKB drafted the manuscript, edited and revised the contents, EO edited and revised the manuscript, KB, EO, MC, RS, DS all contributed to the conceptual development, editing and review of the manuscript.The pre-publication history for this paper can be accessed here:

Bayesian phylogenetic inference holds promise as an alternative to maximum likelihood, particularly for large molecular-sequence data sets. We have investigated the performance of Bayesian inference with empirical and simulated protein-sequence data under conditions of relative branch-length differences and model violation.With empirical protein-sequence data, Bayesian posterior probabilities provide more-generous estimates of subtree reliability than does the nonparametric bootstrap combined with maximum likelihood inference, reaching 100% posterior probability at bootstrap proportions around 80%. With simulated 7-taxon protein-sequence datasets, Bayesian posterior probabilities are somewhat more generous than bootstrap proportions, but do not saturate. Compared with likelihood, Bayesian phylogenetic inference can be as or more robust to relative branch-length differences for datasets of this size, particularly when among-sites rate variation is modeled using a gamma distribution. When the (known) correct model was used to infer trees, Bayesian inference recovered the (known) correct tree in 100% of instances in which one or two branches were up to 20-fold longer than the others. At ratios more extreme than 20-fold, topological accuracy of reconstruction degraded only slowly when only one branch was of relatively greater length, but more rapidly when there were two such branches. Under an incorrect model of sequence change, inaccurate trees were sometimes observed at less extreme branch-length ratios, and (particularly for trees with single long branches) such trees tended to be more inaccurate. The effect of model violation on accuracy of reconstruction for trees with two long branches was more variable, but gamma-corrected Bayesian inference nonetheless yielded more-accurate trees than did either maximum likelihood or uncorrected Bayesian inference across the range of conditions we examined. Assuming an exponential Bayesian prior on branch lengths did not improve, and under certain extreme conditions significantly diminished, performance. The two topology-comparison metrics we employed, edit distance and Robinson-Foulds symmetric distance, yielded different but highly complementary measures of performance.Our results demonstrate that Bayesian inference can be relatively robust against biologically reasonable levels of relative branch-length differences and model violation, and thus may provide a promising alternative to maximum likelihood for inference of phylogenetic trees from protein-sequence data. The inference of phylogenies from molecular sequence data, like most other quantitative problems in science, is most powerful within a model-based statistical framework. Sophisticated models are available to describe how sequences change along branches of a tree, and how the rate of sequence change varies among sites. Statistical measures describe both the quality of inferred trees, and the confidence that can be assigned to the existence and position of subtrees. Likelihood-based approaches have proven especially powerful for inferring phylogenetic trees ,2 but are.g. the relative contributions of vertical and lateral gene transfer to genomic diversity [At the same time, the ongoing success of genomic sequencing – new microbial genome sequences are now appearing at the rate of at least one per week – is yielding a wealth of ever-larger gene and protein datasets suitable for large-scale analysis of deep issues in comparative and evolutionary genomics, iversity ,8. Howeviversity we have i.e. a tree) is associated with its probability of being correct, given the prior probability, model and data [Among the most interesting of these is Bayesian inference, in which the posterior probability of a hypothesis that do not actually exist [Bayesian phylogenetic inference has been applied to simulated -18 as wely exist . Certaina priori reason that protein-sequence data should be more or less problematic than nucleotide data for Bayesian phylogenetics, gene and protein sequences have distinct statistical properties, and are subject to different selective constraints; so it is not inconceivable that, in practice, the corresponding models of sequence change might tend to fail in different ways, or to different extents. Bayesian inference has been applied to inference of phylogenetic trees for cytochrome b [et al. [Much less is known about the behaviour of Bayesian inference with protein-sequence data. While there is no chrome b , elongatchrome b , hydropechrome b , 3-hydrochrome b , membranchrome b , and conchrome b and largchrome b datasets [et al. report aTo better characterize the behavior of Bayesian phylogenetic inference with protein-sequence data, we have applied MrBayes ,32 to boe.g. examining solution space, estimating support, and assessing stability to stochastic error. Only a subset of these broad bodies of theory and practice has so far been applied to phylogenetic inference, and even less implemented in platform-independent software. If we apply BIC to alternative trees and assume equal prior probabilities, it becomes possible to estimate Bayesian posteriors from their likelihood differences, linking the two approaches at this level [In this work we compare and contrast results obtained using two popular software programs, PROML and MrBais level ,38. Stocis level and the is level , can be is level ,18. The is level -43, the is level , and a mis level lie fartEmpirical data under Methods) yielded the same topology. Interestingly, for these, the bootstrap consensus ML trees were topologically identical to the ML and Bayesian trees, indicating that the sequences in these datasets show a high degree of internal consistency across positions (i.e. bear few homoplasies). For another 10 datasets, one or more of these four approaches yielded a tree that differs slightly (edit distance ≤ 2) from the others. No pattern was obvious among these disagreements: the differences do not, for example, systematically separate ML from Bayesian trees. For these 10 datasets, the differences are simple edits, e.g. -(A(BC)) to -(B(AC)), or -((AB)(CD)) to -(A(B(CD))). For the remaining 4 datasets, one or more of the four approaches yielded a tree that differed more substantially (edit distance ≥ 3). Over these examples, the datasets that yield more-conflicted trees are slightly larger than those yielding slightly conflicted or identical trees , although the numbers of datasets involved are too few for this observation to be generalized.We inferred maximum likelihood (ML) and Bayesian (B) trees for the 21 empirical protein-sequence datasets. For 7 of these datasets, every combination of approach and model that we investigated with Bayesian posterior probabilities (PPs) separately for all subtrees among the three groups of trees inferred from these 21 empirical datasets: the 7 trees for which all four sets of approaches and models yielded the same topology, the 10 for which one or more approach yielded a slightly different tree, and the 4 for which one or more tree differed more substantially. In Figure e.g. involving minority subtrees (those not in the extended 50% majority-rule consensus) or higher-order fit curves.From our data, it is not possible to reject the hypothesis that the relationship between BP and PP has the same slope whether the Bayesian inference is conducted using JTT, or EQ, as the model of sequence change. Analysis of covariation (ANCOVA) yields probabilities 0.579 (Panel A), 0.235 (Panel D) and 0.195 (Panel E) that the lines described in Table Because for these trees the true molecular phylogeny is unknown, these results do not speak to the accuracy of the inferred topologies. For this, it is necessary to examine inferences based data simulated on trees of known topology.We first examine cases where tree inference was carried out under the same model (JTT) as that used to generate the data, and where a single branch was progressively extended in length (see Methods). When trees were inferred using gamma-corrected ML, the correct tree was recovered in 100% (50/50) of the cases in which the relative branch-length difference was 5-, 10- or 20-fold . The similarities we observe in both magnitude and trend for the two approaches demonstrate that the comparison we are making between ML and Bayesian inference does not, in these cases at least, depend on whether or not the performance of ML is assessed using an approach that involves the nonparametric bootstrap.We investigated two ways of assessing the performance of ML inference. In panel A of Figures With Bayesian inference, inaccurately reconstructed trees were also first seen at the 30-fold branch-length ratio Figure , panel Di.e. the long branches were topologically adjacent in the reconstructed tree.In Figures i.e. identical with the known topology). By structuring the comparison in this way, we avoid cases where the ML consensus might be topologically different from the best component tree, and avoid dealing with the plethora of cases and sub-cases that arise in comparing topologically non-congruent trees.In Figure i.e. shows little or no "saturation". For both the single- and two-long-branches cases, the PP is greatest, compared to BP, for Bayesian trees inferred without correction for ASRV, and least generous for gamma-corrected trees where the prior distribution was assumed to be uniform. Unsurprisingly, the lower values of subtree support, as measured both by BP and by PP, arise from the trees with the most extreme relative branch length differences.For all three combinations of ASRV correction and prior , but inferring trees under the JTT model (see Methods). Performance of each of the four sets of approaches and methods was assessed by comparing four measures: the branch-length ratio at which inaccurate trees were first observed; the total number of steps (summed over the eight ratios) by which the 400 trees differ from the true topology; the weighted sum ("burden") of these steps; and the mean number of steps by which each inaccurate tree differs from the known tree. The latter two measures were each calculated using both Robinson-Foulds symmetric distance, and edit distance, yielding six comparisons in all. A more-complete description is provided at footnote 2 of Table For datasets in which a single branch was of relatively greater length, violating the model of sequence change degraded performance of the four approaches Table . In eachFor datasets containing two long branches, model violation affected performance of ML and Bayesian inference differently. With ML, inference under the wrong model produced a somewhat lower frequency of topologically inaccurate trees, although each inaccurate tree was more inaccurate as judged by symmetric distance Table . With BaUnlike the situation with established approaches based on pairwise distances, parsimony or maximum likelihood, relatively little experience has accumulated so far on the application of Bayesian approaches to phylogenetic inference, especially for protein-sequence datasets. In this work we (a) extend the comparison of Bayesian posterior probabilities with nonparametric bootstrap proportions as measures of confidence in subtrees, (b) systematically investigate the robustness of ML and Bayesian inference to branch-length differences, and (c) compare the behavior of these two approaches to one specific violation of the model of sequence change. We used two measures to compare topologies , and it is clear that they captured different facets of topological incongruence.Model violation, below). As it is unlikely that any existing model – certainly any that fails to account for lineage-specific processes and temporal variations along these lineages – fully represents the historical complexity of molecular evolution, the same criticism could be levelled, albeit perhaps in lesser degree, against all current applications of statistically based phylogenetic inference to empirical datasets.Using 21 empirical protein-sequence datasets, we compared Bayesian posterior probabilities with bootstrap proportions based on ML as measures of support for subtrees. To make this comparison as fair as possible, we restricted our analysis to a model of sequence change (JTT) and a correction for ASRV (discrete approximation to the gamma distribution) available in both PROML and MrBayes. We did not optimize models separately for each approach or for each dataset, as JTT+gamma represents the most-parameterized combination that these two programs support in common. It is therefore possible that some of the difference observed between the two measures results from differential sensitivity of ML and Bayesian inference, as implemented in these programs, to deviation of JTT and the discrete gamma distribution from an optimal description of the processes of sequence change that actually gave rise to these sequences , with our simulated data the relationship between BP and PP resembles a smooth curve reaching 100% PP only at BP greater than 99%. Further studies will be required to disentangle why little or no saturation was observed; possibilities include the structure of our simulated trees , the way that data were evolved on these trees , and/or the way we summarize the support data for ML (via extended majority-rule consensus trees).For sets of consensus trees inferred from simulated protein-sequence data Figure , Bayesiae.g. in selection of outgroups and resolution of topologically problematic regions. Parsimony analysis is particularly susceptible to "long branch attraction" (LBA) artefacts, in which two or more branches are resolved adjacent in a tree solely because they are highly divergent from the others [Dissimilar sequences (represented in phylogenetic trees as long branches) create difficulties in phylogenetic analysis. The issue has been most extensively explored in parsimony analysis, where branch length can be an important consideration, e others . ML infeOur results Figures , 3, 4, 5Both the mammalian mitochondrial (mtmam) and JTT models embody empirical probabilistic models of amino acid substitution. Codon usage is highly skewed in mitochondrial genomes compared with the cognate nucleocytoplasmic components , and theParticularly in simulations where a single branch was differentially lengthened Table , using tSupport for subtrees) that the relative performance of these approaches as reported herein might, in part, reflect their differential sensitivity to sub-optimality in the models used.The degree of insensitivity to model violation we observe for gamma-corrected ML and Bayesian inference goes some way toward mitigating possible concern from each other. Our results also illustrate the difference in dynamic range offered by these metrics, while simulation studies [e.g. in distinguishing transformations that affect large numbers of termini from those that affect small numbers of termini, in robustness against displacement of particular termini, or in application to very large trees [Our results Figures illustra studies ,55,56 inge trees -59.e.g. 100 or 1000 replicate runs required to estimate bootstrap proportions, ASRV-corrected Bayesian inference must be seen as an important alternative for statistically based phylogenetic analysis of protein-sequence data when computational resources are limiting. It appears that the interpretation of bootstrap proportions and posterior probabilities being developed for nucleotide sequences will apply as well to protein sequences.Bayesian inference can be as robust as ML against relative branch-length differences of 20-fold or greater in inference of correct topologies from protein-sequence data, although details depend on the number of relatively long branches, the presence or absence of an effective correction for ASRV, and (presumably) other factors. One might doubt that sequences so dissimilar as to produce a 20-fold (or more) difference in branch lengths could be believably recognised as homologous, or reliably aligned. Bayesian inference can also be as robust as ML to violation of the model of amino acid transition probability. For empirical protein-sequence data that might reasonably be encountered in biological research, then, both gamma-corrected ML and gamma-corrected Bayesian inference perform well in recovering the correct topology. As Bayesian inference is typically very much faster than even a single ML run, not to mention than Our interest in lateral genetic transfer (LGT) -9 led usSimulated data were evolved using the "evolver" program within PAML version 3.13a ,63. FirsProtein data sets were then generated on each of the 16 trees with differentially lengthened branches, using the "evolver" program in PAML. On each tree we evolved 100 replicate protein datasets under the JTT model of sequence change , with amvs simuated data. Here we present methods for the simulated data; methods specific to the empirical data are given below.All maximum-likelihood (ML) trees were inferred using PROML version 3.6a3 in Felsenstein's PHYLIP package implemenN = 10) each of the 50 replicate datasets, as described in the preceding paragraph.For simulated data, we report results from both (1) single ML inference runs based on each of the 50 replicate protein datasets at each branch-length ratio increment, and (2) bootstrapping among these sampled trees.Bayesian inference (B) was carried out using MRBAYES version 2.01 implemeni.e. did not merely serve to initialize estimation by MRBAYES). In runs where an exponential prior was used, the value of the exponent was estimated from the simulated data, and differed according to sequence-change model: under JTT, 0.10 for datasets with both one and two long branches, and under mtmam, 1.04 for one long branch, and 0.60 for two long branches.For simulated data, we examined three models of different complexities: (1) a uniform prior distribution over branch lengths, and a single rate category; (2) a uniform prior, and an 8-category gamma model of ASRV; and (3) an exponential prior, and an 8-category gamma. The gamma shape parameter was, as above, estimated using Tree-Puzzle, and was fixed the Robinson-Foulds symmetric distance [For trees inferred from the 16 sets of simulated data , topologies were compared against that of the (known) tree on which the data had been evolved. For this we employed two metrics: (1) the minimum number of break-and-reanneal edits required to convert one tree into the other. This metric goes under various names, including distance ; we refedistance as impledistance . The valdistance ) becauseMethods and procedures followed those for simulated data (above), except as described subsequently here.Aligned protein sequence datasets see were obtFor empirical data, we inferred ML trees in two ways: (1) using a user-defined hidden Markov model (HMM) with 8 categories, each set to 12.5% of sites, and with rates in each category estimated using Tree-Puzzle version 5.0 ; and (2)N = 100 for the 21 empirical data sets, N = 10 for the 1600 simulated datasets) with preservation of rate-class information as described in the SEQBOOT documentation. Nonparametric bootstrap proportions (BPs) were computed under extended majority rule consensus using CONSENSE. Both SEQBOOT and CONSENSE are in PHYLIP [ML analyses were bootstrapped were therefore compared amongst themselves, using edit distance as the comparison metric. Topologies of the bootstrap ML consensus trees were compared as well, although as consensus trees they do not necessarily reflect most-likely topologies.The 21 empirical protein-sequence datasets from Dr Nick Goldman, and our simulated datasets with one or two long branches, are available for download at .JCM was responsible for data simulation and analysis. TJH was responsible for high-performance computing, and generated the figures. MAR initiated and supervised the project, and wrote the manuscript.Description of 21 empirical datasets This PDF file contains information on each of the 21 empirical datasets provided by Dr Nick Goldman, including: number of sequences, GenBank ID (gi number) of first sequence in dataset, key words from description line of first sequence, PAUP* parsimony score of dataset, number of internal nodes, and number of zero-length internal edges observed with PROML to have support in three non-overlapping intervals: P < 0.01, P < 0.05 but not P < 0.01, and worse than P < 0.05.Click here for file

Cancer specialists often talk about cancer as an umbrella term for over 200 different diseases, each having unique characteristics. But even these categories are too broad, as the same type of cancer can take very different paths in different people. It's not uncommon, for example, for a tumor to grow aggressively in one patient and stabilize or regress in another, even though their tumors are indistinguishable and are treated in the same way. Researchers have traditionally diagnosed and treated cancer based on microscopic analysis of cell size and shape, a method that's especially difficult for very closely related cancers, such as non-Hodgkin's lymphoma, which has 20 subtypes. As scientists learn more about the molecular alterations in cancer, they're beginning to establish cancer subtypes based on the underlying molecular footprint of a tumor. Four years ago, DNA microarray analysis revealed that the most common subtype of non-Hodgkin's lymphoma is in fact two separate diseases. Though the tumor cells of both cancers appear large and diffusely dispersed in a tissue sample under a microscope, each has a distinct genetic profile, possibly explaining why only 40% of patients with this subtype respond to the standard chemotherapy treatment.Such molecular pathology has led to the discovery of subtypes of several different tumor types and has successfully identified patients with different survival times. But such correlations work best when cancer subtypes based on genetic profiles are already known. If you know that different subtypes exist and which patients belong to which subtype, then you can build a statistical model to diagnose such cancers in future patients. But in most situations, clinicians don't know either of these variables—or even whether such a subtype exists—information that is crucial to developing effective diagnostic and treatment protocols. Statistical methods to identify such subtypes exist, but they can generate classifications that lack clinical relevance. Now Eric Bair and Robert Tibshirani describe a procedure that combines both gene expression data and the patients' clinical history to identify biologically significant cancer subtypes and show that this method is a powerful predictor of patient survival.Their approach uses clinical data to identify a list of genes that correspond to a particular clinical factor—such as survival time, tumor stage, or metastasis—in tandem with statistical analysis to look for additional patterns in the data to identify clinically relevant subsets of genes. In many retrospective studies, patient survival time is known, even though tumor subtypes are not; Bair and Tibshirani used that survival data to guide their analysis of the microarray data. They calculated the correlation of each gene in the microarray data with patient survival to generate a list of “significant” genes and then used these genes to identify tumor subtypes. Creating a list of candidate genes based on clinical data, the authors explain, reduces the chances of including genes unrelated to survival, increasing the probability of identifying gene clusters with clinical and thus predictive significance. Such “indicator gene lists” could identify subgroups of patients with similar gene expression profiles. The lists of subgroups, based on gene expression profiles and clinical outcomes of previous patients, could be used to assign future patients to the appropriate subgroup.An important goal of microarray research is to identify genetic profiles that can predict the risk of tumor metastasis. Being able to distinguish the subtle differences in cancer subtype will help doctors assess a patient's risk profile and to prescribe a course of treatment tailored to that profile. A patient with a particularly aggressive tumor, for example, would be a candidate for aggressive treatment, while a patient whose cancer seems unlikely to metastasize could be spared the debilitating side effects of aggressive anticancer therapies. By providing a method to cull the thousands of genes generated by a microarray to those most likely to have clinical relevance, Bair and Tibshirani have created a powerful tool to identify new cancer subtypes, predict expected patient survival, and, in some cases, help suggest the most appropriate course of treatment.

With the recent progress made in large-scale genome sequencing projects a vast amount of novel data is becoming available. A comparative sequence analysis, exploiting sequence information from various resources, can be used to uncover hidden information, such as genetic variation. Although there are enormous amounts of SNPs for a wide variety of organisms submitted to NCBI dbSNP and annotated in most genome assembly viewers like Ensembl and the UCSC Genome Browser, these platforms do not easily allow for extensive annotation and incorporation of experimental data supporting the polymorphism. However, such information is very important for selecting the most promising and useful candidate polymorphisms for use in experimental setups.in silico mining of high-throughput sequencing data. Currently, the database provides collections of laboratory rat (Rattus norvegicus) and zebrafish (Danio rerio) candidate SNPs. The database stores detailed information about raw data supporting the candidate, extensive annotation and links to external databases , verification information, and predictions of a potential effect for non-synonymous polymorphisms in coding regions. The CASCAD website allows search based on an arbitrary combination of 27 different parameters related to characteristics like candidate SNP quality, genomic localization, and sequence data source or strain. In addition, the database can be queried with any custom nucleotide sequences of interest. The interface is crosslinked to other public databases and tightly coupled with primer design and local genome assembly interfaces in order to facilitate experimental verification of candidates.The CASCAD database is designed for presentation and query of candidate SNPs that are retrieved by allows universal access to the database content and allows various queries supporting many types of research utilizing single nucleotide polymorphisms.The CASCAD database discloses detailed information on rat and zebrafish candidate SNPs, including the raw data underlying its discovery. An advanced web-based search interface Single nucleotide polymorphisms (SNPs) are the most common form of genetic variation within species. As a result, SNPs are now becoming the most popular type of marker in genetic association and mapping studies. SNPs are also most likely to be the molecular basis for the majority of phenotypic variation in (outbred) populations. In particular, SNPs in regulatory and protein-coding regions can have an effect on gene expression levels and protein activity, respectively. The phenotypic differences observed between selected (sub) strains in model organisms may be the result of specific (combinations of) natural occurring polymorphisms. Hence, a comprehensive inventory of SNPs, including extensive annotation will be extremely valuable in the search for functional polymorphisms.in silico candidate SNP mining pipeline that uses all publicly available sequence data for a specific organism, and designed a database, CASCAD (CAscad SNP CAndidates Database), that allows storage of a wide variety of primary source data, cross-annotation to other databases, and analysis parameters for SNPs associated with expressed sequences.There is often a vast unexplored potential in large sequence datasets that have been collected for other purposes, for example, EST and whole genome sequencing (WGS) projects. In an effort to address these two issues, we have developed an We applied the SNP discovery pipeline to both rat and zebrWe designed a web-based interface with Perl scripts communicating to a MySQL database, and displaying HTML pages through Apache server running on SuSE Linux. The interface provides simple, advanced Figure , and seqIn addition to primary sequence data analysis, the effect of all SNPs on protein coding capacity was evaluated and non-synonymous SNPs were categorized in classes reflecting the severity of the polymorphism using a BLOSUM-based score. The predicted missense SNPs were analyzed by SIFT and PolyQuery results are summarized on the SNP details page Figure , listingin silico discovery pipelines [For many applications, it is important to be able to distinguish between SNP candidates by their characteristics, as they may be predictive for verification success rate or carry biologically relevant information. Non-confirmed candidate polymorphisms may represent variants uncommon for a given population, but also sequencing errors , RNA editing events and reverse transcriptase errors (EST reads). In order to minimize the contribution of false positives, one can exclude polymorphisms based on a single read for either allele, as is common for many ipelines . AlthougWe have developed our database to fulfill the needs of any particular SNP application by providing control over every parameter we used in the polymorphism discovery step.Applications of the CASCAD database include queries for potentially deleterious SNPs in a specific genomic region of interest, for example a QTL interval, design of SNP-based mapping panels using either RFLP or any other technology, and identification of informative SNPs for fine-mapping. Custom sequences can be provided to search for known SNPs in any sequence of interest. In addition, the CASCAD pipeline can be uThe main purpose of CASCAD database is to provide flexible access to candidate single nucleotide polymorphisms, which were predicted using a computational approach from publicly available sequence data of the rat and zebrafish. The resulting database is crosslinked to most common public databases and can be queried for SNPs using accession numbers, sequence context, SNP characteristics, but also using parameters specific to the SNP discovery process, allowing stringent or relaxed conditions suitable for different types of applications.. Programs, scripts, MySQL database dumps, and instructions for setting up a species-specific SNP database can be obtained from the authors upon request.The database is freely accessible through the website VG designed and implemented the CASCAD database. EB tested database and interface. EC provided supervision and guidance for the project.

The circulating estrogen concentration elevated gradually along with time after ovariectomy in rats. To explore the source of the increased circulation estrogen, the extragonadal aromatization as well as the synthesis of androgen in the adrenal cortex of the ovariectomized rats was evaluated.Female rats were divided into twelve groups: 1 month after ovariectomy (OVX1M), OVX2M, OVX3M, OVX4M, OVX5M, OVX6M; intact 1 month (INT1M), INT2M, INT3M, INT4M, INT5M, INT6M. The blood concentration of testosterone (T) was measured by radioimmunoassay. The mRNA expressions of P450 aromatase in the liver and subcutaneous abdominal (SA) adipose as well as the adrenal cytochrome P450 17 alpha hydroxylase/lyase (P450c17) were semiquantified by RT-PCR. The P450 aromatase protein expressions in the liver and SA adipose were detected by Western blot.The blood E2 concentrations increased gradually along with time after ovariectomy in the rats. The 58-kDa aromatase protein and mRNA expressions normalized to β-actin in the OVX6M rats' SA adipose tissues showed higher levels than those from corresponding tissues in the INT6M (p < 0.05). And the ratios of aromatase mRNA and protein to β-actin in the OVX6M rats' liver tissues increased significantly compared with those in the OVX1M rats (p < 0.05). The ratio of adrenal P450c17 to beta-actin in the OVX6M increased markedly, and was higher than OVX1M (p < 0.05), though the blood concentration of T decreased significantly in all the ovariectomized rats (p < 0.05).Both the subcutaneous abdominal adipose tissues and the liver tissues contributed to the extragonadal aromatisation to promote the circulating E2 levels in the rats along with time after ovariectomy; the adrenal compensation might also be activated naturally. Ovaries are the primary source of estrogen. In ovariectomized rats, the production of estrogen is shifted from ovary to a number of extragonadal sites ,2. SimpsEstrogen production in extragonadal sites is dependent on an external source of C19 androgenic precursors . Circula2) and T as well as the aromatase expressions in adipose and liver tissues in the ovariectomized rats.We have observed that the release of corticotrophin-releasing hormone (CRH) in the hypothalamic paraventricular nucleus of the ovariectomized rats increased significantly compared with the intact rats . And morFemale Sprague-Dawley rats (180–200 g), with regular 4-day estrus cycles were purchased from Medical Experimental Animals Centre of Fudan University . The animals were housed under laminar flow in an isolated room with controlled temperature and at a 12 /12 (light /dark) schedule. Forty-eight of them underwent ovariectomy with ether anaesthesia, which were then divided randomly into six groups: 1 month after ovariectomy (OVX1M), OVX2M, OVX3M, OVX4M, OVX5M, OVX6M. The corresponding control groups were: intact 1 month (INT1M), INT2M, INT3M, INT4M, INT5M, INT6M. All experimental procedures involving the use of animals were conducted in accordance with NIH Guidelines and were reviewed and approved by the Animal Use and Care Committee for the Fudan University.At the time of sacrifice, the vaginal cytology of each rat was first examined. The tissues of the rats were collected respectively, and those of the intact control animals, during the period of diestrous. All the operations were carried out at 4°C. The liver tissues, subcutaneous abdominal (SA) adipose tissues and the adrenals were excised, and then snap-frozen in liquid nitrogen, and stored at -80°C. The preparation of the microsomal pellet was accordance with the report by Hiroshi . Total tTo compare the level of adrenal cytochrome P450 17α hydroxylase/lyase (P450c17), liver and SA adipose P450arom expressions after different treatments, PCR methologies were adapted to provide a semiquantitative measure of mRNA levels. Primers were synthesized based on published reports . Table 1A 50 μg sample of the microsomal protein was loaded into each lane along with a prestained protein size marker , electrophoresed on a 10% SDS-polyacrylamide gel at 18 V/cm, and electroblotted onto a polyvinylidene difluoride membrane using a wet electroblotter. After blocking in fat-free milk, incubation was conducted with the antiaromatase antibody and β-actin antibody (1:3000) at room temperature in 18°C for 4 h in TBS-T solution . After extensive washing, blots were incubated with AP-labelled goat antirabbit antiserum for 60 min at room temperature in 18°C and developed using NBT/BCIP detection system (Amersham Pharmacia Biotech). The intensities of the bands were evaluated using the Image Master Software , and values were normalized to β-actin immunoreactivity in each sample and expressed as percent of the control. Specificity of the aromatase immuno-staining was determined by preincubation of antiserum for 24 h at 4°C with varying concentrations of aromatase, with the primary antibody omitted to identify non-specific staining as well.At the time of sacrifice, the blood samples (0.8 ml) of the rats were collected from tail veins respectively, and the corresponding intact controlling animals, during the period of diestrous. The plasma was separated by centrifugation and stored at -70°C until assayed. Concentration of blood hormones were determined by double-antibody RIA kits purchased from the National Atomic Energy Research Institute . The samples were assayed in duplicate, and all the subjects' samples were assayed together. The sensitivity of the kit was 0.8 pg/ml (testosterone) and 1.4 pg/ml (estrogen), the intra- and interassay coefficients of variation, 3.7–8.0% and 4.74–7.7%.All data are presented as means ± S.E.M. Statistical analysis was performed on raw data using two-way analysis of variance (ANOVA), with the significance set at p < 0.05 and p < 0.01 in two-tailed testing chosen.The epithelial cells were stained by haematoxylin-eosin (HE). The intact rats showed regular 4-day estrus cycle change. The cyclic change disappeared in the ovariectomized rats. A few of mature vaginal epithelia were observed in the smears of the OVX5M and OVX6M rats, and the percent of mature epithelia increased significantly in the OVX6M rats (p < 0.05) compared with those in the INT1M, 2M and 3M. The concentrations in OVX4M, 5M and 6M groups increased significantly (p < 0.05) compared with OVX1M, though still lower than INT4M, 5M and 6M. There were no disparities between the INT1M, 2M, 3M, 4M, 5M and 6M groups . Densitometric analysis of the mRNA concentration using target product/β-actin was expressed as the mean with SEM. The ratios of liver P450arom to β-actin in the OVX1M, 2M, 3M, 4M and 5M groups were lower than the corresponding intact controls (p < 0.05). The ratio increased significantly in the OVX6M compared with OVX1M (p < 0.05), and no difference was detected between OVX6M and INT6M . But the ratio increased significantly in the OVX6M compared with OVX1M (p < 0.05) . Its actThough it has been reported that the splanchnic tissue is a minor site for extragonadal aromatization of androgens , there i2 levels in the rats along with time after ovariectomy; the adrenal compensation might also be activated naturally.Both the subcutaneous abdominal adipose tissues and the liver tissues contributed to the extragonadal aromatization to promote the circulating EHong Zhao and Zhanzhuang Tian designed the study, performed the studies and the statistical analysis, and drafted the manuscript. Junwei Hao performed the animal experiment. Boying Chen conceived of the study, and participated in its design and coordination. All authors read and approved the final manuscript.

