File size: 46,250 Bytes
7de23e7 |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813 814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852 |
---
base_model: BAAI/bge-base-en-v1.5
datasets: []
language: []
library_name: sentence-transformers
metrics:
- cosine_accuracy@1
- cosine_accuracy@3
- cosine_accuracy@5
- cosine_accuracy@10
- cosine_precision@1
- cosine_precision@3
- cosine_precision@5
- cosine_precision@10
- cosine_recall@1
- cosine_recall@3
- cosine_recall@5
- cosine_recall@10
- cosine_ndcg@10
- cosine_mrr@10
- cosine_map@100
pipeline_tag: sentence-similarity
tags:
- sentence-transformers
- sentence-similarity
- feature-extraction
- generated_from_trainer
- dataset_size:76
- loss:MatryoshkaLoss
- loss:MultipleNegativesRankingLoss
widget:
- source_sentence: ply C Tris pH8.0 Dextran Trehalose dNTPS Na2 SO4 Triton X-100
sentences:
- NE
- Assignee
- ID NO
- source_sentence: Certain isothermal amplification methods are able to amplify
a target nucleic acid from trace levels to very high 25 and detectable levels within a matter of minutes. Such
isothermal methods, e.g., Nicking and Extension Amplifi cation Reaction (NEAR), allow
users to detect a particular nucleotide sequence in trace amounts, facilitating
point-of care testing and increasing the accessibility and speed of diagnostics.
Streptococcus pyogenes is the causative agent of group A streptococcal (GAS) infections such as pharyngitis, impe
tigo, and life-threatening necrotizing fasciitis and sepsis. The most common GAS infection, pharyngitis, can be
diagnosed by collecting a throat swab sample from a patient and culturing the
sample under conditions that would enable bacterial, specifically S. pyogenes, growth,
which takes 2-3 days. Culturing S. pyogenes is an accurate and reliable
method of diagnosing GAS, but it is slow. A 2-3 day delay in prescribing appropriate antibiotic
treatment can result in unnecessary patient suffering and potentially the onset
oflife threatening conditions such as rheumatic fever. In the recent past, biochemical
methods have been developed to detect S. pyogenes, but these methods do not provide the necessary
characteristics to be deployed in the point-of-care setting, either due to a lack
of sensitivity or time to result (speed). Accordingly, a highly sensitive and
rapid qualitative assay for the detection and diagnosis of a S. pyogenes infection
is desired.
sentences:
- ABSTRACT
- TACTGTTCCTGTTTGA
- BACKGROUND
- source_sentence: W02010/141940 12/2010 CA (US)
sentences:
- WO
- DESCRIPTION OF DRAWINGS
- SUMMARY
- source_sentence: 9 6 nucleotide sequence at least 80, 85 or 95% identity to SEQ
sentences:
- '2'
- NEAR
- Ph. Dissertation published Jan. 1, 2008. (Year
- source_sentence: One potential inhibitor of the NEAR technology is human gDNA. When a throat swab sample is collected from a
patient symptomatic for GAS infection, it is possible that human gDNA
is also collected on the swab (from immune cells such as white blood cells
or from local epithelial cells). In order to assess the impact that human gDNA
has on the GAS assay, a study was performed using three different levels of
GAS gDNA (25, 250 and 1000 copies) in the presence of 0, 10, 50, 100, 250, 500 or 1000
ng of human gDNA. As shown in FIG. 6, the presence of human gDNA does have an impact on
GAS assay performance, and the impact is GAS target concentration dependent. When
there is a low copy number of target GAS present in the reaction, 10 ng of
human gDNA or more significantly inhibits the assay. At 250 copies of GAS
target, the impact of 10 ng of 60 human gDNA is less, and at 1,000 copies of
GAS target, the effect of 10 ng of human gDNA on the assay is significantly less. In
fact, when 1,000 copies of target is present in the assay, up to 100 ng
of human gDNA can be tolerated, albeit with a slower amplification speed and reduced
fluorescence signal. Testing of the 501 (IC only) mix showed a more robust response to human gDNA. When the 501 mix was
tested in the presence of O copies of target GAS and up to US 10,329,601 B2
23 1,000 ng of human gDNA, the assay still produced a clearly positive signal
at 500 ng of human gDNA (even at 1,000 ng of human gDNA the fluorescence signal was still above
background). Other Embodiments It is to be understood that while the invention
has been described in conjunction with the detailed description 24 thereof, the foregoing description is intended to illustrate
and not limit the scope of the invention, which is defined by the scope of the
appended claims. Other aspects, advantages, and modifications are within the scope of
the following claims.
