Datasets:

kenhktsui

/

code-natural-language-classification-dataset

like 0

We at Seoul Metropolitan Government will take countermeasures for the stabilization of deposit money for lease of house and monthly rent on the occasion of fall, when many people choose to move to new houses. From September through year-end, we will supply a total of 10,021 public houses for lease and provide administrative and financial support, including the introduction of loans for deposit money for lease of house. Our countermeasures for lease of house stabilization will include: ▴ more supply of public housing,▴financial support including the introduction of loans for lease of house security deposit, ▴ strengthening of lessees’ right through the Lease of House Security Deposit Support Center,▴ provision of housing-related financial support for low-income households under the Seoul-type Housing Voucher Program, and

minipile

NaturalLanguage

mit

2 | Is NBC’s Andrea Kremer purposely trying to offend this year’s crop of U.S. Olympic swimmers, or is she merely clueless? That parting dig at reducing Michael Phelps’ 4×200 freestyle relay teammates to mere footnotes in his march to history has to rank as her worst moment of the games so far, no? 3 | How many times did you rewatch McKayla Maroney’s amazing vault during the women’s team gymnastics final? (Check out the judges’ reaction on the far left!) Where did the deductions come from?! And doesn’t this girl look like she should be on Pretty Little Liars or some other teen soap? 4 | How come the chilly London evenings have reduced most Olympic women’s volleyball teams to awkwardly trying to rock bikinis over base layers, but American dynamos Misty May-Treanor and Kerri Walsh Jennings always look so sporty-stylish on the court — no matter the conditions? 6 | Whose Olympic smile shines brighter: Gabby Douglas or Missy Franklin? It’s a draw for us! Or has there been no sweeter smile than Nathan Adrian’s megawatt grin after his surprise win during Wednesday’s Men’s 100 Freestyle? And that concludes the Olympics portion of this week’s column. Now back to our regularly scheduled programming… 7 | Who knew that handing Olivia Munn an intense, dramatic Newsroom storyline would deliver such fantastic results? Her rattling off the angry Japanese? In sexy librarian glasses? We die. And wasn’t David Krumholtz, star of the upcoming Partners, a nice touch as Will’s shrink? 8 | Given the way the POTUS gig has prompted our last three presidents to go rapidly gray, isn’t President Hammond’s jet-black coif on Political Animals a little unrealistic? Then again, isn’t everything about his character a wee bit cartoonish amongst the otherwise tense and thrilling machinations of the show’s central plot lines? And really, Susan Berg? You allowed that cheatin’ cretin a booty call? 9 | We get the gist, but what, exactly, did Breaking Bad‘s Walt mean by “Maybe he flew too close to the sun” in reference to murdered Gus Fring associate Victor? 10 | Did the final, shocking scene of The Closer this week remind you why Kyra Sedgwick has an Emmy, a Golden Globe and numerous other awards on her mantel? 11 | Did we accidentally tune into a bizarre-o world version of The Glee Project this week where the top three contestants were in the bottom? And as if Shanna’s elimination wasn’t infuriating enough, how come Oxygen had to go and spoil the ending with just a few minutes remaining by featuring Aylin and Blake in the preview for next week’s episode? Oh, and regarding Shanna’s exit, is there any other reality show on TV where being consistently good and avoiding the bottom three is more of a liability than an asset? 12 | Was there a more thankless guest star role on TV this summer than Brett Cullen as White Collar‘s FBI warehouse supervisor? 13 | Where do we sign the petition to keep Simon around on Covert Affairs? 14 | Who knew Pretty Little Liars‘ Caleb and Spencer had so much chemistry? In fact, it actually made us question our longtime ‘Haleb’ loyalties. And do you ever get the feeling that Emily could not care less about Aria’s relationship problems? 15 | Are you impressed and/or shocked that ABC Family can afford to send Jane By Design to film on location so much? First Paris, now London. Speaking of money, what was Gray thinking handing Jane a bonus check in front of all her employees? 16 | Between the 7th Heaven/Secret Life of the American Teenager,Grey’s Anatomy and Daily Show-like series within The L.A. Complex, is there a better TV satire currently on the air? 17 | Why does Rebecca’s hot not-brother on Dallas have to be such a bastard? 19 | With Project Runway mixing a Lexus product placement, the Emmy red carpet, a former Runway contestant, and two-person teams into this week’s convoluted challenge, wouldn’t it have been a good time to follow Coco Chanel’s take-one-thing-off rule? 20 | Are you having a hard time buying the Sadie and Ricky Schwartz storyline on Awkward? 21 | Wouldn’t it have been kind of interesting if Dianna Agron’s Quinn had made her Glee exit with that left-on-the-cutting-room-floor, giving-Rachel-a-harsh-dose-of-reality “Bridesmaids” scene that made its way to YouTube this week? Hit the comments with your answers — and any other questions you care to throw out there!

minipile

NaturalLanguage

mit

“Scratching the Sky” I recently came across this documentary which is both visually stunning and emotionally heart warming. I won’t say much more than that–I’ll let the video speaks for itself. I truly hope you enjoy this as much as I do. “Sometimes the biggest risk we can take is to truly live.” – Scratching the Sky

minipile

NaturalLanguage

mit

By Lee C. Chipongian Singapore-based Sindicatum Renewable Energy Co. Pte. Ltd. has issued P1.06-billion 10-year green bonds to fund its clean energy projects in the Philippines. ING Bank which arranged the issuance as sole lead manager, bookrunner and green structuring advisor, said in a statement that this was the second green bond issuance that it has arranged and managed for Sindicatum Renewable. The first was in January this year and it was denominated in Indian Rupee amounting to INR 2.5 billion. The two green bonds arranged for Sindicatum Renewable had a total value of about $60 million. Sindicatum Renewable is a regional clean energy project developer. ING said the landmark deal – described as a synthetic local currency issue in pesos – will finance the company’s renewable projects in the Philippines. “Such a structure allows the issuer to have greater US dollar liquidity and to achieve 10-year funding at a more competitive pricing level,” said ING. The bond is credit guaranteed by GuarantCo, an international development finance institution headquartered in London, helping it to achieve issue ratings of “A1” by Moody’s, it said. Company CEO Assaad W. Razzouk said in the same statement that the transaction “was very well received by the market and attracted high quality, long-term investors, allowing us to extend the maturity profile of our debt. We can now expand further our renewable energy footprint in the Philippines where we intend to rapidly build a portfolio of 250MW of solar and wind assets.” ING country manager, Hans B. Sicat, said this is only the start of more deals for the Philippines to “achieve energy efficiency in the coming years”. “We see growing interest by clients in sustainable finance. This deal demonstrates our capabilities to attract long-term sustainability-focused investors in the local market. Being one of the frontrunners in this arena, ING is well-placed to support corporates in the Philippines committed to becoming more sustainable,” he said. ING stated that the peso-denominated green bond was issued in compliance with both the International Capital Market Association’s Green Bond Principles 2017 and the ASEAN Green Bond Standards. The bank said this means the borrower must apply the loan to fund specific green projects, preserving the market integrity of the green bonds to fund sustainable, environmental projects. Dutch financial giant ING has helped issue green bonds for several regional banks and corporations. Last year it arranged two major green bond issuances: the $500-million green bond debut by DBS as well as EUR1 billion green bond by China Development Bank.

minipile

NaturalLanguage

mit

1. Field of the Invention The present invention relates to a device to assist in leveling wall-mounted pictures and other objects and to keep them in leveled condition. 2. Description of the Prior Art Picture frames are commonly hung by wire from one or two wall-mounted hooks and are adjusted after hanging to achieve a level condition of the top and bottom edges and a vertical condition of the side edges. Such picture leveling has normally been accomplished by adjusting it back and forth by eye until it appeared to be level from a distance, by measuring from a known vertical edge such as a door or window frame or room corner, or from a known level such as the floor or ceiling. In some instances a level indicating device has been used such as a spirit level placed against one edge of the frame to determine whether or not the adjustment has leveled the picture. This requires that the person hanging the picture either hold onto the level with one hand and attempt to adjust the picture with the other hand, which can be a difficult maneuver, or to set the level down, trial adjust the picture with both hands, and then check it with the level.

minipile

NaturalLanguage

mit

Purchase either a combined Buildings & Contents Home Insurance policy, or separate Buildings or Contents Home Insurance Policy online at Littlewoods.com between 1st and 31st August 2017 to qualify for a free Amazon Echo Dot. New Littlewoods Home Insurance customers only. Provided your policy is still active and your premiums are up to date, we'll email you 4 weeks post-purchase to explain how you claim your free Amazon Echo Dot. If you return your item due to a fault, where possible, a replacement item will be provided. Own it! this summerwith £20 back! 1 - Spend £50 or more in one order before 30.06.172 - Enter code LAMJA at checkout3 - £20 will be credited to your original method of payment - simple! Offer excludes sale items, Apple products, Financial Services products and delivery/installation charges. Valid for one use only, this code cannot be used in conjunction with any other offer code.If you return items from your order, the credit will be reversed if the order value falls below the minimum required. Choose from 3 great payment options so you can pay in a way that suits you and your budget: 1. Interest Free Payments 20 weeks interest free credit available on all items. 52 weeks interest free credit available on items over £120. Interest free credit is available on all insurance products. 2. Buy Now Pay Later (BNPL) Delay payment for 12 months when you spend £50 or more. The payment free period starts when you place your order. BNPL is an interest bearing option on the Littlewoods Account. The interest rate typically used to calculate BNPL interest is 44.9% per annum. Your interest rate will be detailed in checkout. The interest is calculated on the payment free period and the repayment period. You can avoid interest by paying the cash price in full within the payment free period. Click on “Find out More” in checkout to see how BNPL works. 3. Spread the Cost Lower monthly payments by taking longer to pay. Pay over 104 weeks (2 years) for orders over £50. Pay over 156 weeks (3 years) for orders over £99. Interest is charged at your account rate for this payment option. Payment options are selectable in checkout along with the cost breakdown, just click on the item description. Buy Now Pay Later is an interest bearing option, subject to status on the Littlewoods account. The interest rate typically used to calculate Buy Now Pay Later interest is 44.9% per annum. Your interest rate will be detailed in checkout. The interest is calculated on the payment free period and the repayment period. You can avoid interest by paying the cash price in full within the payment free period. Whether you are paying the full cash price, or a part payment remember to target your payment to Buy Now Pay Later. Shop as usual and when you get to checkout select Buy Now Pay Later and the repayment period of either 104 or 156 weeks. This is the repayment period you will pay over, once the payment free period (12 months) has ended. The payment free period will start from the date of order, including pre-orders and items not ready for immediate dispatch. Delivery, installation and other Financial Services products such as insurance cannot be placed on Buy Now Pay Later, these charges will appear on your next statement. Exclusions will be confirmed at the point of order. If you have any non Buy Now Pay Later purchases on your account you will still need to make at least your minimum payment as detailed on your statement. Aqualux Mezzo Bathroom Towel Rail Aqualux Haceka Mezzo Towel Ring The Mezzo collection from Aqualux's Haceka range of bathroom accessories is a stylish finishing touch for bathrooms where sleek minimalism is key. The cutting-edge design means neat shapes and polished chrome for a thoroughly contemporary look. The Mezzo towel ring flaunts a high-shine finish and can be attached to the wall for your convenience. Buy Now Pay Later (BNPL) allows you to delay payment for 12 months. The payment free period starts when you place your order (including items which are purchased on pre-order and/or are not ready for immediate dispatch). Select BNPL at checkout and the repayment period of either 104 or 156 weeks. This is the repayment period you will pay over, once the payment free period (12 months) has ended. The interest rate typically used to calculate BNPL interest is 44.9% per annum. Your interest rate will be detailed in checkout. The interest is calculated on the payment free period and the repayment period. You can avoid interest by paying the cash price in full within the payment free period. Delivery charges and other Financial Services products are not available on Buy Now Pay Later and will appear on your next statement. Please note, if you have non BNPL purchases on your account you will still need to make at least your minimum payment as detailed on your statement.

minipile

NaturalLanguage

mit

Nutritional intake in both free-living and institutionalized older adults with xerostomia. A common problem in the institutionalized as well as the free-living elderly is inadequate nutrition. This problem will continue in significance as the population continues to age. Previous studies have indicated a variety of nutritional deficiencies in the diets of older adults. Chronic degenerative diseases and usage of multiple pharmacologic agents are also prevalent in the geriatric population and confound this complex problem. A common observation among the many contributing factors to the problem of relative or absolute malnutrition in seniors is that many individuals exhibit the sign/symptom of xerostomia (dry mouth). Recent studies indicate that nearly one in five older adults exhibit xerostomia. Xerostomia increases the difficulty of these older adults in obtaining the proper nutrition. Problems in lubricating, masticating, tolerating, tasting and swallowing food contribute significantly to the complex physiological and psychological manifestations of aging. To this date the literature fails to demonstrate an association between xerostomia and malnutrition in the elderly.

minipile

NaturalLanguage

mit

Timothy Evans Timothy John Evans (20 November 1924 – 9 March 1950) was a Welshman falsely convicted and hanged for the murder of his wife and infant daughter at their residence at 10 Rillington Place in Notting Hill, London. In January 1950, he was tried for and convicted of the murder of his daughter. He was sentenced to death by hanging, a sentence that was later carried out. During his trial, Evans had accused his downstairs neighbour, John Christie, who was the chief prosecutor’s witness, of committing the murders. Three years after Evans' execution, Christie was found to be a serial killer who had murdered six other women in the same house, including his own wife. Before his execution, Christie confessed to murdering Mrs. Evans. An official inquiry concluded in 1966 that Christie had also murdered Evans' daughter, and Evans was granted a posthumous pardon.The case generated much controversy and is acknowledged as a serious miscarriage of justice. Along with those of Derek Bentley and Ruth Ellis, the case played a major part in the abolition of capital punishment in the United Kingdom for murder in 1965. Early life Evans was a native of Merthyr Tydfil in Glamorgan, Wales. His father Daniel abandoned the family in April 1924 before Evans's birth. Evans had an older sister, Eileen, born in 1921 and a younger half-sister, Maureen, who was born in September 1929. Evans' mother remarried in September 1933. As a child, Evans had difficulty learning to speak and struggled at school. Following an accident when he was eight, Evans developed a tubercular verruca on his right foot that never completely healed and caused him to miss considerable amounts of time from school for treatments, further setting back his education. As a result, when he reached adulthood Evans possessed low literacy skills, often needing others to read lengthy documents to him, although he did possess some ability in being able to read simple passages such as in comics, newspaper football reports and on his wages and receipts. He liked football, supporting QPR, as did Christie, and boxing.The Murders of the Black Museum. p. 465 He was also prone to inventing stories about himself to boost his self-esteem, a trait that continued into adulthood and interfered with his efforts to establish credibility when dealing with the police and courts. In 1935, his mother and her second husband moved to London, and Evans worked as a painter and decorator while attending school. He returned to Merthyr Tydfil in 1937 and briefly worked in the coal mines but had to resign because of continuing problems with his foot. In 1939, he returned to London to live again with his mother, and in 1946 they moved to St Mark's Road, Notting Hill. This was just over two minutes' walk from 10 Rillington Place, his future residence after he married. Evans was fined 60 shillings at West London Magistrates court on 25 April 1946 for stealing a car, and driving without insurance or a licence. Married life On 20 September 1947, Evans married Beryl Susanna Thorley, whom he had met through a friend in January 1947 who had encouraged the pair to meet on a blind date. The couple initially lived with Evans's family at St Mark's Road but in early 1948 Beryl discovered she was pregnant and they decided they would find their own place to live with their child. On Easter Monday 1948, the couple moved into the top-floor flat at 10 Rillington Place in the Ladbroke Grove area of Notting Hill. Their neighbours in the ground-floor flat were John Christie, a post office clerk and former Special Constable, and his wife, Ethel Christie. Unknown to Evans, Christie was also a serial killer who had already killed two women at the property prior to the Evanses' arrival and had buried their bodies in the backyard garden. Christie would go on to murder at least four more women, including his wife, over the next five years. Timothy's and Beryl's daughter Geraldine was born on 10 October 1948. Their marriage was characterised by angry quarrels; Beryl was a poor housekeeper and incapable of managing the family's finances, while Timothy misspent his wages on alcohol, and his heavy drinking at the time exacerbated his already short temper. The arguments between Timothy and Beryl were loud enough to be heard by the neighbours and physical violence between them was witnessed on several occasions. In 1949, Beryl revealed to Timothy that she was pregnant with their second child. Since the family was already struggling financially, Beryl decided to have an abortion. After some initial reluctance, Evans agreed to this course of action. Events leading to Evans's arrest Several weeks later, on 30 November 1949, Evans informed police at Merthyr Tydfil that his wife had died in unusual circumstances. His first confession was that he had accidentally killed her by giving her something in a bottle that a man had given him to abort the foetus; he had then disposed of her body in a sewer drain outside 10 Rillington Place. He told the police that after arranging for Geraldine to be looked after, he had gone to Wales. When police examined the drain outside the front of the building, however, they found nothing and, furthermore, discovered that the manhole cover required the combined strength of three officers to remove it. When re-questioned, Evans changed his story and said that Christie had offered to perform an abortion on Beryl. Evans stated that he had left Christie out of his first statement in order to protect him (abortion being illegal in the UK at this time). After some deliberation between Evans and his wife, they had both agreed to take up Christie's offer. On 8 November, Evans had returned home from work to be informed by Christie that the abortion had not worked and that Beryl was dead. Christie had said that he would dispose of the body and would make arrangements for a couple from East Acton to look after Geraldine. He said that Evans should leave London for the meantime. On 14 November, Evans left for Wales to stay with relatives. Evans said he later returned to 10 Rillington Place to ask about Geraldine, but Christie had refused to let him see her. In response to Evans's second statement, the police performed a preliminary search of 10 Rillington Place but did not uncover anything incriminating, despite the presence of a human thigh bone supporting a fence post in the tiny garden (about long by wide). On a more thorough search on 2 December, the police found the body of Beryl Evans, wrapped in a tablecloth in the wash-house in the back garden. Access to the locked wash-house was only possible by using a knife kept by Mrs Christie. Significantly, the body of Geraldine was also found alongside Beryl's body — Evans had not mentioned he had killed his daughter in either of his statements. Beryl and Geraldine had both been strangled. Although they examined the garden, the police did not find traces of the skeletal remains of two prior victims of Christie, despite their shallow burial. Christie actually removed the skull of Miss Eady when his dog dug it up from the garden around this time, and he disposed of it in a bombed-out building nearby. This vital clue was ignored when the skull was then discovered by children playing in the ruins and handed in to police. When Evans was shown the clothing taken from the bodies of his wife and child, he was also informed that both had been strangled. This was, according to Evans's statement, the first occasion in which he was informed that his baby daughter had been killed. He was asked whether he was responsible for their deaths. To this, Evans apparently responded, "Yes." He then apparently confessed to having strangled Beryl during an argument over debts and strangling Geraldine two days later, after which he left for Wales. This confession, along with other contradictory statements Evans made during the police interrogation, has been cited as proof of his guilt. Several authors who have written about the case have argued that the police provided Evans with all the necessary details for him to make a plausible confession, which they may have in turn edited further while transcribing it.Eddowes, M., op. cit., pp. 71-80 Furthermore, the police interrogated Evans over the course of late evening and early morning hours to his physical and emotional detriment, a man already in a highly emotional state. Evans later stated in court that he thought he would be subjected to violence by the police if he didn't confess, and this fear along with the shock of discovering that both his wife and daughter had been strangled, likely induced him to make a false confession. The police investigation was marred by a lack of forensic expertise, with significant evidence overlooked.The Psychology of Interrogations and Confessions (2003) states that some of the phraseology of the confession seemed more in line with language a police officer might use, rather than that used by an illiterate man as Evans was. Evans was kept in solitary confinement for two days before being handed over to the London police. He did not know what was happening other than his wife's body had not been found in the drain as expected. At Notting Hill police station, he was shown his wife's and daughter's clothing, and the ligature which had been used to strangle his daughter. This book cites Kennedy as a source for the conclusion that Evans felt tremendous guilt over not doing more to prevent the deaths of his wife and daughter, and particularly that his daughter's murder must have been a tremendous shock. Trial and execution Evans was put on trial for the murder of his daughter on 11 January 1950. In accordance with legal practice at the time, the prosecution proceeded only with the single charge of murder, that concerning Geraldine. Beryl's murder, with which Evans was still formally charged, was not formally before the court, though evidence that he had murdered Beryl was used with the aim of establishing Evans's guilt of the murder of Geraldine. Evans was represented by Malcolm Morris. He withdrew his confession during consultations with his solicitor and alleged that Christie was responsible for the murders in accordance with his second statement given to the police at Merthyr Tydfil. Although this allegation was dismissed by the court as "fantastic" and Evans's solicitors had also warned him that it was difficult to prove, Evans maintained this defence until his execution. It was subsequently found that Christie, not Evans, was responsible. Christie and his wife, Ethel, were key witnesses for the prosecution. Christie denied that he had offered to abort Beryl's unborn child and gave detailed evidence about the quarrels between Evans and his wife. The defence sought to show that Christie was the murderer, highlighting his past criminal record. Christie had previous convictions for several thefts and for malicious wounding. The latter case involved Christie striking a woman on the head with a cricket bat. But his apparent reform, and his service with the police, may have impressed the jury. The defence also could not find a motive for which a respected person like Christie would murder two people, whereas the prosecution could use the explanation in Evans's confessions as Evans's motive. Unlike Christie, Evans had no previous convictions for violence, but his conflicting statements undermined his credibility. Had the police conducted a thorough search of the garden and found the bones of two previous victims of Christie, the trial of Evans might not have occurred at all. The case largely came down to Christie's word against Evans's and the course of the trial turned against Evans. The trial lasted only three days and much key evidence was omitted, or never shown to the jury. Evans was found guilty – the jury taking just 40 minutes to come to its decision. After a failed appeal held before the Lord Chief Justice, Lord Goddard, Mr Justice Sellers and Mr Justice Humphreys on 20 February, Evans was hanged on 9 March 1950 by Albert Pierrepoint, assisted by Syd Dernley at Pentonville Prison. The safety of Evans's conviction was severely criticised when Christie's murders were discovered three years later. During interviews with police and psychiatrists prior to his execution, Christie admitted several times that he had been responsible for the murder of Beryl Evans. If these confessions were true, Evans's second statement detailing Christie's offer to abort Beryl's baby is likely to be the true version of events that took place at Rillington Place on 8 November 1949. Ludovic Kennedy provided one possible reconstruction of how the murder took place, surmising that an unsuspecting Beryl let Christie into her flat, expecting the abortion to be carried out, but was instead attacked and then strangled. Christie claimed to have possibly engaged in sexual intercourse with Beryl's body after her death (he claimed to be unable to remember the precise details) but her post-mortem had failed to uncover evidence of sexual intercourse. In his confessions to Beryl's death, Christie denied he had agreed to carry out an abortion on Beryl. He instead claimed to have strangled her while being intimate with her, or that she had wanted to commit suicide and he helped her do so. One important fact was not brought up in Evans's trial: two workmen were willing to testify that there were no bodies in the wash-house when they worked there several days after Evans supposedly hid them. They stored their tools in the wash-room (a small outhouse measuring ) and cleaned it out completely when they finished their work on 11 November. Their evidence in itself would have raised doubts about the veracity of Evans's alleged confessions, but the workmen were not called to give evidence. Indeed, the police re-interviewed the workmen and forced them to change their evidence to fit the preconceived idea that Evans was the sole murderer. The murderer, Christie, would have hidden the bodies of Beryl and Geraldine in the temporarily vacant first-floor flat, and then moved them to the wash-house four days later when the workmen had finished. John Christie Three years later, Christie vacated his premises at 10 Rillington Place and the landlord allowed an upstairs tenant, Beresford Brown, to use Christie's kitchen. Brown found the bodies of three women (Kathleen Maloney, Rita Nelson and Hectorina Maclennan) hidden in a papered-over kitchen pantry, a recess immediately next to the wash-house where Beryl and Geraldine Evans had been found. A further search of the building and grounds turned up three more bodies: Christie's wife, Ethel, under the floorboards of the front room; Ruth Fuerst, an Austrian nurse and munitions worker; and Muriel Eady, a former colleague of Christie, who were both buried in the right-hand side of the small back garden of the building. Christie had even used one of their thigh bones to prop up a trellis in the garden, which the police had missed in their earlier searches of the property. Christie was arrested on 31 March 1953, on the Embankment near Putney Bridge and during the course of interrogation confessed four separate times to killing Beryl Evans. He never admitted to killing Geraldine Evans, however. He confessed to murdering Fuerst and Eady, saying he had stored their bodies in the wash-room before burying them in shallow graves in the garden. It was in the same wash-room that the bodies of Beryl and Geraldine Evans had been found during the investigation into their murders. Christie was found guilty of murdering his wife and was hanged on 15 July 1953 by Albert Pierrepoint, the same hangman who had executed Evans three years prior. Because Christie's crimes raised doubts about Evans's guilt in the murders of his wife and daughter, the serving Home Secretary, David Maxwell-Fyfe, commissioned an inquiry to investigate the possibility of a miscarriage of justice. It was chaired by the Recorder of Portsmouth, John Scott Henderson, QC. The inquiry ran for one week and its findings upheld Evans's guilt in both murders with the explanation that Christie's confessions of murdering Beryl Evans were unreliable because they were made in the context of supporting his defence that he was insane. The conclusion was met with scepticism by the press and the public alike: if Christie's confessions were unreliable, why should those of Evans be acceptable? The inquiry ignored vital evidence and led to more questions in Parliament, especially from Geoffrey Bing, Reginald Paget, Sydney Silverman, Michael Foot and many other MPs. The controversy was to continue until it led eventually to the exculpation of Evans and a declaration of his innocence of the murder of both his wife and his daughter. The murder of Beryl Evans was never a primary charge in the trials of either Evans or Christie. The former had been charged with the murder of his daughter and the latter with the murder of Mrs Christie. Hence questions that went to the murder of Mrs Evans were not those with which the trials were especially concerned. When Christie was later the subject of the Scott Henderson Inquiry, questions drafted by a solicitor representing Evans's mother were deemed not relevant and Scott Henderson retained the right of deciding if they could be asked. Campaign to overturn Evans's conviction In 1955, David Astor, editor of The Observer, Ian Gilmour, editor of The Spectator, John Grigg, editor of The National and English Review and Sir Lynton Andrews, editor of The Yorkshire Post, formed a delegation to petition the Home Secretary for a new inquiry because of their dissatisfaction with the conclusions of the Scott Henderson Inquiry. In the same year, barrister Michael Eddowes examined the case and wrote the book The Man on Your Conscience, which argued that Evans could not have been the killer on the basis that if he were there were a number of extraordinary coincidences with his crimes and Christie's, most notably that two strangler murderers, who both used a ligature to kill their victims, had been living in the same property at the same time, unknown to each other. The television journalist Ludovic Kennedy's book Ten Rillington Place went on to criticise the police investigation and evidence submitted at the 1950 trial in which Evans was found guilty. This produced another Parliamentary debate in 1961 but still no second inquiry. In 1965, Liberal Party politician Herbert Wolfe of Darlington, County Durham contacted Harold Evans, then editor of The Northern Echo. He and Kennedy formed the Timothy Evans Committee. The result of a prolonged campaign was that the Home Secretary, Sir Frank Soskice, ordered a new inquiry chaired by High Court judge Sir Daniel Brabin in 1965–66. Brabin found it was "more probable than not" that Evans murdered his wife and that he did not murder his daughter. This was contrary to the prosecution case in Evans's trial, which held that both murders had been committed by the same person as a single act. The victims' bodies had been found together in the same location and had been murdered in the same way by strangulation. Brabin went to great lengths to prefer police evidence wherever possible and exonerate them of any police misconduct, and he did not address the allegations made by Kennedy about the validity of several of the confessions allegedly made by Evans. He also did not consider the incompetence of the police in their searches of the garden at Rillington Place. The enquiry did little to settle the many issues which arose from the case, but, by exonerating Evans of killing his child, was crucial in subsequent events. Since Evans had only been convicted of the murder of his daughter, Roy Jenkins, Soskice's successor as Home Secretary, recommended a royal pardon for Evans, which was granted in October 1966. In 1965 Evans's remains were exhumed from Pentonville Prison and reburied in St Patrick's Roman Catholic Cemetery in Leytonstone, Greater London. The outcry over the Evans case contributed to the suspension and then abolition of capital punishment in the United Kingdom. Innocence of Evans In January 2003, the Home Office awarded Timothy Evans's half-sister, Mary Westlake, and his sister, Eileen Ashby, ex gratia payments as compensation for the miscarriage of justice in Evans's trial. The independent assessor for the Home Office, Lord Brennan QC, accepted that "the conviction and execution of Timothy Evans for the murder of his child was wrongful and a miscarriage of justice" and that "there is no evidence to implicate Timothy Evans in the murder of his wife. She was most probably murdered by Christie." Lord Brennan believed that the Brabin Report's conclusion that Evans probably murdered his wife should be rejected given Christie's confessions and conviction. On 16 November 2004, Westlake began an application for judicial review in the High Court, challenging a decision by the Criminal Cases Review Commission not to refer Evans's case to the Court of Appeal to have his conviction formally quashed. She argued that Evans's pardon had not formally expunged his conviction of murdering his daughter, and although the Brabin report had concluded that Evans probably did not kill his daughter, it had not declared him innocent. The report also contained the "devastating" conclusion that Evans had probably killed his wife. The request to refer the case was dismissed on 19 November 2004, with the judges saying that the cost and resources of quashing the conviction could not be justified, although they did accept that Evans did not murder either his wife or his child. In the media Ewan MacColl wrote the song "The Ballad of Tim Evans" (also known as "Go Down You Murderer") about the case. MacColl said in his autobiography that the song was used in many news programmes and documentaries, but that many broadcasters were uncomfortable with the last verse which reads They sent Tim Evans to the drop for a crime he did not do / It was Christy was the murderer and the judge and jury too. In some recordings of the song, this is altered to: It was Christy was the murderer and everybody knew / They sent Tim Evans to the drop for a crime he didn't do. The film 10 Rillington Place was released in the UK on 10 February 1971. It was directed by Richard Fleischer and starred Richard Attenborough as Christie, Judy Geeson as Beryl Evans and John Hurt as Timothy Evans. In the 2016 BBC dramatisation Rillington Place, Evans was portrayed by Nico Mirallegro. See also Francis Camps List of miscarriage of justice cases Mahmood Hussein Mattan Philip Allen, Baron Allen of Abbeydale Notes Bibliography Report of an inquiry into certain matters arising out of the deaths of Mrs. Beryl Evans and of Geraldine Evans and out of the conviction of Timothy John Evans of the murder of Geraldine Evans. Report by Mr. J. Scott Henderson, Q.C. Cmd. 8896. HMSO, July 1953. The case of Timothy John Evans. Supplementary Report by Mr. J. Scott Henderson, Q.C. Cmd. 8946. HMSO, September 1953. Michael Eddowes, The Man on Your Conscience: An Investigation of the Evans Murder Trial'', Cassell and Co (1955). The case of Timothy John Evans. Report of an Inquiry by The Hon. Mr. Justice Brabin. Cmnd. 3101. HMSO, October 1966. External links Discussion of the case Archive of Documents Discussion of the murders Parliamentary discussion of events surrounding the re-interment of Evans's remains in 1965 Location and Mythology The long wait for justice Category:1924 births Category:1950 deaths Category:20th-century executions by England and Wales Category:1949 in London Category:Overturned convictions in the United Kingdom Category:People convicted of murder by England and Wales Category:People executed for murder Category:People from Merthyr Tydfil Category:People wrongfully convicted of murder Category:Recipients of British royal pardons Category:Executed Welsh people Category:Welsh people convicted of murder Category:Wrongful executions Category:People who have received posthumous pardons Category:People from Notting Hill Category:1949 murders in Europe Category:1940s murders in the United Kingdom Category:1949 crimes in the United Kingdom

minipile

NaturalLanguage

mit

Search AVR Port Input in C Let’s figure out how to read port input data on an AVR processor using C. Connect PortB To Switches Remember how we connected PORTA to the LEDS? Now we are going to connect PORTB to the SWITCHES. Just be sure that you connect pin 1 of PORTB also known as PB0 toSW0 by orienting the cable so that the red stripe is on the correct side on both headers. AVR Port Input Before you can read input from a port on an AVR microcontroller you need to configure the pins that you are going to read to be input pins. In our AVR Port Output Using C guide we talked about the Data Direction Registers. Review that guide if you are not familiar with the concept. You should also write 0’s out to PORTB to ensure that it is in high impedance mode. If PORTB has 1’s in it, then the AVR will source current if pulled externally low. Lets set ourPORTB up as an input port. // setup PORTB data direction as an input DDRB = 0; // make sure it is high impedance and will not source PORTB = 0; Map Switches to LED’s For a really simple test application, lets map the PORTB switch inputs to the PORTA lights. This way, any time you press a button on the STK500, the corresponding LED will turn on. Remember that the LEDs on the STK500 are wired in reverse logic. So are the switches. This means that an open switch is feeding a 1 in to the corresponding pin, which will send a 1 out to the corresponding LED and that LED will be off. When you press a switch a 0 will be read in, which is sent out PORTA and the LED will light up. To read the input from a pin, you read the PINx value. In this case, we are going to read PINB and map it to PORTA, like this. PORTA = PINB; Do It In The Loop If you just put the above instruction in your program outside of a loop, then it would only happen once, and your PORTA lights will reflect the state of your PINB inputs at the time you turn on the STK500. To make the LEDs mimic the switches for ever, put the above line inside your main loop. Categories About Efundies The goal of efundies.com is to provide the Internet with a collection of fun, free, electronics projects and advice. Jason Bauer is an owner and programmer for Portforward.com. He's allergic to twitter and facebook, but you can find more of his articles in the Guides section.

minipile

NaturalLanguage

mit

Tuesday, January 3, 2017 Jesse Lucas Masterclass: The Art Of Writing Music For Film/TV Wazzup Pilipinas! Top-notch composer Jesse Lucas gives a masterclass on the art of writing music for Film/TV. Jesse is an award-winning and prolific composer who has written music for film, television, theater and ballet. In film, his works have won awards from different award-giving bodies. In 2010, he was elevated to the FAMAS Hall of Fame for Best Music Scorer. He won the Best Music at the 2005 Screamfest International Film Festival in Los Angeles for the film Sigaw, 2005. His music for films have reaped awards such as Gawad Urian, Best Music Score for Babae sa Breakwater, 2004; four Young Critics Circle Awards for Best Sound and Aural Orchestration in Phone Sex, 2000, Sugatang Puso, 2001, Minsan May Isang Puso, 2002, and Anghel sa Lupa, 2004; Star Awards for Best Music Score for Filipinas, 2004; five Filipino Academy of Movie Arts and Sciences (FAMAS) Awards for Best Music Score for 9 Mornings, 2003, Filipinas, 2004, Mano Po 3, 2005, A Love Story, 2008, and Kasal, Kasali, Kasalo, 2007; Metro Manila Film Festival (MMFF) Award for Best Original Song for Babae, 1997; MMFF Best Music Score for Luksong Tinik, 1999; and Gawad Tanglaw for Batanes, 2008. Jesse has made scores for some noted TV "teleserye" series such as Maging Sino Ka Man, 2006 and 2008; Kahit Isang Saglit 2008; Lovers In Paris, 2009; Magkaribal, 2010; Princess And I, 2012 and Bridges of Love, 2015. His most recent TV work is the top-rating Magpahanggang Wakas and for film - the box-office hit The Unmarried Wife. He won the 2016 ALIW AWARDS Best Musical Director for his work in the theatrical play Happiness is a Pearl. TOPICS TO BE DISCUSSED: • Mindset for composing music for Film/TV• Walk-through the creative process of composing music from pre-production to post-production• Guidelines in composing effective music for the different FILM/TV genres• FILM vs TV scoring• Dealing with Directors• How to handle tight deadlines• Cultural sensibility applied to musical choices WazzupPilipinas.com is the fastest growing and most awarded blog and social media community that has transcended beyond online media. It has successfully collaborated with all forms of media namely print, radio and television making it the most diverse multimedia organization. The numerous collaborations with hundreds of brands and organizations as online media partner and brand ambassador makes WazzupPilipinas.com a truly successful advocate of everything about the Philippines, and even more since its support extends further to even international organizations including startups and SMEs that have made our country their second home. Post a Comment Wyndham Timeshare Traveling the Philippines on a budget? Check out a Wyndham timeshare resale online. These can be a great alternative to a hotel when vacationing in popular destinations such as Palawan, Philippines or Phuket, Thailand. When you no longer wish to own the timeshare you can use the services of a timeshare exit team to get rid of it. Lenovo Philippines Storywriting School Nominated at the Philippine Tourism Industry Awards We Are Proud To Be Recognized Wazzup Pilipinas Radio Search This Blog Ang Pambansang Blog ng Pilipinas The Rise of Filipino Digital Marketing Consultants Total Page Views As Of Today Wazzup Pilipinas Radio Wazzup Pilipinas TV Wazzup Pilipinas YouTube Diving in the Seas of Bohol Advertisements Wazzup Pilipinas on Adobo Magazine About the Founder Ross is the Pambansang Blogcaster ng Pilipinas - An Information and Communication Technology (ICT) Professional by profession and a Social Media Evangelist by heart. He blogs as an advocacy to help the country in making itself known as a prime tourist destination to prove that it is really more fun in the Philippines. [email protected] Categories YouTube Videos Disclaimer Wazzup Pilipinas is a proud media partner of the Philippines. We showcase mostly everything about the Philippines since tourism is not only about tourist spots and attractions. It's more fun in the Philippines not only because of its lovely beaches and magnificent mountains, or the food, tradition and culture, but because of the Filipino people.

minipile

NaturalLanguage

mit

North Korea on Friday said it will never resume nuclear talks with the U.S. unless the Trump administration modifies its position on unilateral demands for disarmament. A spokesman of the North's Foreign Ministry made the comments on Pyongyang's official Korean Central News Agency. He reportedly accused the U.S. of deliberately causing the collapse of February's nuclear summit in Hanoi between President Trump and North Korean leader Kim Jong Un with unilateral and impossible demands. "We hereby make it clear once again that the United States would not be able to move us even an inch with the device it is now weighing in its mind, and the further its mistrust and hostile acts toward the DPRK grow, the fiercer our reaction will be," the statement said, referring to North Korea's formal name, the Democratic People's Republic of Korea. "Unless the United States puts aside the current method of calculation and comes forward with a new method of calculation, the DPRK-U.S. dialogue will never be resumed and by extension, the prospect for resolving the nuclear issue will be much gloomy," the statement added. JOE BIDEN THE SUBJECT OF CRITICAL EDITORIAL PUBLISHED BY NORTH KOREA'S STATE-OWNED MEDIA AGENCY U.S. officials have said the meeting broke down because of North Korea's excessive demands for sanctions relief in exchange for partial disarmament steps. Kim has said Washington has until the end of the year to come up with mutually acceptable terms for a deal to salvage the negotiations. The latest comments come after KCNA labeled Joe Biden a "fool of low IQ" and an "imbecile bereft of elementary quality as a human being", after the former Vice President called Kim Jong Un a tyrant. NORTH KOREA SUFFERING 'EXTREME DROUGHT', WORST IN NEARLY 40 YEARS AMID FEARS OF FOOD SHORTAGES Biden during a campaign launch in Philadelphia on Saturday accused President Donald Trump of cozying up to "dictators and tyrants" like Kim and Russian President Vladimir Putin. "What he uttered is just sophism of an imbecile bereft of elementary quality as a human being, let alone a politician," KCNA said. "It is by no means accidental that here is nonstop comment over his bid for candidacy that he is not worth pinning hope on, backed by the jeer that he is a fool of low IQ," KCNA said. CLICK HERE FOR THE FOX NEWS APP It mocked Biden's belief that he was "the most popular presidential candidate." ''This is enough to make a cat laugh," the report said. The Associated Press contributed to this report.

minipile

NaturalLanguage

mit

Majority rule Majority rule is a decision rule that selects alternatives which have a majority, that is, more than half the votes. It is the binary decision rule used most often in influential decision-making bodies, including all the legislatures of democratic nations. Distinction with plurality Though plurality (first-past-the post) is often mistaken for majority rule, they are not the same. Plurality makes the option with the most votes the winner, regardless of whether the fifty percent threshold is passed. This is equivalent to majority rule when there are only two alternatives. However, when there are more than two alternatives, it is possible for plurality to choose an alternative that has less than fifty percent of the votes cast in its favor. Use Majority rule is used pervasively in many modern western democracies. It is frequently used in legislatures and other bodies in which alternatives can be considered and amended in a process of deliberation until the final version of a proposal is adopted or rejected by majority rule. It is one of the basic rules prescribed in books like Robert's Rules of Order. The rules in such books and those rules adopted by groups may additionally prescribe the use of a supermajoritarian rule under certain circumstances, such as a two-thirds rule to close debate. Many referendums are decided by majority rule. Properties May's Theorem According to Kenneth May, majority rule is the only reasonable decision rule that is "fair", that is, that does not privilege voters by letting some votes count for more or privilege an alternative by requiring fewer votes for its passing. Stated more formally, majority rule is the only binary decision rule that has the following properties: Fairness: This can be further separated into two properties: Anonymity: The decision rule treats each voter identically. When using majority rule, it makes no difference who casts a vote; indeed the voter's identity need not even be known. Neutrality: The decision rule treats each alternative equally. This is unlike supermajoritarian rules, which can allow an alternative that has received fewer votes to win. Decisiveness: The decision rule selects a unique winner. Monotonicity: The decision rule would always, if a voter were to change a preference, select the alternative that the voter preferred, if that alternative would have won before the change in preference. Similarly, the decision rule would never, if a voter were to change a preference, select a candidate the voter did not prefer, if that alternative would not have won before the change in preference. Strictly speaking, it has been shown that majority rule meets these criteria only if the number of voters is odd or infinite. If the number of voters is even, there is the chance that there will be a tie, and so the criterion of neutrality is not met. Many deliberative bodies reduce one participant's voting capacity—namely, they allow the chair to vote only to break ties. This substitutes a loss of total anonymity for the loss of neutrality. Other properties In group decision-making it is possible for a voting paradox to form. That is, it is possible that there are alternatives a, b, and c such that a majority prefers a to b, another majority prefers b to c, and yet another majority prefers c to a. Because majority rule requires an alternative to have only majority support to pass, a majority under majority rule is especially vulnerable to having its decision overturned. (The minimum number of alternatives that can form such a cycle (voting paradox) is 3 if the number of voters is different from 4, because the Nakamura number of the majority rule is 3. For supermajority rules the minimum number is often greater, because the Nakamura number is often greater.) As Rae argued and Taylor proved in 1969, majority rule is the rule that maximizes the likelihood that the issues a voter votes for will pass and that the issues a voter votes against will fail. Schmitz and Tröger (2012) consider a collective choice problem with two alternatives and they show that the majority rule maximizes utilitarian welfare among all incentive compatible, anonymous, and neutral voting rules, provided that the voters’ types are independent. Yet, when the votersʼ utilities are stochastically correlated, other dominant-strategy choice rules may perform better than the majority rule. Azrieli and Kim (2014) extend the analysis for the case of independent types to asymmetric environments and by considering both anonymous and non-anonymous rules. Limitations Arguments for limitations Minority rights Because a majority can win a vote under majority rule, it has been commonly argued that majority rule can lead to a "[tyranny of the majority]". Supermajoritarian rules, such as the three-fifths supermajority rule required to end a filibuster in the United States Senate, have been proposed as preventative measures of this problem. Other experts argue that this solution is questionable. Supermajority rules do not guarantee that it is a minority that will be protected by the supermajority rule; they only establish that one of two alternatives is the status quo, and privilege it against being overturned by a mere majority. To use the example of the US Senate, if a majority votes against cloture, then the filibuster will continue, even though a minority supports it. Anthony McGann argues that when there are multiple minorities and one is protected (or privileged) by the supermajority rule, there is no guarantee that the protected minority won't be one that is already privileged, and if nothing else it will be the one that has the privilege of being aligned with the status quo. Another way to safeguard against tyranny of the majority, it is argued, is to guarantee certain rights. Inalienable rights, including who can vote, which cannot be transgressed by a majority, can be decided beforehand as a separate act, by charter or constitution. Thereafter, any decision that unfairly targets a minority's right could be said to be majoritarian, but would not be a legitimate example of a majority decision because it would violate the requirement for equal rights. In response, advocates of unfettered majority rule argue that because the procedure that privileges constitutional rights is generally some sort of supermajoritarian rule, this solution inherits whatever problems this rule would have. They also add the following: First, constitutional rights, being words on paper, cannot by themselves offer protection. Second, under some circumstances, the rights of one person cannot be guaranteed without making an imposition on someone else; as Anthony McGann wrote, "one man's right to property in the antebellum South was another man's slavery". Finally, as Amartya Sen stated when presenting the liberal paradox, a proliferation of rights may make everyone worse off. Erroneous priorities The erroneous priorities effect (EPE) states that groups acting upon what they initially consider important are almost always misplacing their effort. When groups do this they have not yet determined which factors are most influential in their potential to achieve desired change. Only after identifying those factors are they ready to take effective action. EPE was discovered by Kevin Dye after extensive research at the Food and Drug Administration. The discovery of EPE led to the recognition that even with good intentions for participatory democracy, people cannot collectively take effective actions unless they change the paradigm for languaging and voting. EPE is a negative consequence of phenomena such as spreadthink and groupthink. Effective priorities for actions that are dependent on recognizing the influence patterns of global interdependencies, are defeated by the EPE, when priorities are chosen on the basis of aggregating individual stakeholder subjective voting that is largely blind to those interdependencies. Dye's work resulted in the discovery of the 6th law of the science of structured dialogic design, namely: "Learning occurs in a dialogue as the observers search for influence relationships among the members of a set of observations." Other arguments for limitations Some argue that majority rule can lead to poor deliberation practice or even to "an aggressive culture and conflict". Along these lines, some have asserted that majority rule fails to measure the intensity of preferences. For example, the authors of An Anarchist Critique of Democracy argue that "two voters who are casually interested in doing something" can defeat one voter who has "dire opposition" to the proposal of the two. Voting theorists have often claimed that cycling leads to debilitating instability. Buchanan and Tullock argue that unanimity is the only decision rule that guarantees economic efficiency. Supermajority rules are often used in binary decisions where a positive decision is weightier than a negative one. Under the standard definition of special majority voting, a positive decision is made if and only if a substantial portion of the votes support that decision—for example, two thirds or three fourths. For example, US jury decisions require the support of at least 10 of 12 jurors, or even unanimous support. This supermajoritarian concept follows directly from the presumption of innocence on which the US legal system is based. Rousseau advocated the use of supermajority voting on important decisions when he said, "The more the deliberations are important and serious, the more the opinion that carries should approach unanimity." Arguments against limitations Minority rights McGann argues that majority rule helps to protect minority rights, at least in settings in which deliberation occurs. The argument is that cycling ensures that parties that lose to a majority have an interest to remain part of the group's process, because the decision can easily be overturned by another majority. Furthermore, if a minority wishes to overturn a decision, it needs to form a coalition with only enough of the group members to ensure that more than half approves of the new proposal. (Under supermajority rules, a minority might need a coalition consisting of something greater than a majority to overturn a decision.) To support the view that majority rule protects minority rights better than supermajority rules McGann points to the cloture rule in the US Senate, which was used to prevent the extension of civil liberties to racial minorities. Ben Saunders, while agreeing that majority rule may offer better protection than supermajority rules, argues that majority rule may nonetheless be of little help to the most despised minorities in a group. Other arguments against limitations Some argue that deliberative democracy flourishes under majority rule. They argue that under majority rule, participants always have to convince more than half the group at the very least, while under supermajoritarian rules participants might only need to persuade a minority. Furthermore, proponents argue that cycling gives participants an interest to compromise, rather than strive to pass resolutions that only have the bare minimum required to "win". Another argument for majority rule is that within this atmosphere of compromise, there will be times when a minority faction will want to support the proposal of another faction in exchange for support of a proposal it believes to be vital. Because it would be in the best interest of such a faction to report the true intensity of its preference, so the argument goes, majority rule differentiates weak and strong preferences. McGann argues that situations such as these give minorities incentive to participate, because there are few permanent losers under majority rule, and so majority rule leads to systemic stability. He points to governments that use majority rule which largely goes unchecked—the governments of the Netherlands, Austria, and Sweden, for example—as empirical evidence of majority rule's stability. See also Appeal to the majority Arrow's theorem Condorcet's jury theorem Majority criterion Majority loser criterion Mutual majority criterion Majoritarianism Majoritarian democracy No independence before majority rule (NIBMAR) Ochlocracy Quadratic voting Voting paradox Voting system criterion Voting system References Further reading Category:Monotonic electoral systems Category:Voting theory