Tuberculosis remains a major world-wide health threat which demands the discovery and characterisation of new drug targets in order to develop future antimycobacterials. The regeneration of methionine consumed during polyamine biosynthesis is an important pathway present in many microorganisms. The final step of this pathway, the conversion of ketomethiobutyrate to methionine, can be performed by aspartate, tyrosine, or branched-chain amino acid aminotransferases depending on the particular species examined.Mycobacterium tuberculosis H37Rv has been cloned, expressed, and characterised. The enzyme was found to be a member of the aminotransferase IIIa subfamily, and closely related to the corresponding aminotransferase in Bacillus subtilis, but not to that found in B. anthracis or B. cereus. The amino donor preference for the formation of methionine from ketomethiobutyrate was for isoleucine, leucine, valine, glutamate, and phenylalanine. The enzyme catalysed branched-chain amino acid and ketomethiobutyrate transamination with a Km of 1.77 – 7.44 mM and a Vmax of 2.17 – 5.70 μmol/min/mg protein, and transamination of ketoglutarate with a Km of 5.79 – 6.95 mM and a Vmax of 11.82 – 14.35 μmol/min/mg protein. Aminooxy compounds were examined as potential enzyme inhibitors, with O-benzylhydroxylamine, O-t-butylhydroxylamine, carboxymethoxylamine, and O-allylhydroxylamine yielding mixed-type inhibition with Ki values of 8.20 – 21.61 μM. These same compounds were examined as antimycobacterial agents against M. tuberculosis and a lower biohazard M. marinum model system, and were found to completely prevent cell growth. O-Allylhydroxylamine was the most effective growth inhibitor with an MIC of 78 μM against M. marinum and one of 156 μM against M. tuberculosis.The gene encoding for branched-chain amino acid aminotransferase in M. tuberculosis. This enzyme can be inhibited by selected aminooxy compounds, which also have effectiveness in preventing cell growth in culture. These compounds represent a starting point for the synthesis of branched-chain aminotransferase inhibitors with higher activity and lower toxicity.Methionine formation from ketomethiobutyrate is catalysed by a branched-chain amino acid aminotransferase in Tuberculosis remains one of the leading causes of worldwide mortality and morbidity, infecting an estimated 8 million people annually with approximately 2 million deaths . The sitKlebsiella pneumoniae [Bacillus subtilis [Mycobacterium spp., only methionine adenosyltransferase has been cloned, expressed, and fully characterised [Polyamine synthesis and its associated methionine (Met) regeneration pathway Figure are knoweumoniae -11 and tsubtilis -14 Selecsubtilis ,15-20. Fcterised .K. pneumoniae, B. subtilis, and B. anthracis [Plasmodium falciparum, Trypanosoma brucei brucei, Giardia intestinalis, and Crithidia fasciculata, this reaction is catalysed by the subfamily Ia enzyme aspartate aminotransferase [K. pneumoniae, however, the reaction was performed by the close homologue tyrosine aminotransferase, which is also a member of subfamily Ia [B. subtilis, B. cereus, and B. anthracis were recently found to catalyse Met regeneration via a branched-chain amino acid aminotransferase (BCAT) [B. subtilis and B. cereus/B. anthracis utilised BCAT enzymes from separate subfamilies (IIIa vs. IIIb respectively). As Mycobacterium spp. also appear to have no subfamily Ia aminotransferase sequences by an aminotransferase. The specific aminotransferase responsible for the reaction has been identified and characterised in a number of microorganisms, including malaria, African trypanosomes, nthracis ,16,17. Ie (BCAT) . IntriguM. tuberculosis H37Rv was found to contain a single gene with a very high sequence homology to either B. subtilis YbgE or YwaA, which are both known to be subfamily IIIa BCATs [B. subtilis YheM, B. cereus BCAT, or B. anthracis BCAT, which are all subfamily IIIb aminotransferases [M. tuberculosis BCAT gene, Rv2210c, has not been previously cloned, expressed, or characterised. It is interesting to note that the M. tuberculosis genome contains a single BCAT homologue and no obvious DAAT homologue.The complete, published genome of Ia BCATs ,23. In csferases . This reMycobacterium spp. uncovered a single gene in M. leprae, M. bovis, M. marinum, M. ulcerans, M. avium, and M. smegmatis with an extremely high identity to Rv2110c. Together, with other subfamily IIIa aminotransferases, the putative mycobacterial sequences were aligned and a cladogram constructed is the PLP binding site and would be expected to be invariant. If one excludes the only DAAT in Figure E. coli BCAT. Clearly, sequence conservation is very low across family III.The low level of sequence conservation outside of the genus can be seen in the alignment of selected BCAT sequences shown in Figure oli BCAT , only K2M. tuberculosis BCAT was cloned as a deca-histidine fusion protein for expression in E. coli. To prevent complete inclusion of the recombinant protein, it was necessary to induce expression with a relatively low concentration of IPTG (0.1 mM) at 20°C for 20 hr. Under these conditions, sufficient soluble material was produced and purified over Ni2+ affinity columns and the human mitochondrial BCAT [M. tuberculosis BCAT. However, while the human mitochondrial BCAT is also a family IIIa aminotransferase, there are some clear differences when compared to the M. tuberculosis enzyme. The human enzyme will not accept aromatic amino acids, whereas the tuberculosis BCAT would use phenylalanine as an amino donor. In addition, the human enzyme contains the redox-active motif CXXC at positions 311–314 with a high similarity to the B. subtilis ykrV gene product. YkrV was found to be a subfamily If aminotransferase and could also catalyse the conversion of KMTB to Met using glutamine as the only effective amino donor [B. subtilis YkrV could transaminate KMTB with glutamine, B. subtilis cell homogenates did not produce Met from KMTB when supplemented with glutamine [M. smegmatis grown in Middlebrook 7H9 incomplete medium were only able to produce Met from KMTB when supplemented with valine, isoleucine, leucine, glutamate, or phenylalanine, as was seen for the recombinant M. tuberculosis BCAT in figure Several interesting findings arose during the course of this investigation. First, while no donor . Therefolutamine . Similarence Rv088c with aM. tuberculosis was found to contain no putative gene product with significant homology to a DAAT. In fact, the organism appeared to contain no subfamily IIIb aminotransferases. The physiological significance of a lack of a DAAT is unclear, but many organisms do not contain a homologue of this enzyme. With DAAT, there might be a diminished capacity to catabolise D-amino acids for energy, although the same reactions could be performed by a D-amino acid oxidase. M. tuberculosis is known to be reliant on carbohydrate catabolism during the active growth phase and lipid metabolism during the chronic, dormant phase [nt phase . TherefoM. tuberculosis was found to lack clearly identifiable homologues of several enzymes in the Met regeneration pathway. The most glaring omission is the lack of an S-adenosylmethionine decarboxylase (SAMdc) homologue were cultured in liquid Middlebrook 7H9 complete medium or on Middlebrook 7H10 plates at 37°C for M. tuberculosis or 30°C for M. marinum. All substrates and inhibitors were obtained from Sigma-Aldrich .M. tuberculosis by vortexing packed cells in a minimal volume of 50 mM Tris-HCl pH 8.0/10 mM EDTA/100 mM NaCl containing 500 μm acid washed glass beads (Sigma). After allowing the glass beads to settle, the supernatant was added to an equal volume of 10 mM Tris-HCl pH 8.0/100 mM NaCl/25 mM EDTA/0.5% w/v sodium dodecyl sulfate/0.1 mg/ml proteinase K and incubated for 1 hr at 37°C with occasional gentle mixing. The mixture was then subjected to extraction with phenol:chloroform:isoamyl alcohol (25:24:1), and the DNA ethanol precipitated.Genomic DNA was isolated from M. tuberculosis BCAT gene was discovered by a BLAST search of the complete M. tuberculosis H37Rv genome using the B. subtilis YbgE, YwaA, or YheM gene products as the query proteins [Escherichia coli XL10 cells and was subsequently recovered using the Qiaspin miniprep kit (Qiagen). Positive clones were determined by digesting the plasmid with NotI and XhoI to confirm the presence of the insert on a 1% agarose gel. The sequence of the insert was confirmed by using the Big-Dye cycle sequencing kit and an ABI Prism 310 genetic analyser.The sequence of the putative proteins ,23,43. TE. coli BL21(DE3) CodonPlus RIL cells (Stratagene) for functional expression. Cells were grown in liquid LB medium containing 50 μg/ml ampicillin and 50 μg/ml chloramphenicol at 37°C and 250 rpm until the culture reached an A600 nm of 0.6–0.8. The culture was then cooled to 20°C for 30 min at 250 rpm before the addition of 0.1 mM isopropylthiogalactopyranoside (IPTG) and an additional 20 hr of incubation at 20°C and 250 rpm.The plasmid from positive clones was transformed into 4. The column was washed with 50 mM HEPES (pH 7.4)/750 mM NaCl and 50 mM HEPES (pH 7.4)/750 mM NaCl/80 mM imidazole, before elution with 50 mM HEPES (pH 7.4)/750 mM NaCl/800 mM imidazole. Fractions containing the recombinant protein were pooled and concentrated to less than 3.0 ml using a 30 kDa molecular mass cut-off filter . The concentrated enzyme was then dialysed against 50 mM HEPES (pH 7.4)/1 mM dithiothreitol/1 mM EDTA/trace pyridoxal-5-phosphate (PLP) overnight at 4°C. The concentrated enzymes were stored at 4°C for several days, or with 20% v/v glycerol at -20°C for several weeks, without appreciable loss of activity. Recombinant protein samples were examined by electrophoresis on 10% SDS polyacrylamide gels followed by Coomassie Brilliant Blue R250 staining. Protein concentration was measured using the Bio-Rad reagent .The culture was centrifuged at 3500 × g for 20 min at 4°C, and the cell pellet resuspended in 50 mM HEPES (pH 7.4)/750 mM NaCl and frozen at -20°C. The resuspended cells were then thawed, sonicated on ice, centrifuged at 3000 × g for 20 min at 4°C, and the supernatant loaded onto a 1.6 × 9.5 Chelating-Sepharose-FF column charged with NiSO4 (pH 7.4)/50 μM PLP/various concentrations of amino acid/various concentrations of keto acid) and incubated for 30 min at 37°C. The samples were then stored at -20°C until analysis by HPLC. All samples were analysed by pre-column derivatisation and reverse-phase HPLC. 10 μl of sample was mixed with 50 μl of 400 mM borate pH 10.5 and then with 10 μl of 10 mg/ml o-phthalaldehyde/12 μl/ml mercaptopropionate/400 mM borate pH 10.5 prior to the injection of 7.0 μl onto a 2.1 × 200 mm ODS-AA column . The column was eluted using 2.72 mg/ml sodium acetate pH 7.2/0.018% v/v triethylamine/0.3% v/v tetrahydrofuran as Buffer A and 2.72 mg/ml sodium acetate pH 7.2/40% v/v methanol/40% v/v acetonitrile as Buffer B with a linear gradient of 0 – 17% B over 16 min followed by a linear gradient of 17–100% B over 1 min and 6.0 min at 100% B. The flow rate was 0.45 ml/min from 0 – 16 min and 0.80 ml/min from 17–30 min. The elution of derivatised amino acids was monitored at 338 nm and fluorometrically with an excitation of 338 nm and an emission of 450 nm. All separations were performed on an Agilent 1100 HPLC equipped with an autosampler, variable wavelength ultraviolet/visible spectrophotometric detector, fluorescence detector, and Chemstation operating system.Aminotransferase activities were assayed by an HPLC method . 5 or 10The amino donor range for Met regeneration was determined by incubating 2 mM of each individual amino acid and 1 mM KMTB, followed by HPLC for Met quantification. Amino acids which were effective amino donors were further studied at 0.1 – 10 mM amino acid and 10 mM KMTB to determine the kinetic constants. Similar assays were performed with 0.1 – 10 mM KMTB and 10 mM Leu. Replacement of KMTB with ketoglutarate (KG) in these experiments and subsequent HPLC analysis of Glu formation allowed for the determination of BCAT activity. The apparent Km and Vmax values for each substrate were assessed by non-linear curve fitting using the Scientist software programmed with the Michaelis-Menton equation .M. tuberculosis BCAT using 2.0 mM Leu/1.0 mM KMTB/0.1 or 1.0 mM inhibitor in the enzyme incubation. Inhibitors which demonstrated better than 50% reduction of activity at the 0.1 mM concentration were further studied for the determination of Ki values. These reactions involved 0.5, 1.0, 2.0, or 3.0 mM Leu and 1.0 mM KMTB in the reaction mixture together with 0, 25, 50, 75, 100, 150, 200 μM of inhibitor. The Ki values were determined by non-linear curve fitting with the Scientist software programmed with competitive, uncompetitive, and mixed inhibition equations [Initial inhibition studies screened 13 aminooxy compounds against M. tuberculosis and M. marinum using the most effective enzyme inhibitors. Cultures at mid-log growth in Middlebrook 7H9 complete medium was diluted to 2 × 105 cfu/ml and 100 μl added to 96 well microtitre plates containing 100 μl of doubling dilutions of each inhibitor. The final inhibitor concentration ranged from 10 mM – 298 pM. Positive and negative controls consisted of 100 μl Middlebrook 7H9 medium replacing the inhibitor or cells respectively. The plates were incubated at 30°C for 8 days (M. marinum) or 37°C for 14 days (M. tuberculosis) with no agitation before measurement of growth at A650 nm using a Molecular Devices 96-well spectrophotometer . The MIC was determined as the lowest dilution that completely prevented microbial growth and the IC50 was determined by non-linear curve fitting with the Scientist software programmed with the Chou equation [In vitro growth inhibition studies were performed on equation .[Mycobacterium spp. BCAT sequences from preliminary genome projects were made available from The Institute for Genomic Research for M. smegmatis and M. avium, from The Sanger Centre for M. marinum, and from The Institut Pasteur for M. ulcerans. These sequences were aligned using the Clustal algorithm and the BLOSUM sequence substitution table in the ClustalX program [Additional BCAT and DAAT sequences were obtained from GenBank . Mycobac program . Aligned program and were program to const program . All tre program .M. marinum experiments. BJB conceived the study, performed the M. tuberculosis experiments, and wrote the manuscript.ESV performed the cloning, expression, and characterisation of the enzyme, and assisted in writing the manuscript. CLR assisted in the cloning and expression experiments. MHK performed the

As the presumed “seat of consciousness,” the cerebral cortex mediates the higher-level cognitive processing—such as abstract thought—that humans like to think distinguishes them from other animals. The cerebral cortex is, in fact, significantly larger in the human brain and has far more “columns” than it does in other mammals, particularly compared to the rat, a traditional model for brain study. Neurons in these cortical columns have similar response properties and form fundamental units of brain processing. It is the larger brain surface area, accommodating a greater number of cortical columns, that gives humans the computational edge.By studying the genetic and molecular agents of cortex development, scientists hope to understand the nature and extent of cortical cognitive function and identify effective therapies to repair brain injury and disease. Analyses of mutant mice have provided insights into the mechanisms controlling cerebral cortex development, but many details of cortical development remain to be revealed. Identifying individual molecules and genes involved in discrete brain processes is particularly difficult given the complexity of brain structure and function. Geneticists have traditionally linked genes to specific biological pathways by first screening large numbers of individuals of a species for unusual physical traits (phenotypes) and then determining the genetic makeup of these mutants to home in on the faulty gene. This approach, called forward genetics, typically requires large numbers of individuals to find unusual phenotypes and so has traditionally focused on fast-breeding organisms like zebrafish and fruitflies. But zebrafish and fruitflies are unlikely to reveal the secrets of higher consciousness.Now Andrew Peterson and colleagues have updated the forward genetic screen and added a new resource to the neuroscientist's “brain dissection” toolkit. Their approach, which labels specific populations of neurons with protein “reporters,” offers a novel way to find mutations in developing neurons and to identify mutations that interfere with cerebral cortex development. The reporter used here highlights mutations that disrupt interneuron migration into the cortex as well as those that affect cortex growth and morphology. Like most forward genetic approaches, the researchers started with a genetically well-characterized breed, then used a chemical mutagen to damage the organism's DNA. After two or three rounds of breeding, the researchers looked for cortical-related defects in the developing embryos. In this case, however, the region of the mouse brain that gives rise to developing interneurons was labeled in the original mice. Thus, when the researchers screened for mutants with defects associated with forebrain development and interneuron migration, they could easily find the cells and genes involved.The screen identified thirteen mutations affecting cortical development and interneuron migration. Three mutations are variants of genes known to play a role in cortical development; nine mutations were in genes that had not been linked to cortical development before.The screen described here takes advantage of a chemical mutagen that induces mutations at a single base pair, or nucleotide, in DNA. These mutations tend to have quite selective effects on protein function—by changing the composition of a single domain—which can provide information on how the protein should normally function and highlight its role in a particular process. The selective nature of ENU, the authors argue, offers new information about how the mutated genes identified here function in cortical development and how these putative roles might be tested.Altogether, the results suggest that this type of focused screening, so long a resource in fly genetics, can be a powerful tool in mammalian biology as well. That the strategy outlined here could identify novel mutations in a process as complicated as cerebral cortex development suggests that it could do the same for a broad range of biological processes. If the success of other model systems moving in this direction is any indication, this new strategy in the mouse offers researchers a powerful resource for identifying the genetic underpinnings of living systems.

Behavior results from the integration of ongoing sensory signals and contextual information in various forms, such as past experience, expectations, current goals, etc. Thus, the response to a specific stimulus, say the ringing of a doorbell, varies depending on whether you are at home or in someone else's house. What is the neural basis of this flexibility? What mechanism is capable of selecting, in a context-dependent way an adequate response to a given stimulus? One possibility is based on a nonlinear neural representation in which context information regulates the gain of stimulus-evoked responses. Here I explore the properties of this mechanism.By means of three hypothetical visuomotor tasks, I study a class of neural network models in which any one of several possible stimulus-response maps or rules can be selected according to context. The underlying mechanism based on gain modulation has three key features: (1) modulating the sensory responses is equivalent to switching on or off different subpopulations of neurons, (2) context does not need to be represented continuously, although this is advantageous for generalization, and (3) context-dependent selection is independent of the discriminability of the stimuli. In all cases, the contextual cues can quickly turn on or off a sensory-motor map, effectively changing the functional connectivity between inputs and outputs in the networks.The modulation of sensory-triggered activity by proprioceptive signals such as eye or head position is regarded as a general mechanism for performing coordinate transformations in vision. The present results generalize this mechanism to situations where the modulatory quantity and the input-output relationships that it selects are arbitrary. The model predicts that sensory responses that are nonlinearly modulated by arbitrary context signals should be found in behavioral situations that involve choosing or switching between multiple sensory-motor maps. Because any relevant circumstancial information can be part of the context, this mechanism may partly explain the complex and rich behavioral repertoire of higher organisms. The concept of a direct, one-to-one association between a sensory stimulus and a motor response has been strongly influential in neuroscience . Such asGain control is a common mechanism by which neurons integrate information from multiple modalities or sources ,9. Gain-Interestingly, all of these examples deal with the same problem – spatial localization – but the computations that can be effectively carried out through gain-modulated responses are much more general ,16,26. IUsing theoretical and computer-simulation methods, I show that this type of functional switching can be achieved through contextual modulation regardless of how the context is encoded – whether continuously or discontinuously – and independently of the discriminability of the stimuli. The results are presented using neural network models of hypothetical behavioral tasks similar to those used in experiments with awake monkeys. A report with a different example was published previously .All model networks discussed below have the same general, two-layer architecture -16. A fix along the horizontal and the subject responds by making an eye movement may serve to indicate which condition applies in each trial + + B,     (16)x]+ = max{0, x}. The second one uses a sigmoid function,where [as and bs. The third nonlinear interaction is based on a power law,The sigmoid is widely used in artificial neural networks and has and has two parameters too. This type of expression approximates some of the gain effects observed experimentally . The frex and y, (2) generating all GM responses (Equation 1), (3) calculating the driven, output responses (Equation 2), and (4) determining the encoded movement Mout by using the center of mass of the motor activity profile (Equation 19). Finally, the encoded movement is compared to the movement Mdesired that should have been performed given x and y – their difference is the error in that particular trial.Having specified a task, the tuning and gain curves of the GM neurons, and the network connections, the model is tested in a series of trials of the task. Each trial consists of the following steps: (1) specifying the stimulus and context, Mout is equated with the center of mass of the output population,The encoded movement ci is the preferred target location of output unit i. The root-mean-square average of the motor error is used to quantify performance over multiple trials,where Mout - Mdesired> ≈ 0. Thus, σCM is the standard deviation of the motor error, and measures the accuracy of the output population as a whole.where only go trials are included in the calculation. On average, the encoded movement is very near the desired one, <ci uniformly spaced between -25 and 25. Preferred stimulus values aj and preferred context values bj are first distributed uniformly and then jittered by small, random amounts.In all tasks, 25 output units are used, with All simulations were performed using Matlab . The source code is available on request.This section shows that, with a finite number of contexts, gain modulation is functionally equivalent to a switch. More precisely, for a discrete number of contexts and everything else being equal, a network of partially modulated neurons can generate the same mean downstream responses as a network of switching neurons.M populations or groups of sensory neurons with identical sets of tuning functions fj(x). There are N neurons in each population, so index j runs from 1 to N. These populations project to a postsynaptic neuron through synaptic connections , where the superscript indicates the presynaptic population of origin. Thus, is the synaptic weight from neuron j in group p to the postsynaptic unit. The sensory neurons are gain modulated, so the mean response of unit j in population p is given byConsider x and y label the stimulus and the context, as before. Next, assume that there are M possible contexts, so y can take integer values from 1 to M. Therefore, the gain factors can be expressed as three-dimensional arrays, and the presynaptic firing rates can be rewritten aswhere corresponds to the gain of unit j in population p during context k. With this notation, the response of the downstream neuron during context k becomesHere, j, the coefficient in front of the tuning function is given by the product of an M-dimensional vector of weights times an M × M matrix of gain factors.where the sums are over all populations and all units in each population. Note that, for each index The essential idea is to compare the response of the postsynaptic unit under two conditions: when only one input population is active in any particular context , and when the populations are only partially suppressed, with different combinations of gain factors for each context. For this, the hat symbol ^ is used to label all quantities obtained in the former case, with switching neurons; that is, the hat means 'obtained with full modulation'.j is equal to the identity matrix,Full modulation occurs when the matrix of gain factors for all the units with index y = 1 and is 0 otherwise; for population 2, the gain is 1 when y = 2 and is 0 otherwise, and so forth. Substituting this expression in equation 23 gives the firing rate of the downstream unit when driven by switching neurons,According to this expression, for population 1, the gain is 1 when implements a different function of x for each context value, such that the function expressed in context 1 depends only on the weights from the first population of switching neurons, , the function expressed in context 2 depends only on the weights from the second population, , and so on. This is the situation depicted in Figs. Again, the hat simply indicates that the quantity was obtained with maximally modulated input neurons. In this case, R, equal to the response obtained with full modulation, ? Compare the right hand sides of Equations 23 and 25; for them to be the same, the coefficients in front of the tuning functions must be equal; that is,On the other hand, the postsynaptic response driven by partially modulated units is simply as in Equation 23, where the absence of a hat means 'obtained with partial modulation'. Under what conditions is the output response driven by partially modulated neurons, This condition is satisfied if the weights with partial modulation are set equal tohj is the inverse of the matrix of gain factors gj; that is, . Therefore, the key constraint here is that the gain factors in the partial modulation case must have linearly independent values across contexts, so that the inverses exist; in other words, the matrices gj must have full rank. An important consequence of this is that for M > 2, the gain of each neuron as a function of context ( in Equation 21) must be nonlinear.where fj(x)). For the recipe to apply, the gain factors in the latter must have the appropriate inverses, but otherwise they are arbitrary. Because each possible function that a network can generate corresponds to a different matrix of synaptic connections, this implies that all the possible functions of x that the output can implement with fully switching neurons can be replicated with partial gain modulation.Equation 27 is the key result. It provides a recipe for going from a network of switching neurons to a network of partially modulated neurons . These determine the possible functions of x that can be generated downstream – that is, the available sensory-motor maps – but have no effect on how these are switched or selected. Finally, the result is also valid if the postsynaptic response is equal, not simply to the weighted sum of GM responses, but to an arbitrary function of that sum.This statement is exact when there is no noise; with noise it applies to the average downstream responses. Notice that this result is independent of the tuning functions To illustrate the result in Appendix A, consider a simple case with two populations and two contexts, as in Figs. in context 1, andM = 2. Context turns one sensory population on and another off. Now, how can we obtain the same downstream responses, as functions of x, when the GM neurons are partially modulated? First, suppose that the modulation matrices arein context 2. This is simply Equation 25 for γ ≥ 0 for the non-preferred one; the full-modulation case is recovered when γ = 0. For simplicity, these factors are the same for all units in each population, so there is no variation across index j. This matrix was used in Fig. γ = 0 and γ = 0.5 for the left and middle columns, respectively, and in Figs. The gain factors can only take two values, 1 for the preferred context, and 1 >Next, substitute into the transformation rule found earlier, Equation 27; the result isp = 1, 2 and the gain factors in Equation 30) become identical to the rates driven by the switching neurons . This is the linear transformation used in Figs. With these synaptic weights, the downstream responses driven by the partially modulated neurons , but now it has a variance, which is equal towhere .Here, the angle brackets indicate an average over trials, which affects the noise terms only. To go from the second to the third line above, the key is to assume that the fluctuations are independent across neurons, such that γ. The variance of the postsynaptic response driven by switching neurons is exactly as in Equation 35, but with and p = 1,2. This must be compared to the variance obtained with partial modulation for the same mean postsynaptic responses. The synaptic weights that achieve this are given by Equations 32 and 33; substituting those into Equation 35 givesThe next step is to compare the variance of the postsynaptic unit when driven by the switching neurons and by the regular, partially modulated GM neurons. For simplicity, consider the same 2 × 2 case as in Appendix B, where the modulation is parameterized by obtained when the response is driven by fully modulated, switching neurons. Here, a depends on the weights , but is not a function of γ,This is the variance of the postsynaptic response driven by an array of partially modulated GM neurons as a function of the variance b is a constant. Note that a is a measure of the overlap between the sets of connections from the two populations. The dependence of on the weights is such that a ≤ 2.where x and y for all γ, its variability changes with γ. A similar result is obtained when the variance of the input firing rates is proportional to their mean. In that case,Equation 36 shows that, although the average postsynaptic response is the same function of = 1. A calculation analogous to the one just described leads towith a is the same as in Equation 37, except with a different proportionality constant. In this case, it is still true that a ≤ 2. This expression was used to generate the continuous lines in Fig. was simply the variance in the postsynaptic firing rate found from the simulations with γ = 0, and b was chosen to generate the best fit to the rest of the simulation data points.where γ. This depends on a, which is a measure of the similarity between the sensory-motor maps established in the two contexts. For instance, when the two maps are the same, for all j, and a attains its maximum value, 2. In that case, the variance with partially modulated neurons is always smaller than with switching neurons. This makes sense: if the maps in the two contexts are the same, it is always better to have the two populations active at the same time, as this reduces the noise. According to the analysis, when a = 2 and γ = 1, Equation 36 gives . The variance is divided by 2 because noise is additive and there are two active populations doing the very same thing. In contrast, when the two maps are different, their respective synaptic weights are also different, and a is either positive but much smaller than 2, or negative. Then, might have a minimum for some intermediate value of γ, or may increase monotonically, which is what happens in Figs. Equations 36 and 39 do not always increase monotonically with GM, gain-modulated.

There is evidence of a contribution of early life socioeconomic exposures to the risk of chronic diseases in adulthood. However, extant studies investigating the impact of the neighborhood social environment on health tend to characterize only the current social environment. This in part may be due to complexities involved in obtaining and geocoding historical addresses. The Life Course Socioeconomic Status, Social Context, and Cardiovascular Disease Study collected information on childhood (1930–1950) and early adulthood (1960–1980) place of residence from 12,681 black and white middle-aged and older men and women from four U.S. communities to link participants with census-based socioeconomic indicators over the life course.Most (99%) participants were linked to 1930–50 county level socioeconomic census data corresponding to childhood place of residence. Linkage did not vary by race, gender, birth cohort, or level of educational attainment. A commercial geocoding vendor processed participants' self-reported street addresses for ages 30, 40, and 50. For 1970 and 1980 censuses, spatial coordinates were overlaid onto shape files containing census tract boundaries; for 1960 no shape files existed and comparability files were used. Several methods were tested for accuracy and to increase linkage. Successful linkage to historical census tracts varied by census . This compares to linkage rates of 94% for current addresses provided by participants over the course of the ARIC examinations.There are complexities and limitations in characterizing the past social context. However, our results suggest that it is feasible to characterize the earlier social environment with known levels of measurement error and that such an approach should be considered in future studies. Notwithstanding concerns about the accuracy in the assignment of statistical tabulation areas by commercial geocoders modify the association of individual-level SES exposures and CVD. Trained interviewers administered a telephone questionnaire including 44 questions about parental and early adulthood occupational and educational exposures, current sociodemographic characteristics and childhood and earlier adulthood places of residence. Participants responding to the questionnaire (N = 12681), represent 81% of the ARIC baseline cohort and approximately 94% of cohort survivors. Additional details about the LC-SES Study can be found in the manual of procedures and otheParticipants were asked "Where did you mostly live when you were a child? If possible, give me the city/town, county, and state of residence." Participants were also asked to provide their address at various points during adulthood. Everyone was asked to provide addresses for age 30 , and those who had first participated in the ARIC study after age 49 or 59 were also asked to provide addresses for ages 40/50 and 50, respectively. Those unable to provide an exact address were asked to provide the street name and the closest cross-street.The year at which participants were aged ten years, which represented the approximate midpoint of childhood, was determined in order to link with the county-level socioeconomic data from the closest census year . When a city, but not a county was provided, we used a publicly available website to attempt to identify the correct county . County Prior to geocoding, all state data was standardized to conform to the two-digit U.S. Postal Services state coding system. Within each state the accuracy of the spellings of cities were verified. Street addresses were reviewed and computer programs written to correct obvious misspellings and to standardize formats. We did not submit zip codes because those accompanying the historical address could have changed over time. Because our goal was to classify the social environment where participants lived, we excluded post office box addresses as they do not necessarily correspond to actual residences. These along with other incomplete and unusable addresses were not sent for geocoding. After editing, addresses and an encrypted study ID number were sent to a commercial vendor under contractual terms of confidentiality negotiated by university counsel and approved by the IRB.The vender assigned to each address: spatial coordinates, Federal Information Processing Standards (FIPS) codes for statistical tabulation areas corresponding to 1990 census boundaries, and a match code describing the degree of accuracy of the geocoding. The accuracy rating assigned by the vendor ranged from" house range address matches" (best) to the "centroid of county" (worst). As we were interested in accurately classifying each participant's place of residence at the level of the census tract , we accepted only house range address matches or matches to centroids of zip code areas where everyone lived within a census block group, census tract or where more than 80% of addresses in area were located in the same tract. Rural routes were sent to the vendor but these addresses were not successfully geocoded.Two methods were considered to link the spatial coordinates obtained from the vendor with the appropriate historical census tract. The overlay method uses the spatial coordinates assigned to exact address matches in conjunction with historical boundary maps to place addresses into historical tracts. The comparability file method uses current US Bureau of the Census tract assignments that are traced back in time stepwise to 1980 tracts, then from 1980 to 1970 tracts using files that describe tract changes from decade to decade. As a test, we compared the 1970 tract assignments by the two methods for 13,044 addresses that were successfully geocoded to the 1990 census by the geocoding vendor. While all addresses were assigned tracts using the overlay method, 36% could not be assigned a 1970 tract using the comparability files due to census tract merges (a tract contains parts of more then one tract from the previous decade). Of the remaining addresses (n = 8348), 97% were assigned the same tract by both methods. Because there are known errors in the assignment of spatial coordinates by commercial geocoding vendors ,12,14, wWe determined the census year that corresponded most closely to when the participant resided at each address. Arcview GIS Version 3.3 software was used to overlay the spatial coordinates assigned to addresses by the vendor onto Geolytics, Inc. shape files of census tract and block numbering area boundaries of the appropriate census year . The spatial coordinates falling within the historical tracts were assigned the corresponding tract number. Figure Electronic shape files were not available for the 1960 census. Thus, 1960 addresses were placed into 1970 tracts using the overlay method and then mapped to the appropriate 1960 tracts using files providing data on the correspondence between 1970 and 1960 tracts. These were obtained from print volumes of comparability files published by the US Bureau of the Census and keye® tools and the street map legends, we attempted to locate each address. If a street was contained within the boundary of a census tract, we assigned it the corresponding tract number. If a street crossed a census tract boundary or was the boundary for two or more tracts, we did not assign a census tract.When a 1960 address fell into a 1970 tract made up of merged 1960 tracts or when addresses were not geocoded by the commercial vendor , we attempted to manually place addresses into historical census tracts. Because this process is labor intensive, we undertook this effort only for addresses which were located within the four ARIC study communities (as a large number of addresses were not clustered in other areas). First, we obtained detailed street maps for the four study areas and overlaid them with census tract boundaries and numbers from the three historical censuses. Then, using web-based MapquestA large number of historical addresses in Washington County, MD were obsolete, because in the early 1990s the state changed to a grid address system to improve emergency response systems. Thus, we obtained historical street maps from the Hagerstown, MD Public Library and tried to locate the original street names in an attempt to manually assign a census tract using the procedure described above.For addresses placed within a 1960–1980 census tract, we linked with tract level socioeconomic data. For 1970 and 1980 we used data from Geolytics, Inc. . The ODUM Institute at the University of North Carolina, USA provided electronic 1960 census tract data. Jackson MS and Washington County MD had not been assigned census tracts in 1960. For Jackson, MS and the portion of Washington County, MD falling within the Hagerstown city limits, we obtained 1960 census housing data at the level of city blocks from print volumes , and aggKMR conceived of and led the writing of the manuscript. JLW analyzed the data on early adulthood and developed the methods for assigning census tracts to historic addresses. GH, the principal investigator of the LC-SES Study, contributed to the conceptualization and writing of this manuscript. EAW assessed the accuracy of the commercial geocoding and developed standardized procedures for manual geocoding. SK developed standardized procedures for editing the recalled address data. RP analyzed data pertaining to childhood place of residence. DY was instrumental in reviewing methods for placing participants into their historical tracts. AVDR provided expert input on methods of geocoding. All authors helped to frame the ideas, interpret findings, and review drafts of the manuscript.