sentences:
- '75'
- TGTAGCTGACACCACCAAGCTACA
- Impact of Human Genomic DNA (gDNA) on GAS Assay
model-index:
- name: SentenceTransformer based on BAAI/bge-base-en-v1.5
results:
- task:
type: information-retrieval
name: Information Retrieval
dataset:
name: dim 768
type: dim_768
metrics:
- type: cosine_accuracy@1
value: 0.625
name: Cosine Accuracy@1
- type: cosine_accuracy@3
value: 0.875
name: Cosine Accuracy@3
- type: cosine_accuracy@5
value: 1.0
name: Cosine Accuracy@5
- type: cosine_accuracy@10
value: 1.0
name: Cosine Accuracy@10
- type: cosine_precision@1
value: 0.625
name: Cosine Precision@1
- type: cosine_precision@3
value: 0.29166666666666663
name: Cosine Precision@3
- type: cosine_precision@5
value: 0.2
name: Cosine Precision@5
- type: cosine_precision@10
value: 0.1
name: Cosine Precision@10
- type: cosine_recall@1
value: 0.625
name: Cosine Recall@1
- type: cosine_recall@3
value: 0.875
name: Cosine Recall@3
- type: cosine_recall@5
value: 1.0
name: Cosine Recall@5
- type: cosine_recall@10
value: 1.0
name: Cosine Recall@10
- type: cosine_ndcg@10
value: 0.8202007889556063
name: Cosine Ndcg@10
- type: cosine_mrr@10
value: 0.7604166666666666
name: Cosine Mrr@10
- type: cosine_map@100
value: 0.7604166666666666
name: Cosine Map@100
- task:
type: information-retrieval
name: Information Retrieval
dataset:
name: dim 512
type: dim_512
metrics:
- type: cosine_accuracy@1
value: 0.625
name: Cosine Accuracy@1
- type: cosine_accuracy@3
value: 0.875
name: Cosine Accuracy@3
- type: cosine_accuracy@5
value: 0.875
name: Cosine Accuracy@5
- type: cosine_accuracy@10
value: 1.0
name: Cosine Accuracy@10
- type: cosine_precision@1
value: 0.625
name: Cosine Precision@1
- type: cosine_precision@3
value: 0.29166666666666663
name: Cosine Precision@3
- type: cosine_precision@5
value: 0.17500000000000002
name: Cosine Precision@5
- type: cosine_precision@10
value: 0.1
name: Cosine Precision@10
- type: cosine_recall@1
value: 0.625
name: Cosine Recall@1
- type: cosine_recall@3
value: 0.875
name: Cosine Recall@3
- type: cosine_recall@5
value: 0.875
name: Cosine Recall@5
- type: cosine_recall@10
value: 1.0
name: Cosine Recall@10
- type: cosine_ndcg@10
value: 0.810892117584935
name: Cosine Ndcg@10
- type: cosine_mrr@10
value: 0.75
name: Cosine Mrr@10
- type: cosine_map@100
value: 0.75
name: Cosine Map@100
- task:
type: information-retrieval
name: Information Retrieval
dataset:
name: dim 256
type: dim_256
metrics:
- type: cosine_accuracy@1
value: 0.625
name: Cosine Accuracy@1
- type: cosine_accuracy@3
value: 0.875
name: Cosine Accuracy@3
- type: cosine_accuracy@5
value: 0.875
name: Cosine Accuracy@5
- type: cosine_accuracy@10
value: 1.0
name: Cosine Accuracy@10
- type: cosine_precision@1
value: 0.625
name: Cosine Precision@1
- type: cosine_precision@3
value: 0.29166666666666663
name: Cosine Precision@3
- type: cosine_precision@5
value: 0.17500000000000002
name: Cosine Precision@5
- type: cosine_precision@10
value: 0.1
name: Cosine Precision@10
- type: cosine_recall@1
value: 0.625
name: Cosine Recall@1
- type: cosine_recall@3
value: 0.875
name: Cosine Recall@3
- type: cosine_recall@5
value: 0.875
name: Cosine Recall@5
- type: cosine_recall@10
value: 1.0
name: Cosine Recall@10
- type: cosine_ndcg@10
value: 0.8057993287946483
name: Cosine Ndcg@10
- type: cosine_mrr@10
value: 0.7447916666666666
name: Cosine Mrr@10
- type: cosine_map@100
value: 0.7447916666666666
name: Cosine Map@100
- task:
type: information-retrieval
name: Information Retrieval
dataset:
name: dim 128
type: dim_128
metrics:
- type: cosine_accuracy@1
value: 0.75
name: Cosine Accuracy@1
- type: cosine_accuracy@3
value: 0.875
name: Cosine Accuracy@3
- type: cosine_accuracy@5
value: 1.0
name: Cosine Accuracy@5