minipile

NaturalLanguage

mit

--- abstract: 'I give a cohomological characterization of semiample line bundles. The result is a generalization of both the Fujita–Zariski Theorem on semiampleness and the Grothendieck–Serre Criterion for ampleness. As an application of the Fujita–Zariski Theorem I characterize contractible curves in 1-dimensional families.' address: 'Mathematisches Institut, Ruhr-Universität, 44780 Bochum, Germany' author: - Stefan Schröer title: A characterization of semiampleness and contractions of relative curves --- Introduction {#introduction .unnumbered} ============ The Fujita–Zariski Theorem asserts that a line bundle ${\mathcal{L}}$ that is ample on its base locus is *semiample*. Semiampleness means that a multiple ${\mathcal{L}}^{\otimes n}$, $n>0$ is globally generated. For discrete base locus the result goes back to Zariski ([@Zariski; @1962], Thm. 6.2), and the general form is due to Fujita ([@Fujita; @1983], Thm. 1.10). This note contains two applications of the Fujita–Zariski Theorem. The first section contains a generalization of both the Fujita–Zariski Theorem and the cohomological criterion for ampleness due to Grothendieck–Serre. The result is the following characterization: A line bundle ${\mathcal{L}}$ is semiample if and only if the modules $H^1(X,{\mathcal{I}}\otimes{\operatorname{Sym}}{\mathcal{L}})$ are finitely generated over the ring $\Gamma(X,{\operatorname{Sym}}{\mathcal{L}})$ for every coherent ideal ${\mathcal{I}}\subset{\mathcal{O}}_B$. Here $B\subset X$ is the stable base locus of ${\mathcal{L}}$. This gives a positive answer to Fujita’s question ([@Fujita; @1983], 1.16) whether it is possible to weaken the assumption in the Fujita–Zariski Theorem. In the second section I generalize results of Piene [@Piene; @1974] and Emsalem [@Emsalem; @1974]. They used the Fujita–Zariski Theorem to obtain sufficient conditions for contractions in normal arithmetic surfaces. Our result is a characterization of contractible curves in 1-dimensional families over local noetherian rings in terms of complementary closed subsets. This also sheds some light on the noncontractible curve constructed by Bosch, Lütkebohmert, and Raynaud ([@Bosch;; @Luetkebohmert;; @Raynaud; @1990], chap. 6.7). For proper normal algebraic surfaces, similar results appear in [@Schroeer; @2000]. Characterization of semiampleness ================================= Throughout this section, $R$ is a noetherian ring, $X$ is a proper $R$-scheme, and ${\mathcal{L}}$ is an invertible ${\mathcal{O}}_{X}$-module. According to the Grothendieck–Serre Criterion ([@Grothendieck; @1961a], Prop. 2.6.1) ${\mathcal{L}}$ is ample if and only if for each coherent ${\mathcal{O}}_{X}$-module ${\mathcal{F}}$ there is an integer $n_0>0$ so that $H^1(X,{\mathcal{F}}\otimes{\mathcal{L}}^{\otimes n})=0$ for all $n>n_0$. Let me reformulate this in terms of graded modules. For a coherent ${\mathcal{O}}_X$-module ${\mathcal{F}}$, set $$H_*^p({\mathcal{F}},{\mathcal{L}})= H^p(X,{\mathcal{F}}\otimes{\operatorname{Sym}}{\mathcal{L}})= \bigoplus_{n\geq 0} H^p(X,{\mathcal{F}}\otimes {\mathcal{L}}^{\otimes n}).$$ This is a graded module over the graded ring $\Gamma_*({\mathcal{L}})=\Gamma(X,{\operatorname{Sym}}{\mathcal{L}})$. The Grothendieck–Serre Criterion takes the form: ${\mathcal{L}}$ is ample if and only if the modules $H^1_*({\mathcal{F}},{\mathcal{L}})$ are finitely generated over the ring $\Gamma_0({\mathcal{L}})=\Gamma({\mathcal{O}}_{X})$ for all coherent ${\mathcal{O}}_{X}$-modules ${\mathcal{F}}$. In this form it generalizes to the semiample case. Following Fujita [@Fujita; @1983], we define the *stable base locus* $B\subset X$ of ${\mathcal{L}}$ to be the intersection of the base loci of ${\mathcal{L}}^{\otimes n}$ for all $n>0$. We regard it as a closed subscheme with reduced scheme structure. \[semiample\] Let $B\subset X$ be the stable base locus of ${\mathcal{L}}$. Then the following are equivalent: 1. The invertible sheaf ${\mathcal{L}}$ is semiample. 2. The modules $H^p_*({\mathcal{F}},{\mathcal{L}})$ are finitely generated over the ring $\Gamma_*({\mathcal{L}})$ for each coherent ${\mathcal{O}}_{X}$-module ${\mathcal{F}}$ and all integers $p\geq 0$. 3. The modules $H^1_*({\mathcal{I}},{\mathcal{L}})$ are finitely generated over the ring $\Gamma_*({\mathcal{L}})$ for each coherent ideal ${\mathcal{I}}\subset {\mathcal{O}}_B$. The implication (i)$\Rightarrow$(ii) is well known, and (ii)$\Rightarrow$(iii) is trivial. To prove (iii)$\Rightarrow$(i) we assume that ${\mathcal{L}}$ is not semiample. According to the Fujita–Zariski Theorem the restriction ${\mathcal{L}}_B$ is not ample. By the Grothendieck–Serre Criterion there is a coherent ideal ${\mathcal{I}}\subset {\mathcal{O}}_B$ with $H^1(X,{\mathcal{I}}\otimes{\mathcal{L}}^{\otimes n})\neq 0$ for infinitely many $n>0$. Thus $H^1_*({\mathcal{I}},{\mathcal{L}})$ is not finitely generated over $\Gamma_0({\mathcal{L}})$. Since $B\subset X$ is the stable base locus, the maps $\Gamma(X,{\mathcal{L}}^{\otimes n}){\rightarrow}\Gamma(B,{\mathcal{L}}_B^{\otimes n})$ vanish for all $n>0$. Consequently, the irrelevant ideal $\Gamma_+({\mathcal{L}})\subset\Gamma_*({\mathcal{L}})$ annihilates $H^1_*({\mathcal{I}},{\mathcal{L}})$, which is therefore not finitely generated over $\Gamma_*({\mathcal{L}})$. Sommese [@Sommese; @1978] introduced a quantitative version of semiampleness: Let $k\geq 0$ be an integer; a semiample invertible sheaf ${\mathcal{L}}$ is called *$k$-ample* if the fibers of the canonical morphism $f:X{\rightarrow}{\operatorname{Proj}}\Gamma_*({\mathcal{L}})$ have dimension $\leq k$. For example, $0$-ampleness means ampleness. \[k-ample\] Let ${\mathcal{L}}$ be a semiample invertible ${\mathcal{O}}_{X}$-module. Then ${\mathcal{L}}$ is $k$-ample if and only if the modules $H^{k+1}_*({\mathcal{F}},{\mathcal{L}})$ are finitely generated over the ground ring $R$ for all coherent ${\mathcal{O}}_{X}$-modules ${\mathcal{F}}$. Set $Y={\operatorname{Proj}}\Gamma_*({\mathcal{L}})$ and let $f:X{\rightarrow}Y$ be the corresponding contraction. Suppose ${\mathcal{L}}$ is $k$-ample. Choose $n_0>0$ so that ${\mathcal{L}}^{\otimes n_0}=f^*({\mathcal{M}})$ for some ample invertible ${\mathcal{O}}_Y$-module ${\mathcal{M}}$. Put ${\mathcal{G}}= {\mathcal{F}}\otimes({\mathcal{L}}\oplus{\mathcal{L}}^{\otimes 2}\oplus\ldots\oplus{\mathcal{L}}^{\otimes n_0})$. Choose $m_0>0$ with $H^p(Y,R^qf_*({\mathcal{G}})\otimes{\mathcal{M}}^{\otimes m})=0$ for $p>0$, $q\leq k+1$, and $m>m_0$. Consequently, the edge map $H^{k+1}(X,{\mathcal{G}}\otimes {\mathcal{L}}^{\otimes mn_0}) {\rightarrow}H^0(Y,R^{k+1}f_*({\mathcal{G}})\otimes{\mathcal{M}}^{\otimes m})$ in the spectral sequence $$H^p(Y,R^qf_*({\mathcal{G}})\otimes{\mathcal{M}}^{\otimes m})\Longrightarrow H^{p+q}(X,{\mathcal{G}}\otimes {\mathcal{L}}^{\otimes mn_0})$$ is injective for $m>m_0$. The fibers of $f:X{\rightarrow}Y$ are at most $k$-dimensional, so $R^{k+1}f_*({\mathcal{G}})=0$. Thus $H^{k+1}(X,{\mathcal{F}}\otimes{\mathcal{L}}^{n})=0$ for all $n>n_0m_0$. Conversely, assume that the condition holds. Seeking a contradiction we suppose that some fiber of $f:X{\rightarrow}Y$ has dimension $>k$. Using [@Kleiman; @1967] we find a coherent ${\mathcal{O}}_{X}$-module ${\mathcal{F}}$ with $R^{k+1}f_*({\mathcal{F}}) \neq 0$. Replacing ${\mathcal{L}}$ by a suitable multiple, we have ${\mathcal{L}}=f^*({\mathcal{M}})$ for some ample invertible ${\mathcal{O}}_Y$-module ${\mathcal{M}}$. Passing to a higher multiple if necessary, $H^p(Y,R^qf_*({\mathcal{F}})\otimes{\mathcal{M}}^{\otimes n})=0$ holds for $p>0$, $q\leq k$, and $n>0$. Then the edge map $H^{k+1}_*(X,{\mathcal{F}}\otimes{\mathcal{L}}^{\otimes n}){\rightarrow}H^0_*(Y,R^{k+1}f_*({\mathcal{F}})\otimes{\mathcal{M}}^{\otimes n}) $ is surjective for $n>0$. Choose a global section $s\in\Gamma(Y,{\mathcal{M}}^{\otimes n})$ for some $n>0$ so that the open subset $Y_s\subset Y$ contains the set of associated points for $R^{k+1}f_*({\mathcal{F}})$. Then $s\in\Gamma_*({\mathcal{M}})$ is not a zero divisor for $H^0_*(R^{k+1}f_*({\mathcal{F}}) ,{\mathcal{M}})$. It follows that $H^0_*(R^{k+1}f_*({\mathcal{F}}) ,{\mathcal{M}})$ is nonzero for infinitely many degrees. Consequently, the same holds for $H^{k+1}_*({\mathcal{F}},{\mathcal{L}})$, which is therefore not finitely generated over $R$. For a *vector bundle* ${\mathcal{E}}$, it might happen that ${\mathcal{O}}_{{\mathbb{P}}({\mathcal{E}})}(1)$ is semiample, whereas ${\operatorname{Sym}}^n({\mathcal{E}})$ fails to be globally generated for all $n>0$. For example, let $k$ be an algebraically closed field of characteristic $p>0$, and $X$ be a smooth proper curve of genus $g>p-1$ so that the absolute Frobenius ${\operatorname{Fr}}_X:H^1({\mathcal{O}}_{X}){\rightarrow}H^1({\mathcal{O}}_{X})$ is zero. For an example see [@Hartshorne; @1977], p. 348, ex. 2.14. Let $D\subset X$ be a divisor of degree $1$. According to the commutative diagram $$\begin{CD} H^0({\mathcal{O}}_X) @>>> H^0({\mathcal{O}}_D) @>>> H^1({\mathcal{O}}_{X}(-D)) @>>> H^1({\mathcal{O}}_{X}) \\ @V{\operatorname{Fr}}_X^* VV @V{\operatorname{Fr}}_X^* VV @V{\operatorname{Fr}}_X^* VV @VV{\operatorname{Fr}}_X^*=0 V\\ H^0({\mathcal{O}}_X) @>>> H^0({\mathcal{O}}_{pD}) @>>> H^1({\mathcal{O}}_{X}(-pD)) @>>> H^1({\mathcal{O}}_{X}), \end{CD}$$ the $p$-linear map ${\operatorname{Fr}}_X^*:H^1({\mathcal{O}}_{X}(-D)){\rightarrow}H^1({\mathcal{O}}_{X}(-pD))$ is not injective. Hence there is a nontrivial extension $$0 {\longrightarrow}{\mathcal{O}}_{X} {\longrightarrow}{\mathcal{E}}{\longrightarrow}{\mathcal{O}}_X(D) {\longrightarrow}0$$ whose Frobenius pull back ${\operatorname{Fr}}_X^*({\mathcal{E}})$ splits. The surjection ${\mathcal{E}}{\rightarrow}{\mathcal{O}}_X(D)$ gives a section $A\subset {\mathbb{P}}({\mathcal{E}})$ representing ${\mathcal{O}}_{{\mathbb{P}}({\mathcal{E}})}(1)$ with $A^2=1$ ([@Hartshorne; @1977], Prop. 2.6, p. 371). The Fujita–Zariski Theorem implies that ${\mathcal{O}}_{{\mathbb{P}}({\mathcal{E}})}(1)$ is semiample, and we obtain a birational contraction ${\mathbb{P}}({\mathcal{E}}){\rightarrow}Y$. It is easy to see that the exceptional set is an integral curve $R\subset {\mathbb{P}}({\mathcal{E}})$ which has degree $p$ on the ruling. Hence ${\mathbb{P}}({\mathcal{E}}){\rightarrow}Y$ does not restrict to closed embeddings on the fibers of ${\mathbb{P}}({\mathcal{E}}){\rightarrow}X$. Consequently, ${\operatorname{Sym}}^n({\mathcal{E}})$ is not globally generated at any point $x\in X$. Contractions of relative curves =============================== Throughout this section, $R$ is a local noetherian ring, and $X$ is a proper $R$-scheme with 1-dimensional closed fiber $X_0\subset X$. Then all fibers of the structure morphism $X{\rightarrow}{\operatorname{Spec}}(R)$ are at most 1-dimensional. For example, $X$ could be a flat family of curves. A *Stein factor* of $X$ is a proper $R$-scheme $Y$ together with a proper morphism $f:X{\rightarrow}Y$ so that ${\mathcal{O}}_Y{\rightarrow}f_*({\mathcal{O}}_X)$ is bijective (compare [@Kleiman; @1966], sec. 5). Our objective is to describe the set of all Stein factors for a given $X$. Let $C_i$, $i\in I$ be the finite collection of all 1-dimensional integral components of the closed fiber $X_0$. A subset $J\subset I$ yields a subcurve $C=\bigcup_{i\in J}C_i$. We call such a curve $C\subset X$ *contractible* if there is a Stein factor $f:X{\rightarrow}Y$ so that $f(C_i)$ is a closed point if and only if $i\in J$. According to [@Grothendieck; @1961a], Theorem 5.4.1, a Stein factor is determined up to isomorphism by its restriction $f_0:X_0{\rightarrow}Y_0$. The task now is to determine the contractible curves $C\subset X$. It follows from [@Piene; @1974] and [@Emsalem; @1974] that all curves $C\subset X$ are contractible provided that the ground ring $R$ is henselian. In particular this holds if $R$ is complete. On the other hand, a noncontractible curve is discussed in [@Bosch;; @Luetkebohmert;; @Raynaud; @1990], chapter 6.7. We seek to describe contractible curves $C\subset X$ in terms of complementary closed subsets $D\subset X$. We need a definition: Suppose $D\subset X$ is a closed subset of codimension $\leq 1$. Let $R\subset R^\wedge$ be the completion with respect to the maximal ideal, $X'$ the normalization of $X\otimes_R R^\wedge$, and $C_i',C',D'\subset X'$ the preimages of $C_i,C,D\subset X$, respectively. Let $h:X'{\rightarrow}Z'$ be the contraction of all $C_i'\subset X_0'$ disjoint from $C' $. We call $D$ *persistent* if $h(D') \subset Z'$ has codimension $\leq 1$. Suppose $R$ is a discrete valuation ring with residue field $k$ and fraction field $K$. Let $X$ be the proper $R$-scheme obtained from $X'={\mathbb{P}}^1_R$ by identifying the closed points $0,\infty\in{\mathbb{P}}^1_k$. Then the closure $D\subset X$ of the point $0\in{\mathbb{P}}^1_K$ is not persistent. \[contractible\] Suppose $J\subset I$ is a subset so that the curve $C=\bigcup_{i\in J}C_i$ is connected. Then $C\subset X_0$ is contractible if and only if there is a persistent closed subset $D\subset X$ of codimension $\leq 1$ disjoint from $C$ and intersecting each irreducible component $C_i\subset X_0$ with $i\not\in J$. Assume that $C$ is contractible. The corresponding contraction $f:X{\rightarrow}Y$ maps $C$ to a single point. Let $V\subset Y $ be an affine open neighborhood of $f(C)$. Set $U=f^{-1}(V)$ and $D=X- U$. Clearly $D\cap C=\emptyset$. Furthermore, $D\cap C_i\neq \emptyset$ for $i\not\in J$; otherwise $f(C_i)$ would be a proper curve contained in the affine scheme $V$, which is absurd. Let $X',Y'$ be the normalizations of $X\otimes_R R^\wedge, Y\otimes_R R^\wedge$, respectively. The induced morphism $f':X'{\rightarrow}Y'$ is the contraction of the preimage $C'\subset X'$ of $C$. The preimage $V'\subset Y'$ of $V$ is affine, so $Y- V$ is of codimension $\leq 1$ ([@SGA; @6] II, 2.2.6). Hence the preimage $D'\subset X'$ of $D$ is of codimension $\leq 1$. Obviously, the same holds if we contract the preimages $C_i'\subset X'$ of $C_i$ disjoint from $C'$. Thus $D\subset X$ is of codimension $\leq 1$ and persistent. Conversely, assume the existence of such a subset $D\subset X$. Set $U=X- D$. We claim that the affine hull $U^{{\text{aff}}}={\operatorname{Spec}}\Gamma(U,{\mathcal{O}}_{X})$ is of finite type over $R$ and that the canonical morphism $U{\rightarrow}U^{{\text{aff}}}$ is proper. Suppose this for a moment. Then $U{\rightarrow}U^{{\text{aff}}}$ contracts $C$ and is a local isomorphism near each $x\in U_0- C$. Choose for each $x\in X_0- C$ an affine open neighborhood $U_x\subset X$ of $x$ disjoint to the exceptional set of $U{\rightarrow}U^{{\text{aff}}}$. Then $U_x\cap U{\rightarrow}U^{{\text{aff}}}$ is an open embedding. It is easy to see that the schemes $U_x\bigcup_{U_x\cap U} U^{{\text{aff}}}$, $x\in X_0- C$ and $U^{{\text{aff}}}$ form an open cover of a proper $R$-scheme $Y$. The induced morphism $f:X{\rightarrow}Y$ is the desired contraction. It remains to verify the claim. Let $R\subset R^\wedge$ be the completion. According to [@SGA; @1], VIII Corollary 3.4, the scheme $U^{{\text{aff}}}$ is of finite type if and only if $U^{{\text{aff}}}\otimes_R R^\wedge$ is of finite type. Furthermore, $U{\rightarrow}U^{{\text{aff}}}$ is proper if and only if if is proper after tensoring with $R^\wedge$ ([@SGA; @1], VIII Cor. 4.8). Since $U^{{\text{aff}}}\otimes_R R^\wedge=(U\otimes_R R^\wedge)^{{\text{aff}}}$ by [@Grothendieck; @1967], Proposition 21.12.2, it suffices to prove the claim under the additional assumption that $R$ is complete. Now each curve in $X_0$ is contractible. Observe that the contraction of $C$ does not change $U^{{\text{aff}}}$, so we can as well assume that $C$ is empty. Now our goal is to prove that $U$ is affine. Since $R$ is complete, hence universally japanese, the normalization $X'{\rightarrow}X$ is finite. Using Chevalley’s Theorem ([@Grothendieck; @1961], Thm. 6.7.1), we reduce the problem to the case that $X$ is normal. Now the irreducible components of $X$ are the connected components. Treating them separately we may assume that $X$ is connected. Contracting the curves $C_i$ contained in $D$ we can assume that $D_0$ is finite and intersects each $C_i$. If $D= X$ or $D=\emptyset$ there is nothing to prove. Assume that $D\subset X$ is of codimension 1, in other words a Weil divisor. The problem is that it might not be Cartier. To overcome this, consider the graded quasicoherent ${\mathcal{O}}_{X}$-algebra ${\mathcal{R}}=\bigoplus_{n\geq 0}{\mathcal{O}}_{X}(nD)$. The graded subalgebra ${\mathcal{R}}'\subset {\mathcal{R}}$ generated by ${\mathcal{R}}_1={\mathcal{O}}_{X}(D)$ is of finite type over ${\mathcal{O}}_{X}$. Set $X'={\mathcal{P}\!\text{\textit{roj}}\,}({\mathcal{R}}')$ and let $g:X'{\rightarrow}X$ be the structure morphism. Then $g$ is projective and ${\mathcal{O}}_{X'}(1)$ is a $g$-very ample invertible ${\mathcal{O}}_{X'}$-module. The canonical maps $D:{\mathcal{O}}_{X}(nD){\rightarrow}{\mathcal{O}}_{X}((n+1)D)$ induce a homomorphism ${\mathcal{R}}'{\rightarrow}{\mathcal{R}}'$ of degree one, hence a section $s:{\mathcal{O}}_{X'}{\rightarrow}{\mathcal{O}}_{X'}(1)$. It follows from the definition of homogeneous spectra that $s$ is bijective over $U$ and vanishes on $g^{-1}(D)$. Thus the corresponding Cartier divisor $D'\subset X'$ representing ${\mathcal{O}}_{X'}(1)$ has support $g^{-1}(D)$. Let $A\subset X_0'$ be a closed integral subscheme of dimension $n>0$. If $g(A)\subset X_0$ is a curve, then $A$ is not contained in $D'$ but intersects $D'$. Hence $D'\cdot A>0$. If $g(A)\subset X$ is a point, then ${\mathcal{O}}_{A}(1)$ is ample, so $(D')^n\cdot A>0$. By the Nakai criterion for ampleness we conclude that ${\mathcal{O}}_{X'}(1)$ is ample on its base locus. Now the Fujita–Zariski Theorem tells us that ${\mathcal{O}}_{X'}(1)$ is semiample. It follows that $U\simeq X'- D'$ is affine. This finishes the proof. Let us consider the special case that the total space $X$ is a normal surface. Replacing $R$ by $\Gamma(X,{\mathcal{O}}_X)$, we are in the following situation: Either $R$ is a discrete valuation ring, such that $X{\rightarrow}{\operatorname{Spec}}(R)$ is a flat deformation of $X_0$. Or $R$ is a local normal 2-dimensional ring, hence $X{\rightarrow}{\operatorname{Spec}}(R)$ is the birational contraction of $X_0$. In either case we call a Weil divisor $H\in Z^1(X)$ *horizontal* if it is a sum of prime divisors not supported by $X_0$. Suppose $J\subset I$ is a subset with $C=\bigcup_{i\in J}C_i$ connected. Let $V\subset X_0$ be the union of all $C_i$ disjoint from $C$. \[surfaces\] Notation as above. Then $C\subset X_0$ is contractible if and only if there is a horizontal Weil divisor $H\subset X$ disjoint from $C$ with the following property: For each $C_i$, $i\not\in J$, either $H$ intersects $C_i$, or $H$ intersects a connected component $V'\subset V$ with $V'\cap C_i\neq\emptyset$. Suppose $C\subset X_0$ is contractible. Let $D\subset X$ be a persistent Weil divisor as in Theorem \[contractible\]. Then its horizontal part $H\subset D$ satisfies the above conditions. Conversely, assume there is a horizontal Weil divisor $H\subset X$ as above. It follows that $D=H+V$ is a persistent Weil divisor disjoint from $C$ intersecting each $C_i$ with $i\not\in J$. Thus $C\subset X_0$ is contractible. [ccccc]{} S. Bosch, W. Lütkebohmert, M. Raynaud: Néron models. Ergeb. Math.  Grenzgebiete 21. Springer, Berlin, 1990. J. Emsalem: Projectivité des schémas en courbes sur un anneau de valuation discrète. Bull. Soc. Math. France 101, 255–263 (1974). T. Fujita: Semipositive line bundles. J. Fac. Sci. Univ. Tokyo 30, 353–378 (1983). A. Grothendieck: Éléments de géométrie algébrique II: Étuede globale élémentaire de quelques classes de morphismes. Publ. Math., Inst. Hautes Etud. Sci. 8 (1961). A. Grothendieck: Éléments de géométrie algébrique III: Étuede cohomologique des faiscaux cohérent. Publ. Math., Inst. Hautes Etud. Sci.  11 (1961). A. Grothendieck: Éléments de géométrie algébrique IV: Étuede locale des schémas et de morphismes de schémas. Publ. Math., Inst. Hautes Etud. Sci.  24 (1965). A. Grothendieck: Éléments de géométrie algébrique IV: Étuede locale des schémas et de morphismes de schémas. Publ. Math., Inst. Hautes Etud. Sci.  28 (1966). A. Grothendieck: Éléments de géométrie algébrique IV: Étuede locale des schémas et de morphismes de schémas. Publ. Math., Inst. Hautes Étud. Sci.  32 (1967). A. Grothendieck et al.: Revêtements étales et groupe fondamental. Lect. Notes Math.  224, Springer, Berlin, 1971. A. Grothendieck et al.: Théorie des intersections et théorème de Riemann-Roch. Lect. Notes Math. 225. Springer, Berlin, 1971. R. Hartshorne: Algebraic geometry. Grad. Texts Math. 52. Springer, Berlin, 1977. S. Kleiman: Toward a numerical theory of ampleness. Ann. Math.  84, 293–344 (1966). S. Kleiman: On the vanishing of $H^n(X,{\mathcal{F}})$ for an $n$-dimensional variety. Proc. Amer. Math. Soc. 18, 940–944 (1967). R. Piene: Courbes sur un trait et morphismes de contraction. Math. Scand. 35, 5–15 (1974). S. Schröer: On contractible curves on normal surfaces. J. Reine Angew. Math. 524, 1–15 (2000). A. Sommese: Submanifolds of Abelian varieties. Math. Ann. 233, 229–256 (1978). O. Zariski: The theorem of Riemann-Roch for high multiples of an effective divisor on an algebraic surface. Ann. Math.  76, 560–615 (1962).

minipile

NaturalLanguage

mit

The alpha 2-adrenoceptor antagonist efaroxan modulates K+ATP channels in insulin-secreting cells. The actions of efaroxan, a highly selective and potent alpha 2-adrenoceptor antagonist, on insulin secretion, cAMP levels, 86Rb+ efflux and ATP-regulated potassium (K+ATP) channels have been studied using isolated pancreatic islets of Langerhans and RINm5F cells. In the absence of an adrenoceptor agonist, efaroxan (1-100 microM) potentiated glucose-induced secretion over the range 4-10 mM glucose, but was without effect upon the maximal rate of secretion induced by 20 mM glucose. Efaroxan did not affect cAMP levels. Suppression of insulin release by the potassium channel opener diazoxide, was partially alleviated by efaroxan and was associated with an inhibition of the diazoxide-induced increase in the rate of 86Rb+ efflux. Using isolated patches of membrane we found efaroxan to be an effective blocker of K+ATP channels, with a KI value of 12 microM and a Hill coefficient of approximately 1. These data indicate that efaroxan promotes insulin secretion, in the absence of exogenous agonists, by a mechanism that involves inhibition of ATP-regulated K+ channels.

minipile

NaturalLanguage

mit

Scott Smith (ice hockey) Scott Smith (born November 27, 1966) is a Canadian ice hockey executive, administrator, and businessman, who has worked for Hockey Canada since 1995. He served as Vice-President and chief operating officer (COO) of Hockey Canada from 2007 to 2016, and as President and COO since 2016. Smith has overseen rapid growth business operations for Hockey Canada, managed International Ice Hockey Federation competitions, and negotiated public–private partnerships, and television deals. He has helped Hockey Canada become a profitable business, and takes a progressive stance on developing youth hockey programs, and increasing minor ice hockey registrations in Canada. Early life Smith was born November 27, 1966, in Bathurst, New Brunswick. He graduated from Bathurst High School in 1984. He completed an education degree at the University of New Brunswick in 1988. Smith was executive director from 1991 to 1995, of the New Brunswick Amateur Hockey Association. He served as an assistant coach for the UNB Varsity Reds during the 1994–95 season, and was an instructor for coaching and player development. Hockey Canada Vice-president Smith began working for Hockey Canada in 1995, as the manager of hockey operations for the Atlantic Canada centre of excellence in Saint John, New Brunswick. He relocated to the Calgary, Alberta office in 1997, becoming the director of operations, and in 1998 was promoted to vice-president of Hockey Canada business operations. The change coincided with the retirement of Murray Costello, and Bob Nicholson becoming president. In 2003, Smith was named by The Globe and Mail in its 40-under-40 list. Smith became the senior vice-president in charge of business operations in 2005, then senior executive vice-president in 2006, and chief operating officer (COO) in 2007. Smith was responsible for the day-to-day business of Hockey Canada under Nicholson. Smith's management and marketing of international events was cited by the Stanford Graduate School of Business as a reason for the growth of Hockey Canada. His planning of programs has created guaranteed profit margins, and strong television ratings. His work included organizing the IIHF World U20 Championships and the IIHF World Women's Championships hosted in Canada, negotiating a broadcasting agreement with The Sports Network and Réseau des sports, and Hockey Canada sponsorships and licensing. He also sat on the board of directors for the International Hockey Heritage Centre, the International Ice Hockey Federation Marketing Committee, and the IIHF 100th Anniversary Committee. Smith has actively sought public–private partnerships for Hockey Canada which have mutual value, a sustainable relationship with similar goals, and realistic goals that Hockey Canada can deliver to partners, to get more funding and sponsorships in the future, instead of relying on donations and government subsidy. Smith said that government subsidy is five to seven per cent of the total Hockey Canada budget, distributed to coaching and officiating development, the national teams for Olympic participation, some is from Sport Canada. Smith negotiated with Canadian Tire, and Bauer Hockey in 2014, to create the First Shift Program. The program includes equipment for new players to the game, and a six-week program to learn the game. As of 2018, First Shift has helped 15,500 Canadian children play hockey, and made its debut in Inuvik, Northwest Territories. Smith negotiated Hockey Canada's relationship with Molson Brewery such that it is different at adult events, and youth events below the legal drinking age, and ensured there are guidelines for usage of the Hockey Canada brand. He has also negotiated deals to perpetuate Hockey Canada Foundation philanthropy, seeking corporate sponsors with an interest in youth hockey, and to run events with hockey alumni, and involve community leaders, such as a partnership with the city of Montreal and the Montreal Canadiens, to provide hockey for underprivileged youth. Smith pursued an ethical consumerism policy for Hockey Canada and its merchandise suppliers. Smith said that Hockey Canada wants "to keep up to the highest standards of transparency", and work with labour rights groups, including the Worker Rights Consortium and the Worldwide Responsible Accredited Production." President Prior to becoming COO of Hockey Canada, Smith was not well known outside of hockey, and seemed to be an internal replacement for Nicholson when the latter retired in July 2014. Smith was considered for the presidency when Tom Renney was hired instead. On December 29, 2016, Hockey Canada announced that Smith would replace Renney as president on July 1, 2017. Smith kept his role as COO, while Renney remained as CEO. Renney said that by promoting Smith, "there was an opportunity for Hockey Canada to be more effective in fulfilling its mandate", and that he and Smith have “very complementary skill sets and approaches”. Renney said that their respective "jobs really won’t change a whole lot, other than that we make ourselves more diverse". The change created a higher public profile for Smith, while he continued to oversee regular business operations. Smith said that one his first objectives after becoming president was to "deepen the quality of the hockey experience" and to attract more players and coaches into the game. He also believed that Hockey Canada's existing coaching, officiating, and respect in sport programs are top notch. He noted that as of 2016, Hockey Canada had approximately 675,000 registered players, and he wanted to increase that and give more players an opportunity to at the World Juniors. He implemented new analytical measures at Hockey Canada to track new players to the game, and retention rate of them. He also began a floorball program, and distributing children's literature to reach out to newer Canadians and ethnic communities, in attempt to have hockey teams reflect the multiculturalism in Canada. Smith became president of Hockey Canada at the same time which the organization was criticized about the ticket prices and the lack of attendance at the 2015 World Junior Ice Hockey Championships, and the 2017 World Junior Ice Hockey Championships, co-hosted in Toronto and Montreal. At the previous events Canada hosted, the total attendance in Calgary and Edmonton was 455,342 fans, Ottawa drew 453,282 fans, but attendance dropped to 366,370 fans in Canada’s largest cities. Smith said that the Toronto market was saturated by other events such as the 2016 World Cup of Hockey, the NHL Centennial Classic, the 104th Grey Cup, the MLS Cup 2016, the 2016 NBA All-Star Game, and the playoff success of the Toronto Raptors, and the Toronto Blue Jays. Ticket sales in Montreal struggled, despite prices being lowered by 30% in 2017 compared to 2015, and a marketing change to sell more individual games, and fewer package deals. Despite the poor attendance, Hockey Canada achieved 80% of its goal of $21 million in ticket sales, to reinvest into the community and the participating teams. Later in 2017, Smith announced a new deal with BDO Global in Canada, to begin the Goals for Kids program, and expand its partnership of events such as the World U-17 Hockey Challenge, the World Junior A Challenge, the World Sledge Hockey Challenge, the National Women's Under-18 Championship, the Esso Cup, the Telus Cup, and the RBC Cup. The deal included a set donation per goal scored by teams at those events, which is reinvested in the host communities as a legacy program. Smith was optimistic that National Hockey League players would participate in ice hockey at the 2018 Winter Olympics, but was prepared for alternative measures. He and Renney collaborated regularly with team management of Sean Burke with the men's national team, and Melody Davidson with the women's national team to ensure that staff and athletes were prepared to perform on the ice. In 2018, Smith extended the partnership with Bauer Hockey for another 8 years, who have been the official equipment supplier for the national teams since 1996. Personal life As of 2018, Smith resides in Calgary and is married to Karen. He had one son named Jackson, who grew up playing hockey. Smith has family in the Bathurst area, including in-laws, and has a summer cottage on Chaleur Bay. He considers himself fortunate to have a career in hockey, and grateful for its experiences, highlighted by the gold medals wins by the men's and women's ice hockey teams at the Winter Olympic Games from 2002 to 2014. References Category:1966 births Category:Living people Category:Businesspeople from New Brunswick Category:Canadian sports builders Category:Canadian sports executives and administrators Category:Hockey Canada presidents Category:Ice hockey people from New Brunswick Category:People from Bathurst, New Brunswick Category:University of New Brunswick alumni

minipile

NaturalLanguage

mit

The Most Peculiar Adventures Money Can Buy What does adventure travel mean in 2018? Two ex-army captains have some very big ideas. If your idea of travel is kicking back on a yacht for 10 days, it’s time you started thinking bigger. These days, anything is possible – and the only limit is your imagination. Want to recreate a trip to Mars in the middle of the desert, or spend 10 days touring the untouched slopes of Alaska? There’s a travel company for that. And while the world gets increasingly smaller thanks to air travel, the internet, and that ever burgeoning industry of armchair tourism (cheers David Attenborough) there is also more to explore than ever. That may not be the case for much longer, though, as you’ll probably have been made aware of thanks to… David Attenborough. Because the planet is under threat. From the dying reefs to the dramatically decreasing shark population, to the 150 acres of rainforest lost every minute, the time to see the wonders of the world is now. Or yesterday. It’s not like we aren’t travelling – 70.8 million Brits went overseas in 2016 – it’s just we’re all travelling to the same places. Skiing in the Alps. City-breaking in Portugal. Holiday-ing on just three of Indonesia’s 17,800 islands. And as for the rest of the world? Well, there’s only so much you can enjoy through a TV screen. In the last 10 years a handful of forward-thinking adventure-junkies have become aware of this, and hence a new market for exclusive, wildly expensive, if-you-dream-it-you-can-do-it adventure holidays has been born. Photograph by: Tommy Schultz One of these men is Geordie Mackay-Lewis – an alumni of the British army with previous experience at another adventure travel company – who’s broken out on his own along with co-founder Jimmy Carroll. Between them the pair have set up Pelorus to make all your weirdest, wildest travel dreams come true. To give you a flavour of what you can expect from this new breed of adventure travel companies: one of the duo’s recent ‘Unknown’ experiences involved a deep desert insertion using helicopters in southern Israel, traveling to the Jordanian border and the group navigating their way into Wadi Rum desert – where they found their accommodation: pressurised dome tents, which sort of simulated the experience of being on Mars. If you’re going to put your lives in someone’s hands, it should probably be these guys. Alongside his army credentials, 36-year old Carroll has also managed the largest ever medical research expedition to Everest, and done time as Manchester United’s global tour manager. Mackay-Lewis’ own CV includes two tours of Afghanistan and both desert and jungle warfare. The duo seem acutely aware of what a privilege it is to explore truly untouched parts of the world. “We’ve got such little time to enjoy our planet and see everything,” says Mackay-Lewis. “The key thing is that people realise our world hasn’t been explored yet, there’s so much more to do and see.” That privilege comes with a huge amount of responsibility. Because from a conservation perspective, these incredibly unique experiences can be a conflict of interest. There are areas these companies are taking clients to which are completely unregulated and untouched. “If we’re the ones taking people there and visiting them we have to have respect and also write the rule book,” offers Mackay-Lewis. “These are places which humans don’t just go to.” “It’s even more important to respect the animals there because they don’t run away – because they don’t know who you are or what you are. So up in the polar regions we do say now – when someone asks ‘Can I go and put a pair of sunglasses on a bearded seal’ – we say no, you just can’t do that.” Right now, the pair are working on a bespoke brief. “A father and son approached us a month ago, and the father said, I want my 15 year old son to experience some of the best experiences the world has to offer, so I want to create a 10 year bucket list” says Mackay-Lewis. “In 10 years we can do some extraordinary things,” he continues. “We’re going to give him an adventure plan, where he’s going to go through some mountaineering training, some scuba diving training, make sure he has the tools he’ll need to access certain parts of the world.” For many, relaxing on a beach is a great way to switch off. But for others, particularly those with high pressure jobs and fast-paced city lives, adventure is the only antidote. And the fun starts as soon as you have your first face to face meeting. “It’s about being kids again,” says Carroll of the initial stages of putting ideas together. “As an adult, you have that sense of safety and security behind everything, but you also need the mentality of a child to create enjoyment and fun and creativity. And we do not work with the standard suppliers, but with experts around the world. From BBC Natural History to an interesting anthropologist who spent 25 years in Papua New Guinea.” Photo: Jeremy Koreski With these kind of contacts there is little of the world which is out of bounds. But occasionally someone comes along with an idea that they really have to say no to. “I had a client who wanted to spend a night on an iceberg. I said no,” says Mackay-Lewis. “We create alternate realities and sometimes people get quite carried away about what reality is possible.” He continues: “There are things which are just physically not possible. One person wanted to reenact The Battle of Britain, and hire ten spitfires and some German bombers. And that’s just not going to happen.” It’s easy to imagine that we’re in a golden age of exploration, thanks largely to technology. But the human desire for adventure is nothing new. “Through technology advancements we’re now able to go to far flung places pretty comfortably,” says Mackay-Lewis. “It means anyone can be an explorer.”

minipile

NaturalLanguage

mit

Q: I uninstalled vsftpd, but I can still connect with sftp I installed vsftpd and was in the process of configuring it. When I sent the vsftpd server stop command: sudo service vsftpd stop I received: stop: Unknown instance So I went ahead and uninstalled it and rebooted the system sudo apt-get remove --purge vsftpd when I 'stop' vsftpd now it says: vsftpd: unrecognized service If I try 'uninstalling' vsftpd its says: Package vsftpd is not installed, so not removed Issue: But I can still connect to my server using FTP client I cannot somehow believe there is a zombie? process that is not getting killed even after reboot. Can someone please throw light on this? System Configuration: Ubuntu 12.04.1 Server LTS as Guest VM on Windows 7 Host VM TCP dump as requested: Command: sudo tcpdump port 22 >tcpdump.log Action taken: Used WinSCP to SFTP into the Guest OS Server tcpdumplog: 17:00:42.745423 IP Brown.home.54199 > ubuntu-12.home.ssh: Flags [P.], seq 4076673955:4076673991, ack 3552872727, win 17520, length 36 17:00:42.745442 IP Brown.home.54199 > ubuntu-12.home.ssh: Flags [F.], seq 36, ack 1, win 17520, length 0 17:00:42.746192 IP ubuntu-12.home.ssh > Brown.home.54199: Flags [F.], seq 1, ack 37, win 16616, length 0 17:00:42.746406 IP Brown.home.54199 > ubuntu-12.home.ssh: Flags [.], ack 2, win 17520, length 0 17:00:50.181085 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [S], seq 8389211, win 8192, options [mss 1460,nop,nop,sackOK], length 0 17:00:50.181112 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [S.], seq 1127786298, ack 8389212, win 14600, options [mss 1460,nop,nop,sackOK], length 0 17:00:50.181262 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [.], ack 1, win 17520, length 0 17:00:50.186862 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [P.], seq 1:40, ack 1, win 14600, length 39 17:00:50.187152 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 1:31, ack 40, win 17481, length 30 17:00:50.187282 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [.], ack 31, win 14600, length 0 17:00:50.187476 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 31:639, ack 40, win 17481, length 608 17:00:50.187485 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [.], ack 639, win 15808, length 0 17:00:50.188653 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [P.], seq 40:1024, ack 639, win 15808, length 984 17:00:50.188900 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 639:655, ack 1024, win 16497, length 16 17:00:50.190537 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [P.], seq 1024:1304, ack 655, win 15808, length 280 17:00:50.240004 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 655:927, ack 1304, win 16217, length 272 17:00:50.254190 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [P.], seq 1304:2152, ack 927, win 17024, length 848 17:00:50.312380 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 927:943, ack 2152, win 17520, length 16 17:00:50.351847 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [.], ack 943, win 17024, length 0 17:00:50.352298 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 943:995, ack 2152, win 17520, length 52 17:00:50.352316 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [.], ack 995, win 17024, length 0 17:00:50.352579 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [P.], seq 2152:2204, ack 995, win 17024, length 52 17:00:50.361499 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 995:1063, ack 2204, win 17468, length 68 17:00:50.388593 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [P.], seq 2204:2272, ack 1063, win 17024, length 68 17:00:50.590761 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [.], ack 2272, win 17400, length 0 17:00:52.960712 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 1063:1147, ack 2272, win 17400, length 84 17:00:52.999659 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [.], ack 1147, win 17024, length 0 17:00:53.037972 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [P.], seq 2272:2308, ack 1147, win 17024, length 36 17:00:53.038482 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 1147:1215, ack 2308, win 17364, length 68 17:00:53.038510 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [.], ack 1215, win 17024, length 0 17:00:53.271416 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [P.], seq 2308:2360, ack 1215, win 17024, length 52 17:00:53.271628 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 1215:1299, ack 2360, win 17312, length 84 17:00:53.271661 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [.], ack 1299, win 17024, length 0 17:00:53.271864 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 1299:1367, ack 2360, win 17312, length 68 17:00:53.271872 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [.], ack 1367, win 17024, length 0 17:00:53.272369 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [P.], seq 2360:2448, ack 1367, win 17024, length 88 17:00:53.275151 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 1367:1419, ack 2448, win 17224, length 52 17:00:53.275347 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [P.], seq 2448:2628, ack 1419, win 17024, length 180 17:00:53.279576 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 1419:1471, ack 2628, win 17044, length 52 17:00:53.279717 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [P.], seq 2628:2728, ack 1471, win 17024, length 100 17:00:53.280194 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 1471:1539, ack 2728, win 16944, length 68 17:00:53.280339 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [P.], seq 2728:2796, ack 1539, win 17024, length 68 17:00:53.280546 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 1539:1607, ack 2796, win 16876, length 68 17:00:53.280869 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [P.], seq 2796:3504, ack 1607, win 17024, length 708 17:00:53.281105 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 1607:1675, ack 3504, win 16168, length 68 17:00:53.281218 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [P.], seq 3504:3588, ack 1675, win 17024, length 84 17:00:53.281416 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 1675:1743, ack 3588, win 16084, length 68 17:00:53.281543 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [P.], seq 3588:3656, ack 1743, win 17024, length 68 17:00:53.480952 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [.], ack 3656, win 17520, length 0 17:00:56.881662 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [P.], seq 1743:1779, ack 3656, win 17520, length 36 17:00:56.881688 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [F.], seq 1779, ack 3656, win 17520, length 0 17:00:56.881908 IP ubuntu-12.home.ssh > Brown.home.54223: Flags [F.], seq 3656, ack 1780, win 17024, length 0 17:00:56.882061 IP Brown.home.54223 > ubuntu-12.home.ssh: Flags [.], ack 3657, win 17520, length 0 Please let me know in case you require any additional information A: SFTP is not FTP. It's the sftp subsystem of ssh, it's handled by the sshd daemon, not vsftpd or any FTP server. It's on the ssh TCP port (22), not the FTP port 21 (well FTP commands are on 21 while data connections are on arbitrary ports, and those multiple connections in FTP are one of the many reasons why SFTP is so much better than FTP). ss -lp sport = :22 or ss -lp sport = :ssh would show you that sshd is handling the connections there. If you want to disable SFTP but retain ssh access (though that would make little sense unless users land with a restricted shell on that machine), you have to disable sftp in sshd_config by commenting out the Subsystem sftp... line.