Metabolic pathway analysis has been recognized as a central approach to the structural analysis of metabolic networks. The concept of elementary (flux) modes provides a rigorous formalism to describe and assess pathways and has proven to be valuable for many applications. However, computing elementary modes is a hard computational task. In recent years we assisted in a multiplication of algorithms dedicated to it. We require a summarizing point of view and a continued improvement of the current methods.We show that computing the set of elementary modes is equivalent to computing the set of extreme rays of a convex cone. This standard mathematical representation provides a unified framework that encompasses the most prominent algorithmic methods that compute elementary modes and allows a clear comparison between them. Taking lessons from this benchmark, we here introduce a new method, the binary approach, which computes the elementary modes as binary patterns of participating reactions from which the respective stoichiometric coefficients can be computed in a post-processing step. We implemented the binary approach in FluxAnalyzer 5.1, a software that is free for academics. The binary approach decreases the memory demand up to 96% without loss of speed giving the most efficient method available for computing elementary modes to date.The equivalence between elementary modes and extreme ray computations offers opportunities for employing tools from polyhedral computation for metabolic pathway analysis. The new binary approach introduced herein was derived from this general theoretical framework and facilitates the computation of elementary modes in considerably larger networks. The background section presents the importance of computing elementary modes for metabolic system analysis, its computational difficulties and the existence of various known algorithms. A theoretical section brings these algorithms into a unified framework. In a following section we introduce a new approach, called the binary approach. Although relying on concepts introduced in the theoretical section, this section gives enough practical details to be stand-alone for the implementer. Results obtained from example networks and a conclusion section close the article.m metabolites and q reactions. Reactions may involve further metabolites that are not considered as proper members of the system of study. The latter metabolites, considered to be buffered, are called external metabolites in opposition to the m metabolites within the boundary of the system, called internal metabolites. The stoichiometry matrix N is an m × q matrix whose element nij is the signed stoichiometric coefficient of metabolite i in reaction j with the following sign convention: negative for educts, positive for products. Some reactions, called irreversible reactions, are thermodynamically feasible in only one direction under the normal conditions of the system. Therefore, reaction indices are split into two sets: Irrev (the set of irreversible reaction indices) and Rev (the set of reversible reaction indices). A flux vector (flux distribution), denoted v, is a q-vector of the reaction space q, in which each element vi describes the net rate of the ith reaction. Sometimes we are interested only in the relative proportions of fluxes in a flux vector. In this sense, two flux vectors v and v' can be seen to be equivalent, denoted by v ≃ v', if and only if there is some α > 0 such that v = α · v'.We consider a metabolic network with Nv = 0. Thermodynamics impose the rate of each irreversible reaction to be nonnegative. Consequently the set of feasible flux vectors is restricted toMetabolism involves fast reactions and high turnover of substances compared to events of gene regulation. Therefore, it is often assumed that metabolite concentrations and reaction rates are equilibrated, thus constant, in the timescale of study. The metabolic system is then considered to be in quasi steady state. This assumption implies P = {v ∈ q : Nv = 0 and vi ≥ 0, i ∈ Irrev}     (1)P is a set of q-vectors that obey a finite set of homogeneous linear equalities and inequalities, namely the |Irrev| inequalities defined by vi ≥ 0, i ∈ Irrev and the m equalities defined by Nv = 0. P is therefore – by definition – a convex polyhedral cone where NRev consists of all columns of N corresponding to reversible reactions. Note that if v is a flux vector of S and v' is its reconfiguration then Nv = N'v'.Let v' ∈ Irrev ∪ Rev × {-1;+1} is such that for any reversible reaction index i ∈ Rev at least one of the two coefficients v'i,+1) the set of reconfigured EMs of Sthe set of two-cycles made of a forward and a backward reaction of S' derived from the same reversible reaction of Sb) Proof: see Methods.Thus, the set of EMs of the original network is equivalent (up to the two-cycles) to the set of EMs in the reconfigured network and therefore can be seen as a reduced set of extreme rays of the pointed convex polyhedron as defined by:P = {v' ∈ q + |Rev| : N'v' = 0 and v' ≥ 0}     (5)Hence, EMs computation can be derived from any extreme ray enumeration algorithm applied to the reconfigured network and followed by vector back-configuration and the elimination of meaningless vectors, namely the two-cycles.extreme currents. Thus, extreme currents are identical to the EMs in the reconfigured network and, hence, also (up to the 2-cycles) equivalent to the EMs from the original networkNote that exactly the same procedure – splitting reversible reactions into two irreversible ones – was carried out also in the original work of Clarke on stabiIn the following we present a simple yet efficient algorithm for extreme ray enumeration, the so-called Double Description Method . We showgenerating matrix R of a pointed polyhedral cone P(A) is a matrix such that P(A) = {x ∈ d : x = Rλ for some λ ≥ 0}. The pair is called a Double Description pair, or DD pair. As mentioned above, the extreme rays form the unique set of minimal generating vectors of P(A) and thus, considered as set of d-vectors, the extreme rays of P(A) form the columns of a generating matrix R that is minimal in terms of number of columns. The pair is then called a minimal DD pair.A Ak, Rk) from a minimal DD pair , where Ak is a submatrix of A made of k rows of A. At each step the columns of Rk are the extreme rays of P(Ak), the convex polyhedron defined by the linear inequalities Ak. The incremental step introduces a constraint of A that is not yet satisfied by all computed extreme rays. Some extreme rays are kept, some are discarded and new ones are generated. The generation of new extreme rays relies on the notion of adjacent extreme rays. Here again, for the sake of simplicity, we adopt a characteristic . Then the following statements are equivalent:r and r' are adjacent extreme rays(a) r" is a ray of P(A) with Z(r) ∩ Z(r') ⊆ Z(r") then either r" ≃ r or r" ≃ r'(b) if P is pointed, A has full rank and contains a nonsingular submatrix of order d denoted by Ad. Hence, is a minimal DD pair which works as initialization and leads directly to step k = d. Note that there is some freedom in choosing a submatrix Ad or some alternative starting minimal DD pair.The initialization of the double description method must be done with a minimal DD pair. One possibility is the following. Since Ak - 1, Rk - 1) is a minimal DD pair and consider a kth constraint defined by a not yet extracted row of A, denoted Ai•. Let J be the set of column indices of Rk - 1 and rj, j ∈ J, its column vectors, i.e. the extreme rays of P(Ak - 1), the polyhedral cone of the previous iteration. Ai• splits J in three parts , with equality (zero ray) or does not satisfy it (negative ray):Assume J- = {j ∈ J : Ai•rj < 0}Rk is ensured in considering all positive rays, all zero rays and new rays obtained as combination of a positive and a negative ray that are adjacent to each other T and can thus be used for Aq. The matrix Aq-1 = I-1 = I gives the q extreme rays that obey to these q independent constraints and works as initialization of R.The matrix m linear inequalities defined by Nr ≥ 0 and -Nr ≥ 0, i.e. m equalities: Nr = 0. The processing of an equality constraint is done in a single pass by only keeping rays of J0 instead of J+ ∪ J0. This is achieved by replacing the line R' ← {rj : j ∈ J+ ∪ J0} with R' ← {rj : j ∈ J0} in the part "Processing of constraints in a given order" in Table Arj (required for the Gaussian combination step) are explicitly stored throughout the algorithm (in the left-hand side of the tableau ; b = ; c = a(b). Vector c reads then .• c(1:3) = ; here, "1:3" expresses "from 1 to 3", thus, 5, 8 and 9 are assigned to the first three elements of vector mat.• mat = 3; value 3 is assigned to the element in the second row and fifth column of matrix mat1 is copied into the third row of matrix mat2. Here, the colon operator ":" expresses "all elements of the respective dimension" (here: columns). Of course, it must be ensured that mat1 and mat2 have the same number of columns.• mat1 = mat2; the values of the fifth row of matrix mat are assigned to a which is now a 3-element vector.• a = mat; the first three elements of the seventh row of matrix a and shifts all elements behind one position back, i.e. vector a reads now .• a= ; a(2)= ; deletes the second element of The pseudo-code given in Figure length(a); if a is a vector then length returns the number of elements in a.• c = find(a); if a is a vector then find returns all positions in a which are not zero. Example: find returns .• c = or returns the result of the logical OR operation applied element-wise to a and b. a and b can be scalars, vectors or matrices and must have the same size. Example: if a = , b = then or returns . In the pseudo-code, we use this routine exclusively for OR-operations of bit masks (arrays with only "ones" and "zeros").• c = zeros returns a matrix of size m × n filled with zeros.• c = null(a) returns a null-space matrix of matrix a.• c = intersect returns the intersection of elements in vectors a and b.• c = all(b) returns "1" if all entries in vector b are not zero and "0" otherwise.• c = EM(s): Elementary Mode(s) also known as Elementary Flux Mode(s).Both authors contributed equally to this work, the starting idea of the binary approach coming from a discussion between them. JG mainly established the relationships between extreme ray and elementary modes computation. SK mainly devised and implemented the binary null-space algorithm. Both authors prepared the manuscript jointly.

MnSOD promoter contains an activator protein-2 (AP-2) binding site that modifies transcription of MnSOD. Mutations have been identified in the proximal region of the promoter in human tumor cell lines. One of these mutations (-102C>T) has been shown to change the binding pattern of AP-2 leading to a reduction in transcriptional activity. The aim of our study was to develop a method to identify and determine the frequency of this (-102C>T) polymorphism in human tissues.Manganese superoxide dismutase (MnSOD) plays a critical role in the detoxification of mitochondrial reactive oxygen species constituting a major cellular defense mechanism against agents that induce oxidative stress. The A new TaqMan allelic discrimination genotype method was successfully applied to genomic DNA samples derived from blood, buccal swabs, snap frozen tissue and paraffin blocks. The polymorphism was shown to be in Hardy-Weinberg Equilibrium in an evaluation of 130 Caucasians from Warsaw, Poland: 44 (33.8%) were heterozygous and 6 (4.6%) were homozygous for -102T.MnSOD -102C>T polymorphism in human subjects by a novel Taqman allelic discrimination assay. This method should enable molecular epidemiological studies to evaluate possible associations of this polymorphism with malignancies and other diseases related to reactive oxygen species.This report represents the first description of the Three distinct types of SODs have been identified in human cells: 1) a homodimeric cytosolic CuZnSOD [Antioxidant enzymes such as superoxide dismutase (SOD) protect cells from oxidative stress. Generation of reactive oxygen species (ROS) has been implicated in the etiology of a diversity of human diseases, including cancer, aging22, athero CuZnSOD , 2) an e CuZnSOD , and 3) CuZnSOD .Numerous reports indicate a relative deficiency of superoxide dismutase catalytic activity, including mitochondrial MnSOD, in many types of solid tumors ,10. InteFurther evaluation of MnSOD suggests that it is critically important in maintenance of mitochondrial function. Mice with deficiency of this enzyme exhibit progressive cardiomyopathy, neurodegeneration and perinatal death. These sMnSOD mitochondrial targeting sequence has been associated with risks to various diseases including breast cancer[Genetic polymorphism in the st cancer,18, lungst cancer, cardiomst cancer and Parkst cancer.A reduction of MnSOD activity has been shown to exist in many types of human cancer cells when compared to normal cells . A recenMnSOD gene is localized to chromosome 6 (6q25). The MnSOD promoter region is characterized by a lack of TATA or CAAT boxes but the presence of a GC rich region containing multiple SP-1 and AP-2 binding sites [MnSOD promoter sequence (MnSOD -102C>T) has been shown to change the binding pattern of AP-2 leading to a reduction in transcriptional activity. However the presence of this polymorphism has not been reported in human tissue.The human ng sites . Furthersome 6 6q. The MnSMnSOD promoter.In this study we developed a TaqMan allelic discrimination assay to reliably genotype DNA from many tissues for the -102C>T polymorphism in the We confirmed the presence of the -102C>T single nucleotide polymorphism in human subjects and submitted the sequence variant to Genbank. The genReactive oxygen species in the form of superoxide radicals, hydrogen peroxide, and hydroxy-radicals are formed during incomplete reduction of molecular oxygen during normal respirations. The production of reactive oxygen species remains relatively stable during normal physiologic respirations. A significant increase in the production of reactive oxygen species such as superoxide radicals can be greatly increased as a result of metabolic disorders or more commonly from exposure to toxins such as cigarette smoke, well-cooked meat, urban residency, and excessive alcohol consumption.MnSOD gene in E. coli significantly increased mutation frequency and cell death when bacteria were grown under aerobic conditions [MnSOD gene has led to detrimental effects. Polymorphisms of the human MnSOD gene have been found in the promoter region, the sequence coding for mature protein, and the mitochondrial targeting sequence. Initial evaluation of the five prime flanking regions from human tumor cell lines indicated that there were no major additions or deletions in the five prime flanking regions of the human MnSOD gene [MnSOD gene [Under normal physiologic conditions, superoxide radicals are detoxified by superoxide dismutase. Among the three SODs, MnSOD has been demonstrated to be the only form that has been essential for survival of aerobic life . Inactivnditions . This haSOD gene . HoweverSOD gene . This chSOD gene , no evalEvaluation of the -102C>T polymorphism is complicated by difficulty in PCR because of the excessive GC rich region in which this polymorphism exists. This location, upstream from the transcription start site was extremely difficult to identify through multiple PCR-restriction fragment length polymorphism (RFLP) assays, which failed to adequately digest at this polymorphism site, and led to multiple false negative results. We found only the highest quality DNA (i.e. blood) was able to be evaluated using a PCR RFLP assay with only 50% genotyping success. This failure to accurately reproduce the PCR-RFLP assay , led us The TaqMan allelic discrimination assay provided results that were confirmed by automated DNA sequencing and blind repeat genotyping. Although we did not test it use on DNA from multiple tissues from the same individual, it was successful for DNA samples derived from buccal swabs and paraffin blocks. It has significant advantages over RFLP analysis, allele-specific amplification, allele-specific hybridization, and oligo-nucleotide ligation assay techniques. The reasons for this advantage come from the reduction in labor intensive work up, the lack of need for special handling of radioactive probes, and the ability to modify this technique to evaluate multiple polymorphisms in this gene. In addition as more significant polymorphisms within the MnSOD gene are discovered, this technique will facilitate detection within the MnSOD gene.The limitations of this technique ultimately come from the quality of DNA that is available and the significant initial expense that is required for a TaqMan assay instrumentation.MnSOD -102C>T polymorphism in human subjects by a novel Taqman allelic discrimination assay. This method should enable molecular epidemiological studies to evaluate possible associations of this polymorphism with malignancies and other diseases related to reactive oxygen species.This report represents the first description of the Most DNA samples (130) were isolated from buffy coats of Caucasian controls derived from a population-based case-control study of stomach cancer carried out in Warsaw, Poland as previously described . To testDNA extraction from paraffin sections was performed after tissue sections were cut from paraffin blocks. Samples were removed from paraffin through a sequential extraction with histaclear, 100% ethanol and acetone, and dried under vacuum. The pellet was incubated overnight with proteinase K at 55°C. After heating at 100°C for 10 min, digestion was sequentially extracted with phenol, phenol/chloroform and chloroform. DNA was precipitated with the addition of 3X volume 95% ethanol.MnSOD promoter region. A MGB quencher probe was utilized on the 3' end by a linker arm. TaqMan Universal PCR Master Mix (Applied Biosystems) was used to prepare the PCR. The 2X mix was optimized for TaqMan reactions and contained AmpliTaq-Gold DNA polymerase, AmpErase, UNG, dNTPs with UTP and a Passive Reference. Primers, probes and genomic DNA were added to final concentrations of 300 nM, 100 nM, and 0.5–2.5 ng/μl respectively. Controls (no DNA template) were run to ensure there was no amplification of contaminating DNA. Reference control DNA was also utilized to verify the polymorphisms identified. The amplification reactions were carried out in an ABI Prism 7700 Sequence Detection System (Applied Biosystems) with two initial hold steps and 50 cycles of a two step PCR . The fluorescence intensity of each sample was measured at each temperature change to monitor amplification of the 278 base pair MnSOD promoter region. The -102 nucleotide was determined by the fluorescence ratio of the two SNP-specific fluorogenic probes. The fluorescence signal increases when the probe with the exact sequence match binds to the single stranded template DNA and is digested by the 5'-3' exonuclease activity of AmpliTaq-Gold DNA polymerase (Applied Biosystems). Digestion of the probe releases the fluorescent reporter dye (either FAM or VIC) from the quencher dye. As shown in figure MnSOD promoter region.SNP-specific polymerase chain reaction (PCR) primers and fluorogenic probes Table were desTwenty samples with genotypes C/T (4 samples), T/T (3 samples), and C/C (13 samples), some of which were derived from paraffin-embedded tissues, were all confirmed by automated DNA sequencing. These sequence-confirmed samples served as reference standards for the remaining samples. In addition, 10% of the samples were genotyped blind a second time with identical results obtained.RM: Participated in design of study and manuscript preparationKH: Participated in genotyping samplesMD: Participated in design of methods of assayQL: Participated in statistical analysisBM: Participated in design of methods of assayJL: Participated in sample collectionNR: Contributed to the study design and the analysis and interpretation of the dataDH: Participated in design of study and manuscript preparation

Reports of the use of psyllium, largely in hypercholesterolemic men, have suggested that it lowers serum cholesterol as a result of the binding of bile acids in the intestinal lumen. Widespread advertisements have claimed an association between the use of soluble fibre from psyllium seed husk and a reduced risk of coronary heart disease. Given the purported mechanism of cholesterol-lowering by psyllium, we hypothesized that there would be a greater effect when psyllium is taken with breakfast than when taken at bedtime. Secondarily, we expected to confirm a cholesterol-lowering effect of psyllium in subjects with "average" cholesterol levels.Sixteen men and 47 women ranging in age from 18 to 77 years [mean 53 +/- 13] with LDL cholesterol levels that were normal or slightly elevated but acceptable for subjects at low risk of coronary artery disease were recruited from general gastroenterology and low risk lipid clinics. Following a one month dietary stabilization period, they received an average daily dose of 12.7 g of psyllium hydrophilic mucilloid, in randomized order, for 8 weeks in the morning and 8 weeks in the evening. Change from baseline was determined for serum total cholesterol, LDL, HDL and triglycerides.Total cholesterol for the "AM first" group at baseline, 8 and 16 weeks was 5.76, 5.77 and 5.80 mmol/L and for the "PM first" group the corresponding values were 5.47, 5.61 and 5.57 mmol/L. No effect on any lipid parameter was demonstrated for the group as a whole or in any sub-group analysis.The timing of psyllium administration had no effect on cholesterol-lowering and, in fact, no cholesterol-lowering was observed. Conclusions regarding the effectiveness of psyllium for the prevention of heart disease in the population at large may be premature. A cholesterol lowering effect has been reported for a variety of soluble dietary fibres -5. In FeThe accumulation and concentration of bile in the gallbladder is a continuous process. In rats which lack a gallbladder, the biliary excretion rate of bile salts is maximal at night and bilePatients identified in gastroenterology practices as requiring long-term treatment with psyllium, typically for chronic constipation or the irritable bowel syndrome, were invited to participate in the study. In addition, individuals who had received dietary counselling in a lipid clinic regarding cholesterol-lowering and who subsequently had cholesterol levels deemed not to require further intervention because they met targets set out in clinical practice guidelines were invited by clinic staff to participate. Subjects were deemed ineligible if they were under age 18 years, were under active treatment for hyperlipidemia, had total cholesterol greater than 7.00 mmol/L, required alterations in dosage of medications which might have an effect on lipid levels, had had a gastrectomy, had any disease which is associated with hyperlipidemia, were receiving a bile acid binding resin, or if they did not eat breakfast regularly.The study was approved by the Conjoint Health Research Ethics Board of the University of Calgary, Faculty of Medicine. Subjects were given a description of the study indicating our interest in comparing the relative efficacy of hs versus am dosing with psyllium without indicating the specific hypothesis, and were asked to sign a consent form.Gastroenterology patients were given a high fibre diet sheet as part of their therapeutic regimen and were asked to take this on a continuing basis, beginning one month prior to the initiation of the study. The diet sheet emphasized dietary sources containing predominantly insoluble fibre. Lipid clinic patients had all received in-depth counselling regarding dietary measures for hypercholesterolemia, including a high fibre regimen, and had implemented their dietary changes at least one month before beginning the study. An unsweetened psyllium preparation, "Novo-Mucilax" [NovoPharm], providing three grams of hydrophilic mucilloid per 6.2 gram powder, and a scoop known to provide at least ten grams of psyllium were provided. Containers were numbered and weighed at the conclusion of each test interval. Subjects were randomized to initially take a scoop full of psyllium either with breakfast or at bedtime. Using a crossover design, psyllium was taken in the morning or evening for eight weeks and at the alternate time for the subsequent eight weeks.Determinations of serum total cholesterol, LDL, HDL and triglycerides were made before beginning psyllium, at eight weeks and at sixteen weeks after commencing its use. A trained dietician obtained a dietary history and patients were weighed at the beginning and at the conclusion of the study. All lipid determinations were undertaken following a 14 hour fast and analyses were done in a central laboratory.After initial data inspection based on boxplots and summary measures, cholesterol values at 8 and 16 weeks were examined using analysis of variance, taking into account treatment, period, and between and within subject effects in accordance with the cross-over design. The pattern of change from baseline to 16 weeks was evaluated using paired t-tests.Of 86 subjects beginning the study, 33 of those referred from the gastroenterology clinics and 30 of those referred from the lipid clinic completed it. Of those withdrawing, eight did so because they could not tolerate the psyllium or it was felt to interfere with prescribed medication, 2 had elevated lipids, 4 did not complete all the required blood work, 5 were unable to comply with the protocol because of work or lifestyle changes and 4 developed intercurrent diseases which precluded completing the protocol.The age range of subjects was 18 to 77 years, mean 53 +/- 13 years, including 16 men and 47 women. The mean dose of psyllium taken was 12.7 +/ - 2.3 g for morning dosing and 12.7 +/- 2.2 g when taken in the evenings.Values for total, LDL, HDL cholesterol and triglycerides at baseline, eight and sixteen weeks for various subgroupings are tabulated in tables The mean caloric intake or the intakes of fat or fibre did not change significantly during the study table . There wWe failed to prove our hypothesis that administration of psyllium in the morning would have a greater cholesterol-lowering effect than it would in the evening. Not only was there no observable difference in lipid levels between the crossover periods but the daily ingestion of a greater daily dose than the 10.2 g of psyllium for which the FDA allows health claims to be made had no eWe used a crossover design since this was the most appropriate one for the primary question being addressed; accordingly, our study did not include a control group. However, the nature of the study should not have provided any motivation for study subjects to adopt any new lifestyle or dietary changes beyond those implemented well before the introduction of psyllium. Observational data has been shown to provide valid information, which is consistent with that observed in randomized, controlled trials ,18. The Failure of lipid-lowering by psyllium has also been demonstrated in twenty hypercholesterolemic children , in twenPublished studies include few normocholesterolemic subjects. Cholesterol reduction was observed in 7 normal men and in 5A meta-analysis of 17 studies of patients with hypercholesterolemia has suggested a small but significant cholesterol-lowering effect of psyllium . All of Several factors may contribute to the difference between our observations and those of others. A meta-analysis has demonstrated that the initial level of cholesterol was highly predictive of the subsequent reduction of cholesterol by oat bran . A greatThe small increase in the weight of subjects is believed to be have resulted from reduced physical activity. In a meta-analysis of the effect of weight reduction on lipids, predominantly through dietary change, a reduction in total cholesterol of 0.05 mmol/L and of 0.02 mmol/L in LDL cholesterol per kilogram of weight lost was identified . DietaryA small cholesterol-lowering effect of psyllium appears to occur in hypercholesterolemic individuals, at least in men and possibly postmenopausal women. The notion of a benefit accruing to the general population requires additional study. The promotion of foods containing psyllium as reducing the risk of heart disease for the population at large may be pThe timing of psyllium administration had no effect on cholesterol-lowering and, in fact, no cholesterol-lowering was observed. Conclusions regarding the effectiveness of psyllium for the prevention of heart disease in the population at large may be premature.The authors declare that they have no competing interests.GVR carried out the study design, data review and writing. EAS carried out the study design and data review. RB carried out the study design, data review and statistical analysis. ALE carried out the study design and data review.

One of the cornerstones of immune system function is movement. When word spreads that a virus has entered the body, chemical signals tell lymphocytes to proliferate and travel to the site of infection. Efforts to combat HIV have focused on understanding how the virus disrupts this immune response in the hopes of developing drugs to block its replication as well as vaccines to control the virus itself. Toward this end, scientists are investigating how each of the virus's nine genes—which all appear to have multiple functions—contribute to HIV infection.When HIV infects a cell, viral enzymes copy its RNA genes into DNA, which can then invade the infected cell's chromosomes. The viral DNA might lay dormant or it might use the cell to reproduce more viruses, which go on to infect other cells. The course of infection is determined by interactions between circulating T cells and antigen-presenting cells (cells that present evidence of infection), like macrophages, which may unwittingly aid the virus by transferring it to the T cells. Macrophages, for example, produce proteins that tell T cells to come check out an infection.A viral protein called Nef sparked intensive research after observations that patients with a rare strain of HIV lacking Nef took a very long time to develop AIDS symptoms. Nef has been linked to molecules involved in macrophage- and other antigen-signaling pathways and may use the molecules to appropriate these pathways for its own ends—enhancing virulence by facilitating viral replication. How Nef does this is not entirely clear. Now Jacek Skowronski and his colleagues at Cold Spring Harbor Laboratory in New York have identified the key molecules that Nef enlists to coopt the signaling machinery of immune cells.To understand how this might happen, biochemically speaking, Skowronski's lab first needed to determine which molecules Nef associates with. An adaptor protein, Nef does not directly catalyze reactions, but binds to enzymes that do. The researchers identified two proteins, DOCK2 and ELMO1, that form a complex with Nef. DOCK2 regulates enzymes, called Rac1 and Rac2, that are required for normal lymphocyte migration and antigen-specific responses. ELMO1 has also been shown to help DOCK2 activate Rac. Because DOCK2 activates Rac as part of two different signaling pathways—one activated by the T cell receptor, which mediates T cell activation, and one by a chemokine receptor, which controls T cell migration—the researchers investigated whether Nef could affect these important pathways by modulating Rac activity. They found that Nef in fact activates Rac by binding to the DOCK2–ELMO1 complex. And they went on to show that HIV uses these components of the chemokine receptor pathway to disrupt T cell migration. To generate an effective immune response, it is crucial that T cells travel to sites within lymphatic tissues where they interact with other lymphocytes. By inhibiting T cell migration, the researchers propose, Nef prevents these critical interactions, thereby providing a mechanism for stifling the immune response.These results, the authors argue, provide the biochemical evidence that Nef targets a protein “switch” that can interfere with important aspects of T cell function. In this way, Nef subverts the immune response pathways controlled by receptors on the surface of T cells to effectively disarm the immune system and turn T cells into viral replication factories. Understanding how Nef interacts with these proteins to spread infection could lay the foundation for valuable new therapies aimed at inhibiting and arresting HIV infection by blocking Nef-mediated effects.

Multicellular organisms contain a complete set of genes in nearly all of their cells, each cell harboring the potential to make nearly any protein in their genome. The same holds true for a single-celled bacterium or yeast. Yet a cell activates only a fraction of its genes at any given time, calling on a number of different mechanisms to activate the right genes at the right time. To metabolize sugar, for example, a cell needs to synthesize proteins involved in sugar metabolism, not protein repair, and vice versa. In a new study, Jason Brickner and Peter Walter report a mechanism for gene activation that depends on shuttling DNA to a particular location within the nucleus.In organisms whose cells have nuclei (eukaryotes), genomes lie within the nucleus but also interact with the inner nuclear membrane. Transcription factors activate gene expression by binding to a promoter sequence in the gene's DNA. The physical structure of DNA—which is packaged with proteins into chromatin—affects gene expression by controlling access to DNA. Where chromatin exists in the nucleus also influences gene expression. Heterochromatin—stretches of highly condensed chromatin—typically lines the nuclear periphery, and genes bundled into heterochromatin are typically silent. Active transcription generally occurs in the less condensed euchromatic regions. But since euchromatic regions are also silenced when they associate with heterochromatin along the membrane, it is thought that delivering chromatin to the nuclear periphery regulates transcriptional repression. Brickner and Walter, however, found evidence of the opposite effect—recruiting genes to the nuclear periphery can promote their activation—suggesting that nuclear membrane recruitment plays a much broader role than previously suspected in gene regulation.INO1, which encodes inositol 1-phosphate synthase, an enzyme involved in phospholipid (fat) biosynthesis. INO1 is also a target gene of the “unfolded protein response,” which is triggered when unfolded proteins accumulate in the endoplasmic reticulum, a subcellular organelle where secreted proteins are folded. The INO1 gene contains a regulatory element within its promoter region that responds to inositol availability. Genes under the control of this element are transcriptionally repressed by a repressor, Opi1, and activated by two transcription factors, Ino2 and Ino4. The presence of unfolded proteins sets off a chain of events to relieve Opi1 repression and allow activation of INO1.To explore the consequences of chromatin location, the authors focused on a yeast gene called INO1 promoter. Opi1 associates with the chromatin, restricting the INO1 locus to the nucleoplasm and repressing transcription. Induction of the unfolded protein response bumps Opi1 off the chromatin and, with Opi1 out of the way, INO1 travels to the membrane and transcription proceeds. Crucially, the authors show that artificial recruitment of INO1 to the nuclear membrane can be enough to activate the gene. There are several mechanistic aspects of this model to figure out still, but Brickner and Walter argue that for INO1, gene recruitment to the nuclear membrane promotes its activation. In light of other recent work, this phenomenon may be emerging as a more general mechanism for regulating eukaryotic gene expression.Through a series of genetic and biochemical studies, Bricker and Walter show that Ino2 and Ino4 are always bound to the

The development of enzyme replacement therapy for Gaucher disease was a triumph of translational medicine. What were the key steps in its development? What are the controversies surrounding its use? Gaucher disease is the most common lysosomal storage disorder . A deficGaucher disease is an inherited metabolic disorder in which harmful quantities of a fatty substance called glucocerebroside accumulate in the spleen, liver, lungs, bone marrow, and, in rare cases, the brain. There are three common forms.Type 1 is the most common. Clinical features include easy bruising, anemia, low blood platelets, enlargement of the liver and spleen, bone disease, and, in some instances, lung impairment. There are no signs of brain involvement. Problems may begin early in life, be delayed until adulthood, or not occur at all.In type 2, liver and spleen enlargement are apparent by three months of age, and there is extensive and progressive brain damage. These patients usually die by two years of age.In type 3, liver and spleen enlargement is variable, and signs of brain involvement, such as seizures, become apparent gradually.Until 1990, treatment consisted only of palliative measures such as splenectomy and hip replacement. The development of enzyme replacement therapy for Gaucher disease, that is, exogenous administration of the missing enzyme, is a triumph of translational medicine. At the same time, powerful commercial interests may have been influential in physicians adopting a high-dose rather than a low-dose treatment schedule. Moreover, the high cost of enzyme replacement therapy forces us to consider what society can afford in the way of palliative treatments for very rare diseases.The possibility that the therapeutic replacement of enzymes missing from lysosomes could be achieved was first raised by de Duve forty years ago when he wrote: “Any substance that is taken up intracellularly by an endocytic process is likely to end up within lysosomes. This obviously opens up many possibilities for interaction, including replacement therapy” .Type 1 Gaucher disease, the most common type, seems a particularly suitable target for enzyme replacement therapy because of the lack of central nervous system involvement . By the 1970s, the underlying enzyme deficiency had been identified, and methods had been developed to purify the enzyme from human placenta in a high state of purity. Three groups of investigators then attempted to treat the disease by infusing exogenous enzyme.In the United States, at the National Institutes of Health in Bethesda, Maryland, the unaltered enzyme was infused directly into the venous circulation ; at CityThe needed conceptual breakthrough was provided by the identification of a mannose receptor on macrophages and the suggestion that this might prove useful in replacement therapy for Gaucher disease . This leThe first study of commercially produced mannose-enriched glucocerebrosidase was carried out in Bethesda, Maryland, on only 12 patients, presumably because of a limited supply of the enzyme . Given tThe enzyme was promptly approved and marketed. Since only a single dose had been tested, this was the dose that most physicians administered in clinical practice. But the preparation was extremely costly—about US$4.00 per unit. At the dose used in the pivotal trial, a 70-kg patient would receive enzyme costing US$16,800 every two weeks.But was the large dose given actually the dose required? There were no data, and many physicians were unwilling to give less than the dose that had been used in the pivotal trial. Moreover, since most physicians took care of only one or at most two patients with the disease, they were not in a position to perform a dose-ranging study. And industry had no interest in supporting studies to show that a lower dose yielded equivalent results.But clinical trials carried out in our National Institutes of Health–sponsored General Clinical Research Center quickly established that a quarter of the dose given at more frequent intervals was fully effective . By 2000Recent “consensus recommendations,” which were supported in part by the Genzyme Corporation, the manufacturers of recombinant human glucocerebrosidase , suggest that children be given an initial dose of 30 to 60 units every two weeks . But theIt is often assumed that patients with severe disease require larger doses of enzyme than those with mild disease, but a meta-analysis based on liver size or spleen size made it clear that this is not the case 12]. La. La12]. The response of enlarged viscera to enzyme infusion is much more rapid than the response of bones. In one early study, the large dose used in the pivotal trial was given for up to four years to patients with bone disease, and although the response was slow, gradual improvement occurred . Strangec.1226 C → G (N370S) mutation never come to medical attention [The severity of Gaucher disease is very variable. We have estimated that some 60% of patients homozygous for the common ttention . Accordittention ,17. WhatEvaluating dose–response relationships in patients with Gaucher disease has been difficult for several reasons. The number of new patients requiring therapy is relatively small, and the Genzyme Corporation has done little to encourage the performance of dose–response studies, making it difficult to enroll patients. But beyond that, the response of patients to any dose is variable. Some authors have suggested that this may be due to individual differences in dose requirements—that some patients are relatively resistant and require a large dose, while others do well on a small dose . This isThe quality of life for patients with Gaucher disease has been greatly improved by the development of enzyme replacement therapy. Manufacturing and selling the enzyme has also been enormously profitable for industry. This profitability has served as a stimulus for the development of enzyme replacement treatments for diseases less common and generally less responsive to treatment than Gaucher disease. Given the small target population, these treatments are enormously costly on a per-patient basis. Treatments for Fabry disease and Hurler-Scheie disease are already licensed, and others are on the way ,21,22. T

Dementia is a chronic illness associated with a progressive loss of cognitive and intellectual abilities, such as memory, judgment and abstract thinking.The objective of this study was to assess the health utilities of patients with dementia in Europe and identify the key factors influencing their Health-Related Quality of Life (HRQol).This study used cross-sectional data from the Odense study; a Danish cohort of patients aged 65–84 living in Odense, Denmark. A total of 244 patients with mild to severe dementia were interviewed together with a caregiver about their health status and activities of daily living (ADL). Alzheimer's disease was diagnosed according to the NINCDS-ADRDA criteria for probable dementia. Vascular dementia and other types of dementia were diagnosed according to the DSM-IIIR criteria. Severity of dementia was defined by score intervals on the Mini Mental State Examination score: mild (MMSE 20–30), moderate (MMSE 10–19), and severe (MMSE 0–9). Based on the ADL information, the patients' dependency level was defined as either dependent or independent. Questions from the Odense Study were mapped into each of the five dimensions of the EQ-5D in order to assess patients' HRQol. Danish EQ-5D social tariffs were used to value patients' HRQol.A regression analysis of EQ-5D values was conducted with backward selection on gender, age, severity, ADL level and setting in order to determine the main factor influencing HRQoL.The EQ-5D weight in patients independent upon others in ADL was 0.641 (95% CI: [0.612–0.669]), and in those dependent upon others was 0.343 (95% CI: [0.251–0.436]).Dependency upon others to perform ADL was the main factor affecting HRQoL. Dementia is a chronic illness associated with a progressive loss of cognitive and intellectual abilities, such as memory, judgment and abstract thinking. Cognitive disabilities are those that impact an individual's ability to access, process, or remember information. People with profound cognitive disability will need assistance with nearly every aspect of daily living. The most visible manifestation of dementia is the progressive inability – proportional to the severity of the disease – to perform activities of daily living (ADL) and the subsequent loss of independence . ProgresMeasuring the QoL of patients suffering from dementia can take several forms. Firstly, QoL can be measured using generic health indices like the other disease specific measures. Recently several scales have been developed and validated specifically for dementia patients such as the Quality of Life-Alzheimer's Disease (QOL-AD). Another alternative to assess QoL is to use utility measurements, which are preference-based . PrefereHealth utilities have already been measured in AD in the US and Canada using the Health Utility Index (HUI) . In the Based on data collected alongside an epidemiological study conducted in Odense Denmark, we attempted to assess the health utilities of patients with dementia and identify the key factors influencing their HRQoL.Data were derived from the Odense study, an epidemiological survey in which the objective was to estimate the prevalence and incidence of dementia in Denmark ,11 In thDemented patients were classified by type of dementia and by severity of dementia. Alzheimer's disease (AD) was diagnosed according to the NINCDS-ADRDA criteria for probable dementia . VasculaAll interviews were conducted by a certified nurse in the patient's home., Patient's and caregiver's socio-economic and socio-demographic status as well patients' health status and ADL were recorded. In the event that a relative was not present during the interview, a professional caregiver verified information provided by the patient.Each interview included the following information:- sociodemographic questions .- activity of daily living (ADL) questionnaire using 7 items describing patients' ability to perform physical activities and psychosocial activities (activities in the home and hobbies inside and outside of the home). Each activity was scored using a four-point Likert scale anchored at the ends with 1 = "Unable to perform the activity" and 4 = "Perform the activity without help from others". The physical ADL ranged between 4 (worst state) and 16 (best state), while the psychosocial ADL scored between 3 (worst state) and 12 (best state) ). Severity of dementia and setting has no statistically significant impact on QoL.For the first time, this study provides health utilities for patients with dementia in Denmark. This study has shown that the factor that most affects the HRQoL of a patient with dementia is their dependency status as defined based by their ability to perform activities of daily living. The type of dementia doesn't seem to have a great an influence on patient's HRQoL, and severity does not appear to discriminate significantly between health utilities. However, due to missing data – particularly among patients with severe dementia – caution must be exercised when interpreting the results.In the utility results previously measured by Neumann et al. using thAs the EQ-5D values were estimated based on mapped questions, it raises the possibility of quotation bias and goodness of fit. Also, both patients and caregivers answered questions. Yet, with AD – and especially when patients are severely demented – it is impossible to collect non-proxy measurements in the later stages. The same methodology was performed in previous evaluations without knowing the impact of the difference between caregivers' and patients' perceptions.A particular strength of this study was that all data have been collected in conjunction with an epidemiological study wherein patients with dementia had been examined carefully and dementia criteria were explicitly stated.Measuring HRQoL is as important as measuring disease severity, progression, symptom response, cognition and behavioural disturbance when assessing the impact of disease and determining proper intervention in the treatment and management of dementia. However, HRQoL is difficult to assess in a disease such as dementia for which patients suffer from cognitive disabilities. Based on study results and as previously shown by Kurz et al. , dependeADL Activities of Daily LivingEQ-5D EuroQol – Five Dimension ScaleEuroQol EuroQol Scalerd editionDSM-IIIR Diagnostic and Statistical Manual of Mental Disorders 3HRQol Health-Related Quality of LifeMMSE Mini Mental State ExaminationQoL Quality of LifeSAS Statistical Analytical SoftwareCKA is principal author and responsible for quality control. K W-J provided mapping of the questions from the Odense Study into the five dimensions of the EQ-5D. AL and KA provided data analysis and data analyses of the Odense database. P K-S provided access to the Odense database.