- type: cosine_accuracy@10
value: 1.0
name: Cosine Accuracy@10
- type: cosine_precision@1
value: 0.75
name: Cosine Precision@1
- type: cosine_precision@3
value: 0.29166666666666663
name: Cosine Precision@3
- type: cosine_precision@5
value: 0.2
name: Cosine Precision@5
- type: cosine_precision@10
value: 0.1
name: Cosine Precision@10
- type: cosine_recall@1
value: 0.75
name: Cosine Recall@1
- type: cosine_recall@3
value: 0.875
name: Cosine Recall@3
- type: cosine_recall@5
value: 1.0
name: Cosine Recall@5
- type: cosine_recall@10
value: 1.0
name: Cosine Recall@10
- type: cosine_ndcg@10
value: 0.8608566009043177
name: Cosine Ndcg@10
- type: cosine_mrr@10
value: 0.8166666666666667
name: Cosine Mrr@10
- type: cosine_map@100
value: 0.8166666666666667
name: Cosine Map@100
- task:
type: information-retrieval
name: Information Retrieval
dataset:
name: dim 64
type: dim_64
metrics:
- type: cosine_accuracy@1
value: 0.75
name: Cosine Accuracy@1
- type: cosine_accuracy@3
value: 0.875
name: Cosine Accuracy@3
- type: cosine_accuracy@5
value: 1.0
name: Cosine Accuracy@5
- type: cosine_accuracy@10
value: 1.0
name: Cosine Accuracy@10
- type: cosine_precision@1
value: 0.75
name: Cosine Precision@1
- type: cosine_precision@3
value: 0.29166666666666663
name: Cosine Precision@3
- type: cosine_precision@5
value: 0.2
name: Cosine Precision@5
- type: cosine_precision@10
value: 0.1
name: Cosine Precision@10
- type: cosine_recall@1
value: 0.75
name: Cosine Recall@1
- type: cosine_recall@3
value: 0.875
name: Cosine Recall@3
- type: cosine_recall@5
value: 1.0
name: Cosine Recall@5
- type: cosine_recall@10
value: 1.0
name: Cosine Recall@10
- type: cosine_ndcg@10
value: 0.8608566009043177
name: Cosine Ndcg@10
- type: cosine_mrr@10
value: 0.8166666666666667
name: Cosine Mrr@10
- type: cosine_map@100
value: 0.8166666666666667
name: Cosine Map@100
---
# SentenceTransformer based on BAAI/bge-base-en-v1.5
This is a [sentence-transformers](https://www.SBERT.net) model finetuned from [BAAI/bge-base-en-v1.5](https://huggingface.co/BAAI/bge-base-en-v1.5). It maps sentences & paragraphs to a 768-dimensional dense vector space and can be used for semantic textual similarity, semantic search, paraphrase mining, text classification, clustering, and more.
## Model Details
### Model Description
- **Model Type:** Sentence Transformer
- **Base model:** [BAAI/bge-base-en-v1.5](https://huggingface.co/BAAI/bge-base-en-v1.5) <!-- at revision a5beb1e3e68b9ab74eb54cfd186867f64f240e1a -->
- **Maximum Sequence Length:** 512 tokens
- **Output Dimensionality:** 768 tokens
- **Similarity Function:** Cosine Similarity
<!-- - **Training Dataset:** Unknown -->
<!-- - **Language:** Unknown -->
<!-- - **License:** Unknown -->
### Model Sources
- **Documentation:** [Sentence Transformers Documentation](https://sbert.net)
- **Repository:** [Sentence Transformers on GitHub](https://github.com/UKPLab/sentence-transformers)
- **Hugging Face:** [Sentence Transformers on Hugging Face](https://huggingface.co/models?library=sentence-transformers)
### Full Model Architecture
```
SentenceTransformer(
(0): Transformer({'max_seq_length': 512, 'do_lower_case': True}) with Transformer model: BertModel
(1): Pooling({'word_embedding_dimension': 768, 'pooling_mode_cls_token': True, 'pooling_mode_mean_tokens': False, 'pooling_mode_max_tokens': False, 'pooling_mode_mean_sqrt_len_tokens': False, 'pooling_mode_weightedmean_tokens': False, 'pooling_mode_lasttoken': False, 'include_prompt': True})
(2): Normalize()
)
```
## Usage
### Direct Usage (Sentence Transformers)
First install the Sentence Transformers library:
```bash
pip install -U sentence-transformers
```
Then you can load this model and run inference.
