Datasets:

Blaise-g

/

PubMed_summ

like 0

it is the fourth most common form of cancer in the us and the third leading cause of cancer - related death in the western world. in patients with localized disease, standard treatment includes surgical resection of the tumor, followed by adjuvant chemotherapy in case of regional lymph node metastases. though curative treatment options are increasingly available in case of metastatic disease, treatment in this situation is still most often palliative. in case of metastatic disease, median overall survival without chemotherapy is approximately 8 months, with a 1-year survival of 34%. when 5-fluorouracil / leucovorin (5-fu / lv) or the equally effective and toxic oral 5-fu prodrug capecitabine is combined with irinotecan or oxaliplatin and bevacizumab, the median survival increases to more than 20 months, with a 1-year survival of 74%. following first - line treatment with folfox or capox, irinotecan is frequently used as second - line therapy. irinotecan (cpt-11) is a prodrug that requires activation by carboxylesterases to yield the potent topoisomerase i inhibitor sn-38 that inhibits dna double strand replication and cell division. well - known side effects of irinotecan are the of the induction of an acute cholinergic syndrome and include rhinitis, increased salivation, miosis, lacrimation, diaphoresis, flushing, and intestinal hyperperistalsis. this cholinergic activity is caused by binding of irinotecan to the active site gorge of acetylcholinesterase ing in its subsequent functional inhibition. here, we describe the case of a patient with metastatic rectal carcinoma who received second - line therapy with irinotecan and developed isolated transient dysarthria following each administration of irinotecan. although we are aware of the reports of 7 patients experiencing this unique and isolated toxic effect, our case is the 1st to include online supplementary video and speech recordings (www.karger.com/doi/10.1159/000336156). a 46-year - old male was referred to our outpatient clinic because of metastatic rectal cancer. one year earlier he was treated with neoadjuvant capecitabine - based chemoradiotherapy and a low anterior resection in another hospital. six months later, he was treated with radiofrequency ablation and transarterial chemoembolization because of liver metastases. as this procedure was complicated by sepsis, ischemia of the left liver lobe and abscesses, his clinical condition at that time impeded the use of adjuvant chemotherapy. unfortunately, new liver metastases, lymph node metastases, and an adrenal metastasis developed over the next months. after referral to our department, first - line palliative chemotherapy (3-weekly : i.v . oxaliplatin 130 mg / m day 1 ; oral capecitabine 1,000 mg / m b.i.d . unfortunately, progressive disease developed after a total of 10 cycles . after a therapy - free interval of 2 months, second - line chemotherapy with irinotecan ( i.v . standard premedication included atropine ( 0.25 mg s.c .), dexamethasone (10 mg i.v .) and ondansetron (8 mg i.v .). a neurologist confirmed that the dysarthria, which resolved spontaneously within 24 h, was not accompanied by any other neurological symptom apart from the known nci - ctc grade 1 peripheral polyneuropathy that ed from prior oxaliplatin exposure. mr imaging of the brain, including diffusion weighted imaging, did not show any structural or perfusion abnormalities (fig . as ondansetron and dexamethasone had also been used previously in combination with first - line chemotherapy in this patient, these agents could not be responsible for the observed dysarthria . a causative role of atropine was excluded by administering atropine premedication ( 0.25 mg s.c .) 2 h prior to the administration of irinotecan; dysarthria did not occur after atropine alone, while subsequent administration of irinotecan again induced dysarthria. acoustic analyses (see video and speech recordings) performed by an experienced speech therapist and otolaryngologist indicated a reduced capacity in fine - tuning of motor functions of the tip of the tongue and a minimal reduction in the power of speech at labiodental contact. also, a reduction in sound coordination was found predominantly for consonants generated by the tip of the tongue. for example, notable changes were observed in the cluster / str / in stretch, destroy, and stranger requiring a coordinated activity of the tip of the tongue and in practice requiring a rapid relatively large movement of the tongue. the patient experienced the dysarthria as only slightly bothersome and, apart from alopecia, he experienced no other toxicity. after an initial radiological response, treatment with irinotecan was stopped after 9 cycles because of progressive disease (fig . speech is based on the fast and varied contractions of oral-, pharyngeal-, and laryngeal muscles . dysarthria is caused by a motility disorder of these muscles caused by upper motor neuron lesions of the cerebral hemispheres or lower motor neuron lesions of the brain stem, but can also from disruption of the integrated action of upper motor neurons, basal ganglia, and cerebellum . no other neurological signs or symptoms were noted and radiological evaluation ( conventional and diffusion - weighted mri) showed no abnormalities, which is in line with previously reported cases. analyses by an otolaryngologist and speech therapist indicated that the dysarthria predominantly affected consonants generated by the tip of the tongue, and although the anatomical level of these disturbances can not be determined with certainty, it is believed to originate centrally at the level of the brainstem. the exact pathogenesis of irinotecan - induced dysarthria is still unknown, but several possible mechanisms have been put forward. gomez et al. reported a case in which tremors and ataxia preceded the development of dysarthria during the third and subsequent cycle of an irinotecan - containing chemotherapy regimen and suggested that the use of atropine could prevent progression to dysarthria. notably, however, this preventive effect of additionally administered atropine was not observed in our case or in the case reported by hamberg. this difference could be related to differences in the dose of irinotecan, which was substantially lower in the case reported by gomez et al. atropine itself was not responsible for the observed toxicity as we found that its sole administration to the patient did not in dysarthria. because an earlier study demonstrated that the pharmacokinetics of irinotecan were not different in patients developing dysarthria, the isolated dysarthria can not be explained by differences in systemic clearance of irinotecan. irinotecan increases cholinergic activity by binding to the active site gorge of acetylcholinesterase ing in its functional inhibition. because of its innervation of tongue muscles, the hypoglossal nerve plays an important role in speech and its overstimulation or damage can cause dysarthria. as the density of cholinergic receptors is relatively high in brainstem nuclei and the application of cholinergic agents in a large increase in hypoglossal nerve activity compared to e.g. phrenic nerve activity , we believe that the occurrence of isolated dysarthria in patients treated with irinotecan could be related to this apparent intrinsic increased sensitivity of hypoglossal nerve activity to cholinergic stimulation. unfortunately, we could not directly test this hypothesis because of progressive disease in our patient. in future cases , the use of pharmacological functional mri or pet scans with n--methyl-4-piperidyl acetate to measure acetylcholinesterase activity could be helpful in elucidating the pathophysiology of irinotecan - induced isolated dysarthria. in , selective irinotecan - induced dysarthria is an unusual and impressive entity, which can occur within minutes of irinotecan infusion. it is potentially related to a relative cholinergic oversensitivity of neurons in the area of the nucleus of the hypoglossal nerve. though atropine can decrease cholinergic symptoms, it has not been conclusively shown to prevent the occurrence of dysarthria. of note, as symptoms were fully reversible in all cases reported to date (in a period differing from 15 min to several hours) and did not increase in severity upon readministration of irinotecan, awareness of this phenomenon is critical in order to prevent unnecessary cessation of a potentially effective anticancer chemotherapeutic agent.

colorectal carcinomas are among the most common tumor types and are generally treated with palliative chemotherapy in case of metastatic disease. here, we describe the case of a 46-year - old patient with metastatic rectal carcinoma who received second - line therapy with irinotecan and developed isolated transient dysarthria (with normal mr imaging of the brain) following each administration of irinotecan. neurological and logopedical evaluation revealed that the dysarthria predominantly ed from a reduced capacity in fine - tuning of motor functions of the tip of the tongue and a minimal reduction in the power of speech at labiodental contact. as hypoglossal nerve activity has been reported to be especially susceptible to cholinergic stimulation and irinotecan can cause cholinergic side effects by binding to and inactivating acetylcholinesterase, we suspect this mechanism to be responsible for irinotecan - induced dysarthria.