Celiac artery stenosis (CAS) may be caused by atherosclerotic degeneration or compression exerted by the arched ligament of the diaphragm. Mitral valve prolapse (MVP) is the most common valvular disorder. There are no reports on an association between CAS and MVP.1560 (41%) out of 3780 consecutive patients undergoing echocardiographic assessment of MVP, had Doppler sonography of the celiac tract to detect CAS.CAS was found in 57 (3.7%) subjects none of whom complained of symptoms related to visceral ischemia. MVP was observed in 47 (82.4%) subjects with and 118 (7.9%) without CAS (p < 0.001). The agreement between MVP and CAS was 39% (95% CI 32–49%). PSV (Peak Systolic Velocity) was the only predictor of CAS in MPV patients as selected in a multivariate logistic model.CAS and MVP seem to be significantly associated in patients undergoing consecutive ultrasonographic screening. Celiac artery stenosis (CAS) may be caused by atherosclerotic degeneration, as observed in different vascular districts, or by extrinsic compression (ECCA) usually exerted by an abnormally developed arched ligament of the diaphragm -7. ECCA Mitral Valve Prolapse (MVP) is the most common valvular disorder, with a prevalence of about 6–7% in the general population ,9. It coThe association between MVP and CAS has not been extensively investigated. Accordingly, this study was aimed at verifying this hypothesis based on a possible common origin of the two conditions, i.e. the abnormal development of connective tissue causing both ECCA exerted by the arched ligament of the diaphragm and exuberance of valvular mitral tissue.The study population consisted of 1560 out of 3780 (41%) consecutive patients undergoing echocardiographic assessment of MVP, who also had celiac artery Doppler ultrasound performed between November 1999 to September 2004.MVP was defined as clear-cut billowing of one or both mitral leaflets across the mitral annular plane in 2-dimensional parasternal long axis recording or >2 mm late systolic posterior displacement of mitral leaflets by M-mode. A >4 mm displacement defined a moderate-severe prolapse.Ultrasonography was performed without intestinal preparation to limit meteorism. The digestive phase was taken into account, because it may influence visceral arterial flow. The evaluation of arterial flow in the celiac tract was recorded by continuous Doppler (CW) and, whenever possible, with the aid of the color-Doppler signal. No corrections of flow velocity by evaluation of the cosine of the insonorisation axis and the axis of the vessel were used: in this way, flow velocity can never be overestimated. The Doppler signal was collected in apnea during inspiration. During expiration, an increase in the compression of the celiac tripod by the arched ligament occurs in the cases of CAS caused by ECCA, with concurrent increase in flow velocity with respect to the velocity during inspiration . An exam45678CAS was defined as severe in case of Peak Systolic Velocity (PSV) flow velocity in the upper celiac tract greater than 2.0 metres/second ,16 and EContinuous variables are expressed as means ± 1 standard deviation (SD). Differences between groups were compared using Student's t-test and chi-square test, as appropriate. Association between CAS and MPV was performed using the Kappa statistics, estimated with 95% confidence interval.Univariate odds ratio (OR) along with their corresponding 95% confidence intervals were computed for describing association of clinical variables with MPV in CAS patients, using a logistic regression model. Selection of variables significantly associated with MPV in CAS patients was made using a multivariate logistic model. Selection criterion was the Akaike Information Criterion, applied backward to the multivariate logistic model. The statistical significance was settled at a p value < 0.05. The R (release 1.9) statistical package and the Harrell's Design and Hmisc libraries were used for analysis.The incidence of MVP in patients with (10.6%) and without (9.3%) assessment of CAS did not differ significantly.Among those undergoing both examinations, CAS was found in 57/1560 (3.6%) patients. The clinical characteristics of patients with and without CAS are reported in Table No patient with CAS was complaining of symptoms related to visceral ischemia, i.e. abdominal or gastric pain in concurrence with food ingestion.Thirteen (22.8 %) of the 57 subjects with CAS were suffering from cardiovascular disorder. In particular, a macrovascular atherosclerotic disorder was ascertained in 7 subjects , whilst no sign of macrovascular atherosclerosis was found in the remaining 50 subjects .In patients with CAS, factors associated with MPV are age, sex, PSV and BMI. At multivariate analysis only PSV resulted as an independent factor associated with MPV (OR 0.24 95% CI 0.08 to 0.69).The incidence of CAS is not clearly established, the majority of the literature consisting of isolated reports -21. SurpThe incidence of CAS and MVP in the present study dealing with an unselected population was 3.7% and 10.6%, respectively. In addition, this is the first report, to our knowledge, to demonstrate a strong association between the two conditions.CAS may be caused by ECCA or atherosclerosis. Unfortunately, the ultrasound technique has not enough resolution to allow an etiological discrimination that may be difficult to get even with angiographic examination . HoweverThe results of this study demonstrate that CAS is a relatively frequent finding among patients undergoing Doppler sonography of the celiac artery and is frequently associated to MVP. On the basis of these findings, further investigations are warranted aimed at determining the exact incidence of ECCA associated with MVP, the family distribution of the association between MVP and ECCA, or the prognostic implication of ECCA in subjects with MVP. Additionally, genetic studies could be advisable in subjects presenting with MVP associated to ECCA.CAS Celiac Artery StenosisMVP Mitral Valve ProlapseECCA Extrinsic Compression of Celiac ArteryCACS Celiac Artery Compression SyndromePSV Peak Systolic VelocityEDV End Diastolic Velocity

Yukio Mano, MD, PhD (1943–2004)Associate Editor, Journal of NeuroEngineering and Rehabilitation I was terribly shocked to hear of the tragic and sudden passing of Yukio Mano on November 7, 2004, at the age of 61. He had not been well this past year but had been working continuously until just ten days before his death.Yukio Mano Figure was bornHis research interest was rehabilitation medicine, especially brain plasticity. He was the first Japanese developer of an apparatus that could deliver transcranial magnetic stimulation. Using this apparatus, he analyzed changes in the central nervous system resulting from various diseases, including brain plasticity after anastomosis of the musculocutaneous and intercostal nerves following cervical root avulsion, and cortical reorganization in training. The knowledge resulting from his research proved beneficial in the rehabilitation of disabled patients. He also emphasized a multidisciplinary approach to rehabilitation medicine and adopted new techniques from engineering. He received the Best Paper Award from ANNIE in 2000 for his work entitled, "Adaptive FES Switching System for Hemiplegics".Yukio Mano served as a council member of the International Society of Electrophysiology and Kinesiology (ISEK) and, in 2000, he organized the XIII Congress of the ISEK in Sapporo, Japan. He was also a member of the editorial board of the Journal of Electromyography and Kinesiology. He served as a council member of many Japanese societies and organized nationwide congresses in Japan even in the year he died. He welcomed the launch of the new Journal of NeuroEngineering and Rehabilitation (JNER) and was honored to be asked to join the Editorial Board as an Associate Editor. He was indeed fully active to his last day.We cannot help praising him for all that he has accomplished in the fields of rehabilitation medicine, neurophysiology and kinesiology. We must also not forget that this remarkable scientist was also a caring family man. He always showed his love for his family as well as for his colleagues and friends. The loss of such an outstanding personality has been met with great sorrow by his family and the international scientific community. We will always remember him with great affection.

Birds, for example, know instinctively what type of nest to build for their offspring; salamanders don't need lessons to swim. But when it comes to primates—including humans—a good deal of behavior is learned. Primates exhibit a wide range of behaviors, not just among species but also among populations and even individuals. Yet the nature versus nurture debate still rages, particularly when it comes to understanding the roots of aggression. While bonobos are famous for using sex to resolve disputes, aggression is far more common in most primate species—again humans included. Our closest relative, the chimpanzee, has a reputation for being among the most belligerent, with rhesus monkeys and baboons not far behind. For many of these species, bouts of violence are often followed by gestures of reconciliation, such as grooming or, in the case of chimps, kissing. Since most primates live in social groups, it may be that such conciliatory measures serve to maintain some semblance of social structure, offsetting the disruptive effects of aggression. but are also passed on to succeeding generations. Such cultural traditions have been documented in African chimp populations, which display over 39 behaviors related to “technology” (such as using stones to crack nuts), grooming, and courtship. While most of these cases involve either tools, foraging, or communication, Robert Sapolsky and Lisa Share report evidence of a higher order cultural tradition in wild baboons in Kenya. Rooted in field observations of a group of olive baboons since 1978, Sapolsky and Share document the emergence of a unique culture affecting the “overall structure and social atmosphere” of the troop.A Primate's Memoir, Sapolsky studied the activities and lifestyle of the Forest Troop to explore the relationship between stress and disease. In typical baboon fashion, the males behaved badly, angling either to assume or maintain dominance with higher ranking males or engaging in bloody battles with lower ranking males, which often tried to overthrow the top baboon by striking tentative alliances with fellow underlings. Females were often harassed and attacked. Internecine feuds were routine. Through a heartbreaking twist of fate, the most aggressive males in the Forest Troop were wiped out. The males, which had taken to foraging in an open garbage pit adjacent to a tourist lodge, had contracted bovine tuberculosis, and most died between 1983 and 1986. Their deaths drastically changed the gender composition of the troop, more than doubling the ratio of females to males, and by 1986 troop behavior had changed considerably as well; males were significantly less aggressive.In his book After the deaths, Sapolsky stopped observing the Forest Troop until 1993. Surprisingly, even though no adult males from the 1983–1986 period remained in the Forest Troop in 1993 , the new males exhibited the less aggressive behavior of their predecessors. Around this time, Sapolsky and Share also began observing another troop, called the Talek Troop. The Talek Troop, along with the pre-TB Forest Troop, served as controls for comparing the behavior of the post-1993 Forest Troop. The authors found that while in some respects male to male dominance behaviors and patterns of aggression were similar in both the Forest and control troops, there were differences that significantly reduced stress for low ranking males, which were far better tolerated by dominant males than were their counterparts in the control troops. The males in the Forest Troop also displayed more grooming behavior, an activity that's decidedly less stressful than fighting. Analyzing blood samples from the different troops, Sapolsky and Share found that the Forest Troop males lacked the distinctive physiological markers of stress, such as elevated levels of stress-induced hormones, seen in the control troops.In light of these observations, the authors investigated various models that might explain how the Forest Troop preserved this (relatively) peaceful lifestyle, complete with underlying physiological changes. One model suggests that nonhuman primates acquire cultural traits through observation. Young chimps may learn how to crack nuts with stones by watching their elders, for example. In this case, the young baboon transplants might learn that it pays to be nice by watching the interactions of older males in their new troop. Or it could be that proximity to such behavior increases the likelihood that the new males will adopt the behavior. Yet another explanation could be that males in troops with such a high proportion of females become less aggressive because they don't need to fight as much for female attention and are perhaps rewarded for good behavior. But it could be that the females had a more direct impact: new male transfers in the Forest Troop were far better received by resident females than new males in the other troops.Sapolsky and Share conclude that the method of transmission is likely either one or a combination of these models, though teasing out the mechanisms for such complex behaviors will require future study. But if aggressive behavior in baboons does have a cultural rather than a biological foundation, perhaps there's hope for us as well.

Oryza sativa L.), barley (Hordeum vulgare L.) and wheat (Triticum aestivum L.) were linkage maps based on cDNA-RFLP markers. The low number of polymorphic RFLP markers has limited the development of dense genetic maps in wheat and the number of available anchor points in comparative maps. Higher density comparative maps using PCR-based anchor markers are necessary to better estimate the conservation of colinearity among cereal genomes. The purposes of this study were to characterize the proportion of transcribed DNA sequences containing simple sequence repeats (SSR or microsatellites) by length and motif for wheat, barley and rice and to determine in-silico rice genome locations for primer sets developed for wheat and barley Expressed Sequence Tags.Earlier comparative maps between the genomes of rice and motifs varied with the length of the SSRs within and among the three species, with trinucleotide SSRs being the most frequent. Distributions of genomic microsatellites (gSSRs), EST-derived microsatellites (EST-SSRs), and transcribed regions in the contiguous sequence of rice chromosome 1 were highly correlated. More than 13,000 primer pairs were developed for use by the cereal research community as potential markers in wheat, barley and rice.Trinucleotide SSRs were the most common type in each of the species; however, the relative proportions of SSR types and motifs differed among rice, wheat, and barley. Genomic microsatellites were found to be primarily located in gene-rich regions of the rice genome. Microsatellite markers derived from the use of non-redundant EST-SSRs are an economic and efficient alternative to RFLP for comparative mapping in cereals. The genetic maps of grass species have been constructed using a variety of marker types. Most of the older species-specific molecular maps were constructed with RFLP markers, but in recent times there has been increased utilization of PCR-based markers because of accessibility and higher throughput. Conservation of gene content and order has been detected among grass genomes through the use of comparative maps ,2. The aGenomic SSR (gSSR) markers are biased towards genome specificity ,5 and geRecently, several researchers -17 have When compared to gSSRs, EST derived SSRs (EST-SSRs) were less polymorphic in a study in hexaploid wheat with onlin-silico to the rice genome. SSR-containing transcripts derived from different species, sharing a pre-determined threshold of similarity and matching the same location in rice were considered putative orthologs that may be used as anchors in comparative mapping studies.We used the rice genome sequence generated by the International Rice Genome Sequence Project (IRGSP) to identThis paper describes a methodology for developing EST-SSR markers from wheat, barley and rice as markers for developing independent species maps as well as for homologous anchor markers for comparative maps. Over 13,000 untested PCR primer pairs for EST-SSRs were generated from the three gene indices and made available to the research community interested in grass genomes. Researchers are encouraged to evaluate a subset of primer pairs and send feedback regarding their utility to the GrainGenes databaseBased on combinations of all four nucleotides, the canonical set of SSR motifs is represented by four different duplets , 10 different triplets, 33 different quadruplets and 102 different quintuplet motifs. In the source sequences, all these basic nucleotide motifs can be represented in variant forms of the same basic set or by their reverse complements but to keep a consistency in the database for estimating frequencies, they were transformed into the canonical motifs. Reverse complements and variants would include, for example, CT for AG and GAG for AGG. Sets of unigene sequences such as the TIGR gene indices have the advantage of built-in elimination of redundant SSR counts allowing for more precise estimates of EST-SSR frequency. The rice genomic SSR (gSSR) counts were processed a-posteriori to eliminate redundancy due to BAC/PAC clone overlaps (see methods). Mononucleotide repeats are common in genomic DNA and some are known to be polymorphic but these were deliberately avoided in the unigene database, because they are usually added by the RNA polymerase and are not present in the template DNA (e.g. poly A tails).Table The abundance of SSRs (perfect and imperfect) in the unigenes can range from one in every 100 to one in every two unigenes depending on the minimum length Table .Wheat unigenes contained a larger number of SSRs for all repeat length categories, followed by rice and barley unigenes. This is probably because wheat has more than twice the number of unigenes than rice or barley with 109,782 for wheat, 51,569 for rice and 48,159 for barley. The larger number of unigenes in hexaploid wheat may result from divergence of the genes in the three genomes, but also from a relatively larger EST dataset, i.e., more ESTs have been sequenced for wheat, with a sequence redundancy of 3.8×, versus 6× and 2.7× for barley and rice, respectively (see methods).The number of the ten most frequent motifs was tabulated for different minimal SSR lengths Table . The relp > 0.01).The longest SSRs were genomic microsatellites (as long as 726 bp). Unigenes had few SSRs longer than 40 bp, up to 333 bp in wheat ESTs. Often these were not useful for developing SSR markers because no flanking sequence was available to design primers. The overall mean length for rice gSSRs equal to or longer than 12 bp was 16.5 (s.d = 12.7), with no significant differences in mean gSSR lengths among the chromosomes in rice, while the mean length for EST-SSRs was 15.3 (s.d = 6) with no significant differences among the three species gene indices , and for anchoring rice, wheat and barley unigenes associated with microsatellites (by sequence similarity). Best similarity matches between the rice genome and 8,259 barley, 16,917 rice and 13,565 wheat EST-SSR unigenes were identified using BLASTN. From these, a total of 6,373 EST-SSRs mapped to R1 pseudomolecules including 1,104 from barley, 3,568 from rice and 1,701 from wheat with 88.8%, 98.4% and 89.1% average sequence similarity respectively.The contiguity of the pseudomolecule sequence of rice chromosome 1 (R1) , with only eight gaps for the whole chromosome, provided a convenient framework of coordinates for calculating density estimates of gSSRs features the density of all rice unigenes mapped to R1, and b) the density of EST-SSRs (a subset from the unigenes) mapped to R1 provided an estimate of the relationship between gSSRs and gene regions in the rice genome. There was a striking resemblance in the patterns of the plots for the density of gSSRs and the density of unigene-derived EST-SSRs in R1 pseudomolecules Figure . The simA decomposition of the set of stringent gSSRs (see the methods section for criteria defining the "stringent gSSRs") by types in R1 Figure showed tWe designed primer pairs for 5,425 wheat, 3,036 barley and 4,726 rice EST-SSRs conforming to the stringent restrictions described in the methods. The average product size expected from the set of designed primers was 217 bp for rice EST-SSRs, 213 for wheat and 218.9 for barley.in-silico to the rice genome. The Of those EST-SSRs, 42% of the wheat and 56% of the barley were mapped r2 = 0.94, p < 0.006) between genomic microsatellite frequency and the percentage of single copy DNA in several plant species with a wide range of genome sizes. Estimates of repetitive and non-repetitive single-copy DNA fractions were based on reviews of the literature describing renaturation kinetics experiments for each of the species. Plant species that have gone through genome expansion due to retrotransposon amplification, such as maize and wheat, had a lower genomic microsatellite frequency indicating that SSR frequency is not a function of overall genome size but rather the relative proportion of single-copy DNA.Morgante and colleagues reportedr = 0.45, p < 1 × 10-5 and r = 0.62, p < 1 × 10-10, respectively) . The density pattern of transcribed regions (unigenes in R1) and of SSRs within transcribed regions (unigenes in R1 with SSRs or EST-SSRs) followed closely the density pattern of gSSRs in rice chromosome 1 of gSSRs along R1 was higher than both the density of transcribed regions and the density of EST-SSRs. A large number of gSSRs that are not already included in the set of EST-SSRs could still be associated with genes because, as Figure Other reports have documented a role for SSRs that are associated with genes in the control of gene expression. For example, several human diseases have been linked with events of triplet expansions in the past . ChromatIn rice, although the presence of a single-base mutation breaking an intron splice site is more directly responsible for the difference in phenotypes of the waxy gene, polymorphism due to SSR expansion has been associated with variation of expression levels in different japonica and indica varieties ,29. The One strategy to better exploit a database of EST-SSRs in order to find polymorphic markers is to first sample the longest SSRs ≥ 30 bp), favoring dinucleotide repeats, then follow with trinucleotide, tetranucleotide and pentanucleotide repeats . After e bp, favoOne percent of unigenes from the three species examined in this study have SSRs starting with a minimum of 30 bp Table . OverallAfter relaxing the microsatellite length constraint to a minimum of 20 bp, the overall number of SSRs in the unigenes increased to around 5%. An additional 3,195, 2,703 and 1,991 EST-SSRs in wheat, rice and barley become available for primer design. Acceptable primer pairs were designed for 2,622 wheat, 2,183 rice and 1,476 barley EST-SSRs in this category (which included the set mentioned previously).The set of EST-SSRs with acceptable primer pairs were selThe relative proportions of di-, tri-, tetra-, and penta nucleotide repeats and motifs varied widely depending on length and were not consistent among the species examined. We have shown that ESTs are a good source of SSRs that can be exploited to develop microsatellite markers for wheat, barley and rice. The advantage to this approach is that the sequences are already available resulting in a lower cost than designing and testing microsatellites from anonymous genomic libraries, even if the polymorphism rate for EST-derived markers is lower.EST-SSRs are useful for enhancing individual species maps, but can be used as anchor probes for creating links between maps in comparative studies when designed from sets of orthologous genes, as demonstrated by Yu et al . The annUsing a different methodology, our results substantiated the report by Morgante et al suggestiTIGR's non-redundant gene indices from wheAll analyses of the rice genome used the version released in December 2002 by the International Rice Genome Sequencing Consortium and consThe TIGR gene indices and the genome of rice were scanned with a modified version of Sputnik availablIn order to eliminate the problem of counting the same microsatellites several times in the rice genome due to the redundancy created by overlapping regions between contiguous BAC/PACs in chromosomes 2 to 12, the gSSRs were annotated as redundant or not, according to their location in the tiling path. When located to a region in the BAC/PAC that overlapped with a neighbor clone :a) The SSRs are dinucleotides or trinucleotides of length equal or larger than 18 bp, tetranucleotides equal or larger than 16 bp or pentanucleotides equal or larger than 20 bp.b) The imperfect SSRs have less than 10% mismatches or gaps relative to a perfect SSR of the same length and motif.c) There is a minimum of 50 bp surrounding the SSR edges in the source sequence to allow for possible primer design.The parameters used for the Primer3 program specified an optimal Tm of 60°C with a minimum and maximum of 57°C and 65°C, respectively, and a 30% to 70% GC content with a low chance of dimer or hair-loop formation. The range for PCR product length was set to be between 100 and 300 bp.EST: Expressed Sequence Tag. SSR: Simple Sequence Repeat. gSSR: genomic SSR. EST-SSR: EST-derived SSR. UTR: Untranslated region flanking a coding region in DNA and messenger RNA. IRGSP: International Rice Genome Sequence Project. R1: rice chromosome 1. BAC/PAC: Bacterial artificial chromosomes or bacteriophage P1 artificial chromosomes (for cloning of large DNA fragments). MITE: Miniature Inverted-repeat Transposable Element.ML did all programming and design of computational experiments and databases. RVK contributed in the first database design. JY did wet-lab testing of a subset of primer pairs.ML and MES drafted the manuscript. All authors read and approved the final manuscript.EST-SSR designed primers Table listing the stringent subset of SSRs found in rice, barley and wheat gene indices for which primer sequences were designed, the source sequences, the primers, their in-silico mapping in the rice genome (to BAC/PAC clones or pseudo-molecule) and relevant metadata. File is a spreadsheet table, compressed with the zip program. The file (14 Mb uncompressed) is also available at the GrainGenes Triticeae EST-SSR Coordination page Click here for fileModified Sputnik source code and executable This is the source code with modifications, to the microsatellite searching program "Sputnik", originally written by Chris Abajian from the University of Washington at Seattle. The set of files are compressed using the zip program. File is also available at Click here for filePerl script to design primers in batch The script uses the Bioperl perl modules to control the Primer3 program in order to design primers from a microsatellite database stored in a MySQL database. The script can be modified to accommodate similar schemas on any database engine supported by the perl DBI module. File is also available at Click here for file

In view of the issues surrounding physical restraint use, it is important to have a method of measurement as valid and reliable as possible. We determined the sensitivity and specificity of physical restraint use a) reported by nursing staff and b) reviewed from medical and nursing records in nursing home settings, by comparing these methods with direct observation.We sampled eight care units in skilled nursing homes, seven care units in nursing homes and one long-term care unit in a hospital, from eight facilities which included 28 nurses and 377 residents. Physical restraint use was assessed the day following three periods of direct observation by two different means: interview with one or several members of the regular nursing staff, and review of medical and nursing records. Sensitivity and specificity values were calculated according to 2-by-2 contingency tables. Differences between the methods were assessed using the phi coefficient. Other information collected included: demographic characteristics, disruptive behaviors, body alignment problems, cognitive and functional skills.Compared to direct observation (gold standard), reported restraint use by nursing staff yielded a sensitivity of 87.4% at a specificity of 93.7% (phi = 0.84). When data was reviewed from subjects' medical and nursing records, sensitivity was reduced to 74.8%, and specificity to 86.3% (phi = 0.54). Justifications for restraint use including risk for falls, agitation, body alignment problems and aggressiveness were associated with the use of physical restraints.The interview of nursing staff and the review of medical and nursing records are both valid and reliable techniques for measuring physical restraint use among nursing home residents. Higher sensitivity and specificity values were achieved when nursing staff was interviewed as compared to reviewing medical records. This study suggests that the interview of nursing staff is a more reliable method of data collection. Nursing homes have the mandate to offer care settings to frail dependent older individuals. However, a renewed emphasis has emerged over the past decades to become more than just a home for older people . A growiAlthough predominantly intended as protective devices, physical restraints in nursing homes are being denunciated as measures that go conversely with the aforementioned principles . JustifiAccording to the literature, the overall prevalence of restraint use in nursing homes ranges between 4 and 68% ,20. ThisThe objective of this study was to determine the sensitivity and specificity of the measurement of physical restraint use reported by members of the nursing staff and reviewed from medical and nursing records among nursing home residents, compared to direct observation. Since underreporting is much more susceptible to be problematic than overreporting, another objective of this study was to compare the sensitivity of the information reported by one nurse with that reported by two nurses or more questioned together. Our research hypothesis was that sensitivity of the interview is highest when the information is collected from more than one nurse.The study was conducted in eight facilities representing a convenience sample of the long-term care facilities in the Quebec City area, Canada. These institutions were carefully selected in order to include a mix of characteristics in size , geographic location , university affiliation and vocation (units associated with psychiatric or rehabilitation team). Selection was made after discussion with nursing direction of each setting to gather units of different practice such as regular units and specialized units for residents with dementia or severe behavioral problems. Twenty-five subjects were randomly chosen from each unit; if an unit comprised less than 25 residents, all of its residents were included. This study was approved by the ethics committee at Laval University. Data collection took place between January and June 1992.A physical restraint was defined as a mechanical means applied on a resident in order to interfere with his/her mobility, including: vest, waist, wrist or ankle restraints, geriatric chair or wheelchair with fixed tray table, or any other type of locally designed devices . RestricPhysical restraint use was measured according to three methods: direct observation, interview with members of the nursing staff including licensed practical as well as registered nurses , and review of medical and nursing notes.Direct observation of restraints on care units were made independently by two trained research assistants using a pre-tested questionnaire. For practical reasons, observations were made before the chart reviews and the nurses' interviews on three occasions on one day. These specific times were selected as being representative of periods of different nurse staffing, and of overloaded periods during morning and afternoon.In order to reduce the occurrence of an information bias, the nursing staff was blinded to the main objective of the research project. Structured interviews were carried out the day following direct observation by one of the authors (PJD), who was unaware of the observations. Interviews with the nurse in charge of each unit were scheduled, although he/she had the liberty to be represented or assisted by other members of the nursing staff. Physical restraint use on each subject was identified for every hour during the last 24 hours, without knowledge of the times that direct observation was made, by means of a pre-tested questionnaire. The questionnaire covered questions about types of physical restraints , reasons for use and the duration including hours and minutes. Other information collected during the interview included: gross cognitive and functional information, risks for falls, history of falls during the last month, agitation, wandering, aggressive behavior and body alignment problems. Cognitive status was evaluated according to five items: recall, speech, and orientation to time, space and people. Three aspects of the functional status were assessed: urinary incontinence, fecal incontinence, and ability to transfer. Respondents could refer to subjects' clinical records at any time during the interview.Restraint use from subjects' medical charts and nursing orders for the last six months was reviewed with a pre-tested questionnaire by a research assistant who was blinded to the observations. Additional information taken into consideration comprised: demographic characteristics, prescriptions for restraints, methods of resident supervision, and psychotropic medications administered in the last 48 hours.Sociodemographic characteristics of the study sample as well as physical restraint use by methods of data collection were examined using descriptive analysis. Interrater reliability between the two research assistants was tested using the kappa statistic. Direct observation served as the gold standard . To be dData collection was carried out in 16 nursing units. Of these units, eight depicted skilled nursing home care units, seven nursing home care units, and one long-term care unit within a short-term care hospital. Information was collected for 377 residents with the help of 28 nurses. Residents' age ranged from 32 to 102 years, with a median of 80 years. The sample was 62% female, and median length of stay was 45 months (0 to 720 months). Benzodiazepines and neuroleptics were administered to 35% and 25% of the subjects, respectively.A total of 6,744 observations over a possibility of 6,786 were made (377 residents by three direct observations and six types of restraints). Prevalence results on physical restraint use according to direct observations : 0.73–0.97)), interviews with nursing staff and reviews of clinical records are summarized in Table The interview with nursing staff and the review of medical and nursing orders were both highly associated with the observation data Table . The intp = 0.03), agitated behavior (p = 0.04), body alignment problems (p < 0.001) and aggressive behavior (p = 0.01), and reported restraint use by nursing staff were observed. No association was observed for residents' age and sex, number of nurses interviewed, history of falls, wandering problem, disorientation to time, space or people, recall troubles, speech troubles, urinary and fecal incontinence, and ability to transfer.Sensitivity values according to specific residents' characteristics and other reported variables are given in Table The measurement of physical restraint use according to interview with members of the nursing staff and review of medical charts and nursing orders both reflect accurately the reality observed in long-term care setting residents. Our study has also shown that sensitivity and specificity values of the reported measurement are higher than those calculated from medical charts and nursing orders. This phenomenon is not surprising considering that the keeping of medical and nursing orders in nursing homes isn't usually done on a daily basis , as oppoThe current investigation was carried out in units of diverse facilities. The selection of these facilities was intended to allow the participation of subjects and care units of various characteristics as compared to other studies usually designed . The samLimitations of the current study must be taken into account when interpreting these findings. First, data were collected in 1992. Due to the implementation of the OBRA act, it is probable that the prevalence figures given in the current study are overestimations of those that would be observed in 2004. On the other hand, the province of Quebec just recently launched its first comprehensive policy on physical restraint use . FurtherIt is well known that the prevalence of residents with physical restraints is usually underreported since a social desirability bias tends to affect the validity of the information when the nursing staff has to declare the use of restraints . DespiteEven though other studies have observed an association between residents' characteristics and the risk of being restrained ,17,30,31Compared to review of clinical records, reported physical restraint use by interviewing nursing staff is a simple, efficient, and valid technique of collection of data regarding their use in nursing homes. No severe information bias was observed even though the use of physical restraints may be associated with poor quality of care. This method of measurement appears to be reliable and valid for research purposes. Moreover, our study provides support to the American initiative in regard to the monitoring of several outcomes in nursing homes through nursing staff reports -35. AccoThe authors declare that they have no competing interests.DL participated in the second line of statistical analyses, and drafted the manuscript. PV drafted parts of the document and contributed to the editing. RV contributed to the editing of the manuscript. PJD served as the Principal Investigator, designed the study, participated and oversaw field activity, revised and edited the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