```python
from sentence_transformers import SentenceTransformer
# Download from the 🤗 Hub
model = SentenceTransformer("kr-manish/fine-tuned-bge-base-raw_pdf-v1")
# Run inference
sentences = [
'One potential inhibitor of the NEAR technology is human gDNA. When a throat swab sample is collected from a patient symptomatic for GAS infection, it is possible that human gDNA is also collected on the swab (from immune cells such as white blood cells or from local epithelial cells). In order to assess the impact that human gDNA has on the GAS assay, a study was performed using three different levels of GAS gDNA (25, 250 and 1000 copies) in the presence of 0, 10, 50, 100, 250, 500 or 1000 ng of human gDNA. As shown in FIG. 6, the presence of human gDNA does have an impact on GAS assay performance, and the impact is GAS target concentration dependent. When there is a low copy number of target GAS present in the reaction, 10 ng of human gDNA or more significantly inhibits the assay. At 250 copies of GAS target, the impact of 10 ng of 60 human gDNA is less, and at 1,000 copies of GAS target, the effect of 10 ng of human gDNA on the assay is significantly less. In fact, when 1,000 copies of target is present in the assay, up to 100 ng of human gDNA can be tolerated, albeit with a slower amplification speed and reduced fluorescence signal. Testing of the 501 (IC only) mix showed a more robust response to human gDNA. When the 501 mix was tested in the presence of O copies of target GAS and up to US 10,329,601 B2 23 1,000 ng of human gDNA, the assay still produced a clearly positive signal at 500 ng of human gDNA (even at 1,000 ng of human gDNA the fluorescence signal was still above background). Other Embodiments It is to be understood that while the invention has been described in conjunction with the detailed description 24 thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.',
'Impact of Human Genomic DNA (gDNA) on GAS Assay',
'TGTAGCTGACACCACCAAGCTACA',
]
embeddings = model.encode(sentences)
print(embeddings.shape)
# [3, 768]
# Get the similarity scores for the embeddings
similarities = model.similarity(embeddings, embeddings)
print(similarities.shape)
# [3, 3]
```
<!--
### Direct Usage (Transformers)
<details><summary>Click to see the direct usage in Transformers</summary>
</details>
-->
<!--
### Downstream Usage (Sentence Transformers)
You can finetune this model on your own dataset.
<details><summary>Click to expand</summary>
</details>
-->
<!--
### Out-of-Scope Use
*List how the model may foreseeably be misused and address what users ought not to do with the model.*
-->
## Evaluation
### Metrics
#### Information Retrieval
* Dataset: `dim_768`
* Evaluated with [<code>InformationRetrievalEvaluator</code>](https://sbert.net/docs/package_reference/sentence_transformer/evaluation.html#sentence_transformers.evaluation.InformationRetrievalEvaluator)
| Metric | Value |
|:--------------------|:-----------|
| cosine_accuracy@1 | 0.625 |
| cosine_accuracy@3 | 0.875 |
| cosine_accuracy@5 | 1.0 |
| cosine_accuracy@10 | 1.0 |
| cosine_precision@1 | 0.625 |
| cosine_precision@3 | 0.2917 |
| cosine_precision@5 | 0.2 |
| cosine_precision@10 | 0.1 |
| cosine_recall@1 | 0.625 |
| cosine_recall@3 | 0.875 |
| cosine_recall@5 | 1.0 |
| cosine_recall@10 | 1.0 |
| cosine_ndcg@10 | 0.8202 |
| cosine_mrr@10 | 0.7604 |
| **cosine_map@100** | **0.7604** |
#### Information Retrieval
* Dataset: `dim_512`
* Evaluated with [<code>InformationRetrievalEvaluator</code>](https://sbert.net/docs/package_reference/sentence_transformer/evaluation.html#sentence_transformers.evaluation.InformationRetrievalEvaluator)
| Metric | Value |
|:--------------------|:---------|
| cosine_accuracy@1 | 0.625 |
| cosine_accuracy@3 | 0.875 |
| cosine_accuracy@5 | 0.875 |
| cosine_accuracy@10 | 1.0 |
| cosine_precision@1 | 0.625 |
| cosine_precision@3 | 0.2917 |
| cosine_precision@5 | 0.175 |
| cosine_precision@10 | 0.1 |
| cosine_recall@1 | 0.625 |
| cosine_recall@3 | 0.875 |
| cosine_recall@5 | 0.875 |