minipile

NaturalLanguage

mit

Computerized Educational Systems (CES) will develop, evaluate, and market a curriculum of computer assisted instruction (CAI) in nursing identification of and intervention in alcohol and other drug abuse (AODA) problems. The curriculum will be designed for generalist nurses in various practice settings, including: acute care, home care, community health, physicians' offices, long term care, and substance abuse centers. The curriculum will include clients from a broad range of nursing specialties, including: medical/surgical, emergency, maternal/child, critical care, geriatrics, mental health, and substance abuse. The design will enable the curriculum to be used by individual nurses regardless of experiences or education. The target population will range from student nurses, to generalist nurses in all practice settings, to nurses beginning practice in the substance abuse setting. Phase I: The staff conducted a literature search and educational needs assessment. From the results, instructional specifications and an outline for the curriculum were developed. An evaluation plan was established. Phase II: The staff and consultants will develop an Author's Guide, conduct an Author's workshop, finalize the curriculum and develop twenty CAI programs. CAI programs will undergo formative and summative evaluation including a cross validation team, beta testing, exit interviews and quasi-experiments. Phase III: CES will commercialize the curriculum by marketing it to nursing schools, hospitals, home healthcare agencies, AODA treatment centers, and individuals.

minipile

NaturalLanguage

mit

The politics of gender in family therapy. This article provides an overview of the political implications of various approaches to gender within the clinical literature. It emphasizes the process of therapy within the social context of gender relations and identifies the political consequences of various clinical responses. Issues surrounding the appropriate role and stance of therapists relative to gender are identified, ethical issues such as neutrality and client welfare are re-examined, and suggestions for practice are addressed.

minipile

NaturalLanguage

mit

Properties for sale in the Summerfield Of Bradley Subdivision, Bourbonnais, Illinois Home is ready to move in and enjoy. It has a wonderful split floor plan and is a beautifully maintained 3 bedroom, 2 bath ranch home in Summerfield. The full, dry basement is ready to be finshed in whatever style you choose. The kitchen has upgraded appliances that are ready for a new chef. The attached 2.5 car garage leads into the first floor laundry room for added convenience. This is a MUST SEE! Vaulted/Cathedral Ceilings,1st Floor Bedroom,1st Floor Laundry,1st Floor Full Bath No additional rooms Patio Oven/Range,Dishwasher,Refrigerator,Washer,Dryer Corner Rt 50-Larry Power Rd-E Summerfield-N to Crescent-Sign

minipile

NaturalLanguage

mit

Kilner 8 Piece Sloe Gin Gift Set Enjoy the delicious and warming taste of home made sloe gin with the Kilner 8 Piece Sloe Gin Gift Set. Specially designed for making your own sloe gin, plum brandy or other fruit liqueur, this set is perfect for recreating traditional recipes. Includes a large Kilner jar for infusing your gin, muslin cloth and funnel for decanting, and smaller Kilner bottles for storing and giving as gifts. Please Note: The Kilner bottles are not suitable for carbonated drinks.

minipile

NaturalLanguage

mit

4, what is 3210 - 13020? -3210 In base 2, what is 11111101011000 + 100011? 11111101111011 In base 11, what is -4 - -14a56? 14a52 In base 3, what is -2101102100102 + 10? -2101102100022 In base 7, what is -3231 + 353? -2545 In base 16, what is 2 + -1fa5? -1fa3 In base 15, what is -745ce + 0? -745ce In base 8, what is 432 + -4210? -3556 In base 5, what is -1 - -1133242? 1133241 In base 6, what is -424 + 4534? 4110 In base 7, what is -3 - -40645? 40642 In base 8, what is -14 + 547156? 547142 In base 14, what is -1c607 - -5? -1c602 In base 12, what is -131015 + 4? -131011 In base 6, what is 3155401 + 2? 3155403 In base 9, what is -2 - 117524? -117526 In base 14, what is 34b4 + -b? 34a7 In base 8, what is -25726 + -3? -25731 In base 8, what is -163 - -26251? 26066 In base 5, what is 311122 - 4? 311113 In base 5, what is -34304 - 41? -34400 In base 13, what is -1 + -88ca? -88cb In base 4, what is -11 + -21010303? -21010320 In base 12, what is a8 - -1688? 1774 In base 3, what is -12010 - 12000? -101010 In base 6, what is -1125534 - -5? -1125525 In base 8, what is -1615000 + 0? -1615000 In base 5, what is -1401114 + 24? -1401040 In base 13, what is -15 - 1a70? -1a85 In base 9, what is 1 - -100328? 100330 In base 10, what is 4 - -8695? 8699 In base 9, what is 60503 + 5? 60508 In base 14, what is 4 - -ca331? ca335 In base 8, what is -213 + -16150? -16363 In base 2, what is 1000111001011100000 + -10? 1000111001011011110 In base 2, what is -110101110100011 - 1? -110101110100100 In base 12, what is -1936958 + 1? -1936957 In base 11, what is 2 - -9493? 9495 In base 7, what is 6264132 + -3? 6264126 In base 7, what is -24 + -2066516? -2066543 In base 8, what is -574423 + 3? -574420 In base 3, what is 1020122 + -2011? 1011111 In base 11, what is 67459 + -2? 67457 In base 12, what is 1522 - -1? 1523 In base 2, what is 11001000101 + -11? 11001000010 In base 14, what is -4 + 306a? 3066 In base 12, what is 128009b - 2? 1280099 In base 2, what is -10 - 100010001010110111? -100010001010111001 In base 10, what is 9316 - -26? 9342 In base 14, what is 1a - 1a7d4? -1a7b8 In base 12, what is -60 + 333? 293 In base 3, what is -20 - 12202010? -12202100 In base 13, what is -693 + -1018? -16ab In base 5, what is -1221200 - -304? -1220341 In base 4, what is -10 - 23111033? -23111103 In base 2, what is 110 + -1000100110110? -1000100110000 In base 16, what is 210f7 - -3? 210fa In base 5, what is -422 + -214? -1141 In base 3, what is -201122 - 210021? -1111220 In base 2, what is -1001010000011 - 11101? -1001010100000 In base 5, what is -2110300 + 11? -2110234 In base 11, what is -797 - 54? -840 In base 3, what is 221200222 + -2? 221200220 In base 8, what is -216410 + -20? -216430 In base 2, what is 1011100001 - 110110000? 100110001 In base 12, what is 108 + 998? aa4 In base 5, what is 1042114 - -1031? 1043200 In base 6, what is -51 + 1340? 1245 In base 8, what is 14315 + -143? 14152 In base 5, what is 10000 - 143? 4302 In base 4, what is -1 + 1012310031? 1012310030 In base 13, what is -83a3 + 8? -8398 In base 2, what is 10 + -1010011011110? -1010011011100 In base 3, what is 122021220122 + -11? 122021220111 In base 4, what is -20020101 - -102? -20013333 In base 6, what is 1 - -50452? 50453 In base 6, what is 2 - -23253? 23255 In base 5, what is 3 - 130232? -130224 In base 3, what is -1021 + 2002210? 2001112 In base 10, what is 4 - -25079? 25083 In base 14, what is 6 - -17961? 17967 In base 16, what is 0 + -b87? -b87 In base 10, what is 49 + -279? -230 In base 3, what is 1010110 + -1200? 1001210 In base 12, what is -217b7 + -10? -21807 In base 8, what is 5 + 440451? 440456 In base 7, what is -11536 + -22? -11561 In base 16, what is 432 + -4e? 3e4 In base 14, what is -179d - -1a? -1783 In base 5, what is -1001 + -4414? -10420 In base 13, what is 5 - -158a? 1592 In base 4, what is 0 + -11031023? -11031023 In base 10, what is 1012 + 88? 1100 In base 13, what is 4 - 39438? -39434 In base 3, what is 1 - -1000211202? 1000211210 In base 14, what is d87 - 81? d06 In base 13, what is -11 - -121? 110 In base 2, what is 110001110001011 + 101001? 110001110110100 In base 14, what is 2bb7 + -2? 2bb5 In base 15, what is 2906 - -2? 2908 In base 15, what is 191 - -362? 503 In base 13, what is 131b - -24? 1342 In base 13, what is 8464b + 5? 84653 In base 14, what is 5 - 502b? -5026 In base 5, what is 1200 - 13422? -12222 In base 14, what is -4b3918 - -4? -4b3914 In base 8, what is 4 + -71172? -71166 In base 9, what is -2 + 30756? 30754 In base 15, what is -2b9c + -2? -2b9e In base 3, what is -100022 - -20100? -2222 In base 13, what is 1355 - -c? 1364 In base 14, what is -36 - 64d? -685 In base 5, what is 31110 + 2? 31112 In base 16, what is -1e8b - -b? -1e80 In base 14, what is 59d0 - -13? 5a03 In base 11, what is 4 - -19011? 19015 In base 10, what is -1780 + 38? -1742 In base 15, what is -4 - e00e? -e013 In base 10, what is 8019 + 1? 8020 In base 5, what is -30031 - 2020? -32101 In base 13, what is 21c - 16b? 81 In base 12, what is 2556 - -24a? 27a4 In base 5, what is -1142 - -10131? 3434 In base 10, what is -132390 - -3? -132387 In base 14, what is -45959 + -d? -45968 In base 16, what is -2 + abd? abb In base 9, what is 30062 - -2? 30064 In base 12, what is 5a5 + 54? 639 In base 9, what is -7018222 - 0? -7018222 In base 13, what is b90 - -42c? 12bc In base 11, what is -923 + -aa? -a22 In base 10, what is -6451 + 15? -6436 In base 5, what is -3 - 14202400? -14202403 In base 11, what is 94a9 + -96? 9413 In base 4, what is -131213 + 131? -131022 In base 7, what is -106 - -1131? 1022 In base 2, what is 1110100111101 + -110010? 1110100001011 In base 16, what is d6f3 + -7? d6ec In base 16, what is d - fb8? -fab In base 14, what is 34aa - 56? 3454 In base 13, what is -10 + -c42? -c52 In base 16, what is 58a - -1d? 5a7 In base 16, what is -be1 - -1? -be0 In base 13, what is 19 - 2131? -2115 In base 5, what is -10434403 - 11? -10434414 In base 16, what is 1 - 17484? -17483 In base 2, what is 1001000100010 + 10101? 1001000110111 In base 11, what is 16 + 658? 673 In base 13, what is -58 - -36c5? 366a In base 15, what is -16116 + 5? -16111 In base 7, what is -450 - -21? -426 In base 14, what is 0 - -401c? 401c In base 10, what is 41411 + -10? 41401 In base 16, what is 3568 + 0? 3568 In base 15, what is 855 + -1? 854 In base 14, what is -1 - -55092? 55091 In base 2, what is -1110001010110100110101 - -10? -1110001010110100110011 In base 13, what is 2 + 177005? 177007 In base 12, what is -51 - -936? 8a5 In base 10, what is -7942 - 3? -7945 In base 10, what is 0 + 569904? 569904 In base 5, what is 31244142 + 10? 31244202 In base 6, what is -15005 + -25? -15034 In base 9, what is 0 + 17002? 17002 In base 11, what is -13 - -53a? 527 In base 14, what is -1d - -47a6? 4787 In base 4, what is -102 - 230? -332 In base 5, what is -1240 - 2412? -4202 In base 4, what is -2220 + 2311? 31 In base 4, what is -2100220232 - 3? -2100220301 In base 16, what is -d4 - -38a? 2b6 In base 7, what is 22 - -32014? 32036 In base 11, what is 2a05 - -499? 33a3 In base 16, what is -5 - 6db0b? -6db10 In base 3, what is 12001 - 112002? -100001 In base 13, what is 0 + -750b? -750b In base 3, what is -2 + -12020211002? -12020211011 In base 4, what is 1300 - 223? 1011 In base 12, what is -5 - -a359? a354 In base 2, what is 11 + -11010001011110000? -11010001011101101 In base 11, what is -5 + 10076? 10071 In base 5, what is 300 + 141? 441 In base 16, what is -b + 1b71d? 1b712 In base 6, what is -3 - -11003243? 11003240 In base 12, what is -1375 - -1a? -1357 In base 9, what is 30 + 3235? 3265 In base 3, what is -112022 - 1000? -120022 In base 16, what is -769 + 40? -729 In base 9, what is -548 - 2452? -3111 In base 10, what is 66075 - -2? 66077 In base 8, what is -15 - 10262? -10277 In base 9, what is 2073 + 75? 2158 In base 6, what is 0 - -344135? 344135 In base 5, what is 2234 - -213? 3002 In base 8, what is 2720 + 51? 2771 In base 2, what is 10 - 100011011000? -100011010110 In base 9, what is 2 - -3012? 3014 In base 3, what is -10 + -1002202221020? -1002202221100 In base 9, what is -1 + -13447? -13448 In base 11, what is 3391 - 18? 3374 In base 13, what is 2 + cb10? cb12 In base 14, what is -1738 + 3? -1735 In base 5, what is -10 - 424? -4

minipile

NaturalLanguage

mit

Q: Flutter Table layout is not responding according to expected Using Flutter v1.20.2 The following code var data = [ ['a', 'VerylongstringwithnospacesVerylongstringwithnospaces'], ['abc', '123456789'], ['abcdefg', '123'], ]; Expanded( child: Table( border: TableBorder.all(color: Colors.red), columnWidths: { 0: IntrinsicColumnWidth(), 1: IntrinsicColumnWidth(), }, children: data.map<TableRow>((x) => ( TableRow( children: <TableCell>[ TableCell(child: Container(child: Text(x[0]))), TableCell(child: Container(color: Colors.green, child: Text(x[1]))), ], ) )).toList(), ), ), results in this layout As you can see the text overflows the boundary of the table. I have tried innumerable solutions but none have worked. It appears that the TableCell itself has a width bigger than it should have, comparing to the size of the column of the table. The biggest problem is that the size of both columns are unknown, they could be hundreds of characters long or single letter. In case of it being bigger than the width the text should break to the next line. Is there a way to make a fluid grid layout so that both sides resize according to the ammount of content for each Column? The ideal layout would be something like this A: The reason why It’s happening is that the IntrinsicColumnWidth doesn’t give TableCell parent size. Because it's trying to set the column width based on child width. At the same time, to make text wrapping on lines, you need to have the width of parent, otherwise text widget don’t know it’s limits. What options do you have : FixedColumnWidth FlexColumnWidth FractionColumnWidth MaxColumnWidth MinColumnWidth (Last two widgets used max/min of other TableColumnWidth widgets.) In your case if you know that the text in the first column never will need to be wraped in lines, you can remove IntrinsicColumnWidth as parameter of second column. If you know that long text is possible, add the maximum width by adding MinColumnWidth dartpad example

minipile

NaturalLanguage

mit

potatoes Everybody's Irish on St. Patrick's Day! Corned beef is similar to that of a roast turkey dinner... it comes around but once a year. Succulent, tender and tasty this recipe makes plenty for a night of leftovers. A sweet and savory dish to celebrate St. Patrick’s Day with your family. Another selection found worthy of sharing from Closet Cooking…Colcannon is is traditionally made from mashed potatoes and kale (or cabbage), with milk (or cream) and butter. In this version, bacon and green are added boosting both texture and flavor. Bangers are Irish or English pork sausages usually served over […] Get your bellies emptied out so you can fill them back up on Thanksgiving. Here are our staffs’ favorite recipes. Let’s Start with a Cocktail: Here are 10 of our Favorite Festive Cocktails. Or would you prefer a glass of wine… T H E B I R D Easy & Healthy Lemon Garlic Roast Turkey w/White Wine […] How about all of your favorite Oktoberfest food neatly packed into a tiny potato bowl? Filled to the max with Bratwurst, caramelized onions, cheese and sauerkraut (and a little bit of lager, of course!) Perfect party food found on the cozy... A sweet and savory dish to celebrate St. Patrick’s Day with your family. Another selection found worthy of sharing from Closet Cooking… Colcannon is is traditionally made from mashed potatoes and kale (or cabbage), with milk (or cream) and butter. In this version, bacon and green are added boosting both texture and flavor. Bangers are Irish or English pork sausages usually […]

minipile

NaturalLanguage

mit

After receiving emails from the Chinese consulate asking him to pass a resolution praising China for its fight against the coronavirus, which originated in China, Wisconsin Senate President Roger Roth (R-Appleton) wrote a resolution slamming China for lying about the coronavirus. “When [Roth] received the first one dated Feb. 26, he saw it was from a hotmail account and disregarded it as a prank,” the Wisconsin Examiner reported. “Then on March 10, 2020, he received a follow up, and Roth says he had his staff start digging, reaching out through government channels. They were able to confirm that the email requests were legitimate — and they were told Chinese diplomats routinely use private email accounts because they are faster.” The Chinese sent Roth a draft of the resolution that they wanted him to use which was full of communist propaganda and said, “there is no need to overreact.” The main section of the communist propaganda resolution stated: Whereas China’s action has been critical to the global fight against the epidemic, and China has adopted unprecedented and rigorous measures for disease control and prevention, including locking down Wuhan, a metropolis of 11 million people, house-to-house temperature checks, postponing the return to work after the Lunar New Year break of hundreds of millions of travelers, construction of hospitals of more than two thousand beds on green fields within days, bringing in medical teams from across the country to Hubei Province. These measures have been effective in curbing the virus from spreading to other parts of China and the world. As a result, the daily number of newly confirmed cases in China has dropped sharply to double digits, over 60,000 (to be updated) people have been cured and discharged from hospital, and the case fatality rate has remained lower than SARS, EBOLA and MERS; and Whereas China has been transparent and quick in sharing key information of the virus with the WHO and the international community, thus creating a window of opportunity for other countries to make timely response “Then I got mad, because that’s when [COVID-19] cases started cropping up here and you saw the problem exacerbated as we started to learn the truth,” Roth told the Wisconsin Examiner. “I just sent them back a one-word response. I said ‘nuts.’” “Then a couple of days later I said that we are going to introduce a resolution, it’s just not the one that the Chinese government wants,” Roth continued. “We’re going to introduce one that speaks the truth to the lies that I believe are being told around the world, so that’s how we ended up with the resolution as it was introduced.” Roth put together the following resolution, in response to the request from the Chinese consulate, condemning China for its actions during the pandemic and for other acts of tyranny [emphasis original]: Relating to: acknowledging that the Communist Party of China deliberately and intentionally misled the world on the Wuhan Coronavirus and standing in solidarity with the Chinese people to condemn the actions of the Communist Party of China. Whereas, the State of Wisconsin is currently in a state of emergency due to the rising spread of the Coronavirus that originated in the Wuhan Province of China, as the number of infected individuals in Wisconsin rose to over 700 and also consisted of 8 deaths as of March 26, 2020; and Whereas, the Chinese people are a great people, and heirs to one of the greatest civilizations in human history, held hostage by a brutal and oppressive regime these past 70 years; and Whereas, the Communist Party of China has engaged in a continued pattern of human and natural rights abuses perpetrated by the country’s communist administration, including the Communist Party’s treatment of Tibet, the internment and “reeducation” of 1.5 million Muslim Uyghurs in concentration camps, the enactment of a one-child policy responsible for aborting hundreds of millions of children, the majority of them female, a record of organ harvesting and forced sterilization, crackdown on the Tiananmen protests, and restrictions on individual expression and religious practice; and Whereas, the Communist Party of China has repeatedly demonstrated a lack of interest in respecting international norms, including a history of currency manipulation, intellectual property theft, and restricting Chinese market access, while receiving the condemnation of numerous American Presidents and Legislators from both political parties for these practices; and Whereas, the Communist Party of China, led by President Xi Jinping, has moved to consolidate power, scrapping term limits to create a de facto life term for the President of China and continually squashing democratic-based initiatives in and outside of mainland China; and Whereas, the Chinese government is currently engaging in a barrage of misinformation throughout all corners of the globe, attempting to pass off the responsibility of their negligent and reckless response to the virus; and Whereas, the Chinese government has imprisoned their own citizens who dared disseminate accurate information on the Coronavirus, destroyed early samples of the virus, refused to release timely and accurate information on the virus, and continued to allow infected individuals to leave the Wuhan Province after reasonable evidence of person-to-person contamination was present; and Whereas, reports have indicated that had the Chinese Government acted in a more efficient, transparent, and responsible way, cases worldwide of the virus may have been limited by 95 percent; and Whereas, on February 5, 2020, the first confirmed case of Coronavirus was identified in Wisconsin; and Whereas, on February 26, 2020, and again on March 10, 2020, the Chinese Consulate reached out to the Wisconsin Senate President requesting that the Senate pass a resolution — written by the Chinese Consulate — including propaganda and falsehoods such as: “China has been transparent and quick in sharing key information of the virus with the WHO and the international community, thus creating a window of opportunity for other countries to make timely response” Whereas, the Wisconsin State Senate deems it necessary and prudent to combat the spread of misinformation propagated by the Communist Party of China and the need to push back on the claims that the virus originated anywhere but China; now, therefore, be it Resolved by the senate, That the Wisconsin Senate acknowledges that the Communist Party of China has deliberately and intentionally misled the world, suppressed vital information on the statistics and spread of the Wuhan Coronavirus both domestically and abroad, allowed millions of individuals to travel outside of the province and country despite clear warnings that the virus could be transmitted person-to-person, and engaged in active suppression and persecution of individuals looking to truthfully discuss information related to the Coronavirus, which has led to a global pandemic the likes of which has not been seen for generations; and, be it further Resolved, That the Wisconsin Senate hereby stands in solidarity with the Chinese people, condemning the actions of the Communist Party of China in the strongest possible terms, and acknowledges that millions, both in China and around the world, are at risk of illness and death due to the negligence and hostile actions of the Chinese Communist Party.

minipile

NaturalLanguage

mit

If this is your first visit, be sure to check out the FAQ by clicking the link above. You may have to register before you can post: click the register link above to proceed. To start viewing messages, select the forum that you want to visit from the selection below. ** If you are logged in, most ads will not be displayed. ** After all parts of the project have been compiled to object files they are ultimately packed together by the linker in order to form an executable. It is a problem at this step that gets you this error message. The linker already knows there has to be the compiled part for lucene::analysis::standard::StandardAnalyzer::Sta ndardAnalyzer() anywhere but he does not know where and that he has to link it in. Actually, it is not the name of the library. It's the name of the file with the initial "lib" and the extension chopped off. If the name of the file had begun with something other than "lib", then you would not have been able to use the -l option with it.

minipile

NaturalLanguage

mit

I have written this book because the Holy Spirit has shown me a missing link between what God has promised in His covenant with us and what we have been receiving. This missing link has happened because there has been a devastating lack of understanding of the call that is upon Jesus' ambassadors. Jesus said: "And as you go, preach, saying, 'The kingdom of heaven is at hand.' "Heal the sick, cleanse the lepers, raise the dead, cast out demons. Freely you have received, freely give. Matt 10:7-8 (NKJ) Jesus also said in John 14:12, "Most assuredly, I say to you, he who believes in Me, the works that I do he will do also; and greater works than these he will do, because I go to My Father." (NKJ) Let me show you the missing link in God's provisions and how we are called by God to be that link. J.D. pastors a growing church in the Upper Peninsula of Michigan. Born and raised in this same rural community, God has graced him with the "gift of helps" to minister to the saved and unsaved alike. He is a passionate Teacher of the Word and believes strongly in the healing, delivering power of God. His heart is to see individuals realize their full potential in Christ Jesus. J.D. and his wife Debbie have four children and 5 grandchildren.

minipile

NaturalLanguage

mit

Posts If we are honest with ourselves, we take our access to water for granted and we expect this water to be safe for our daily use. Not so for too many in the marginalized parts of the world. One area of great need is in the mountainous area of Oaxaca Mexico. Pescadores de Hombres is a community development civil association that takes a wholistic approach to meeting the physical, spiritual and emotional needs of indiginous communities. As a Christian organization we believe that sharing the love of Christ changes lives. Drilling water wells for those with little resources also changes lives. We do both. A local Mixec pastor friend is drilling wells in the city of Tlaxiaco, Silacayoapan, Tierra Azul and in the surrounding area in the state of Oaxaca. In Tierra Azul, during my last visit, I helped drill a well at an orphanage just outside the city of Tlaxiaco. We encountered several unique challenges with drilling at this site as the nearby river with the unground veins of water running to it caused our borehole to collapse not just once but twice. After not being able to repair the damaged boreholes we then moved to high ground and finished a successful water well which is producing sufficient water for the orphanage/farm. These are some pictures of the process of drilling with our small rig in the beautiful setting of this farm land. My friend Dan and I will again return to Oaxaca this March to help support the on-going work and do some maintenance on the equipment. In our short stay in this city where we started this work 10 years ago we hope to visit with friends that my wife and I met when we live in Tlaxiaco for over 4 years. We are excited that the work continues on with the local people and it is our hope that they catch the vision to reach out to the surrounding villages to share the good news of Jesus Christ. Water well for future children’s school and home: Pescadores de Hombres is committed in helping Eliseo see his vision come true. With help from the people that partner with us we can drill a water well to provide one of the key resources they will need for the children at his proposed orphanage and christian school. Ten years ago my wife and I were led to the mountainous regions of Oaxaca Mexico. She is a registered nurse and I have extensive experience in the construction trade. We left family and home to answer the call of “Go and make disciples in every nation”. My wife oversaw medical outreaches with teams of doctors, nurses, and volunteers in villages that have few medical services available to them. These usually drew hundreds of people that walked many miles to get some help with their health problems. We lived in a traditional home in a “colonia” and made many friends with our neighbors who were always coureous of what the gringos were doing. We lived across the street from a school so it was hard to keep a low profile. Besides helping with the medical clinics and helping neighbors pick corn, I wanted to do more for community development. Frustrated with attempting to dig well with hand augers and bailers, I built a small trailer well drilling rig. There were a few years of learning the process of drilling deep wells initially but we have dug wells for a local orphanage, a pastor’s home, a cluster of neighborhoods with no running water, and have done other projects. It has been our intent to help provide water to those who need it, but also to allow people to develop better living skills and be more self sustaining. Water is a major key in developing countries to grow their own food, to improve their sanitation and improve their way of life. We also know that water isn’t the only thing that is needed to live a better life and sharing the Good News of Jesus Christ is all part of the vision to reach people with the love of God. We are encouraged by the network of partners that are helping to bring transformation in the on going work in this region of Mexico.

minipile

NaturalLanguage

mit

Chapter One: The Hero Becomes the Villain The story of El Hijo del Santo vs. Negro Casas begins all the way back in 1984, when both men were working for the Universal Wrestling Association (UWA). Think of the UWA as like AAA, without the success (though the company did last a solid twenty years as the number two promotion in Mexico). By this point, Casas, then UWA’s World Lightweight Champion, was a five year veteran who had already had a stint with CMLL (then still EMLL), while Santo had barely been wrestling year. Never the less, the son of the legendary El Santo proved to be quite capable in the ring, and he soon dethroned Casas for the title on October 28th. His victory of Casas would start a long (and according to Wikipedia, intense) three year feud between the two, with Casas as the ruthless rudo and Santo taking up the heroic technico role his father had long held. By the time Santo defeated Casas in a hair vs. mask match in July of 1987, both men had been established as the future of lucha libre and major box office attractions. The two would continue on and off for several years, before briefly going their separate ways. Casas would eventually wind up in CMLL full time, while Santo bounced between UWA and CMLL before finding a home in, where he would eventually find himself in one of the most famous tag team matches in wrestling history. Let’s just say octagons and love machines were involved. Eventually, Santo and Casas found themselves both in CMLL by 1995, where they resumed their feud. In a smart move, CMLL decided Santo-Casas was the perfect match to co-headline one of the two shows CMLL was running for their 63rd Anniversary (yes, the 63rd Anniversary Show was split into two. Very AAA of them). That's not all CMLL had in mind though. Only two years earlier, the Mexican economy had collapsed after the government suddenly devalued the peso, Mexico’s form of currency. The downturn took a huge toll on the country in general, and especially on CMLL, which was already having issues on the business side due to the rise of AAA in 1992. How bad things were is something only the company can know, but in any event, they needed a spark in the worse way. What would that spark be? A revitalized Hijo del Santo-Negro Casas feud, only this time with a twist; Casas would be the technico, and Santo would be the rudo. Now you're probably thinking this isn't a big deal. Despite being a rudo throughout his career, Casas had long been one of the most popular luchadors across the country. Officially making him a villain would be no sweat. But Santo as the villain? This was a massive risk, especially since no one in El Santo lore had been a rudo since the 1950s. In a way, it was very much like what WCW did with Hulk Hogan only months earlier in taking one of the most famous legacies in wrestling history and flipping it to the dark side. And just like with WCW, it worked. It greatly helped that the execution of the angle was pretty flawless. Casas would defeat Santo at the 63rd Anniversary Show (albeit by DQ0, his first big win over his long time rival and the start of his technico turn. Santo would then quietly disappear for a few months while Casas feuded with his former teammates, Scorpio Jr. and Bestia Salvaje. The storyline had Scorpio and Salvaje jealous of Casas' popularity, leading to them claiming they had a surprise for Casas. This surprise revealed itself at the beginning of a trios match between Casas, El Dandy and Hector Garza against Scorpio, Salvaje and Felino. This did appear to be big on the surface as Felino is Casas’ real life brother. As it turns out, it was a very clever ruse. Right before the match began, Scorpio and Salvaje would take out Casas’ teammates and then gang attack him, all while Felino watched from the ring apron. As the technicos started to rally and Felino did nothing, it appeared Casas' brother was refusing to attack his own flesh and blood. NOT SO FAST MY FRIEND! As soon as the technicos took full control Felino got into the ring, took off his mask and reveal that it wasn't actually Felino; it was Santo.

minipile

NaturalLanguage

mit

Toward a psychology of harm reduction. This article discusses 3 different strategies for dealing with the harmful consequences of drug use and other risky behaviors: We can discourage people from engaging in the behavior (prevalence reduction), we can encourage people to reduce the frequency or extent of the behavior (quantity reduction), or we can try to reduce the harmful consequences of the behavior when it occurs (harm reduction). These strategies are not mutually exclusive; this article offers a framework for integrating them. The framework is useful for examining frequent claims that harm reduction "sends the wrong message." Opposition to harm reduction is based in part on a recognition of potential trade-offs among the strategies, but it is also fueled by several more symbolic psychological factors. Strategies for successfully integrating prevalence reduction, quantity reduction, and harm reduction are explored.

minipile

NaturalLanguage

mit

UN 'plans to fight rebels in DRC' By Barbara Plett BBC UN correspondent Published duration 25 January 2013 image caption M23 rebels say they want to improve living conditions for the people of eastern DRC The UN wants to set up an intervention force to fight rebels fuelling conflict in DR Congo, says a UN official. Meanwhile, eight African presidents are set to sign a UN-brokered accord aimed at bringing stability to the region. As many as 800,000 people have been displaced since the M23 rebel group took up arms against the Kinshasa government last May. It accuses President Joseph Kabila of failing to honour an earlier peace deal to integrate rebels into the army. The M23 rebels say they want to improve living conditions for the people of eastern DR Congo, but the UN says they are supported by Rwanda, which has been heavily involved in its eastern neighbour since those responsible for the country's genocide fled there en masse in 1994. Stability plan The UN official said the plan for a 2,500-strong intervention force was at an advanced stage, although it has yet to be approved by the Security Council. The troops would be added to Monusco, the UN's existing DRC peacekeeping mission, mandated to protect civilians. image caption Joseph Kabila has little control over eastern Congo The new brigades would be tasked with preventing rebels from seizing territory, and weakening them through targeted operations. Alongside this rapid reaction force, said a UN official, a broad political plan to bring stability to the region is set to be signed on the side-lines of the AU summit in Addis Ababa by the leaders of the DRC, Rwanda, Uganda, Burundi, Angola, the Republic of Congo (Congo-Brazzaville), Tanzania and South Africa. All of these measures were triggered late last year when M23 rebels seized the eastern city of Goma. UN peacekeepers chose not to confront the well-armed insurgents, and suffered a blow to their image. UN Secretary General Ban Ki-moon has been pushing for a comprehensive approach to dealing with the seemingly continuous conflict in the eastern DRC, fuelled by interference from neighbouring states and facilitated by the weakness of the Congolese government and army. UN experts have cited evidence that Rwanda and Uganda are backing M23, although both countries strongly deny the charges. "Following the Goma crisis there was a realization here that after more than 10 years of UN engagement in the DRC there was a need to look at things differently to break the cycle of violence in the east," said the UN official. "So we tried to go for the heart of the problem and see why these cycles are on-going." The framework agreement involves a commitment from Kinshasa to strengthen the Congolese army and pledges of non-interference from its neighbours. It also seeks to address the legitimate concerns of all countries concerned, says the UN official, "meaning there are legitimate concerns for all countries involved, including Rwanda and Uganda". The UN intervention force would not be a substitute for the Congolese army, said the peacekeeping official. Rather it would "create a specific space and time for the political process, and for the army to build at least some capacity." The idea would be to recruit African soldiers. Only Tanzania has offered troops so far. The combat brigades would be aided by surveillance drones recently authorised by the Security Council, which are also meant to monitor the borders.

minipile

NaturalLanguage

mit

Racing Metro fly-half Jonathan Sexton is weighing up where to spend next season and says he is close to deciding whether to extend his stay in Paris or return to Ireland. Sexton moved to the Top 14 ahead of the 2013-14 season on a two-year deal with the option of a third. With the 2015 World Cup looming ever closer on the horizon, Sexton could decide to end his Racing Metro career after this season and return to Ireland or spend one more year in the Top 14. He says he is close to deciding just where his future lies and hinted there could be an announcement in the next couple of weeks. "I'm just sort of taking my time," Sexton told the Irish Times. "Obviously I just have a baby boy that's taking up a lot of time, that's taking up all of my time to be honest, I can barely fit in training at the moment. That brings challenges with living abroad, you do what Laura and I are doing living by ourselves. "We'll see what happens in the next couple of weeks. I think it will obviously be sorted out sooner rather later. I think everyone knows where I stood after, with the interviews that I gave when I left so I will see what happens." Sexton kicked a last gasp penalty to secure a victory for Metro in their opening game of the Top 14 season and he is hoping to push on after a difficult first campaign in France. "Last year was always going to be difficult in hindsight. Obviously we didn't say that at the time but we had 14 new players, all staff was new, half those new players didn't speak any French so it was always going to take time," Sexton said. "You're walking on egg shells with guys you don't know, guys you're trying to build a relationship with. It was a bit of a disaster to be honest, the start of last season I played 14 games in a row straight after a Lions tour so it wasn't ideal for me either. "Look, it's obviously started a little bit better now but we'll see. We've got to go forward, we got some big wins away from home and we haven't backed them up so that's obviously the next step for this team." In related news, Racing Metro will be without Wales lock Luke Charteris for two months after he broke his foot in their win over Montpellier.

minipile

NaturalLanguage

mit

Tuesday, February 23, 2010 During the customization of Desktop many users dont like the Panel which is at the top, so they use to remove it [ Click here to see how to remove]. If you want to restore your panel back, follow this. Open Terminal [Application->Accessories->Terminal], Run the following commands: 1.Type this to disappear all panels gconftool --recursive-unset /apps/panel 2.Run the following to delete current one: rm -rf ~/.gconf/apps/panel 3.Finally Reload the panel: pkill gnome-panel Liked this Post???Rate & Comment on this Post, So we can serve you better.