As part of qualitative research for developing a culturally sensitive and developmentally appropriate videotape-based HIV prevention intervention for heterosexual African- American men, six focus groups were conducted with thirty African-American men to determine their perceptions of AIDS as a threat to the African-American community, characteristics of past situations that have placed African Americans at risk for HIV infection, their personal high risk behaviors, and suggestions on how HIV intervention videotapes could be produced to achieve maximum levels of interest among African-American men in HIV training programs.The groups took place at a low-income housing project in Houston, Texas, a major epicenter for HIV/AIDS. Each group was audiotaped, transcribed, and analyzed using theme and domain analysis.The results revealed that low-income African-American men perceive HIV/AIDS as a threat to their community and they have placed themselves at risk of HIV infection based on unsafe sex practices, substance abuse, and lack of knowledge. They also cite lack of income to purchase condoms as a barrier to safe sex practice. They believe that HIV training programs should address these risk factors and that videotapes developed for prevention should offer a sensationalized look at the effects of HIV/AIDS on affected persons. They further believe that programs should be held in African-American communities and should include condoms to facilitate reduction of risk behaviors.The results indicate that the respondents taking part in this study believe that HIV and AIDS are continued threats to the African-American community because of sexual risk taking behavior, that is, failure to use condoms. Further, African-American men are having sex without condoms when having sex with women often when they are under the influence of alcohol or other mind-altering substances and they are having sex with men while incarcerated and become infected and once released resume unprotected sexual relations with women. According to the men, substance abuse is an important part of the problem of HIV in the African-American community. This is in keeping with research that shows that drug use, especially crack cocaine, is linked to sexual risk taking among African Americans and to increased likelihood of becoming infected with other sexually transmitted diseases (STDs) including HIV. Thus, interventions for men should address condom use, condom availability, skills for using condoms, eroticizing condoms and substance abuse prevention. Men in the present study also strongly recommended that HIV/AIDS videotaped messages should include footage of the sensational effects of the disease. The HIV/AIDS epidemic continues to be a major public health challenge in the African-American community. Although African Americans constitute only 13% of the United States population, they have accounted for 39% of all the 886,000 estimated AIDS cases that have been diagnosed since the epidemic began in 1981 too."'Wally, a 20-year old bricklayer adds:There's only one way and it's through education and I mean education will sum it up. We have to educate on drugs, we have to educate on protective sex. I mean, education is it.""Freddy echoes the sentiments of Trevor and Wally regarding education but also discussed the need to provide condoms:We need to get more condoms out on the streets. All STDs have to be prevented so we have to get more education on the streets, not just about AIDS because they [AIDS and other STDs] work hand in hand.""Incentives such as gifts and social events were recommended as a means to get African-American participation in HIV prevention and risk reduction interventions. Wally stated the need to provide incentives to increase program participation:You can give and receive at the same time. What I'm saying is you may have to start having a little gift or something to get them to come in the first few times, or a meal.""Barry adds:You gotta give something to get something. Another thing, have you a little barbecue, have it sitting out or something and you can get a whole lot of people. And believe it or not, a crowd of people will open up to a conversation, too.""Karl stressed incentives and programs for adolescents:Sometimes especially with the younger generation, you have to give them something that they want. Give them caps, give them T-shirts, but at the same time, push the condoms.""Outreach workers were advised to eliminate formality and go into the community to provide their programs. They should make an effort to ensure the target community members are comfortable with their presence. Jason said:And go into the neighborhoods and walk around and talk to folks. People have a tendency to stay away from people in a suit and tie in a neighborhood.""Gene, a 20-year old laborer added:Instead of making it formal, just come in off the streets. Go to the people and give them that incentive and sit down and talk to them.""It is believed among two-thirds of men participating in these discussion groups that the government can assist AIDS prevention by firstly, providing funding for community-based education programs, secondly, providing convenient and free testing, and thirdly, free condom distribution. Other suggestions included quarantining or having a salient means of identifying those affected by HIV and AIDS, providing more medication and treatment for those affected, and having stiffer penalties for those who knowingly transmit the virus.Jason believes in the efficacy of outreach programs that provide free testing and incentives:Just have three of four vans, just go to different neighborhood, have free testing, give T-shirts.""Terry believes in the community approach to governmental intervention:I think the greatest weapon we have against AIDS is knowledge and we must bring some type of community-based program.""Roger asserted his belief that the entire US population should be tested and those with HIV and AIDS identified and placed in isolation:Either quarantine, mandatory testing for HIV for the whole US population. You go to get tested. You're going to a quarantine island for the rest of your life.""Terry believes that the government should impose stringent punishment against persons who knowingly infect others with HIV:I think we can make stiffer penalties for people with AIDS that are willingly passing the disease on. Probably the government can open some more clinics or help the doctors find a cure.""To create a video that addresses HIV prevention, close to one-half of participants recommended using a sensational approach that includes those morbidly affected by HIV and AIDS. They believe that the video should include footage of people in pain, being shunned by friends and family, and suffering tremendous physical pain. They also recommended testimonials from infected persons. A quarter of respondents believed that the video should be educational providing information about transmission and prevention. The remainder suggested the use of rappers to promote the message of prevention and acknowledgement that HIV happens to African Americans.Karl who has a college degree stated that a video developed for AIDS prevention should include the disease's effects on the person:They need to see those people suffering to let them know that this is how you're going to end up if you don't begin to practice safe sex. But also how people are being discriminatory to you, treating you like crap like you're this or that or you're contagious or something.""Roger has similar views but adds that education about high risk behaviors should be included:Stay away from the dope and don't go tricking and also go to the hospitals. A lot of African Americans are not educated on the full blown AIDS and how it destroys the major organs in your body. And let them see first hand on what you're dealing with here.""Jason would like a video that includes the various modes of transmission as well as prevention information:Just about everything that you can get on it from drug use to safe sex to having sex with the same partner. You know it's different ways you can catch it and a lot of people don't know that.""When asked what can be done to recruit African Americans to HIV training programs, most men suggested the use of participation incentives, especially those that are financial and preventive (condoms). The men also recommended recruiting participants from and having the programs take place within the communities in which the target population resides.Wally said:You may have to start with a few passes; they can be little small things. Then everyone would gradually grab a hold and then their minds would be off on what you're giving personally and they could see what they can receive. You can give and receive at the same time. What I'm saying is you may have to start having a little gift or something to get them to come in the first few times, or a meal.""Jason suggests community-based recruitment:Stand at every corner. AIDS is gonna get too bad in a couple of years. We don't want it to be too late before we say, "Hey, let's put education groups here and people just stop here and get rubbers.""The results indicate that the respondents taking part in this study believe that HIV and AIDS are continued threats to the African-American community because of sexual risk taking behavior, that is, failure to use condoms. Further, African-American men are having sex without condoms when having sex with women often when they are under the influence of alcohol or other mind-altering substances and they are having sex with men while incarcerated and become infected and once released resume unprotected sexual relations with women. According to the men, substance abuse is an important part of the problem of HIV in the African-American community. This is in keeping with research that shows that drug use, especially crack cocaine, is linked to sexual risk taking among African Americans and to increased likelihood of becoming infected with other sexually transmitted diseases (STDs) including HIV ,28. AfriAlthough most respondents indicated they have knowledge of behaviors that place one at risk for HIV and they are motivated by reasons such as life and not wanting to contract an STD, they still fail to consistently use condoms and may even have sex with someone they know is HIV positive and they continue to suggest that more educational programs are needed. This shows that knowledge and motivation are not enough for behavior change to occur. These men need education but education that is provided in a way that has been different from what has been offered in the past because it seems not to change their behaviors. Interventions for men should address condom use, condom availability, skills for using condoms, and eroticizing condoms. Substance use programs should incorporate sexual risks. Men in the present study strongly recommended that HIV/AIDS videotaped messages should include footage of the sensational effects of the disease. There is a trend toward reality broadcasting in the US and development and field testing of such a videotape for AIDS prevention might prove worthwhile . Low-incPrior research has identified the leading causes of HIV infection among African-American men that includes sexual contact between African-American men who have sex with men, injection drug use and heterosexual contact. These high-risk behaviors are exacerbated by the high rate of poverty among African Americans that may be due to high rates of unemployment and associated drug related economic activities, injection drug, and substance abusers' engagement in unprotected sex when they are under the influence of drugs and alcohol ,13. The Although most of the men had completed high school or beyond, they were mainly homeless or living in substandard housing. Their conditions of poverty may exacerbate their risk for infection because they may engage in illegal or high-risk behaviors. The barriers these men face related to poverty should also be addressed when developing training programs. This may call for the involvement of social service workers. Like programs developed for African-American women, they must be presented in settings that are familiar, comfortable and easily accessible to the target audience and incorporate culturally relevant contextual information .Before developing programs, health educators should become familiar with the facilitators and barriers to HIV risk reduction behaviors among this population. They should also recognize that African Americans are a heterogeneous group and that not all messages will work with all audiences. The messages must be tailored and celebrate the diversity that exists within this population. Interventions such as videotapes should have mass appeal yet contain contextual, cultural, and gender specific messages.There are several limitations to this study. Qualitative data collection methodology was employed and it is therefore not possible to make assumptions or draw inferences. Next, the data cannot be generalized to other African American men. The participants were homeless and low-income and selected using a convenience sampling approach. The goal of this study, however, was to recruit low-income African-American men because by virtue of their income status they may be at increased risk for HIV infection. Although the findings from this research are limited, they may provide a foundation for conducting future research among and developing a videotape-based HIV intervention for low-income African-American men.The author(s) declare that they have no competing interests.EJE, AFM and GOO conceived and designed the study. EJE, AFM, RJP jointly planned and executed the data analyses. EJE and AFM wrote the paper with assistance from RJP, GOO and NIO.The pre-publication history for this paper can be accessed here:

We set out to describe the risk of hospitalization from heart disease, stroke, and diabetes among persons born in India, all foreign-born persons, and U.S.-born persons residing in New York City.We examined billing records of 1,083,817 persons hospitalized in New York City during the year 2000. The zip code of each patient's residence was linked to corresponding data from the 2000 U.S. Census to obtain covariates not present in the billing records. Using logistic models, we evaluated the risk of hospitalization for heart disease, stroke and diabetes by country of origin.After controlling for covariates, Indian-born persons are at similar risk of hospitalization for heart disease , stroke , and diabetes mellitus as native-born persons. However, Indian-born persons are more likely to be hospitalized for these diseases than other foreign-born persons. For instance, the risk of hospitalization for heart disease among foreign-born persons is 0.70 and the risk of hospitalization for diabetes is 0.39 relative to native-born persons.South Asians have considerably lower rates of hospitalization in New York than reported in countries with national health systems. Access may play a role. Clinicians working in immigrant settings should nonetheless maintain a higher vigilance for these conditions among Indian-born persons than among other foreign-born populations. Immigrant populations in industrialized nations are on average healthier than their native-born counterparts . HoweverStudies conducted in countries with national health-care systems have noted approximately twice the risk of hospitalization for ischemic heart disease or myocardial infarction among South Asian immigrant men relative to native-born men aged 45–64 . This amWe set out to describe relative differences in the rates of hospitalization for heart disease, stroke, and diabetes among Indian-born persons relative to native-born persons or other foreign-born persons living in New York City. Unfortunately, there are no national datasets that provide individual level data for the risk of hospitalisation among specific immigrant sub-groups. It is, however, possible to compare the risk of hospitalization among immigrant sub-groups on an area-level using established small area analytic techniques via local datasets with a large sample size . Herein,We obtained all hospital admission records for residents of New York City from the Statewide Planning and Research Cooperative System (SPARCS) and population data for New York City from Census 2000 . The SPAth Revision codes 410, 413, and 428 respectively), stroke (430–438), and diabetes (250) as the dependent variables in each regression model. The following categorical variables were entered as independent predictors: age , sex , education level (completed high school versus no high school [reference]), and country of birth .We used this model to calculate hospitalizations for manifestations of atherosclerotic heart disease . Indian-born persons, however, are more likely than other foreign-born persons to be hospitalized for stroke; the average foreign-born person has a risk ratio of 0.75 .While the risk of hospitalization for diabetes similar among Indian-born persons and native-born persons , the likelihood of hospitalization for this condition is considerably higher on average than that of other foreign-born persons regardless of sex. Foreign-born persons overall are at 39% the risk of hospitalization for diabetes mellitus .While Indian immigrants to industrialized nations are at similar risk of hospitalization for heart disease, diabetes, and stroke as their native-born counterparts, they are at much greater risk of hospitalization for heart disease, stroke, and diabetes than are immigrants from other countries. Although earlier studies have found differences in the risk of heart disease among Indian-born persons to England and Canada by sex, we found that risks were similar among males and females,11.In an earlier paper, a higher age-adjusted mortality rate due to ischemic heart disease and stroke was noted among foreign-born women relative to native-born women . In thatOur study was subject to a number of important limitations. While the hospitalization data contained insurance status, the census data did not. We were therefore unable to control for insurance status in our study.Given that foreign-born persons in the U.S. approach three times the rate of lacking health insurance as native-born persons (33.4% versus 12.2% respectively), it is pA second limitation was our use of zip-code-only data for the proportion of foreign-born in a neighbourhood, which may be confounded by ecological factors. This was minimized somewhat by examining individual-level hospitalizations for all variables but education and country of birth. It is notable that our data on the foreign-born overall are constant with a growing body of literature showing lower morbidity and mortality among immigrants to the United States than native-born persons.The risk differences we found between native-born persons and persons born in India were not large – for every 100 hospitalizations for heart disease among native-born persons, we would expect 2–3 additional hospitalizations among persons from India. However, the risk of heart disease, cancer and diabetes is significantly higher than those of other immigrant groups with a similarly low prevalence of smoking,10,11. TIndian-born New Yorkers are at substantially higher risk of heart disease, stroke, and diabetes than other foreign-born persons. However, these risks are comparable to that of heart disease, stroke, and diabetes among native-born persons. It is also conceivable that access to health services plays a role in the risk of hospitalisation for heart disease or related conditions given that higher hospitalization rates have been observed in countries with universal health coverage. Prospective data are needed to refine our understanding of the risk factors associated with heart disease in persons from India. As with interpreting data with any epidemiological study, results should not be generalized to clinical practice without first considering the individual patient's socio-demographic risk profile. Nevertheless, clinicians working in facilities serving foreign-born populations may wish to maintain a higher degree of vigilance for heart disease and its risk factors among persons from India.The author(s) declare that they have no competing interests.PM planned the analysis, outlined the study, reviewed the data and regression analyses, and contributed to the development of the manuscript.HJ compiled the data, designed the small area analyses, and conducted the regression analyses.KK contributed to the planning of the analysis and the preparation of the manuscript.The pre-publication history for this paper can be accessed here:

The authors describe a powerful approach for discovering globally conserved regulatory elements between two genomes that does not require alignments. Its application to pairs of yeasts, worm, flies and mammals, yields a large number of known and novel putative regulatory elements, many of which show surprising conservation across large phylogenetic distances. We describe a powerful new approach for discovering globally conserved regulatory elements between two genomes. The method is fast, simple and comprehensive, without requiring alignments. Its application to pairs of yeasts, worms, flies and mammals yields a large number of known and novel putative regulatory elements. Many of these are validated by independent biological observations, have spatial and/or orientation biases, are co-conserved with other elements and show surprising conservation across large phylogenetic distances. One of the major challenges facing biology is to reconstruct the entire network of protein-DNA interactions within living cells. A large fraction of protein-DNA interactions corresponds to transcriptional regulators binding DNA in the neighborhood of protein-coding and RNA genes. By interacting with RNA polymerase or recruiting chromatin-modifying machinery, transcriptional regulators increase or decrease the transcription rate of these genes. Transcriptional regulators bind specific DNA sequences upstream, within or downstream of the genes they regulate, and a large number of experimental and computational studies are aimed at locating these sites and understanding their functions . The Here we describe a simple and efficient comparative approach for finding short noncoding DNA sequences that are globally conserved between two genomes, independently of their specific location within their respective promoter regions. Our method, which we call FastCompare, is based on a principle that we have termed 'network-level conservation' , accordiOur previous attempts at using network-level conservation relied on Gibbs sampling to find candidate regulatory elements . HoweverSaccharomyces cerevisiae and S. bayanus), worms (Caenorhabditis elegans and C. briggsae), flies (Drosophila melanogaster and D. pseudoobscura) and mammals (Homo sapiens and Mus musculus). For each phylogenetic group, we describe some of the most interesting, known and novel, predicted regulatory elements. For each of these regulatory elements, we perform independent validation using gene expression data, chromatin immunoprecipitation (IP) data, known motifs and data from several biological databases (Gene Ontology (GO)/MIPS, TRANSFAC), and show that the most globally conserved predicted regulatory elements are strongly supported by these independent sources.In the following sections, pairs of closely related species are termed phylogenetic groups. We applied FastCompare to the four following phylogenetic groups: yeasts . We chose to analyze 1 kb-long upstream regions, because most of the known transcription factor binding sites in S. cerevisiae are located within this range NTTTATGGC), while the second site is the known consensus binding site for the Antennapedia (Antp) class of homeodomain proteins [D. melanogaster. Also, FastCompare predicts CAGGTGC, the binding site for the Snail repressor/activator protein, a transcription factor required for proper mesodermal development [Several of the other predicted sites are known to be bound by proteins as one of the most conserved putative regulatory elements between the two flies. This site is the binding site for the POU-domain family of transcription factors, and it is probably bound by one or several of the three POU-domain transcription factors in al cells , whereasal cells .Drosophila genomes were also found when analyzing the worm genomes. For example, GAGA repeats are found to be strongly conserved, slightly oriented 3' to 5' (p < 10-4), and very significantly found upstream of genes involved in morphogenesis (p < 10-23). GTAAACA (rank 147), the DAF16-binding site in C. elegans, is also one of the most conserved sites between the two Drosophila genomes. This site is probably bound by dFOXO, the unique homolog of the C. elegans DAF16 protein in D. melanogaster [Many of the known motifs found when comparing the two nogaster .k-mers are the DRE site and the known AP-4/MyoD binding site . However, both the optimal windows and the median distances in Table d0.025 = 798 and d0.975 = 1,126. Among the 469 highest scoring k-mers, 45 fall below 798 (p < 10-13) and 36 above 1,126 (p < 10-8), once again suggesting weaker positional constraints than in yeasts and worms, at least when considering the first 2,000 bp of 5' upstream sequences.As for both previous phylogenetic groups (yeasts and worms), the median distances to ATG for the conserved elements show that some of the predicted regulatory elements are severely constrained in terms of position. Among the most constrained Drosophila that to the best of our knowledge are unknown (Table Drosophila species [Sxl and sisterlessB) in a subsequent study . It is interesting to see that this particular site is significantly conserved upstream of genes involved in cell fate commitment (p < 10-8).FastCompare predicts many putative regulatory elements in wn Table . One of species ; it was p < 10-9). The same site appears to be strongly oriented 5' to 3' (p < 10-12). Others, such as GTGTGACC or AAATGGCG, appear to be located closer to ATG than most other sites .Some of these sites, such as the palindromic TTAATTA (rank 31), are found much more often in upstream regions than in exons (with an over-representation ratio of 3.07). Others, such as ACACACAC, are found to be significantly enriched upstream of genes in known functional categories ; ACACACAC and TAATTGC (an Antp variant site), embryonic development (p < 10-5). The full list of interactions is available at [We found many potential interactions between the most conserved sites discovered by FastCompare. For example, the POU-domain-binding site ATTTGCATA was found to be strongly co-conserved with TAATTGA, the Antp-binding site, and with many other potential homeodomain sites, such as AATAAAT and TAATTAA. The CACA repeats were also found to be co-conserved with several different sites, and in some cases, the set of genes having both sites simultaneously conserved in their upstream regions (conserved sets) was found to be enriched in certain functional categories, for example, ACACACAC and GAGAGAG, regulation of transcription (lable at .Alu) have colonized mammalian genomes and are likely to be conserved between closely related genomes. The distance between enhancers and the transcriptional start of the genes they regulate can be extremely large, reaching tens of kilobases. Finally, gene predictions and gene boundaries are still largely unverified experimentally for a large number of genes.The much larger noncoding regions of mammalian genomes present significant challenges for computational motif discovery. Also, many repeat elements . However, analysis of the FastCompare output yielded the same validations as for other species. Indeed, the distribution of conservation scores obtained on actual and randomized sequences shows that high conservation scores are very unlikely to be obtained by chance Figure . As withAlu repeats did not influence the output of FastCompare (data not shown). To overcome the overabundance of GC-rich sequences in the FastCompare output, we use longer k-mers as starting points, namely 8-mers instead of 7-mers. We started with the 600 highest-scoring 8-mers, and replaced each of these 8-mers by one of its substrings (7-mer) or one of its superstrings (9-mer), when their conservation score is higher. We then removed duplicates in the list and added the high-scoring 9-mers that have no substrings within the list. This procedure yielded 284 k-mers . Subsequent validation was limited to this small set of high-scoring predictions.We found that masking k-mers. Among these are the well characterized sites for the Sp1, C/EBP, CREB and Myc/Max proteins or families of proteins. These four sites reside very close to ATG (their median distance to ATG is between 100 and 250 bp), suggesting that the four proteins (or families of proteins) may be involved in intimate interactions with the transcriptional complex. Sp1 is an ubiquitous transcription factor, involved in the basal expression of a large number of genes in mammals involve Sp1-binding sites (CCCGCCC or CCGCCCC) with other known sites such as CACGTGAC (Myc/Max), TGACGTCA (CREB), CGCAGGCGC (unknown), GCCAATC (CCAAT-box) and ACTTCCG (Ets), and that the median distances between these sites are relatively small .Interestingly, we found that some of the most conserved interactions between in vivo footprinting and electrophoretic mobility shift assay (EMSA) [D. melanogaster by the anterior morphogen Bicoid, and also recently shown to be bound in human by Goosecoid-like (GSCL) [p < 10-14). It is also the site with the strongest over-representation in upstream regions compared to exons that we observed, with a ratio of 7.06.Among the other predicted regulatory elements returned by FastCompare are CCGCCTC, a site known as the insulin response element ; CGGAAGTy (EMSA) ; TTTCGCGe (GSCL) . InteresFastCompare also predicts ATTTGCAT, the binding site for the POU-domain Oct-1 and Oct-2 proteins, known to bind the promoter and intronic enhancer of immunoglobulin genes ; it alsod0.025 = 342 and d0.975 = 1,185 and found that 83 k-mers among the 284 highest-scoring ones have a shorter median distance than 342 (p < 10-63) and only 11 have a larger median distance than 1,185. Indeed, a majority of the known sites identified by FastCompare are preferentially located near the 5' start of genes, with some elements being very close to ATG . Nonetheless, a few known motifs do not seem to show any positional constraints. For example, the Bicoid-like site TAATCCCAG has a median distance to ATG of 1,258.The distribution of distances to ATG for all 7-mers Figure shows anp < 10-6).FastCompare identifies many putative regulatory elements which to the best of our knowledge are novel Table . Some ofTo gain a better understanding of the network-level conservation of regulatory elements between the different phylogenetic groups, we compared the results we obtained by applying FastCompare to yeasts, worms, flies and mammals in the previous sections. We calculated the overlap (and its significance) of the 400 highest-scoring 7-mers and 8-mers found for each phylogenetic group. As shown in Table k-mers in different phylogenetic groups , we found little overlap. The only significant overlap we found (after Bonferroni correction) was between the GATA sites (GATAAGA) in worm and fly (p = 2.5 × 10-4). As a control, we performed the same analysis within the yeast phylogenetic group, using the S. cerevisiae/S. bayanus and S. paradoxus/S. mikatae 400 most conserved 7-mers. One hundred and ninety-five sites were found in both groups of 7-mers, and for all of them, the overlaps between the conserved sets obtained separately in the S. cerevisiae/S. bayanus and S. paradoxus/S. mikatae analyses were highly significant, with hypergeometric p-values < 10-40. Therefore, our results strongly suggest that, while transcription factors have largely retained their ability to recognize specific DNA sites, their targets have largely changed through appearance or disappearance of those binding sites in promoters. This hypothesis is supported by recent analysis of the fission yeast cell cycle using microarrays, which showed that the role and the binding sites for several of the main transcription factors involved in regulating the yeast cell cycle are conserved between budding and fission yeasts (which diverged about 1 billion years ago), but the sets of genes that they regulate overlap much less than expected (only about 50 orthologous genes are cell-cycle-regulated in both species) [However, when we looked at the overlap between conserved sets for identical high-scoring species) .ATG = 230 for GCCACGCC) make it a promising candidate for experimental testing. Interestingly, the location constraints on these conserved sites can vary across phylogenetic groups. For example, the CRE appears weakly constrained in worms and flies in terms of distance to ATG , but is very close to ATG in mammalian genomes (DATG = 107). However, the distances to ATG of the POU-domain-binding sites indicate that their positional constraints are shared among the phylogenetic groups. The same holds for the HRE binding site .It is particularly interesting to consider the seven 8-mers that are top predictions for all three multicellular phylogenetic groups (note that many more 7-mers are conserved between these groups). These sites include the CRE , the POU-domain binding site (ATTTGCAT), and the HRE (CAAGGTCA). A fourth site is also shared , which to the best of our knowledge is a novel motif. Its strong over-representation in upstream regions compared to coding regions, and its closeness to ATG clearly shows that our method is able to detect conserved and functional motifs in all the phylogenetic groups that we studied. In all analyses, we have shown that some of the discovered known or novel motifs were severely constrained, either in terms of position relative to the start of translation or in orientation. We also observed that some of the known or novel motifs are co-conserved within upstream regions, potentially revealing interactions between the (often unknown) transcription factors that bind them.Our results show that FastCompare can recover most of the known functional binding sites in k-mers discovered by FastCompare to user-supplied sequences or multiple alignments. An example is shown in Figure STE2 gene from four different yeast species were aligned using ClustalW, and the most globally conserved k-mers are highlighted. All experimentally determined sites for STE2 were also predicted to be globally conserved by FastCompare. Moreover, several other sites also appear to be conserved, both at the global level (predicted by FastCompare) and the local level . In Figure We have created a set of web tools to superimpose the most globally conserved k-mer to be on different strands within pairs of orthlogous upstream regions. This flexibility substantially increases the number of k-mers that are supported by independent biological data , at least for yeasts and worms (data not shown). However, it is difficult to evaluate whether this flexibility introduces more true positives than false positives. Also, transcription factors often bind several slightly distinct sites with different affinities, and it is widely acknowledged that binding-site degeneracy is better captured by using position-weight matrices (PWM) instead of k-mers or consensus patterns [k-mers that unambiguously correspond to the same binding sites. Conservation scores for weight matrices were calculated as described for k-mers in Materials and methods, except that we used the weight-matrix score thresholds that maximize the significance of the overlap between the two sets of ORFs containing matches to the weight matrices in each species. This involves progressively lowering the score threshold by small increments, and for each threshold, calculating the overlap and its hypergeometric p-value. We then choose the score threshold corresponding to the most significant p-value, and use the negative natural logarithm of this p-value as the conservation score. As shown in Table k-mers. These results suggest that k-mers provide results that are almost as good as those obtained using weight matrices, when utilizing the network-level conservation criterion. One reason why, in many cases, k-mers have a higher conservation score than weight matrices may have to do with the more narrow selection of k-mers for binding sites with similar or identical affinities. In fact, we recently showed that PWM scores, widely seen as proxies for binding affinity, are statistically conserved in a comparison between S. cerevisiae and S. bayanus [k-mers representing each transcription factor binding site may be defining affinity classes that are more strongly conserved than a looser definition of a binding site represented by a weight matrix. Recent work in bacteria has established the importance of binding affinity, especially with respect to coordinating the temporal order of events [While powerful, our approach has potential limitations. Our current approach allows matches to a given patterns . To eval bayanus . In the f events .k-mer. This suggest that our k-mer based approach is limited in its ability to discover highly degenerate binding sites.However, Table Drosophila and mosquito genomes (which diverged approximately 400 million years ago), we only found a handful of k-mers (interestingly including GATA-factor and Myc/Max binding sites) to have conservation scores above those obtained from randomized data.As shown by our inter-group analysis, many regulatory elements have remained functional across evolution, but few have remained upstream of the same genes. The network-level conservation principle thus appears less applicable to species that diverged very long ago. For example, when we compared the k-mers could be used to seed weight matrices whose individual weights could be optimized for network-level conservation, using stochastic optimization procedures . Introns and downstream noncoding regions could also be explored using our approach, as these regions are known to harbor functional regulatory elements in metazoan genomes. While our approach can deal with genomes presenting arbitrary levels of divergence and rearrangements, it would be interesting to investigate how global alignments or suboptimal and non-overlapping local alignments [There are also several directions in which our approach could be extended. From a methodological standpoint, the approach could be extended to take into account local over-representation of identical or nearly identical copies of the same binding sites, a well known feature in the promoter regions of higher eukaryotic species . To discignments could bek as a candidate regulatory element. For each k-mer, we found the set of ORFs whose upstream regions contain at least one exact match to the k-mer, anywhere in the upstream region, in the first genome. We did the same for the second genome, obtaining another set of ORFs. Then, we calculated the overlap between the two sets and assessed its statistical significance for all yeast species considered in this paper; worm (C. elegans and C. briggsae), Drosophila (D. melanogaster), human (H. sapiens) and mouse (M. musculus) sequence data were downloaded from Ensembl [D. pseudoobscura genome sequences (contigs) were downloaded from [Sequence data were downloaded from the Ensembl . The D. ded from . The upset al. [D. melanogaster and D. pseudoobscura, or between distant species such as S. cerevisiae and C. elegans), we determine orthologs using the reciprocal best BLAST hits approach.Orthology information provided by Ensembl or by Kellis et al. was usedk, we first generated the set of all possible k-mers and removed half of them on the basis of reverse complementarity. We also removed k-mers with very low complexity and which are over-abundant in the intergenic regions of the genomes we analyzed , as these sequences are unlikely to be regulatory elements. Every remaining k-mer is then considered as a candidate regulatory element. For each k-mer, we found the set of ORFs in the first species that have at least one exact occurrence of the k-mer in their upstream regions. We then found the set of ORFs in the second species that have at least one occurrence of the same k-mer in their upstream region. Importantly, the matches can be anywhere in the upstream regions: they do not have to be at the same positions in two orthologous upstream regions and can be on any strand. Since both functional and non-functional elements are expected to be conserved between two closely related species, the two sets are expected to overlap. However, under the network-level conservation principle, the extent of the overlap - and therefore its statistical significance - will be even greater for k-mers that represent functional transcription factor binding sites. The significance of the overlap can be measured using the hypergeometric distribution. The probability of two sets of size s1 and s2, drawn from a set of N elements, to have i or more elements in common is given by :Given a value of k-mers can be ranked by their hypergeometric p-values. It is important to note that due to basal conservation , the hypergeometric p-values will generally be very small for most k-mers. Therefore, we only use these p-values as relative measures of network-level conservation and focus on k-mers with the greatest conservation. For simplicity, we define the 'conservation score' to be the negative logarithm (base e) of the hypergeometric p-value obtained for a given k-mer. Therefore, the more extensive the overlap between the two sets, the higher the conservation score. Also, for the same k-mer, we call 'conserved set' the set of ORFs corresponding to the overlap between the two sets of orthologous ORFs containing at least one exact match to the k-mer in their upstream regions. Conserved sets are used throughout this study to get insights into the function of the most conserved k-mers, using functional annotation [k-mers are constrained in terms of position or orientation.In this way, all notation ,82, chronotation , known mk-mers with a user-specified gap (termed gapped k-mers), which is a straightforward extension of the approach described above. The conservation score returned by FastCompare is independent of the size of the patterns ; therefore k-mers with different sizes, and gapped k-mers can be compared.The current FastCompare implementation handles m highest-scoring 7-mers, with m chosen according to independent biological data . We then replace each of the retained 7-mers by an 8-mer (if there is one) with higher conservation score for which the considered 7-mer is a substring. We also include within the final list the 8-mers which do not have any substrings within the m 7-mers. We then repeat the same process for the retained 8-mers, replacing each of them by its higher scoring 9-mer superstring if there is one, and add the 9-mers that do not have any substring within the 8-mers. This strategy thus allows the optimal length for candidate regulatory elements to be determined.We use the following strategy when applying FastCompare to pairs of genomes. First, we calculate conservation scores for all 7-mers, 8-mers and 9-mers. We then retain only the k, the worst-case time complexity is O(kn + 4k(p + k)), where n is the total amount of upstream sequences and p is the total number of orthologous pairs. Note that the first term is generally much larger than the second one; therefore the complexity of our approach can be seen as linear in the combined sizes of the genomes to be compared . The calculation of hypergeometric p-values involves factorials of large integers, so we use specialized C routines, as described in [FastCompare is implemented in the C language and uses efficient data structures (hash tables and prefix trees ). For a ribed in . FastComk-mers found at the previous stage in the following ways.As described in Results, we applied FastCompare to 1 kb (yeast) or 2 kb upstream regions . While these lengths are reasonable, they are somewhat arbitrary, and it is known that some regulatory elements are constrained to be within specific distances (often shorter than 1 kb) from the start of transcription, reflecting mechanistic constraints for transcription factor-transcription factor or transcription factor-RNA polymerase interactions . Moreovek-mer, we calculated the median distance to ATG for the set of all (non-overlapping) occurrences of this k-mer within the upstream regions of its conserved set (see previous section for a definition of the conserved set of a given k-mer). To statistically assess whether the median distance to ATG for a given k-mer is unusually small or large, we built the distribution P(d) of median distances to ATG, for the entire set of 8,170 7-mers. We first created a histogram by binning the median distances to ATG for all 7-mers into 20-bp bins, and then smoothed the histogram . Then, using numerical integration, we sought the distance thresholds d0.025 and d0.975 such that P(d <d0.025) = 0.025 and P(d <d0.975) = 0.975. We then considered the median distance to ATG for a given k-mer as unusually short or long when it is less than d0.025 or greater than d0.975, respectively.First, for each high-scoring k-mer, we also sought the sequence window which maximizes the conservation score by progressively shortening all upstream regions by 100 bp increments from the 5' end. Then, we did the same from the 3' end using the optimal 5' end found in the previous step. Evaluating every possible window whose length is a multiple of 100 bp almost always yields identical results. We then calculated the conserved sets for these windows, and output the orientation (strand) for each k-mer occurrence within its conserved set .For each k-mer, we used the binomial distribution to assess whether the proportion of occurrences of this k-mer (within its conserved sets) on one strand is significantly smaller (or larger) than 0.5. Binomial p-values less than 0.05 (after Bonferroni correction) are considered significant.Finally, using the results of the previous step, for each k-mers. To focus on heterotypic interactions, we only examined k-mers that differ by more than l nucleotides, after optimal ungapped alignment. We tested several values of l and found that l = 4 was most appropriate when using 7-, 8- and 9-mers. Then, we proceeded as described above, except that instead of seeking two sets of ORFs (one for each species) whose upstream regions contain a single k-mer, we sought the two sets of ORFs that contain the two k-mers simultaneously. Once these two sets were available, we evaluated the extent of their overlap as described above, and rank interaction pairs according to their conservation score.It is now known that the regulatory code governing the expression of genes is combinatorial ,85,86. TWe used randomized data to show that high conservation scores (obtained as described above) are unlikely to be obtained by chance, and independent biological information to assess the ability of FastCompare to predict functional regulatory elements by giving them a high conservation score. We also estimated the over-representation of predicted regulatory elements in upstream regions compared to coding regions.Our goal was to generate new pairs of upstream regions that are conserved at the same level of divergence as the actual sequence data. We align each pair of orthologous sequences using the Needleman-Wunsch algorithm , and calThe proportions of 7-mers supported by each type of independent data, as presented in Figures S. cerevisiae), worm (C. elegans), fly (D. melanogaster) and human (H. sapiens) functional categories and corresponding ORF annotations were downloaded from the MIPS [p-values for functional enrichment were not corrected for multiple testing, but only p-values smaller than 10-4 are reported, providing a slightly less stringent thresholds than Bonferroni corrections.Yeast (the MIPS and GO [the MIPS websitesk-mer as a known motif if it meets the following two criteria. The first is significant overlap (p < 10-4) between the conserved set for the given k-mer and the set of ORFs whose upstream regions contain at least one match to the known motif . The sempareACE to calcuS. cerevisiae [p-value < 0.001 7-mers and removing consensus patterns that matched more than 50 7-mers.The 309 weight matrices and corresponding consensus patterns for known transcription factor binding sites were downloaded from ,91. k-meS. cerevisiae, 555 conditions for C. elegans, 156 conditions for D. melanogaster, and 1,384 conditions for H. sapiens. We use these expression data in the following way.Expression data for all species considered were downloaded from diverse sources ,93. Overk-mer in the upstream regions of genes that are themselves over- or underexpressed in certain microarray conditions. Over- or underexpressed genes are operationally defined as having a log ratio of intensity above average plus two standard deviations, or below average minus two standard deviations, respectively . To evaluate the over-representation of a given k-mer in a given microarray condition, we defined as O1 the set of overexpressed genes in this condition, and as O2 the set of ORFs whose upstream regions contain at least one occurrence of the considered k-mer, genome-wide. Then, we evaluated the significance of the overlap between O1 and O2 using the hypergeometric distribution, as described above. Overlaps whose hypergeometric p-value is smaller than 0.05 (after Bonferroni correction) were considered significant. We proceeded separately with the set of underexpressed genes in the same way. The total number of microarray conditions (overexpressed plus underexpressed) for which a k-mer was found to be significantly over-represented is reported. Note that we do not use the conserved set for the considered k-mer here, as we do not want to restrict our analysis to orthologous genes. Indeed, except for yeast, microarrays often contain only a fraction of all genes within the considered organism. In these cases, the overlap between conserved sets and over- or underexpressed genes can be very small, reducing statistical power. Using all genes, therefore, increases our power to detect significant associations, while retaining a uniform approach for all species considered.We evaluated the over-representation of each k-mer in their upstream regions over the number of genes that have the k-mer in their coding regions (using only exons), and we correct this ratio using the average length of the upstream and coding regions.As shown in for the The FastCompare implementation, all the sequences, and results are available on our website .