| cosine_recall@10 | 1.0 |
| cosine_ndcg@10 | 0.8109 |
| cosine_mrr@10 | 0.75 |
| **cosine_map@100** | **0.75** |
#### Information Retrieval
* Dataset: `dim_256`
* Evaluated with [<code>InformationRetrievalEvaluator</code>](https://sbert.net/docs/package_reference/sentence_transformer/evaluation.html#sentence_transformers.evaluation.InformationRetrievalEvaluator)
| Metric | Value |
|:--------------------|:-----------|
| cosine_accuracy@1 | 0.625 |
| cosine_accuracy@3 | 0.875 |
| cosine_accuracy@5 | 0.875 |
| cosine_accuracy@10 | 1.0 |
| cosine_precision@1 | 0.625 |
| cosine_precision@3 | 0.2917 |
| cosine_precision@5 | 0.175 |
| cosine_precision@10 | 0.1 |
| cosine_recall@1 | 0.625 |
| cosine_recall@3 | 0.875 |
| cosine_recall@5 | 0.875 |
| cosine_recall@10 | 1.0 |
| cosine_ndcg@10 | 0.8058 |
| cosine_mrr@10 | 0.7448 |
| **cosine_map@100** | **0.7448** |
#### Information Retrieval
* Dataset: `dim_128`
* Evaluated with [<code>InformationRetrievalEvaluator</code>](https://sbert.net/docs/package_reference/sentence_transformer/evaluation.html#sentence_transformers.evaluation.InformationRetrievalEvaluator)
| Metric | Value |
|:--------------------|:-----------|
| cosine_accuracy@1 | 0.75 |
| cosine_accuracy@3 | 0.875 |
| cosine_accuracy@5 | 1.0 |
| cosine_accuracy@10 | 1.0 |
| cosine_precision@1 | 0.75 |
| cosine_precision@3 | 0.2917 |
| cosine_precision@5 | 0.2 |
| cosine_precision@10 | 0.1 |
| cosine_recall@1 | 0.75 |
| cosine_recall@3 | 0.875 |
| cosine_recall@5 | 1.0 |
| cosine_recall@10 | 1.0 |
| cosine_ndcg@10 | 0.8609 |
| cosine_mrr@10 | 0.8167 |
| **cosine_map@100** | **0.8167** |
#### Information Retrieval
* Dataset: `dim_64`
* Evaluated with [<code>InformationRetrievalEvaluator</code>](https://sbert.net/docs/package_reference/sentence_transformer/evaluation.html#sentence_transformers.evaluation.InformationRetrievalEvaluator)
| Metric | Value |
|:--------------------|:-----------|
| cosine_accuracy@1 | 0.75 |
| cosine_accuracy@3 | 0.875 |
| cosine_accuracy@5 | 1.0 |
| cosine_accuracy@10 | 1.0 |
| cosine_precision@1 | 0.75 |
| cosine_precision@3 | 0.2917 |
| cosine_precision@5 | 0.2 |
| cosine_precision@10 | 0.1 |
| cosine_recall@1 | 0.75 |
| cosine_recall@3 | 0.875 |
| cosine_recall@5 | 1.0 |
| cosine_recall@10 | 1.0 |
| cosine_ndcg@10 | 0.8609 |
| cosine_mrr@10 | 0.8167 |
| **cosine_map@100** | **0.8167** |
<!--
## Bias, Risks and Limitations
*What are the known or foreseeable issues stemming from this model? You could also flag here known failure cases or weaknesses of the model.*
-->
<!--
### Recommendations
*What are recommendations with respect to the foreseeable issues? For example, filtering explicit content.*
-->
## Training Details
### Training Dataset
#### Unnamed Dataset
* Size: 76 training samples
* Columns: <code>positive</code> and <code>anchor</code>
* Approximate statistics based on the first 1000 samples:
| | positive | anchor |
|:--------|:------------------------------------------------------------------------------------|:---------------------------------------------------------------------------------|
| type | string | string |
| details | <ul><li>min: 8 tokens</li><li>mean: 148.89 tokens</li><li>max: 512 tokens</li></ul> | <ul><li>min: 3 tokens</li><li>mean: 6.54 tokens</li><li>max: 18 tokens</li></ul> |
* Samples:
| positive | anchor |
|:----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------|:----------------------------------------------------------------|
| <code>1 (AGACTCCATATGGAGTCTAGC CAAACAGGAACA); a reverse template comprising a nucleotide sequence having at least 80, 85 or 95% identity 55 (CGACTCCATATGGAGTC to GAAAGCAATCTGAGGA); and a probe oligonucleotide comprising a nucleotide sequence at least 80, 85 or 95%</code> | <code>to SEQ ID NO</code> |