human adult gut microbiota is estimated to consist of up to 100 trillion microorganisms, comprising at least 500 different species, mostly anaerobic bacteria. although the advent of modern molecular microbiological methods has expanded the degree of bacterial detection from stool samples, it does not allow for the phenotypic description of new living species. consequently, there has been renewed interest in culture methods. a new taxonomic approach known as taxonogenomics this polyphasic strategy combines phenotypic characteristics, the matrix - assisted laser desorption / ionization time - of - flight mass spectrometry (maldi - tof ms) spectrum, and the analysis and comparison of the complete genome sequence. since the creation of the genus clostridium in 1880, while species belonging to the family clostridiaceae are mainly associated with the commensal digestive flora of mammals and can be commonly found in the environment, some are major human pathogens, including toxigenic clostridium botulinum, peptoclostridium difficile, clostridium tetani and clostridium perfringens. , strain gd3 (= csur p1929 = dsm 100334) as the type strain of c. phoceensis sp. this strain was isolated from the gut microbiota of a 28-year - old healthy french man as part of a culturomics study aiming at individually cultivating all bacterial species from a stool sample. here the sample was collected as part of a research study on the human gut microbiota. the study was approved by the institut fdratif de recherche 48 (agreement no . 09 - 022, marseille, france), and the patient's consent was obtained. the sample was stored at 80c in la timone hospital (marseille, france). the colonies obtained were identified using maldi - tof ms, (bruker daltonics, leipzig, germany) and analysed using a microflex spectrometer (bruker), leading to the protein spectrum being obtained. subsequently, 16s rrna was sequenced and the sequence was matched using blast (basic local alignment search tool) against the national center for biotechnology information database. dna was extracted using the ez1 tissue extraction kit (qiagen, hilden, germany), and sequences were aligned using chromaspro 1.6 (technelysium, south brisbane, queensland, australia). five growth temperatures (ambient, 28, 37, 45 and 56c) were tested under anaerobic (genbag anaer) microaerophilic atmospheres (genbag microer) (biomrieux, marcy ltoile, france) and aerobic condition on 5% sheep's blood agar (biomrieux). colonies were obtained after thermal shock for 20 minutes at 80c in an anaerobic blood culture bottle (bactec lytic/10 anaerobic / f) supplemented with 5% sheep's blood at 37c. gram staining, motility, catalase and oxidase were determined as described by lagier et al.. sporulation was tested using a thermal shock on bacterial colonies (diluted in phosphate - buffered saline) for 10 minutes at 80c. the biochemical characteristics were tested using api 50ch, api zym and api 20a strips (biomrieux). two samples were prepared with 2 mg of bacterial biomass from several culture plates. two samples were prepared with approximately 2 mg of bacterial biomass per tube collected from several culture plates. gc / ms analyses were carried out as described by dione et al.. briefly, fames were separated using an elite 5-ms column and monitored by mass spectrometry (clarus 500-sq8s ; perkinelmer, courtaboeuf, france). a spectral database search was performed using ms search 2.0 operated using the standard reference database 1a (national institute of standards and technology, gaithersburg, md, usa) and the fame mass spectral database (wiley, chichester, uk). individual cells of c. phoceensis strain gd3 were captured using a tecnai g20 electron microscopy (fei company, limeil - brevannes, france). a color gram 2 kit (biomrieux) was used to perform the gram coloration observed with a 100 oil - immersion objective lens using the dm1000 photonic microscope (leica, wetzlar, germany),. the organism was selected for sequencing because it had been isolated from a healthy person for the first time and on the basis of its 16s rrna similarity, phylogenetic position and phenotypic differences with other members of the genus clostridia. the genbank accession number is cvug01000000 and consists of 10 scaffolds with a total of 16 contigs. the genomic dna of clostridium phoceensis gd3 was sequenced on the miseq sequencer (illumina, san diego, ca, usa) using the mate - pair strategy. the gdna was barcoded in order to be mixed with 11 other projects using the nextera mate - pair sample prep kit (illumina). the mate - pair library was prepared with 1.5 g of genomic dna using the nextera mate - pair illumina guide. the gdna sample was simultaneously fragmented and tagged using a mate - pair junction adapter. the pattern of the fragmentation was validated on an agilent 2100 bioanalyzer (agilent technologies, santa clara, ca, usa) with a dna 7500 lab chip. the dna fragments ranged in size from 1 to 10 kb, with an optimal size of 4.490 kb. no size selection was performed, and only 600 ng of tagmented fragments were circularized. the circularized dna was mechanically sheared to small fragments with an optimal size of 938 bp on the covaris s2 device in microtubes (covaris, woburn, ma, usa). the library profile was visualized on a high sensitivity bioanalyzer labchip (agilent technologies), and the final library concentration was measured at 4.457 after a denaturation step and dilution at 15 pm, the pool of libraries was loaded onto the reagent cartridge and then onto the instrument along with the flow cell. automated cluster generation and sequencing run were performed in a single 39-hour run in a 2 251 bp; 6.1 gb of total information was obtained from a 653k / mm cluster density, with a cluster passing quality control filters of 96.1% (12 031 000 clusters). within this run, the index representation for c. phoceensis gd3 was determined to 9.32%. the 1 121 200 paired reads were filtered according to the read qualities. these reads were trimmed, then assembled by spdes software. finally, the draft genome of c. phoceensis gd3 consisted of ten scaffolds with 16 contigs and generated a genome size of 3.4 mb with 59.32% g+c content. open reading frames (orfs) were predicted using prodigal with default parameters, although the predicted orfs were excluded if they spanned a sequencing gap region. the predicted bacterial protein sequences were searched against the genbank database and the clusters of orthologous groups (cogs) databases using blastp. the trna genes were found using the trnascanse tool, while rnammer was used to find ribosomal rnas and blastn against the genbank database. lipoprotein signal peptides and the number of transmembrane helices were predicted using signalp and tmhmm respectively. artemis was used for data management, and dna plotter was used to visualize genomic features. to estimate the mean level of nucleotide sequence similarity at the genome level , we used homemade average genomic identity of orthologous gene sequences (agios) software. maldi - tof ms failed to identify the strain gd3, so its mass spectrum was added to the bruker database (fig . 1). to improve identification, 16s rrna sequencing was performed, and the access number in 16s rrna embl - ebi (european molecular biology laboratory the highest value of nucleotide sequence similarity was observed with flavonifractor plautii ( 97%), the phylogenetically closest species. c. phoceensis strain gd3 is a gram - negative (fig . 2), spore - forming, nonmotile, strictly anaerobic bacterium that has no catalase and oxidase activities, measuring 1.8 m in length and 0.5 m in diameter (fig . 3). the sporulation test was positive; the organism grows at 45c in anaerobic conditions. using the api zym gallery, c. phoceensis exhibits esterase (c4), phosphatase acid, naphthol - as - bi - phosphohydrolase and -glucosidase activities. when using the api 20a gallery, a positive reaction was only observed for d - glucose (table 1). of the antibiotics tested, c. phoceensis was found to be sensitive to amoxicillin, amoxicillin the predominant cellular fatty acids of c. phoceensis strain gd3 are hexadecanoic acid (16:0 ; 33.1 1.7%), 9-octadecenoic acid (18:1n9 ; 24.3 0.6%), octadecanoic acid (18:0 ; 20.0 0.1%), 9,12-octadecadienoic acid (18:2n6 ; 8.6 0.1%), 11-octadecenoic acid (18:1n7 ; 5.5 0.5%), tetradecanoic acid (14:0 ; 4.7 0.8%) and trace amounts (less than 1%) of heptadecanoic acid, 9-hexadecenoic acid, pentadecanoic acid, 15-methyl - hexadecanoic acid, 14-methyl - hexadecanoic acid, 10-heptadecenoic acid, 13-methyl - tetradecanoic acid and 12-methyl - tetradecanoic acid (table 2). a phylogenetic tree highlighting the position of clostridium phoceensis gd3 relative to other type strains within the order clostridiales is provided in fig. the genome of the c. phoceensis strain gd3 is 3 453 562 bp long with 59.32% g+c content. a total of 3320 genes were predicted, of which 3264 were protein - coding genes and 56 were rna genes (three genes are 5s rrna, one gene is 16s rrna, one gene is 23s rrna and 51 genes are trna genes). a total of 227 genes (6.95%) were identified as orfans. the remaining genes (28.92%) the properties and statistics of the genome are summarized in table 3 and fig. the distribution of genes into cogs functional categories is presented in table 4 and fig. we made some brief comparisons against nine genomes: intestinimonas butyriciproducens strain er1 (genbank accession no . jpjd01000000), flavonifractor plautii atcc 29863 (agck01000000), clostridium leptum dsm 753 (abcb02000000), clostridium cellulosi dg5 (nz_lm995447), ethanoligenens harbinense yuan-3 (nc_01482), oscillibacter valericigenes sjm18 - 20 (nc_016048), clostridium viride dsm 6836 (nz_jhzo01000000), eubacterium siraeum v10sc8a (fp929059) and pseudoflavonifractor capillosus atcc 29799 (nz_aaxg02000000). the draft genome sequence of c. phoceensis is smaller than those of pseudoflavonifractor capillosus, oscillibacter valericigenes, flavonifractor plautii, clostridium cellulosi and intestinimonas butyriciproducens (3.45, 4.24, 4.47, 3.81, 5.68 and 3.57 mb respectively), but larger than those of clostridium viride, ethanoligenens harbinense, clostridium leptum and eubacterium siraeum (2.41, 3.01, 2.82 and 2.84 mb respectively). the g+c content of c. phoceensis is smaller than those of flavonifractor plautii (59.32 and 61.07% respectively) but larger than those of pseudoflavonifractor capillosus, oscillibacter valericigenes, clostridium viride, ethanoligenens harbinense, clostridium leptum, eubacterium siraeum, clostridium cellulosi and intestinimonas butyriciproducens (59.11, 53.19, 49.28, 55.56, 50.25, 45.13, 42.07 and 58.44% respectively). the gene content of c. phoceensis is smaller than those of pseudoflavonifractor capillosus, oscillibacter valericigenes, flavonifractor plautii, clostridium cellulosi and intestinimonas butyriciproducens (3264, 4829, 4723, 4278, 5171 and 3529 respectively) but larger than those of clostridium viride, ethanoligenens harbinense, clostridium leptum and eubacterium siraeum (2321, 2701, 2482 and 2211 c. phoceensis has a similar distribution of genes into cogs categories with the most of the compared species ( fig . 4) however, clostridium cellulosi was overrepresented for all the categories, and clostridium viride was overrepresented for category z (cytoskeleton). in addition, clostridium phoceensis shared 846, 884, 492, 562, 482, 717, 634, 407 and 842 orthologous genes respectively with intestinimonas butyriciproducens, flavonifractor plautii, clostridium leptum, clostridium cellulosi, ethanoligenens harbinense, oscillibacter valericigenes, clostridium viride, eubacterium siraeum and pseudoflavonifractor capillosus (table 5). of these species, the orthologous genes shared ranged from 365 between eubacterium siraeum and clostridium viride to 1079 between flavonifractor plautii and intestinimonas butyriciproducens. compared to other species, c. phoceensis exhibited agios values ranging from 56.64 with ethanoligenens harbinense to 71.58 with flavonifractor plautii. on the basis of taxonogenomic analyses, we propose clostridium phoceensis sp. nov., strain gd3 (= csur p1929 = dsm 100334), as the type strain of c. phoceensis sp. this strain was isolated from the gut microbiota of a 28-year - old healthy french man. adj., from phoceensis referring to phocea, the greek name of the city which founded marseille, where it was isolated ) is a gram - negative nonmotile bacillus whose individual cell size is 1.8 m in length and 0.5 m in diameter. strain gd3 is catalase and oxidase negative, and its optimal growth temperature is 45c, but it also grows weakly at 37c. biochemical analyses showed positive reactions of c. phoceensis for d - glucose and produced esterase (c4), phosphatase acid, naphthol - as - bi - phosphohydrolase and -glucosidase enzymes. c. phoceensis was sensitive to amoxicillin, amoxicillin its predominant cellular fatty acids are hexadecanoic acid (16:0 ; 33.1 1.7%), 9-octadecenoic acid (18:1n9 ; 24.3 0.6%), octadecanoic acid (18:0 ; 20.0 0.1%), 9,12-octadecadienoic acid (18:2n6 ; 8.6 0.1%), 11-octadecenoic acid (18:1n7 ; 5.5 0.5%) and tetradecanoic acid (14:0 ; 4.7 0.8%). strain gd3, whose csur and dsmz numbers are respectively csur p1929 and dsm 100334, was identified from the stool sample of a 28-year - old healthy french man.