Both paclitaxel (P) and carboplatin (C) have significant activity in non-small cell lung cancer (NSCLC). The weekly administration of P is active, dose intense, and has a favorable toxicity profile. We retrospectively reviewed the data of 51 consecutive patients receiving C and day 1 and 8 P chemotherapy (CT) regimen in advanced stage NSCLC to evaluate the efficacy and toxicity.2 intravenously (IV) over 1 hour on day 1 and 8, followed by C AUC 5 IV over 1 hour, repeated in every three weeks. PC was given for maximum of 6 cycles.Patients treated in our institutions having pathologically proven NSCLC, no CNS metastases, adequate organ function and performance status (PS) ECOG 0–2 were given P 112.5 mg/mMedian age was 58 (age range 39–77) and 41 patients (80%) were male. PS was 0/1/2 in 29/17/5 patients and stage was IIIA/IIIB/IV in 3/14/34 patients respectively. The median number of cycles administered was 3 (1–6). Seven patients (14%) did not complete the first 3 cycles either due to death, progression, grade 3 hypersensitivity reactions to P or lost to follow up. Best evaluable response was partial response (PR) in 45% and stable disease (SD) in 18%. Twelve patients (24%) received local RT. Thirteen patients (25%) received 2nd line CT at progression. At a median follow-up of 7 months , 25 (49%) patients died and 35 patients (69%) progressed. Median overall survival (OS) was 11 ± 2 months , 1-year OS ratio was 44%. Median time to progression (TTP) was 6 ± 1 months , 1-year progression free survival (PFS) ratio was 20%. We observed following grade 3 toxicities: asthenia (10%), neuropathy (4%), anorexia (4%), anemia (4%), hypersensitivity to P (2%), nausea/vomiting (2%), diarrhea (2%) and neutropenia (2%). Two patients (4%) died of febrile neutropenia. Doses of CT were reduced or delayed in 12 patients (24%).P on day 1 and 8 and C every three weeks is practical and fairly well tolerated outpatient regimen. This regimen seems to be comparably active to regimens given once in every three weeks. Lung cancer is the leading cause of cancer related deaths all around the world. About 80% of all lung cancers are non-small cell lung cancer (NSCLC) and more than 50% of these patients present with locally advanced or metastatic disease.Meta-analysis of several randomized trials have demonstrated a modest survival advantage for treatment with cisplatin-based regimens in patients with advanced stages of NSCLC ,2. FurthBeing the first of the taxane antimicrotubule agents, paclitaxel (P) demonstrated overall response rates of 21–24% and 1-year survival rates of 37–42% in the phase II trials where it was used as a single agent . AntiangP and C used in combined chemotherapy regimens have significant activity in NSCLC. PC given every three weeks is considered to be one of the standard regimens being used worldwide . The wee3, hemoglobin ≥ 9 g/dl, and platelet count ≥ 100000/mm3), and adequate liver functions and kidney functions (creatinine ≤ 1.5 mg/dl). No prior chemotherapy or radiotherapy was allowed. Patients presenting with known central nervous system (CNS) disease and uncontrolled cardiac arrhythmia were excluded from this study and they were treated with other chemotherapy regimens .All patients with stage III or IV NSCLC treated at Medical Oncology Units of Marmara University Hospital, Dr. Lutfi Kirdar Research and Training Hospital, SSK Sureyyapasa Chest and Cardiovascular Diseases Hospital and Gulhane Military Medical Academy Hospital within July 2002 and August 2003 were considered for this protocol. Eligible patients were required to have pathologically proven NSCLC, stage III or IV disease at presentation or progressed after surgery, performance status (PS) ECOG 0–2, objective measurable disease, adequate bone marrow functions (white blood cell count ≥ 3500/mm2/day) on days 1 and 8, followed by C (AUC 5/6) on day 1, repeated in every three weeks. Both drugs were diluted in 250 ml of normal saline and given intravenously (IV) over 1 hour. No growth factors were administered. Anti-allergic premedication included IV diphenhydramine 50 mg, IV ranitidine 50 mg, and IV dexamethasone 16 mg 1 hour prior to P administration.Patients were treated with P was done on days 1 and 8 of each cycle, liver and kidney function tests on every 2 cycles. Cranial computed tomography scans (CT), magnetic resonance imaging (MRI) and bone scans were performed as clinically indicated. Side effects of the treatment were graded according to the National Cancer Institute Common Toxicity Criteria (CTC), version 2.0 . Colony rd cycle and standard World Health Organization (WHO) criteria were used to determine response [Response was evaluated with CT of chest and/or abdomen on every 3response . IndepenPatients were irradiated with CT based treatment planning and multiple fields arrangements with custom blocking to all fields and involved hilar and mediastinal lymph nodes up to 40–41.4 Gy. Boost was given to the primary tumor. Total dose of 60–61.2 Gy was administered in 1.8–2 Gy daily fractions for 5 days a week and completed in 6 weeks.Overall survival (OS) and time to progression (TTP) were assessed from the date of diagnosis to the date of death (any cause) and the date of objective disease progression (death was considered a progression event in patients who died before disease progression), respectively. Survival rates were calculated by using the Kaplan-Meier method . The preThe data of 51 patients receiving PC treatment were collected retrospectively between July 2002 and November 2003. Median follow-up time was 7 months . Median age was 58 years (range 39–77) and 45% of patients were 60 year-old or above. Eighty percent were male. PS was 0 in 57% of patients and 67% had presented with stage IV disease. Most frequent metastatic sites were the other lung (17), adrenal (10), liver (7) and bone (7). Eighty-two percent of the patients had smoking history, median of which was 40 pack-years . Patients' baseline characteristics are presented in Table The median number of cycles administered was 3 . Seven patients (14%) did not complete the first 3 cycles either due to death (2), progression (3), grade 3 hypersensitivity reaction to P (1) or lost to follow up (1).Best evaluable response was PR in 45% and SD in 18%. Only 22 (43%) patients continued the treatment after the 3rd course. At the end of treatment of these 22 patients 10 (46%) had PR and 6 (27%) had SD, but the other 6 patients (27%) had PD. No complete remission was seen. Twelve patients (24%) received local RT and 4 of these patients were given low dose gemcitabine (75 mg/m2/week × 5–6 weeks) as radiosensitizing agent. Of these 12 patients 3 presented with stage IIIA and all had PR to PC therapy. But of the 5 patients with IIIB disease who were irradiated only one patient had PR, 3 had SD and another one had PD after the 3 cycles of CT. Four patients with stage IV were offered RT for palliation. Thirteen patients (25%) received 2nd line CT at progression and of those only one patient had PR and another SD to this treatment. For 2nd line CT gemcitabine ± cisplatin or C was used in 10 patients (78%) and the rest received other agents like vinorelbine, C or docetaxel. Details of this data can be seen in Table At a median follow-up of 7 months 25 (49%) patients died and 35 patients (69%) progressed. Median OS time was 11 ± 2 months , 1-year OS ratio was 44% , neuropathy (42%) and anorexia 35%). We observed the following grade 3 toxicities: asthenia (10%), neuropathy (4%), anorexia (4%), anemia (4%), hypersensitivity to P (2%), nausea/vomiting (2%), diarrhea (2%) and neutropenia (2%). Two patients (4%) died of febrile neutropenia due to a three day delay in referral to hospital after the onset of fever > 38°, although they were warned about the side effects of the therapy. Doses of CT was reduced or delayed in 12 patients (24%) and C (AUC = 2) given weekly for 6 out of 8 weeks for a total of two cycles. Greater percentage of the patients on arm I received intended CT (30% of P and 55% of C) compared with the other arms (28–29% of P and 21–22% of C). Patients on arm I received more than half of the planned C dose. The main reasons for discontinuation of therapy were progression of disease (31%) and adverse events (15%). Median time to progression and median survival time were significantly higher for arm I than arm II for patients with stage IIIB disease. Performance status of the patients was also statistically related to the survival times. Patients with PS-0/1 had longer median PFS with treatment arm I than arm II and patients with PS-2 had higher median OS with arm I than arm II. Although arm I was the most easily tolerable schedule between the three arms, grade 3 or 4 neutropenia was observed in 22% of the patients included. In this trial treatment arm I had a response rate of 32%, median TTP of 6.9 months, median OS time of 11.3 months and 1-year survival rate of 47%. In our study, response rate was 45%, median TTP was 6 months, median OS time was 11 months and 1-year survival rate was 44%. The majority of our patients comprised of stage IIIB and IV disease, similar to the patient group in Belani's study resulting in similar response rates and survival data [Weekly dose of P in combination with cisplatin or C had been administered in NSCLC patients by Belani et al. ,22. Theyval data ,16.2) given in every three weeks and divided into two consecutive weeks. C dose was calculated according to Calvert formulation with an AUC of 5. This is a lower dose than the dose of C being used in other phase III trials in the literature. In our study only 4 patients (8%) had dose reduction of 10% and 16% of patients had treatment delays of 1 week because of side effects. According to this data, 76% of patients have received the total planned doses of the drugs on scheduled date. Two patients (4%) died of febrile neutropenia due to a three day delay in referral to hospital after the onset of fever > 38°, although they were warned about the side effects of the therapy. It is worth mentioning that none of our patients received any colony stimulating factors.We used the standard dose of P , only 4% of our patients experiencing grade 3 sensory neuropathy. Grade 3 or 4 neuropathy has been reported to be 10–20% in schedules given every three weeks . Belani 2/week × 3 weeks out of four weeks cycles) in maintenance arm or observed until disease progression has occurred. They reported that the maintenance arm was compared to the observation arm and had a median PFS of 38 weeks vs. 29 weeks, median OS of 75 weeks vs. 60 weeks, respectively [Besides the reduced toxicity, weekly administration of P also increases the drugs' anti-angiogenic and apoptotic effects. The metronomic schedule of P has been studied widely during the last few years. P had been shown to inhibit endothelial cell proliferation, motility, invasiveness, and cord formation both in vitro and in vivo Matrigel assays in a dose dependent manner . Belani ectively . AlthougAlthough our study is a retrospective analysis, it is one of the few manuscripts on this PC scheduling in NSCLC in the literature.Paclitaxel on day 1 and 8 and carboplatin every three weeks is a practical and fairly well tolerated outpatient regimen. This regimen seems to be comparably active to regimens given every three weeks. This schedule needs to be further evaluated by well planned randomized phase III trials where it could be compared to the standard regimens in patients with advanced stage NSCLC.The author(s) declare that they have no competing interests.PFY designed the study, followed the patients, collected the data, performed the statistical analysis and drafted the manuscript. NST followed the patients and helped with the manuscript. MG followed the patients and helped with statistical analysis. NFH, OT, AO, TS, MA followed the patients. RA confirmed the diagnosis. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:

Understanding how the cell functions—or breaks down—implies an understanding of the assembly lines, transportation systems, and powerhouses that keep it running. Global approaches are needed to identify the numerous proteins essential to each cellular machine. But which techniques are best? Lars Steinmetz and colleagues applied and evaluated a variety of methods to define mitochondrial proteins, and report that sets of complementary approaches are needed to characterize a cellular subsystem.Yeast mitochondria make an ideal subject for study. About two-thirds of the estimated 700 mitochondrial proteins have been identified to date, leaving fertile ground for new finds. The researchers previously compiled a list of 477 proteins with compelling evidence for mitochondrial involvement. This list provides a well-defined reference set against which to test protein-finding methods. Moreover, the well-studied and accessible yeast genome is well-suited for exploration and genetic manipulation. Since mitochondria are very similar among all eurkaryotes (organisms whose cells have nuclei), the results will prove relevant across species.Steinmetz and colleagues triangulated results from multiple techniques to identify new candidate mitochondrial proteins. They compared the reference protein list to their new data from protein, mRNA, and gene knockout studies, and to 19 published datasets from other researchers, to evaluate the success of different techniques at finding known mitochondrial proteins. Then they combined evidence across studies to identify a set of proteins that likely characterizes most of the mitochondrial machinery.The researchers first identified proteins from yeast mitochondria using a technique called liquid chromatography mass spectrometry, which separates the proteins by water insolubility , then identifies each by the mass and molecular charge of its constituents. By comparing this approach with others, the authors show that this proteomic technique alone is by no means comprehensive, nor error-free. Mass spectrometry is biased toward finding more abundant proteins, and the purified mitochondria can contain contaminants from elsewhere in the cell. To address these issues, the authors compared their protein data with a protein study from another group, the reference protein set, and a recent subcellular localization study. Potential mitochondrial proteins identified by more than one protein approach were more likely to localize to mitochondria in the localization study than were proteins identified by only one approach. This finding suggests that, compared to either method alone, a combination of protein and localization measures can more robustly identify proteins residing in mitochondria.But since mitochondria, as the cell's power plants, are integrated into other cellular machinery, the authors argue, methods targeting proteins that are physically located to mitochondria should be complemented with functional approaches. Proteins with mitochondrial roles, regardless of concentration or location in the cell, are better identified by approaches that associate mRNA expression or gene deletion—which removes proteins or renders them inoperable—with changes in mitochondrial function.By comparing results from multiple methods against the reference protein list, the researchers evaluated the likelihood that each protein was mitochondrial. They compiled a list of 691 top candidates. This multi-technique analysis easily outperformed any single study in terms of its ability to identify proteins in the reference set, and of the proportion of known versus unconfirmed proteins located. As mitochondria are well-conserved across species, the results provide a candidate gene list for finding human counterparts that might be associated with mitochondrial disorders.Future studies can use this analysis to evaluate which research methods are likely to be most informative in other cell systems. This paper demonstrates the power of combining techniques with differing strengths in order to zero in on proteins that might elude any single approach, resulting in a more complete parts list for specific cellular machinery.

Raised activity of the renin-angiotensin system (RAS) may both amplify inflammatory and free radical responses and decrease tissue metabolic efficiency and thus enhance cerebral injury in the preterm infant. The angiotensin-converting enzyme (ACE) DD genotype is associated with raised ACE and RAS activity as well as potentially adverse stimuli such as inflammation. The DD genotype has been associated with neurological impairments in the elderly, and thus may be also associated with poorer motor or cognitive development amongst children born preterm prematurely.The association of DD genotype with developmental progress amongst 176 Caucasian children born at less than 33 weeks gestation was examined at 2 and 5 1/2 years of age. Measured neuro-cognitive outcomes were cranial ultrasound abnormalities, cerebral palsy, disability, Griffiths Developmental Quotient [DQ] at 2 yrs, and General Cognitive Ability [British Ability Scales-11] and motor performance [ABC Movement], both performed at 5 1/2 yrs. All outcomes were correlated with ACE genotype.The DD genotype was not associated with lower developmental quotients even after accounting for important social variables.These data do not support either a role for ACE in the development of cognitive or motor function in surviving infants born preterm or inhibition of ACE as a neuroprotective therapy. Delight over recent survival gains for the very premature infant has been tempered by the frequent presence of cerebral injury and developmental impairment. One quarter of those born before 26 weeks postmenstrual age (at least 11 weeks premature) show evidence of severe cerebral injury including cognitive dysfunction by 30 months of age .Three factors seem to play important roles in the aetiology of preterm cerebral injury. Firstly, exposure to inflammatory stimuli is associated with white matter injury and cerebral palsy in the preterm . SecondlCandidate systems that might influence motor or cognitive outcome after premature birth are likely to be those which affect these responses. The human renin-angiotensin systems may be such a system. Angiotensin converting enzyme (ACE), a key component of the circulating (or endocrine) renin-angiotensin system (RAS), cleaves angiotensin I to yield the potent vasoconstrictor angiotensin II. In addition, ACE degrades vasodilator kinins. In these ways, endocrine RAS plays an important role in circulatory homeostasis. However, local RAS also exist in diverse human tissues including lung, myocardium, vasculature, lymphocyte and brain tissue. These are powerful regulators of mitochondrial respiration and whole-cell metabolism and exerA common variant of the human ACE gene provides a tool to determine if ACE activity does influence developmental progress after preterm birth. The presence rather than the absence of a 284-base-pair fragment in the human ACE gene is associated with lower ACE activity in organs including both circulating inflammatory cells and the The study was approved by the ethical committees of Southmead Hospital and United Bristol Health Care Trust. Parental consent was obtained for participation in neurodevelopmental follow-up . BrieflyThe Griffiths Mental Development Scales, used to assess motor and cognitive performance, was performed at 2 years corrected age . The GriA psychologist performed the Griffiths Scales of Mental Development and a second psychologist performed the British Ability Scales (second edition) (BAS). The ABC Movement tests were performed by a trained research nurse. All assessments were blind to the child's neonatal course and subsequent progress.DNA was extracted from the Guthrie card blood spots (newborn metabolic screening cards). ACE genotype was determined using 3-primer PCR amplification . Primer An estimate of sample size suggested that 144 patients would be needed for this study. The assumptions made for this calculation were that DD genotype infants had a mean DQ of 92.5 (1/2 SD below the norm) compared to a mean DQ of 100 in the ID+II group, assumed typical genotype distributions, and a significance of 0.05 with 80% power.Data were stored in SPPS v9.0 for Windows. Lymphocyte and tissp = 0.047) (table p = 0.65).Guthrie cards were located for 230 of 308 children. After exclusion of non-Caucasians and, at random, 1 child of any identical twin pairs (based on genotypes and gender) 176 babies with ACE genotype formed the study population with follow-up data at 2 years. 122 of these also had follow-up at 5 1/2 years. The ACE genotype distribution was 49 [27.8%] DD, 73 [41.5%] ID, 54 [30.7%] II, demonstrated Hardy-Weinberg equilibrium, and was similar to that observed in the newborn term population from the same region of the UK II). Baseline characteristics were independent of genotype, except that fewer individuals of DD genotype were from twin births . Thus the effect of any one polymorphism, with a relatively minor effect, may be swamped in the newborn infant by other protective mechanisms.The lack of any association between ACE genotype and scores of developmental progress was also surprising because we have demonstrated an association between DD genotype and markers of poor cardio-respiratory instability in the perinatal period in this patient group . This asWe cannot support an association of ACE genotype with cognitive or motor development in survivors born preterm or, thus, the use of RAS inhibition as a neuroprotective agent in the preterm. Given the current lack of understanding of the mechanisms leading to cerebral injury and subsequent impairment – particularly of higher function – in such patients, further genetic association studies of other candidate genes are warranted.ACE, angiotensin-1 converting enzyme; DQ developmental quotient, BAS, British ability scales (second edition); GCA, general cognitive ability; RAS, renin angiotensin system; PCR, polymerase chain rection.The author(s) declare that they have no competing interests.DH, HM, AW, NM conceived the study and its design and wrote the manuscript. DH, DD and SD performed data collection, DNA extraction and PCR and participated in analysis of the data with SH and HM. NM reviewed all cranial imaging. All authors participated in the writing of the manuscript and approved the final manuscript.

Nidation of floating tumour cells initiates peritoneal carcinosis and limits prognosis of gastro-intestinal tumours. Adhesion of tumour cells to extracellular matrix components is a pivotal step in developing peritoneal dissemination of intraabdominal malignancies. Since phospholipids efficaciously prevented peritoneal adhesion formation in numerous animal studies we investigated their capacity to reduce adhesions of gastric cancer cells to extracellular matrix components (ECM).Human gastric cancer cells were used in this study. Microtiter plates were coated with collagen IV (coll), laminin (ln) and fibronectin (fn). Non-specific protein binding of the coated wells was blocked by adding 1% (w/v) BSA and rinsing the wells with Hepes buffer. 50.000 tumour cells in 100 μl medium were seeded into each well. Beside the controls, phospholipids were added in concentrations of 0.05, 0.1, 0.5, 0.75 and 1.0/100 μl medium. After an incubation interval of 30 min, attached cells were fixed and stained with 0.1% (w/v) crystal violet. The dye was resuspended with 50 μl of 0.2% (v/v) Triton X-100 per well and colour yields were then measured by an ELISA reader at 590 nm. Optical density (OD) showed a linear relationship to the amount of cells and was corrected for dying of BSA/polystyrene without cells.The attachment of gastric cancer cells to collagen IV, laminin, and fibronectin could be significantly reduced up to 53% by phospholipid concentrations of 0.5 mg/100 μl and higher.These results, within the scope of additional experimental studies on mice and rats which showed a significant reduction of peritoneal carcinosis, demonstrated the capacity of phospholipids in controlling abdominal nidation of tumour cells to ECM components. Lipid emulsions may be a beneficial adjunct in surgery of gastrointestinal malignancies. In the treatment of gastro-intestinal cancer the detection of free, isolated tumour cells in the peritoneal cavity serve as a prognostic marker for postoperative survival -4. Sincein vitro study was focused on the influence of phospholipids on adhesion of gastric cancer cells to extracellular matrix components with broad reactivity to several integrins. Collagen IV (coll IV), and laminin (ln) are main components of the basement membrane and fibronectin (fn) plays an important role in wound healing [Phospholipids, polar phosphoric acid di-esters, are natural constituents of the abdominal fluid. The substance is able to form a lubricant layer on the peritoneal surface . Additio healing ,18.2, Falcon, Becton Dickinson-Gambil, Heidelberg, Germany) in RPMI 1640 medium , supplemented with 10% foetal bovine serum (GIBCO), penicillin and streptomycin (GIBCO). Cell cultures were incubated at 37°C in a humidified atmosphere of 5% CO2 in air. Cells were passaged after treatment with 0.125% trypsin for 6 min. The cells were pelleted after centrifugation for 10 min at 200 g, suspended in 20 ml PBS, and pelleted. The cell pellet was resuspended in 30 ml complete medium and seeded with a splitting ratio of 1:3. Only cells from three passages were used for the experiments.The human gastric cancer cell line NUGC-4 was purchased from the Japanese Cancer Research Resources Bank . The cells were maintained in monolayers in tissue culture flasks (75 cm2 in air (ln), respectively. Nonspecific protein binding of the coated wells was blocked by adding 1% (w/v) BSA and rinsing the wells with Hepes buffer.Flat-bottom polystyrene microtiter plates were coated for adhesion experiments. The purified ECM components were dissolved in PBS with the following concentrations: coll IV – 2,5 μg/ml , fn – 10 μg/ml , ln – 50 μg/ml . We found these concentrations to be optimal in foregoing dilution series. They were added to the wells and incubated at 4°C for 24 hours , or at 37°C for 45 min in a humidified atmosphere of 5% CO3 and 5 × 104 cells per well, as determined by a dilution series.For adhesion experiments gastric cancer cells were detached with collagenase I , washed once with RPMI 1640, centrifuged (200 g for 10 min), resuspended in RPMI 1640, and preincubated for 30 min in a humidified atmosphere of 5% CO2 in air (37°C). Fifty thousand tumour cells in 100 μl medium were seeded into each well. Evaluation of adherent cells was performed using crystal violet staining according to the method described by Aumeilley et al., and Tietze et al. ,20. AfteControl dying of BSA/polystyrene without cells led to Optical Density (OD) values of 0.01–0.07. These values were subtracted from those obtained in the experiments.After complete preparation of the tumour cell suspension, the PL solution was added in the following concentrations: 0.05, 0.1, 0.5, 0.75, and 1 mg per 100 μl medium. The concentrations used were correlated to our in vivo experiments. The phospholipid solution consists of phosphatidylcholine 70% by weight, phosphatidylethanolamine 15% by weight, neutral lipids 8% by weight, sphingomyelin <3% by weight and lysophosphatidylcholine <3% by weight.All experiments were performed three times in quadruplicate. The data are expressed as means +/- standard error of the mean (SEM). Student's t-test for unpaired data was used for statistical analysis. Differences were regarded as significant for p values < 0.05.The analysis of tumour cell adhesion to BSA 1% resulted in a mean extinction of 0.27 (SEM 0.01) at 590 nm. Coating with ln and fn led to a nearly twofold increase of tumour cell adhesion with mean values of 0.59 and 0.63 . The cancer cells showed a most pronounced adhesion to coll IV with a mean extinction of 0.97 (0.02).The tumour cell adhesion to ln registered after addition of PL was significantly reduced. The effect was concentration dependent compared to the controls. Even the minimum amount of PL 0.05 mg/100 μl led to a reduced extinction of 0.4 (0.01). Treatment with 0.1 or 0.5 mg/100 μl PL revealed extinction values of 0.32 (0.02) and 0.28 (0.02), respectively. The maximum effect could be demonstrated with 0.75 mg/100 μl PL with an extinction of 0.24 (0.02). The relative reduction of tumour cell adhesion compared to the control amounts to 59%. Treatment with 1 mg/100 μl PL showed no further decrease of tumour cell adhesion to ln. The mean extinction was 0.26 (0.01) and 0.59 (0.01). However, a significant reduction of tumour cell adhesion could be observed after treatment with 0.5 mg/100 μl PL, 0.42 (0.02); as well as with 0.75 mg/100 μl PL (0.39 (0.02)) and 1 mg/100 μl PL (0.38 (0.02)). We found a similar situation compared to ln with equal effects of 0.75 mg/100 μl and 1 mg/100 μl PL indicating that the maximum influence on adhesion is reached. The relative reduction of tumour cell adhesion compared to the control values amounts to 40% after administration of 0.05 mg/100 μl PL to a maximum effect after treatment with 1 mg/100 μl PL with a value of 0.44 (0.02) table . In compCell adhesion to the extracellular matrix plays a fundamental role in peritoneal carcinosis. The adhesion is mediated by transmembrane Integrins. Several proteins including fibronectin in the interstitial matrix, laminin and collagen IV in the basement membrane were identified as important ligands ,22. Manyin vitro as well as a reduction of tumour weight after intraperitoneal tumour injection [In our experiments the reduced rate of cell attachment in the presence of phospholipids was independent from the extracellular matrix. A similar effect on intraperitoneal tumour growth was described by Jacobi et al. who could demonstrate that taurolidine/heparin and povidone iodine lead to a significant reduction of tumour cell growth njection . Predominjection . Dextrannjection ,32. Howenjection ,34. PhosThe hypothesis is that phospholipids form a lubricant layer on the peritoneum by binding with its negatively charged cholin branch chain to the positively charged peritoneal surface ,14,35. Pin vitro experiments with tumour cells as soluble agents added to ECM immobilized onto plastic surfaces cannot appropriately mimic the situation in situ. Recently we found that phospholipids significantly reduce the attachment area and the tumour volume of peritoneal carcinosis caused by the colonic cancer cell line DHD/K12/TRb in rats. These results were supported by a prolonged survival rate of the treated animals as compared to the control group. Additionally, we found a similar effect of phospholipids on the adhesion of the human rectal cancer cell line HRT-18 on the same ECM-components in vitro [The in situ tumour cell – ECM interaction is influenced by adhesive and non-adhesive ECM components and can be understood as a three dimensional network . Therefoin vitro . Consistin vitro ,6,38,39.We performed this study to ascertain the results of the foregoing animal experiments and to demonstrate the influence of phospholipids to three different ECM components, even though matrices of collagen IV, laminin and fibronectin alone may not be predictive of peritoneal membrane nidation.These results, within the scope of additional experimental studies on mice and rats which showed a significant reduction of peritoneal carcinosis, demonstrated the capacity of phospholipids in controlling abdominal nidation of tumor cells to ECM components. Lipid emulsions may be a beneficial adjunct in surgery of gastrointestinal malignancies.The work was financially supported by Fresenius Kabi, Bad Homburg, Germany.The results are part of an international patent application.The pre-publication history for this paper can be accessed here:

Pregnancy in patients with lipoprotein lipase deficiency is associated with high risk of maternal pancreatitis and fetal death. A very low fat diet is the primary treatment modality for the prevention of acute pancreatitis, a rare but potentially serious complication of severe hypertriglyceridemia. Since pregnancy can exacerbate hypertriglyceridemia in the genetic absence of lipoprotein lipase, a further reduction of dietary fat intake to < 1–2% of total caloric intake may be required during the pregnancy, along with the administration of a fibrate. It is uncertain if essential fatty acid deficiency will develop in the mother and fetus with this extremely low fat diet, or whether fibrates will cross the placenta and concentrate in the fetus.A 23 year-old gravida 1 woman with primary lipoprotein lipase deficiency was seen at 7 weeks of gestation in the Lipid Clinic for management of severe hypertriglyceridemia that had worsened with pregnancy. While on her habitual fat intake of 10% of total calories, her pregnancy resulted in an exacerbation of the hypertriglyceridemia, which prompted further restriction of fat intake to < 2% of total calories, as well as administration of gemfibrozil at a lower than average dose. The level of gemfibrozil, as the active metabolite, in the venous and arterial fetal cord blood was within the expected therapeutic range for adults. The clinical signs and a biomarker of essential fatty acid deficiency, namely the ratio of 20:3 [n-9] to 20:4 [n-6] fatty acids, were closely monitored throughout her pregnancy. Despite her extremely low fat diet, the levels of essential fatty acids measured in the mother and in the fetal blood immediately postpartum were normal. Normal essential fatty acid levels may have been achieved by the topical application of sunflower oil.An extremely low fat diet in combination with topical sunflower oil and gemfibrozil administration was safely implemented in pregnancy associated with the severe hypertriglyceridemia of lipoprotein lipase deficiency. Primary lipoprotein lipase (LPL) deficiency is a rare autosomal recessive disorder characterized by severe hypertriglyceridemia, due to the accumulation in plasma of chylomicrons and very low density lipoproteins (VLDL) that result from the absence of LPL activity . The estThe management of severe hypertriglyceridemia in a pregnant patient with LPL deficiency is directed toward preventing pancreatitis in the mother and delivery of a healthy infant. Lowering of plasma TG in the prevention of pancreatitis is managed primarily by dietary fat restriction, but additional TG lowering may be required and has been reported with use of fibrates, such as gemfibrozil ,9,10. TwThe proband presented to her pediatrician at age 3 month with failure to thrive. She was evaluated at the Children's Hospital Medical Center in Seattle, where an elevated TG level of 14,000 mg/dl (158 mmol/L) suggested hyperchylomicronemia with LPL deficiency. Plasma post-heparin LPL activity was absent, consistent with defective catabolism of TG rich particles. Further study at the University of Washington of her post-heparin plasma at age 19 revealed absent LPL activity due to a defective LPL protein, while her hepatic lipase activity was normal . She wasth week of gestation. A 5 lb 3 oz baby girl with a 5-minute Apgar score of 9 was delivered vaginally. A short time after the delivery, the baby was briefly intubated for about 48 hours due to respiratory distress but did well subsequently. The patient's plasma TG rapidly decreased to 2015 mg/dl (22.8 mmol/L) within the first postpartum 24 hours, accompanied by improved abdominal symptoms. Resumption of low fat solid food brought back the symptoms of pancreatitis and she was placed back on the IV fluids followed by a more gradual incremental introduction of oral intake. Along with 1,200 mg/day of gemfibrozil, she had complete resolution of abdominal symptoms by postpartum day-8 and eventual resolution two weeks after discharge of peri-pancreatic fluid accumulation demonstrated by CT imaging studies. Now, 11 years later, the proband and her daughter are both healthy and doing well. The proband's TG levels are back to baseline and stable on 10–20% fat diet. Her daughter has had normal TG and cholesterol levels on regular diet.At the age of 23, the proband presented at week 7 of gestation for management of anticipated worsening of hypertriglyceridemia in pregnancy. She had been in excellent physical condition and had continued her routine 10–20% fat diet during the first trimester , also developed at week 27. A concomitant regnancy .Because of concern for unfavorable fetal neurological development due to EFA deficiency, EFA profile was monitored in the mother at each visit starting at gestational week 23. The initial analyses were performed at the Clinical Nutrition Research Unit (CNRU), Harborview Medical Center campus of the University of Washington. After separation from cells, the fatty acids from the phospholipid fraction of the plasma were extracted and subsequently measured by capillary gas chromatography. In addition to the total amount and % of each FA, the ratio of eicosatrienoic acid ) to arachidonic acid ) was calculated by high performance liquid chromatography (HPLC) and revealed similar concentrations of the drug and its active metabolites in both umbilical vein and artery, which were within the normal reference range for adults Figure .Children with primary LPL deficiency can be effectively managed on fat-restricted diets and grow normally into adulthood. However, they can present with extreme elevation of TG levels with serious acute pancreatitis. This LPL-deficient subject developed severe hypertriglyceridemia in early pregnancy, with eruptive xanthomas and pancreatitis. With the diligent efforts from the patient, her family, and a team of specialists in lipid metabolism, dietetics, high-risk obstetrics and gastroenterology, a successful outcome was achieved. Outcome goals were clearly set at the onset of her pregnancy care, including nutritional management of the expected rise in triglyceride levels associated with the estrogen surge of pregnancy to prevent acute pancreatitis, and avoidance of clinical EFA deficiency in both the mother and the fetus.Pregnancy-induced hypertriglyceridemia is estimated to be the cause in 4–6% of all pancreatitis cases during pregnancy, while most cases result from cholelithiasis . SuccessPregnancy is a well known situation in which the physiologic estrogen surge profoundly alters the TG-rich lipoprotein metabolism, resulting in a gradual rise in TG levels over the course of non-complicated pregnancy, peaking at the level of 200–300 mg/dl (2.26 – 3.39 mmol/L) at term . During Arachidonic acid , an important precursor of the prostaglandin compounds, cannot be synthesized de novo from FFA in mammals and must be derived from another EFA in the diet, namely linoleic acid . In the case of life long low oral fat intake, as in our patient, clinical EFA deficiency might occur with depletion of n-3 and n-6 FA stored in adipose tissue. Therefore, her source of EFA would be entirely from recent dietary intake and deficiency might occur sooner than in individuals with normal LPL and abundant EFA storage . EicosatUse of TG lowering drugs, such as gemfibrozil (a fibrate), can be used to directly lower the triglyceride level in the prevention of acute pancreatitis. Pregnancy induces hepatic production of TG-rich VLDL and may respond to fibrates through inhibition of hepatic production of VLDL. Gemfibrozil, which is an FDA category C drug, has not been observed to be associated with adverse drug effects in reports of pregnancy-related severe hypertriglyceridemia ,10,36,37In conclusion, a successful pregnancy outcome was achieved in our LPL deficient patient, confirming previous reports ,43 that The author(s) declare that they have no competing interests.ECT was a senior fellow in Metabolism, Endocrinology and Nutrition and drafted the manuscript. JAB was the dietitian. Both MSV and GJA contributed to the measurement of fatty acids. GJA was also a consulting scientist in fatty acid metabolism. AC and JDB were the faculty associated with the case at the UW GCRC. JDB conceived of the research, supervised the fellow, and coordinated the manuscript revisions.The pre-publication history for this paper can be accessed here:

There is a growing body of evidence linking health and well-being to key business issues. Despite this, corporate uptake of workplace health promotion programmes has been slow outside the USA. One possible reason for this is the lack of a generally available health risk measure that is quick and easy to administer and produces data that is rich enough to inform and direct subsequent employee health promotional interventions.We report on the development and validation of the health and well-being (HWB) assessment, a free to use health risk appraisal questionnaire that has been specifically developed for use in the corporate setting. The HWB assessment focuses upon modifiable health issues that directly impact upon business drivers. Development involved interviews with business leaders to ascertain their key areas of focus, scientific and general literature review to find evidence for health status having an impact upon these areas, and end user testing.Three UK-based organisations participated in the research. A total of 2224 employees completed the HWB assessment, the short-form 36 (SF-36) and the World Health Organisation Health and Work Performance questionnaire (WHO-HPQ) as part of the validation process.th percentile were more likely to achieve workplace productivity standards than those with scores below the 25th percentile .The HWB assessment is a twenty item questionnaire covering ten areas of health and well-being. Completion of the HWB assessment generates a global health risk score and ten sub-scores corresponding to the ten areas covered. It is easy to use and quick to complete (average completion time was eight minutes) and showed good internal consistency and test-retest reliability. Statistically significant correlations with similar SF-36 variables were observed. A significant negative correlation between HWB score and productivity decrement, as measured by the WHO-HPQ, was observed (r = -0.4). Individuals with HWB scores above the 25The HWB assessment generates reliable business focused health risk data that can be used to direct and target appropriate interventions within corporate populations. It may also be useful in quantifying the financial impact health status issues have upon organisations. The last decade has seen increasing interest in the health and well-being of the workforce. This has been driven partly by the increasing burden of direct healthcare costs, but also from a recognition that the economy within the developed world has appreciably changed,2. The rThe evidence for the impact of many lifestyle factors upon long-term health is overwhelming. Smoking, excess alcohol intake, poor nutritional status, a sedentary lifestyle and psychological distress have all been associated with numerous diseases -10. IndeWith these issues gaining greater ascendancy in the corporate world, we saw a need for a short, easy to administer questionnaire that could capture this business critical health status information. By conducting a confidential survey of all employees, aggregated data can be used to provide a first step by which organisations can target and monitor appropriate population-based health interventions within their workforce. A key issue in conducting such surveys is maintaining individual privacy and ensuring confidentiality of information. The majority of US organisations who already conduct annual health surveys of their employee populations do so either via their occupational health departments or external third parties.Although there are a number of general and specific health risk appraisal measures available for corporate use, they are either not well validated, suffer from being too long and cumbersome to administer, or cost an appreciable amount to use. In the case of health related quality of life measures, such as the SF-36, or specific stress indicators such as the general health questionnaire (GHQ), the data that is generated is not specific enough to direct health and well-being interventions within the corporate setting.We report on the development and validation of the health and well-being (HWB) assessment, a free to use twenty item questionnaire. We also describe its use in assessing the impact employee health has upon productivity and performance.Our principal aim was to develop a questionnaire that focused upon business pertinent health and well-being issues. A secondary aim was that it should be quick and easy to administer with the amalgamated results serving as a baseline from which employers can start to implement appropriate health promotion interventions within their employee populations.We initially surveyed a sample of twelve business managers and executives to ascertain the key issues currently facing their organisations. Interviewees came from four different business sectors, namely (i) Technology (ii) Engineering (iii) Banking and Insurance and (iv) Public sector / Health. Interviews lasted no more than 30 minutes and were semi-structured, asking each interviewee to describe the key issues they faced in their day-to-day operations. We then searched the general and scientific literature for evidence of the effect health parameters have upon the issues identified. The key business issues facing our sample of corporate leaders could be categorised into four separate areas. Table Initial questionnaire development involved formulating items that corresponded with the health and well-being areas that impact upon the four key business issues. An initial set of 40 questions was tested and discussed in one to one interviews and focus group discussions. Thirty-five employees and managers, from companies in the four industry sectors described previously, participated in these sessions. Question changes and selection were an iterative process, with the final questionnaire formulated after three rounds of small group testing and one round of initial data collection from 100 volunteers. This background research and subsequent refinement led us to construct a 20-item questionnaire covering ten areas of health and well-being were invited to complete the questionnaire via the internet. All data transmission utilised 128-bit encryption and all data storage was fully compliant with the UK Data Protection Act (1998). All participants were required to electronically sign an agreement for their anonymised data to be used in amalgamated format for purposes of research. A draw with a prize of a weekend break was offered as an incentive to participate for each company group. Thirty employees re-took the questionnaire four weeks after the initial completion date in order to provide test re-test data.As well as completing the newly developed questionnaire, participants were also asked to concurrently complete the Short Form 36 (SF-36) and part B of the World Health Organisation's Health and Work Performance (WHO-HPQ) questionnaire in order to assess criterion validity,25. The For each participant in the study details on age, gender, sickness absence in the preceding three months, company position, marital status and weekly working hours were also collected.Statistica, a statistical software package distributed by Statsoft Inc. All data analysis was carried out using Of the 3000 employees invited to participate in the study, 2224 completed the questionnaires (74% response rate). Online completion ensured that there were no missing data points in completed questionnaires. The mean age was 38.1 years (standard deviation 10.7). Fifty-nine per cent of respondents were female , mental health vs. symptoms of stress (r = 0.70) and mental component summary measure (MCS) vs. stress (r = 0.71). Additionally, there was a clear association between the overall HWB score and the General Health and Vitality scores of the SF-36 (r = 0.59 and 0.49 respectively). All SF-36 multi-item scales were significantly correlated with the overall HWB score (p ≤ 0.01).th percentile was 10% and 75th percentile was 33.5%)The 2224 individuals who completed the HWB assessment and the SF-36 also completed part B of the WHO-HPQ. The output from the WHO-HPQ is a calculated productivity decrement for each respondent, i.e. the proportion of the week that the individual is not working optimally, either because they are absent or because they are not working effectively [A negative correlation between the HWB score and calculated productivity decrement was observed , i.e. better health status, as measured by the HWB assessment, was associated with less weekly productivity decrement.General linear model analysis indicated that age and the overall HWB score were the only two variables that remained as significant predictors of weekly productivity decrement (p < 0.0001 for both).th percentile figure of 33.5% productivity decrement per week was taken as the cut-off for achieving the productivity standard within the current population.The 75Similarly, the lower quartile HWB score of 52.1 was used as the cut-off to define poor health. 2 × 2 table analysis using these cut-offs demonstrates an odds ratio of 3.62 for making the productivity standard if HWB score is above the lower quartile value, Chi squares 158.82 (Yates Corrected), p < 0.0001.There was a significant correlation between the single question on effectiveness contained in the HWB assessment and the productivity decrement, as calculated by the WHO-HPQ, .Thirty individuals re-took the HWB assessment four weeks after their original completion date. During this time no information or intervention with regard to health and well-being was delivered to them. The correlation between HWB scores at both time points was excellent (r = 0.90), with no significant differences between mean scores or variance of the data sets.Table The association between employee health status and costs incurred by employers is incontrovertible. Numerous studies have clearly shown how health risk factors directly impact upon medical care costs, short- and long-term absence and workers' compensation,27-29. AAs already mentioned, although well-established questionnaires have been extensively validated in many different populations the data that is generated is often of limited value in specifically directing health and well-being interventions. We have presented the first steps of the development and validation of a health risk appraisal measure that has been specifically designed for use in the corporate setting. As well as having good content, criterion and construct validity, the generated data can help health promotion specialists develop appropriate and targeted interventions for the respondent population. The questionnaire provides information on areas such as nutritional choices, levels of habitual physical activity, sleep difficulties and stress symptoms. Amalgamated answers can be used to ensure the correct and most appropriate health interventions are delivered to the population being assessed. In addition, the single question on work effectiveness can be used to confirm the link between the health of the population being studied and their performance, prior to more in-depth evaluations of productivity such as can be made with a specific productivity measure.One would naturally expect those individuals who have taken more time off due to illness to have worse health than those who have been absent for less time. We have demonstrated that sickness absence in the preceding three months is a significant predictor of HWB score and remains so when other variables are controlled for. This is an indication that the HWB assessment is indeed measuring the health and well-being issues that are critical to businesses as a whole. Further confirmation of the discriminant validity of the HWB assessment is needed, however a suggestion that it can detect real differences in health status between groups is also seen in the significantly better scores observed between those with more senior positions as compared with those in junior positions. This difference possibly reflects the better financial rewards, the better access to healthy alternatives and the superior levels of job control associated with more senior corporate positions.The fact that the HWB score and sub-indices were significantly correlated with the broadly similar SF-36 multi-tem scales is an indication that the majority of the constructs assessed by the SF-36 are at least partially reflected in the HWB.Productivity whilst at work can be influenced by a multitude of different factors, however as demonstrated by Burton and colleagues, health is a major contributor. Our stuAlthough these initial results appear promising, data collection from a larger employee sample, from different sectors and incorporating a wider age range, is necessary in order to confirm that our observations still hold true. Normalising the scoring (as is often performed with SF-36 data) would also make interpretation easier and more user friendly. Additionally, longitudinal data on whether the HWB assessment can be used as a predictive tool for populations, and hence provide businesses with visibility on how their employee health status issues are likely to affect their bottom line, is the logical next step. This process is already underway in four multinational organisations with populations in both the USA and the UK and is being overseen by the Institute for Health and Productivity Management (IHPM).In summary we present a new health risk measure, the Health and Well-being Assessment (HWB), which has the following key features:(i) has been specifically designed for the corporate environment addressing the health and well-being issues that affect key business drivers(ii) is quick, easy and free to use(iii) the generated data is useful for guiding future interventionsBy combining medical health issues with other more "lifestyle" and well-being focused areas within a short, easy to use questionnaire we believe that we have created a useful corporate tool.GHQ – General Health QuestionnaireHWB – Health and well-beingROI – Return on InvestmentSF-36 – Short Form 36 questionnaireWHO-HPQ – World Health Organisation Health and Work Productivity QuestionnairePM has a part-time salaried role with health and well-being business consultants Vielife.No other financial competing interestsNo non-financial competing interests.PM performed all of the work that is contained within this paper.Health & Well-being Questionnaire Questionnaire and scoring algorithms.Click here for file

Allermatch™ A query amino acid sequence is compared with all known allergenic proteins retrieved from the protein databases using a sliding window approach. This identifies stretches of 80 amino acids with more than 35% similarity or small identical stretches of at least six amino acids. The outcome of the analysis is presented in a concise format. The predictive performance of the FAO/WHO criteria is evaluated by screening sets of allergens and non-allergens against the Allermatch databases. Besides correct predictions, both methods are shown to generate false positive and false negative hits and the outcomes should therefore be combined with other methods of allergenicity assessment, as advised by the FAO/WHO.Allermatch™ provides an accessible, efficient, and useful webtool for analysis of potential allergenicity of proteins introduced in genetically modified food prior to market release that complies with current FAO/WHO guidelines. A step-by-step procedure to assess allergenicity is described by the Codex alimentarius and the FAO/WHO consultation group [The safety of genetically engineered foods must be assessed before authorities in most nations will consider granting market approval. An important issue in current food safety assessment is the evaluation of the potential allergenicity of food derived from biotechnology. Since many food allergens are proteins, introduction of a new ("foreign") protein in food by genetic engineering can in theory cause allergic reactions. Therefore the allergenicity of novel proteins needs to be assessed. Potential allergenicity of a protein is a complex issue and various tests can be used for prediction, including bioinformatics, on group ,2. An imon group to estab(1) Obtain the amino acids sequences of known allergens in protein databases in FASTA format .(2) Prepare the complete set of 80-amino acid length sequences derived from the query protein .3) Compare each of the sequences of (2) with all sequences of (1), using the program FASTA [ Compare According to the Codex alimentarius , potenti(a) More than 35 % similarity over a window of 80 amino acids of the query protein with a known allergen.(b) A stretch of identity of 6 to 8 contiguous amino acids.This procedure is described in more detail by the expert consultation and the Codex Alimentarius. Potential allergenicity requires further testing of the protein with panels of patient sera and possibly animal exposure tests ,2.. Leader sequences were, if annotated, trimmed from the sequence. The SwissProt allergen list contains 334 mature protein sequences, while the WHO-IUIS allergen list contains 632 sequences . These two databases contain 236 duplicate entries. The non-redundant combined database contains 730 sequences windows using a sliding window with steps of a single residue. Each of these windows is compared with all sequences in the allergen database of choice. All database entries showing a similarity higher than a configurable threshold percentage (default is 35%) to any of the 80 aa query sequence windows are flagged. Upon completion of the analysis, a table is shown with all flagged database entries. Per entry, the highest similarity score is given, as well as the number of windows having a similarity above the cut-off percentage. For each allergen database entry identified, more detailed information on the similarity between the allergen and query sequence can be retrieved, such as those areas of both proteins within all 80 aa windows scoring above the cut-off percentage. The similarity score calculated by FASTA can apply to stretches smaller than 80 aa, Allermatch™ converts such a similarity score to an 80 aa window. For example, 40% similarity on a stretch of 40 aa converts to 20% similarity on an 80 aa window.This method looks for short sub-sequences (words), which have a perfect identity with a database entry. The wordsize is configurable (default is 6 aa). The output given is similar to the output given by Mode 1. All database entries with at least one hit are listed and for each of these, more detailed information can be retrieved upon request.The Allermatch™ webtool also offers a full alignment of the query sequence with either of the allergen databases using FASTA. Although this full alignment is currently not required by the FAO/WHO guidelines, the full alignment of protein sequences helps positioning of regions of potential allergenicity in the whole primary structure of the protein. The FASTA output is parsed and information from the allergen database is added and presented.To examine the predictive performance of the FAO/WHO criteria for potential allergenicity, we have performed two tests. The first test determines the percentage of false negative and the second test assesses the amount of false positives. Both tests are performed with standard settings; for the sliding window approach an 80 amino acid window with a 35% similarity cutoff is used and for the wordmatch approach 6, 7 and 8 aa word sizes are tested.The false negative error-rate is estimated by a leave-one-out method, testing all sequences in each Allermatch™ database against that database with the tested sequence excluded. Each sequence not resulting in a hit is considered a false negative. The results of each method/database combination are summarized in Table i.e. T1 (related to Bet v 1), human serum albumin , and human heat shock protein 70 . A selection of unrelated, non-allergenic proteins is therefore likely to give a lower false positive rate. Caution should be taken in interpreting these false hit rates. The used methods might perform differently with other sets of proteins. For example, a member of a completely novel group of valid allergens is likely to generate a false negative result.In the second test, we assess the odds of a false positive by testing 12 protein sequences known to be non allergenic. This is based on non-reactivity of these proteins towards IgE-sera of allergy patients or on the inability to cause IgE-responses in experimental animals and confirm results, before arriving at conclusions. To prevent false positives as much as possible, one should choose for the well-annotated SwissProt database. To prevent false negatives, the combination of the larger WHO-IUIS database with that of SwissProt is more appropriate. Updates to the SwissProt and WHO-IUIS allergen lists will be incorporated in the Allermatch™ databases on a regular basis.The prediction of potential allergenicity by primary sequence comparison depends on the quality of the data used for comparison. Addition of a non-allergenic or poorly annotated protein to any of the Allermatch™ allergen databases would obviously result in undesired false positives and should be prevented. A workable strategy could be to use multiple databases, Several other websites in the public domain offer sequence alignment facilities that support the prediction of potential allergenicity, such as SDAP ,11, AlleAllermatch™ is an efficient and comprehensive webtool that combines all bioinformatics approaches required to assess the allergenicity of protein sequences according to the current guidelines in the Codex. The application will be kept up to date with the FAO/WHO criteria and the SwissProt and WHO-IUIS allergen lists. It will be extended with other, supplementary methods to support and refine the prediction of allergenicity..Allermatch™ is platform independent and accessible using any Netscape 4+ compatible webbrowser at MF developed and implemented the Allermatch™ webtool. HN provided the domain name registration and advised in the web site development. GK and AP provided the scientific background and constructed the sequence databases. JPN and RvH provided time, resources and ample discussion. All authors have read and approved the final manuscript.

The protein structure prediction problem is one of the most challenging problems in biological sciences. Many approaches have been proposed using database information and/or simplified protein models. The protein structure prediction problem can be cast in the form of an optimization problem. Notwithstanding its importance, the problem has very seldom been tackled by Constraint Logic Programming, a declarative programming paradigm suitable for solving combinatorial optimization problems.Constraint Logic Programming techniques have been applied to the protein structure prediction problem on the face-centered cube lattice model. Molecular dynamics techniques, endowed with the notion of constraint, have been also exploited. Even using a very simplified model, Constraint Logic Programming on the face-centered cube lattice model allowed us to obtain acceptable results for a few small proteins. As a test implementation their (known) secondary structure and the presence of disulfide bridges are used as constraints. Simplified structures obtained in this way have been converted to all atom models with plausible structure. Results have been compared with a similar approach using a well-established technique as molecular dynamics.The results obtained on small proteins show that Constraint Logic Programming techniques can be employed for studying protein simplified models, which can be converted into realistic all atom models. The advantage of Constraint Logic Programming over other, much more explored, methodologies, resides in the rapid software prototyping, in the easy way of encoding heuristics, and in exploiting all the advances made in this research area, e.g. in constraint propagation and its use for pruning the huge search space. Notwithstanding the continuous improvement in predictive methods, witnessed every two years by the world wide CASP experiment ,2, predi1. assemblying the structure of a protein using structural fragments of similar sequences, available in the protein structure repository (the Protein Databank ), and la2. representing the protein chain by a highly simplified model which is, hopefully, treatable.) lattice studied by Toma and Toma , 1, 10)domain domain {1, 2, ..., 10}. Suppose we wish to state that the weight of each item of X is 3, of Y is 4, and of Z is 5 and the total weight of selected items must be less than or equal to 40. Moreover, we wish to state that the number of items of X plus those of Y must be less than those of Z. This can be simply stated as:is a constraint that states that the three variables X + 4 * Y + 5 * Z ≤ 40, X + Y <Z3 * knapsack problem using . In general, in the modeling stage we can use constraints as well as declarative programs involving them.We have modeled a sort of constraint solver that is available in the language. The constraint solver uses constraints for sensibly pruning the search tree. One of the main capabilities is called constraint propagation. Constraint propagation reduces the domains of the variables eliminating those values that cannot lead to constraint solutions. For instance, in the considered example, constraint propagation reduces the domains of the variables X, Y, and Z to {1, ..., 4}, {1, ..., 4}, and {3, ..., 6}, respectively. For finding a possible solution, a further built-in capability – the labeling predicate – can be used. We can look for a generic solution as well as for a solution minimizing some function. In the example above, we could ask for minimizing the function -2X2 + Y + 4Z. This can be done by adding a constraint of the form:Solution's search is performed by a F = -2 * X * X + Y + 4 * Z, labeling([minimize (F)], ).The constraint solver then exploits the solution's search using constraint propagation and branch-and-bound techniques returning the answer:F = 3, X = 3, Y = 1, Z = 5F be a linear function.The library clpfd of SlCStus Prolog allows tConstrain & Generate technique introduced as opposed to the Generate & Test technique of the classical Logic Programming approach . In theWe have followed the Constrain & Generate programming style for encoding the protein structure prediction problem. As a matter of fact, the main predicate of our solution is of the form reported in Figure Methods Section), writetime and print_results are output predicates. The constraint predicate is defined using several predicates each of them modeling one of the properties of the problem. For instance, the predicate next_constraints sets the distance between consecutive aminoacids .Briefly, next_constraints recursively calls the predicate next for each pair of consecutive aminoacids. Assume that < code described in the Methods Section. All tests are done using SICStus PROLOG 3.11.1 [In Table G 3.11.1 and a PCN of aminoacids, the execution time, the energy of the best model found and its RMSD from the native structure for all the residues and for the core residues only. When there is not explicitly written "limit" it means that the program successfully terminated in the time reported; otherwise the program terminated due to time limit. We wish to observe that the results with time limit 10 h/24 h are typically computed in few hours. The rest of the time is used to further explore the solutions' space.From left to right, the meaning of each column is as follows: the protein PDB identification code, the number η is reported a further constraint on the compactness ratio η is added before the search. CF = η bounds the linear distances |Xi - Xj|, |Yi - Yj|, and |Zi - Zj| between all pair of residues i and j to ηN where N is the length of the primary list. If η is low (e.g. 0.2), this constraint imposes a compact form to the protein and strongly reduces the running time.When a CF = ss = γ is reported.One of the structural constraints considered is the presence of disulfide bonded residues (ssbonds). The rigid structure of the lattice is such that a low value of Euclidean distance between ssbonds often precludes all possible solutions. For this reason the default is chosen as 6. However, in some cases we tried computations with lower value. In these cases in the table the text GOR IV secondary structure prediction method [The secondary structure, as computed from the deposited structure in PDB, has been input as constraint. As a unique exception, in the case of 1VII(*) we have instead predicted it using the n method .Detailed models from lattice models Section. There is some improvement in general on RMSD from native structure. This is especially significant when the starting structure is already close to the native one, being not merely due to increasing compactness of the structure. It is moreover reassuring that the procedure we are discussing is able to recover realistic models starting from the very simplified lattice models. The RMSDs of the resulting detailed models from the corresponding native structures are reported in Table The predicted structures have been also transformed into all atoms models as described in the 3. For the sake of comparison, we have used it as an ab-initio predictor . The comparison is obviously not fair because in our case secondary structure is known and not predicted. Times are obtained from the result files, but it is not clear to which machine/CPU occupation they refer. Results are reported in Table We conclude the section comparing some results of our prediction with those returned by the well-known HMMSTR/Rosetta Prediction System . This pr on the lattice. Secondary structure elements have been imposed through a constraining potential as described in the Methods Section. In order to search the conformational space a simulated annealing procedure has been adopted. Globularity of the simulated proteins is forced by a harmonic constraint on the radius of gyration.We have used secondary structure information in conjunction with the well-established methodology of molecular dynamics simulations in order to implement a procedure similar to the one implemented using α atoms on the whole protein and only on core residues and the simulation time. The last column reports the RMSD from native structure for models obtained by after addition of all atoms and energy minimization as described in the Methods Section.The simulation time, ranging approximately between one and four CPU days, required for folding each protein on a 1.533 GHz AMD Athlon processor is reported in Table The simulation time needed for obtaining structures similar to native structures increases with the size of the protein both for the increasing size of the system and for the longer simulated annealing runs needed because of increasing complexity of the free energy landscape. Unfortunately a safer scheme would employ substantially longer simulation times.This fact prompts for searching alternative ways to employ the same ideas.The results in terms of RMSD from native structure support the idea that folding may be achieved, at least in simulation, by a hierarchical approach where local secondary structure elements are formed first and later their arrangement and contacts are optimized. A similar conclusion has been reached using a different model by Maritan and coworkers . The RMS. With respect to the few applications reported in the literature so far using the same methodology [. In the present application the known secondary structure of the protein has been imposed as a constraint. has been applied on face centered cubic lattice models of proteins where every aminoacid is represented by a single point on the lattice that can take one out of six possible positions with respect to the previous three aminoacids. It is immediately seen that the time needed for a systematic space search for such model grows exponentially with the number of free aminoacids. is a programming paradigm that is suited for the solution of optimization combinatorial problems. In the problem and the related heuristics are extremely natural to be programmed. Moreover, the constraint propagation allows to control the search in the huge solution's space.The purpose of the present work was to demonstrate that the protein folding problem can be approached by a well-established programming paradigm like hodology , mainly hodology ,24, the The results obtained using this approach and reported in Tables Further work is being devoted towards a more realistic modeling representation of the protein, with at least two centers of interaction per residue, and towards refinement of the potential function by including a term for rotamer preferences. This term should map on the lattice the directional preferences of each unit with respect to the previous three units. Each of the six possible next positions for each unit should be weighted by an energy term derived from database analysis.α trace, the RMSD on core residues of the resulting models, after energy minimization, compared to native structures, is as low as 4.8 Å for the thermostable domain of villin headpiece (PDB id.: 1VII), 3.6 Å for the WW domain (PDB id.: 1E0M), 2.3 Å for the coat protein-binding domain of bacteriophage P22 (PDB id.: 2GP8).Also the optimal size of non constrained parts of the chain will be determined in order to allow more possible relative orientations among constrained secondary structure elements, possibly without increasing significantly the computation time. At present, however, when the positions of all atoms are reconstructed from the lattice CIt should be also noted that both the thermostable domain of villin headpiece and the WW contain three secondary structure elements that can be arranged in different ways in order to produce a compact structure. The low RMSD is therefore significant.A comparable protocol employing a molecular dynamics simulated annealing procedure still leads to superior results for larger proteins, as expected because the protein representation is more accurate, but it takes longer execution times between one and four days on a 1.5 GHz P3 machine. could be useful for finding starting conformations for further refinement.Recent results have shown that simplified models and more refined models can be employed successfully in hierarchical modeling procedures ,10. The primary structure. This structure uniquely determines the (3D) native conformation, also known as tertiary structure. The protein structure prediction problem is the problem of predicting the tertiary structure of a protein given its primary structure. The native tertiary structure minimizes the global free energy of the protein.The sequence of aminoacids defining a protein is called sphere centered in its Cα atom; the distance between two consecutive Cα atoms is assumed to be 3.8 Å Recent results and the value of 2.6 Å empirically determined in [contact has been developed [x, y) the energy value associated to a contact between aminoacids x and y ; this value can either be positive or negative, according to the pair x, y.We consider each aminoacid as a single e, e.g., ) show thmined in for van eveloped ,13. Let Face-Centered Cubic Lattice that allows realistic angles between consecutive residues. The lattice is composed by cubes of size 2, where the central point of each face and the vertices are admitted. Thus, the domain consists in a set of triples <x, y, z> where <x, y, z ∈ >. We recall that given a point <x, y, z>, its 2-norm is: ||<x, y, z>|| = . Given two points p1 and p2, ||p1 - p2|| is known as their Euclidean distance.According to we use t lattice, two points at Euclidean distance are linked together, forming a lattice unit, corresponding to the distance of 3.8 Å. In this lattice, each point is adjacent to 12 neighboring points. A contact is defined between two non adjacent residues placed on two vertices of a side of a cube . This number can be considered a good approximation of the limit of 6.4 Å described above.Going back to the S = s1 ... sn, with si aminoacids, a fold of S is a function ω : {1, ..., n} → such that: ||ω(i) - ω(i + 1)|| = and ||ω(i) - ω(j)|| ≥ 2 for i ≠ j. The first constraint states that consecutive aminoacids have a fixed distance, corresponding to one lattice unit; the second that each aminoacid occupies a unitary sphere and that two spheres cannot overlap.In this setting, it is possible to formalize the protein folding problem as an optimization problem. Given a sequence ω of S such that the following energy is minimized [The protein folding problem can be reduced to the optimization problem of finding the fold inimized ,27:ω(i), ω(j)) is 1 if ||ω(i) - ω(j)|| = 2, 0 otherwise. To avoid solutions equivalent modulo simple symmetries, other constraints can be added on the first positions.where contact is proven to be NP-complete on various lattices ,29. Howe., e.g., )SAWfcc = 1.26N0.162(10.0364)N     (2)This formula should modify in the presence of additional constraints as mentioned later.Background Section. The complete program and related material can be found in [ where ℓ is the length of each unit and α is the cosine of the angle made by each unit with the direction of the preceding unit. The average end-to-end distance is clearly related to the average maximal dimension of the chain. Based on a survey of protein structures Huang and Powers derived the following approximated formula for the radius of gyration (in Å): 2.2N0.38 [ the radius of gyration. The default value for CompactFactor was therefore assumed to be approximately equal to times the radius of gyration which in turn was computed by the empirical formula 2.2N0.38 [Our implementation of the protein folding minimization problem described in the above sections is based on the code briefly introduced in the found in . The profound in . In part2.2N0.38 . Note th2.2N0.38 .The auxiliary file data.pl stores the Primary and Secondary structures of the proteins that one wishes to test, as, for instance in the example reported in Figure lattice to be even (a property of the lattice) and we add some constraints for avoiding equivalent symmetric solutions. In what follows, we refer to predicate names as used in the code. avoid_symmetries removes redundant admissible conformations equivalent to others modulo some symmetries and/or rotations. The predicate assigns immediately three consecutive aminoacids positions (in the Tertiary list).The intrinsic complexity of the problem forces us to introduce several other constraints. For instance, we constrain the sum of the coordinates of each aminoacid in the Cαs modelling aminoacids.With distance_constraints, we also impose that two non consecutive residues must be separated by more than one lattice unit, to reflect the steric interaction between the x, y, z coordinate, is smaller than CompactFactor × N.As described above, compact_constraints imposes that, for every pair of aminoacids, the norm of the projection of their distance on each lattice, the angle between three consecutive residues can assume values in {60°, 90°, 120°, 180°}. In real proteins, steric occupancy and energetic potential show a clear distribution of bend angles in the range 90°–150° [ lattice, it is a good approximation to exclude 60° and 180° angles, as unfeasible. This constraint allows us to restrict the search space from a number close to 10N (cf. formula (2)) to a number close to 5N.Further constraints are related to angles. In the 90°–150° ,35. WhenLattice model Section, a contact is generated by two non consecutive aminoacids with Euclidean distance less than or equal to 2. As a consequence of the constraints applied, it suffices to check for a contact when the lattice distance equals 2, since distance_constraints excludes from the domain the possibility to place two non consecutive aminoacids at one lattice unit.As said in the i, j): elements i, i + 1, ..., j of the input sequence form an α-helix; strand: elements i, i + 1, ..., j are in a β-strand; ssbond: there is a disulfide bridge between element number i and j.We also impose constraints coming from secondary structure information. Secondary structure can be predicted with good approximation . In ourIndexes that stores torsional angles defined by four consecutive aminoacid positions. Due to lattice structure and our constraints, every four consecutive aminoacids can form only 6 discrete angles. Thus, each variable in Indexes can assume a value i from {0, ..., 5}, representing torsional angles of 0°, 60°, 120°, 180°, 240°, 300°, respectively. With these conventions, helices are approximated by sequences of indexes of the form 5, 5, 5, ... while β-strands are associated to sequences of the form 3, 3, 3, .... Note that specifying the coordinates of three points (i.e. to place and orient the protein) and the indexes, uniquely determines the conformation, ssbond, introduces a maximum distance constraint between the aminoacids i and j. The predicate energy_constrain is developed using an auxiliary symmetric matrix M. The optimal fold is reached when the sum of M elements is minimal. During the labeling phase, the information stored in M is used to control the minimization process and to cut the search tree.We use an auxiliary list called solutions_search. We describe here briefly the main features of this predicate and of its auxiliary predicates.To reduce the size of the solution's space visited during execution, we have replaced the built-in labeling predicate with an ad-hoc constraint-based solution search predicate, called solutions_search • If the Tertiary list or the Indexes list is ground , then it terminates the folding process .choose_labeling. When this procedure terminates, it calls recursively solutions_search. Termination is guaranteed by the fact that each call to choose_labeling reduces the number of non-ground variables.• Otherwise, it calls choose_labeling • If the number of variables to be instantiated is low (in our code less than 4), it calls the built-in labeling.selection_strategy. This predicate computes several subsequences of the list of Indexes. Each subsequence consists of alternations of ground elements and non-ground variables. selection_strategy selects the most known subsequence, namely the one containing the smallest ratio of variable over ground indexes, preferring the ones that include a ssbond. If in the selected subsequence there are too many variables, an arbitrary subsequence cut is done. After the subsequence is selected, the procedure labeling_new_launch is called.• Otherwise, it calls labeling_new_launch It calls the auxiliary predicate labeling_new but stops the solution search when the global runtime is greater than the input time limit. If this is the case, the best computed solution is returned.labeling_new This procedure receives the chosen sublist to be folded. Each index variable in it, is assigned an admissible value between 0 and 5. The order of values that is tried for each index is described by a pre-computed auxiliary list. For each torsional index, a frequency statistics of the 6 indexes is pre-computed and extracted from the PDB, according to the specific aminoacid sequence involved locally. We use this information to direct the search and explore first the most common torsional angles, in the hope that this selection rule reflects nature's strategy.t of variables in a phase, we collect the best known ground admissible solution, its energy and its associated potential matrix. We compare the current status to history and decide if it is reasonable to cut the search tree. In particular, we designed a heuristic that allows to control the effectiveness of the cut, adapting it dynamically to the status of the fold. Practically, when the protein is partially specified, we estimate the ratio between ground and non-ground variables in the potential matrix. If the ratio is low (i.e. the protein is poorly determined), we allow the current energy to be worse than the corresponding counterpart in the best fold so far reached. When the ratio is high we constrain the current energy to be slightly lower than the previous best known.Moreover, the energy associated to the fold is minimized. For doing that, after each instantiation of a fixed number θ - θ0)2 kcal/(mol rad2). The reference target angles (i.e. θ0 in the previous formula) were set to φ = -139 and ψ = 135 for residues in β-strand and to φ = -48 and ψ = -57 for residues in α-helices. For all constrained residues also the ω dihedral angle was constrained at 180 degrees.In order to have a fair comparison with a similar approach using all-atom protein models we built detailed all atom models for six proteins in the studied set and imposed, through torsional constraints, the secondary structure geometry found in the native structure. The constraining potential was 100 * was imposed. The target radius was decreased during the simulation from a value proper of an extended conformation down to the value given by 2.2N0.38 [N is the number of residues.In order to obtain globular protein during simulation a constraint on the radius of gyration using the Generalized Born implicit solvent model was performed. The resulting structure at the end of the simulation was energy minimized.The models obtained by t server into an t server and the procedure were constrained as described above.The initial minimizations required 1500 minimization steps each, because the starting structures were built from the lattice models. The final minimization, on the structure relaxed by molecular dynamics simulation, employed 900 minimization steps. During molecular dynamics simulation the radius of gyration and backbone torsion angles corresponding to residues constrained in the