| <code>One potential inhibitor of the NEAR technology is human gDNA. When a throat swab sample is collected from a patient symptomatic for GAS infection, it is possible that human gDNA is also collected on the swab (from immune cells such as white blood cells or from local epithelial cells). In order to assess the impact that human gDNA has on the GAS assay, a study was performed using three different levels of GAS gDNA (25, 250 and 1000 copies) in the presence of 0, 10, 50, 100, 250, 500 or 1000 ng of human gDNA. As shown in FIG. 6, the presence of human gDNA does have an impact on GAS assay performance, and the impact is GAS target concentration dependent. When there is a low copy number of target GAS present in the reaction, 10 ng of human gDNA or more significantly inhibits the assay. At 250 copies of GAS target, the impact of 10 ng of 60 human gDNA is less, and at 1,000 copies of GAS target, the effect of 10 ng of human gDNA on the assay is significantly less. In fact, when 1,000 copies of target is present in the assay, up to 100 ng of human gDNA can be tolerated, albeit with a slower amplification speed and reduced fluorescence signal. Testing of the 501 (IC only) mix showed a more robust response to human gDNA. When the 501 mix was tested in the presence of O copies of target GAS and up to US 10,329,601 B2 23 1,000 ng of human gDNA, the assay still produced a clearly positive signal at 500 ng of human gDNA (even at 1,000 ng of human gDNA the fluorescence signal was still above background). Other Embodiments It is to be understood that while the invention has been described in conjunction with the detailed description 24 thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.</code> | <code>Impact of Human Genomic DNA (gDNA) on GAS Assay</code> |
| <code>25C-4x lyophilization mix, single tube assay format; 50C-2x lyophilization mix, single tube assay format; 25T-4x lyophilization mix, target assay only; 50T-2x lyophilization mix, target assay only; 25I- 4x lyophilization mix, IC assay only; 50I-2x lyophilization mix, internal control (IC) assay only. The GAS NEAR assay can be run on an appropriate platform. For example, the GAS NEAR assay can be run on an Al ere i platform (www.alere.com/ww/en/product-details/ alere-i-strep-a.html). AnA!ere i system consists of an instru ment which provides heating, mixing and fluorescence detection with automated result output, and a set of dispos ables, consisting of the sample receiver (where the elution buffer is stored), a test base ( containing two tubes of lyophilized NEAR reagents) and a transfer device ( designed to transfer 100 µI aliquots of eluted sample from the sample receiver to each of the two tubes containing lyophilized NEAR reagents located in the test base). Suitable dispos ables for use with the Alere i GAS NEAR test include those 60 described in, for example U.S. application Ser. No. 13/242, 999, incorporated herein by reference in its entirety. In addition to containing the reagents necessary for driv ing the GAS NEAR assay, the lyophilized material also contains the lytic agent for GAS, the protein plyC; therefore, 65 GAS lysis does not occur until the lyophilized material is re-suspended. In some cases, the lyophilized material does not contain a lytic agent for GAS, for example, in some US 10,329,601 B2 19 examples, the lyophilized material does not contain the protein plyC. The elution buffer was designed to allow for the rapid release of GAS organisms from clinical sample throat swabs as well as to provide the necessary salts for driving the NEAR assay (both MgSO4 and (NH4)2SO4), in 5 a slightly basic environment. In some examples, the elution buffer also includes an anti-microbial agent or preservative (e.g., ProClin® 950). For the present examples, GAS assay was performed as a two tube assay-a GAS target specific assay in one tube, and an internal control (IC) assay in a second tube (tested side by side on the Alere i).</code> | <code>annotated as follows</code> |
* Loss: [<code>MatryoshkaLoss</code>](https://sbert.net/docs/package_reference/sentence_transformer/losses.html#matryoshkaloss) with these parameters:
```json
{
"loss": "MultipleNegativesRankingLoss",
"matryoshka_dims": [
768,
512,
256,
128,
64
],
"matryoshka_weights": [
1,
1,
1,
1,
1
],