minipile

NaturalLanguage

mit

The amidohydrolase superfamily (AHS) is a large group of enzymes that catalyze a remarkably diverse set of hydrolytic reactions. In general, these enzymatic reactions are directed at the hydrolysis of amide and ester functional groups at carbon and phosphorus centers.^[@ref1]^ Structural and mechanistic studies of the proteins within the AHS have shown that these enzymes utilize from zero to three divalent metal ions in the active site.^[@ref2]−[@ref4]^ The catalytic mechanism of hydrolysis utilizes an activated water/hydroxide for nucleophilic attack at an electrophilic carbon or phosphorus center. The enzymes in the AHS that possess a trinuclear metal center in the active site belong to the polymerase and histidinol phosphatase (PHP) family of proteins and are involved in the hydrolysis of phosphoesters.^[@ref4],[@ref5]^ The available crystal structures from the PHP family indicate that these enzymes possess a distorted (β/α)~7~-barrel structural fold, as opposed to the distorted (β/α)~8~-barrel fold observed in most of the other members of the AHS.^[@ref6],[@ref7]^ The PHP family within the amidohydrolase superfamily is further subdivided into three Clusters of Orthologous Groups: cog1387, cog0613, and cog4464. cog4464 consists of protein tyrosine phosphatases, which have been implicated in the regulation of capsular polysaccharide assembly in Gram-positive bacteria. Biochemical studies have provided insights into the structure and catalytically important residues of these tyrosine phosphatases.^[@ref8],[@ref9]^ cog1387 consists of [l]{.smallcaps}-histid*i*nol phosphate phosphatase (HPP), an enzyme from the [l]{.smallcaps}-histidine biosynthetic pathway, and other related enzymes, including the PHP domain of DNA polymerase X involved in DNA repair. Structural and mechanistic investigations of HPP enzymes have revealed the orientation of the substrate with respect to the metal center in the active site.^[@ref4]^ Further work has also elucidated the role of the trinuclear active site in the activation of the nucleophilic hydroxide, and Lewis acid stabilization of the alcohol product.^[@ref4],[@ref6]^ The mechanistic details obtained from an improved understanding of the enzymes from cog1387 should be directly applicable, in principle, to the enzymes belonging to cog0613. cog0613 consists of PHP family members that have been generically annotated as metal-dependent phosphoesterases in various online databases (NCBI and Uniprot). A sequence similarity network (SSN) map at an *E* value cutoff of 10^--60^ of 650 nonredundant protein sequences from cog0613 is presented in Figure [1](#fig1){ref-type="fig"}.^[@ref10],[@ref11]^ There are currently three proteins from cog0613 whose crystal structures have been determined. These include Protein Data Bank (PDB) entry 3O0F (locus tag Bad1165 from *Bifidobacterium adolescentis*), PDB entry 2ANU (locus tag Tm0559 from *Thermotoga maritima*), and PDB entry 3E38 (locus tag Bvu3505 from *Bacteroides vulgatus*). The physiological substrates for these enzymes are unknown, but it has been shown that Bad1165 can hydrolyze *p*-nitrophenyl phosphate, albeit very slowly, indicating that it is a phosphoesterase. The crystal structure of this enzyme has been determined with 5′-adenosine monophosphate (5′-AMP) bound in the active site, and it has been demonstrated that this enzyme does not possess DNA polymerase or DNA proofreading activity.^[@ref12]^ The only reported enzymatic function for any enzyme from cog0613 is that of cyclic phosphate dihydrolase (cPDH) for Elen0235 from *Eggerthella lenta*, which hydrolyzes the cyclic phosphate of 5-phospho-[d]{.smallcaps}-ribose 1,2-cyclic phosphate (PRcP) to [d]{.smallcaps}-ribose 5-phosphate and orthophosphate in a nonprocessive manner through [d]{.smallcaps}-ribose 2,5-bisphosphate as an obligatory reaction intermediate.^[@ref13]^ {#fig1} Our search for new enzymatic functions in cog0613 focused on the characterization of proteins of unknown function contained within the two large groups of proteins (colored yellow and blue) in the SSN depicted in Figure [1](#fig1){ref-type="fig"}. Toward that end, we have purified and determined the three-dimensional crystal structure of Cv1693 from *Chromobacterium violaceum* and have shown that this enzyme catalyzes the hydrolysis of 3′,5′-adenosine bisphosphate (pAp) to 5′-AMP and orthophosphate. Materials and Methods {#sec2} ===================== Materials {#sec2.1} --------- HEPES, 3′,5′-adenosine bisphosphate (pAp), 2′,5′-adenosine bisphosphate (2′,5′-pAp), 3′-adenosine monophosphate (3′-AMP), 5′-adenosine monophosphate (AMP), phosphoenolpyruvate (PEP), NADH, and the enzymes myokinase, pyruvate kinase, and lactate dehydrogenase were purchased from Sigma-Aldrich. The 3′- and 5′-phosphorylated derivatives of short DNA oligonucleotides (dAdAdAdAdAp and pdAdAdAdAdA) were synthesized by Integrated DNA Technologies. The dinucleotides, 5′-phosphoadenylyl-(3′→5′)-adenosine (pApA), and 5′-phosphoguanylyl-(3′→5′)-guanosine (pGpG) were purchased from Biolog Life Science Institute (Axxora, U.S. distributor). Guanosine 3′,5′-bis-diphosphate (ppGpp) was purchased from TriLink Biotechnologies. Synthesis of 3′,5′-Nucleotide Bisphosphates {#sec2.2} ------------------------------------------- The synthesis of 2′-deoxy-3′,5′-pAp, 2′-deoxy-3′,5′-pCp, 2′-deoxy-3′,5′-pGp, 2′-deoxy-3′,5′-pIp, 2′-deoxy-3′,5′-pUp, 3′,5′-pTp, pCp (2′,5′/3′,5′-bisphosphate mixture), pGp (2′,5′/3′,5′-bisphosphate mixture), and pUp (2′,5′/3′,5′-bisphosphate mixture) were synthesized according to the method of Barrio et al.^[@ref14]^ Cloning and Expression {#sec2.3} ---------------------- A codon-optimized synthetic gene for Cv1693 (gi\|34497148) from *C. violaceum* was inserted into a pET30 variant by ligation-independent cloning (LIC), utilizing the synthetic gene as a template and 5′-TTAAGAAGGAGATATACCATGGC[AAACATTGACCTGCATTTTCATTC]{.ul}-3′ and 5′-[GATTGGAAGTAGAGGTTCTCTGC]{.ul}ATCAGCCGGACGCAGGATACG-3′ as primers.^[@ref15]^ The resultant protein is identical to the native protein with the inclusion of a C-terminal tag (added sequence AENLYFQSHHHHHHWSHPQFEK), consisting of a tobacco etch virus (TEV) cleavage site, a hexahistidine tag, and a STREP tag. The plasmid was transformed into ROSETTA2(plysS) and plated on LB agar plates (100 μg/mL kanamycin, 35 μg/mL chloroamphenicol, and 0.5% glucose). Ten colonies were transferred to 100 mL of LB (100 μg/mL kanamycin, 35 μg/mL chloroamphenicol, and 0.5% glucose) and grown overnight at 37 °C. The overnight culture was added to 4 L of autoinduction medium (25 mM Na~2~HPO~4~, 25 mM KH~2~PO~4~, 50 mM NH~4~Cl, 5 mM Na~2~SO~4~, 25 mM sodium succinate, 2 mM MgSO~4~, 0.5% yeast extract, 1% NZ-AMINE-AS, 0.9% glycerol, 0.45% lactose, and 0.03% glucose) distributed into eight 2 L baffled flasks.^[@ref16]^ The flasks were shaken (250 rpm) at 30 °C for 4 h (OD \< 3), and the temperature was reduced to 23 °C for an additional 16 h. The cells were harvested by centrifugation and stored at −80 °C. To increase the metal content of the isolated protein, additional expressions that were supplemented with 150 μM 2,2′-bipyridine, 1.0 mM ZnCl~2~, and 1.0 mM MnCl~2~ were performed prior to the temperature being reduced to 23 °C. Purification {#sec2.4} ------------ Thirty grams of cells were resuspended in 150 mL of buffer A \[50 mM HEPES (pH 7.8), 150 mM NaCl, 20 mM imidazole, and 10% glycerol\] and disrupted by sonication. The lysate was clarified by centrifugation and applied to a 10 mL Ni-Sepharose HP column equilibrated against buffer A. The column was washed with 10 column volumes of buffer A, and bound proteins were eluted with 3 column volumes of buffer B \[50 mM HEPES (pH 7.8), 150 mM NaCl, 20 mM imidazole, and 10% glycerol\]. Eluted proteins (∼10--30 mg/mL) were pooled, aliquoted (10 mL), frozen by immersion in liquid nitrogen, and stored at −80 °C. Individual aliquots were rapidly thawed, incubated at 4 °C overnight with purified TEV protease (1/100 weight ratio), and applied in two separate runs to a Superdex 200 16/60 (GE Healthcare) column equilibrated against buffer C \[10 mM HEPES (pH 7.8), 150 mM NaCl, and 10% glycerol\]. Fractions from the primary peak were pooled and concentrated to 10--15 mg/mL by centrifugal ultrafiltration, aliquoted (500 μL), frozen by being immersed in liquid nitrogen, and stored at −80 °C. The purified protein contained 0.6 equiv of Mn and 2.4 equiv of Zn as determined by inductively coupled mass spectrometry (ICP-MS). Assay for AMP {#sec2.5} ------------- Cv1693 hydrolyzes pApA to release two molecules of 5′-adenosine monophosphate (AMP). The rate of hydrolysis of pApA was measured by coupling the formation of AMP to the oxidation of NADH. Each 250 μL assay contained 250 mM KCl, 0.7 mM PEP, 0.5 mM ATP, 5.0 mM MgCl~2~, 0.2 mM NADH, myokinase (2 units), pyruvate kinase (2 units), and [l]{.smallcaps}-lactate dehydrogenase (3 units) in 50 mM HEPES (pH 7.5). The oxidation of NADH was followed at 340 nm with a Spectromax 384 Plus 96-well plate reader from Molecular Devices. The AMP coupling system assay was also used to measure the initial rate of release of 5′-dAMP from the oligomer of DNA (pdApdApdApdApdA) or 2′,5′-pAp. Assay for Phosphate {#sec2.6} ------------------- The formation of phosphate was assessed using the P~i~ ColorLock Gold assay kit from Innova Biosciences according to the manufacturer's instructions. The enzymatic assays were conducted in 25 mM HEPES containing 250 mM KCl (pH 7.5) at 30 °C. The extinction coefficient of the phosphate--dye complex was 68000 M^--1^ cm^--1^ (λ = 650 nm) under the conditions used to assess the enzymatic activity. The phosphate detection assay was also used to determine if free phosphate was produced when 1.0 μM Cv1693 was incubated with 0.1 mM dAdAdAdAdAp, 3′-AMP, 3′-NADPH, CoA, 1,3-bisphosphoglycerol, 3′-phosphoadenosine 5′-phosphosulfate (PAPS), pGpG, and ppGpp for 75 min at 30 °C. Crystallization {#sec2.7} --------------- Cv1693 was crystallized by sitting drop vapor diffusion at 20 °C utilizing Intelliplates and 2 + 2 μL drops equilibrated against 70 μL reservoir solutions. All crystallization work used a protein that was derived from expressions that did not contain 2,2′-bipyridine, ZnCl~2~, or MnCl~2~. Crystals for the unliganded and Mn/AMP structures were grown from protein that included 2.0 mM EDTA during the overnight TEV cleavage reaction. Crystals utilized for phasing were grown by combining protein \[10--15 mg/mL, 150 mM NaCl, 10% glycerol, 20 mM inositol 5′-monophosphate, and 10 mM HEPES (pH 7.8)\] with 20% Peg2000 MME and 100 mM Bis-Tris (pH 6.0). For the unliganded (sulfate bound) structure, the crystallization conditions were Cv1693 \[10--15 mg/mL, 150 mM NaCl, 10% glycerol, and 10 mM HEPES (pH 7.8)\] and 25% PEG3350, 200 mM (NH~4~)~2~SO~4~, and 100 mM Bis-Tris (pH 6.5). For the Mn^2+^--AMP complex, Cv1693 \[10--15 mg/mL, 150 mM NaCl, 10% glycerol, 20 mM adenosine 5′-monophosphate, 5.0 mM MnCl~2~, and 10 mM HEPES (pH 7.8)\] was combined with 20% Peg2000 MME and 100 mM Bis-Tris (pH 6.0). Prior to data collection, crystals were soaked in precipitant supplemented with 20% ethylene glycol and vitrified by being immersed in liquid nitrogen. All data were collected in-house on an R-AXIS IV^++^ detector with Cu Kα X-rays generated by a Rigaku RU-H3R rotating anode generator and focused with OSMIC mirrors. Data were integrated and scaled with HKL3000.^[@ref17]^ Data statistics are listed in Table [1](#tbl1){ref-type="other"}. ###### Data Collection Statistics for Cv1693[a](#t1fn1){ref-type="table-fn"}   10 mM HgCl~2~[b](#t1fn2){ref-type="table-fn"} 10 mM TMLA unliganded Mn^2+^, AMP ------------------------------- ----------------------------------------------- ---------------------- ----------------------- -------------------- space group *P*2~1~2~1~2~1~ *P*2~1~2~1~2~1~ *P*2~1~2~1~2~1~ *P*2~1~2~1~2~1~ unit cell (Å) *a* = 40.0 *a* = 40.0 *a* = 40.1 *a* = 39.9   *b* = 46.8 *b* = 46.8 *b* = 46.5 *b* = 46.7   *c* = 130.4 *c* = 130.8 *c* = 130.5 *c* = 131.0 resolution (Å) 40--2.4 (2.44--2.40) 40--1.9 (1.93--1.90) 40--2.20 (2.32--2.20) 40--1.9 (2.0--1.9) completeness (%) 98.1 (92.4) 98.7 (85.1) 99.7 (100.0) 96.9 (82.6) redundancy 6.7 (6.4) 6.2 (2.9) 3.8 (3.7) 5.3 (3.8) mean *I* (standard deviation) 20.8 (6.5) 21.6 (3.2) 10.3 (4.8) 12.9 (4.1) *R*~sym~ 0.096 (0.276) 0.089 (0.243) 0.098 (0.264) 0.083 (0.301) Data in parentheses are for the highest-resolution bin. No binding, used as the native data set. Structure Determination {#sec2.8} ----------------------- To obtain experimental phases, data were collected from crystals soaked for 3 min in a cryo solution supplemented with either 50 mM trimethyllead acetate (TMLA) or 10 mM HgCl~2~. The structure was determined using single isomorphous replacement with anomalous scattering (SIRAS) utilizing the TMLA data set as the anomalously scattering derivative and the HgCl~2~ data set as "native". Determination of the heavy atom constellation, phasing, and automatic chain tracing were performed with PHENIX.^[@ref18]^ The starting model was completed by iterative rounds of model building utilizing COOT^[@ref19]^ followed by refinement using PHENIX. There was a single molecule per asymmetric unit with a solvent content of 37%. Waters were added to difference density map peaks (*F*~o~ -- *F*~c~ \> 3.5σ) located \<3.2 Å from potential hydrogen bonding partners. Translation--libration--screw (TLS) refinement was included in the final rounds with the number of domains determined by PHENIX. The quality of the final model was validated with MOLPROBITY.^[@ref20]^ Data collection and refinement statistics for Cv1693 are listed in Tables [1](#tbl1){ref-type="other"} and [2](#tbl2){ref-type="other"}. ###### Structural Statistics for Cv1693[a](#t2fn1){ref-type="table-fn"}   unliganded Mn^2+^, AMP ------------------------------------------------- ----------------------- ----------------------- resolution (Å) 40--2.2 (2.42--2.2) 40--1.9 (2.0--1.9) no. of unique reflections 12140 (2942) 18950 (2050) *R*~cryst~ (%) 17.0 (17.7) 15.8 (19.6) *R*~free~ (%, 5% of data) 23.3 (25.5) 20.7 (24.8) contents of model     residues 1--285[b](#t2fn2){ref-type="table-fn"} 2--254, 258--288 2--254, 258--288 waters 194 271 Mn^2+^ 0 3 total no. of atoms 2340 2438 average Wilson *B* Factor (Å^2^) 18.6 12.5 no. of TLS groups 3 4 no. of proteins/waters/Mn^2+^/AMP 9.4/14.2/--/-- 11.5/21.1/9.0/13.1 root-mean-square deviation     bond lengths (Å) 0.006 0.007 bond angles (deg) 1.05 1.13 MOLPROBITY statistics     Ramachandran     favored/outliers (%) 98.9/0.0 98.9/0.0 rotamer outliers (%) 1.9 1.4 Clashscore[c](#t2fn3){ref-type="table-fn"} 7.1 (97th percentile) 6.4 (93rd percentile) overall score[c](#t2fn3){ref-type="table-fn"} 1.6 (97th percentile) 1.5 (96th percentile) PDB entry 2yb4 2yb1 Statistics in parentheses are for the highest-resolution bin. Additional residues past position 285 are from the C-terminal tag. Scores are ranked according to structures of similar resolution as formulated in MOLPROBITY. Analytical Size Exclusion Chromatography {#sec2.9} ---------------------------------------- Proteins were analyzed by analytical size exclusion chromatography with a 10 mm × 300 mm SUPERDEX 200 column (GE-Healthcare) using thyroglobulin (670 kDa), δ-globulin (158 kDa), ovalbumin (44 kDa), myglobin (17 kDa), and vitamin B12 (1.35 kDa) as molecular mass standards (Bio-Rad 151-1901). Bioinformatics {#sec2.10} -------------- The protein sequences from various cog's were retrieved from the NCBI (<http://www.ncbi.nlm.nih.gov>) and Microbesonline (<http://www.microbesonline.org>) databases.^[@ref21]^ The redundant sequences from cog0613 obtained from the NCBI database were removed using Jalview version 2.7^[@ref22]^ and then converted into FASTA format. Cytoscape version 2.8.2 was used to create protein sequence network diagrams,^[@ref23]^ while Jalview version 2.7 was used to make the amino acid sequence alignments. Results {#sec3} ======= Structure Determination of Cv1693 {#sec3.1} --------------------------------- Crystals of Cv1693 from the original crystallization attempts were thin spindly needles that did not improve in shape upon standard grid screening protocols. A search of the PDB revealed that the structure of a distantly related protein from cog0613 (Bad1165 from *B. adolescentis*, PDB entry 3O0F, sequence identity of 25%) had previously been determined with bound adenosine monophosphate (AMP). In addition, several mono- and diphosphorylated nucleosides were found to increase the thermostability of Cv1693 by fluorescence-monitored thermal denaturation (data not shown). As such, the original Cv1693 crystallization conditions were rescreened with added inosine monophosphate (IMP), cytidine monophosphate (CMP), or AMP. In these experiments, IMP gave the best improvement in the crystals, such that several derivative data sets could be collected. The structure of Cv1693 was determined by single isomorphous replacement with anomalous dispersion from a trimethyllead acetate derivatized crystal. Analysis of the electron density maps originating from Cv1693 crystals grown in the presence of IMP with no added metal indicated low occupancy for the three metal sites and unsatisfactory density for the nucleoside. The occupancies of the metal sites are consistent with the ICP-metal analysis for the protein used in the crystallization, which exhibited a mixture of Ni^2+^ (0.6 equiv), Zn^2+^ (0.2 equiv), and Fe^2+^ (0.1 equiv). In an attempt to improve the homogeneity of the crystals, we performed a new round of crystal screening after Cv1693 had been treated with EDTA to remove the metals. The structure of apoenzyme (no metals) Cv1693 was determined from crystallization conditions that included Peg3350 and ammonium sulfate. In this structure, there is no electron density for the metal ions, and sulfate is bound in the nucleoside 5′-phosphate binding site. The structure of the complex with Mn^2+^ and AMP was determined from crystals grown in the presence of Mn^2+^ and AMP without ammonium sulfate. The structures of Cv1693 and the Cv1693 metal--nucleoside complex are nearly identical with no large-scale structural movements \[root-mean-square deviation (rmsd) of 0.22 Å, 284 common Cα atoms\], and only small side chain positional differences in the ligands to the metals; all subsequent discussion will pertain to the AMP-bound structure. Structure of Cv1693 {#sec3.2} ------------------- Cv1693 crystallized with a single molecule per asymmetric unit. An analysis of the intermolecular contacts within the crystal suggests that Cv1693 is monomeric in solution, consistent with analytical gel filtration results. The entire sequence of Cv1693 could be fit to the electron density except for a portion of one loop (residues 255--257). Refinement statistics are listed in Table [2](#tbl2){ref-type="other"}. Cv1693 exhibits the (β/α)-barrel fold common to members of the amidohydrolase superfamily but with significant deviations (Figure [2](#fig2){ref-type="fig"}). In Cv1693, the third β-strand of the barrel, β~3~, is significantly longer than the strand usually seen for other members of the AHS. Furthermore, the bridging ligand between two of the metals (M~α~ and M~β~) is usually located at the end of β-strand 3 or 4, but in Cv1693, the bridging ligand (Glu-64) is positioned at the center of elongated β-strand 3. Therefore, in keeping with the β-strand numbering scheme for other members of the AHS used to designate key active site residues with respect to their β-strand number, we have chosen to designate β~3~ as β~3/4~. While most AHS (β/α)-barrels are composed completely of parallel β-strands, the fifth β-strand of Cv1693, β~5~, is antiparallel to β~3/4~ and β~6~. In addition, Cv1693 lacks two (β/α)-barrel α-helices (α~3~ and α~4~) and includes an insertion (amino acids 83--171, α~5b~--α~5e~) between β~5~ and α~5f~. One of the helices, α~5a~, assumes the typical position of α~3~, and the other, α~5a~--α~5e~, forms a four-helix bundle that caps the top of the (β/α)-barrel and contains several residues that contact adenosine 5′-monophosphate. These residues include Arg-99, Arg-102, Arg-134, Thr-135, and Phe-154. A stereo image of Cv1693 is presented in Figure [3](#fig3){ref-type="fig"}. {#fig2} {#fig3} Metal Center {#sec3.3} ------------ Clear electron density was observed for three manganese ions (Mn~α~, Mn~β~, and Mn~γ~) and AMP. In addition, a tetragonally shaped density feature bridging the three metal ions was interpreted as a phosphate ion assumed to originate from degradation of AMP (Figure [4](#fig4){ref-type="fig"}). A comparison of thermal factors with coordinating protein ligands suggests the Mn^2+^--AMP--HPO~4~^2--^ species approach full occupancy in the ternary complex. Mn~α~ and Mn~β~ are bridged by contacts to Glu-64 from β~3~ and an oxygen from inorganic phosphate. Mn~α~ is coordinated to His-7 and His-9 at the end of β-strand 1 and Asp-248 at the end of β-strand 8. Mn~β~ is ligated to His-75 (β~4~) and His-191 (end of β~6~). The third metal coordinates to Asp-14 (β~1~--α~1~ loop), His-39 (β~2~--α~2~ loop), and His-250 (β~8~--α~8~ loop). The orthophosphate forms a bridge not only from Mn~α~ to Mn~β~ but also from Mn~α~ to Mn~γ~ and is additionally coordinated by the guanidinium group of Arg-194 projecting from the β~6~--α~6~ loop (Figure [5](#fig5){ref-type="fig"}). {#fig4} {#fig5} Contacts between Cv1693 and AMP {#sec3.4} ------------------------------- All of the contacts between Cv1693 and AMP originate from the insertion domain between β~5~ and α~5f~. Arg-99 and Arg-103 from α~5b~ and Arg-134 from α~5d~ form salt bridges to the 5′-phosphate of AMP. In the APO structure, this binding pocket was occupied by a sulfate ion. The only contact to the adenine base is a stacking interaction with Phe-154 (α~5e~). The 2′-OH group of the ribose moiety forms a hydrogen bond to Thr-135, and the 2′-OH (2.4 Å) and 3′-OH (2.5 Å) groups are coordinated to the third metal (M~γ~). Interestingly, the 3′-OH group is only 2.5 Å from an oxygen of the metal-bound orthophosphate. The contacts to the bound AMP and P~i~ are depicted in Figure [6](#fig6){ref-type="fig"}. {#fig6} Substrate Profile {#sec3.5} ----------------- The kinetic constants *k*~cat~, *K*~m~, and *k*~cat~/*K*~m~ are summarized in Table [3](#tbl3){ref-type="other"} for the hydrolysis of pApA and 11 3′,5′-nucleotide bisphosphates. The substrates with the highest activity were *N*^6^-methyl-3′,5′-pAp (*k*~cat~/*K*~m~ = 2.1 × 10^6^ M^--1^ s^--1^) and pAp (*k*~cat~/*K*~m~ = 1.4 × 10^6^ M^--1^ s^--1^), although Cv1693 hydrolyzed several other 3′,5′-nucleotide bisphosphates with similar catalytic efficiencies. At a 2′,5′-pAp concentration of 100 μM, the upper limit for substrate turnover was 0.015 s^--1^ in the presence of Cv1693. This is more than 3 orders of magnitude slower than the hydrolysis of 3′,5′-pAp. In all three of the bisphosphate mixtures (pCp, pGp, and pUp), the ratios of 2′,5′-pNp and 3′,5′-pNp nucleotides were close to 1:1, and thus, the apparent kinetic constants are assumed to be for the 3′,5′-pNp compound. However, the inhibitory properties of the 2′,5′-pNp compounds have not been determined. Cv1693 was unable to hydrolyze other compounds when assayed at a concentration of 100 μM: 3′-NADPH (≤8 × 10^--4^ s^--1^), 3′-AMP (≤2 × 10^--4^ s^--1^), CoA (≤7 × 10^--4^ s^--1^), and a 3′-phosphorylated 5-mer of DNA dAdAdAdAdAp (≤1 × 10^--4^ s^--1^). The 5′-phosphorylated 5-mer of DNA, pdApdApdApdApdA, abbreviated (pdA)~5~, was a poor substrate for Cv1693 with an estimated rate constant of ∼7 × 10^--3^ s^--1^ at a concentration of 100 μM. ###### Kinetic Constants for Cv1693 with Various Substrates compound *k*~cat~ (s^--1^) *K*~m~ (μM) *k*~cat~/*K*~m~ (M^--1^ s^--1^) ------------------------------------- ------------------- ------------- --------------------------------- pAp 22 ± 1 15.5 ± 2.4 (1.4 ± 0.2) × 10^6^ 2′-deoxy-pAp 7.1 ± 0.2 10.2 ± 0.9 (7.0 ± 0.6) × 10^5^ pCp[a](#t3fn1){ref-type="table-fn"} 8.6 ± 0.3 14 ± 2 (6.2 ± 1.0) × 10^5^ 2′-deoxy-pCp 9.4 ± 0.3 26 ± 3 (3.6 ± 0.5) × 10^5^ pGp[a](#t3fn1){ref-type="table-fn"} 12.3 ± 0.4 17.3 ± 2 (7.1 ± 0.8) × 10^5^ 2′-deoxy-pGp 4.2 ± 0.1 5.2 ± 0.4 (7.9 ± 0.6) × 10^5^ pUp[a](#t3fn1){ref-type="table-fn"} 5.4 ± 0.2 8.8 ± 1.0 (6.1 ± 0.8) × 10^5^ 2′-deoxy-pUp 5.2 ± 0.2 29 ± 4 (1.8 ± 0.2) × 10^5^ pTp 3.3 ± 0.1 9.3 ± 1.0 (3.6 ± 0.4) × 10^5^ 2′-deoxy-pIp 4.3 ± 0.2 22 ± 3 (1.9 ± 0.3) × 10^5^ pApA 0.05 ± 0.01 1.6 ± 0.2 (3.2 ± 0.3) × 10^4^ *N*^6^-methyl-3′,5′-pAp 11.6 ± 0.4 5.4 ± 1.0 (2.1 ± 0.4) × 10^6^ These assays were conducted with mixtures of the 2′,5′- and 3′,5′-nucleotide bisphosphates. Discussion {#sec4} ========== Substrate Determination {#sec4.1} ----------------------- We have demonstrated that Cv1693 from *C. violaceum* catalyzes the efficient hydrolysis of 3′,5′-adenosine bisphosphate (pAp) to 5′-AMP and orthophosphate; this reaction is presented in Scheme [1](#sch1){ref-type="scheme"}. In addition to pAp, this enzyme will also hydrolyze pCp, pUp, pTp, and pGp with nearly equivalent catalytic efficiency. However, this enzyme will not hydrolyze 2′,5′-pAp, and the hydrolysis of the simple dinucleotide, pApA to 5′-AMP, is slower by 2 orders of magnitude. The successful functional annotation of Cv1693 began with the determination of the three-dimensional structure of this enzyme and the recognition that another protein of unknown function, Bad1165 from *B. adolscentis*, was structurally similar (PDB entry 3O0F) despite a low level of sequence identity (25%). Because Bad1165 had been successfully crystallized with AMP, a nucleotide cocrystallization scan and an exchange of active site metals eventually led to the successful determination of the structure of Cv1693 with AMP, three manganese ions, and a phosphate ion. The numerous interactions of three arginine residues from the Cv1693 insertion domain with the 5′-phosphate of AMP suggested that the true substrate would bind an AMP-like moiety in this pocket and contribute to substrate recognition. The initial indication that Cv1693 is a phosphatase originated from the fact that histidinol phosphate phosphatase (HPP) is also a member of the AHS from the structurally similar cog1387. Enzymes within this cog bind three divalent cations in the active site and catalyze the hydrolysis of phosphate monoesters.^[@ref4]^ In addition, Bad1165 had been shown to catalyze the hydrolysis of *p*-nitrophenyl phosphate, but the hydrolysis of pNp-like substrates has apparently not been investigated.^[@ref12]^ Finally, the proximity of orthophosphate in the active site of Cv1693 to the 3′-OH group of the bound AMP in the ternary complex suggested that this enzyme would likely hydrolyze compounds such as 3′,5′-cAMP, 3′,5′-pAp, 2′,5′-pAp, and 3′-AMP. The utilization of a small substrate library quickly demonstrated that Cv1693 efficiently hydrolyzes 3′,5′-pAp to orthophosphate and 5′-AMP with a *k*~cat~/*K*~m~ value that exceeds 10^6^ M^--1^ s^--1^. The enzyme has a rather broad specificity for the identity of the aromatic base, and the 2′-hydroxyl is relatively unimportant for substrate recognition. Additionally, the enzyme can slowly hydrolyze short oligonucleotides with a terminal 5′-phosphate but will not hydrolyze short oligonucleotides without a terminal 5′-phosphate. However, the rate of hydrolysis of the phosphodiester bonds in short oligonucleotides is significantly slower than the rate of hydrolysis of the phosphomonoester bond in pAp. {#sch1} Structural Comparison to Bad1165 {#sec4.2} -------------------------------- A structure similarity search using the secondary structure similarity matching server,^[@ref24]^ with a 70% secondary structure match requirement, returned only one structural homologue: Bad1165 from *B. adolescentis* (rmsd of 1.87 Å over 255 common Cα atoms). The three-dimensional structure of Bad1165 was determined in complex with phosphate to 2.4 Å resolution (PDB entry 3E0F) and AMP and phosphate to 1.9 Å resolution (PDB entry 3O0F).^[@ref12]^ On the basis of anomalous data, the metal ions in Bad1165 were modeled as Fe ions for M~α~ and M~β~ and Zn for M~γ~. All of the protein-derived ligands to the three metals are conserved between Bad1165 and Cv1693, and the positions of the metal ions are very similar despite differences in metal content. Two other active site features are strictly conserved between these enzymes: (a) the three arginine residues originating from the insertion domain that coordinate the 5′-phosphate and (b) the phenylalanine side chain, also from the insertion domain, that stacks against the adenine ring. However, despite these similarities, the adenosine moiety takes a slightly different pose in Bad1165. In Cv1693, the ribose is in the 3′-*endo* conformation and the adenine is in the *anti* conformation, while in Bad1165, the ribose is in the 0--4′-*endo* conformation and the adenine is in the *syn* conformation. In Cv1693, the 2′- and 3′-OH groups interact with M~γ~ and the 3′-OH group also interacts with the orthophosphate, while in Bad1165, the 2′- and 3′-OH groups interact with the orthophosphate and not with any of the active site metals. In Bad1165, there is a bridging water molecule between metals M~α~ and M~β~, while in Cv1693, one of the oxygens of the orthophosphate bridges these two metals. In Bad1165, the adenine ring makes hydrogen bonds to the side chains of Arg-161 and Ser-162 from the insertion domain (not conserved in Cv1693), and to the backbone carbonyl of Gly-265 on a flexible loop between β~8~ and α~8~. In Cv1693, this loop is disordered, and the adenine, because of its *anti* conformation, does not approach this loop. Finally, in Cv1693, Thr-135 from the insertion domain makes a hydrogen bond with the 2′-OH group, while in Bad1165, this residue is a proline. Both enzymes have a positively charged residue interacting with the bound orthophosphate; in Bad1165, this is a lysine residue from the flexible loop between β~8~ and α~8~, and in Cv1693, it is an arginine residue from the loop between β~6~ and α~6~. The structural overlay of Cv1693 and Bad1165 is presented in Figure [7](#fig7){ref-type="fig"}, and the specific interactions of AMP in the active site of Bad1165 are presented in Figure [8](#fig8){ref-type="fig"}. {#fig7} {#fig8} Bioinformatic Analysis {#sec4.3} ---------------------- The apparent physiological substrate for Cv1693 is 3′,5′-adenosine bisphosphate. In the cell, the two most common sources of this substrate occur after the transfer of a sulfate from 3′-phosphoadenosine 5′-phosphosulfate (PAPS) and the transfer of the phosphopantetheine group of CoASH to the acyl-carrier protein (ACP).^[@ref25],[@ref26]^ In many bacteria such as *Escherichia coli*, the pAp product is hydrolyzed to 5′-AMP and orthophosphate by an enzyme denoted CysQ.^[@ref27]^ The CysQ enzyme from *Es. coli* K12 (locus tag b4214) belongs to cog1218 and hydrolyzes pAp with a catalytic efficiency of ∼10^7^ M^--1^ s^--1^.^[@ref28]^ The CysQ from *Mycobacterium tuberculosis*, Rv2131c, has a reported *k*~cat~/*K*~m~ for the hydrolysis of pAp of 7 × 10^5^ M^--1^ s^--1^.^[@ref25]^ It has also been reported that NrnA (YtqI) orthologs from *Bacillus subtilis*, *M. tuberculosis*, *Mycobacterium pneumoniae*, and *Streptococcus mutans* can also catalyze the hydrolysis of pAp, in addition to the hydrolysis of short pieces of single-stranded RNA.^[@ref29],[@ref30]^ These bifunctional enzymes (pAp phosphatase and nano RNase) belong to cog0618. The prevalence of enzymes from different families catalyzing the same function, i.e., pAp hydrolysis, prompted us to determine the distribution of these enzymes among various organisms. Because \>6000 bacterial genomes have been completely sequenced, it was more efficient to deal with a representative subset of the sequenced bacterial genomes. We used the 1752 bacterial genomes available in the Microbesonline database (October 2013) and searched for protein sequences from cog0613, cog1218, and cog0618. This exercise retrieved 964, 830, and 856 protein sequences from three cog's, respectively. A sequence network diagram at a BLAST *E* value of 1 × 10^--70^ was constructed for each of these cog's (see Figures S1--S3 of the [Supporting Information](#notes-1){ref-type="notes"}). Any two sequences connected by lines bear a level of sequence similarity greater than the BLAST *E* value of 1 × 10^--70^, which corresponds to an overall level of sequence identity of ≥40%. We then identified the proteins that have been biochemically characterized from each of the three cog's and then annotated all protein sequences within the representative groups in the SSN to possess the same enzymatic function as the experimentally characterized enzyme. We were able to provisionally annotate 118 enzymes from cog0613, 309 from cog1218, and 283 from cog0618 as pAp phosphatases in this manner. When we compared the list of organisms to which each of these enzymes belonged, we found that ∼6% of the organisms had apparent pAp phosphatases from two of the three cog's discussed here, while the remaining organisms had a pAp phosphatase from just one of the three cog's (see the Venn diagram in Figure S4 of the [Supporting Information](#notes-1){ref-type="notes"}). There was no instance of an organism possessing pAp phosphatases from all three cog's. Further examination of the phylogenetic classification of each organism revealed that organisms possessing the pAp phosphatase from cog0613 are predominantly betaproteobacteria (∼97%), those from cog1218 are largely gammaproteobacteria (∼74%), while those from cog0618 are largely bacilli from the phylum Firmicutes (80%) (see pie charts showing the phylogenetic distribution of pAp phosphatases from the three cog's in Figures S5--S7 of the [Supporting Information](#notes-1){ref-type="notes"}). It is clear that different classes of microorganisms have evolved enzymes to hydrolyze pAp from different families. This is also a strong indication that the physiological function of Cv1693 and its closely related orthologs (colored blue in Figure [1](#fig1){ref-type="fig"}) from cog0613 is the hydrolysis of pAp. The functional annotation of Cv1693 along with its available crystal structure provides an ideal platform for predicting new enzymatic functions in cog0613 based on the sequence--structure--function correlations. A sequence alignment of Cv1693 from *C. violaceum*, b1266 (an enzyme annotated as TrpH) from *E. coli*, Bad1165 from *B. adolescentis*, and Elen0235 (cyclic phosphate dihydrolase) from *E. lenta* is presented in Figure [9](#fig9){ref-type="fig"}. Cv1693 and Elen0235 are the two known functional annotations from cog0613, and the crystal structures of Cv1693 and Bad1165 are available. TrpH from *E. coli* and its closely related orthologs (colored yellow in Figure [1](#fig1){ref-type="fig"}) constitute the largest cluster of proteins of unknown function in cog0613. It is apparent from the sequence alignment that TrpH possesses all of the residues that bind the three metal ions in the active site, indicating that this enzyme likely catalyzes the hydrolysis of phosphate esters. All residues, except one, in Cv1693 that interact with 5′-AMP and orthophosphate in the crystal structure are conserved in TrpH. The sole exception is that of Thr-135 from the insertion domain in Cv1693, which interacts with the 2′-OH group and 4′-oxygen of 5′-AMP and is replaced by Gly-142 in TrpH. However, because Cv1693 cannot distinguish between 3′,5′-pNp and 2′-deoxy-3′,5′-pNp, Thr-135 may not be a critical residue for substrate recognition. This leads us to the hypothesis that the substrate profile for TrpH, if distinct from that of Cv1693, will closely resemble 3′,5′-pNp. If distinct, two possible substrates of TrpH may include 2′-substituted 3′,5′-bisphosphonucleotides or 2′,5′-bisphosphonucleotides, because the relatively small glycine residue can be envisaged to accommodate a larger functional group at the enzyme active site. {#fig9} Conclusions {#sec4.4} ----------- We have determined the crystal structure of Cv1693 from cog0613 of the amidohydrolase superfamily with 5′-AMP and orthophosphate bound in the active site. The enzyme was shown to hydrolyze the 3′-phosphate from the substrate 3′,5′-pAp, and the substrate profile was shown to include various 3′,5′-bisphosphonucleotides. Bioinformatic analysis showed that the vast majority of organisms that possess a closely related ortholog of Cv1693 do not possess an enzyme from cog1218 (CysQ) or cog0618 (YtqI or NrnA) that can catalyze the same reaction. This observation supports the hypothesis that pAp is the physiological substrate of Cv1693. Sequence network maps for cog0613 (Figure S1), cog0618 (Figure S2), and cog1218 (Figure S3); Venn diagram (Figure S4) showing the number of organisms that possess pAp phosphatase from the three cog's mentioned in this study; pie charts showing the phylogenetic distribution of organisms for each of the three cog's (Figures S5--S7); and a list of enzymes identified as pAp phosphatases from each cog (Tables S1--S3), along with the organism to which they belong and their gene identifiers. This material is available free of charge via the Internet at <http://pubs.acs.org>. Supplementary Material ====================== ###### bi401640r_si_001.pdf This work was supported in part by the Robert A. Welch Foundation (A-840) and the National Institutes of Health (GM71790 and GM93342). The authors declare no competing financial interest. We thank Dr. Margaret Glasner of the Department of Biochemistry and Biophysics at Texas A&M University for helpful discussions and insights into the bioinformatic analysis of pAp phosphatases. We thank Dr. Andrew W. McMillan from the Glasner lab for retrieving the list of identifiers for the pAp phosphatases presented in the [Supporting Information](#notes-1){ref-type="notes"}.

minipile

NaturalLanguage

mit

Marco Simoncelli Crash VIDEO: The Tragic and Gruesome Death of the Italian MotoGP Star On Sunday, Marco Simoncelli, one of the best motocross riders in the world, was killed in a horrific crash at the Malaysian MotoGP motorcycle race in Kuala Lumpur. The 24-year-old Italian crashed after being hit by two other riders, and was then sent to the local medical center where he was pronounced dead 45 minutes later after chest, head, and neck injuries. Simoncelli was motionless on the track following the collision, and his helmet had come off. How the crash occurred was difficult to watch. Simoncelli had lost control of his Honda at Turn 11, just four minutes into the race, His bike regained partial grip and swerved across the track, where he ended up in the path of Italian racer Valentino Rossi and American Colin Edwards. Edwards dislocated a shoulder in the crash, but Rossi returned to the pits. Officials were interested in restarting the race, before they learned the extent of Simoncelli's injury, but the race was later cancelled as news became more clear, and as fans threw bottles in anger. Race director Paul Butler said there will be an investigation into the crash. Simoncelli won the 250cc world championship in 2008 and clinched the crown in Sepang. He moved up into MotoGP in 2010 where he finished eighth overall last season. Marco was flamboyant on and off the track, said Matt Roberts, a BBC MotoGP broadcaster. When someone dies, everyone always says they loved life. But he had a very vibrant personality. He already had a huge fanbase around the world, partly down to aggressive riding - but also because he was just a cool guy. He didn't take himself too seriously and would have been a big star for next year.

minipile

NaturalLanguage

mit

Q: XNA Game Studio 3.1 and Zune HD (How to render a 3D texture/model) I am wondering if anyone can find a sample or has a sample or knows how to draw a 3D Model on the Zune HD. It appears Microsoft limited the functionality of XNA for the Zune HD by removing the Model object. Is there a way they suggest replacing this object, or is there something else that can be done to draw Models? Thanks. A: It seems that there isn't really a way to do it at the moment, I know somebody has tried but it didn't work out very well. The first link takes you to a discussion about why it's not available and the second takes you to the attempt at using 3d objects on the Zune. Lack of 3d - Zune 3d Attempt It seems like it's something that might not be available for a while, if at all.

minipile

NaturalLanguage

mit

A hiker managed to keep his cool while hiking the Katmai National Park in Alaska. Katmai National Park and Preserve is on a peninsula in southern Alaska. Its wild landscapes span tundra, forests, lakes and mountains. The park is known for the many brown bears that are drawn to the abundant salmon in Brooks Falls.

minipile

NaturalLanguage

mit

Attunements: Ofanite of Fire; immune to damage from corporeal heat, radiation and electricity. Cooperation: Special Rite — Convince a divisive group of individuals to cooperate on a task (+2 Essence if group is openly hostile) (from Asiel)3 [0 pts]

minipile

NaturalLanguage

mit

News Article Grenada Triathlete Takes on the World! 18 September 2007 by ITU Admin Between August 30th and September 2nd, the German city of Hamburg hosted the World Triathlon Championships. Grenada was represented by Clare Morrall, President of the Grenada Triathlon Association. Three race courses in central Hamburg were used over the championships, each with a swim in the Alster Lake, a bike course through the city streets and a run course partly along the lake. Racing conditions were rather different from those of the Caribbean! The water temperature was a rather chilly 16.2 degrees centigrade; air temperatures were in the low teens and some unwelcome head winds blasted competitors at times on the bike course. Aside from the weather, the racing was great. A total of 2500 Age Group athletes swam rode and ran either the Sprint or Olympic distance races. Amateur athletes from over 70 nations selected by their respective country triathlon federations raced in the Age Group category on Sunday, a day after 3500 athletes raced in the Open category. After a strong swim, bike and run, Clare finished the Olympic distance course in 2 hours and 40 minutes, placing 50th out of 83 athletes in her age group. The Grenada flag was held high over the entire championships, joining the Caribbean nations of Barbados who was represented by the talented junior athlete Jason Wilson and age grouper Derek Wilson along with Winston Crooke from Nevis. The 2007 World Championships was a superbly run mega event that attracted thousands of athletes and huge crowds of spectators who lined the lake and the streets for the Open, Age Group and Elite races. The final race of the Championships was the Elite Men’s race. Beijing Olympic places were assured to those who took the top ten places so the stakes were high. The men’s race was won by German Daniel Unger in an incredible in 1 hour 43 minutes. More information on the World Championships, including full results and video footage of the championship races is posted on the International Triathlon Union website at: www.triathlon.org Next years World Championships will hosted by the Canadian city of Vancouver in June. The Grenada Annual Triathlon, which will be held over the weekend of April 26/27th, will be great preparation for the World Champs- make a note of the dates now and visit www.grenadatriathlon.com.

minipile

NaturalLanguage

mit

Reflecting on some of the top sports stories involving area teams and athletes in these random thoughts for a New Year's Eve Tuesday: » Tokay grad and Stockton product Julius Thomas had a breakout season with the Broncos. The third-year tight end, who saw action in nine games his first two seasons, caught 65 passes for 788 yards and 12 touchdowns, including Peyton Manning's NFL-record 51st TD pass of the season. Thomas was selected to play in the Pro Bowl, and the Broncos have the AFC's No. 1 seed in the upcoming playoffs. » Lincoln graduate Brandin Cooks became the first Stockton product to win the Biletnikoff Award as college football's top receiver. Cooks, a junior at Oregon State, soon will decide whether to return for his senior season or enter the NFL Draft. » The World of Outlaws Series made its Stockton debut at the San Joaquin County Fairgrounds, and more than 10,000 came to see the races and a special appearance by NASCAR star Tony Stewart. The event's organizers, Tony and Carol Noceti, plan to have the series return to the fairgrounds in 2014. » The Stockton Thunder advanced to the Kelly Cup Finals for the first time in team history. Success brought change to the franchise. Coach Matt Thomas and president Dan Chapman moved on - Thomas to coach at the University of Alaska-Anchorage and Chapman to work in the Pacific athletic department. Rich Kromm took over as coach and Brian Sandy as president. » The Pacific men's basketball program bid a fond farewell to Bob Thomason, who retired after coaching 25 seasons at his alma mater. Thomason's final season included the Big West Conference tournament championship and his fifth appearance in the NCAA tournament. » Thomason's longtime assistant, Ron Verlin, was selected as his successor and ushered Pacific men's basketball back into the West Coast Conference after 42 years in the Big West. » The Pacific women's basketball team set a program record with 27 wins, earned its first conference regular-season championship and advanced to the Sweet 16 of the Women's National Invitation Tournament. » Afure Jemerigbe, a former St. Mary's standout, is believed to be the first Stockton product to play in the Final Four of the NCAA Women's Basketball Tournament. Jemerigbe and Cal reached the women's national semifinals for the first time, but lost to Louisville in New Orleans. Jemerigbe is in her senior season at Cal. » The Pacific men's water polo team won the regular season title in the Mountain Pacific Sports Federation, was ranked No. 1 in the country for four weeks, and advanced to the NCAA Championship match, ultimately losing to USC, 11-10, in overtime. » Lincoln High's Jessica Rodriguez won the 146-pound weight division at the Girls California Interscholastic Federation State Wrestling Championships in Lemoore. Now a senior, Rodriguez went unbeaten in her third state tournament appearance.

minipile

NaturalLanguage

mit

While the rest of the trading world is mired in a seemingly “riskless” environment, with implied volatility offered at historically depressed levels across almost all asset classes, the cryptocurrency space is a beacon of light for the thrill-seekers. For the cryptos who slept through the end of the week, the ETH/BTC pair rallied a mindboggling 25% from Thursday to Friday night EST. (see chart above). In outright terms, ethereum was up 13% while bitcoin was down 9% in the same 24-hour period. To put this in perspective, the day Swiss National Bank shocked the world by unpegging the franc from the euro in January 2015, the franc gained 30% on the euro and 25% on the dollar in one of the most volatile days of currency trading in decades. But this is just a blip on the radar in the ‘crypto-verse’. What forces are at work here? There’s clearly been a significant distribution of length from bitcoin into other cryptocurrencies the past month, and this seemed to accelerate to close out the week. This didn’t feel like a capital event, in which a large entity was forced to blow out of a losing BTC/ETH spread position with massive volume, but the magnitude of the move was impressive. Starting with the SEC’s March 10 decision to deny approval of the first bitcoin ETF and continuing with the intensifying hard fork drama of the past couple weeks, bitcoin has lost a bit of its command of crypto money flow. As the cryptocurrency sector matures, the “bitcoin share” (bit-share) is an interesting metric to track, bit-share is the term we use to represent bitcoin’s percent of total cryptocurrency market capitalization. Bit-share reached a new all-time low to end the week, dropping from 85% at the beginning of March to under 70% over the weekend, standing at 67.5% entering Monday trade. See the chart below from CoinMarketCap:

minipile

NaturalLanguage

mit

Q: Select all rows from start of the year, month, week and day in MySQL? I am looking for a way to be able to select all the rows from the start of a year, month, week and day on the current day from a MySQL database.. For example, let's suppose that today's date is 12th March 2017. The year query would select all posts from the start of 2017 The month query would select all posts from the start of March 2017 The week query would select all posts from the start of the weeks that date is on The day query would select all posts from the start of 12th March 2017 In the database I have got a 'date added' column which stores dates in the format of '2017-03-12'. Thanks in advance A: You can also use curdate(). Query can be select * from tbname where tddate>=curdate() --date query select * from tbname where month(tbdate)>=month(curdate()) AND year(tdbdate)>=year(curdate()) --month query select * from tbname where year(tbdate)>=year(curdate()) --year query

minipile

NaturalLanguage

mit

Evacuating Settlements in Gaza Saturday, August 23, 2005 Gaza City: The last Jewish settler has left Gaza yesterday on Monday, August 22nd. It was Nitzarim settlement which became the last to evacuate from the entire Gaza Strip. By 6: 45 PM, it was reported that the last settler left Nitzarim to mark a historical day for Gaza痴 modern history. That meant an end of a violent occupation and settlement movement of Gaza Strip which last for thirty eight years. Residents of Gaza city saw few apache helicopters flying above the coastal area of the city yesterday on Tuesday. This time it was not for sending down missiles but to oversee the evacuation process of the Nitzarim settlement located about five KM south of the city. Now, the process of demolishing settlement houses is going to start soon which and to last for two and a half weeks as reported in local Palestinian media. Military evacuation is supposed to follow towards the end of September. But, the media mentioned that the military evacuation could actually start much sooner than expected. The whole evacuation process has proven much easier and smoother than thought before. From the Palestinian side, the last couple of weeks, Palestinian militant factions have remained calm. In addition, the internal situation of calm inside Gaza has prevailed as the public and local leaders waited and watched the evacuation of settlements. No faction wants to appear as a hurdle in the process of withdrawal. Public sentiment is strongly in favor of seeing the withdrawal to continue and to insure a complete withdrawal from the whole settlements. No faction, no matter how militant it is, wants to go against such public mood. On the Israeli side, a police spokesman told media sources that the evacuation process has been much easier than even the training which police units received in the past months. On the ground, inside the Gaza strip, local Gazans are still facing extreme difficulties in crossing the biggest check point , Abu Houly , which divides Gaza into two parts ( north and south). These days, commuters are only allowed to cross Abu houly check point at night where it is supposed to open from ten before midnight until five in the morning. The road is closed completely during the day time for any Palestinian commuters. Many local people are suffering from this practice; however, knowing that settlements are being evacuated, this has encouraged people to put up with the situation for the moment till the main road re-opens again. President Abu Mazen, Abbas, has declared that the real struggle has already begun. 展e are now facing the big struggle to rebuild the homeland, to change people痴 lives and to strive for a better life for the people・ said the president of the Palestinian Authority. Many Palestinian officials are very concern about some serious and sticking issues which may remain after the end of evacuation process from inside the Gaza Strip. Main concerns are mainly to do with border crossings and freedom of enter and re-entry into the Gaza Strip especially at the border with Egypt. Palestinians politicians and also the public in general do not want to see Israeli presence at the border which controls the freedom of movement of people and goods. It has been reported recently that Palestinians would like to see a third party to be involved at controlling border with Egypt. EU is most likely so far to take part in controlling Rafah border along with Egyptians and Palestinians. So far, no confirmation has been mentioned yet on that. Also, the issue of the safe passage connecting Gaza and West bank is of crucial importance to Palestinians. Negotiations are still going on between Palestinians and Israeli in an effort to bring about some kind of arrangement for people to cross from Gaza to West Bank and vise versa. Meanwhile in the West Bank, about six thousands Israeli soldiers and policemen have already begun moving to four West Bank settlements to force radical settlers to evacuate. It is expected that by the end of the day, Tuesday, the four settlements will be evacuated completely. The west bank has about one hundred settlement spreading throughout the whole area which called the West Bank. In today痴 Al Quds Newspaper, biggest in Palestine, one Palestinian writer from Nablus City in West Bank, Lutfi Zaghlul, wrote on the current Israeli withdrawal, 哲o matter what is the motive behind the withdrawal which Israeli declares. However, the real motive from a Palestinian view is simply represented in the struggles and the huge sacrifices and the determination to retain the rights no matter how long it takes. And that liberating any piece of land is without any doubt bringing back part of those rights. The rest will be gained despite the big challenges. The road is not covered with roses and flowers.・

minipile

NaturalLanguage

mit

SARAJEVO (Bosnia and Herzegovina), February 13 (SeeNews) – Bosnian power utility Elektroprivreda BiH was awarded six concession deals by the Central Bosnia Canton for the construction of a wind park on the Vlasic plateau, the cantonal authorities said on Thursday. Elektroprivreda BiH and the Central Bosnia Canton's economy ministry signed on February 12 concession contracts for the construction, installation, equipment, use and maintenance of wind energy facilities on mount Vlasic, near the central city of Travnik, the cantonal government said in a statement. It did not provide any details about the concession terms. According to reports in the local media last year, the Central Bosnia Canton has signed six concession contracts for wind power projects on the Vlasic plateau since 2011, but in 2019 the local authorities cancelled two of the contracts - with Travnik-based firms Eberkon and Lahor, after they failed to make any progress on the projects.

minipile

NaturalLanguage

mit

Q: IronPython.Runtime.UnboundNameException: 'global name 'sin' is not defined' error I am having a problem with iron python script when I am trying to use math function sin. var pyForSrc = @"def Test(): return sin(a)"; As I am trying to execute the above script then getting the error. IronPython.Runtime.UnboundNameException: 'global name 'sin' is not defined' I tried using math.sin(a); also but then I got error like below IronPython.Runtime.UnboundNameException: 'global name 'math' is not defined'. I am getting error also when I tried to add like Math.sin(a); can someone help me how can I add math library to the IronPython Script? A: You should write: import math at the top of your code

minipile

NaturalLanguage

mit

Goguac Lake Goguac Lake is a lake in the city of Battle Creek, located in Calhoun County in the southwest portion of the U.S. state of Michigan. With a maximum depth of , the lake is home to many fish species, including Crappie, Bluegill, Pike, Largemouth Bass, Yellow Perch, Rock Bass and Walleye. While the perimeter of the lake consists primarily of private residences and expansive estates, the Battle Creek Country Club, Pasche's Lakeside Restaurant, and Willard Beach public park can be found on the lake. A fictional version of the lake was featured in the television show Battle Creek Islands There are three islands on Goguac Lake. Picnic Island, farthest south, became Chamberlain's, then Elk's and finally Vince's Island. Dr. Vince, the English-born dentist, built a causeway from the shore so that he could drive to the handsome manor house he built there. Peach Island was so named for the peach orchard planted there by Hermes Sweet. It was sometimes used for cockfights because both the sport and betting were against the law and this was a good hideaway from the sheriff. The island was subsequently known as Hulbert's, then Clark's, then Gould's for the owners of the single cottage. Ward's Island is smaller than in the early days when the lake level was lower. Ward's cottage stood on it several decades, so did the first Goguac Boat Club for about three years. Occasional picnickers use it now as trespassers, although those who recognize poison ivy generally stay away. Before its graceful elms died it became quite a bird sanctuary. Hummingbirds that fed in gardens on the mainland nested there. History The lake was originally spelled Coguagiack, a Native American term referring to the "undulating" prairie surrounding the lake. This was an area that was home for the Potawatomi tribe and Goguac Lake was said to be a gathering place for them from time to time. Since being settled by the English in the early nineteenth century, Goguac Lake has provided irrigation for crops, a ready supply of water and a focal point for community recreation. Liberty Amusement Park Like many lakes throughout the early 20th Century, Goguac Lake was once home to a small amusement park, called Liberty Amusement Park. It boasted a wooden roller coaster as well as a large dance hall. Construction started in the late 1890s and the park operated at least through the 1912 season. Pictures and further information can be found at Willard Library. Tall tales Goguac Lake has figured in a surprising number of stories: pure fiction, legends based on a thread of fact and some fantasied logic. George Willard guessed that La Salle had camped beside Goguac Lake; the story grew to La Salle's committing himself on the beauty of this particular body of water. After slogging through swamps around hundreds of lakes in his hasty escape across southern Michigan. It is doubtful if La Salle had bothered to look at Goguac, much less to comment on its superiority. Of course he had to sleep someplace, Willard figured, so why not beside this lake? Willard also thought the name Goguac meant Ancient Fort and was given to the lake by the Indians. A mound of earth that cut across Waupakisco peninsula was designated Ancient Fort on early maps. Indians seldom gave names to bodies of water and we now know that it was the prairie that was 'undulating' — the meaning of the Indian word Coghwagiak. The larger bay, in one place deep, is spring fed, but any number of stories arose as to the cause of cold and warm water only a few feet apart. In the 1890s a few cottagers stocked the lake with fish of desirable kinds for eating and one year brought in some choice eels. That started stories comparable to those told about the Loch Ness Monster. But the stories disappeared as did the eels. Only one catch, harmless enough, has been reported in the last quarter century. In the 1850s the New York Mercury, a journal which sired the dime novel and our modern mystery magazines, published a story whose setting was an island in Goguac Lake. The author is unknown. Its main character was a two personality man. He didn't have two personalities to begin with, like the later Dr. Jekyll and Mr. Hyde, but had stolen the 'soul' and appearance of a man dying here and placed them in his own sturdy body. The story included plenty of suspense and an evil cat. Goguac Lake has no known natural outlets and its level changes according to season, going down during dry spells, coming up when there is much rain. An artificial inlet from Minges Brook controls this somewhat. Following a rumor that the lake has a hidden outlet into the Kalamazoo River, a priceless 'first person' story was written for a local paper. Suspected as author of the story, and perhaps of the rumor, is William Pease who was owner, editor and possibly sole writer for The Jeffersonian, a short-lived newspaper in Battle Creek. The autobiographical bit told that the author was a visitor, living at the Battle Creek House, and that he was swimming in Goguac Lake when he was sucked into the outlet at the bottom of the lake. he was swept all the way to the Kalamazoo River. Badly bruised but uninjured, he was not only able to walk but to run back to the hotel and sneak unobserved in the back way. His suit was shamefully torn. Just how he breathed all of that time in a tunnel of water he did not bother to explain. See also List of lakes in Michigan External links Photos of Goguac Lake from Willard Library   http://www.waterwinterwonderland.com/amusementpark.aspx?id=1331&Type=2 References Category:Lakes of Michigan Category:Battle Creek, Michigan Category:Bodies of water of Calhoun County, Michigan

minipile

NaturalLanguage

mit

Transhuman Space was one of the first role-playing games to tackle postcyberpunk and transhumanist themes.[citation needed] In 2002, the Transhuman Space adventure "Orbital Decay" received an Origins Award nomination for Best Role-Playing Game Adventure. Transhuman Space won the 2003 Grog d'Or Award for Best Role-playing Game, Game Line or RPG Setting.[1] Human genetic engineering has advanced to the point that anyone--single individuals, same-sex couples, groups of three or more--can reproduce. The embryos can be allowed to be developed naturally, or they can undergo three levels of tinkering: genefixing, which corrects defects; upgrades, which boost natural abilities (Ishtar Upgrades are slightly more attractive than usual, Metanoia Upgrades are more intelligent, etc.); and full transition to parahuman status (Nyx Parahumans only need a few hours of sleep per week, Aquamorphs can live underwater, etc.) Another type of human genetic engineering, far more controversial, is the creation of bioroids, fully sentient slave races. Critically wounded (or completely healthy) persons can "upload" by recording the contents of his/her brain on a computer disk. The individual then become a ghost, an infomorph very easily confused with "sapientartificial intelligence". However, this technology has several problems as the solely available "brainpeeling" technique is fatal to the original person, has a significant failure rate and the philosophical questions regarding personal identity remain equivocal. Any informorph, regardless of its origin, can be plugged into a "cybershell", or a biological body, or "bioshell". Or, the individual can illegally make multiple "xoxes", or copies of themselves, and scatter them throughout the system, exponentially increasing the odds that at least one of them will live for centuries more, if not forever. This is no utopia, however, as several problems arise from these otherwise beneficial developments. The Generation gap has become a chasm as lifespans increase. No longer do the elite fear death, and no longer can the young hope to replace them. While it seemed that outworld colonies would offer accommodation and work for those young ones, they are being replaced by genetically tailored bioroids and AI-powered cybershells. The concept of humanity is no longer clear in a world where even some animals speak of their rights and the dead haunt both cyberspace and reality (in form of informorph-controlled bioshells or cybershells). And the wonders of high science aren't universally shared — some countries merely struggle with informatization while others suffer from nanoplagues, defective drugs, implants and software tested on their populace. In some poor countries high-tech tyrants oppress their backward people. And in outer space all sort of modern crime thrives, barely suppressed by military forces.