Whether inhaled corticosteroids suppress airway inflammation in chronic obstructive pulmonary disease (COPD) remains controversial. We sought to determine the effects of inhaled corticosteroids on sputum indices of inflammation in stable COPD.We searched MEDLINE, EMBASE, CINAHL, and the Cochrane Databases for randomized, controlled clinical trials that used induced sputum to evaluate the effect of inhaled corticosteroids in stable COPD. For each chosen study, we calculated the mean differences in the concentrations of sputum cells before and after treatment in both intervention and control groups. These values were then converted into standardized mean differences to accommodate the differences in patient selection, clinical treatment, and biochemical procedures that were employed across original studies. If significant heterogeneity was present (p < 0.10), then a random effects model was used to pool the original data. In the absence of significant heterogeneity, a fixed effects model was used.We identified six original studies that met the inclusion criteria (N = 162 participants). In studies with higher cumulative dose (≥ 60 mg) or longer duration of therapy (≥ 6 weeks), inhaled corticosteroids were uniformly effective in reducing the total cell, neutrophil, and lymphocyte counts. In contrast, studies with lower cumulative dose (< 60 mg) or shorter duration of therapy (< 6 weeks) did not demonstrate a favorable effect of inhaled corticosteroids on these sputum indices.Our study suggests that prolonged therapy with inhaled corticosteroids is effective in reducing airway inflammation in stable COPD. Chronic obstructive pulmonary disease (COPD) is characterized by prominent airway inflammation ,2. The iOne potential therapy for down-regulating the inflammatory process in the airways is through the use of corticosteroids, which are potent but non-specific anti-inflammatory agents. Some in vitro studies have demonstrated that inhaled corticosteroids can modulate certain aspects of the inflammatory cascade in COPD ,9; howevMEDLINE (1966–2004), EMBASE (1980–2004), CINAHL (1982–2004), and the Cochrane Databases were searched for randomized, controlled clinical trials that used induced sputum to evaluate the effect of inhaled steroids on airway inflammation in stable COPD. The search was restricted on articles published in the English language, using human participants. Subject headings included disease-specific search terms , drug-specific search terms , and laboratory method-specific search terms . We also scanned the bibliographies and reference lists of retrieved articles to supplement the electronic searches. We contacted the primary authors for additional data and/or clarification of data.1), the ratio of FEV1 to forced vital capacity (FVC), percent predicted reversibility with inhaled bronchodilator, the specific brand of inhaled corticosteroids and the dose as well as the duration of therapy. Cumulative dose of inhaled corticosteroids was calculated by multiplying the average daily dose by the total days of treatment. All formulations were converted to beclomethasone equivalent based on the recommendations from the Canadian Asthma Consensus Report [The primary objective of this meta-analysis was to compare the changes in sputum inflammatory indices among stable COPD patients before and after treatment with inhaled corticosteroids, using the control group in each individual studies as the referent. We chose sputum as the primary source of the analysis because there was a marked scarcity of quality studies which had evaluated the effect of inhaled corticosteroids from bronchoalveolar lavage fluid or tissue biopsy specimens. The inflammatory indices included total cell, neutrophil, macrophage, eosinophil, lymphocyte, and epithelial cell counts and interleukin (IL)-8 levels. Since the actions of oral corticosteroids may differ from those of inhaled corticosteroids, we excluded studies that evaluated the effects of oral corticosteroids on sputum inflammatory indices. From each selected article, two investigators abstracted the following baseline information: the source of data, study design, inclusion and exclusion criteria, concomitant drugs, demographics of study participants including sample size, age, sex, current smoking status, pack-years of smoking history, predicted forced expiratory volume in one second , indicating that inhaled corticosteroids had a favorable effect in reducing total count compared with controls Figure . ImportaInhaled corticosteroids had a salutary effect on neutrophil counts in the sputum. As compared with the control group, the standardized mean difference in those treated with inhaled corticosteroids was -2.16 units Figure . InhaledTo evaluate whether the magnitude of the reduction in the inflammatory cells was modified by the absolute levels of the inflammatory cells in the sputum at baseline, we performed a stratified analysis based on the total cell counts at baseline Figure . For preBy combining data across the clinical studies, we increased statistical power to demonstrate a salutary effect of moderate to high doses of inhaled corticosteroids on some inflammatory indices in the sputum of patients with stable COPD. Over a short term, these medications reduced neutrophil, lymphocyte and epithelial cell counts in the sputum of stable COPD patients. They had smaller (and insignificant) effect on sputum eosinophils and IL-8. They had little effect on sputum macrophages. Although the magnitudes of these reductions were relatively small, they may explain why inhaled corticosteroids decrease cough and sputum production , reduce We also found that duration of therapy and total cumulative dose, which are related constructs, made a material difference to the overall results. Short trials (less than 6 weeks in duration) were uniformly "negative"; while longer term trials (at least 6 weeks of therapy) were mostly positive. Similarly, trials that exposed the patients to higher cumulative dose were more "positive" than those that exposed patients to lower dose. This suggests that duration of therapy and total cumulative doses may be important determinants of the effect of inhaled corticosteroids on airway inflammation.Although corticosteroids delay neutrophil apoptosis and may increase neutrophil survival ,26, they1. Although there was a trend towards improvement, we did not find a statistically significant effect of inhaled corticosteroids on FEV1. Larger randomized trials have demonstrated, however, that inhaled corticosteroids significantly improve FEV1 over the first three to six months of therapy [Superficially, the present data on sputum eosinophils appear to be inconsistent with the known effect of corticosteroids in general on eosinophils. Many experiments have shown that eosinophils are exquisitely sensitive to corticosteroids ,30. The therapy ,32-34, sIn the present review, we did not include randomized studies that used bronchoalveolar lavage (BAL) or bronchial biopsies to measure inflammatory cells in the airways. However, in one study, Balbi and colleagues observedWe also did not include studies that used systemic corticosteroids. Barcyk and colleagues have repAlthough in the present review, we could not adequately determine the effects of tobacco smoke exposure on the relationship between inhaled corticosteroids and airway inflammation, there is a growing body of evidence to suggest that active smoking may attenuate the effectiveness of corticosteroids in suppressing airway inflammation. Active smoking increases oxidative stress and up-regulates the production of various pro-inflammatory cytokines including Il-6, IL-8, IL-1β and monocyte chemoattractant protein-1 in airways, which may through a series of complex pathways lead to a state of steroid resistance . AdditioThere are certain limitations with the present analysis. First, although we used stringent entry criteria in order to minimize the heterogeneity in the research methods employed by each of the selected study, there were still some variations in the study design, the exposure medications, and the target population across the original studies. However, the differences in the characteristics of the studies were relatively small and unlikely to have materially affected the overall findings of the current review. We also contacted the primary authors to clarify any ambiguities or to obtain additional data, where necessary, to further minimize the "noise" inherent to meta-analyses. Moreover, to accommodate various differences in the methodology of data collection and laboratory techniques employed across the original studies, we converted the individual data into standardized mean estimates, which enhanced the comparability of data across the original studies. Second, it is possible that corticosteroid therapy could have affected the volume of sputum recovery, decreasing the total sputum cell counts in those patients exposed to this therapy. To mitigate this possibility, the cell counts were expressed as cells per volume of sputum recovered.In summary, the present meta-analysis suggests that inhaled corticosteroids when used for longer than 6 weeks can significantly reduce neutrophil counts and other inflammatory indices in the sputum of patients with stable COPD. Large randomized controlled trials are needed in the future to confirm these early findings and to determine whether these salutary effects persist longer than 3 to 4 months of therapy.COPD chronic obstructive pulmonary disease1 forced expiratory volume in 1 secondFEVFVC forced vital capacitySD standard deviationIL-8 interleukin-8DDS and SFP have received honoraria for speaking engagements from GlaxoSmithKline (GSK) & AstraZeneca, and have received consultation fees and research funding from GSK. However, no part of this work was financed by these companies. This work was funded by Canada Research Chair and a Michael Smith/St. Paul's Hospital Foundation Professorship in COPD.All the authors contributed to the design and implementation of the study. Data analyses were performed by WQG and DDS. All authors contributed to the write-up of the manuscript.The pre-publication history for this paper can be accessed here:

Order Charadriiformes (shorebirds) is an ideal model group in which to study a wide range of behavioural, ecological and macroevolutionary processes across species. However, comparative studies depend on phylogeny to control for the effects of shared evolutionary history. Although numerous hypotheses have been presented for subsets of the Charadriiformes none to date include all recognised species. Here we use the matrix representation with parsimony method to produce the first fully inclusive supertree of Charadriiformes. We also provide preliminary estimates of ages for all nodes in the tree.Three main lineages are revealed: i) the plovers and allies; ii) the gulls and allies; and iii) the sandpipers and allies. The relative position of these clades is unresolved in the strict consensus tree but a 50% majority-rule consensus tree indicates that the sandpiper clade is sister group to the gulls and allies whilst the plover group is placed at the base of the tree. The overall topology is highly consistent with recent molecular hypotheses of shorebird phylogeny.The supertree hypothesis presented herein is (to our knowledge) the only complete phylogenetic hypothesis of all extant shorebirds. Despite concerns over the robustness of supertrees (see Discussion), we believe that it provides a valuable framework for testing numerous evolutionary hypotheses relating to the diversity of behaviour, ecology and life-history of the Charadriiformes. Prosobonia leucoptera, the Canary Islands oystercatcher Haematopus maedewaldoi, and the Great auk Pinguinus impennis.The shorebirds and allies presentet al. The higher resolution of the majority-rule tree means it is more likely to be of use in comparative studies. We therefore estimated node ages for this topology only see and 2. WA fuller understanding of the phylogenetic affinities of fossil shorebirds will probably improve estimates of node ages for the group. For example, the extinct form Graculavidae, is represented by fossils from the Maastrichtian of New Jersey and Cretet al. [b but used a range of methods including parsimony and Bayesian analyses. We therefore combined these trees to minimise bias. In contrast, Ericson et al. [et al. [Supertrees are still at an early stage of development and many aspects of MRP, and supertree methods in general, are not yet clearly understood. Steps can be taken to ensure that the supertree includes the most appropriate sets of sources trees, such as only using trees from explicitly phylogenetic studies. This is not always straightforward and could result in the exclusion of important information. For instance, in our shorebird supertree, we included Sibley and Ahlquist's DNA-DNA hybridisation tapestry althoughet al. based thn et al. used two [et al. should b [et al. ,33 and tOur shorebird supertree is highly consistent with recent advances in the molecular phylogenetics Charadriiformes. However, we urge caution when using the tree in comparative analyses and encourage the additional use of alternative phylogenies and branch length assumptions. It is particularly important to note that the position of some groups such as the Alcinae remains controversial and that although the majority rule tree is consistent with recent molecular studies, the strict consensus tree fails to resolve the deepest nodes.Gallinago and Vanellus are desirable. Furthermore, additional work is required to establish the true affinities of the Turnicidae. Nonetheless, it appears that shorebird phylogeny is gradually approaching a consensus view. The broad taxonomic scope and consistency of the supertree mean that is of potentially great value to future comparative studies (accepting the caveats discussed above) of the behaviour, life-history, ecology and conservation of this diverse group.The supertree presented here is, to our knowledge, the first attempt to reconstruct the phylogeny of the entire order Charadriiformes. Overall, the supertree is highly consistent with recent molecular hypotheses of shorebird phylogeny. However, it is apparent that fresh attempts to resolve both the phylogeny and estimates of age will be dependent on further gene sequencing and new fossil discoveries. The affinities of the Alcinae and the relationships between the three major shorebird clades require further corroboration, and studies of several genera such as covering the years 1981 to 2004. We used the single key strings phylogen*, cladistic*, clado*, classif*, systematic*, and taxonom* in the topic field, in conjunction with a major Charadriiformes taxon name (scientific or common). As supertree methods have been criticized for being biased towards historical trends, we preferred those studies that explicitly set out to derive a phylogenetic hypothesis and so exclude purely descriptive taxonomic works. The Sibley and Ahlquist [Possible source trees were identified from online searches of Web of Science Ahlquist DNA-DNA Ahlquist . We therAhlquist DNA-DNA contra Monroe and Sibley [Larus thayeri [Larus glaucoides or a spd Sibley include d Sibley . We incld Sibley to produd Sibley ). The oud Sibley ,68. ThisWe produced an MRP matrix of the 51 Nexus source tThe tendency of large data sets to produce many sub-optimal trees that are close in length and topology to the shortest tree is a serious problem in phylogenetics. Standard heuristic searches frequently are trapped searching within globally sub-optimal "islands" and the tree search is often aborted before completion. Nixon proposedWe did not calculate any measures of branch support for two reasons. First, their validity and meaning is questionable in MRP supertrees . Second,et al. [Nupharanassa tolutaria, Rupellian), Phalaropus , Burhinidae , Glareolidae , Alcinae , Stercoariini , and Larini . We took the midpoint of the range from the Fossil Record 2 [Following Purvis and Biniet al. we datedet al. as the sRecord 2 as our dRecord 2 ). We assRecord 2 in termsRecord 2 . The phyet al. [A, B, and C where A and B are sister taxa and C is sister to A and B. The root is dated to 10 million years (myr) from fossil evidence, and independent molecular data provides estimates of divergence based on the number of substitutions per site. The molecular estimates of branch lengths are as follows: A, 6 substitutions; B, 8 substitutions; C, 20 substitutions; A and B are 11 substitutions from the root. A and B are therefore separated from their common node by a mean of 7 substitutions. The total length from A and B to the root is thus 18 substitutions compared to 20 for C (a mean of 19). This can be converted to date estimates such that 19 substitutions are equivalent to 10 myr. The dates of the tree are then: , C: 10)). There were no cases where multiple source trees with molecular divergence dates were able to provide estimates for the same node. We estimated relative dates from multiple nodes rather than a single dated node to minimise correlative errors in estimates.Source trees may include estimates of relative branch lengths . This allows further dating of the supertree but is problematic because different relative estimates are not comparable and cannot be applied directly to the supertree . Howeveret al. . For exaTo provide date estimates for all nodes in the tree we employed a pure birth model to date nodes for which absolute and relative dates could not be attained . Pure bidate of daughter = date of ancestor *(log daughter clade size/log parent clade size)For example, the age of a daughter node that subtends 12 taxa, estimated from its immediate ancestor dated to 20 myr and which subtends 19 taxa is:20*(log(12)/log(19)) = 16.879We applied this approach to estimate the ages of daughter nodes based on dates of ancestral nodes. We had no ancestral node on which to base estimates of the most basal clade. In this case, we rearranged the pure birth formula and calculated the age of the ancestral node from its two daughter nodes, taking the mean as our "best estimate". Finally, to estimate the ages of nodes between daughter and ancestor nodes of known age we spaced the nodes evenly along the branches length .GHT assisted in the design of the study, carried out the phylogenetic analyses and node dating, and drafted the manuscript in partial fulfillment of a doctoral degree at the University of Bath. MAW assisted in the design of the study and with editing and revision of the manuscript. TS assisted in the design of the study, collection of source trees, and editing and revision of the manuscript. All authors read and approved the final manuscript.Estimates of node ages and node support (branch lengths.xls) Node numbers correspond to figures 2-9. Five types of estimate were used: a) absolute dates from the fossil record; b) absolute dates from molecular point estimates; c) relative dates based on branch length estimates from molecular studies; d) estimates based on a pure birth model (see text for details); and e) even spacing of nodes along branches with daughters and ancestors of known age. The numbers of characters supporting each node are provided (column D), this is equivalent to the number of source trees that share the equivalent node (see text for details).Click here for fileShorebird supertree Shorebird supertree based on 50% majority-rule consensus of 1496 shortest trees with calibrated branch lengths. Scale bar indicates time from the present in millions of years.Click here for fileShorebird supertree Shorebird supertree based on 50% majority-rule consensus of 1496 shortest trees.Click here for fileSource trees (source trees.xls) A summary of each tree used is given including the data type and main taxa studied. This is a brief summary and the original papers should be consulted for full details.Click here for fileMRP matrix (shorebirdMRP.txt) The MRP matrix used in the shorebird supertree analysis.Click here for fileCalibrated supertree (shorebirdsupertree.txt) The supertree in nexus format including branch length estimates.Click here for file

Natural variation rather than genetic modification - is this the way to achieve global food security? But I notice also that they may become fixed and permanent in any stock, by painting and repainting them on every individual, until at last nature adopts them and bakes them into her porcelain”—Ralph Waldo EmersonThe history of domesticated plant form and function evolves along a two-tiered track that doubles back on itself, offering panoramic vistas of natural forces intertwined with the creative force of human endeavor . For appPLoS Biology have been selected by humans in the last 10,000 years and inevitably represent a subset of the variation found in their wild ancestors. Cultivars are recognizable because they manifest characteristics that are associated with domestication in plants. Unusual or extreme phenotypes, such as large fruit or seed size, intense color, sweet flavor, or pleasing aroma are often selected by humans and maintained in their cultivars for aesthetic reasons, while synchronous ripening or inhibition of seed shattering are selected to facilitate harvest. These phenotypes may occur in nature but they will frequently be eliminated by natural selection before they are fixed in a population. Because of human selection, cultivars may exemplify a range of exaggerated phenotypic attributes that give them the appearance of being, on the whole, more diverse than some of the wild populations from which they were derived, but in truth, domestication usually represents a kind of genetic bottleneck. Furthermore, cultivars are grown in agricultural environments that are generally more uniform than the environments in which wild species grow, and this tends to further narrow the gene pool. Thus, while cultivars may embody a high degree of obvious phenotypic variation, this may not always be a good predictor of the extent of their genetic variation.The landrace varieties are the earliest form of cultivar and represent the first step in the domestication process. Landraces are highly heterogeneous, having been selected for subsistence agricultural environments where low, but stable yields were important and natural environmental fluctuation required a broad genetic base . LandracWild relatives and early landrace varieties have long been recognized as the essential pool of genetic variation that will drive the future of plant improvement . Early pIn today's world where automated sequencing and DNA synthesis are mundane activities, it may seem contradictory to be worrying about saving or using “old genes.” Can't new ones be synthesized to order? Can't we modify a plant at will by introducing a new gene or two into an existing variety? Why should we worry about saving populations of historically valuable genes in millions of living plant specimens at great cost to the tax-paying public?Perhaps it is not the genes themselves we are now in fear of losing. It is the information they encode in all their combinatorial complexity. After all, we are only at the very beginning of the endeavor to understand the way in which a genotype confers a particular set of attributes to a living organism. The subtleties of phenotypic plasticity in the face of a changing environment and the layers of genetic redundancy that characterize biological systems are largely mysterious. We have only just begun to consider the millions and billions of genetic trials and errors that have been evaluated by nature over evolutionary time. We cannot even begin to simulate the selective filters that have provided us with the diversity of form and function in the living world. We do know that living forms of natural diversity are needed to sustain life, and that it would be impossible to replace or recreate that diversity if it were lost at this time.As plant breeders, we know what to do with living forms of genetic diversity. If we keep our options open and learn to better utilize the reservoirs of natural variation that have been preserved in our gene banks and in the few remaining in situ populations of wild species and landrace varieties, an almost infinite array of novelty can be achieved using traditional, time-proven practices involving crossing and selection of genes that have withstood the test of evolutionary time . By restIn crosses between wild and cultivated species of inbreeding plants, alleles that were “left behind” during the domestication process may be reintroduced into the cultivated gene pool. This infusion of “new blood” renews and invigorates modern cultivars in surprising and interesting ways. It is not uncommon for some of the inbred progenies derived from these crosses to perform better than the better parent . This phThis approach has proven to be extremely successful in several crop species , variety development can go forward with the expectation that new varieties can be developed and distributed as inbred strains. This will come as very good news to people who are concerned about the infrastructural requirements needed to maintain a hybrid seed industry. Inbred variety seed can be saved from year to year without noticeable loss of vigor. Farmers are free to amplify the varieties and pass seed on to their neighbors if it proves valuable. Plant breeders living in parts of the world where germplasm diversity is highest are in the best position to explore its value. Until now, there have been few opportunities to make use of the wealth of natural diversity that abounds in many countries where people are the poorest and population is growing the fastest. This approach offers a way forward and can help people make good use of locally available resources to enhance the food security of their own nations.As we consider the implementation of smart breeding efforts in the future, we might ask, who will have access to nature's reserves of genetic diversity? How will knowledge about the patterns that govern the generation and selective elimination of that diversity help guide conservation efforts as well as current and future crop improvement efforts? What are the limits to biological variation? How far can we push those limits, and what will be the consequences of not pushing them? Who will participate in the endeavor? What will the rules of engagement be? What tools can we use to expedite the effort?What genetic characteristics will help us cope with climate change, global warming, the emergence of new pests and diseases, depleted soils, shortages of fresh water, and increasing levels of water and air pollution? What trace minerals, vitamins, and other metabolites will we need to breed into the crops of the future to fight the causes of hidden hunger, to prevent cancer, or to enhance the immune system? The combinatorial possibilities for crop improvement are almost infinite, as long as we maintain our options. Faced with a clear choice today, it is obvious that enhancing the potential for genetic flexibility in the future is a wise course of action and one we ignore at our peril.“Moreover, from our wild plants, we may not only obtain new products but new vigor, new hardiness, new adaptive powers, and endless other desirable new qualities for our cultivated plants. All of these things are as immediate in possibilities and consequences as transcontinental railroads were fifty years ago.”—Luther Burbank, 1914Luther Burbank (1849–1926) was one of America's first and most prolific plant breeders. He was inspired by Charles Darwin's Variation of Animals and Plants under Domestication (tication to explotication .Nikolai Vavilov (1887–1943), a Russian geneticist and biologist, was one of the first to explore and actively collect wild relatives and early landrace varieties as sources of genetic variation for the future of agriculture. His botanical collecting expeditions (1916–1940) amassed many thousands of rare and valuable specimens that are preserved in the Vavilov Institute of Plant Industry in St. Petersburg, the world's first seed bank and inspiration for the International Crop Germplasm Collections (http://www.sgrp.cgiar.org/publications.html). Vavilov's concepts in evolutionary genetics, such as the law of homologous series in variation was also well known for his plant collection expeditions and eloquent expositions about the value of wild relatives and early domesticated forms of crop plants was an avid collector of exotic tomato germplasm. He noted that up until the 1940s, progress in tomato improvement lagged and few major innovations were achieved. The turning point, according to Rick, was the introduction of exotic germplasm. As a cultivated species, tomato had experienced a severe genetic bottleneck that led to extreme attrition of genetic variability compared to the wild species of Lycopersicon (persicon . Yet, Ripersicon , 1974. Hpersicon .

FOB1 and overexpression of SIR2 have been previously found to increase life span by reducing the levels of toxic rDNA circles in aged mother cells. We find that combining calorie restriction with either of these genetic interventions dramatically enhances longevity, resulting in the longest-lived yeast strain reported thus far. Further, calorie restriction results in a greater life span extension in cells lacking both Sir2 and Fob1 than in cells where Sir2 is present. These findings indicate that Sir2 and calorie restriction act in parallel pathways to promote longevity in yeast and, perhaps, higher eukaryotes.Calorie restriction slows aging and increases life span in many organisms. In yeast, a mechanistic explanation has been proposed whereby calorie restriction slows aging by activating Sir2. Here we report the identification of a Sir2-independent pathway responsible for a majority of the longevity benefit associated with calorie restriction. Deletion of This study indicates that calorie restriction and Sir2 promote longevity in yeast through distinct pathways. This undermines the accepted view, and has implications for aging in higher organisms Saccharomyces cerevisiae has served as a useful model for aging research, leading to the identification of new longevity genes and pathways whose counterparts can be examined in higher eukaryotes in the mother cell nucleus , and mutHM loci of yeast cells can be accomplished by a reduction in the glucose concentration of growth media from 2% to 0.5% (or lower) and results in a 30%–40% increase in life span . Severalactivity . Growth activity , 2004.cdc25-10 is reported to decrease both rDNA recombination and ERC levels se and fob1Δ. As previously reported for shorter-lived strain backgrounds . This analysis was performed in the BY4742 genetic background, which has a mean life span significantly longer than most other yeast strains commonly used for aging research . Includekgrounds , each ofkgrounds A.FOB1 increased life span individually in BY4742, we examined the effect of CR combined with deletion of FOB1. It is notable that this experiment has not to our knowledge been previously reported. We constructed a fob1Δ hxk2Δ double mutant and determined the replicative aging potential of this strain. As expected, both single mutants lived longer than wild-type mother cells (p < 0.001). However, the life span of the fob1Δ hxk2Δ double mutant greatly exceeded that of either single mutant (p < 0.001), suggesting an additional effect on longevity as a result of combining deletion of FOB1 with CR , and nearly double that of wild-type cells . Similarly, the life span of sir2Δ fob1Δ gpa2Δ triple mutant cells was significantly longer than that of sir2Δ fob1Δ double mutant cells (p < 0.001). In fact, the life spans of sir2Δ fob1Δ hxk2Δ and sir2Δ fob1Δ gpa2Δ cells did not differ significantly (p ≈ 0.4) from fob1Δ hxk2Δ and fob1Δ gpa2Δ cells, respectively. Thus, CR clearly enhances longevity in the absence of both Sir2 and Fob1, but not in the absence of Sir2 alone. While seemingly contradictory (see below), these findings demonstrate that Sir2 is dispensable for life span extension by CR, at least in the context of reduced ERC levels (as a result of fob1Δ).The observation that CR further increases the long life span of a Δ mutant , CR . The effect of growth on low glucose was even more pronounced in the sir2Δ fob1Δ double mutant, with mean life span increased by 25% on 0.5% glucose (p < 0.01) and by 60% on 0.05% glucose (p < 0.001).Genetic models of CR, such as glucose , 2002; h glucose . Taking glucose . Wild-tysir2Δ fob1Δ double mutant (sir2Δ fob1Δ double mutant derived from strain PSY316 (unpublished data). However, the previous experiments demonstrating that either deletion of FOB1 or overexpression of SIR2 increase life span were carried out in W303R nor overexpression of SIR2 (p = 0.76) was sufficient to increase life span in the PSY316 background . Further, growth of SIR2-overexpressing cells on low glucose results in an additional life span increase (p < 0.001), similar to that observed for sir2Δ fob1Δ double mutant cells on low glucose. The observation that CR further enhances the already long life span of cells in which SIR2 is overexpressed reinforces our model that CR and SIR2 promote longevity by influencing different pathways , suggesting that, at least under normal conditions, Hst1 is not an important determinant of longevity.Our findings do not preclude the possibility that CR enhances Sir2 function through previously proposed mechanisms. However, the fact that the life spans of SIR2 overexpression, in particular, to increase life span in the PSY316 background supports the idea that Sir2 does not play a primary role in CR-mediated life span extension, as it is not straightforward to postulate a model whereby CR would increase life span via activation of Sir2 in a strain background that is insensitive to Sir2 dosage. Further, the inability of the fob1Δ mutation to increase life span in PSY316 provides a plausible explanation for why CR is unable to enhance longevity in the PSY316 sir2Δ fob1Δ double mutant, and suggests that either deletion of FOB1 fails to impact ERCs in this background or ERCs are not limiting for life span. While we cannot rule out the possibility that the Sir2-independent nature of CR is unique to BY4742, we note that BY4742 behaves like the majority of other strains with respect to increased life span in response to deletion of FOB1 or overexpression of SIR2, while PSY316 is the only strain (to our knowledge) that is unresponsive to these interventions , except for PSY316AR , PSY316AR fob1Δ::kanMX, and PSY316AR SIR2-ox. All gene disruptions were verified by PCR. In addition, sir2Δ mutants were verified by the sterility phenotype associated with this mutation. Strains overexpressing Sir2 were constructed by genomic integration of an extra copy of SIR2, as described and streaked onto YPD. After 2 d of growth, single colonies were selected and patched to YPD. The next evening, cells were lightly patched to the plates used for life span analysis (4–6 strains per plate). After overnight growth, cells were arrayed onto solid medium using a micromanipulator and allowed to undergo 1–2 divisions. Virgin cells were selected and subjected to life span analysis. Cells were grown at 30 °C during the day and stored at 4 °C at night. Daughter cells were removed by gentle agitation with a dissecting needle and tabulated every 1–2 cell divisions. All life span experiments were carried out on standard YPD plates (2% glucose), except for the low glucose experiments, which were performed on YEP plates supplemented with the indicated amounts of glucose. In order to prevent introduction of bias, strains were coded such that the researcher performing the life span experiment had no knowledge of the strain genotype for any particular strain. For each experiment, each strain was randomly coded at the time of removal from frozen stock. One individual was responsible for assigning codes (K. T. K.) while a different individual (M. K. or B. K. K.) performed the micromanipulation and was unaware of the genotypes of the strains being analyzed.p-value matrices for each figure are available in p-values were calculated using the MATLAB ranksum function. Data shown in each figure and used to calculate p-values were derived from pair-matched, pooled experiments where each mutant was compared to wild-type cells examined within the same experiment(s). Strains are stated to have a significant difference in life span for p < 0.05.For statistical analysis, life span datasets were compared using a two-tailed Wilcoxon Rank-Sum test. Mother cell life span and Dataset S1p-values for a two-tailed test in which the life span data for the strain in the corresponding row were compared against the life span data for the strain in the corresponding column. Significant p-values (p < 0.05) are colored yellow. P-values were calculated using the MATLAB ranksum function.Each matrix contains the Wilcoxon Rank-Sum (46 KB PDF).Click here for additional data file.Dataset S2(16 KB TXT).Click here for additional data file.Figure S1(A) Life span extension by CR is maximized at 0.05% glucose in BY4742 mother cells. Mean life spans are shown for cells grown on 2% glucose (24.8), 0.5% glucose (28.3), 0.1% glucose (30.1), and 0.05% glucose (32.1).sir2Δ fob1Δ mother cells. Mean life spans are shown for cells grown on 2% glucose (26.0), 0.5% glucose (32.9), 0.1% glucose (40.8), and 0.05% glucose (42.0).(B) Life span extension by CR is maximized at 0.05% glucose in (88 KB PS).Click here for additional data file.Saccharomyces Genome Database (http://www.yeastgenome.org/) accession numbers for the yeast genes and gene products discussed in this paper are CDC25 (SGDID S0004301), FOB1 (SGDID S0002517), GPA2 (SGDID S0000822), GPR1 (SGDID S0002193), HST1 (SGDID S0005429), HXK2 (SGDID S0003222), PNC1 (SGDID S0003005), and SIR2 (SGDID S0002200) The LocusLink (http://www.ncbi.nlm.nih.gov/LocusLink/) accession numbers for the non-yeast genes and gene products discussed in this paper are C. elegans Daf-16 (LocusLink 172981), C. elegans Sir-2.1 (LocusLink 177924), mouse Foxo3A (LocusLink 2309), and mouse SirT1 (LocusLink 23411).The