"n_dims_per_step": -1
}
```
### Training Hyperparameters
#### Non-Default Hyperparameters
- `eval_strategy`: epoch
- `per_device_train_batch_size`: 16
- `per_device_eval_batch_size`: 16
- `gradient_accumulation_steps`: 16
- `learning_rate`: 3e-05
- `num_train_epochs`: 40
- `lr_scheduler_type`: cosine
- `warmup_ratio`: 0.2
- `fp16`: True
- `load_best_model_at_end`: True
- `optim`: adamw_torch_fused
#### All Hyperparameters
<details><summary>Click to expand</summary>
- `overwrite_output_dir`: False
- `do_predict`: False
- `eval_strategy`: epoch
- `prediction_loss_only`: True
- `per_device_train_batch_size`: 16
- `per_device_eval_batch_size`: 16
- `per_gpu_train_batch_size`: None
- `per_gpu_eval_batch_size`: None
- `gradient_accumulation_steps`: 16
- `eval_accumulation_steps`: None
- `learning_rate`: 3e-05
- `weight_decay`: 0.0
- `adam_beta1`: 0.9
- `adam_beta2`: 0.999
- `adam_epsilon`: 1e-08
- `max_grad_norm`: 1.0
- `num_train_epochs`: 40
- `max_steps`: -1
- `lr_scheduler_type`: cosine
- `lr_scheduler_kwargs`: {}
- `warmup_ratio`: 0.2
- `warmup_steps`: 0
- `log_level`: passive
- `log_level_replica`: warning
- `log_on_each_node`: True
- `logging_nan_inf_filter`: True
- `save_safetensors`: True
- `save_on_each_node`: False
- `save_only_model`: False
- `restore_callback_states_from_checkpoint`: False
- `no_cuda`: False
- `use_cpu`: False
- `use_mps_device`: False
- `seed`: 42
- `data_seed`: None
- `jit_mode_eval`: False
- `use_ipex`: False
- `bf16`: False
- `fp16`: True
- `fp16_opt_level`: O1
- `half_precision_backend`: auto
- `bf16_full_eval`: False
- `fp16_full_eval`: False
- `tf32`: None
- `local_rank`: 0
- `ddp_backend`: None
- `tpu_num_cores`: None
- `tpu_metrics_debug`: False
- `debug`: []
- `dataloader_drop_last`: False
- `dataloader_num_workers`: 0
- `dataloader_prefetch_factor`: None
- `past_index`: -1
- `disable_tqdm`: False
- `remove_unused_columns`: True
- `label_names`: None
- `load_best_model_at_end`: True
- `ignore_data_skip`: False
- `fsdp`: []
- `fsdp_min_num_params`: 0
- `fsdp_config`: {'min_num_params': 0, 'xla': False, 'xla_fsdp_v2': False, 'xla_fsdp_grad_ckpt': False}
- `fsdp_transformer_layer_cls_to_wrap`: None
- `accelerator_config`: {'split_batches': False, 'dispatch_batches': None, 'even_batches': True, 'use_seedable_sampler': True, 'non_blocking': False, 'gradient_accumulation_kwargs': None}
- `deepspeed`: None
- `label_smoothing_factor`: 0.0
- `optim`: adamw_torch_fused
- `optim_args`: None
- `adafactor`: False
- `group_by_length`: False
- `length_column_name`: length
- `ddp_find_unused_parameters`: None
- `ddp_bucket_cap_mb`: None
- `ddp_broadcast_buffers`: False
- `dataloader_pin_memory`: True
- `dataloader_persistent_workers`: False
- `skip_memory_metrics`: True
- `use_legacy_prediction_loop`: False
- `push_to_hub`: False
- `resume_from_checkpoint`: None
- `hub_model_id`: None
- `hub_strategy`: every_save
- `hub_private_repo`: False
- `hub_always_push`: False
- `gradient_checkpointing`: False
- `gradient_checkpointing_kwargs`: None
- `include_inputs_for_metrics`: False
- `eval_do_concat_batches`: True
- `fp16_backend`: auto
- `push_to_hub_model_id`: None
- `push_to_hub_organization`: None
- `mp_parameters`:
- `auto_find_batch_size`: False
- `full_determinism`: False
- `torchdynamo`: None
- `ray_scope`: last
- `ddp_timeout`: 1800
- `torch_compile`: False
- `torch_compile_backend`: None
- `torch_compile_mode`: None
- `dispatch_batches`: None
- `split_batches`: None
- `include_tokens_per_second`: False
- `include_num_input_tokens_seen`: False
- `neftune_noise_alpha`: None
- `optim_target_modules`: None
- `batch_eval_metrics`: False
- `eval_on_start`: False
- `batch_sampler`: batch_sampler
- `multi_dataset_batch_sampler`: proportional
</details>
### Training Logs
| Epoch | Step | Training Loss | dim_128_cosine_map@100 | dim_256_cosine_map@100 | dim_512_cosine_map@100 | dim_64_cosine_map@100 | dim_768_cosine_map@100 |
|:--------:|:------:|:-------------:|:----------------------:|:----------------------:|:----------------------:|:---------------------:|:----------------------:|