minipile

NaturalLanguage

mit

1. Field of the Invention The inventive method and apparatus relate to alignment devices and methods for use in boring cylinders of internal combustion engine blocks. 2. The Prior Art Apparatus for use in boring internal combustion engines are known. However, there continues to be a need for a device and method which will provide even more precise perpendicular alignment between a vertical boring tool and a center of rotation of a crankshaft of the engine. Additionally, there continues to be a need for an apparatus where the block may be fixtured for boring the cylinders without removing dowel pins or studs from the top of the block before beginning the boring operation.

minipile

NaturalLanguage

mit

Some of the best dunking happens in soccer. There’s a growing sense of style and art to team accounts finding ways to harass each other in MLS. Everything from simplistically brutal postgame jabs to elaborate haymakers have become more and more ingrained in the MLS social media culture. Not all of them are winners (oh man, trust me, we’ll get there), but there’s a regular amount of objectively clever content that creates conversation and helps build the community around the sport. Which is a good thing. I promise. And something about MLS lends itself nicely to these kinds of things: There’s enough downtime for ideas to go through a full creative process, and a small enough sample of games for individual moments to carry weight in the season as a whole. Or at least for the moments to be dissected. Say, for example, in a closely contested game a key player maybe or maybe doesn’t, but almost definitely, does take a dive and a player is sent off for the team that goes on to lose. Maybe not a huge deal overall, but still, for at least the week, an important moment. Which means…..well, it means this: Like many good things, the idea to give an opposing player the “Shooting Stars” treatment started as an office in-joke. “It was something we were talking about doing for a few months. It was a thing we kind of enjoyed in the office and something we tried to do in preseason. We almost did it then and then that kind of moment with the Timbers game totally fell in our lap,” Galaxy Senior Director of Digital Media & Marketing, Chris Thomas said. “We were kind of joking after the game about actually using it for that. And our videographer at the time was like, ‘Should I do it?’ We said, ‘Yeah. Whatever. Just go for it.’” “Yeah. Whatever. Just go for it” led to a video that has been viewed nearly 4 million times. It’s been over two years since it posted and you know what the joke is each time it plays. But when the music drops and Diego Chara goes flying through space and time and slip and slides, it’s funny every single time. Even people like World Champion Alex Morgan are in the replies just to say how good it is. The good news here for Portland fans is, first off, scoreboard (they won the match 1-0 on a Chara goal, of course). Secondly, the Timbers social team had plenty of time between the next meeting with the Galaxy to hit back. We all know about the upcoming solar eclipse, but have you heard of the fading star phenomenon? Let us explain. #ScienceIsFun #RCTID pic.twitter.com/aB4ZAsO2LA — Portland Timbers (@TimbersFC) August 7, 2017 THE PRODUCTION VALUE. Look, one video has nearly 4 million views, the other one has 80,000. There’s a clear winner in terms of reach. But that is extremely solid from Portland. And numbers don’t mean everything. Imagine Dragons have sold 12 million records. Either way, the great “Shooting Stars”ing of Diego Chara has staying power. Enough so that when another Galaxy opponent — I am not DisCo absolutely do not @ me — went airborne last weekend it only made sense to bring back a classic...With a bit of an Easter Egg at the end. you knew it was coming pic.twitter.com/wUCVpYSv5T — LA Galaxy (@LAGalaxy) July 22, 2019 Did you catch it? I missed it the first time so I’ll help. DIEEEEEEEEGGGGGOOOOOOOOOOOOOOOO!!! Just in time for LA Galaxy vs. Portland (Saturday at 10:30 pm ET on FS1, FOX Deportes, TSN4). Whether it’s FC Dallas tempting fate by provoking Zlatan Ibrahimovic, Minnesota United accentuating a win over FC Dallas with “Dallas,” Sporting KC make some alterations to the Real Salt Lake logo, Atlanta United going full Nintendo, or Philadelphia recruiting a guy in a funny shirt and a giant blue demon snake with arms to destroy a Red Bulls-themed car before the demon snake destroys us ... and uhh, there’s the Illuminati ... apparently, or……uh……. Brisket Bob. [Hey, remember when I said that we would get here?] Anyway, there is a purpose and a philosophy behind the team-on-team social media violence. When Portland takes an opportunity to celebrate ruining Scott Frost Seattle Sounders FC Day, they do it with a few key ideas in mind, which at their heart come back to one thing: This is fun, y’all. “I think for me at the end of the day, sports are entertainment and it's fun to be fun,” Kayla Knapp, Portland’s senior manager of social content and strategy said. “It's about humanizing it, but it's about entertainment and about making it fun to follow all the accounts. Whether it's us, the Galaxy, Seattle, whoever, just making it a positive experience for all the fans across the league.” Fun gets people to pay attention. And while the club standing under the metaphorical basket on the dunk may not exactly enjoy being there, being upset is, in a weird way, one of the most enjoyable parts of following soccer and sports in general. It distracts us from the every day, and when it’s finally our turn to enjoy things for a while, it makes it feel that much sweeter. If these interactions are bringing more people into that fold then, according to Portland’s senior VP of business operations and marketing, Cory Dolich, even better. “It's trying to introduce the club and the brand to people that might not necessarily know it,” Dolich said. “Creating content that isn't always just about the competitive aspects of the organization and just about soccer, I think it has the potential to reach outside your traditional audience.” There is always the danger of overdoing it though, and teams will admit that constantly clapping back can become grating. It’s all about knowing how to pick your spots. Some teams will do it better than others, but it's all a small part in helping to further that connection between the league's clubs and their fans while hopefully entertaining the rest of us along the way. But mostly lol look at Portland doing the LAFC hat thing. Hahahhahahaha. EDITOR'S NOTE: J. Sam Jones is a soccer writer and columnist and regular contributor to DirtySouthSoccer.com. You can listen to him stumble through discussions about Atlanta United on the Dirty South Soccer podcast network and follow him @J_SamJones if you don’t mind occasional ALL CAPS YELLING about American Football and Pitchfork reviews.

minipile

NaturalLanguage

mit

Q: WireMock in Junit in Jenkins - BindException: Address already in use I have some Junit test in which I use WireMock. Locally the tests pass, but on Jenkins I get an error of java.lang.RuntimeException: java.net.BindException: Address already in use In the WireMock configuration I set dynamicHttpsPort() (which according to docs "Randomly asssign the HTTPS port on startup") and its working locally, but on Jenkins it fails. My WireMock configuration is @Rule public WireMockRule wireMockRule = new WireMockRule(wireMockConfig() .dynamicHttpsPort() .keystorePath(certsDir.resolve("server.jks").toString()) .keystorePassword(MY_PASS) .keystoreType("JKS") ); I have 2 JUnit classes in which I create a new WireMockRule, and they may run simultaneously. In one of the classes I have 4 tests and in the other one I have one test. All 5 tests fail. And the full stack trace is: com.github.tomakehurst.wiremock.common.FatalStartupException: java.lang.RuntimeException: java.net.BindException: Address already in use at com.github.tomakehurst.wiremock.WireMockServer.start(WireMockServer.java:146) at com.github.tomakehurst.wiremock.junit.WireMockRule$1.evaluate(WireMockRule.java:68) at org.junit.rules.RunRules.evaluate(RunRules.java:20) at org.junit.runners.ParentRunner.runLeaf(ParentRunner.java:271) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:70) at org.junit.runners.BlockJUnit4ClassRunner.runChild(BlockJUnit4ClassRunner.java:50) at org.junit.runners.ParentRunner$3.run(ParentRunner.java:238) at org.junit.runners.ParentRunner$1.schedule(ParentRunner.java:63) at org.junit.runners.ParentRunner.runChildren(ParentRunner.java:236) at org.junit.runners.ParentRunner.access$000(ParentRunner.java:53) at org.junit.runners.ParentRunner$2.evaluate(ParentRunner.java:229) at org.junit.runners.ParentRunner.run(ParentRunner.java:309) at org.apache.maven.surefire.junit4.JUnit4TestSet.execute(JUnit4TestSet.java:53) at org.apache.maven.surefire.junit4.JUnit4Provider.executeTestSet(JUnit4Provider.java:123) at org.apache.maven.surefire.junit4.JUnit4Provider.invoke(JUnit4Provider.java:104) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:62) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:43) at java.lang.reflect.Method.invoke(Method.java:498) at org.apache.maven.surefire.util.ReflectionUtils.invokeMethodWithArray(ReflectionUtils.java:164) at org.apache.maven.surefire.booter.ProviderFactory$ProviderProxy.invoke(ProviderFactory.java:110) at org.apache.maven.surefire.booter.SurefireStarter.invokeProvider(SurefireStarter.java:172) at org.apache.maven.surefire.booter.SurefireStarter.runSuitesInProcessWhenForked(SurefireStarter.java:104) at org.apache.maven.surefire.booter.ForkedBooter.main(ForkedBooter.java:70) Caused by: java.lang.RuntimeException: java.net.BindException: Address already in use at com.github.tomakehurst.wiremock.jetty9.JettyHttpServer.start(JettyHttpServer.java:139) at com.github.tomakehurst.wiremock.WireMockServer.start(WireMockServer.java:144) ... 23 more Caused by: java.net.BindException: Address already in use at sun.nio.ch.Net.bind0(Native Method) at sun.nio.ch.Net.bind(Net.java:433) at sun.nio.ch.Net.bind(Net.java:425) at sun.nio.ch.ServerSocketChannelImpl.bind(ServerSocketChannelImpl.java:223) at sun.nio.ch.ServerSocketAdaptor.bind(ServerSocketAdaptor.java:74) at wiremock.org.eclipse.jetty.server.ServerConnector.open(ServerConnector.java:321) at wiremock.org.eclipse.jetty.server.AbstractNetworkConnector.doStart(AbstractNetworkConnector.java:80) at wiremock.org.eclipse.jetty.server.ServerConnector.doStart(ServerConnector.java:236) at wiremock.org.eclipse.jetty.util.component.AbstractLifeCycle.start(AbstractLifeCycle.java:68) at wiremock.org.eclipse.jetty.server.Server.doStart(Server.java:366) at wiremock.org.eclipse.jetty.util.component.AbstractLifeCycle.start(AbstractLifeCycle.java:68) at com.github.tomakehurst.wiremock.jetty9.JettyHttpServer.start(JettyHttpServer.java:137) ... 24 more A: Found the solution here: The problem is that you're not setting the HTTP port on either, which will always be active and default to 8080 (hence them clashing). If you add dynamicPort() to both configs it should fix it. So adding dynamicPort() fixed it: @Rule public WireMockRule wireMockRule = new WireMockRule(wireMockConfig() .dynamicPort() .dynamicHttpsPort() .keystorePath(certsDir.resolve("server.jks").toString()) .keystorePassword(MY_PASS) .keystoreType("JKS") );

minipile

NaturalLanguage

mit

How to Fix a Meniscus Tear Without Surgery Hi Doug, I have a question about your meniscus tear. How did you treat it without surgery? Was it just by doing your Fusion training? And how long did it take to fully heal? I’m a professional dancer and yoga teacher with a mild medial meniscus tear on both knees (no clicking or giving way… but definitely reduced ROM in flexion and weight bearing ability), I’ve been off dancing for 2.5 months now, and I’ve had to reduce and modify my yoga practice a great deal since. I’m trying to let my menisci heal on their own with conservative physical therapy, since I am not a good candidate for surgery according to my physio anyway because of the mildness of my symptoms, but I am losing muscle strength especially in my legs from not being able to dance/do yoga and exercise enough without aggravating the injury. I am really hoping to resume dancing and doing a full yoga practice soon, even though I know it will probably take more time than I want to. Thank you in advance for your response. Miriam (not her real name) What Happened Thanks Miriam for your question and sharing your situation. Just to bring everyone else up to speed, back in 2011, I slipped getting up off the floor and my right knee sort of twisted and buckled making a load snapping sound. I was working with a client at the time and it was loud enough that she stopped and said,”Oh my God, are you alright?” Well, that snapping sound as my right medial meniscus tearing apart. What followed was a couple of months of limping, my knee giving way, locking up and a generally frustrating period of time. I did my best to rebuild the strength of my joint and leg but the tear was just too large. Almost twenty years ago, I tore the left medial mensicus playing basketball and ended up in surgery. I had the same symptoms then as I did in 2011 so in my mind I was thinking, “I do not want to go through surgery”. What I Did I had helped people recover and rebuild following platelet rich plasma injections (PRP) and had done some additional research on it. I thought there may be some benefit to giving that a shot (no pun intended 🙂 The PRP process consists of drawing some blood, spinning it in a centrifuge and then injecting the platelets into the injured tissue. Platelets carry certain proteins – growth factors – that help tissue heal. The PRP process concentrates the growth factors by up to ten times the normal amount. There wasn’t any scientific data to show that this idea – injecting the mensicus with PRP – would work. So, it was an expensive gamble with the injections costing anywhere from $750 to $1000. But, I’m an “early adopter” and like to test new things. So, PRP was the choice for me. My knee post-PRP I had the injection and also had some knee pain from it. My knee swelled up like someone had stuffed a small apple in it. I was on crutches for about three weeks. This was my choice mostly. I felt that the injured tissue might be too fragile to withstand full weightbearing right away. Again, no data to prove it but it made sense to me. After about seven days, I started a joint strengthening program – this was partial weightbearing – and then proceeded from there into rebuilding the strength and capacity of my leg. My program was very similar to what I present in my book “The Runner’s Knee Bible: The Keys to Running Again”. I had a great result from this process. But, it took quite a while for my knee to return to “normal”. You not only need to be willing to experiment but you also MUST be patient. After about one year, I had almost 100% return of normal motion, had no symptoms, I could exercise consistently and my knee felt solid. Progress though is not linear and there’s an interesting, well, maybe bizarre is a better word, response that your body has to PRP. We call it the “prolocoaster”. About eight to twelve weeks after the injection, my knee suddenly felt a lot worse. More like it did before I had the injection and I thought, “Did I somehow mess this up? Is the mensicus torn again?” I knew about this phenomenon having helped a number of people post-PRP injection but knowing about it and living it are different things. These cycles of feeling good and feeling not so good continued for about a year and then just dissipated. Not everyone has the same response though to PRP. Some people have less pain; some more. Some go through the “prolocoaster” more often; some less. Some people have a great result and some don’t. Why? No one knows…yet. There’s a lot going on in this general area of “regenerative medicine” and there’s some encouraging research. I was invited to give a presentation in May 2011 at the American Association of Orthopedic Medicine Annual Conference – “Regenerative Orthopedic Medicine – Applications through the Lifespan” in Las Vegas. While I was there, I met and visited with a number of researchers who were investigating alternative methods of healing using the body’s own natural healing processes. PRP was one the methods and there were a number of stem cell papers as well. For a small meniscus tear, we’ve had fairly good success using the principles I outlined in my book “The Runner’s Knee Bible” but if you can add PRP to the equation, I think you “stack the deck” in your favor. Sometimes surgery is the only option but I would do my best to avoid it. Why Choose PRP over Surgery for a Meniscus Tear? All surgery carries significant risk. We tend to forget this with how common place surgery is in our society. But things like stroke, infection, and even death are in the fine print on all of the waivers for surgery so really think about what you’re doing. Removing part of your meniscus increases your chances of osteoarthritis in later years. The meniscus, in addition to being a shock absorber for your knee, helps keep it stable. When you remove a portion of the meniscus, you destabilize the knee and allow it to shift in very small amounts. No articular joint in the body likes shifting or sliding and the result is a gradual deterioration of the joint if you’re not very mindful of what you do. Some surgeries though do not remove the meniscus but repair it which is a much better choice. However, most surgeons make that decision based on the size and general stability of the tear. It’s less expensive. Yes, PRP is generally not covered by insurance but if, like a lot of people, you have a high deductible plan, then you’re out of pocket expenses for surgery will be more than the cost of PRP. Surgery is not a quick fix. I’ve met with thousands of people who all seem to have the same idea about surgery – just cut out whatever is wrong and I”ll be good to go. Not true. Yes, sometimes people with a small tear can have surgery and be up and about quickly but if you have a large tear then post-operatively you’ll want to go through rehab (your surgeon may argue about that unless he owns his own rehab – funny how that works) which can be a 2-4 month process. And getting back to impact activities like running or jumping, etc can be even longer. So, don’t delude yourself that surgery is in and out and all is well. Sometimes you can’t. In my case, the tear was certainly large enough that surgery was a real possibility and likely the only other option if the PRP failed (in fact, the doctor wasn’t at all sure that the PRP would work for me because of the kind of tear I had). Non-surgical options for meniscus tears continue to improve so before you opt for surgery, investigate all of your options and weigh them carefully. I have effusion (water on knee). It looks like your knee photo, only on the right side of my right knee. My MRI shows arthropathy (arthritis), meniscus tear, full thickness cartilage loss. one doctor who does PRP would not do it, because he contends that PRP is only good for ligament and tendon injury, not for cartilage or arthritis . I thought that PRP would help my problem. I’m seeing another doctor who might be more positive about PRP for me. I’ll report what I find. Any comments? I appreciate your article as I am a career long dance professional…I DO however know why some do not do as well with the injections…it is that the doctors currently do not select for autoimmune disease. After a severe meniscus tear I was involved enough to get to the top at a place doing stem cell injections and PRP and ask them direct questions. The data is there to show that we (I have 2 autoimmune diseases) do not have as good a chance of success as our immune systems fight the process and get in the way of the healing. Many doctors do not select for this and advise you because they don’t want to send patients and $ away. I have asked several through the years “Would you advise this for patients with an autoimmune disease?” and they said no, then I asked “Do you select for those patients?” and most said “No”. I learned to be my own advocate and not trust all the recommendations blindly..others should too… I had PRP about 6 weeks ago for chronic heel pain, with the MRI showing tenosynovitis. My foot is still slightly swollen from the injections, and more sore than before treatment, with increased pain when I’m on my feet a lot. I am trying to be patient and wait for beneficial results, but it is frustrating. Twice I’ve needed to follow the program in DK’s book “The Runner’s Knee Bible”. The first time was when I was having trouble with Bakers Cyst’s in both knees. The second time was after a small meniscus tear in my left knee. I started the RKB program after 8 weeks of PT then started the Active Age Blueprint program two months later. My left knee had microfracture surgery six years before the meniscus tear and until three months into the AAB training I could “feel” where the microfacture had been done and had not been able to load the knee when training . Finally my left knee has healed up. The RKB and AAB programs worked for me and changed my life.

minipile

NaturalLanguage

mit

GENOME ANNOUNCEMENT =================== Plant growth-promoting bacteria can enhance plant growth and nutrient uptake ([@B1]), and they are considered good candidates for crop inoculation. Bacteria of the Rhizobium genus are traditionally classified as symbiotic bacteria that fix atmospheric nitrogen within nodules of leguminous plants. Rhizobium organisms can also act as nonsymbiotic bacteria associated with nonleguminous species of great agricultural importance ([@B2][@B3][@B6]). Rhizobium sp. UR51a was isolated from the roots of rice plants collected from Uruguaiana (29°45′18″S, 57°05′16″W), in the state of Rio Grande do Sul, Brazil ([@B5]). This strain possesses plant growth-promoting abilities, such as siderophore and indolic compound production and biological nitrogen fixation. Satisfactory results, obtained in relation to the nutrient uptake of rice plants inoculated with UR51a, indicated that this strain provides essential nutrients to plants and/or enables them to access more nutrients from the soil (R. de Souza, R. Schoenfeld and L. M. P. Passaglia, submitted for publication). The genomic DNA of strain FeS53a was extracted and constructed into a 500- to 1,200-bp insert library. The whole-genome sequencing was performed with MiSeq Illumina platforms using the MiSeq regent kit v2. The assembly was initially tested using four software packages: CLC Genomics Workbench, A5-miseq ([@B7]), CISA ([@B8]), and SPAdes ([@B9]); the A5-miseq was chosen due to the lower value of *N*~50~ and fewer contigs. To assess the quality of the microbial genome, the CheckM program ([@B10]) was used with a completeness of 99.91%. Finally, the automatic annotation and classification of sequences were obtained using the RAST server ([@B11]). The sequencing of UR51a resulted in 496,691 high-quality paired-end reads (approximately 39-fold coverage), with an average length of 250 bp. The 54 contigs obtained were connected to form 32 scaffolds, based on the paired-end relationships of the reads. The draft genome sequence of strain UR51a consisted of 5,233,443 bp, with a G+C content of approximately 59.25%. Fifty-one tRNA genes, 5 rRNA genes, and 5,079 coding sequences (CDSs) were assigned on the basis of the annotation. The UR51a genome contains genes for the siderophore aerobactin uptake system (*fhuABCD*). Siderophores are involved in the sequestration of Fe^3+^ in soils with low iron content, and they can stimulate bacterial and plant growth by improving Fe^3+^ nutrition. Genes for auxin biosynthesis, an important regulator that can influence plant development, were also encountered. The UR51a genome encodes antioxidant enzymes that mediate the protection from reactive oxygen species generated by the plant hosts, as well as genes involved in resistance to antibiotics and toxic compounds. Similarly, the sequencing of the UR51a genome will increase the understanding of interaction mechanisms between this bacterium and rice, evidencing the future application as a biotechnological product to enhance crop nutrition and production. Nucleotide sequence accession numbers. {#s1} -------------------------------------- This whole-genome shotgun project has been deposited at GenBank under the accession number [JYFU00000000](JYFU00000000). The version described in this paper is version JYFU01000000. **Citation** de Souza R, Sant'Anna FH, Ambrosini A, Tadra-Sfeir M, Faoro H, Pedrosa FO, Souza EM, Passaglia LMP. 2015. Genome of *Rhizobium* sp. UR51a, isolated from rice cropped in southern Brazilian fields. Genome Announc 3(2):e00249-15. doi:10.1128/genomeA.00249-15. This work was supported by Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq/Brasil) and INCT da Fixação Biológica do Nitrogênio (Brasil).

minipile

NaturalLanguage

mit

1. Field of the Invention The present invention generally relates to hosiery and, more particularly, to a stocking which is illuminated in response to motion by a wearer. 2. Description of the Related Art Stockings are, of course, worn by men, women and children, typically for reasons of comfort, hygiene, and fashion when shoes are worn over the stockings. Also, stockings are often worn instead of shoes, especially indoors. As advantageous as the known stockings have been, improvements can still be made in their use, particularly for providing a more visually stimulating appearance and for enhancing their safe use.

minipile

NaturalLanguage

mit

5 Marvel Superhero Dresses For Grown Ups Superhero cosplay have become all the rage at conventions but sometimes you want something that shows off your fandom but doesn’t come with all the hassle of a glue gun and 10 pounds of extra weight. Fear not we have hunted down 5 of the best Marvel themed dresses for grown ups we could find. All of my blog posts may contain affiliate links. This means that if you click on them and make a purchase, I’ll receive a small commission. Thank you for supporting Watching Fireflies Blue Avengers Sleeveless Dress This Marvel Avengers blue sleeveless dress is perfect for everyday wear. A little more subtle than most Marvel dresses you can wear this to a con or just to the grocery store. Pick this up from KYOCATClothing. Marvel Halter Dress This Marvel Halter dress is super cute. It features scenes from some of the classic Marvel comics and has a really nice cut and style to it. You can get this dress from CakeShopCouture. Captain Marvel Dress One of my favorite characters from the Marvel comics books is Captain Marvel (Carol Danvers) and this dress does a perfect job of capturing the superhero’s theme in a dress. This dress was designed and hand stitched by AnotherBirdInTheHive and you can get it from her Etsy store. Avengers Pinup Dress Looking for something for a night out on the town? Check out this really cool Marvel pinup style dress. You have to go to SuperHeroSewing’s Etsy store and check out the other pictures of this dress, they are great. Deadpool Pencil Skirt Dress Deadpool has risen to the top as one of the most popular characters in the Marvel world in recent years. RetroDynamiteLLC has done a great job of creating this Deadpool pencil skirt dress, perfect for all you female Deadpool fans out there. Have you seen any other Marvel dresses out there that you really like? Let us know in the comments below.

minipile

NaturalLanguage

mit

Use and reporting of restricted randomization: a review. Restricted randomization, such as blocking or minimization, allows for the creation of balanced groups and even distribution of covariates, but it increases the risk of selection bias and technical error. Various methods are available to reduce these risks but there is limited evidence about their current usage, and there are also indications that reporting of these methods may not be adequate. This review aims to identify how frequently different methods of restriction are being used and to assess the reporting of these methods against established reporting standards. 82 reports of randomized controlled trial were reviewed. For each trial, the reported method of randomization was recorded and the reporting of randomization was assessed. Where the method of randomization was not clear from the main paper, protocols and other published materials were also reviewed, and authors were contacted for further information. For 11% of trials the method of randomization was not reported in either the paper or a published protocol, and in a further 39% of cases the report omitted key details so that the predictability of the method could not be evaluated. In total, 88% of trials appear to have used some form of restricted randomization, and all of those that report the exact methods used either blocking or minimization. 15% of trials reported using blocks of six or less and 4% used minimization with no random element reported, both of which are highly predictable. Our results indicate that the majority of trials use some form of restriction, with many using relatively predictable methods that put them at greater risk of selection bias and technical error. Reporting of randomization methods often falls short of the minimum requirements set out by the CONSORT statement, leaving the reader unable to make an informed judgement about the risk of bias.

minipile

NaturalLanguage

mit

Comparison of frequency of complex ventricular arrhythmias in patients with positive versus negative anti-Ro/SSA and connective tissue disease. A previous study of electrocardiography at rest showed that anti-Ro/SSA-positive patients with connective tissue disease (CTD) frequently had corrected QT (QTc) interval prolongation. Because QTc interval prolongation is a definite risk factor for arrhythmic sudden death in the general population, a 24-hour electrocardiographic monitoring study was performed to investigate the possible relation between QTc interval prolongation and incidence of ventricular arrhythmias as a possible expression of immunomediated electric instability of the myocardium in anti-Ro/SSA-positive patients with CTD. The study population consisted of 46 patients with CTD; 26 anti-Ro/SSA-positive and 20 anti-Ro/SSA-negative (control group) patients (Sjögren's syndrome, 9 and 3 patients; systemic lupus erythematosus, 4 and 9 patients; systemic sclerosis, 2 and 4 patients; undifferentiated CTD, 8 and 1 patients; mixed CTD, 2 and 2 patients, and polymyositis/dermatomyositis, 1 and 1 patient, respectively). All patients underwent ambulatory Holter electrocardiography to obtain 24-hour monitoring of the QTc interval and ventricular arrhythmias. With respect to the control group, anti-Ro/SSA-positive patients with CTD (1) commonly showed QTc interval prolongation (46% vs 5%), and this abnormality, when present, persisted for the 24 hours (global mean 24-hour QTc interval 440.5+/-23.4 vs 418.2+/-13.2 ms); (2) had a higher incidence of complex ventricular arrhythmias (i.e., Lown classes 2 to 5, 50% vs 10%) also in the absence of detectable cardiac abnormalities; and (3) in patients with CTD, there is a direct relation between global mean 24-hour QTc interval and ventricular arrhythmic load independently of age and disease duration. In conclusion, anti-Ro/SSA-positive patients with CTD seemed to have a particularly high risk of developing ventricular arrhythmias. The risk appeared related mainly to abnormalities in ventricular electrophysiologic characteristics emerging in the clinical setting as QTc interval prolongation.

minipile

NaturalLanguage

mit

## # This file is part of WhatWeb and may be subject to # redistribution and commercial restrictions. Please see the WhatWeb # web site for more information on licensing and terms of use. # http://www.morningstarsecurity.com/research/whatweb ## Plugin.define "Empire-CMS" do author "Brendan Coles <[email protected]>" # 2010-08-04 version "0.1" description "Open source CMS" website "http://www.phome.net/" # 371 results for "powered by EmpireCMS" @ 2010-08-04 # Dorks # dorks [ '"powered by EmpireCMS"' ] matches [ { :text=>' - Powered by EmpireCMS</title>' }, ] end

minipile

NaturalLanguage

mit

Tasty Spicy Red Pepper Rice Pilaf Recipe This is a great way to spice up your rice side dish. Add more or less red pepper flakes to taste. My husband thought I should have added more to my dish as it wasn’t very spicy at all. I’ve over spiced recipes before so I didn’t want to take that risk again and decided to just sprinkle the red pepper flakes in the dish instead of measuring it out. Next time I will add a little more red pepper flakes. I also already had all the pantry ingredients and was looking for a way to use my Priano Marinated Red Peppers from Aldi. Actually, my entire recipe was made from Aldi ingredients, which helps me save money without sacrificing quality. Read more about the Top 10 Reasons I Love to Shop at Aldi. I also love this recipe because it took very little additional time to make. I omitted the onion due to my family’s taste preference (which is the nice way to say they are picky eaters!) I really love that Aldi has instant brown rice because I can whip up a rice dish in 5 minutes! This one did take about 10 minutes because I cooked a few things before adding in the rice. Also, I used Aldi’s vegetable stock but you can easily use your own homemade version to save even more. I would have been happy for this one as my entire meal. I had already planned the other parts of the meal which include asparagus and Biotrue Challenge Sweepstakes. They look like read chicken tenders, don’t they? My daughter also made us Homemade Honey Mustard. I’ll be sharing her recipe soon!

minipile

NaturalLanguage

mit

LONDON: London MayorBoris Johnson has spent almost 25,000 pounds on his "Prime Ministerial-style" trade mission to India last November, British media reported today. Johnson has been known to attack his predecessor, Labour mayor Ken Livingstone, for extravagant trips, including one to India which is believed to have cost 740,000 pounds. He, however, defended the bill saying, "It's something business always asks you to do. It's one of those things they all say is valuable to them. They always say London must be represented." "My opposition was to spending a lot on PR consultants to handle the whole thing. We've done a much more economical version." Johnson's Prime Ministerial-style week-long trip, which took in Delhi, Hyderabad and Mumbai, boosted the profile of London -- and the Mayor -- on the international stage, the Evening Standard newspaper reported. According to the paper, the mayor's entourage, which included his chief of staff, head of communications and a foreign affairs team, spent 13,781.44 pounds on flights. This included premium economy tickets on international British Airways flights -- where Johnson was upgraded to first class -- and two internal domestic flights. The team spent 7,004.86 pounds on hotels. About 1,245 pounds went on cars for the mayor and his entourage and a bus for the accompanying media. He racked up 2,783.63 pounds in expenses, thought to have covered food, gifts and entertaining. Johnson received several gifts, including a gold lantern from Maharashtra Chief Minister Prithviraj Chavan and a silver plaque of Gandhi from a Delhi-based business group. He was also given a filigree silver peacock, a statue of an air traffic control tower and up to 50 other presents that did not need to be declared because of their low monetary value. India figures among the top countries from where projects have been coming into the city of London and since 2007, nearly 120 Indian companies have set up a London base. London & Partners (L&P), the mayor's inward investment agency which is part of the delegation, believes this figure could be significantly higher following the visit.

minipile

NaturalLanguage

mit

The goal of the POLARIS project is to contribute to the understanding (from the observation, modeling and analysis to the actual optimization through adapted algorithms) of the performance of very large scale distributed systems by applying original ideas from various research fields and application domains. Studying all these different aspects at once without restricting to specific systems is the key to push forward our understanding of such challenges and propose innovative solutions. If large computing infrastructures are naturally among our targets, the synergies with other data intensive sciences leads us to consider other kind of big data processing infrastructures as well. This is why we investigate problems arising from application domains as varied as large computing infrastructures, wireless networks, smart grids or transportation systems. The POLARIS team works in close cooperation with other research teams on a continuum of five research themes including measurement and experimentation, statistical trace analysis and visualization, discrete-event and perfect simulation, asymptotic modeling, stochastic optimization and game theory.

minipile

NaturalLanguage

mit

Comforting Thoughts About Death That Have Nothing to Do with God "In this book Greta Christina tackles the subject of death with the insight of a philosopher and the relaxed candor of a friend — that really cool, intelligent friend who understands and cares." -David Niose, author of Fighting Back the Right: Reclaiming America from the Attack on Reason Comforting Thoughts About Death That Have Nothing to Do with God by Greta Christina -- available now! Coming Out Atheist “"Witty, wise, helpful, and humane, this clear and engaging book is most timely.” -Phil Zuckerman, Ph.D., author of Faith No More: Why People Reject Religion Coming Out Atheist: How to Do It, How to Help Each Other, and Why by Greta Christina -- available now in ebook, print, and audiobook! I Support Atheism Plus! Atheists plus we care about social justice. Atheists plus we support women’s rights. Atheists plus we protest racism. Atheists plus we fight homophobia and transphobia. Atheists plus we use critical thinking and skepticism. EVENTS Atheist Meme of the Day: Unfalsifiability Today’s Atheist Meme of the Day, from my Facebook page. Pass this on; or don’t; or edit it as you see fit; or make up your own. Enjoy! Most religious beliefs are unfalsifiable — there’s no possible way to test whether or not they’re true. And unfalsifiable hypotheses should be rejected on that basis alone. If there’s no way to test whether a religion is true, how do you distinguish it from the thousands of other untestable religious beliefs? Pass it on: if we say it enough times to enough people, it may get across. How would you falsify the hypothesis that “unfalsifiable hypotheses should be rejected”? Good question. I’ll take a stab: If unfalsifiable hypotheses could be found to be useful in some way; if they could be found to serve some function that can’t be served by falsifiable hypothesis. That would falsify the hypothesis that “unfalsifiable hypotheses should be rejected”. Thoughts? I disagree with this. First of all, many unfalsifiable hypotheses are as unfalsifiable as their negations. Thus, “there does not exist an undetectable dragon in my garage” is as unfalsifiable as “there does exist an undetectable dragon in my garage.” So a simple basis of fasifiability is not sufficient to determine whether a hypothesis should be rejected. Falsifiability is potentially a useful test to determine if a hypothesis is scientific. It might also be a useful test for determining if a question is worth thinking about. But without a lot of other machinery, such as Hume’s and Occam’s razos, simple falsifiability isn’t sufficient to reject a hypothesis. Moreover, falsifiability isn’t even a great test for what is scientific. While this test works for naive Popperianism, as pointed out by Quine, Kuhn and others we rarely reject a treasured hypothesis when an experiment provides evidence against it. Indeed, we often posit additional defensive hypotheses to preserve the statement. As Quine observed, one can preserve a hypothesis indefinitely by adding enough defensive hypotheses. Even more troubling, sometimes this is the correct response and sometimes it isn’t. For example, to preserve the Ptolemaic system people kept adding additional epicycles to the model of the solar system. However, this turned out to be bad. On the other hand, the neutrino was posited to exist to preserve various hypothesized symmetry laws. So it isn’t even easy to tell when one is making legitimate or illegitimate defensive hypotheses. @Joshua: Agreed. If most religious beliefs are unfalsifiable, then so is atheism, as long as no god literally presents itself to humanity. A better criterion, following the switch from the (both technically correct) Ptolemaic to Copernican model, would be the elegance of starting premises, though of course that has met its own bugbears on the religious/atheistic front. Axiom: Use the simplest model that explains the evidence and makes correct predictions, because simpler models are easier to deal with. Working from that assumption, unfalsifiable hypotheses are a bad idea because there’s no way of telling if their inclusion in your model is making it unnecessarily complex, because there’s no prediction that can invalidate them and no evidence that can disprove them. Joshua, that takes care of the “endless extension” problem, since extensions (that is, complications) to the model have to be justified by additional predictive power. It also, I think, takes care of the “negation is unfalsifiable too” problem, since it’s not helpful to have such negations in the model and therefore we can just ignore them. For example, the theory of gravity is “The force of gravity is proportional to the mass over the square of the distance”, end of line. It’s an unnecessary complication to make it “The force of gravity is proportional to the mass over the square of the distance, and has nothing to do with invisible pink unicorns or shoe-repairing elves or caramel popcorn”. Joshua: I don’t agree. It’s true that “There is absolutely, positively, with 100% certainty no undetectable dragon in my garage” is unfalsifiable… but that’s not an important, interesting, or useful statement. The important and useful statement is, “There is no reason to think that there’s an undetectable dragon in my garage, and in any practical sense a completely undetectable dragon is no different from no dragon at all — so I’m going to act as if it isn’t there.” Which is what atheism is: it’s the null hypothesis. As for the process of science: It’s true that as a practical matter, one experiment contradicting a hypothesis will rarely overturn it — especially if the hypothesis is an important one. But I would argue that this doesn’t contradict the principle of falsifiability. I would argue that that’s as it should be — even with the principle of falsifiability in place. As a science teacher of mine once pointed out: “If one of my students announced that they had discovered that the atomic weights of helium and lead were the same, I wouldn’t immediately alert the scientific journals. I would first ask if my student had turned on their scale.” If a hypothesis has proven extremely powerful in the past, a handful of experiments shouldn’t necessarily be enough to overturn it. Experiments can be wrong: they can have poor methodology, etc. (Despite the joke, it would probably take more than one fossilized rabbit in the pre-Cambrian layer to overturn the theory of evolution.) It should take time, and extraordinary care and rigor, for science to adopt radical new hypotheses. And sometimes the appropriate response to experiments contradicting a useful hypothesis is to modify the hypothesis rather than discard it. Experiments didn’t eradicate Newton’s laws of motion and replace them with Einstein’s — they showed Newton’s laws of motion to be an entirely useful approximation of Einstein’s when applies to the special case of slow-moving objects. The theory of relativity wasn’t a reversal of Newton’s laws — it was a modification of them. And that’s appropriate. If most religious beliefs are unfalsifiable, then so is atheism, as long as no god literally presents itself to humanity. Colin: “As long as no god literally presents itself to humanity”? But that’s the whole point. Of course atheism is falsifiable. If a god or gods presented themselves to humanity, atheism would be falsified. The principle of falsifiability doesn’t mean a hypothesis has to be falsifiable with the currently available evidence. That wouldn’t make a hypothesis falsifiable — it would make it falsified. The principle means that it has to be possible, in theory, for some evidence to arise that would prove the hypothesis wrong. There are, of course, limits to the principle of falsifiability. The main one is that you always have to start with some axioms. (Most commonly, we start with the axioms that our perceptions are not hallucinations, we’re not living in the Matrix, etc.) But the fact that no current evidence has contradicted atheism doesn’t make it unfalsifiable. It makes it a really good, strong, plausible hypothesis. Greta no disagreement there. But the point is that you are using other notions such as what constitutes a reasonable null hypothesis (implicitly using Occam’s razor). Thus a claim that “unfalsifiable hypotheses should be rejected on that basis alone” isn’t accurate. Greta: It is not necessary to assume we are not living in the Matrix. A useful hypothesis ultimately predicts (subjective) observations. A good hypothesis predicts them consistently and accurately. A bad one has a lot of error. Unfalsifiable nonsense like deism or last thursdayism doesn’t predict observations at all and may therefore be dismissed without wasting further brainpower on it. Two hypotheses that make exactly the same predictions (e.g. the universe is actually old, vs. the universe was created last thursday with a perfect illusion of age) are actually the same hypothesis. Only when hypotheses make conflicting predictions is the statement that there is a difference falsifiable, and therefore itself a hypothesis worthy of consideration. So as to whether the universe is actually old or just a perfect illusion, I don’t care. It will never (because we are assuming the illusion is perfect) make the tiniest little difference to anything that ever happens. Occam’s razor was created as a technique for choosing the most plausible hypothesis given incomplete information. But it’s also a good rule of thumb for choosing among equivalent hypotheses: when they will all produce the same predictions in the end, choose the one that involves the least mental effort. Joshua: unfalsifiable hypotheses absolutely should be rejected on that basis alone. They aren’t real hypotheses, but rather daydreams with pretensions. Once you’ve considered them long enough to understand that they are unfalsifiable, you’re done. There is nothing whatsoever to be gained from considering them any further. It’s far more fruitful to discuss whether pigs have wings. Greta: Let’s say that it would take only one fossilized rabbit in the pre-cambrian to overturn evolution as currently understood, but more than one rabbit in pre-cambrian rock. We’d look good and hard to see if there were alternative ways for fossils to get into older rock, or of the rock was misidentified, or if the rabbit was misidentified, or if the whole thing was due to some stupid error, or if it was a practical joke, or… Very few observations are supported completely by a single hypothesis. You usually have one dubious one being tested, and a large number of “safe” hypotheses that are assumed to be reliable. (E.g. measuring instruments working properly, readings recorded properly, etc.) But if you observe something really unexpected, you start looking for the least implausible thing to explain the observation, which may be one of your “safe” assumptions.

minipile

NaturalLanguage

mit

Contact (video game) is a role-playing video game developed by Grasshopper Manufacture for the Nintendo DS handheld game console. It was published by Marvelous Entertainment in Japan on March 30, 2006, by Atlus USA in North America on October 19, 2006, and by Rising Star Games in Australia, Asia and Europe on January 25, 2007 and February 2, 2007 respectively. Plot The story begins as a scientist, known as the Professor, flees through space from a mysterious enemy known only as the "CosmoNOTs" (Cosmic Nihilist Organization for Terror). He crash lands on a strange planet, losing the "cells" that power his ship. Without power, he is stranded. He enlists the help of Terry, a young boy. Terry agrees to help the Professor by exploring the planet and locating the cells. Helping the Professor is the only way that Terry will be able to get home, but the Klaxon Army are tracking them down, the cells are hidden in some dangerous areas and, as the game progresses, the Professor's intentions are slowly thrown deeper and deeper into question. The player is included in the story-line as a separate character from Terry, and the game's characters recognize the player as "controlling" Terry using the DS, breaking the fourth wall, and assisting him through the use of 'decals' - sticker-like items that apply specific, often powerful effects. Throughout the game, the Professor will talk directly to the player to give hints on how to use the controls and to voice his concerns about Terry. The Professor is eager to keep the player's existence and their role in Terry's life a secret from the boy. Gameplay In Contact, several atypical gameplay mechanics ensure a certain amount of alienation between the player, the Professor, and Terry. The Professor talks directly to the player, giving instructions in order to help Terry. Once battle mode is entered, Terry's attacking is essentially on autopilot - being done automatically provided the attack is not on cooldown, and Terry is within range of the enemy. The player can switch weapons, move Terry, and use items, decals, and skills, but the bulk of combat is out of the player's hands, and they essentially watch, waiting for the right moments to use their abilities, while Terry handles attacking on his own. Unlike many RPGs, experience gain is instantaneous during battles, which complements the real time combat system. Rather than increasing multiple statistics at once, Contact's experience system increases Terry's statistics individually as he performs specific actions. For instance, when Terry takes damage, his defense increases; when he damages an enemy, his strength increases. There are other statistics that affect Terry's relationship with the game's non-playable characters, including fame, courage, and karma. The character can attack any NPC at will. As animosity towards Terry grows, townsfolk will attack Terry on the street or run when they see him. Weaker enemies also flee when Terry advances depending on his fame. There is a costume system through which new skills can be learned. Up to eight costumes can be obtained, turning Terry into such forms as a fisherman, a chef, a thief, an "aqua shot," a car driver, a digger and a pilot. With greater use, a costume will add extra powers to its associated skills and statistics, including elemental magic and magical properties. Terry also has weapon-based skills. The weapons are divided into three different categories: punching (gloves), striking (clubs), and slashing (swords). Each skill can be upgraded by using each type of weapon throughout the game. Each enemy has its own weakness, so some of Contact's strategy involves switching to the appropriate weapon to exploit an enemy's weak point. The game also uses decals or stickers. The player can stick multiple decals to Terry, resulting in added powers. Decals can also be used to attack enemies, heal, and other functions. There are many items to collect, a large number of which are food. Terry can combine foods in the cooking system while wearing the chef costume, which Terry can consume to replenish health and negate status ailments. Food and potions also require time to digest in Terry's gut and yield bonuses which vary depending on the kind of item, in addition to the digestion time varying, so timing is a factor when using these items in battle. The game contains a number of side-quests. While none of these are necessary to complete the game, certain costumes cannot be obtained without completing a particular side-quest. The game additionally makes use of the Nintendo Wi-Fi Connection. During Contact Mode, the player can exchange friend codes with another player and make contact with one another. In the single player adventure, upon reaching the WiFisland, all friends who have been contacted through friend codes appear as non-playable characters, sharing tips and items. Up to 8 players can be stored as NPCs in the WiFisland. Development Contact was developed by Grasshopper Manufacture as the company's first RPG on the DS. The game's main designer and director, Akira Ueda, a former Square graphic designer and a prominent contributor to the Shining Soul games, described the game's main story line as providing a "framework of diversions" such as combat, item collection, and monster hunting. The game uses the touchscreen in several ways through the game. "We've endeavoured to use as many of the DS' features as we could, but not in an obvious way," Ueda explained. "Our philosophy was 'How can we use these fantastic features properly?' We wanted them to work for the story rather than dictate it, which is something we feel is incredibly important for an original concept like Contact." Contact features Apple IIe-style fonts on its title screen and 8-bit mini-games. However, the main graphical draw of Contact is its contrast in art styles between the two DS screens. A simple, pixelated style makes up the top screen, while the bottom screen has a pre-rendered, detailed art style. These styles clash when the Professor transitions from one screen to the other. Ueda originally developed the game for the Game Boy Advance; producer Takeshi Ogura revealed that the two art styles were to switch back and forth. However, when development moved to the DS, the team decided to take advantage of the dual screens by showing them simultaneously. According to Ueda, this differentiation "underlines how the player and the Professor are aliens to each other. They must make contact, communicate and co-operate to make it through the game" and "creates feelings of nostalgia; just like the interplay between the 'real' and 'game' worlds." Contact was picked up for a North American release by Atlus USA prior to its Japanese launch. The company's localization director, Tomm Hulett, was attracted to the game's art style and humor, comparing it to the cult-classic EarthBound. As per the company's translation policy, Atlus attempted not to alter the original Japanese text in its English language localization of the game. This was a slight challenge. According to Hulett, it was difficult to figure out which parts of the dialogue were serious and which were comical. Also, the files did not show which character was speaking, which was a problem when multiple characters conversed. Reception According to Media Create, Contact performed poorly on the Japanese market with just 8,102 copies sold during its first week on sale and a total of 25,413 copies sold by the end of 2006. Atlus suspects that the game suffered from low sales in the region due to the game's concurrent release with the highly anticipated handheld title Mother 3. The game received "average" reviews according to the review aggregation website Metacritic. In Japan, Famitsu gave it a score of one nine, one seven, one eight, and one nine for a total of 33 out of 40. Gamebrink compared the statistics and level systems to games like Oblivion. The site praised the story, job system and, especially, the music, but defined the battles as "fairly shallow." In contrast, Nintendo Powers major complaints were that the game was "frustrating because your objectives are often obtuse and unintuitive and the game can be brutally difficult." Sequel Ueda claimed during a 2006 interview between Gamasutra and developer Grasshopper Manufacture that he was working on a sequel to Contact. When asked again in 2011 about a sequel, Ueda responded that he was ready to work with Suda on a follow-up game despite the original's lack of success. "Regardless of the business aspects of making a sequel," Ueda explained, "I think the world would be a better place if there was another Contact game in existence!" The game has yet to be officially announced. Notes References External links Category:2006 video games Category:Atlus games Category:Cancelled Game Boy Advance games Category:Grasshopper Manufacture games Category:Marvelous Entertainment Category:Multiplayer and single-player video games Category:Multiplayer online games Category:Nintendo DS games Category:Nintendo DS-only games Category:Nintendo Wi-Fi Connection games Category:Role-playing video games Category:Video games about video games Category:Video games developed in Japan Category:Video games scored by Masafumi Takada

minipile

NaturalLanguage

mit

Disagreement between height/weight classifications of underweight, normal weight, and obesity in peritoneal dialysis patients. Peritoneal dialysis (PD) patients are classified as underweight, normal weight, or obese by height/weight indices including body mass index (BMI) and the body weight/desired weight (W/DW) ratio. We compared these classifications of degree of obesity in 378 women and 555 men on PD. We used these cut-off values: for underweight, BMI < or = 18.5 and W/DW < or = 0.9; for obesity, BMI > or = 30.0 and W/DW > or = 1.2. The W/DW values were calculated assuming first a small frame, then a medium frame, and finally a large frame for all subjects. Regardless of sex or skeletal frame, BMI correlated highly with W/DW (r value between 0.98 and 0.99); however, the range of BMI values corresponding by linear regression to the normal range of W/DW (0.9-1.2) was narrower than the range of "normal" BMI (18.5-30.0). Consequently, regardless of sex or skeletal frame, smaller fractions of the patient population were classified as underweight or obese by BMI standards than by W/DW standards. The degree of agreement of the classifications of subjects as underweight, normal weight, or obese by BMI and W/DW was evaluated by Cohen's kappa ratio. The kappa ratio varied between 0.47 and 0.58, indicating a reasonable--but not high--degree of agreement beyond chance. The highest kappa ratios were obtained assuming a medium skeletal frame for both women and men. Substantial discrepancies are observed in the classification of PD patients as underweight, normal weight, or obese by BMI and W/DW. Further research is needed to identify the height/weight index that has the strongest association both with clinical outcomes and with other, more precise measurements of body fat content.