clostridium phoceensis sp. nov. , strain gd3 t (= csur p1929 = dsm 100334) is the type strain of c. phoceensis sp. nov. , a new species within the genus clostridium. this strain was isolated from the gut microbiota of a 28-year - old healthy french man. c. phoceensis is a gram - negative, spore - forming, nonmotile, strictly anaerobic bacterium. we describe its complete genome sequence and annotation, together with its phenotypic characteristics.

primary cutaneous malignant melanoma (cmm) is an increasingly frequent malignancy in the white population of western countries. the tumour size is closely associated with cell proliferation including the size of the growth fraction. in recent years , some progress has been reached in the understanding of primary genetic alterations involved in the cmm initiation. the following neoplastic progression is accompanied or supported by other additional genetic mutations. many oncogenes, tumour suppressor genes, and altered signalling pathways have been identified. thus, following the initial malignant thigmotropism step, a variety of subsequent mutations occur promoting the cmm invasiveness. some of these changes are probably involved in the rise of potential for metastasis. the malignant cells prone to metastasize but still in contact with the primary tumour are currently not identifiable under the microscope. although some specific cmm subtypes are clinically and histopathologically distinct, these features do not commonly exhibit independent prognostic value. despite a wealth of information , the prognostic indicators for the progression of primary cmm currently remain the tumour depth and proliferation, as well as the presence or absence of ulceration and micrometastases. the diversity of cmm presentations allows to establish a classification providing insight into cmm epidemiological data and their molecular counterparts. in addition, the translation of cmm molecular biology to relevant clinical correlates and novel therapies has made significant progress over the past few years. gene expression profiling of human cancers, in particular cmm, allows for a unique insight into the genes intimately involved in the neoplastic process. clinical and genomic evidence suggests that the metastatic potential of a primary cmm may be dictated by prometastatic events that have additional oncogenic capability. the homeobox gene family and its subset represented by hox genes, and their related proteins represent, a cluster of molecules that are likely involved in the potential for metastasis expressed by some cancer cells including cmm cells. the homeodomain is a four--helix helix - loop - helix dna binding motif, and its flanking sequences provide either activating or repressing functions for target gene transcription. these homeogenes are organized in four multigene clusters named a, b, c, and d mapped on chromosomes 2, 7, 12, and 17. each cluster is composed of 9 to 11 hox genes. any hox gene is part of a family of dna sequences involved in a series of transcription factors affecting tissue development and cell differentiation. hox proteins are present in nuclei and they direct dna - protein and protein - protein interactions. the most common mutation in human cmm braf (v600e) activates the serine / threonine kinase braf and causes excessive activity in the mitogen - activated protein kinase (mapk) pathway. braf (v600e) mutations are also present in benign melanocytic naevi, highlighting the importance of additional genetic alterations in the genesis of malignancies. such changes include recurrent copy number variations that in the amplification of oncogenes. for certain amplifications, the large number of genes in the interval has precluded an understanding of the cooperating oncogenic events. the present coverage of peer - reviewed articles revisits the salient aspects of aberrant expression of hox genes in human cmm. they appear highly conserved during evolution from simple organisms to vertebrates including humans. in humans, hox proteins are crucial for skin morphogenesis, involved in the control of axial patterning, and responsible for hereditary malformations and some cancers including cmm. during ontogenetic development hox gene expression appear - tumour - stage related and tissue or region specific. their relative position on chromosomes is connected to their expression domains along the anterior - posterior axis of the central nervous system. in addition, hox genes coding for transcription factors is involved in the process of neoplastic progression including cmm. they vary according to the histopathologic type and progression stage of the neoplasm including metastasis. the location of the primary cmm on the body is unrelated to the aberrant hox expression. hox - a1 is an oncogene playing a pivotal role in human cancers by stimulating cell proliferation, anchorage - independent cell growth, and loss of contact inhibition. in addition, hox - a1 and -a2 expression was higher in cmm with distant metastases compared to cmm without metastases. of note, hox - a5 downregulates angiogenesis by mitigating the activity of proangiogenic genes and upregulating the expression of antiangiogenic genes. the expression of hox - a11 and -a13 was reported to be higher in cmm than in melanocytic naevi. hox - a11 expression was further more altered in metastatic cmm than in the pt1-t3 nonmetastatic tumours. hox - b9 aberrant expression was reported to be higher in cmm than in melanocytic naevi. hox - b13 appeared overexpressed in cmm with distant metastases than in cmm without metastases. hox - b7 was reported to be overexpressed in proliferative cmm cells. the bone morphogenetic protein (bmp)-4 is overexpressed in cmm cells leading to the induction of basic fibroblast growth factor (bfgf) mediating cmm cell migration. this biological pathway starts with the reduced expression of the micro - rna mir-196 in cmm cells compared to nonneoplastic melanocytes. it is particularly activated by increasing hox - b7 transcription factor levels. an inverse relationship was established in the patterns of expression of hox - b7 and the promyelocytic leukemia zinc finger (plzf) protein, which acts as a suppressor. hence, hox - b7 and plzf are functionally independent and their coupled deregulation may account for most if the alterations found in cmm. there is an aberrant expression of genes located near the hox - c locus corresponding to hox - c10, c11, and c13. it in alterations in integrins, icam-1, n - ras, il-1a, il-6, and tnf-. hox - c4 was apparently overexpressed in cmm with distant metastases compared to cmm without metastases. hox - c13 aberrant expression was higher in metastatic cmm compared to pt1-t3 nonmetastatic tumours. microrna (mirna)-196a appeared to negatively regulate the expression of the transcription factor hox - c8. hox - d3 is involved in regulating cell - cell interactions in cmm, as well as the motile and invasive behaviours of cmm cells. by contrast hox - d12 and -d13 were reported to be expressed in cmm at a higher level than in melanocytic naevi. this finding is in line with a study on 79 tumour tissue types in which significant differences were reported between specific normal tissues and the corresponding neoplasms exhibiting an increase in hox - d13 expression. compared to primary cmm, their metastases commonly express higher levels of genes including mage, gpr 19, bcl2a1, mmp14, sox5, bvb1, and rgs20. the transition from non - metastatic to metastatic expression of hox activation levels occurs as the cmm increases in thickness. the transition in gene expression appears to occur at different thicknesses for different cmm genes. this critical transition timing for the emergence of the metastatic phenotype is a key moment in the evolution of cmm. tumour oncogenes include spp-1, mitf, cited-1, gdf-15, c - met, and hox loci. suppressor genes include pitx-1, cst-6, pdgfrl, dsc-3, pou2f3, clca2, and st7l. hox genes are transcriptional regulators, which modulate embryonic morphogenesis and pathological tissue remodelling in adults via regulation of genes associated with cell - cell or cell extracellular matrix (ecm) interactions. members of the hox family of homeodomain - containing transcription factors are deregulated in cmm. the homeodomain is capable to bind to specific dna sequences, including promoters of other hox genes, and to enhance or inhibit transcription. alteration of such a complex network controlling cell proliferation contributes to the multistep process underlying the onset of neoplasia. indeed, alterations of specific groups of hox genes are associated with neoplastic transformation in different tissues including the breast, kidney, lymphoid organ, colon, lung, thyroid, bladder, prostate, and skin. accordingly, identifying the hox expression levels is expected to have a diagnostic value and to establish the prognosis of the neoplasm under consideration. it has been suggested that hox genes contribute to cmm transformation and progression via the basic fibroblast growth factor (bfgf), which promotes an autocrine loop in cmm and is one of the major angiogenic factors. the molecular mechanisms and the possible genetic dysfunction underlying this process remain obscure, but the intervention of hox genes is likely. the gene expression profiling of primary, nonmetastatic and metastatic cmm has ed in the identification of several genes that are centrally involved in the progression and metastatic potential of cmm. among these mechanisms, homeoproteins represent transactivating factors issued from hox genes that regulate a series of gene expression. some alterations in specific hox genes are activated during various malignant transformations. the regulatory function of hox genes is possibly mediated by crucial growth factor genes. after the identification of the genes encoding several adhesion molecules, such as cytotactin, n - cam , and l - cam, as target genes for homeoproteins, it was shown that bfgf was the first growth factor involved in the complex network underlying hox gene effects on cell proliferation and differentiation. the autocrine bfgf production by cmm cells sustains tumoural growth as an early event in cmm progression. other autocrine loops are likely involved in the same process and implicate diverse cytokines, growth factors, and receptors. hox activation possibly boosts the rate of proliferation of cmm or represents a critical step in the progression and metastatic processes. the intervention of hox gene dysfunction in the metastatic cmm switch is supported by the absence of such altered function in melanocytic naevi and primary non - metastatic cmm. the search for new molecular markers that allow to select the tumour cell clones with respect to their aggressiveness and their ability to metastasize is certainly one of the most important future goals in cmm biomedical research. several molecules, such as antisense oligonucleotide (aso) and interfering rna (irna), were shown to be possibly capable to interact with crucial genes involved in the altered proliferation of the neoplastic cells.

the homeobox family and its subset of hox gene products represent a family of transcription factors directing dna - protein and protein - protein interactions. in the embryo, they are central regulators in cell differentiation during morphogenesis. a series of genes of the four hox gene clusters a, b, c, and d were reported to show aberrant expressions in oncogenesis, particularly in cutaneous malignant melanoma (cmm). they are involved in cell proliferation and progression in the cmm metastatic path. we present relevant peer - reviewed literature findings about the aberrant expression of hox genes in cmm. the number of cmm cell nuclei exhibiting aberrant hox protein expression appears correlated with tumour progression.