| 0 | 0 | - | 0.2103 | 0.1702 | 0.1888 | 0.1783 | 0.1815 |
| 1.0 | 1 | - | 0.2102 | 0.1702 | 0.1888 | 0.1783 | 0.1815 |
| 2.0 | 2 | - | 0.2104 | 0.1705 | 0.1890 | 0.1797 | 0.1815 |
| 3.0 | 3 | - | 0.2841 | 0.1733 | 0.2524 | 0.1997 | 0.2465 |
| 4.0 | 5 | - | 0.3285 | 0.2747 | 0.2865 | 0.3281 | 0.2901 |
| 5.0 | 6 | - | 0.3311 | 0.3045 | 0.2996 | 0.3930 | 0.3001 |
| 6.0 | 7 | - | 0.3948 | 0.3808 | 0.3193 | 0.4576 | 0.3147 |
| 7.0 | 9 | - | 0.5308 | 0.4366 | 0.4222 | 0.5445 | 0.4367 |
| 8.0 | 10 | 3.233 | 0.5352 | 0.5240 | 0.5224 | 0.5867 | 0.4591 |
| 9.0 | 11 | - | 0.5438 | 0.5864 | 0.5228 | 0.6519 | 0.6475 |
| 10.0 | 13 | - | 0.6540 | 0.5906 | 0.6554 | 0.6684 | 0.6511 |
| 11.0 | 14 | - | 0.6585 | 0.6020 | 0.6684 | 0.6857 | 0.6621 |
| 12.0 | 15 | - | 0.6632 | 0.6661 | 0.6798 | 0.7063 | 0.6685 |
| 13.0 | 17 | - | 0.7292 | 0.7210 | 0.6971 | 0.7396 | 0.7062 |
| 14.0 | 18 | - | 0.7396 | 0.7375 | 0.7229 | 0.8333 | 0.7068 |
| 15.0 | 19 | - | 0.75 | 0.7438 | 0.7021 | 0.8333 | 0.7083 |
| 16.0 | 20 | 1.4113 | 0.7604 | 0.7292 | 0.7042 | 0.8229 | 0.7104 |
| 17.0 | 21 | - | 0.7542 | 0.7262 | 0.7095 | 0.8229 | 0.7158 |
| 18.0 | 22 | - | 0.7438 | 0.7344 | 0.7054 | 0.8167 | 0.7188 |
| 19.0 | 23 | - | 0.8063 | 0.7344 | 0.7125 | 0.8125 | 0.7021 |
| 20.0 | 25 | - | 0.7958 | 0.7344 | 0.7262 | 0.8125 | 0.7333 |
| 21.0 | 26 | - | 0.8021 | 0.7344 | 0.7470 | 0.8095 | 0.7333 |
| 22.0 | 27 | - | 0.8021 | 0.7344 | 0.7470 | 0.8095 | 0.7333 |
| 23.0 | 29 | - | 0.8021 | 0.7344 | 0.7470 | 0.8095 | 0.7438 |
| 24.0 | 30 | 0.6643 | 0.8021 | 0.7448 | 0.7470 | 0.8125 | 0.7438 |
| 25.0 | 31 | - | 0.8125 | 0.7448 | 0.7470 | 0.8125 | 0.7604 |
| 26.0 | 33 | - | 0.8125 | 0.7448 | 0.75 | 0.8167 | 0.7604 |
| 27.0 | 34 | - | 0.8125 | 0.7448 | 0.75 | 0.8167 | 0.7604 |
| 28.0 | 35 | - | 0.8125 | 0.7448 | 0.75 | 0.8167 | 0.7604 |
| **29.0** | **37** | **-** | **0.8167** | **0.7448** | **0.75** | **0.8167** | **0.7604** |
| 30.0 | 38 | - | 0.8167 | 0.7448 | 0.75 | 0.8167 | 0.7604 |
| 31.0 | 39 | - | 0.8167 | 0.7448 | 0.75 | 0.8167 | 0.7604 |
| 32.0 | 40 | 0.4648 | 0.8167 | 0.7448 | 0.75 | 0.8167 | 0.7604 |
* The bold row denotes the saved checkpoint.
### Framework Versions
- Python: 3.10.12
- Sentence Transformers: 3.0.1
- Transformers: 4.42.4
- PyTorch: 2.3.1+cu121
- Accelerate: 0.32.1
- Datasets: 2.20.0
- Tokenizers: 0.19.1
## Citation
### BibTeX
#### Sentence Transformers
```bibtex
@inproceedings{reimers-2019-sentence-bert,
title = "Sentence-BERT: Sentence Embeddings using Siamese BERT-Networks",
author = "Reimers, Nils and Gurevych, Iryna",
booktitle = "Proceedings of the 2019 Conference on Empirical Methods in Natural Language Processing",
month = "11",
year = "2019",
publisher = "Association for Computational Linguistics",
url = "https://arxiv.org/abs/1908.10084",
}
```
#### MatryoshkaLoss
```bibtex
@misc{kusupati2024matryoshka,
title={Matryoshka Representation Learning},
author={Aditya Kusupati and Gantavya Bhatt and Aniket Rege and Matthew Wallingford and Aditya Sinha and Vivek Ramanujan and William Howard-Snyder and Kaifeng Chen and Sham Kakade and Prateek Jain and Ali Farhadi},
year={2024},
eprint={2205.13147},
archivePrefix={arXiv},
primaryClass={cs.LG}
}
```
#### MultipleNegativesRankingLoss
```bibtex
@misc{henderson2017efficient,
title={Efficient Natural Language Response Suggestion for Smart Reply},
author={Matthew Henderson and Rami Al-Rfou and Brian Strope and Yun-hsuan Sung and Laszlo Lukacs and Ruiqi Guo and Sanjiv Kumar and Balint Miklos and Ray Kurzweil},
year={2017},
eprint={1705.00652},
archivePrefix={arXiv},
primaryClass={cs.CL}
}
```
<!--
## Glossary
*Clearly define terms in order to be accessible across audiences.*
-->
<!--
## Model Card Authors
*Lists the people who create the model card, providing recognition and accountability for the detailed work that goes into its construction.*
-->
<!--
## Model Card Contact
*Provides a way for people who have updates to the Model Card, suggestions, or questions, to contact the Model Card authors.*
--> |