minipile

NaturalLanguage

mit

Background {#Sec1} ========== Roe deer (*Capreolus capreolus*) and European red deer (*Cervus elaphus elaphus*) are the only species of deer native to the British Isles. Although historically widespread, roe deer became extinct over large areas of Britain during the post mediaeval period, particularly in Wales and the English Midlands \[[@CR1], [@CR2]\]. However, following re-introductions from France, Germany, Austria and Siberia during the 1800s and early 1900s \[[@CR1], [@CR3]\] roe deer populations in Britain started to recover and it is now believed that all roe deer in southern England are derived from animals introduced from Europe \[[@CR2]\]. In recent decades there has been a spectacular increase in the British roe deer population \[[@CR4]\] and, with the rate of range expansion recently estimated at 2.3%, per annum, this is expected to expand further for the foreseeable future \[[@CR5]\]. The factors that are driving this and other deer population trends in Britain are poorly understood and there is a need for an evidence-based understanding of the mechanisms involved \[[@CR6]\]. Increased roe deer density has previously been implicated in the enhanced spread of pathogens such as *Mycobacterium bovis* \[[@CR7]\] and might increase the risk of chronic wasting disease (CWD) transmission should it reach the UK \[[@CR8]\]. When combined with climate changes which may support larger mollusc populations \[[@CR9]\], and a concomitant enhanced risk of transmission of mollusc-vectored pathogens, there is a greater risk that parasites such as *Varestrongylus capreoli* will become established in the UK. Many roe deer are shot in Britain each year for human consumption and also to limit the damage they do to commercial woodland \[[@CR10]\]. Despite this, there is little published information on the diseases and causes of mortality of roe deer in this country. Case presentation {#Sec2} ================= Samples and sample preparation {#Sec3} ------------------------------ The lungs and, in one case the majority of the lung lobes, from two adult male roe deer were submitted to the Wildlife Veterinary Investigation Centre by hunters in April 2015 and April 2017 following the observation of gross abnormalities for the purpose of food safety. Both deer were shot by licenced marksmen as part of estate management strategies at locations denoted by National Grid Reference numbers SX08 64 and SW84 45, respectively. One animal (case \#1) had been shot because it was lame, having suffered a recent amputation of the left forelimb distal to the carpus; despite this injury it was in quite good physical condition. The second animal (case \#2) was shot for human consumption and was judged to be in good body condition. The lungs in each case were subjected to gross examination and showed multiple swellings in the parenchyma. In order to check for the possible presence of parasite eggs or larvae impression smears from the cut surface of the swellings were made on to microscope slides; a small amount of normal saline was added, a coverslip applied and the specimen examined by direct light microscopy. Duplicate impression smears were mounted in dilute Lactophenol Cotton Blue to clear and stain the characteristic features of any parasitic forms present. In case \#1 only an additional smear was air-dried, heat-fixed and stained by Ziehl-Neelson in order to check for the presence of acid-fast organisms such as *Mycobacterium* sp.. Larvae and parasite appendages were measured using an eye-piece micrometer calibrated against a stage micrometer. Representative sections through several parenchymal swellings of both sets of lungs were placed in 10% neutral buffered formalin, dehydrated through graded alcohols, embedded in paraffin wax, sectioned at 5 μm and stained by haematoxylin and eosin (H&E) and periodic acid-Schiff (PAS). Additionally, lungs from case \#2 were examined by fine blunt dissection for the presence of adult nematodes. Fragments of dissected lung were pooled, placed in a glass beaker with 2 L of tap water, thoroughly agitated, left to settle and then the sediment examined for parasites or fragments. Gross pathology {#Sec4} --------------- The lungs in case \#1 showed multiple tan-coloured, nodular, roughly 2--5 cm diameter swellings located mostly along the margins of the lobes. They were clearly demarcated from the lung parenchyma, had a firm, uniform consistency and frequent small ecchymotic haemorrhages. Also present in the parenchyma were localised areas of atelectasis and haemorrhage (Fig. [1](#Fig1){ref-type="fig"}). There was a small number of adult *Dictyocaulus* sp. nematodes present in the bronchi and larger bronchioles. The nodular lung lesions in case \#2 were very similar to those in the first case but were often surrounded by a zone of parenchyma that was much paler than elsewhere in the lung.Fig. 1The gross appearance of the lungs in case \#1 showing multiple pale tan nodular swellings in the pulmonary parenchyma Bacteriology {#Sec5} ------------ No acid-fast organisms were seen in a Ziehl-Neelsen stained, air-dried and heat-fixed impression smear from the cut surface of a lung nodule in case \#1. Histopathology {#Sec6} -------------- The nodular lesions in both cases showed dense consolidation with very large numbers of nematode eggs present in various stages of development together with numerous larvae in the bronchioles and the alveolar lumena. Associated with this was a large number of inflammatory cells, mostly macrophages, eosinophils and multinucleate giant cells, and fibrosis of alveolar walls (Fig. [2](#Fig2){ref-type="fig"}). The smaller bronchioles showed pronounced smooth muscle hypertrophy and were surrounded by a thick layer of lymphocytes (Fig. [3](#Fig3){ref-type="fig"}). No adult nematodes were seen in the nodules or in unaffected lung parenchyma.Fig. 2Histological section through a nodular swelling in the lungs of case \#1. Note the eggs in various stages of development (arrows) and first stage larvae (arrow heads) H&E stain. Bar =200 μmFig. 3Histological section through the lung of case \#1 showing severe smooth muscle hypertrophy of a small bronchiole and a surrounding rim of lymphocytes. PAS stain. Bar =200 μm Parasitology {#Sec7} ------------ There were moderate numbers of adult *Dictyocaulus* sp. in the bronchi and bronchioles of case \#1 but none were seen in case \#2. In both cases microscopic examination of wet impression smears from the cut surface of the nodules revealed numerous first stage nematode larvae and embryonated eggs. The larvae had a dorsal spike at the base of the tail appendage and the appendage itself had well-developed cuticular folds (Fig. [4](#Fig4){ref-type="fig"}). The larvae in case \#2 were measured and the mean dimensions (*n* = 10) were length 294.4 μm (standard error 3.3) and width 18.8 μm (0.7).Fig. 4High power view of the tail appendage with cuticular ridges and the dorsal spine (arrow) of a first stage larva in an impression smear from a lung nodule in case \#2. Lactophenol Cotton Blue stain. Bar =25 μm Blunt dissection of lung parenchyma was carried out in case \#2 only. Examination of the sediment after washing the pooled fragments of lung tissue revealed a single male nematode measuring approximately 5 mm in length. It had well developed bursae with radiating rays that did not extend fully to the margins. The spicules were tubular, equal, symmetrical and yellowish brown and measured 258.5 μm (Fig. [5](#Fig5){ref-type="fig"}).Fig. 5Caudal end of the male protostrongylid recovered following blunt dissection of lung in case \#2. The spicules are tubular, equal size and symmetrical and the bursal rays do not extend fully to the margins. Unstained. Bar =200 μm Molecular biology {#Sec8} ----------------- Total genomic DNA was extracted from (i) pooled L1 larvae recovered from an additional unfixed impression smear sample from case \#2 only and (ii) a single adult male preserved in 70% (*v*/v) ethanol, using a Qiagen DNeasy Blood and Tissue kit following the animal tissues spin column protocol as described by the manufacturer (Qiagen, Hilden, Germany). A fragment of the internal transcribed spacer (ITS)-2 sequence within the nuclear ribosomal DNA was amplified in duplicate and sequenced from each sample using the generic pan-nematode primers NC1 (5′-ACGTCTGGTTCAGGGTTGTT-3′) and NC2 (5′-TTAGTTTCTTTTCCTCCGCT-3′) \[[@CR11]\] to confirm parasite identity. Briefly, each PCR reaction contained 3 μl template DNA, 1.5 μl of each of the relevant forward and reverse primers (10 μM stock; Sigma-Aldrich, Poole, UK) and 20.0 μl of MyTaq × 2 mastermix (Bioline, London, UK), made up to a final volume of 40 μl with molecular grade water (Sigma). Molecular grade water was used as a no template negative control. Thermal cycler parameters were: 1 x initial denaturation at 95 °C for 2 min, followed by 35 x (denaturation 30 s at 95 °C, annealing 30 s at 52 °C, extension 30 s at 72 °C), followed by a final extension phase of 72 °C for 7 min. PCR amplicons were resolved by agarose gel electrophoresis using a 1% (*w*/*v*) UltraPure agarose gel in 1× Tris-borate-EDTA buffer (TBE; all Sigma), including 0.01% (*v*/v) SafeView nucleic acid stain (NBS Biologicals). The results of electrophoresis were visualised using a U:Genius Gel Documentation System(Syngene). PCR amplicons were purified using a PCR purification kit (Qiagen) and sequenced on both strands using the same primers employed in their original amplification (GATC Biotech, Konstanz, Germany). Sequence assembly, annotation, and interrogation were undertaken with CLC Main Workbench v6.0.2 (CLC Bio, Aarhus, Denmark) using BLASTn against the GenBank non-redundant database to assign identity. Following these methods partial ITS-2 sequences were derived from L1 larvae and the single adult male worm. In total 449 bp high quality sequence was produced in duplicate from the L1 larvae, with 100% sequence similarity between duplicates (available under accession number LT962658). Comparison with the GenBank non-redundant nucleotide database identified the highest sequence similarity with *V.* cf. *capreoli* (accession number KJ452176.1; 100% coverage, 100% identity). Separately, 480 bp sequence was produced in duplicate from the adult male worm (LT962657), with greatest similarity to *Varestrongylus sagittatus* (KJ439592.1; 100% coverage, 100% identity). Comparison with published *V. sagittatus* ITS-2 sequences KJ439592--4 and KJ439596--7, revealed 15 copies of the degenerate TCG/CCG triplet repeat, which may provide future value as a genetic marker. Discussion {#Sec9} ========== The protostrongylid nematode *Varestrongylus capreoli* is a recognised cause of lung lesions in roe deer in Europe \[[@CR12]--[@CR15]\]. However, prior to the present study it does not appear to have been recorded in roe deer in the British Isles. A histopathological study of roe deer lungs in Scotland described infection with an unidentified protostrongylid nematode but as examination was confined to histopathology no description of the parasite other than the appearance of the eggs and larvae was provided \[[@CR16]\]. The paper does not include a description of the gross pathology of the lungs so it is not apparent whether or not there were nodular lesions similar to those seen in the present study. However, the histopathological findings closely resembled those seen in the present Cornish cases with larvae and eggs filling alveolar lumena accompanied by eosinophils, giant cells, alveolar macrophages and some neutrophils, supporting association of the inflammatory response observed with the parasite infection. As in the present study, severe muscular hypertrophy of the smaller bronchiolar walls was a prominent feature \[[@CR16]\]. A notable feature in both studies is the absence of adult nematodes in the histological sections. However, adults have been recorded in both alveoli and bronchioles of roe deer elsewhere in Europe \[[@CR14]\]. A possible explanation for their absence in some instances is that they may survive for only a short while after egg laying and are phagocytosed. A similar situation exists with *Capillaria hepatica* infection where eggs often remain in the hepatic parenchyma after the adults have died and been resorbed (Simpson, unpublished data). However, adults of *V. sagittatus* remain viable for several years \[[@CR17]\] and it seems unlikely that *V. capreoli* would be markedly different from this closely related species. Both deer in the present study were killed in April and showed evidence of active infection with eggs and larvae in varying stages of development. The seasonality of infection for *V capreoli* does not appear to have been documented but *V. sagittatus* infection of maral deer (*Cervus elaphus maral*) peaks during winter and spring \[[@CR17]\]; this could possibly be in relation to a period when either the molluscs which act as intermediate hosts become most active or when ingestion of infective larvae is most common. It has been postulated that parasites could infect deer during feeding on dry grass and short shrubs covered by snow in which hibernating snails occur \[[@CR12], [@CR14]\]. Also, the presence of immature forms in the lungs could represent a latent phase of infection \[[@CR12], [@CR14]\]. The gross appearance of the nodular lung lesions in the present study bore a superficial resemblance to lung lesions due to tuberculosis in roe deer in Spain and Italy \[[@CR7]\]. The lesions in those cases included foci in the pulmonary parenchyma that were occasionally calcified and surrounded by a thin layer of epithelioid and multinucleated giant cells. Although no such lesions were seen in the roe deer infected with *Varestrongylus sp.* it does illustrate the need to examine lung lesions in roe deer for evidence of infection by mycobacteria. Many conservationists may welcome the re-establishment of a former native species after it had become extinct or extremely rare. However, the recent recolonization of England by roe deer has been dramatic and shows no sign of reducing. This raises concern about an increased risk of disease transmission, such as tuberculosis, due to animals living at a higher population density \[[@CR7]\]. In addition there is growing concern that climate change is likely to influence the geographic distribution of diseases such as bluetongue and Lyme disease \[[@CR6]\]. There is a need to be aware of these factors from both a conservation viewpoint and also from a zoonotic perspective. Identification of protostrongylid larvae by morphological features is not generally possible. The first stage larvae of species of the subfamilies Muelleriinae, Elaphostrongylinae and Varestrongylinae all have a dorsal spine and they also have a similar tail appendix \[[@CR18]\]. However, the larvae of the various species have a recognised size range and this can assist in identification. In the present study the mean length of the larvae was 294.4 μm and this was within the recorded range of 285--341 μm for *Varestrongylus capreoli* \[[@CR17]\], although larvae for other *Varestrongylus* spp. fall within the same or similar ranges \[[@CR15]\]. Identification was confirmed by sequencing of the ITS-2, which gave a 100% match to a published Norwegian *Varestrongylus* cf. *capreoli* sequence. The adult male protostrongylid recovered after blunt dissection of the lung was identified by DNA sequencing as *Varestrongylus sagittatus*. This is known to be a common lungworm of European red, maral and fallow (*Dama dama*) deer in Europe and Asia where it produces small nodules in the lungs, similar to those caused by *Muellerius capillaris* in sheep and goats \[[@CR19]\]. *Varestrongylus sagittatus*, described using the synonym *Bicaulus sagittatus*, has also been recorded in Britain where it was found in a roe deer buck shot in the New Forest \[[@CR20]\]. No morphological or other data was provided to confirm the identification. *Varestrongylus sagittatus* is one of a group of seven *Varestrongylus* species which are characterised by having spicules greater than 200 μm. However, although they measured 258.5 μm in the roe deer specimen in this study, this is significantly shorter than the range normally quoted for *V. sagittatus* (325--433.8 μm) \[[@CR15]\]. The total length of the nematode at around 5 mm is also much less than the accepted range for an adult male *V. sagittatus* (14.5--33.8 mm, as well as for a number of other species such as *V. alpenae* (13--15 mm), *V alces* (11.36--14.7 mm) and *V capricola* (15--18 mm) \[[@CR15]\]. A possible explanation for the small size of *V. sagittatus* in this study is that this is typically a parasite of red or fallow deer, not roe deer, and its development may have been restricted in an atypical host. Conclusions {#Sec10} =========== Verminous pneumonia due to infection with *Dictyocaulus* sp. is considered to be an important cause of mortality in roe deer in Britain \[[@CR2], [@CR21]\] and in some areas has been considered to act as the main factor controlling populations \[[@CR21]\]. This study has shown that *Varestrongylus capreoli* also has the capability to cause significant lung pathology in roe deer. There is clearly a need to consider the possible involvement of this parasite when investigating lung disease in roe deer, especially as mixed infections with the more obvious *Dictyocaulus* parasite may occur resulting in under diagnosis of *V. capreoli*. The authors wish to thank Adrian Cross and Jeremy Preston for submitting the specimens and Abbey Veterinary Services for histopathological processing and advice. They also express their thanks to Professor Mark Fox from the Royal Veterinary College and Dr. Mark Dagleish from Moredun Research Institute for helpful discussion. Funding {#FPar1} ======= The study was funded by the Wildlife Veterinary Investigation Centre and the Royal Veterinary College. No external sources of funding were available. This manuscript has been assigned the reference PPS_01724 by the Royal Veterinary College. The funding bodies played no role in the design of the study, the collection, analysis and interpretation of data, or in writing the manuscript. Availability of data and materials {#FPar2} ================================== The sequences generated in this work are publically available from the European Nucleotide Archive under the accession numbers LT962657--8. VS performed the gross and histopathological examinations, coordinated the study and drafted the preliminary manuscript. DB carried out the molecular genetic studies. Both authors contributed to writing the draft manuscript and read and approved the final manuscript. Ethics approval {#FPar3} =============== The animals in this study were legally culled by licenced hunters following the Code of Practice, recommendations and ethics of the British Association for Shooting and Conservation for the purpose of population control. Samples were submitted and processed for the purpose of food safety and this report prepared after receiving approval from the Ethical Review Committee of the Royal Veterinary College under the reference SR2018--1617. Consent for publication {#FPar4} ======================= Not applicable. Competing interests {#FPar5} =================== The authors declare that they have no competing interests. Publisher's Note {#FPar6} ================ Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

minipile

NaturalLanguage

mit

Q: Simplify process with linq query This is my Table: PupilNutrition Id PupilId NutritionId 1 10 100 2 10 101 My another table Nutrition: Id Nutritioncategory BatchId NutritionRate NutritionId Operation 1 A 1 9000 100 1 2 B 1 5000 100 0 3 C 1 5000 100 1 4 D 2 6000 101 2 5 E 2 7000 101 2 6 F 2 8000 101 0 This is one field to store final Rate: decimal Rate= 0; Case 1: Operation field with Value 0 and Batch Id 1 Rate= Rate + NutritionRate(i.e 5000 because for batch id 1 with condition 0 only 1 record is there). Case 2:Now for operation field with Value 1 and Batch Id 1 Here i want to sum up both the value i.e(10000 and 5000) but during addition if sum of both is greater than 10000 then just take 10000 else take sum like this: if(9000 + 5000 > 10000) Rate= 10000 else Rate=Rate + (Addition of both if less than 10000). Case 3:Now for operation field with Value 0 and Batch Id 2 Rate= Rate + NutritionRate(i.e 8000 because for batch id 1 with condition 0 only 1 record is there). Case 4:Now for operation field with Value 2 and Batch Id 2 Here I will select Maximum value from Nutrition Rate field if there are 2 records: Rate=Rate - (Maximum value from 6000 and 7000 so will take 7000). My Class file: public partial class PupilNutrition { public int Id { get; set; } public int PupilId { get; set; } public int NutritionId { get; set; } } public partial class Nutrition { public int Id { get; set; } public string Nutritioncategory { get; set; } public decimal NutritionRate { get; set; } public Nullable<int> NutritionId { get; set; } } This is how i have Done: batchId=1 or 2;// List<int> NutritionId = db.PupilNutrition.Where(x => PupilId == 10).Select(c => c.NutritionId).ToList(); //output 100,101 var data = db.Nutrition.Where(x => x.BatchId == batchId && NutritionId.Contains(x.NutritionId.Value)).ToList(); I have tried like this but its a labour process: var data1=data.where(t=>t.Operation==0); Rate= Rate + data1.Sum(p => p.NutritionRate); Similarly for Operation 1: var data2=data.where(t=>t.Operation==1); This is left because here i need to sum up 2 value if two records are there as shown in my above cases and if sum is greater than 10000 than select 10000 else select sum. Similarly for Operation 2: var data3=data.where(t=>t.Operation==2); Rate= Rate - data3.Max(p => p.NutritionRate); I think i have done a labour process as this can be done even in better way with linq query only i guess. So can anybody help me to simplify this whole process in linq query or even some better way and provide solution for Operation Value 2 which is left? A: Shortest is not always the best. Personally, I think that single complex LINQ statement can be hard to read and hard to debug. Here is what I would do: public decimal CalculateRate(int pupilId, int batchId) { return db.Nutrition .Where(x => x.BatchId == batchId && db.PupilNutrition.Any(y => y.PupilId == pupilId && y.NutritionId == x.NutritionId)) .GroupBy(x => x.Operation) .Select(CalculateRateForOperationGroup) .Sum(); } public decimal CalculateRateForOperationGroup(IGrouping<int, Nutrition> group) { switch (group.Key) { case 0: // Rate = Sum(x) return group.Sum(x => x.NutritionRate); case 1: // Rate = Min(10000, Sum(x)) return Math.Min(10000, group.Sum(x => x.NutritionRate)); case 2: // Rate = -Max(x) return -group.Max(x => x.NutritionRate); default: throw new ArgumentException("operation"); } } Then you could use it as follows: var rateForFirstBatch = CalculateRate(10, 1); var rateForSecondBatch = CalculateRate(10, 2); A: Easier with a group by: int sumMax = 10000; var group = from n in nutrition group n by new { n.Operation, n.BatchId } into g select new { BatchId = g.Key.BatchId, Operation = g.Key.Operation, RateSum = g.ToList().Sum(nn => nn.NutritionRate), RateSumMax = g.ToList().Sum(nn => nn.NutritionRate) > sumMax ? sumMax : g.ToList().Sum(nn => nn.NutritionRate), RateMax = g.ToList().Max(nn => nn.NutritionRate) }; var result = from g in group select new { BatchId = g.BatchId, Operation = g.Operation, Rate = g.Operation == 1 ? g.RateSumMax : g.Operation == 2 ? g.RateMax : g.RateSum //default is operation 0 }; var totalRate = result.Sum(g=>g.Rate); A: Update This query looks like it should get the job done for you. Note, I haven't tested it, so there may be a syntax error or two, but the idea seems sound. var rate = db.Nutrition .GroupBy(n => new { n.BatchId, n.Operation }) .Select(g => g.Sum(n => n.NutritionRate) > 10000 ? 10000 : g.Sum(n => n.NutritionRate)) .Sum(); Or, if you want queries for each 'case': rate = db.Nutrition .Where(n => n.BatchId == 1 && n.Operation == 0) .Sum(n => n.NutritionRate); //Case 1 rate += Math.Min( 10000, //Either return 10,000, or the calculation if it's less than 10,000 db.Nutrition .Where(n => n.BatchId == 1 && n.Operation == 1) //filter based on batch and operation .Sum(n => n.NutritionRate) //take the sum of the nutrition rates for that filter ); //Case 2 rate += db.Nutrition .Where(n => n.BatchId == 2 && n.Operation == 0) .Sum(n => n.NutritionRate); //Case 3 rate += Math.Min( 10000, //Either return 10,000, or the calculation if it's less than 10,000 db.Nutrition .Where(n => n.BatchId == 2 && n.Operation == 2) //filter based on batch and operation .Sum(n => n.NutritionRate) //take the sum of the nutrition rates for that filter ); //Case 4

minipile

NaturalLanguage

mit

Don't Be Too Quick to Blame It All on Marx December 28, 1989 Regarding the editorial ``Marx Flunks Out,'' Dec. 4: I find somewhat parochial and simplistic the continual hubris that socialism (communism, Marxist-Leninism, fill in the blank) has proven an irrelevant failure and is headed toward the ``trash-bin of history.'' This position conveniently ignores that: (1) Marx's theory and philosophy were based on conditions present at the turn of the century, and history cannot be condemned simply because it appears less applicable in 1990; (2) The benefits of socialism cannot be rejected just because totalitarian governments which called themselves socialist are dissolving - in fact, Czechoslovakia and other East European countries appear likely to include strong and popular ``democratic socialist'' parties; (3) Most economic/political systems, including our own, encompass both capitalist (privatelyowned for individual profit) and socialist (publicly owned and/or funded) components - highway systems, welfare/medicare, national forests, the defense industry; and, (4) We'd be the snake oil salesman calling the bandit crooked if we pretend the ``free market'' is the sole guarantor of freedom, decency, and social harmony. Let's go beyond nationalistic economic partisanship with our own perestroika by incorporating what is productive and fair in all models for organizing society. A world order based on scientific knowledge, humanitarian principles, and international law isn't such a bad idea. Tom Dudley Tempe, Ariz. Is it because of Marxism that millions of people are starving or living in abject poverty in Asia, Central and South America, and Africa? Is it because of Marxism that the greenhouse effect is literally wrecking the planet, or private corporations are getting away with mass murder by lethally polluting and damaging our biosphere? Is it because of Marxism that people sleep on grates in the dark shadows of the White House while a president's personal friends feast on the billions poured out from HUD? Is it because of Marxism that millions are injecting dangerous drugs into their bodies to escape the utter futility of living a life based on money and power? There are the questions we should ask before setting ourselves up as the model for all to follow. Roger Lafontaine Williams, Calif. Fighting Tyranny at the Ballot Box In his column ``Vote for Democracy, Not Incumbency,'' Rushworth Kidder writes: ``First there is the damaging effect of extended incumbency. Carried to its extreme, it breeds tyranny.'' The fundamental rule governing elections is ``let the best man win.'' If the incumbent is that man, and is barred from re-election by such a law, the results may also be tyrannical. Tyranny really results from the destruction of our Bill of Rights. This destruction is now taking place because the public isn't interested in choosing the best man, incumbent or otherwise. We need more discussion of our Bill of Rights. Such emphasis is the best defense against tyranny from entrenched power, or tyranny from newly elected officials. Louis R. Henry Watertown, Mass.

minipile

NaturalLanguage

mit

Providing Insights that Contribute to Better Health Policy Advanced Search Instructions Use an to perform a wildcard search.Example: prescript* would return "prescription", "prescriptions" etc. "" Use quotes to match a phrase.Example: "prescription drug" only returns results where the words are next to each other. + Use a plus sign to perform a search where the additional term MUST be part of the page.Example: prescription +drug - Use a minus sign to perform a search where the additional term SHOULD NOT be part of the page.Example: prescription -drug < > Use a < > sign to perform a search where the additional term should be of greater or lesser importance in the search.Example: prescription >drugFind pages with the word precription with additional importance for the word drug. ( ) Use parentheses to group different search terms together.Example: prescription (+medicare -drug) Health Care Safety Net As part of the California Health Care Almanac project, the California HealthCare Foundation (CHCF) funded HSC to conduct interviews in six California communities in 2011-12 to assess how the organization, financing and delivery of health care are changing, including preparations for health reform. In recent years, local public hospitals have stayed afloat financially without abandoning their mission to care for low-income people by expanding access to primary care, attracting privately insured patients and paying closer attention to collection of patient revenues, among other strategies, according to a qualitative study by the Center for Studying Health System Change (HSC). Safety net clinics, hospitals and other providers that care for uninsured and low-income people increasingly are seeking ways to coordinate services to increase access, improve quality and reduce costs, according to a study by HSC published in the August edition of Health Affairs. Majority of Medicaid ED Visits for Urgent or More Serious Symptoms July 2012 Contrary to conventional wisdom that Medicaid patients often use hospital emergency departments for routine care, the majority of ED visits by nonelderly Medicaid patients are for symptoms suggesting urgent or more serious medical problems, according to a national study by the Center for Studying Health System Change (HSC). A Long and Winding Road: Federally Qualified Health Centers, Community Variation and Prospects Under ReformNovember 2011 Tracing their roots to the civil rights movement and the 1960s’ War on Poverty, federally qualified health centers (FQHCs) have grown from fringe providers to mainstays of many local health care system safety nets, according to a study by the Center for Studying Health System Change (HSC). Despite the economic downturn’s severe fallout on Miami’s tourism, real estate and construction sectors, some hospitals are expanding beyond their traditional geographic markets to compete for privately insured patients, according to a Community Report HSC. Communities that formally build collaborative health care safety nets can offer lessons for national health reform by offering roadmaps on how to improve access, reduce the use of unnecessary emergency and inpatient care, and improve people’s health, according to a qualitative study by HSC published in the July edition of Health Affairs. Early Impacts of the Recession on Health Care Safety Net ProvidersJan. 27, 2010 While the recession increased demands on the health care safety net as Americans lost jobs and health insurance, the impact on safety net providers has been mixed and less severe—at least initially—than expected in some cases, according to a new HSC study of five communities—Cleveland; Greenville, S.C.; northern New Jersey; Phoenix; and Seattle. As suburban poverty increases, the availability of health care services for low-income and uninsured people in the suburbs has not kept pace, according to a new study by HSC of five communities—Boston, Cleveland, Indianapolis, Miami and Seattle.. Policymakers have focused primarily on increasing Medicaid reimbursement rates to increase physicians’ participation in Medicaid, although physicians often complain of payment delays and other administrative burdens associated with Medicaid. Linking state-level data on average reimbursement times to the 2004-05 Community Tracking Study Physician Survey, this study examines how Medicaid reimbursement time affects physicians’ willingness to accept Medicaid patients. Delays in reimbursement can offset the effects of high Medicaid fees, thereby lowering participation to levels that are closer to those in states with relatively low rates. Increasing these rates may be insufficient to increase physicians’ participation unless accompanied by reductions in administrative burden. As private physicians and hospitals shed unprofitable patients and services, safety net providers are balancing their mission to serve the needy with steps to attract higher-paying patients to shore up their margins. To maintain financial viability, some safety-net providers—the patchwork of hospitals, community health centers (CHCs) and free clinics that either have an explicit mission to serve low-income and uninsured patients or are widely recognized as playing that role in their communities—are trying to limit exposure to uncompensated care and adopting such private-sector strategies as renovating and expanding facilities and focusing on lucrative specialty care to attract higher-paying privately insured and Medicare patients. Community Efforts to Expand Dental Services for Low-Income PeopleJuly 2008 Recognizing the difficulties low-income people face in getting dental care, many communities are attempting to provide more dental services to vulnerable residents, according to a study released today by the Center for Studying Health System Change (HSC). Lack of dental care is the key contributor to oral health problems, with low-income people and some racial and ethnic minorities receiving fewer dental services than higher-income people and whites, according to the Agency for Healthcare Research and Quality. Poor oral health may contribute to other health problems, including heart and lung disease, stroke, and premature births. Abscessed teeth can cause severe infections and even death. Faced with more patients seeking care for non-emergencies, safety net hospital emergency departments are working to redirect patients to outpatient clinics, community health centers and private physicians, with varied results. Low-income, uninsured and Medicaid patients often turn to emergency departments (EDs) for care because they lack timely access to care in other settings, according to the study. The growing reluctance of physicians and dentists to serve Medicaid and uninsured patients, along with shortages of primary care physicians and certain specialists, such as psychiatrists, in some communities make obtaining clinic or physician appointments increasingly difficult. The sensitivity of state budgets to economic cycles contributes to instability in public health insurance eligibility, benefits and provider payments, as well as support for safety net hospitals and community health centers. Despite significant federal funding increases, community health centers (CHCs)—the backbone of the nation's safety net—are struggling to meet rising demand for care, particularly for specialty medical, dental and mental health services. Since 2000, federal funding for federally qualified community health centers—key providers of preventive and primary care for underserved people—has doubled to nearly $2 billion annually in 2006, according to the Health Resources and Services Administration (HRSA). More than 16 million patients—primarily racial or ethnic minorities, low income, uninsured or covered by Medicaid—received care at more than 1,100 federally qualified and look-alike health centers in 2006, up from just more than 10 million patients in 2001, according to HRSA. A Widening Rift in Access and Quality: Growing Evidence of Economic DisparitiesDecember 2005 As health care gobbles up an ever-larger share of the U.S. economy, the inability or unwillingness to ensure equal access to high-quality health care is fueling a widening rift between rich and poor Americans.

minipile

NaturalLanguage

mit

Féry Infrared Spectrometer for Single-Shot Analysis of Protein Dynamics. Current submillisecond time-resolved broad-band infrared spectroscopy, one of the most frequently used techniques for studying structure-function relationships in life sciences, is typically limited to fast-cycling reactions that can be repeated thousands of times with high frequency. Notably, a majority of chemical and biological processes do not comply with this requirement. For example, the activation of vertebrate rhodopsin, a prototype of many protein receptors in biological organisms that mediate basic functions of life, including vision, smell, and taste, is irreversible. Here we present a dispersive single-shot Féry spectrometer setup that extends such spectroscopy to irreversible and slow-cycling systems by exploiting the unique properties of brilliant synchrotron infrared light combined with an advanced focal plane detector array embedded in a dispersive optical concept. We demonstrate our single-shot method on microbial actinorhodopsin with a slow photocycle and on vertebrate rhodopsin with irreversible activation.

minipile

NaturalLanguage

mit

Suffice to say I agree with their views on European games of back then, they were always a little bit off gameplay wise. Lots of focus on technicalities and how games look and sound, but not on perfecting game design. I would say it has to do with the demoscene ethos of always trying to push the hardware more, many times without any real reason but showing off. Games like Elfmania which look amazing but play like absolute garbage are a good example, and unfortunately there are many of them out there.

minipile

NaturalLanguage

mit

The use of the Internet or this form for communication with the firm or any individual member of the firm does not establish an attorney-client relationship. Confidential or time-sensitive information should not be sent through this form. Trucking Company Liability for a Driver's Negligence 80947 About The Author Steven J. Gordon Houston, TX Practice Areas: Trucking Accident Other Articles by the Author Driving acommercial truck is a considerable responsibility. While large truck accidentsaccounted for only 3% of all injury crashes in 2007, they were responsible for 8% of all accident-relatedfatalities. If you, or a loved one, have recently suffered a personalinjury or wrongful death as the result of a truck accident, it is important tocontact a truck accident attorney to determine if you have a case and if thetruck company is liable for your injuries. According toa common-law doctrine referred to as respondeatsuperior, the trucking company can be held liable in a truck accident ifthey neglected to enforce or follow federal trucking regulations. There are many types of trucking companynegligence that can lead to a life-altering truck accident. Truck Driver Schedules An importantregulation that trucking companies must follow pertains to the driver schedule.A trucking company cannot schedule a delivery that requires the driver totravel above the speed limit or go beyond his or her maximum driving time.Failure to adhere to this regulation shows liability in a truck accidentlawsuit. Truck drivers must keep detailed log books of the miles traveled andtime spent driving. If you are involvedin a truck accident, your personal injury lawyer can use these log books asevidence in your case. Truck Vehicle Maintenance Beforebeginning a delivery, both the truck driver and trucking company have aresponsibility to ensure that the truck is maintained properly and in goodworking order. The vehicle’s brakes, lights, tires, horn, windshield wipers,and other parts must be inspected and used when necessary. Truck Cargo In order toavoid liability in a truck accident, the driver and trucking company mustensure that the vehicle’s cargo is secured and the weight is distributedproperly. Unsecured cargo may roll offthe truck and cause an accident for vehicles traveling beside or behind thetruck. Prior to departure, the truck driver should make sure the cargo doesnot obscure his or her view or interfere with the truck’s movement. Truck Driver Employment Truckingcompanies also have a responsibility to hire safe and qualified truck drivers.The company must ensure that the truck driver’s commercial license has not beenrevoked, suspended, or canceled. The driver must complete all specializedtraining needed to drive a commercial vehicle and may also be subject toalcohol and drug screenings. After a Trucking Accident After a trucking accident, it is important to hire an experienced truck accident attorney as soon as the possible. A skilled personal injury attorney can review the facts of your case to determine the company’s liability in a truck accident and defend your best interests in court. If you, or a loved one, have sustained serious injuries in a truck accident ontact one of our experienced truck accident lawyers at Gordon Elias & Seely, L.L.P. to discuss your options. The content of this article is provided for informational purposes only, and does not constitute legal advice. If you need help with a Truck Accident claims, consult an experienced trucking accident attoney from the law offices of Gordon Elias & Seely, L.L.P. by calling TOLL FREE: 800 - 773 - 6770 OR by filling out the Free Case Evaluation Form on this page. The content of this website is provided for informational purposes only, and does not constitute legal advice. If you need help with a Truck Accident claim, consult an experienced trucking accident attorney from the law offices of Gordon Elias & Seely, L.L.P. by calling TOLL FREE: 800 - 773 - 6770 OR by filling out the Free Case Evaluation Form on this page.

minipile

NaturalLanguage

mit

Passengers arrive at LAX from Shanghai, China, after a positive case of the coronavirus was announced in the Orange County suburb of Los Angeles, California, January 26, 2020. Ringo Chiu | Reuters Human trials testing a potential vaccine for the COVID-19 coronavirus are expected to begin in six weeks, U.S. health officials announced Tuesday. "We are on time at least and maybe even a little bit better," Dr. Anthony Fauci, director of the National Institute of Allergy and Infectious Diseases, an agency within the Department of Health and Human Services, told reporters at a press conference. "Hopefully, no further glitches." The White House reportedly asked Congress on Monday for $1.25 billion in additional funding to bolster its coronavirus response, including money to develop a vaccine and therapeutics to treat the virus. The National Institutes of Health has been working with biotech company Moderna to develop a vaccine using the current strain of the coronavirus. Hopes to get a vaccine to market are high, but doctors want expectations to be low for how quickly it can happen. Developing, testing and reviewing any potential vaccine is a long, complex and expensive endeavor that could take months or even years, global health experts say. Before researchers can begin human trials, they must have a firm understanding of the pathogen, run safety tests and find enough human volunteers. U.S. health officials are fast-tracking work on a coronavirus vaccine. Fauci said Tuesday that the potential vaccine has so far been put into mice and is "immunogenic," or triggers a response in the immune system, suggesting it could fight the virus. "The gene has been expressed in the platform, in this case, a messenger RNA. The material has been produced, it's been put into mice. It's immunogenic," he said. "It's now getting ready to go through the regulatory issues of getting it to go." Fauci said a vaccine may not solve "problems in the next couple of months but it certainly would be an important tool that we would have." He said it's possible the virus will prove to be seasonal, thus likely to subside in the warmer months like the flu. There are currently no proven therapies for the latest outbreak, which has killed at least 2,704 and sickened more than 80,200 people worldwide since emerging from the Chinese city of Wuhan about two months ago. Local authorities in China have using Gilead Sciences' antiviral drug Remdesivir, which was tested as a possible treatment during the Ebola outbreak, U.S. health officials said last month. Some authorities are also using antiviral drug Kaletra, developed by drugmaker AbbVie, on a "compassionate basis."