the mortality rate following neurosurgical treatment of an unruptured cerebral aneurysm varies from 0.4% to 1.5%, and age of the patient and size and location of the aneurysm are generally accepted factors that affect surgical outcome.9 ) for achievement of acceptable surgery - related morbidity and mortality rates, neurosurgeons strive for precise aneurysmal neck clipping, careful confirmation of branches or perforators that were not clipped together, and maintenance of flow in the parent artery to prevent ischemic accidents. atherosclerotic changes in the intracranial artery and in part of the aneurysm in diminished flexibility of the vessel itself, which not only makes the surgery difficult to perform but can also in unexpected ischemic complications such as thromboembolism and vessel occlusion.2 ) in the current study, we analyzed and reported the clinical features of atherosclerotic intracerebral aneurysms treated at our center. cases of 262 patients who underwent aneurysmal neck clipping surgery at our center between june 2004 and november 2010 were analyzed retrospectively. we reviewed intraoperative videos; microscopic photographs; pre- and post - operative findings of computed tomography angiogram (cta), magnetic resonance angiogram (mra), and digital subtraction angiogram (dsa); and medical and surgical records. we divided the patients into two groups: the atherosclerotic group (ag) with atherosclerotic appearance of vessels, and the non - atherosclerotic group (nag) without atherosclerosis. the criteria for atherosclerotic aneurysm were assessed according to the surgeons' intraoperative findings, either retrospectively or prospectively. atherosclerotic changes in the vessel or aneurysm walls were identified as follows: yellowish and/or whitish spotty appearance of the vessel and/or aneurysm; surgical confirmation of a definite decrease in elasticity of the wall, with or without a color change of the vessel (fig . atherosclerosis types were divided according to the following categories based on the position of the atherosclerotic changes : parent artery and aneurysm neck; aneurysm neck; aneurysm neck and dome; aneurysm dome. location in the parent artery was defined as atherosclerotic change within 5 mm from the neck of the aneurysm. clinical outcome was determined according to scoring and changes on the glasgow outcome scale (gos). the outcome was determined as favorable if the gos score was either unchanged, regardless of the preoperative status, or improved to a gos score of 4 - 5. an outcome was considered unfavorable if there was deterioration to a gos score of 1 - 3. in addition, the occurrence of new postoperative ischemia was assessed with a head computed tomography (ct) scan. the postoperative ct was analyzed for territory infarction or perforator infarction in relation to the clip position. to evaluate the difference between the ag and nag, the variables of clinical characteristics, aneurysmal characteristics, and surgical procedures between the two groups were compared using univariate methods (the two - sample t - test, fisher 's exact test, and pearson 's chi - square test). medcalc (version 13, medcalc software bvba, ostend, belgium) was used for analysis, and a p value less than 0.05 was considered statistically significant for all statistics. cases of 262 patients who underwent aneurysmal neck clipping surgery at our center between june 2004 and november 2010 were analyzed retrospectively. we reviewed intraoperative videos; microscopic photographs; pre- and post - operative findings of computed tomography angiogram (cta), magnetic resonance angiogram (mra), and digital subtraction angiogram (dsa); and medical and surgical records. we divided the patients into two groups: the atherosclerotic group (ag) with atherosclerotic appearance of vessels, and the non - atherosclerotic group (nag) without atherosclerosis. the criteria for atherosclerotic aneurysm were assessed according to the surgeons' intraoperative findings, either retrospectively or prospectively. atherosclerotic changes in the vessel or aneurysm walls were identified as follows: yellowish and/or whitish spotty appearance of the vessel and/or aneurysm; surgical confirmation of a definite decrease in elasticity of the wall, with or without a color change of the vessel (fig . atherosclerosis types were divided according to the following categories based on the position of the atherosclerotic changes : parent artery and aneurysm neck; aneurysm neck; aneurysm neck and dome; aneurysm dome. location in the parent artery was defined as atherosclerotic change within 5 mm from the neck of the aneurysm. clinical outcome was determined according to scoring and changes on the glasgow outcome scale (gos). the outcome was determined as favorable if the gos score was either unchanged, regardless of the preoperative status, or improved to a gos score of 4 - 5. an outcome was considered unfavorable if there was deterioration to a gos score of 1 - 3. in addition, the occurrence of new postoperative ischemia was assessed with a head computed tomography (ct) scan. the postoperative ct was analyzed for territory infarction or perforator infarction in relation to the clip position. to evaluate the difference between the ag and nag, the variables of clinical characteristics, aneurysmal characteristics, and surgical procedures between the two groups were compared using univariate methods (the two - sample t - test, fisher 's exact test, and pearson 's chi - square test). medcalc (version 13, medcalc software bvba, ostend, belgium) was used for analysis, and a p value less than 0.05 was considered statistically significant for all statistics. among 262 patients who underwent aneurysm clipping surgery at our center between june 2004 and november 2010, atherosclerotic aneurysms were found in 67 patients, representing approximately 25.6% of all patients undergoing aneurysm clipping surgery. the mean age of the patients with atherosclerotic aneurysms was 60.0 9.0 years (mean sd, range : 38 - 74), among whom 27 were males and 40 were females. the mean age of the remaining 195 patients without atherosclerotic aneurysms was 54.2 11.3 years (mean sd, range : 21 - 79), among whom 64 were males and 131 were females (table 1). a total of 73 lesions were identified among the atherosclerotic aneurysms; of these, 48 lesions were ruptured and the remaining 25 were unruptured. among the non - atherosclerotic aneurysms, 205 lesions were identified; of these, 143 and 62 were ruptured and unruptured, respectively. among the atherosclerotic aneurysms, 43 were found in the middle cerebral artery (mca), 18 were found in the internal carotid artery (ica), and 12 were found in the anterior cerebral artery (aca). among the non - atherosclerotic aneurysms, 93 were found in the mca, 40 were found in the ica, and 72 were found in the aca (table 1). a significant difference in aneurysm location was observed between the two groups (p = 0.012). when the vessels with atherosclerotic changes were visualized intraoperatively, sites of the changes varied considerably. atherosclerotic changes were observed in the parent artery and aneurysm neck in 24 cases, in the aneurysm neck in 21 cases, in the aneurysm neck and dome in 17 cases, and in only the aneurysm dome in 11 cases (table 2). out of 73 atherosclerotic aneurysms, 14 were clipped with multiple permanent clips; however, remnant neck and clip slippage were later observed in six and four cases, respectively. among 205 surgeries for non - atherosclerotic aneurysms, multiple clippings were performed in 34 cases, remnant neck was found in five cases, and clip slippage occurred in four cases. comparison of the two groups showed a statistically significant difference in the variable of intentional remnant neck (table 3). we then subdivided the specific surgical steps in the atherosclerotic aneurysm group; there were 15 cases of specific surgical steps in the group with atherosclerotic change in the parent artery and aneurysmal neck. among them, multiple clippings were performed in seven cases, remnant neck was found in four cases, and clip slippage occurred in three cases, with only one case of wrapping. in another group, atherosclerotic change on the aneurysmal neck, multiple clippings were performed in six cases, remnant neck was found in two cases. in the other group, atherosclerotic change on the aneurysmal neck and dome, multiple clippings were performed in one case and clip slippage occurred in one case (table 4). in review of the postoperative outcomes of patients in the ag, 47 patients had gos score of 4 - 5 and 20 patients had gos score of 1 - 3. one patient expired because of a territory infarction. in the ag, postoperative ischemic lesions developed in five patients; two of these patients had a total territory infarction (fig . 2) and three patients had a perforator infarction related to the site of the operated lesion. in the nag, five patients had infarctions in small subcortical regions. however, all patients in the nag who developed postoperative infarctions recovered completely from their neurologic deficits. among 262 patients who underwent aneurysm clipping surgery at our center between june 2004 and november 2010, atherosclerotic aneurysms were found in 67 patients, representing approximately 25.6% of all patients undergoing aneurysm clipping surgery. the mean age of the patients with atherosclerotic aneurysms was 60.0 9.0 years (mean sd, range : 38 - 74), among whom 27 were males and 40 were females. the mean age of the remaining 195 patients without atherosclerotic aneurysms was 54.2 11.3 years (mean sd, range : 21 - 79), among whom 64 were males and 131 were females (table 1). a total of 73 lesions were identified among the atherosclerotic aneurysms; of these, 48 lesions were ruptured and the remaining 25 were unruptured. among the non - atherosclerotic aneurysms, 205 lesions were identified; of these, 143 and 62 were ruptured and unruptured, respectively. among the atherosclerotic aneurysms, 43 were found in the middle cerebral artery (mca), 18 were found in the internal carotid artery (ica), and 12 were found in the anterior cerebral artery (aca). among the non - atherosclerotic aneurysms, 93 were found in the mca, 40 were found in the ica, and 72 were found in the aca (table 1). a significant difference in aneurysm location when the vessels with atherosclerotic changes were visualized intraoperatively, sites of the changes varied considerably. atherosclerotic changes were observed in the parent artery and aneurysm neck in 24 cases, in the aneurysm neck in 21 cases, in the aneurysm neck and dome in 17 cases, and in only the aneurysm dome in 11 cases (table 2). out of 73 atherosclerotic aneurysms, 14 were clipped with multiple permanent clips; however, remnant neck and clip slippage were later observed in six and four cases, respectively. among 205 surgeries for non - atherosclerotic aneurysms, multiple clippings were performed in 34 cases, remnant neck was found in five cases, and clip slippage occurred in four cases. comparison of the two groups showed a statistically significant difference in the variable of intentional remnant neck (table 3). we then subdivided the specific surgical steps in the atherosclerotic aneurysm group; there were 15 cases of specific surgical steps in the group with atherosclerotic change in the parent artery and aneurysmal neck. among them, multiple clippings were performed in seven cases, remnant neck was found in four cases, and clip slippage occurred in three cases, with only one case of wrapping. in another group, atherosclerotic change on the aneurysmal neck, multiple clippings were performed in six cases, remnant neck was found in two cases. in the other group, atherosclerotic change on the aneurysmal neck and dome, multiple clippings were performed in one case and clip slippage occurred in one case (table 4). in review of the postoperative outcomes of patients in the ag, 47 patients had gos score of 4 - 5 and 20 patients had gos score of 1 - 3. one patient expired because of a territory infarction. in the ag, postoperative ischemic lesions developed in five patients; two of these patients had a total territory infarction (fig . 2) and three patients had a perforator infarction related to the site of the operated lesion. in the nag, five patients had infarctions in small subcortical regions. however, all patients in the nag who developed postoperative infarctions recovered completely from their neurologic deficits. no statistical difference in development of ischemic complications recently, treatment of cerebral aneurysms has been developing at a rapid pace, and a number of studies have reported good clinical outcomes of aneurysm surgeries. however, flamm et al. reported that the presence of plaque in an aneurysm can be a predictive factor for unexpected complications during aneurysm surgery.3 ) other researchers have also examined the importance of atherosclerotic aneurysms. in 1999, ohno et al. reported atherosclerotic changes in six patients (10%) among 30 patients with cerebral aneurysms.8 ) similarly, in 2003, grigorian et al. reported atherosclerotic changes in 81 patients (26.7%) among 333 patients with aneurysms.4 ) in our study, 67 (25.6%) of the 262 patients with aneurysms had atherosclerotic aneurysms. atherosclerosis is a well - known pathological condition that generally affects the arterial blood vessels. as a degenerative process , atherosclerotic changes from deposition of plasma lipids, connective tissues, and local or circulating cells over the intima of the blood vessels, which leads to narrowing of the vessel lumen.7 ) the restorability of such atherosclerotic vessels is limited because of a ant decrease in elasticity and increase in rigidity of the vessel.10 ) during aneurysm surgery, if the aneurysmal neck has atherosclerotic changes, problems such as incomplete neck clipping and narrowing of the lumen of the parent artery may occur.8 ) in particular, narrowing of the lumen of the parent artery may be an important cause of postoperative ischemic events. regarding aneurysm location, szelenyi et al. reported that among patients with atherosclerotic aneurysms, ten had aneurysms in the ica, five had aneurysms in the anterior communicating artery, and 19 had aneurysms in the mca.9 ) ohno et al. reported that six patients among seven patients with atherosclerotic changes in the aneurysmal neck had mca aneurysms.8 ) in our study, 43 patients among the 73 patients with atherosclerotic aneurysms had aneurysms in the mca. reported that eight cases among 34 atherosclerotic aneurysm cases had atherosclerotic changes in the parent vessel, aneurysm dome, or aneurysm neck, respectively, and 11 cases had changes in both the aneurysm dome and neck.9 ) in our study of 73 cases, the sites of atherosclerotic change were as follows: both parent artery and aneurysm neck in 24 (32.9%), aneurysm neck in 21 (28.8%), both aneurysm neck and dome in 17 (23.3%), and aneurysm dome in 11 (15.0%). these findings are not relevant to the findings reported in the papers mentioned earlier. regarding the postoperative prognosis of patients with atherosclerotic aneurysms, szelenyi et al. reported that 27 of 34 atherosclerotic aneurysm patients had a good clinical outcome, increasing to 30 patients at six months. postoperatively, four patients had an unfavorable outcome, and at the six - month follow - up, only three patients had an unfavorable outcome.9 ) in our series, 47 patients had a favorable outcome, 20 patients had an unfavorable outcome, and, unfortunately, one patient expired. the most likely explanation for the higher rate of unfavorable clinical outcomes in our series as compared with that of szelenyi et al. is that the latter study included only unruptured aneurysms, whereas we included 48 cases of ruptured aneurysms. reviews of other studies have found that the frequency of morbidity in patients with atherosclerotic aneurysms is higher than in patients with non - atherosclerotic aneurysms, approximately 14% and 6.8%, respectively.2)3)6 ) in atherosclerotic aneurysms, the atherosclerotic wall might increase the occurrence of thromboembolic events, or its rigidity might lead to occlusion of perforators within the aneurysm vicinity during surgery.1)5 ) szelenyi et al. reported that in six patients with atherosclerotic aneurysms, a small residuum of the aneurysm neck was intentionally left. in addition, in patients with atherosclerotic aneurysms, temporary vessel occlusion and multiple repositioning of the permanent clip were performed more often than in patients with non - athe rosclerotic aneurysms. although the application of more than one permanent clip and wrapping occurred more often in patients with atherosclerotic aneurysms, this did not reach statistical significance in their study.9 ) it is expected that clip placement in atherosclerotic aneurysms requires more surgical steps compared with non - atherosclerotic aneurysms. this is supported by our finding that the intraoperative observation of atherosclerosis showed significant correlation with a higher percentage of multiple positioning of a permanent clip. clip placement might be hampered by a rigid atherosclerotic wall such that aneurysm obliteration due to sliding of the clip off the aneurysm dome is not complete or that the parent vessel or perforating branches are occluded (fig . one solution to this problem is aneurysm obliteration with multiple clips.8)9 ) furthermore, as in our study, avoidance of the region of the atheroma could promote effective clip placement and prevent parent artery occlusion. in the surgical repair of aneurysms, the incidence of ischemia, which is irreversible or severe, might be greater in atherosclerotic than in non - atherosclerotic aneurysms. careful manipulation and a thorough understanding of atherosclerotic vessels during neck clipping surgery can prevent ischemic accidents ing from parent artery stenosis or perforating artery occlusion and yield satisfactory surgical . in addition, multiple clips might be applied to atherosclerotic aneurysms for effective obliteration and the aneurysm neck might be left to avoid a region of atheroma.

objectiveatherosclerotic cerebral aneurysms are known to increase occurrence of thromboembolic events and occlusion of perforator vessels intraoperatively due to pathological changes in the vessels themselves. in the current study , we analyzed the points to be considered during surgery for atherosclerotic cerebral aneurysms and the postoperative .materials and methodswe retrospectively reviewed the medical records, radiological , and surgical records, including intraoperative video recordings and photographs, of 262 patients who underwent cerebral aneurysm surgery. we then performed a detailed analysis of aneurysm features, surgical methods, and clinical outcomes.among 278 aneurysms in 262 patients, 73 aneurysms in 67 patients showed atherosclerotic features (atherosclerotic group, ag), and 205 aneurysms in 195 patients showed no evidence of atherosclerosis (non - atherosclerotic group, nag). in the ag, clipping with multiple permanent clips was performed in 14 aneurysms, and clip slippage was found in four cases. six ag cases had a remnant neck after clipping, which was significantly more frequent than in the nag (p < 0.05). clinical outcomes and surgery - related complications did not differ significantly between the two groups.in the surgical repair of aneurysms, the incidence of ischemia, which is irreversible or severe, might be greater in atherosclerotic than in non - atherosclerotic aneurysms. in addition, multiple clips might be applied to atherosclerotic aneurysms for effective obliteration and an aneurysm neck might be left to avoid a region of atheroma.