minipile

NaturalLanguage

mit

snit::type a_pe_grammar { constructor {} { install myg using pt::peg::container ${selfns}::G $myg start {n Grammar} $myg add ALNUM ALPHA AND APOSTROPH ASCII Attribute Char CharOctalFull CharOctalPart CharSpecial CharUnescaped CharUnicode Class CLOSE CLOSEB COLON COMMENT CONTROL DAPOSTROPH DDIGIT Definition DIGIT DOT EOF EOL Expression Final Grammar GRAPH Header Ident Identifier IS LEAF Literal LOWER NOT OPEN OPENB PEG PLUS Prefix Primary PRINTABLE PUNCT QUESTION Range SEMICOLON Sequence SLASH SPACE STAR StartExpr Suffix TO UPPER VOID WHITESPACE WORDCHAR XDIGIT $myg modes { ALNUM leaf ALPHA leaf AND leaf APOSTROPH void ASCII leaf Attribute value Char value CharOctalFull leaf CharOctalPart leaf CharSpecial leaf CharUnescaped leaf CharUnicode leaf Class value CLOSE void CLOSEB void COLON void COMMENT void CONTROL leaf DAPOSTROPH void DDIGIT leaf Definition value DIGIT leaf DOT leaf EOF void EOL void Expression value Final void Grammar value GRAPH leaf Header value Ident leaf Identifier value IS void LEAF leaf Literal value LOWER leaf NOT leaf OPEN void OPENB void PEG void PLUS leaf Prefix value Primary value PRINTABLE leaf PUNCT leaf QUESTION leaf Range value SEMICOLON void Sequence value SLASH void SPACE leaf STAR leaf StartExpr value Suffix value TO void UPPER leaf VOID leaf WHITESPACE void WORDCHAR leaf XDIGIT leaf } $myg rules { ALNUM {x {t <} {t a} {t l} {t n} {t u} {t m} {t >} {n WHITESPACE}} ALPHA {x {t <} {t a} {t l} {t p} {t h} {t a} {t >} {n WHITESPACE}} AND {x {t &} {n WHITESPACE}} APOSTROPH {t '} ASCII {x {t <} {t a} {t s} {t c} {t i} {t i} {t >} {n WHITESPACE}} Attribute {x {/ {n VOID} {n LEAF}} {n COLON}} Char {/ {n CharSpecial} {n CharOctalFull} {n CharOctalPart} {n CharUnicode} {n CharUnescaped}} CharOctalFull {x {t \134} {.. 0 2} {.. 0 7} {.. 0 7}} CharOctalPart {x {t \134} {.. 0 7} {? {.. 0 7}}} CharSpecial {x {t \134} {/ {t n} {t r} {t t} {t '} {t \42} {t \133} {t \135} {t \134}}} CharUnescaped {x {! {t \134}} dot} CharUnicode {x {t \134} {t u} xdigit {? {x xdigit {? {x xdigit {? xdigit}}}}}} Class {x {n OPENB} {* {x {! {n CLOSEB}} {n Range}}} {n CLOSEB} {n WHITESPACE}} CLOSE {x {t \51} {n WHITESPACE}} CLOSEB {t \135} COLON {x {t :} {n WHITESPACE}} COMMENT {x {t #} {* {x {! {n EOL}} dot}} {n EOL}} CONTROL {x {t <} {t c} {t o} {t n} {t t} {t r} {t o} {t l} {t >} {n WHITESPACE}} DAPOSTROPH {t \42} DDIGIT {x {t <} {t d} {t d} {t i} {t g} {t i} {t t} {t >} {n WHITESPACE}} Definition {x {? {n Attribute}} {n Identifier} {n IS} {n Expression} {n SEMICOLON}} DIGIT {x {t <} {t d} {t i} {t g} {t i} {t t} {t >} {n WHITESPACE}} DOT {x {t .} {n WHITESPACE}} EOF {! dot} EOL {/ {t \n} {t \r}} Expression {x {n Sequence} {* {x {n SLASH} {n Sequence}}}} Final {x {t E} {t N} {t D} {n WHITESPACE} {n SEMICOLON} {n WHITESPACE}} Grammar {x {n WHITESPACE} {n Header} {* {n Definition}} {n Final} {n EOF}} GRAPH {x {t <} {t g} {t r} {t a} {t p} {t h} {t >} {n WHITESPACE}} Header {x {n PEG} {n Identifier} {n StartExpr}} Ident {x {/ {t _} {t :} alpha} {* {/ {t _} {t :} alnum}}} Identifier {x {n Ident} {n WHITESPACE}} IS {x {t <} {t -} {n WHITESPACE}} LEAF {x {t l} {t e} {t a} {t f} {n WHITESPACE}} Literal {/ {x {n APOSTROPH} {* {x {! {n APOSTROPH}} {n Char}}} {n APOSTROPH} {n WHITESPACE}} {x {n DAPOSTROPH} {* {x {! {n DAPOSTROPH}} {n Char}}} {n DAPOSTROPH} {n WHITESPACE}}} LOWER {x {t <} {t l} {t o} {t w} {t e} {t r} {t >} {n WHITESPACE}} NOT {x {t !} {n WHITESPACE}} OPEN {x {t \50} {n WHITESPACE}} OPENB {t \133} PEG {x {t P} {t E} {t G} {! {/ {t _} {t :} alnum}} {n WHITESPACE}} PLUS {x {t +} {n WHITESPACE}} Prefix {x {? {/ {n AND} {n NOT}}} {n Suffix}} Primary {/ {n ALNUM} {n ALPHA} {n ASCII} {n CONTROL} {n DDIGIT} {n DIGIT} {n GRAPH} {n LOWER} {n PRINTABLE} {n PUNCT} {n SPACE} {n UPPER} {n WORDCHAR} {n XDIGIT} {n Identifier} {x {n OPEN} {n Expression} {n CLOSE}} {n Literal} {n Class} {n DOT}} PRINTABLE {x {t <} {t p} {t r} {t i} {t n} {t t} {t >} {n WHITESPACE}} PUNCT {x {t <} {t p} {t u} {t n} {t c} {t t} {t >} {n WHITESPACE}} QUESTION {x {t ?} {n WHITESPACE}} Range {/ {x {n Char} {n TO} {n Char}} {n Char}} SEMICOLON {x {t \73} {n WHITESPACE}} Sequence {+ {n Prefix}} SLASH {x {t /} {n WHITESPACE}} SPACE {x {t <} {t s} {t p} {t a} {t c} {t e} {t >} {n WHITESPACE}} STAR {x {t *} {n WHITESPACE}} StartExpr {x {n OPEN} {n Expression} {n CLOSE}} Suffix {x {n Primary} {? {/ {n QUESTION} {n STAR} {n PLUS}}}} TO {t -} UPPER {x {t <} {t u} {t p} {t p} {t e} {t r} {t >} {n WHITESPACE}} VOID {x {t v} {t o} {t i} {t d} {n WHITESPACE}} WHITESPACE {* {/ space {n COMMENT}}} WORDCHAR {x {t <} {t w} {t o} {t r} {t d} {t c} {t h} {t a} {t r} {t >} {n WHITESPACE}} XDIGIT {x {t <} {t x} {t d} {t i} {t g} {t i} {t t} {t >} {n WHITESPACE}} } return } component myg delegate method * to myg }

minipile

NaturalLanguage

mit

Q: Alinear bitmap image a center Tengo el siguiente código para generar un bitmap en un ticket para una impresora térmica: String ticketPreSelectedImage = SharedPref.getInstance(this).getTicketPreSelectedImagePath(); if (ticketPreSelectedImage != null) { Bitmap image = BitmapFactory.decodeFile(ticketPreSelectedImage); ticketBuilder.addCommand(new byte[]{27, 97, 1, 0}); // Esta linea es la que creo que centra la imagen ticketBuilder.addImage(image, image.getWidth() * 1, image.getHeight() * 1); } Este código lo que hace es alinearme la imagen en el ticket a la izquierda y no se muy bien como centrarla para que quede bien, Un saludo. A: La línea que marcas lo que hace es enviar un código ESC/POS. Concretamente, se puede traducir a lo siguiente: ESC a 1 0 Revisando la lista de comandos ESC/POS, encontramos lo siguiente para ESC a: [Formato] ESC a n En el modo Standard, alinea todos los datos en una lines al layout seleccionado, usando n de la siguiente manera: n Justificado ----------------------------------- 0, 48 Justificado a la izquierda 1, 49 Centrado 2, 50 Justificado a la derecha Tomando eso en cuenta, tu código está enviando un 0 después del 1 que es lo que quieres (centrado). Así que deberías tener lo siguiente en tu código: ticketBuilder.addCommand(new byte[]{27, 97, 1}); //27=ESC 97=a 1=Centrado P.D. No se que librería estás usando para enviar los comandos, y es posible que necesite enviar un 0 para marcar el final del comando, pero añado mi respuesta ya que creo que la información sobre ESC/P y el comando que estás usando puede resultarte útil

minipile

NaturalLanguage

mit

MetLife Survey Shows Many Homeowner’s Unaware of Important Coverage Gaps Homeowner’s insurance coverage constitutes fundamental financial protection for many families because the family home is often their most valuable asset. While your homeowner’s policy can provide indispensable financial protections to cover certain types of property damage and perils, many policies have a wide range of expenses that you might be surprised to learn are not covered. As a Florida insurance claims attorney, my office frequently hears from policyholders who are shocked to learn that they will not be compensated for certain costs after disaster strikes. Unanticipated deductibles, earthquakes and floods may all cause unexpected expenses. A survey conducted by MetLife and published in an article by U.S. News and World Report reveals many homeowners are unaware of the gaps in their insurance coverage. The U.S News and World Report story provided a graphic example of the potential impact of these unanticipated costs. A couple purchased their dream home only to have the home destroyed by fire when a lamp overheated. Portions of the couple’s home were destroyed. While these losses would be stressful for most homeowners, the situation got much worse. The insurance company hired a contractor to repair the inside of the property. The contractor botched the job and caused a flood in the basement of the home. The moisture from the flood caused an infestation of black mold. The insurance company than offered less than the cost of repair to remediate the damage. The couple was distraught and could not sleep because of the overwhelming stress, which wore on them physically and mentally. This story is by no means unique, so we have provided answers to questions about common coverage gaps: If my home floods because my sump pump backs up will the damage be covered? While most people think that their standard homeowner’s policy covers this type of accident, this loss usually is not covered unless the homeowner purchases special insurance. Will my insurer rebuild my home if it is destroyed in a fire? While fire is a covered peril, there is a good chance you will receive less than you need to rebuild. Many policies cap coverage, so you might not have enough coverage to cover the entire cost to rebuild. Even if you do not have an issue with the policy limit, the insurance company typically will offer an amount that includes a deduction for depreciation. The survey by MetLife found that one in three homeowners did not know how much coverage they had for their home. Half of those who responded did not know how much coverage they had for personal property inside the home. If you are a homeowner, it is important to confirm you have sufficient coverage limits for your home and personal property, as well as any policy limits or other deductions that will be made that might impact your ability to rebuild. Will my claim be covered under a standard homeowner’s policy if building codes or other laws change, requiring me to rebuild undamaged portions of my home? Although the MetLife survey indicated that two-thirds of policyholders believed this would be covered, this is an incorrect assumption. Portions of your home that are not damaged by a covered peril will not generally be upgraded unless you have purchased separate ordinance or law coverage. Does a standard homeowner’s policy reimburse policyholders for earthquake damage? Although a third or all policyholders surveyed by MetLife thought their homeowner’s insurance did cover this risk, this type of damage will not be covered unless you purchase special earthquake coverage. Do you need to pay two deductibles for damage to your home and car if you have both insured through the same carrier? If your home and car are both damaged in a severe winds storm because a tree falls on part of your house and your car, for example, you might be required to pay a separate deductible for both your home and vehicle. However, some insurance companies waive the second deductible. The important takeaway from this blog post is that policyholders need to have a clear idea about potential gaps in their coverage before a catastrophe. In most cases, an insured can purchase supplemental coverage which allows a homeowner to customize coverage to fill appropriate coverage gaps. If you have suffered damage to your home that your insurance company refuses to cover, we may be able to help. My law firm represents policyholders in claims disputes in Miami and throughout Florida and we have obtain significant results for our clients. The Law Firm of J.P. Gonzalez-Sirgo, P.A. offers free consultations and case evaluations. No Recovery, No Lawyer Fees. Call 305-461-1095 or Toll Free 1-866-71-CLAIM. Contact Us Get Help Now The use of this Website or use of our "Contact Us" form for communication with the firm or any individual member of the firm does not establish an attorney-client relationship and does not constitute legal advice. Time-sensitive or personal confidential information should not be sent through the "Contact Us" form. You are not forming an official attorney-client relationship with the Law Firm of J.P. Gonzalez-Sirgo, P.A. or its attorneys unless and until you have signed a written retainer agreement with this law firm. Submission of the "Contact Us" form does not create a written retainer agreement. If you would like to enter into a written retainer agreement with the Law Firm J.P. Gonzalez-Sirgo, P.A., please call (305)-461-1095 or Toll Free at 1-(866)-71-CLAIM. The accounts of recent trials, verdicts, and settlements contained in this website are intended to illustrate the results of our work ethic and experience. Of course, each case is unique and the results in one case do not necessarily indicate the quality or value of any other case.

minipile

NaturalLanguage

mit

Digital subscriber lines (DSLs) are technologies designed to provide the means for communication over copper wires (twisted pairs, loop) of the existing plain old telephone service (POTS) infrastructure. Such an infrastructure typically includes a central office (CO) employing at least one distribution point (DP) that provides data services to a plurality end-users (i.e., also known as subscribers) that employ devices known as customer premises equipment (CPE) units. The architecture of hybrid communication networks such as very-high-bit-rate digital subscriber line (VDSL) or G.fast (fast access to subscriber terminals) combine the use of an optical fiber segment and a DSL (or G.fast) segment, where the latter stretches along typically the last couple hundred meters over the existing copper wire infrastructure toward the endpoint subscriber. In G.fast, communication equipment is located at the DP and is linked over the communication lines with typically a plurality of corresponding communication equipment (CPEs, e.g., modems) located at the customers' (subscribers') ends. For proper operation, the modem is generally operative, at least to some extent, to adapt its respective transmission parameters to varying communication line conditions. These transmission parameters have to be known at both ends, so that a receiver will be able to correctly decode received signals from a transmitter. In certain circumstances, however, such as in instances of elevated levels of electronic interference exhibited in the loop, there is a need to change the existing system configuration on-line without causing interruption to the data service; this is what is known as on-line reconfiguration (OLR). Various types of OLR are known, for example, bit swapping, seamless rate adaptation (SRA), transmitter initiated gain adjustment (TIGA), and the like. Other various methods and protocols for OLR are also known in the art. For example, U.S. Patent Application Publication No. U.S. 2006/0176942 A1 to Oksman et al., entitled “On-Line Reconfiguration and Synchronization Protocol for Multi-Carrier DSL” is directed at a communication system and method for providing an indication of a change in system configuration as a synchronization flag that is temporarily assigned to a plurality of data sub-channels to effectuate an on-line reconfiguration (OLR) of the communication system. The system employs provider and subscriber digital subscriber line (DSL) modems, which are connected via a communication channel and operative to transmit and receive communication signals. The method that is implemented by the system employs a fast OLR procedure that initially identifies free sub-channels that are not being used for data transmission based on a presently used bit loading table configuration. These plurality of free sub-channels are temporarily assigned to carry a synchronization flag, which in turn is transmitted over these sub-channels. The subscriber DSL modem receives and detects the synchronization flag and applies new parameters for subsequent incoming symbols. In order to prevent a possible situation where the synchronization flag is transmitted but not detected at subscriber DSL modem, the provider DSL modem delays the reconfiguration until the subscriber DSL modem sends back a synchronization flag acknowledgement over a sub-channel whereupon the reconfiguration occurs in a synchronized manner between provider DSL modem and subscriber DSL modem. PCT International Publication Number WO 2011/143101 A1 to Schelstraete et al. and entitled “Systems and Methods for Retransmission with On-Line Reconfiguration” is directed at a system and method for performing retransmission with on-line reconfiguration in DSL systems. The system disclosed, which includes a transmitter and receiver, is a single link retransmission system in which a retransmission method with on-line reconfiguration is implemented. According to this method, a data stream is initially encoded into first frames according to a framing configuration. The transmitter receives a request for an OLR of the framing configuration from the receiver. In response to the request, the encoding of the data stream into the first frames is suspended. The transmitter then enters a retransmission state in which the transmitter transmits one or more first frames transmitted to the receiver during a retransmission time period that commences relative to the suspension of the encoding of the data streams into the first frames. The transmitter then sends an acknowledgement of the OLR request to the receiver. The encoding of the data stream into second frames is resumed according to a modified framing configuration that is consistent with the OLR. The transmitter transmits the second frames to the receiver upon expiration of the retransmission time period. Reference is now made to FIG. 1, which is a schematic diagram showing an example of a prior art method, generally referenced 10, for enabling synchronization between a receiver and a transmitter via on-line reconfiguration. A horizontal position in FIG. 1 represents information pertaining either to a receiver 12, receiver OLR requests 14, a synchronization status 16, a transmitter 18, and a frame number 20. Frame number 20 identifies and enumerates a frame (frame i, frame i+1, etc.), which is a set of data symbols grouped together that is conveyed between a transmitter 18 and a receiver 12. A vertical position in FIG. 1 represents time in progressing frame units. Receiver 12 is communicatively coupled with transmitter 18, both of which require for synchronization of configuration therebetween. For this purpose, receiver 12 sends to transmitter 18 OLR requests 14, which in turn are to be implemented by transmitter 18. A synchronized state is when both receiver 12 and transmitter 18 employ an identical configuration, such as the same bit loading table (BLT). Synchronization status 16 represents the synchronization status between receiver 12 and transmitter 18. In an initial state shown in FIG. 1 at frame i, both receiver 12 and transmitter 18 employ the same bit-loading table configuration (i.e., termed “BLT0”) and hence they are synchronized. Suppose, in the upstream (US) direction, at frame i+1, receiver 12 sends an OLR request in the form of message 22 to transmitter 18 for a new configuration having a flat reduction by one bit from the previous configuration (i.e., BLT0). Transmitter 18 receives OLR message 22 and implements the new configuration (i.e., −1 bit) at frame i+4. Now suppose that due to increasing noise conditions receiver 12 sends a new OLR message 24 to transmitter 18 at frame i+5 for a new configuration having a flat reduction of six bits from the previous configuration to be implemented at frame i+7. In this case, however, suppose that that this message (i.e., OLR message 24) does not reach its intended destination (i.e., transmitter 18). At frame i+7 there is a loss of synchronization between receiver 12 and transmitter 18 since they do not employ the same configuration. Moreover, suppose that receiver 12 sends a new OLR message 26 to transmitter at frame i+8 for an additional flat reduction by two bits from the previous BLT and suppose further that this message is successfully received by transmitter 18. At frame i+10 receiver 12 implements the new configuration (i.e., having minus 9 bits), whereas transmitter implements a new configuration that is different (i.e., having minus 3 bits) thereby leading to a long-term loss of synchronization of between transmitter 18 and receiver 12. Since OLR requests are based on the assumption of successful reception and implementation of preceding (i.e., past, “historical”) OLR requests, given a case where transmitter 18 fails to receive one of the OLR messages (e.g., OLR message 24), subsequently received OLR messages (e.g., OLR message 26) accumulate errors resulting in a mismatch of configuration between receiver and transmitter, consequently leading to a loss of synchronization. Alternative prior art approaches may convey explicitly the absolute bit-loading table per carrier frequency. These approaches will generally be slower reacting (i.e., than the approach described in FIG. 1) as generally there is a need to convey larger amounts of information. These approaches require an acknowledgement based protocol, to make sure that both sides (e.g., transmitter and receiver) implement the newly communicated configuration at the same time.

minipile

NaturalLanguage

mit

Latest & Popular Videos Travancore Devaswom Board The Supreme Court on Monday questioned the tradition of prohibiting women of menstrual age group from entering the Sabarimala Temple in Kerala. The court termed it as unconstitutional. “The Constitution bars discrimination on the basis of sex. Such a prohibition (not to allow women devotees) is unconstitutional,” the bench of Justices Dipak Misra and N V Ramana said. The next hearing is scheduled for February 8. The bench was hearing a Public Interest Litigation (PIL), filed by the Young Lawyers Association of India 10 years ago, seeking entry for all women and girls in the Sabarimala Temple premises. Women between the age of 10 and 50 are traditionally banned from entering the ancient hilltop shrine, the argument being that the presiding deity, Lord Ayyappa is a bachelor. “...

minipile

NaturalLanguage

mit

Confederation Line builder Rideau Transit Group (RTG) will miss a fourth deadline to hand over Ottawa's light rail system. The LRT system will not be ready by June 30, city councillors on the finance and economic deveopment committee learned Tuesday morning. Unfortunately, the vehicles are not ready for prime time. - John Manconi, transportation GM There is no new date set. The Confederation Line was originally supposed to be ready by May 2018, and RTG had missed two subsequent handover dates. The problem remains the trains themselves, transportation general manager John Manconi told the committee. "Unfortunately, the vehicles are not ready for prime time," Manconi said during Tuesday's update. RTG and the city have agreed the 34 Alstom-built train vehicles need to be "virtually defect-free" and reliable, Manconi said, but the trains continue to experience problems with their doors and brake valves — problems that are time-consuming to retrofit. "We're not just sitting by and waiting for them," Manconi said, adding the city is bringing in high-priced experts to monitor the ongoing repairs. Mayor Jim Watson also called Alstom CEO and president Henri Poupart-Lafarge on Tuesday. "[I] let him know in no uncertain terms that we were fed up with his company's performance, and I'll send the same message to RTG," Watson said Tuesday. Watson said Poupart-Lafarge has agreed to come to Ottawa from France to meet with officials from RTG and the city. John Manconi, general manager of OC Transpo, says Rideau Transit Group will not be able to hand the LRT system over to the city by the end of June. 0:52 No new date Manconi told the committee he's told RTG he doesn't want the consortium to "give us a date just for the sake of giving us a date." Because June 30 was not a formal contractual deadline, the city will not be levying a million-dollar penalty on RTG, as it has twice in the past, Manconi explained. RTG has not received a payment from the city in months. The consortium tried to submit paperwork a month ago to hit the important milestone known as "substantial completion," which triggers a $59-million payment and allows it to launch a required 12-day trial run. Mayor Jim Watson says he's called a meeting with the heads of Rideau Transit Group and Alstom to discuss the delays and push for a solution. 0:40 'No grey zones' Both the city and an independent certifier disagreed with RTG's assessment that it was finished, however, and met with RTG and rail experts to discuss the outstanding issues in detail. Manconi confirmed Tuesday that the 12-day trial has not started. "There's no grey zones. There's a comprehensive list. They know what they need to do," Manconi said. Once the handover does happen, the city is supposed to deliver the final $202-million payment to RTG. Manconi has said people will be able to ride the train some four weeks after that happens. The city has been keeping track of the costs of the delays to keep extra buses on the road, for instance, and intends to deduct those from the final payment. RTG disagrees, and Watson has said in the past he could see the dispute eventually landing in court.

minipile

NaturalLanguage

mit

A garbage truck driver who ran over an emaciated homeless man sleeping in a Sydney laneway after mistaking him for a pile of blankets has been cleared of negligent driving causing death. Ian Juurik, 36, had denied the charge in Downing Centre Local Court after the incident on Bourke Lane in Redfern during the morning bin run on May 21 last year. Mathew Hayne, who was 1.58 metres tall and weighed 53 kilograms, had wrapped himself in a thin foam mattress on the street, which has 45-centimetre-wide sloping footpaths on each side. The 31-year-old, who was described by a responding paramedic as "very, very emaciated", suffered fractures from his left ribs to his right pelvis. He died at the scene.

minipile

NaturalLanguage

mit

Q: How to exit bash function if error? I am making a presubmit script. It looks like this: function presubmit() { gradle test android gradle test ios gradle test server git push origin master } I want the function to exit, if any of the tests fail so it won't push a bug to git. How? A: The way I do it is to add && \ after every command in the function (except the last one). function presubmit() { gradle test android && \ gradle test ios && \ gradle test server && \ git push origin master } A: 1. Use subshell ( .. ) with set -e; to make it more concise, you can do this: build() {( set -e # Fail early build_cmd_step_1 build_cmd_step_2 build_cmd_step_3 ... )} Then, the function will fail on the first failure and you can intercept the exit status: build exit_status=$? if [ ${exit_status} -ne 0 ]; then echo "We have error - build failed!" exit "${exit_status}" fi 2. Alternatively, the && \ chaining inside a function is also good (https://stackoverflow.com/a/51913013/1375784), though it might get bad if you have a bigger function. Both methods can be good, depending on your use case (in some cases using subshells may cause some unwanted side effects) A: You can do this: # declare a wrapper function for gradle gradle() { command gradle "$@" || exit 1 } presubmit() { gradle test android gradle test ios gradle test server git push origin master } declare -xf presubmit gradle Call the function in a subshell as: ( presubmit )

minipile

NaturalLanguage

mit

FEATURED | The Coming Struggle for the Spine of Latin America Abstract: This essay analyzes the multiple, simultaneous challenges and electoral processes currently affecting the situation and political-economic orientation of nations comprising the Pacific Rim, or spine, of Latin America. It examines the likely collapse of the trans-pacific partnership, the uncertain future of the Pacific Alliance, upcoming presidential elections in the next two years in Chile, Ecuador, Colombia, and Mexico, and another phenomenon, to conclude that the combination of these factors produces the possibility for significant change in the political and economic orientation of the region in the coming two years. It argues that such change, in combination with initiatives by the People's Republic of China toward the region, could impact the commercial regime that links Asia and the Western Hemisphere, and indirectly, the security of the United States and the Region. The article recommends that decision makers in the U.S. and the region give more attention to the transformative potential of these dynamics in the short to medium term, and work to preserve the neo-liberal, democratic, pro-US orientation of these countries that are key to the future of the region. Key Words: TRANS NAFTA, Pacific, China-Latin America Alliance Introduction: In March 2017, in the shadow of the withdrawal of the United States from the trans-Pacific Partnership (TPP) member countries of the agreement, along with the people's Republic of China (PRC) and South Korea, met in Santiago Chile to discuss the future of the trade regime which will dominate in the Pacific. In a manner similar to the strategic message presented by Chinese President Xi Jinping at the APEC Summit in November 2016, the intention of the PRC in Santiago towards the members of the TPP in Latin America was clear: take advantage of disorientation arising from the political change in the United States, to advance an alternative concept of trans-Pacific trade without the United States, and more advantageous to the PRC. The main fight of the twentieth century in Latin America was of a politico-military nature, defined by an axis across the Atlantic between the United States and the Soviet Union. On the other hand, the struggle that defines the region of the 21st century is more politico-economic in nature, defined by an axis across the Pacific, between the United States and the PRC. To understand the strategic framework of Latin America in the 21st century in this way, the most important aspect is not the size of the business, political, or military relationship with the PRC, versus the U.S., but rather the structure of the commercial interactions and associated political orientation that defines the relationship. It can be said that countries of the coast Pacific Latin America define geographical backbone of the continent, and with the importance of transpacific relations in the 21st century, it is also their economic and political backbone. At this time, the backbone of the region is in a process of uncertainty and transition, whose result will define the nature of the trade regime that prevails in the trans-Pacific and the political orientation of the continent. But, despite its historical importance, this moment of transition has received little attention by analysts and decision makers in the continent. A few years ago, although the economic relationship between the countries of the Pacific with the PRC remained many, its orientation towards trans-pacific trade was dominated by a clearly neo-liberal ideology, focusing on free markets with transparency, efficiency, and the importance of contracts and the rule of law above private arrangements between leaders. Such values were reflected in the "Alliance of the Pacific," which incorporated key countries of the “backbone”: Mexico, Colombia, Peru, and Chile, Costa Rica and Panama, as contenders. The neo-liberal consensus represented by the partnership was reinforced by the incorporation of three of its members in the equally neoliberal TPP. The latter contemplated to manage the Transpacific trade according to rules that ensured transparency, the sanctity of contracts, and intellectual property protection complemented a neoliberal model of trade between its members with similar principles for trade with Asia. In the course of the last year, the two motors of this neoliberal multilateral integration of the spine of the content, and of that spine with Asia, unexpectedly have stalled, even while the political future of almost all of the countries of the backbone are in doubt. With regard to the multilateral structure of the orientation of the Backbone in the region towards the Pacific in recent years, the Alliance of Pacific, at the time the most promising multilateral integration project in the region, has lost its momentum regarding the strengthening of its structures, to include the stagnation of progress in integrating Costa Rica and Panama as full members, and in recent summits, has focused more on developing relations with other blocs in the region, such as Mercosur, rather than deepening its own integration. In the same way, the withdrawal of the United States from the TPP not only has cast doubt on the future of that organization, but it also has deeply hurt the Alliance of the Pacific, although the death of the Alliance has not yet been announced. In addition to uncertainty about multilateralism that prevails in the backbone, never before all its countries have been subject to such radical political changes within such a short period. Starting in the South, Chile is in a crisis of middle-income development, made worse by low commodity prices, its main economic driver and principal export of its economy. Broad disenchantment with the poor performance of the second (and more left-leaning) Government of Michelle Bachelet, could contribute to the return of a regime more Center-right in the presidential election of November 2017, which, in turn, could help the region return to its path toward a more neoliberal business model with Asia. In Peru, the President Pedro Pablo Kuczynski, elected in June 2016, was educated in the United States, and has a disposition toward classic economic principles of the "Chicago School", yet in his first year, has had many domestic problems in his country, and with the loss of the TPP, has shown an initial orientation to move closer to the, the main economic partner of Peru, its largest mining investor, and the main engine of the economy. In Ecuador, where leftist President Rafael Correa has been an impediment to consolidating a "neo-liberal consensus" in the backbone countries, Correa’s handpicked successor, Lenin Moreno, is running neck-and-neck with opposition candidate Gustavo Larrea in the second round of a presidential race that that could determine the future of the country. In Colombia, President Juan Manuel Santos is currently in a critical stage for implementing a peace agreement with the armed forces revolutionaries of Colombia (FARC), with many possibilities that the fragile peace will disintegrate in a wave of crime and violence even worse than before, transforming Colombia from a model to a source of instability in the region, and impacting the results of presidential elections in May 2018. In Central America, five of the six countries in the region diplomatically recognize Taiwan, not the PRC, as China's legitimate Government. The collapse of the diplomatic truce that, from 2008, has prevented the PRC from accepting changes in the diplomatic positions of the countries that recognize Taiwan, could unleash a "diplomatic war" in the region. It would be a war that Taiwan would lose very quickly, setting in motion a transformation which, within a few months, could result in a region that recognizes the PRC and is more open to accepting large projects with it, to include the delayed inter-oceanic Canal in Nicaragua. In Africa, the acceptance by the PRC in March 2016 of the diplomatic recognition of Gambia, and the diplomatic change by São Tomé and Príncipe in December 2016 indicates that the truce that has kept the diplomatic status quo in Central America and the Caribbean since 2008 may be breaking down. In Mexico, the country that since signing the North American Free Trade Agreement (NAFTA) has been increasingly more economically integrated with the United States (as well as in security cooperation), is now besieged on three sides. On the one hand, protectionism by the new government in the United States, and its possible withdraw from the NAFTA, puts the country's economic future in question. On the other hand, the possible collapse of the TPP (in which Mexico is a partner), and the (unrecognized) stagnation of the Pacific Alliance, requires Mexico to re-think its approach to interacting economically with Asia. On the third side, the rhetoric and policies of the Government of Donald Trump toward Mexico feed current populist politicians and anti-Americanism in the country, including the MORENA movement of Andres Manuel Lopez Obrador, the likely candidate in presidential elections of November 2018. If such challenges were nothing, Mexico also faces an increase in violence by groups of drug traffickers at the end of the presidential term of President Enrique Peña Nieto. On the one hand, the traditional cartels have fragmented, with 40 or more gangs and factions now collaborating and competing for power and illegal business in the country, making the strategic landscape of the much less predictable, particularly in states such as Guerrero or Mexico Stat. On the other hand, the Jalisco New Generation cartel, with aggressive leadership and good ties for the supply of precursor chemicals from Asia, is now cooperating with the remnants of organizations like Beltrán Leyva, Arellano Felix and Carillo Fuentes to attack the most wealthy cartel of Mexico, the Sinaloa organization, now weakened by the extradition of its boss, "El Chapo" Guzman, to the United States. The combination of such economic incentives, internal challenges, and political changes time - with the PRC Government, could push Mexico on a course that is less stable, less oriented toward the free market, more receptive to particularistic projects from China, and less willing to cooperate with the United States. on security issues. This combination, if it occurred, would create significant challenges on the southern border of the United States, which could force the country to rethink fundamentally, the projection of its power in other parts of the world. Possible changes, detailed in previous sections, can also be impacted by various other dynamics happening in the region outside the backbone countries. These include the destabilization of Venezuela, or the political crisis in Brazil, including cases associated with the Odebrecht bribery scandal. Also, the evolution of policy in the United States and the initiatives in the region by the PRC, China, India, and Iran, among other actors, it will have an impact on guiding the region’s dynamic, that cannot be dismissed. In its entirety, the sources of significant change both within in the multilateral institutions and individual countries of the region’s backbone mean that, in the next two years, the panorama of the region could fundamentally change, with a range of possibilities, from a region facing the West and the market to one much more leftist and more dependent on the PRC. In a reinforcing feedback cycle, the orientation of the backbone governments, through their position on the Pacific Ocean, will have an important role in the determination of the trade regime prevailing between Asia and the countries of Latin America. Such developments, in turn, will have an economic and political impact on the path of those countries. This brief analysis, at the very least, should give pause to those in the U.S. and the other countries of the region who are prematurely celebrating the erosion of the "pink tide" of populist socialism in the region. This analysis emphasizes that the real situation is fragile, and could produce a very different regional panorama within two years. For the United States and the region, the extent of possible change in the backbone of Latin America in the short and medium term serves as a wake-up call, to closely follow from a holistic perspective, the electoral processes and other challenges faced by those countries in the coming years. It is a vital national interest for the United States and the region, that the countries of the backbone of Latin America remain neoliberal and democratic, with a friendly orientation towards the United States. It is an interest of all of the countries in Latin America, and also in Asia, that the commercial regime prevailing across the Pacific includes the U.S., and is framed by the principles of transparency, free trade, respect for law and property. There is no region of the world in which conditions more directly impact the prosperity and security of the United States than the Western hemisphere. If the United States allows the collapse of neoliberalism in the countries comprising the backbone of the Americas, there is no wall sufficiently high to protect the nation from the consequences. About the Author: Dr. R. Evan Ellis is research professor for Latin America and the Caribbean at the Strategic Studies Institute of the U.S. Army War College. The opinions expressed in this article are strictly his own. DISCLAIMER: Translated and adapted from the essay, “La Lucha por Venir para la Espinilla de America Latina” originally published in Spanish by the Strategic Studies Institute of the Mexican Navy (Instituto de Investigaciones Estratégicas de la Armada de México)

minipile

NaturalLanguage

mit

E. Tory Higgins “Conflict and control at different levels of self-regulation” Coauthor(s): Abigail Scholer. Editors: Ran Hassin, Kevin Ochsner and Yaacov Trope Abstract: Traditionally, self-control conflicts have been defined as conflicts between some immediate, short-term gratification versus some delayed, long-term gain. Although this is certainly a self-control issue, we argue that a focus on this definition of self-control has obscured the broader self-control issue: self-control is about resolving and managing conflict. In this chapter, we take a broad view of defining self-control within the self-regulatory system by considering how conflicts and control are represented within a self-regulatory hierarchy. Specifically, we suggest that self-control involves managing conflicts at multiple levels: managing conflicts between and within the levels of behaviors, tactics, strategies, and goals. In particular, we suggest that self-control conflicts can exist both between and within multiple levels in a hierarchy. Vertical conflicts occur between levels in a self-regulatory hierarchy (e.g., between higher-order and lower-order concerns, between goal orientations and strategies, between strategies and tactics). Horizontal conflicts occur within levels in a self-regulatory hierarchy (e.g., between goals, between strategies, between tactics, between behaviors). We review evidence that individuals exert self-control both horizontally and vertically at the goal and strategic levels of the self-regulatory hierarchy. We end by discussing the possibility that conflict representations are malleable. Representing the same conflict in different ways (e.g., vertically vs. horizontally) may have significant implications for interventions. Source:Self Control in Society, Mind, and Brain Exact Citation: Scholer, Abigail, and E. Tory Higgins. "Conflict and control at different levels of self-regulation." In Self Control in Society, Mind, and Brain, 312-335. Ed. Ran Hassin, Kevin Ochsner and Yaacov Trope. New York: Oxford University Press, March 2010.

minipile

NaturalLanguage

mit

Novel peptide toxins from acrorhagi, aggressive organs of the sea anemone Actinia equina. Two peptide toxins, acrorhagin I (50 residues) and II (44 residues), were isolated from special aggressive organs (acrorhagi) of the sea anemone Actinia equina by gel filtration on Sephadex G-50 and reverse-phase HPLC on TSKgel ODS-120T. The LD50 against crabs of acrorhagin I and II were estimated to be 520 and 80 microg/kg, respectively. 3'- and 5'-RACE established the amino acid sequences of the acrorhagin precursors. The precursor of acrorhagin I is composed of both signal and mature peptides and that of acrorhagin II has an additional sequence (propart) between signal and mature peptides. Acrorhagin I has no sequence homologies with any toxins, while acrorhagin II is somewhat similar to spider neurotoxins (hainantoxin-I from Selenocosmia hainana and Tx 3-2 from Phoneutria nigriventer) and cone snail neurotoxin (omega-conotoxin MVIIB from Conus magus). In addition, analogous peptides (acrorhagin Ia and IIa) were also cloned during RT-PCR experiments performed to confirm the nucleotide sequences of acrorhagins. This is the first to demonstrate the existence of novel peptide toxins in the sea anemone acrorhagi.

minipile

NaturalLanguage

mit

The infamous Anthony Scaramucci, irrepressible Trump backer turned top White House adviser, hails from Wall Street, where his fund of funds business was a vehicle for schmoozing with the world’s most rich and powerful. Wall Street, of course, is filled with egos as big as the paychecks, where dick-measuring is as much a part of the culture as having an unhealthy attachment to one’s Bloomberg terminal. So it’s not that Scaramucci, a.k.a. “the Mooch,” isn’t used to self-importance. It’s just that when it’s coming from the relative indigents of the political world, it strikes him as totally pathetic. The “thing I have learned about these people in Washington,” Scaramucci told New York’s Jessica Pressler, “is they have no money. So what happens when they have no fucking money is they write about what seat they are in and what the title is. Fucking congressmen act like that. They are fucking jackasses.” Scaramucci has a plan for winning over the pitiful wretches, however. “Do you know how many congressional liaisons we are going to have? I don’t either, but I told Pence it should be four times whatever Obama had,” he continued. “I don’t know how many he had, but I’m telling you that didn’t work out. I’m telling you if you want to decrease the government, you gotta increase it in certain ways.” Then he looked at Pressler and said, really, “How old are you? You look good. No lines on your face. What are you, a Sagittarius?” Trump plans to cut regulations, big league . . . As you might already know, Donald Trump hates regulation almost as much as he hates nuance and restraint. During his transition, he named corporate raider Carl Icahn a “special adviser” on regulatory matters and on Monday declared that he plans to slash regulations by 75 percent or “maybe more.” Naturally, the president did not elaborate on which rules he plans to cut, but presumably they’ll include the ones affecting Icahn’s investments. . . . and tax companies that go abroad Per The Wall Street Journal: “There will be no country that’s going to be faster, better, more fair,” Mr. Trump said. He promised incentives for businesses that produce and hire in the U.S. but warned the leaders, “if you go to another country . . . we are going to be imposing a very major border tax.” Don vs. China Citigroup has weighed in on the brewing cross-Pacific conflagration and predicts things are going to get pretty tense! Which is generally what happens when a U.S. president violates decades of diplomatic protocol so that he can take a congratulatory phone call from Taiwan and then, in the course of saying sorry, he’s not sorry, calls China “currency manipulators,” and threatens a trade war. Per Bloomberg:

minipile

NaturalLanguage

mit

Cockshoot In fowl hunting, a cockshoot, also called cockshut or cock-road, was a broad glade, an opening in a forest, through which woodcock might shoot. During the day, woodcocks remain out of sight, unless disturbed; but at night, they take flight in search of water. Flying generally low, they will follow along any openings in the woods. Hunters would place nets across the glade to catch any such birds. If such broad glades did not exist, hunters would cut roads through woods, thickets, groves, etc. They usually made these roads about 40 ft (12 m) wide, perfectly straight and clear; and to two opposite trees, they tied a net, which had a stone fastened to each corner. Then, having a place to lie hidden, at a proper distance, a stake was placed nearby, to which was fastened the lines of the net. When they perceived the game flying up the road, they unwound the lines from the stake; the stones would then pull down the netting, catching the birds. Various dictionaries erroneously applied the term cockshoot to the net itself, and claimed that the proper spelling was cockshut, believing that the word referred to something which shut in the birds. From this came the phrases cockshut time or light, referring to evening twilight, or nightfall, when woodcocks are likely to fly in the open. This alternate spelling is now more prevalent than the original, though usually occurring as in the previously-mentioned phrase, or as a surname, than as a reference to the original, obsolete hunting practice. Quotations See also Cockshutt (disambiguation) References Category:Bird hunting Category:Forests

minipile

NaturalLanguage

mit

Q: Anchor slow scroll fixed header I want to use a smooth scroll for the anchors on the page. Therefore I use the following code: <script> $(document).on('click', 'a', function(event){ event.preventDefault(); $('html, body').animate({ scrollTop: $( $.attr(this, 'href') ).offset().top }, 500); }); </script> The only problem is that I have a fixed header, with a height of 88px. So when clicking on the anchor, it currently scrolls to far. How can I extent my code so it will work correctly? A: If you know that your fixed header will always have a height of 88px, you can simply add that value to the final scroll position to make space for that :) $('html, body').animate({ scrollTop: $( $.attr(this, 'href') ).offset().top + 88 }, 500); If the fixed header height might change, you will want to check it's outerHeight and add that to the offset. Assuming that the fixed header's jQuery object is stored as $fixedHeader: $('html, body').animate({ scrollTop: $( $.attr(this, 'href') ).offset().top + $fixedHeader.outerHeight() }, 500);

minipile

NaturalLanguage

mit

To be a survivor in this amazing race with a need for speed you need godís grace and if you are more desperate than housewives watching jersey shore you can be sure that you canít cope without hope and thatís not on a soap like general hospital, it donít matter if your young and restless or living in Dallas cause as the world turns those that donít choose will burn and if your looking to oprah or dr Phil you will still be lost because it wasnít Raymond that paid the cost. You wont find the truth in the vampire diaries or grayís anatomy because Seinfeld didnít die for you and me. It was a supernatural season thatís the reason that god saved the gossip girl and the rest of the world. Thereís no bones about it you will get the la blues if you donít heed gods good news because it canít be found on cnn or espn and watching who wants to be a millionaire wonít get you there. It doesnít matter if you ask the audience because only he has a real life line No American idol or council tribe has a final answer that will satisfy. You canít get saved by the fall guy, or the six million dollar man, not wonder women, spider man or Tarzan can lead the way you wonít be saved by the bell and delivered from the fire of hell by following leno, or spinning the wheel of fortune, so why put your eternity in jeopardy, forget the family feud because the Bradyís, the beaver even Joan cleaver are no better than Denis the menace when it comes to saving your sins. But donít feel like the sopranos on Saturday night, because there is a way to save your friends and David letterman but the top chef canít cook it up in 60 minutes even with the help of bobby flay, emril, Sandra lee, Paula dean, or even tony bourdain mark summers cant show you how manna is made and even Mario batali doesnít have a recipe to get saved. Even an iron chef or Alton brown canít help you, if you donít choose the only one who ever fed thousands with five fishes and bread for one. You may love lucky but if you donít love Christ, then it will take more than a prison break and criminal minds to show you that the bang bang theory didnít make the third rock from the sun. Happy days are here to come if you choose the true blood of the one that truly traveled the star trek and came to earth to save you from your sins. It doesnít take Dr oz, house or squad 51 to mend your broken heart, all you have to do is place the remote control on the son, because own, nbc, cbs, hbo, and even TBN cant deliver you from your sins so turn off the TV and set your focus on him. If you died today, are you absolutely certain that you would go to heaven? You can be! TRUST JESUS NOW Read more articles by Alan Shulver or search for articles on the same topic or others. I did get saved on TV - in a program for Lent in 1994 titled "Christ is the Answer" by 700 Club Asia. The actor there shared the Gospel and the need for repentance and accepting Christ alone as Savior and LORD, the only Way to the Father.

minipile

NaturalLanguage

mit

Call of the wild John Howard reckons it wins elections, but others say we've been conned about the power of talkback. Sue Javes reports. When Haydn Sargent was asked to present a morning show on Brisbane's 4BC in the 1970s, he was leery of embracing talkback. Despite the growing popularity of early practitioners such as John Pearce, Ron Casey and John Laws, he told colleagues at the time: "Even in Sydney, it's only a matter of time before those programs run out of suckers willing to be insulted." How wrong he was. Nearly 40 years after the then federal government bowed to pressure and allowed radio stations to put callers live-to-air, the format is more popular and more influential than ever. At any time of the day or night, from the home, car or office, individuals take part in radio's gabfest to gripe, praise, commiserate, inquire or simply share their experiences with radio hosts and other listeners. Politicians love it because they can set the news agenda of the day, avoiding more probing questions from journalists, and be seen to be talking to the people at the same time. Where talkback was once considered largely the domain of housewives needing a distraction from their morning chores, it is now widely regarded as a litmus test of community feeling and a form of people power for the disenfranchised. Former prime minister Paul Keating famously said: "Forget the Canberra press gallery. If you educate John Laws, you educate the people." No other politician has used the medium more to his advantage than the incumbent, John Howard, who said: "Talkback radio has played a greater role in shaping the outcome of an election over the last few years than other sections of the media." The Australian's veteran political commentator, Paul Kelly, told readers to forget street rallies, town halls, trades hall and the pulpit. "Radio jocks are the new mobilisers and organisers of mass opinion." I had my own brief personal taste of talkback behind the scenes as a young researcher for the then undisputed king of talkback, John Laws, in 1980. I manned the switchboard on his first day back on 2UE after a decade at 2UW. The first call I took was a sobbing woman threatening to end her life. Laws's producer, a man named Stan Zemanek, didn't hesitate. "Get rid of her," he ordered, while I rang Lifeline on the quiet. They were looking for something more uplifting and there were always plenty of callers to choose from. There were floods of them and they'd wait patiently while Laws conducted the show like an orchestra, choosing his next guest from my brief description on a computer screen. If a listener was after information, Laws would be supplied with the answer before he took the call, creating a sense of infallibility. Politicians who had been lined up by the producer in advance were asked to introduce themselves on air, allowing themselves to play second fiddle to the radio host. Part of the job was to keep the callers on a string, sometimes for more than an hour, and when time ran out and the sign-off music played, those who were left would usually accept the apology meekly. If they were cheesed off, they never held Laws responsible. He was their friend. For his part, Laws wasn't indifferent to his callers, but the driving philosophy was that show business came first, and the callers were the fuel that kept the wheels turning. Not much has changed over the decades. When I sat in on the Ray Hadley morning show on 2GB recently, the only noticeable difference was the more sophisticated technology. The dynamics driving the callers were the same. John Brennan, who has produced or overseen more talkback than anyone else in Australian radio history, describes it as God's little equaliser. Anyone with a telephone, he says, can "share a moment with the prime minister, have a joke with Vince Sorrenti, or ask Nicole Kidman a question she's never been asked". With more than half a century of radio behind him, and now program director at 2GB, Brennan remains the guru of commercial talkback or, as he calls it, radio wrestling. "People don't call to chat, they call to agree or disagree. The presenter has to decide quickly whose side they're on. The hardest job for the host is to inspire a person to call in the first place. My benchmark for deciding which calls to put to air is if they make you frustrated, angry, happy or sad. They're the calls which bring more calls." So who are they, these people who keep the airwaves filled? Are they, as some media critics believe, mostly ignorant rednecks whose prejudices are easily exploited by the more extreme talkback hosts, or are they more representative of mainstream opinion? Surprisingly, little research has been done on either the callers or the listeners, but Queensland academic Professor Graeme Turner is a few months into a three-year research project on the issue. His interest was piqued by the cash-for-comment inquiry of 1999 and the realisation that talkback had largely replaced current affairs on commercial radio. The director of the Centre for Critical and Cultural studies at the University of Queensland, Turner wants to explore the social function of talkback, the relationship between host and caller and whether it really does reflect the opinions of the broader community. "Early indications suggest the traditional audience is mostly over 50, Australian-born, working class and right wing, but there has never been any formal research," he says. Turner believes talkback revolves around notions of community and membership. "Listeners feel they belong to some kind of society. They can gain access to that place, that social centre ... Callers have told me about the sense of empowerment they feel being able to make other people listen to them." Peter Maher, executive director of media monitor Rehame, says talkback callers can be divided into three categories. "There's the self-interested caller who rings up because he or she has been personally affected by a certain event. There's the issues caller who has very strong feelings about a particular subject, such as Tampa or the Bulldogs. The third is the opinion caller, who is not personally affected but has an opinion on everything from Iraq to Peter Hollingworth." Sydney's four talkback stations (2GB, 2UE, 2SM and the ABC) host dozens of programs of varying styles and passions almost 24 hours a day, with John Laws still prominent but no longer dominant. He and key rival Ray Hadley tend to run their talkback components over a predictable range of topics, with law and order a popular recurring theme. But they're mild compared with night-time commercial radio. 2UE's night-time stirrer, Stan Zemanek, has embraced Brennan's philosophy to the extreme. Zemanek says his show is the modern equivalent of the soap box in the Domain. People get up on the pedestal, have their say and the crowd either boos or cheers. He considers it a badge of honour that the Australian Broadcasting Authority receives more complaints about his show than any other. Hot night-time topics include immigration, welfare, single mothers and Aborigines, but Zemanek again says the issue that always guarantees the most calls is law and order and fears for personal safety. What Zemanek calls "terrific entertainment", the Director of Public Prosecutions, Nicholas Cowdery, calls "talkback terrorism". In a speech last year, Cowdery accused many talkback presenters of simplifying issues, often by omitting relevant material, especially if it was complicated, and erecting an adversarial framework of conflict. "If the promoter of one view can be portrayed as a baddie and the other as a goodie (or, even better, a victim) then so much the better," he said. "Conflict sells. People are prone to act emotionally, rather than intellectually, to their entertainment. They are usually not tempted to analyse the information they are given and to identify the gaps in fact or logic." ABC 702 has proved in recent years talkback does not have to be adversarial to be effective and popular. Richard Glover, Sydney's top-rating drivetime talk host, says the best talkback comes from people sharing their experiences rather than giving their opinions. "The methodology in commercial radio is to put out an issue that will get people upset and have them shouting at the radio," Glover says. "You end up with whinge wireless - a very one-note program which is quite boring because all the callers tend to have a similar point of view, similar tone, similar age and gender. The aim of good media is to leave people with an accurate sense of reality, full of light and shade, that contains the challenging things about life and the things to be joyous about. Our callers are encouraged to talk about their experiences and the result, I think, is a richer, more interesting program." Maher says it would be foolhardy for a politician to ignore the daily feedback coming from talk radio. "You're not going to get a better daily barometer of what is affecting, impacting or upsetting the daily constituency than what those talkback callers will give you ... If you compare the calls to what the polls are saying, they nearly run hand in hand." Social commentator and author Hugh Mackay could not disagree more strongly. He believes it's extremely dangerous for politicians to place too much credence on talkback. "They assume this is representative of society at large when it's not. It's not even representative of listeners of talkback. It's only representative of the small percentage of people who choose to call radio stations. Those people tend to be slightly more rabid, more conservative and generally more lonely than the community at large. Talkback can also be manipulated by the political parties, the religious right, by any special interest group that wants to stack the calls on a particular day." Mackay believes the talkback industry has the politicians conned. If 9 per cent of Sydney listens to John Laws, there's another 91 per cent who don't. Alan Jones might win the breakfast slot with a 13 per cent audience share but there's a huge 87 per cent not listening, and the people who call in are even more in the minority. Regardless, John Howard and Mark Latham will be spending a substantial part of their next few months trudging from one radio studio to another, feeding the beast that is talkback. A brief history of talkback In the early days of radio, in the 1920s, there were experiments with listeners phoning in questions, but the Postmaster-General's department quickly stepped in and declared it illegal. Radio historian Wayne Mac believes authorities were worried about the broadcast of undesirable language or libellous material because, at the time, there were no tape-delay systems. The arrival of television in the late '50s signalled the end of radio quiz shows and serials, and radio needed a new attraction. One of the forefathers of the format was former Pick-a-Box champion and later politician Barry Jones. He had a 90-minute show on Melbourne's 3DB in early 1967 called Talk Back to Barry Jones. To stay within the law, he would say his piece on air and then sprint down the corridor to the telephones while a record was playing. He'd then sprint back to the microphone to tell listeners what the callers had said. Talkback was finally introduced, with Parliament's blessing, on April 17, 1967. Radio veteran John Brennan was working at 2SM the day it was launched. "Mike Walsh was poised to launch the first legal phone-in program, starting at 9am on 2SM, but at the last minute 2UE announced Ormsby Wilkins would take a short burst of calls at midnight so he could say he was the first," Brennan says. "But you'd have to say Walsh was the first presenter to have his own talkback program." But, by the end of the '80s, commercial radio was in dire financial straits, largely as a result of the then federal government's exorbitant prices for FM licences. To ensure the viability of the industry, the government reduced the stations' obligation to employ journalists and provide news and current affairs. Almost overnight, commercial stations dropped their news-analysis programs, replacing them with talkback. Mobile-phone use has led to a huge increase in the volume and diversity of callers. Programmers say that in the '70s and '80s most calls originated from housewives, the unemployed or retirees. Mobile phones made talkback more accessible and strengthened the format by widening the "backyard" to include more men, a slightly younger demographic and more workers.