preeclampsia is the most frequently encountered medical complication of pregnancy, causing considerable maternal and fetal morbidity and mortality. preeclampsia affects approximately 5% of all pregnancies and in up to 10% to 20% of nulliparous women. despite intensive studies, placental ischemia caused by the inadequate endometrial invasion of trophoblast and endothelial damage is considered to play a crucial role in the pathogenesis of preeclampsia. the failure of communication between trophoblast cells and decidual immune cells in the placenta, in poor placentation which leads to poor remodeling of spiral arteries, systemic inflammatory response, dysfunctional maternal endothelium, poor placental oxygenation and hypoxic conditions. these events precede the clinically recognizable symptoms of maternal disease, such as hypertension, proteinuria and edema. interleukin10 (il-10) is a potent pleiotropic cytokine, located on chromosome 1q31 - 32, consisting of five exons and four introns. it has the dual ability of immunosuppression or immunostimulation via the production of pro - inflammatory cytokines by the inhibition of t - helper 1 (th1) lymphocytes and stimulation of b lymphocytes and th2 lymphocytes, and thus downregulates the inflammatory response. various single nucleotide polymorphisms (snps) have been described in the il-10 promoter region, both of distal and proximal promoter regions, with functional significance. genotypic variations in the human interleukin-10 (il-10) promoter accounts for marked inter - individual variations in il-10 production and may influence individual susceptibility to autoimmune diseases. the g / a polymorphism at position -1082 has been linked to high / low il-10 production status. in view of the above , we aimed to evaluate the role of il-10 (-1082 g / a) gene promoter polymorphism in the etiology of preeclampsia. a total of 88 pregnant women with preeclampsia and 100 women with normal pregnancy attending the gynecological unit of government maternity hospital were considered for the present study during the year 2011 - 12. information regarding the demographic features such as age, marital history, parity, gestational age, family history, consanguinity, etc were obtained from all the subjects with the help of a standard proforma questionnaire. the patients showing blood pressure > 130/90 mm hg on two occasions, 6 hr apart, and onset of proteinuria > 2 + by dip stick test in urine sample were considered as preeclamptic and those who showed blood pressure > 150/100 mm hg and proteinuria > 3 + by dipstick test in urine sample were considered as patients with severe preeclampsia. women with no complications throughout their gestational period, like infections, fetal anomalies, hypertension and diabetes were considered as the control subjects. patients with previous history of intrauterine fetal deaths and other complications were not considered for the study. the venous blood (5 ml) was collected from all the participants for biochemical and molecular analysis and aliquoted in plain and edta vacutainers. the genomic dna was extracted from the samples using salting out method described by lahiri et al. the isolated dna was subjected to a standard amplification refractory mutation system polymerase chain reaction (arms - pcr). briefly, two complementary reactions were established for each allele consisting of target dna: allele specific arms primers (fg for g allele and fa for a allele) and the common primer (cf). the primers used are as follows: a common (cf) anti - sense primer 5-gta agc ttc tgt ggc tgg agt c-3; (fg) sense 5-aac act act aag gct tct ttg ggt g-3 g - primer; (fa) sense 5-aac act act aag gct tct ttg ggt a-3. the optimized reaction conditions consisted of 40 ng of genomic dna in a reaction volume of 15 l containing 1x reaction buffer, 1.5 m mgcl2, 30 m of each dntp, 0.16 m of each primer, and 0.3 u of taq dna polymerase. the cycling conditions were as follows: an initial denaturation at 94c for 4 min, followed by 35 cycles at 94c for 30 s, 61c for 20 s, and 72c for 30 s. the final extension step was at 72c for 6 min. the pcr products were separated by electrophoresis on an agarose gel (2%) stained with ethidium bromide. were cross - checked with internal positive (796 bp of hla gene) and negative controls (millipore water). ten percent of the samples were randomly taken, and the assay was repeated and found no bias in the genotyping. genotype distribution in the control and case groups were compared with values predicted by hardy - weinberg equilibrium using test. discrete variables were expressed as counts (%) and were compared by the test. odd ratios (or) and their 95% confidence intervals were used to measure the strength of association between il-10 gene polymorphism and preeclampsia. a total of 88 pregnant women with preeclampsia and 100 women with normal pregnancy attending the gynecological unit of government maternity hospital were considered for the present study during the year 2011 - 12. information regarding the demographic features such as age, marital history, parity, gestational age, family history, consanguinity, etc were obtained from all the subjects with the help of a standard proforma questionnaire. the patients showing blood pressure > 130/90 mm hg on two occasions, 6 hr apart, and onset of proteinuria > 2 + by dip stick test in urine sample were considered as preeclamptic and those who showed blood pressure > 150/100 mm hg and proteinuria > 3 + by dipstick test in urine sample were considered as patients with severe preeclampsia. women with no complications throughout their gestational period, like infections, fetal anomalies, hypertension and diabetes were considered as the control subjects. patients with previous history of intrauterine fetal deaths and other complications were not considered for the study. the venous blood (5 ml) was collected from all the participants for biochemical and molecular analysis and aliquoted in plain and edta vacutainers. serum and plasma the genomic dna was extracted from the samples using salting out method described by lahiri et al. the isolated dna was subjected to a standard amplification refractory mutation system polymerase chain reaction (arms - pcr). briefly, two complementary reactions were established for each allele consisting of target dna: allele specific arms primers (fg for g allele and fa for a allele) and the common primer (cf). the primers used are as follows: a common (cf) anti - sense primer 5-gta agc ttc tgt ggc tgg agt c-3; (fg) sense 5-aac act act aag gct tct ttg ggt g-3 g - primer; (fa) sense 5-aac act act aag gct tct ttg ggt a-3. the optimized reaction conditions consisted of 40 ng of genomic dna in a reaction volume of 15 l containing 1x reaction buffer, 1.5 m mgcl2, 30 m of each dntp, 0.16 m of each primer, and 0.3 u of taq dna polymerase. the cycling conditions were as follows: an initial denaturation at 94c for 4 min, followed by 35 cycles at 94c for 30 s, 61c for 20 s, and 72c for 30 s. the final extension step was at 72c for 6 min. the pcr products were separated by electrophoresis on an agarose gel (2%) stained with ethidium bromide. were cross - checked with internal positive (796 bp of hla gene) and negative controls (millipore water). ten percent of the samples were randomly taken, and the assay was repeated and found no bias in the genotyping. genotype distribution in the control and case groups were compared with values predicted by hardy - weinberg equilibrium using test. discrete variables were expressed as counts (%) and were compared by the test. odd ratios (or) and their 95% confidence intervals were used to measure the strength of association between il-10 gene polymorphism and preeclampsia. a total of 88 pregnant patients with preeclampsia and 100 controls with normal pregnancy were included in this study. the demographic characteristics of patients and controls revealed a significant difference with respect to age (p=0.0013), number of children (p=0.0076) and blood pressure (p= 0.0001). however, there was no variation with regard to mode of delivery, fetal growth and edema. the genotypic distribution of -1082 g / a il-10 polymorphism are illustrated in table 1. the frequencies of the genotypes gg, ga and aa, were 17.8%, 41.09% and 41.09% in patients with preeclampsia, and 25%, 28% and 47% in controls, respectively. there was no statistical difference in the distribution of genotypic or allelic frequencies between the patient and control groups (test power=0.66) for gg vs. aa (or=0.814, 95% ci=0.36181.834), gg vs. ga+aa (or=0.65, 95% ci=0.30671.370), ga vs. gg+aa (or=0.5574, 95% ci=0.29431.056), aa vs. ga+gg (or= 1.271, 95% ci=0.6902.338) and g allele vs. t allele (or=0.97, 95% ci= 0.621.5). preeclampsia is the most common pregnancy - specific complication that still ranks as one of the major obstetric problems. preeclampsia syndrome is described as excessive maternal inflammatory responses, perhaps directed against foreign fetal antigens that induce a chain of events including surface trophoblast invasion, defective spiral artery remodeling, placental infarction and release of pro - inflammatory cytokines and placental fragments in the systemic circulation. a normal pregnancy is accompanied by an inflammatory response which produces a state of mild systemic inflammation, completed with activation of multi - components of inflammatory network. these inflammatory changes may progress to the point of circulatory decompensation and endothelial dysfunction, ing in one or more pregnancy complications, including preeclampsia. current theories regarding the immune response in preeclampsia focus on the phenomenon of t - cell differentiation into two types of helper cells: type 1 (th1) and type 2 (th2). t - helper type 1 cells produce pro - inflammatory cytokines and are involved in cell - mediated immunity, while t - helper type 2 cells produce anti - inflammatory, immuno - suppressor cytokines and are involved in b - cell humoral immunity. first proposed the hypothesis that th1 responses are suppressed in normal pregnancy to prevent immune rejection of fetus. in preeclampsia an imbalance in the th1/th2 ratio has been proposed with deviation towards th1 response. th1 type cytokines, such as tnf-, ifn- and il-2, are pro - inflammatory cytokines which induce trophoblastic apoptosis, and restrain differentiation of trophoblast. th2 type cytokines, such as il-10, are anti - inflammatory cytokines, and act as autocrine inhibitors of cytotrophoblast invasion in the uterine wall. roth and fisher stated that high concentrations of il-10 reduces the tropho - blast invasion which in turn is a major cause of preeclampsia. thus, the role of il-10 in the immune response is to inhibit the production of various pro - inflam - matory cytokines produced by a large number of different immune cells. the inter - individual differences in il-10 production are largely under genetic control; 5075% of the variation can be explained by genetic factors as demonstrated in twin studies. it is also plausible that intrauterine cytokine milieu and balance of vascular factors may modulate the effects of hypoxic levels of oxygen. hypoxia affects the cytokine balance by reducing interleukin il-10 production and inducing il-6 and il-8 in placenta and trophoblast.. carried out a study on patients with preeclampsia and indicated that the -1082a allele confers a two - fold increase in transcriptional activity of the il-10 promoter compared to the g allele. there was marked inter - individual variation in il-10 production by peripheral blood mononuclear cells in vitro, with no consistent effect of genotype. the present study revealed no association of il-10 -1082 polymorphism in patients with preeclampsia compared to the controls. in white women demonstrated a significant association of il-10 genotype and allele frequency between controls and patients. on the contrary, in australian population demonstrated that even though the il-10 genotype was aa, there was no significant lowering of il-10 levels in maternal serum but when observed in placental tissue revealed a significant decrease in il-10 concentration in placenta proving that il-10 plays an important role in the placental formation. most of the studies have either shown a significant association with a allele or no association with neither of the alleles. the latest meta - analysis conducted by xie et al. , also concluded no association between il-10 -1082a / g, and preeclampsia. in , the present study suggests that the il-10 -1082 promoter polymorphism is not a major genetic regulator in the etiology of preeclampsia in the studied ethnic group

preeclampsia is a pregnancy - specific syndrome that may be life - threatening, especially to the fetus. several causes have been reported that may have a possible role in the development of the disorder. interleukin-10 affect maternal intravascular inflammation, as well as endothelial dysfunction. the aim of this study was to investigate the association between il-10 g-1082a polymorphism and preeclampsia.methodsa total of eightyeight pregnant women with preeclampsia and 100 women with normal pregnancy attending the gynecological unit of government maternity hospital, petlaburz, hyderabad, india, were considered for the study. a standard amplification refractory mutation system (arms) pcr was carried out for genotyping il-10 g-1082a promoter polymorphism in all the participants. genotypic distribution of the control and patient groups were compared with values predicted by hardy - weinberg equilibrium using 2 test. odd ratios (or) and their respective 95% confidence intervals were used to measure the strength of association between il-10 gene polymorphism and preeclampsia.the frequencies of il-10 g-1082a genotypes, gg, ga and aa, were 17.8%, 41.09% and 41.09% in women with preeclampsia and 25%, 28% and 47% in the controls respectively. there was no significant difference in the distribution of genotypes and alleles of il-10 g-1082a between the two groups (test power=0.66).the present study suggests that the il-10 g-1082a gene promoter polymorphism is not a major genetic regulator in the etiology of preeclampsia.

bartonella species are gram - negative, facultative intracellular bacilli, and the genus includes more than 20 species or subspecies. among these species and subspecies, bartonella henselae is the primary species that causes human illnesses, including lymphadenopathy, bacteremia, bacillary angiomatosis, and other localized infections. cat bites and the scratching of flea - bite sites are thought to be the main routes of transmission to humans and cats. there have been several reports of bartonella infection in korea. in one study, among 31 patients with cervical lymphadenopathy, 21 (67.7%) and 20 (64.5%) patients had positive serologic for b. henselae and b. quintana, respectively. using polymerase chain reaction (pcr) analysis, the prevalence of bartonella infection was found to be 0 - 44.1% in animals and 0 - 19.1% in arthropod vectors. infection in both cats and cat fleas are high in korea , it is rather surprising that there have been only 5 case reports of cat - scratch disease and 1 case report of b. quintana endocarditis published. all these previously reported cases were diagnosed using pcr. to our knowledge, no case of culture - proven bartonella bacteremia has been reported thus far in korea. bacteremia has been known to occur, typically in immunocompromised patients. however, with advanced diagnostic methods, such as the use of a novel growth medium, b. henselae bacteremia is increasingly identified in immunocompetent patients. we report a case of culture - proven b. henselae bacteremia in a patient presenting with fever of unknown origin (fuo). a 73-year - old woman was admitted to our hospital for evaluation of fever. the patient had diabetes mellitus that had been managed with oral hypoglycemic agents for 10 years. six years previously, the patient underwent an orthopedic operation involving the insertion of internal fixation due to a right ankle fracture. one week later, the patient visited the emergency room of our hospital for evaluation of fever. at that time, her body temperature was 39. to identify the cause of the fever, laboratory tests were conducted, which revealed the following: hemoglobin level, 12.9 g / dl; white blood cell (wbc) count, 5,120/mm; platelet count, 164,000/mm; aspartate aminotransferase level, 47 iu / l; alanine aminotransferase level, 56 iu / l; alkaline phosphatase level, 228 iu / l; c - reactive protein (crp) level, 131.6 mg / l; and erythrocyte sedimentation rate, 22 mm / h. blood culture grew coagulase - negative staphylococcus in 1 of the 2 sets, which was dismissed as a contaminant. the patient refused to be admitted to hospital; therefore, oral amoxicillin - clavulanate was prescribed. thus, the patient was admitted to our division on may 22, 2009. on admission , she had a body temperature of 39.0, a pulse rate of 90/min, a respiration rate of 18/min, and blood pressure of 120/80 mmhg. her wbc count had increased to 9,930/mm, her platelet count to 189,000/mm, and her crp level to 179.2 mg / l. other laboratory , including repeated blood culture, revealed no significant changes. to determine the cause of the headache, ceftriaxone was administered empirically for 5 days, followed by a combination of ceftriaxone and doxycycline for 6 days. owing to her persistent fever, vancomycin and doxycycline were substituted on hospital day (hd) 16, and as a , her fever decreased to 37.5 the next day. on hd 23, serologic test for q fever, which were analyzed at the korea centers for disease control and prevention, were positive at titers of 1:64 for immunoglobulin (ig) m and 1:1,024 for igg in a blood specimen taken on hd 7. the treatment regimen was changed to a combination of doxycycline and hydroxychloroquine to target the possible chronic q fever, and the fever reduced to below 37. the patient was discharged on hd 29, and followed up at the opd on july 3, 2009. at this follow - up visit, antibody titers to q fever were 1:32 and 1:2,048 for igm and igg, respectively. we performed cell culture or shell vial culture assays routinely for all patients with fuo. edta - treated whole blood (0.3 ml) obtained at admission was inoculated onto a monolayer of ecv304 cells grown in a tissue culture flask (25 cm). the inoculated blood was washed with phosphate buffered saline 24 h later, and the culture was maintained in m199 medium (gibco brl, gaithersburg, md, usa) supplemented with 10% heat - inactivated fetal bovine serum (gibco brl) in a humidified atmosphere containing 5% co2 at 37. media were changed every 3 to 4 days without subculture. nine days after subculture onto a blood agar plate, small transparent colonies were observed (fig . 1b). to identify the isolated bacterium, conventional pcr targeting the 16s-23s rrna intergenic spacer (its) region of bartonella species was performed, followed by sequencing, as described previously. the pair of primers used for the amplification of the its gene were 16sf (5'-agaggcaggcaaccacggta-3 ') and 23si (5'-gccaaggcatccacc-3 '). the sequence alignment of the pcr product was 960 characters long (genbank accession number : jq638927.1). pair - wise comparison using blast (national institutes of health, bethesda, md, usa) revealed that the isolate was most like b. henselae houston-1 strain (maximum pairwise identity score : 98%). instead, cell culture, direct inoculation of blood specimens onto agar plates, or the use of bartonella alpha proteobacteria growth medium must be used to successfully cultivate the bacterium. however , these culture techniques are seldom used in korean hospitals, and hence, isolation of the bacterium has never been reported. if isolated, the pathogen can then be used for further study. the isolate described above in addition, one cause of false - negative obtained using an indirect immunofluorescent assay (ifa) is thought to be the variation in antigenic expression between b. henselae strains. ifa is thought to be more sensitive if a locally isolated strain is incorporated into the panel of strains used as antigens. therefore, pcr has been used for patients with clinically suspected bartonella infection, who usually exhibit lymphadenopathy or have a history of exposure to cats or dogs. the 5 cases of b. henselae lymphadenitis documented in korea were diagnosed in this manner. serologic tests have low sensitivity, yield inconsistent in some patients, and are subject to significant cross - reactivity with other pathogens. for example, in the present case, the seropositivity for q fever was thought to be due to cross - reaction with bartonella species antigens. although co - infection with coxiella burnetii and b. henselae can not be excluded, our previous experience with a scrub typhus case found a false - positive for c. burnetii. in addition, a report revealing occasional false - positive for c. burnetii in bartonellosis leads us to disregard the positive serologic for c. burnetii. the drawbacks of serologic testing had rendered them unavailable in most korean hospitals and referral centers, with the exception of the korea centers for disease control and prevention. pathologic examination using silver staining methods has been used to diagnose bartonella lymphadenopathy, but is not useful in the diagnosis of bacteremia. although bartonellosis is an important cause of fuo, previous studies of fuo in korea have not evaluated bartonellosis. therefore, the level of clinical suspicion of bartonellosis in patients with fuo is lower than that in patients with lymphadenopathy. in addition, clues suggesting bartonellosis, such as contact with cats or insects, are often lacking, which makes diagnosis more difficult. furthermore, bartonella infection in elderly persons frequently presents with atypical manifestations and is not accompanied by lymphadenopathy; thus, this diagnosis is often disregarded. screening by laboratory tests is necessary for diagnosing bartonellosis in patients with prolonged fever, even in those lacking the characteristics usually associated with bartonellosis. exposure to cats or possibly dogs is a risk factor, but many patients with bartonellosis do not report exposure to pet animals. instead, because bartonella dna has been detected in various arthropod vectors including ticks and mites, patients may become infected via these vectors. given that b. henselae can cause persistent infection, recrudescence may be an alternative explanation, though the patient did not have a history of bartonellosis. the patient in the present report was successfully managed with a combination of doxycycline and chloroquine, although this treatment's efficacy against b. henselae bacteremia is unproven. a combination of doxycycline and gentamicin is recommended for bartonella endocarditis, and azithromycin and rifampin in combination have been used in some patients with b. henselae bacteremia. although the effects of chloroquine in the treatment of bartonellosis are currently not known, its effect has been established in other intracellular bacterial infections such as q fever and whipple's disease. in these diseases, chloroquine enhances the antimicrobial efficacy of doxycycline through the alkalization of acid vesicles such as phagosomes. although b. henselae does not proliferate in acidic vesicles, in the present case, the addition of chloroquine to doxycycline seemed to be more efficacious in controlling the fever than doxycycline alone (ceftriaxone and doxycycline, vancomycin and doxycycline). therefore, chloroquine may potentiate the antibiotic effect in bartonella infection via a mechanism other than alkalization of phagosomes. further evaluation of the efficacy of adding chloroquine to doxycycline is needed. in summary, we have reported a case of culture - proven b. henselae bacteremia in a patient who presented with fuo. this case suggests that bartonellosis should be included in the list of differential diagnoses in fuo, even in patients lacking the common characteristics of cat - scratch disease. because the characteristic findings of bartonellosis are frequently absent in elderly persons with this disease, screening by laboratory tests

bartonella henselae causes cat - scratch disease, bacteremia, and various focal infections. despite the worldwide occurrence of b. henselae infections, reports in humans are rare in korea. the clinical manifestation of all 5 previously reported cases was lymphadenopathy. herein, we report a case of bacteremia in a woman who presented with prolonged fever. b. henselae was isolated from a blood specimen by cell culture. conventional polymerase chain reaction amplification and sequencing of the 16s-23s rrna intergenic space region confirmed the isolate to be b. henselae. the patient had no underlying immunocompromising conditions and no recent exposure to animals. she was successfully managed with a combination of doxycycline and hydroxychloroquine.