minipile

NaturalLanguage

mit

This is a blog detailing the creation/evolution/ID controversy and assorted palaeontological news. I will post news here with running commentary. Friday, July 10, 2009 Perry Leaning Toward Appointing Cynthia Dunbar Just when you thought it was safe to go back to Texas, Garry Scharrer, of the Houston Chronicle, reports that Texas governor Rick Perry is leaning toward selecting Cynthia Dunbar to replace the ousted Don McLeroy. This is not a step in the right direction. The story notes: Dunbar, whose district runs from outside Houston to Austin, said she expresses her views so constituents know exactly where she stands. “I believe constituents deserve to know our thoughts, which is why I have always been boldly transparent,” she said. But if she is chosen to chair the board, Dunbar said, she would “play a different role” by focusing on leadership. She is confident she could bring the various board factions together. “I would strive to be just, merciful and humble in my service,” Dunbar said of a potential promotion to board chair. Merciful? Just who would you need to be merciful to? The story largely focuses on Dunbar's religious attitudes, which are not portrayed in the most positive light. The problem that I and many other people who are TEs have is that there is much in her religious stance that I agree with. But, as with so many people who are in these positions, she doesn't know a bit about the biological sciences and doesn't seem to want to learn. It is somewhat puzzling, though, that Governor Perry would appoint as head of the SBOE someone who believes that the public schools are "tyrannical" and who homeschooled her children. I don't care much for public schools largely because the quality is usually poor (it is where we live) and we were convinced that we could give them a better education. On the other hand, I don't have the slightest inclination to run for the local school board, let alone the state one. My concern stems from her public stance against evolutionary theory. I have posted on the views of Ms. Dunbar, here, where she accepted the writings of creationist Jerry Bergman, who misrepresented the work of Nobel Prize winner Werner Arber so badly that Arber issued a public denunciation.

minipile

NaturalLanguage

mit

--- abstract: 'Heat capacities of Na$_{N}$, $N$ = 13, 20, 55, 135, 142, and 147, clusters have been investigated using a many-body Gupta potential and microcanonical molecular dynamics simulations. Negative heat capacities around the cluster melting-like transition have been obtained for $N$ = 135, 142, and 147, but the smaller clusters ($N$ = 13, 20, and 55) do not show this peculiarity. By performing a survey of the cluster potential energy landscape (PEL), it is found that the width of the distribution function of the kinetic energy and the spread of the distribution of potential energy minima (isomers), are useful features to determine the different behavior of the heat capacity as a function of the cluster size. The effect of the range of the interatomic forces is studied by comparing the heat capacities of the Na$_{55}$ and Cd$_{55}$ clusters. It is shown that by decreasing the range of the many-body interaction, the distribution of isomers characterizing the PEL is modified appropriately to generate a negative heat capacity in the Cd$_{55}$ cluster.' author: - 'Juan A. Reyes-Nava, Ignacio L. Garzón, and Karo Michaelian' title: '**Negative heat capacity of sodium clusters**' --- Introduction ============ Negative microcanonical heat capacity in atomic and molecular clusters was theoretically predicted by considering simple models of the distribution of local minima that characterize the potential energy landscape (PEL) of clusters [@Bixon]. In that study, it was found that for high values of the parameter involving the ratios of the vibrational frequencies corresponding to the global and local isomers, the caloric curve displays an S-shaped loop, with a negative heat capacity in the vicinity of the melting point [@Bixon]. In another study on the solid-liquid transition of clusters [@Labas], it was shown that in microcanonical simulations of Lennard-Jones clusters, an increase in total energy causes a temperature reduction. This effect was related to the broadening of the cluster kinetic-energy distribution toward lower energy values [@Labas]. Although the existence of negative heat capacity in physical systems like stars or star clusters [@Thirring; @Bell], and in fragmenting nuclei [@Gross; @Agostino] is well-known, this peculiar effect gained a lot of interest in the field of atomic and molecular clusters due to recent experimental results where a negative heat capacity was measured for a 147-atom sodium cluster [@Schmidt]. In this study, the photofragmentation mass spectra was used to measure the internal energy of free, mass selected clusters with known temperature. These measurements were used to determine the microcanonical caloric curve of the Na$^{+}$$_{147}$ that shows the characteristic S-shaped (backbending) feature, indicating a negative heat capacity [@Schmidt]. The negative value of the microcanonical heat capacity was interpreted by considering that a finite system upon melting tries to avoid partly molten states and prefers to convert some of its kinetic energy into potential energy [@Schmidt; @Schmidt1]. This peculiarity has been attributed to the non-additivity of the total energy of a cluster with finite size [@Schmidt; @Schmidt1]. Microcanonical heat capacities of metal clusters have been theoretically investigated using constant-energy molecular dynamics (MD) with many-body potentials [@Gallego; @Calvo; @Jell] and an orbital-free version of the first-principles MD method [@Agua1; @Agua2]. In these studies, heat capacities of fcc transition and noble metal clusters with up to 23 atoms were calculated to characterize their melting-like transition [@Gallego]. In another study, on the melting of sodium clusters [@Calvo], the microcanonical caloric curve of the Na$_{55}$ cluster was obtained. However, in not one of these studies was a signature of a negative heat capacity found. Similar results, indicating the non-existence of a negative heat capacity in constant-energy orbital-free first-principles MD simulations of larger sodium clusters (Na$_{55}$, Na$_{92}$, and Na$_{142}$), were obtained [@Agua2]. Nevertheless, in such calculations the simulation time employed was too short to obtain converged results [@Agua2]. On the other hand, in microcanonical MD simulations of Al$_{N}$, $N$ = 7, 13, 55, and 147, clusters, a negative heat capacity was obtained for the larger Al$_{147}$ cluster [@Jell]. In the present work, motivated by the availability of experimental techniques that allow the measurement of the microcanonical heat capacity and other thermal properties of mass selected metal clusters [@Haber1; @Haber2; @Haber3], we theoretically investigate the behavior of the heat capacity of sodium clusters in the size range of 13-147 atoms. In our approach, constant-energy MD simulations are performed using a phenomenological many-body potential that mimics the metallic bonding of sodium clusters. This approximation allows us to use simulation times of the order of $\sim$ 50 ns, in order to obtain converged averages of the microcanonical heat capacity and other cluster thermal properties. Our main objective is to gain additional insights into the conditions that determine if a cluster has a negative heat capacity. The main finding of this work shows that the width of the distribution function of the kinetic energy and the spread of the distribution of the potential energy minima (isomers), characterizing the PEL, are useful features to determine the signature of the cluster heat capacity. In section II, we provide the theoretical background on which this study is based. The results and their discussion are given in section III, and section IV contains a summary and the conclusions of this work. Theoretical background ====================== The heat capacity and temperature of sodium clusters as a function of the cluster total energy are calculated through constant-energy MD simulations using the microcanonical expressions derived in Refs. : $$\label{C} \frac{C}{Nk_{B}}= \left[ N-N(1-\frac{2}{3N-6}) \langle K \rangle \langle K^{-1} \rangle \right]^{-1}$$ $$\label{tem} T=\frac {2\langle K \rangle }{(3N-6)k_{B}},$$ where $K$ is the kinetic energy of the cluster, $k_{B}$ is the Boltzmann constant, and $\langle$...$\rangle$ denotes a time average. In these formulas, 3$N$ was changed to 3$N$-6, the number of degrees of freedom of the system, since the calculations are performed for a non-translating and non-rotating cluster in a three-dimensional space (the position of the center of mass was fixed and the total momentum was held to zero during the simulations). In our implementation of the constant-energy MD method, the Newton’s equations of motion are solved with the Verlet algorithm [@Verlet] using a time step of 2.4 fs, which provides total energy conservation within 0.001 $\%$. A typical calculation consists in heating up a cluster from its lowest-energy solid-like configuration until it transforms into a liquid-like cluster. To simulate this procedure the cluster total energy is increased in a step-like manner by scaling up the atomic velocities. For each initial condition the cluster was equilibrated during 10$^4$ time steps and the time averages of the physical quantities are calculated using 10$^7$ time steps. This averaging time is increased by a factor of 2 when the cluster is in the region of the solid-to-liquid transition in order to ensure the calculation of fully converged averages. To model the metallic bonding in sodium clusters we used the many-body Gupta potential [@Gupta], which is based on the second moment approximation of a tight-binding hamiltonian [@Cleri]. Its analytical expression is given by: $$\label{V} V = \sum_{i=1}^{N} V_i$$ $$V_i = A \sum_{j \ne i} e^{-p \left(\frac{r_{ij}}{r_0}-1 \right)} - \xi \left( \sum_{j \ne i} e^{-2q \left(\frac{r_{ij}}{r_0}-1 \right)} \right)^{\frac{1}{2}} \label{Gupta}$$ where $r_0$, $A$, $\xi$, $p$, and $q$ are adjustable parameters [@Cleri]. For sodium clusters these parameters have been fitted to band structure calculations [@Li]. Their values are: $A$=0.01595 eV, $\xi$=0.29113 eV, $r_0$=6.99 bohr, $p$=10.13, and $q$=1.30 [@Li]. This phenomelogical many-body potential has been used to study the melting-like transition in sodium clusters of different sizes using Monte Carlo (MC) [@Calvo] and constant-energy MD simulations [@Reyes]. A good qualitative agreement has been obtained between structural and thermal properties calculated using the Gupta potential [@Calvo; @Reyes] and those generated from first-principles methods [@Agua1; @Agua2]. An additional advantage in using this potential is that it allows simulation times of the order of 50 ns, necessary to obtain fully converged time averages in the melting-like transition region. Results and Discussion ====================== The microcanonical heat capacities of the Na$_N$, $N$ = 13, 20, 55, 135, 142, and 147, clusters, calculated using Eq. (1), are displayed in Fig. \[Fig1\]. For $N$ = 13, 20, and 55, they are continuous functions of the cluster total energy showing a maximum value that is characteristic of a melting-like transition [@Calvo; @Agua1; @Agua2; @Reyes]. On the other hand, the heat capacity of the larger clusters ($N$ = 135, 142, and 147) shows two discontinuity points and a continuous negative-valued interval between them. This peculiar behavior in the heat capacity is related with a backbending loop in the caloric curve (temperature as a function of the total energy) [@Bixon; @Labas; @Wales1; @Wales]. In fact, our calculated microcanonical caloric curves of Na$_{135}$, Na$_{142}$, and Na$_{147}$ show the backbending loop at the same energies where the heat capacity takes negative values (see the caloric curves shown in Fig. 2 of Ref. ). In previous studies, the negative slope (backbending loop) of the microcanonical caloric curve has been attributed to a peculiar behavior of the cluster entropy as a function of energy that shows a *dent with inverted curvature in the region of the solid-liquid transition [@Bixon; @Labas; @Schmidt; @Schmidt1; @Wales].* In the present work, we analyze the behavior of the microcanonical heat capacity of sodium clusters from a different perspective. First, we consider Eq. (1) and obtain the condition to have a negative value in the heat capacity: $$Z_E \, \equiv \, \langle K \rangle \langle K^{-1} \rangle \, \,\, > \, \, \, \frac{3N-6}{3N-8}. \label{Z}$$ Figure \[Fig2\] display the values of $Z_{E}$ (black dots) as a function of the cluster total energy $E$ that were calculated from a time average, using the MD trajectories. In the same scale the threshold value $Z_{c} \equiv (3N-6)/(3N-8)$ for each cluster size is given. In Fig. \[Fig2\] , it can be graphically seen how the relative difference between $Z_{E}$ and $Z_{c}$ changes with the cluster size. For the three smaller clusters (see panels (a), (b), and (c) in Fig. \[Fig2\] ) the $Z_E$ values do not overcome the threshold value, whereas for the three larger clusters there is a range of total energy where $Z_{E}$ satisfy the condition to have negative heat capacities (see panels (d), (e), and (f) in Fig. \[Fig2\] ). In order to investigate what determines a negative value of the heat capacity, we consider the quantity $Z_{E}$. This is the product of the averages of the kinetic energy and of the inverse of this quantity, and therefore, its value will depend on the distribution function of the kinetic energy, $g_{E}(K)$. The average of any function of the kinetic energy $f(K)$ can be obtained through the following expression: $${\langle {f_{E}} \rangle}_g = \int f(K) g_{E}(K) dK. \label{f}$$ Since the distribution function of the kinetic energy, $g_E(K)$, determines the behavior of $Z_{E}$, it is useful to analyze $g_{E}(K)$ at different values of the cluster total energy $E$. The calculation of this quantity is straightforward from the constant-energy MD simulations. Figure \[Fig3\] shows $g_{E}$ as a function of the normalized mean deviation $\delta K$ = ($K$ - $\langle K \rangle$)/ $\langle K \rangle$ for three different energies, corresponding to the cases where the cluster is in the solid- and liquid-like phases, and at the middle of the melting-like transition. The analysis of $g_{E}$ as a function of $\delta K$, instead of $K$, has the advantage that it allows the comparison, on the same scale, of the lineshapes of this function at different cluster energies and for different cluster sizes. As a general trend, it is found that $g_E$ becomes narrower for increasing cluster sizes, indicating a larger relative dispersion of the kinetic energy values for the smaller clusters. This result is expected since it confirms the increment of fluctuations in kinetic energy of a physical system that decrease in size. A common characteristic of $g_E$, existing in the six clusters investigated, is the larger broadening of the distribution function when the cluster is at the melting-like transition. At lower (solid-like phase) and higher (liquid-like phase) energies, the width of $g_E$ is smaller, whereas at the phase transition the fluctuations in kinetic energy, as expected, should increase. For the three smaller clusters which do not have negative heat capacity, $g_{E}(\delta K)$ shows a nearly symmetric lineshape independent of the cluster energy (see panels (a), (b), and (c) of Fig. \[Fig3\] ). In contrast, Na$_{142}$ and Na$_{147}$, that show a negative heat capacity, have a distribution function $g_{E}(\delta K)$ with a shoulder towards positive values of $\delta K$, at energies in the middle of the melting region (see panels (e) and (f) of Fig. \[Fig3\] ). Although this difference in the distribution function of the kinetic energy could be a useful feature to determine the existence of a negative heat capacity, the Na$_{135}$ cluster would be an exception to this rule since its $g_{E}(\delta K)$ does not show a resolved shoulder in its lineshape (see panel (d) in Fig. \[Fig3\]), but it has negative heat capacity. On the other hand, a characteristic of $g_{E}$ that would be useful to determine the sign of the heat capacity is the width of the distribution function, which can be obtained through its second moment: $${\langle (\delta K)^2 \rangle}_g = \int (\delta K)^2 g_{E}(\delta K) d(\delta K). \label{sigma}$$ The second moment of $g_{E}$ corresponds to the second term in the expansion of $Z_E$, which can be obtained from the left hand term of Eq. (5) [@Pearson; @Sugano]: $$Z_E = 1 + {\langle (\delta K)^2 \rangle}_g + .... \label{Zbar}$$ By taking terms up to second order in this expansion, assuming that $ {\langle \delta K \rangle}_g << 1 $, $Z_E$ can be approximated by: $$Z_E \approx Z_{E}^{(2)} = 1 + {\langle (\delta K)^2 \rangle}_g. \label{Z2}$$ Since the $Z_{E}^{(2)}$ values can be calculated using $g_E$ and Eq. (7), it is possible to check the validity of this approximation, which can only be applied to systems with a finite number of particles. Fig. \[Fig2\] shows the values of $Z_{E}^{(2)}$ (stars) as a function of the cluster energy. It can be seen that the difference with $Z_E$ is small for the three smaller clusters and negligible for the three larger ones. Then, $Z_{E}^{(2)}$ can be considered as a quantitative measure of the width (second moment) of the distribution function of the kinetic energy, and can be used to determine the sign of the heat capacity. Figure \[Fig4\] shows the maximum values of $Z_{E}^{(2)}$ (black dots) calculated for energies at the middle of the melting transition, and their comparison with the threshold values $Z_c$ as a function of the cluster size (full line). From this figure, it is obvious that although the width of $g_E$ is relatively large for the three smaller clusters, the corresponding maximum values of $Z_{E}^{(2)}$ are below the threshold $Z_c$, and therefore these clusters do not show a negative heat capacity. On the other hand, the width of $g_E$ for Na$_{135}$, Na$_{142}$, and Na$_{147}$ is smaller than for Na$_{13}$, Na$_{20}$, and Na$_{55}$, however, $Z_c$ is a faster decreasing function of the cluster size $N$, such that the maximum of $Z_{E}^{(2)}$ lies above the threshold values, indicating that the larger clusters have negative heat capacities. Then, the above results suggest that the width of the distribution function of the kinetic energy is a useful property to determine the sign of the heat capacity of clusters. However, this quantity not only depends on the cluster size, but also on the characteristics of the PEL. To illustrate the importance of the topology of the PEL we have investigated the behavior of the heat capacity of 55-atom clusters using the many-body Gupta potential [@Gupta], shown in Eqs. (3) and (4), for the different metals listed in Tables I and III of Ref. , and in Table II of Ref. . Our results show that the Cd$_{55}$ cluster (with the following parameter values [@Cleri]: $A$=0.0416 eV, $\xi$=0.4720 eV, $p$=13.639, and $q$=3.908) has a negative heat capacity, but none of the other 55-atom clusters show this peculiarity. The upper insets of Fig. \[Fig4\] show the calculated caloric curve with the corresponding backbending loop and the heat capacity with negative values for a range of total energy values of the Cd$_{55}$ cluster. The inset at the lower right corner of Fig. 4 shows $g_E$ as a function of the normalized mean deviation of the kinetic energy for both, the Na$_{55}$ and Cd$_{55}$, clusters. It can be seen that the broadening of $g_E$ is larger in Cd$_{55}$ than in Na$_{55}$, such that, it generates a maximum value of $Z_{E}^{(2)}$ (this value corresponds to the point represented by a star in Fig. 4) that overcome the threshold $Z_c$, and consequently, the Cd$_{55}$ cluster display a negative heat capacity. This comparison with the Na$_{55}$ cluster which does not show this peculiarity, indicates that although both clusters have the same size, their dynamical properties defined by their corresponding PEL’s, generate different behavior in their heat capacities. In order to investigate the influence of the PEL on the different widths of the distribution function of the kinetic energy of the Na$_{55}$ and Cd$_{55}$ clusters, further studies are necessary. In this direction, the calculation of short-time averages of the kinetic energy and periodic quenchings of instantaneous configurations during the MD trajectories allow us to obtain the distribution of potential energy minima (isomers) that are accessible at different cluster energies [@Wales1]. Figure \[Fig5\] display the normalized distribution of potential energy minima, obtained by periodical quenchings using MD trajectories at a total energy where the cluster is at the middle of the melting transition, for the Na$_{55}$ and Cd$_{55}$ clusters. It can be notice that the number of isomers with higher energy relative to the global minimum, are larger for the Cd$_{55}$ cluster in comparison with the results obtained for Na$_{55}$. This result can be explained by taking into account that the range of the interatomic forces is shorter in Cd than in Na clusters, mainly due to the higher value of the $q$ parameter in the many-body Gupta potential [@Karo3]. The physical reason for the larger number of minima at short range is the loss of accessible configuration space as the potential wells become narrower, thus producing barriers where there are none at long range [@Doye]. To show how the distribution of potential energy minima determine the broadening of the distribution function of the kinetic energy, we approximate the complex topology of the PEL by a set of independent harmonic potential wells in the $3N-6$ dimensional space. Each one of these wells is associated to the different potential energy minima forming the distribution of isomers shown in Fig. 5. For each potential energy minimum denoted by $l$, the distribution function of the kinetic energy at a total energy $E$, in the harmonic approximation, is given by [@Labas; @Pearson]: $$g_{E,l}(K) = C_{l} (E-\Delta _{l}-K)^{\frac{3N-7}{2}} K^{\frac{3N-7}{2}}, \label{ghar}$$ where $\Delta _{l}$ is the potential energy of the isomer $l$, relative to the potential energy value of the lowest-energy isomer, and $C_l$ is a normalization constant such that: $$\int_ {0}^{E- \Delta _{l}} g_{E,l}(K) dK = 1. \label{Cghar}$$ The distribution function of the kinetic energy $g_{E,har}$, at a total energy $E$, corresponding to the whole PEL can be constructed by adding up the contribution of each harmonic potential well, weighted by the probability, $\omega _{E,l}$, of finding a given isomer during the quenching from the MD trajectories. This probability is given by the height of the distribution shown in Fig. 5. Then, $g_{E,har}$ is given by: $$g_{E,har} = \sum _{l=1}^{l_{max}} \omega _{E,l} \, g_{E,l}(K), \label{gharE}$$ with $$\sum _{l=1}^{l_{max}} \omega _{E,l} = 1. \label{wharE}$$ By using the data from the whole distribution of isomers in Fig. 5, the distribution function of the kinetic energy $g_{E,har}$ was calculated for the Cd$_{55}$ and Na$_{55}$ clusters. They are displayed in the insets of Fig. 5 (full lines). A comparison between $g_{E,har}$ and the exact $g_E$ (obtained from the MD simulation and displayed in the lower right inset of Fig. 4) shows that there is a good agreement between the two distribution functions. This indicates that $g_E$ is determined mainly from the number of isomers and the probability to found them (height of the distribution), rather than from other features of the PEL like saddle points. The advantage in introducing $g_{E,har}$ in this discussion is related with the fact that it is possible to analyze the broadening of this distribution function of the kinetic energy by considering different subsets of potential energy minima (isomers). This is useful to determine what regions of the PEL are more relevant to increase the width of $g_{E,har}$, and investigate the appearance of the negative heat capacity. The insets of Fig. 5 show three partial distribution functions $g_{E,har}$, considering different subsets of isomers corresponding to three intervals of low (L), medium (M) and high (H) potential energy values. By analyzing the relative contribution of these subsets to the width of $g_{E,har}$ for the Cd$_{55}$ and Na$_{55}$ clusters, it is found that the larger broadening in the cadmium cluster is mainly due to the larger contribution of the isomers in the range of high potential energy which are spreaded along a larger interval than those corresponding to the Na$_{55}$ cluster. The width of $g_{E,har}$ for the Na$_{55}$ cluster is smaller since there are proportionally less isomers with high potential energy, and they are extended over a shorter interval of values. As was mentioned above, the physical reason for this difference in the distribution of isomers between the Cd$_{55}$ and Na$_{55}$ clusters is the shorter range of the many-body forces existing in the cadmium cluster as compared with those present in the sodium cluster. A similar result was obtained for 55-atom clusters using a pairwise Morse potential for different values of the range of the interatomic forces [@Doye]. In that case the backbending loop in the caloric curve (negative heat capacity) was obtained using a Morse potential with a range of the interatomic forces that is shorter than the range characteristic of alkali metals which have long-ranged interactions [@Doye]. Therefore, if a detailed characterization of the distribution of isomers forming the PEL of clusters is performed, the broadening of $g_{E}$ may be estimated, and by the comparison of the corresponding $Z_{E}^{(2)}$ and $Z_c$ values, it would be possible to predict the sign of the heat capacity of clusters. Summary ======= The microcanonical heat capacity of sodium clusters has been calculated using constant-energy MD simulations and the many-body Gupta potential. Negative values for the heat capacity at energies where the cluster is at the melting-like transition were found for Na$_{135}$, Na$_{142}$, and Na$_{147}$. The smaller sodium clusters Na$_{N}$, $N$=13, 20, and 55, do not show this peculiarity. An analysis of the calculated distribution function of the kinetic energy $g_E$ for the six clusters investigated, shows that the width of this distribution function is a useful feature to determine the sign of the heat capacity. It was found, that although the broadening of $g_E$ is larger for the smaller clusters, it is not enough to overcome the corresponding threshold value to obtain a negative heat capacity. However, since this threshold is a fast decreasing function of the cluster size, the broadening of $g_E$ in the larger clusters is enough to generate a negative heat capacity. It was also shown that the broadening of $g_E$ depends on the distribution of potential energy minima that characterize the PEL of clusters. Specifically, as the range of the many-body interactions is decreased (like in the case of Cd clusters), the number of local minima with higher energy increases generating a larger broadening in $g_E$, and consequently a negative heat capacity. The analysis presented in this paper shows how the complex topology of the PEL can be explored to extract the main features that determine the sign of the heat capacity of metal clusters. This work was supported by Conacyt-Mexico under Project No. G32723-E. JARN acknowledges a graduate fellowship from DGEP-UNAM. [26]{} M. Bixon and J. Jortner, J. Chem. Phys. [**91**]{}, 1631 (1989). P. Labastie and R.L. Whetten, Phys. Rev. Lett. [**65**]{}, 1567 (1990). W. Thirring, Z. Phys. [**235**]{}, 339 (1970). D. Lynden-Bell, Physica (Amsterdam) [**263A**]{}, 293 (1999). D.H.E. Gross, Rep. Prog. Phys. [**53**]{}, 605 (1990). M. D’Agostino *et al., Phys. Lett. B [**473**]{}, 219 (2000).* M. Schmidt, R. Kusche, T. Hippler, J. Donges, W. Kronmüller, B. von Issendorff, and H. Haberland, Phys. Rev. Lett. [**86**]{}, 1191 (2001). M. Schmidt and H. Haberland, C. R. Physique [**3**]{}, 327 (2002). J. García-Rodeja, C. Rey, L.J. Gallego, and J.A. Alonso, Phys. Rev. B [**49**]{}, 8495 (1994). F. Calvo and F. Spiegelman, J. Chem. Phys. [**112**]{}, 2888 (2000). J. Jellinek and A. Goldberg, J. Chem. Phys. [**113**]{}, 2570 (2000). A. Aguado, J.M. López, J.A. Alonso, and M.J. Stott, J. Chem. Phys. [**111**]{}, 6026 (1999). A. Aguado, J.M. López, J.A. Alonso, and M.J. Stott, J. Phys. Chem. B [**105**]{}, 2386 (2001). M. Schmidt, R. Kusche, W. Kronmüller, B. von Issendorff, and H. Haberland, Phys. Rev. Lett. [**79**]{}, 99 (1997). M. Schmidt, R. Kusche, B. von Issendorff, and H. Haberland, Nature [**393**]{}, 238 (1998). R. Kusche, T. Hippler, M. Schmidt, B. von Issendorff, and H. Haberland, Eur. Phys. J. D [**9**]{}, 1 (1999). E.M. Pearson, T. Halicioglu, and W.A. Tiller, Phys. Rev. A [**32**]{}, 3030 (1985). S. Sawada and S. Sugano, Z. Phys. D [**14**]{}, 247 (1989). L. Verlet, Phys. Rev. [**159**]{}, 98 (1967). R. P. Gupta, Phys. Rev. B [**23**]{}, 6265 (1981). F. Cleri and V. Rosato, Phys. Rev. B [**48**]{}, 22 (1993). Y. Li, E. Blaisten-Barojas, and D.A. Papaconstantopoulos, Phys. Rev. B [**57**]{}, 15519 (1998). J.A. Reyes-Nava, I.L. Garzón, M.R. Beltrán, and K. Michaelian, Rev. Mex. Fis. [**48**]{}, 450 (2002); http://arxiv.org/abs/physics/0207068. D.J. Wales, Mol. Phys. [**78**]{}, 151 (1993). D.J. Wales and R.S. Berry, Phys. Rev. Lett. [**73**]{}, 2875 (1994). K. Michaelian, M.R. Beltrán, and I.L. Garzón, Phys. Rev. B [**65**]{}, 041403(R) (2002). J.P.K. Doye and D.J. Wales, J. Phys. B [**29**]{}, 4859 (1996).

minipile

NaturalLanguage

mit

The mutational specificity of DNA polymerase-beta during in vitro DNA synthesis. Production of frameshift, base substitution, and deletion mutations. The frequency and specificity of mutations produced in vitro by eucaryotic DNA polymerase-beta have been determined in a forward mutation assay using a 250-base target sequence in M13mp2 DNA. Homogeneous DNA polymerase-beta, isolated from four different sources, produces mutations at a frequency of 4-6%/single round of gap-filling DNA synthesis. DNA sequence analyses of 460 independent mutants resulting from this error-prone DNA synthesis demonstrate a wide variety of mutational events. Frameshift and base substitutions are made at approximately equal frequency and together comprise about 90% of all mutations. Two mutational "hot spots" for frameshift and base substitution mutations were observed. The characteristics of the mutations at these sites suggest that certain base substitution errors result from dislocation of template bases rather than from direct mispair formation by DNA polymerase-beta. When considering the entire target sequence, single-base frameshift mutations occur primarily in runs of identical bases, usually pyrimidines. The loss of a single base occurs 20-80 times more frequently than single-base additions and much more frequently than the loss of two or more bases. Base substitutions occur at many sites throughout the target, representing a wide spectrum of mispair formations. Averaged over a large number of phenotypically detectable sites, the base substitution error frequency is greater than one mistake for every 5000 bases polymerized. Large deletion mutations are also observed, at a frequency more than 10-fold over background, indicating that purified DNA polymerases alone are capable of producing such deletions. These data are discussed in relation to the physical and kinetic properties of the purified enzymes and with respect to the proposed role for this DNA polymerase in vivo.

minipile

NaturalLanguage

mit

In 2007, Navy SEAL Marcus Lutrell wrote a book called Lone Survivor, which recounted his experience during a 2005 mission in Northeastern Afghanistan that ultimately claimed the lives of 19 of his fellow soldiers. It was a bestseller, and in 2014, became a major motion picture starring Mark Wahlberg. Matt Brady (MBA 2016) lived this mission. As a pilot in an elite Army helicopter unit called the Night Stalkers, he was tasked with delivering Luttrell and three other soldiers to the drop point and sticking around to make sure they found a good place to hide in the mountains. The next day, though, that team was attacked, and here, Brady tells the story of the last-minute decision that kept him from the subsequent, ill-fated rescue mission, the difficult decisions he had to make that day, and the leadership lessons that he took from the experience.

minipile

NaturalLanguage

mit

Q: Using photos without permission for purpose of charity I'm making a video collage of photos from the internet of the California wildfires to ask for people's donations for the first responders. Will I run afoul with copyright laws in doing this, or will this be ok under a 'fair use' case, as I am not looking to profit, but rather collect donations for charity. A: Collecting donations is profiting. Merely because those profits will be used in order to help someone/thing it doesn't change the fact that usage of the images would be benefiting an organization. There's no such thing as "altruistic usage" which circumvent copyright infringements. "Profit" in terms of unauthorized image use equates to any use which provides value. "Fair Use" refers to usage where nothing is directly gained from the use. It certainly sounds to me as though the usage you describe would be unauthorized use and an infringement. Charities, non-profits, and/or not-for profit organizations do not get "free reign" to use anything merely due to the nature of their business. They are bound to copyright laws the same as any other organization.

minipile

NaturalLanguage

mit

The 3 plays in sports everybody will be talking about today Sergio Garcia after hitting a hole-in-one at the Players Championship. Warren Little/Getty Images Good morning! Here are the plays everybody will be talking about Friday: The Sergio Garcia ace. Garcia is having quite a season. One month after winning his first major at the Masters, Garcia became just the eighth player to hit a hole-in-one at the No. 17 island green during the Players Championship. The Dustin Johnson putt. Johnson finished second at last week's Wells Fargo Championship, his first tournament since having to pull out of the Masters because of an injury. That, and his No. 1 ranking, made him the betting favorite at the Players Championship even though he had never performed well at TPC Sawgrass. It doesn't help when he has putts like this. DJ shot 1-under and is four shots back after the first round. The John Guidetti miss. In the second leg of the semifinal of the Europa League, Celta Vigo was tied with Manchester United in stoppage time. Vigo needed one goal to advance to the final. In the 96th minute, with just seconds to go until the final whistle, Guidetti missed an empty net, and Manchester United is on to face Ajax in the final. The Little League-home-run bonus. Rays center fielder Kevin Kiermaier has a reputation as one of the best fielders in baseball. And yet, for the second time this week, Kiermaier overran a ground ball and allowed the batter to circle the bases and score, also known as a "Little League home run."

minipile

NaturalLanguage

mit

Next-generation bionic eyes are practically here today. Imagine a blind person’s real-world conundrum trying to shop for one — they could schedule surgery for Nano Retina’s implant today and see their daughter’s wedding in 576-pixel clarity, but it would cost them their life’s savings. The Nano Retina 5000-pixel device could be ready tomorrow, or in another six months… and would be much more affordable. When the procedure involves assimilation of an electrode pincushion into the ganglionic tentacles of your retina, hardware upgrades are not as simple as popping in more RAM. What kind of decision matrix could be offered under such critical circumstances? Cochlear implants, used to restore hearing, work phenomenally well when properly tuned and fitted. Most are refinements of the basic piece of hardware one might have sitting on their bookshelf — the graphic equalizer. The implant processes a single audio stream into bins of various sizes according to frequency, and then applies current to the corresponding frequency location in the cochlea, typically with a 16-spot linear electrode. The main function of these devices is to capture speech formants — the peaks in the frequency spectrum of the voice. The toughest challenge for the cochlear implant is to provide sound localization and source separation in noisy environments like a cocktail party. Vision implants are much more complex. As any practiced photographer knows, the eye is more than a camera. The optic nerve does not feed the brain pixels. If you imagine your camera responding to auto-selected targets several times a second, gathering the full spectrum of light through its entire range of settings at each pause, and compressing the data onto a bandwidth- and energy-limited channel ideally matched to its receiver, you have some idea of what the retina accomplishes routinely. The reason cochlear implants work so well is that the brain is just that good at making sense out of virtually any kind of signal it is given. If presented only with noise, or with nothing at all, the brain will eventually begin to manufacture hallucinations. If the implant signal contains even some distorted fragment of the original signal, it can be made to work convincingly. This is also the reason why retina implants can work without incorporating any knowledge of what the retina actually does in the healthy state. These days researchers are trying to do a little better than the grainy images provided through our current implants. Signal processing techniques were developed in the Cold War era to track and target incoming missiles by extracting signals from noisy radar data. These same techniques are now used to convert the activity of groups of neurons in the motor cortex into a set of commands for moving a cursor, prosthetic device, or de-enervated limb in brain machine interfaces (BCIs). These methods and derivations of them can also be applied to incoming sensory data and can approximate what the retina actually does, without doing it in the same way. Unfortunately, videos and TED talks are not the places where this kind of knowledge is typically transmitted in much depth. For that, one needs to look back to the work of the founding father of cybernetics, Norbert Wiener, and his eminently practical inspiration, Vito Volterra. After suggesting that helium be used instead of hydrogen in airships, to great success, Volterra shifted gears and came up with some methods to characterize complex systems. Wiener simplified Volterra’s equations and they are now widely used today in statistical techniques like linear regression analysis, and analysis of spike trains from neurons. Next page: The future of high-res bionic eyes

minipile

NaturalLanguage

mit

Management of pediatric facial burns. The acute management of pediatric facial burns is not uniform. Many surgeons prefer to wait until primary wound separation occurs before grafting. Concerns over early excision are accentuated in small pediatric patients. The possible benefits of early excision results have led to adoption of this technique at our facility. This study presents our recent experience with early excision and grafting. Sixty-six patients with a mean age of 6.2 years underwent early excision and grafting of facial burns. Patients underwent grafting a mean 12.7 days after burn. Procedures were done in two stages. All grafts were dressed open. There were no episodes of acute airway decompensation. No patient required regrafting. Patients wore pressure masks a mean of 15.5 months after grafting. Thirteen patients had releases (10 eyelids, three lips/commissures) in the first postoperative year. These results demonstrate that early excision and grafting of facial burns can be carried out safely in pediatric patients with burns. The benefits of early wound coverage can thus be applied to facial burns in this population of patients.

minipile

NaturalLanguage

mit

Q: How to correctly check for nested values in ruby I have a ruby hash that looks like this: payload = { "fields" => { "publishedDate" => { "de"=>"2019-05-02T00:00+02:00" } } } So now I want to access the date. How would I efficiently and correctly write an if statement to check if the date exists? I'm currently doing something like this but it somehow feels like it is too much code: payload["fields"] && payload["fields"]["publishedDate"] && payload["fields"]["publishedDate"].first && payload["fields"]["publishedDate"].first.last Thank you for helping me out! A: Assuming the date is always the value (taking the example of de), then you can use dig to reach every publishedDate, then Hash#values to for every hash/value and any?(&:present?) to check if any of the given values is not blank: (payload.dig('fields', 'publishedDate') || {}).values.any?(&:present?) In the eventual case that fields and/or publishedDate aren't present in the hash, it'll return nil, and you'll use {} to invoke values, resulting in an empty array with no present? values. If the hash comes from a request params, you must know that Rails invokes with_indifferent_access on the object and your hash keys are accessible as symbols as well, so you could do: (payload.dig(:fields, :publishedDate) || {}).values.any?(&:present?)

minipile

NaturalLanguage

mit

Texas Children’s Hospital launches pediatric Thyroid Tumor Program Texas Children’s Hospital recently formed a new pediatric Thyroid Tumor Program dedicated to the diagnosis and treatment of children and young adults with thyroid tumors, cancer and diseases. Approximately 2 percent of children develop solitary thyroid nodules – lumps which can grow on an otherwise normal thyroid gland. Most of these are benign, but a few are malignant and can develop into thyroid cancer. Although thyroid tumors in children are rare, they are being diagnosed with increased frequency. The Surveillance Epidemiology and End Results (SEER) program estimates 1,200 children will be diagnosed with thyroid cancer in the U.S. this year. “Thyroid tumors in children are especially challenging for many children’s hospitals, as specialized expertise is often not available and many pediatricians and surgeons have limited experience with them,” says Dr. Jake Kushner, chief of pediatric diabetes and endocrinology. “Our goal is to ensure that children with thyroid tumors have the highest possible level of care to improve their quality of life, and ultimately, to increase the odds of survivorship.” This is why receiving care at a dedicated pediatric hospital is critical. It provides vital access to a comprehensive spectrum of pediatric specialists. “Our Thyroid Tumor Program combines the expertise and skills of a dedicated team of pediatric specialists in surgery, endocrinology, pathology, radiology, nuclear medicine, oncology, psychology and nursing to give every child with a thyroid tumor state-of-the-art care,” says Dr. David Wesson, associate surgeon-in-chief. Led by Dr. Loanna Athanassaki, pediatric endocrinologist, and Dr. Monica Lopez, pediatric surgeon, the Thyroid Tumor Program strives to provide best-in-class care and will remain dedicated to tracking patient outcomes to refine and improve management of patients with these diseases. For more information about the program, visit http://www.texaschildrens.org/thyroid-tumor-program/

minipile

NaturalLanguage

mit

Q: FileVault 2 Login Issues on OpenLDAP Network with Admin, Managed, Mobile Account on Lion 10.7.4 This issue occurs on any machine with Lion in my environment. I install Lion and connect to OpenLDAP for authentication. I enable FileVault. Some users were reporting that when they'd wake their computer from sleep or reboot, the only available account to unlock FileVault was Administrator (not their local cached OpenLDAP account any longer). In an attempt to reproduce this issue, I shut down all network interfaces on my test MacBook Pro and rebooted -- sure enough FileVault will only allow me to unlock my hard drive by using the Administrator password, just as it occurred for my users. Also, when I tried to check to see if my user account was still enabled in FileVault (by accessing System Preferences -> Security & Privacy), System Preferences crashes. I found a workaround that sometimes works: Open any other System Preferences pane (for example, Users & Groups), and authenticate by clicking the lock icon. Then click Show All to go back to the main System Preferences UI, and access Security & Privacy again. It will work. In the FileVault tab, the text "Some users are not able to unlock this disk" appears (presumably my Admin, Managed, Mobile Account). I click on the "Enable Users" button and it brings up a dialog, but in this dialog my user account is the only one listed, and it has a green checkmark badge, as though it's set up properly (even when it isn't). If I click the "Done" button here, it appears to process something for a moment. If I reboot after doing this, it works, and I'm able to authenticate as myself. I think what is happening here is that the network is shutting down on MacBooks that are in sleep mode or shut down, and FileVault is then removing any accounts that authenticate with LDAP from the Enabled Users. I presume something is broken too here, due to the crash that happens when trying to investigate the FileVault configuration. Steps to Reproduce Install Lion. Connect to my OpenLDAP server. Enable FileVault 2, enable LDAP-authenticated user to unlock FileVault. Reboot. It works! Log in, and disable network interfaces, with the goal of forcing Lion to use the cached LDAP credentials for user authentication in FileVault. Reboot. The only user that is available for authentication is Administrator. After logging in as Administrator, then logging out, and logging back in as the LDAP-auth'd user, I try to access System Preferences -> Security & Privacy. This causes System Preferences to crash with the crash dump pasted below. The only way to prevent this crash is to authenticate by clicking the lock icon on any other System Preferences pane (e.g. Users & Groups), then click "Show All", then click "Security & Privacy" again. This time it will work. Details are noted in the above Summary section of this bug report. Expected Results I would expect FileVault 2 authentication to work for the user it is originally set up under. Actual Results This isn't happening, and the users end up not able to unlock their machine (and thus, can't work without me (the sysadmin) coming over and unlocking their machine as Administrator, then logging out and letting them log into OS X under their account). I have filed a bug report with Apple, but heard nothing from them. I'm going to get in touch with phone support to see if it is of any use, but I'm curious if anyone here has encountered and somehow overcome these issues. Notes Here is the crash log produced when trying to access Security & Privacy after the issue occurs: http://pastebin.com/2ewfZCUP A: FileVault 2 uses the GeneratedUID user attribute to save who is permitted to unlock an encrypted volume. If the GeneratedUID of a user differs from what was generated (or pulled from LDAP) when FileVault 2 was enabled, the user will not be permitted to unlock the machine, as their account will appear to be unavailable at the EFI menu. Also, this causes the crash of System Preferences on their Mac whenever they try to access the Security & Privacy prefpane. This problem arises when /usr/bin/mcxrefresh runs and pulls a null value or a value different than what is stored locally from LDAP (if the attribute isn't defined for the user in question or is defined incorrectly, respectively), overwriting the GeneratedUID stored locally (which is generated and only stored locally when FileVault 2 is enabled without a matching LDAP attribute). In other words, if an apple-generateduid value exists in LDAP for a user and is mapped properly on the users Mac to the GeneratedUID attribute, FileVault 2 will not generate a new value, but will instead use the value stored in LDAP. I was able to resolve this issue by adding an attribute called apple-generateduid to the LDAP entry of any user experiencing this issue. I could generate a random value for this attribute in Python by running the following one-liner from my terminal: python -c 'import uuid; print str(uuid.uuid4()).upper();' This isn't the only step, however. You must also add a mapping for this attribute on the client side. This is easily done using the following steps: Open System Preferences. Click Users & Groups. Click Login Options. Click on the Unlock Icon. Under Network Account Server, click Edit. Click to highlight your directory server. Under Services, double-click on your directory service (in my case, it was LDAPv3) In the window that slides open, highlight your configuration name, and then click the Edit... button. Under Search & Mappings scroll down and single-click on Users to highlight it. Click the Add button (the left one). Choose GeneratedUID from the list of available Attribute Types. In the right column, click the Add button, and type apple-generateduid. Click OK to save the changes until you're back at the main System Preferences dialog. At this point a mapping from GeneratedUID to apple-generateduid has been created. Now when OS X looks up the GeneratedUID value it will get the value of apple-generateduid from the user in questions LDAP entry. Finally, it's important that the locally stored value of GeneratedUID and value stored on LDAP match. Run the following command and make sure the two GeneratedUID values match: dscl /Search search /Users GeneratedUID $(dscl . read /Users/$(echo $USER) GeneratedUID | cut -d " " -f2)

minipile

NaturalLanguage

mit

when i try to kill time Standard …i’ve realised i don’t really kill it. a new look for the blog has happened. its fauna customized, with some neat AJAX plugins. thats while i wait for k2 to be updated… the next one promises to be a major upgrade. i wanted to go back to squible, seeing as it has some great updates, but the beta 2 refused to work – widgets and all. which brings me to my additions. simple theme, this.. no major frills. added AJAX for viewing comments and expanding posts, as well as a live preview of comments for you chaps. am using widgets for the first time, simpler theming in some ways, if the damned theme gets the implementation right ! my archives go back to being dull, as this theme is not very supportive of live archiving 😦 am tending towards minimalism or kiwi – one a completely stripped blog; and the other a completely widgetized blog. 2 opposite approaches.. but the look is not coming out just yet. kiwi has enough features to play around with for ages.. the other would look sleek. maybe in a week. should be bored enough by then. memo to self: AJAX comments in any form and Spam Karma 2 do not go well together 😦 Post navigation 2 thoughts on “when i try to kill time” You remind of myself hehehe – I kept changing my themes ever so often, till I ended up making one of my own based on Squible and Hemingway. Not the greatest work of art, but I think was pretty happy in the end. I think u should just develope a theme yourself – wordpress is quite easy!

minipile

NaturalLanguage

mit

More from Football Premier League: Arsenal's Aaron Ramsey sets Champions League stakes Aaron Ramsey knows Arsenal are at the make-or-break stage as they bid to beat rivals Tottenham to the Champions League. Last Updated: 30/03/13 4:07pm Spurs currently occupy the lucrative fourth place in the Premier League and their London neighbours sit four points behind in fifth but with a game in hand. Arsenal, despite injuries to the likes of Jack Wilshere and Abou Diaby, also have momentum after defeating Swansea City before the international break. In contrast, Spurs have lost back-to-back games against Liverpool and Fulham to leave Ramsey optimistic of a repeat of last season, when Arsenal produced a late run to overtake their local foes for third position. But the Welshman is aware there is no room for any slip-ups ahead of Saturday's game against Reading, as he told Sky Sports News: "We are coming to the stage now where we need to treat every game as a cup final. "We need the points and hopefully we can do that. "We have done well and got some points when others dropped them a couple of weeks ago so hopefully we can continue doing that and have a similar result as we had last season." A dramatic 5-2 derby win in February 2012 over Tottenham started Arsenal's run last season as Arsene Wenger's men finished third while Spurs ended up in fourth and missed out on the Champions League after Chelsea won the competition. The third-placed finish ensured Wenger kept up his impressive record of perennially qualifying for the European Cup and Ramsey does not want to be a member of the first Arsenal squad to fail under the Frenchman. "It is massive for us to be in the Champions League and be in a competition where you are competing against the best teams in Europe," he said. "Since Arsene Wenger has been here, none of the sides have failed to qualify and so we do not want to be the first."

minipile

NaturalLanguage

mit