influenza is potentially fatal in the elderly, as it can be complicated by pneumonia and other serious diseases in this subpopulation. in several studies, influenza vaccination in the elderly has been reported to reduce influenza - associated mortality by 3954% and pneumonia - associated hospitalization by 2773% 13. the commonly encountered adverse reactions to seasonal influenza vaccine are redness, pain and/or swelling at the injection site, which are reported to occur in 20% of all vaccine recipients. these adverse reactions are generally mild, the majority occurring within 48 h of vaccination and resolving within 2 or 3 days 4,5. although rare systemic adverse reactions, such as guillain barre syndrome and acute disseminated encephalomyelitis, are known to occur a few days to a few weeks after vaccination, the incidence rates of these reactions are extremely low. given that influenza - associated mortality is 30150 per 100,000 persons each year, it has been concluded that the benefits of the vaccine exceed the risks 6,7. an 80-year - old man received influenza vaccination in the deltoid muscle area of the left upper arm. on the evening of day seven after the vaccination, he noticed trembling of his left hand for 10 min. at that time he then went to bed as usual. in the morning on day eight after the vaccination , his family discovered that he had urinated in his bed and vomited in his sleep. because he did not respond to their calls, he was brought to our hospital by ambulance. the physical findings on arrival at the hospital were as follows: glasgow coma scale e4v3m6, blood pressure 116/79 mmhg, pulse rate 79/min (regular), peripheral arterial oxygen saturation by pulse oximetry 97% (room air), respiratory rate 16/min, and body temperature 37.3c. the hematological findings were as follows: white blood cell (wbc) count 10,400/l (neutrophils : 79.8%), serum creatine kinase (ck) 1272 iu / l, and serum c - reactive protein (crp) 2.39 mg / dl. head computed tomography (ct) revealed no abnormal findings that could explain the impaired consciousness. by the time the patient arrived at the hospital, , there was no relapse of the impaired consciousness, and neither head magnetic resonance imaging (mri) nor electroencephalography revealed any abnormalities. on day two of hospitalization, iu / l and 3.95 mg / dl, respectively ), and redness and swelling were observed in the left shoulder region. on day three of hospitalization, the fever and the redness of the left shoulder resolved, and the hematological findings revealed a decreasing trend of the wbc count and serum ck. however, because the swelling in the left shoulder was almost unchanged, ct and mri were performed. contrast - enhanced ct of the left shoulder joint (fig.1) revealed swelling and an increase in area of the surrounding subcutaneous adipose tissue in the left deltoid muscle, and mri of the left shoulder joint (fig.2) revealed muscle swelling and inflammatory changes around the left deltoid muscle. although there seemed to be a tendency toward improvement of the general condition and hematological findings, oral administration of nonsteroidal anti - inflammatory drugs and intravenous infusion of sulbactam / ampicillin were started on day four of hospitalization, considering the possibility of a complicating bacterial infection at the inflamed site. axial contrast - enhanced computed tomography (ct) of the shoulder showing the low density area, in the left deltoid muscle, with slightly enhanced the marginal region (arrow). (a) axial t1-weighted mr image, (b) axial t2-weighted mr image, (c) axial t2-weighted fat - saturated mr image of the shoulder showing increased t2-weighted signal in left deltoid muscle and subcutaneous fat tissue (arrow), which might suggest focal inflammatory changes. in japan, in the 1970s, it was reported that intramuscular injection of antipyretics and antimicrobial drugs caused quadriceps contracture in as many as 3600 patients. since then, there has been a tendency to avoid administration of drugs by intramuscular injection. thus, almost all vaccines, including influenza vaccine, with the exception of human papillomavirus vaccine, are administered by subcutaneous injection. as compared to intramuscular injection, subcutaneous injection is considered to be more likely to cause local adverse reactions (pain, erythema, induration, etc .) thus, even adjuvant - containing vaccines that contain a substance to enhance the immune responses to the administered antigens are not used in japan, with the objective of preventing adverse reactions. according to reports on the adverse reactions after influenza vaccination by the japanese ministry of health, labour and welfare, the majority of cases of local reactions are reported within 2 days of vaccination. a summary report based on surveys conducted in 13,386 vaccine recipients over a period of 12 years shows that there were only eight vaccine recipients who developed local reactions 1 week or more after vaccination. unlike our patient, however, none of the eight vaccine recipients had any systemic reaction 9. on the other hand, inactivated vaccines are administered by intramuscular injection abroad. according to several studies, local reactions to intramuscular injection are considered to be mild, in general, and to mainly occur within 2 days of vaccination, similar to the case in japan 1013. the adverse reactions include events caused by errors in vaccination procedures and events occurring by coincidence, in addition to allergic reactions to vaccine preparations. thus, it is considered to be extremely difficult to prove a causal relationship between a serious adverse reaction and a vaccine preparation. in our patient, a causal relationship with the vaccination was strongly suspected based on the temporal course and muscle swelling corresponding to the vaccination site. in most cases, allergic reactions to vaccine preparations are immediate hypersensitivity reactions mediated by immunoglobulin e antibody, that occur within a few minutes to a few hours after the vaccination 14. however, allergic reactions may be caused not only by the vaccine antigen, but also by residual egg protein, preservative, buffer and other components, and depending on the components responsible, delayed - type hypersensitivity reactions may also occur. in general, hypersensitivity reactions such as contact dermatitis due to thimerosal, which is a preservative contained in vaccines, are reported to be delayed - type hypersensitivity reactions occurring 210 days after vaccination 15. while our patient was receiving influenza vaccination every year, in the current year, it was possible that the vaccine was administered by intramuscular injection. given that the myositis occurred 1 week after the influenza vaccination, we assumed that thimerosal contained in the vaccine administered by intramuscular injection might have been responsible for the delayed - type hypersensitivity reaction. however, it has also been reported that currently, there are no differences in safety among thimerosal - free or thimerosal - containing vaccine 16. events associated with the vaccination procedure include infection with viruses or bacteria at the puncture site. it was assumed that the impaired consciousness in this patient was not caused by encephalitis, but was a of a symptomatic seizure triggered by fever, based on the following reasons: the short duration of the impaired consciousness, absence of abnormal findings on head ct, head mri and electroencephalography, and presence of a history of intracranial hemorrhage. in regard to bacterial infection, a case of necrotizing fasciitis at the vaccination site after influenza vaccination has been reported previously 17. in our patient, the blood culture was negative, and defervescence and a trend toward improvement in the hematological findings were observed even prior to the administration of the antibiotic therapy. however, vaccination should still be recommended, in view of their clinical benefits and the very small incidence of serious adverse reactions. meanwhile, we consider that adverse reactions which occur should be examined to identify their causes and be properly classified in order to promote the safe use of vaccines.

key clinical messagewe report a case of an elderly man who developed myositis of the deltoid muscle 8 days after influenza vaccination. adverse reactions to influenza vaccine are generally immediate reactions. however, delayed - type hypersensitivity reactions, although rare, can occur after routine influenza vaccination.

the spiritual dimension of humans has a multidimensional and complex nature with cognitive, emotional, and behavioral aspects. the emotional dimension of spirituality mixes with individual hope, love and dependence, internal peace, comfort, support, and experiences. behavioral aspects include inner spirituality and personal beliefs that are spliced with the outside world. in fact, spiritual care manifests in caring and nurturing in the spirit of individual such that attention to physical, intellectual, emotional, and spiritual dimensions is highly important to keep health and promote spiritual care. the terms spirituality and religion are used interchangeably, but they have different meanings for most individuals. while religion is considered as a particular set of beliefs in an organized group, spirituality is considered a personal feeling of peace, purpose, relation with others, and beliefs about life. spirituality is beyond colors, features, and geographical borders, and unifies the person with other people around the world and with god. religion is a bridge for spirituality such that religion contributes to a meaningful feeling of spirituality by encouraging people to use thought methods, feelings, and behaviors. spirituality is the nature of humans that gives meaning to life and accompanies people in their life journey. developing spiritual relationships with the infinite power gives individuals the confidence that a strong power always supports them. these individuals deal with accidents calmly by relying on their faith and belief and suffer less from stress and anxiety. spirituality increases the coping ability of an individual against diseases and improves the speed of recovery. although spiritual dimensions have considerable effects on different aspects of human life and providing spiritual care is one of the duties of nurses, it is not fully considered. understanding this dimension of patients is very important for nurses since nursing is a profession which looks at all dimensions of the patient, and spiritual care is an indispensable part and the core of holistic care. the holistic view requires that nurses consider individuals as biological, psychological, and social creatures with a core (of spirituality). therefore, nurses are expected to accept the spiritual care of patients and establish appropriate relationships with patients. competence is defined as a set of traits and characteristics which form the basis for optimal performance. the dimensions of competence relate to knowledge, skill, attitude, communication, management, motivation, education, culture, ethics, spirituality, research and information technology, and working with devices. the competence of a nurse is effective in guaranteeing the quality of care services provided for patients and their satisfaction, and a key factor in the competition intense world for the survival of hospitals. spiritual care is a set of skills used in the professional field or nursing process which include therapeutic relationships between the nurse and patients, being accessible for patients, active listening, showing empathy, providing religious facilities for patients with certain religious beliefs, helping patients, etc. spiritual competence in spiritual care refers to a set of skills which are used in the clinical nursing processes. if nurses become aware of their spiritual condition, they will be aware of the spiritual state of their patients. this awareness and spirituality in nurses is a prerequisite for creating commitment in the spiritual care process. in fact, for communicating patients with tension, nurses should become aware of their spiritual life. according to the standards although nurses are aware of the importance of spiritual care, studies show that it is not adequately provided. based on different studies, there is a close relationship between nurses' internal spirituality and attention and the tendency for providing spiritual care. this means that the higher the internal spirituality of a nurse, the more spiritual care he or she will provide for patients. because spiritual care needs understanding the spiritual ideas of patients and recognizing their intellectual needs, it is expected that nurses develop their knowledge and understanding in this regard. to provide complete and suitable services for patients by preserving human and ethical virtues , it is necessary to consider spiritual dimension as an important dimension which has a significant influence on individual health. the nurses' perception of spirituality can directly influence how they behave, deal with their patients, and communicate with them in providing spiritual care. the importance of nurses' abilities to understand their own perception of spirituality before assessing the spiritual needs of others has to be stressed. first, nurses believe that spiritual care is a part of their role, but most of them are confused about how to include it in clinical practice. second, nurses in all levels of clinical work feel that they are not ready for spiritual care. third, spiritual care may be defined in different ways and nurses should have their specific definition for providing acceptable care. studies have shown that spiritual care - a central element of holistic and multidisciplinary care - is not often included in practice. since we live in a country in which we believe in a supreme being and worship god, our nurses should have a higher understanding of their competence for presenting spiritual care, as spiritual care needs competence in nursing. this study was conducted to determine the perception of nurses of their competence in providing spiritual care for patients. this study was conducted to determine the perception of nurses of their competence in providing spiritual care for patients. the study population was all nurses who were working as a nurse or a nursing manager in one of the medical - educational centers of tabriz university of medical sciences (head nurse, supervisor, and director of nursing care) and had study criteria (at least 1 year work experience and university degree). to determine sample size, multistage random sampling was used, and the suitable assignment was used for allocation to wards. therefore, after selecting hospital, samples were chosen randomly considering number of nursing staff in different wards of hospitals. to gather data, then, researcher referred to selected wards and after explaining the purpose and delivered questionnaires to nurses in there different shifts to complete. data were entered into spss software version 13 (spss inc ., chicago, il, usa) and were analyzed. to gather data from demographic questionnaire and spiritual care competence scale (sccs) content validity of persian version was done by experts' opinion such that the scale was delivered to ten faculty members of nursing to study questions regarding ease, being clear and relevant. reliability and validity were measured by khalaj et al. in 2013, and cronbach alpha of questionnaire was 0.77 and for subscales was 0.650.85. this scale has 27 questions with 5 point likert scale (1 strongly disagree, 2 disagree, 3 neutral, 4 agree, 5 strongly agree) which is divided to 6 categories individual support and consultation with patient (6 questions 16), being professional and improving quality of spiritual care (6 questions, 712), attitude toward religious states (4 questions, 1316), communication (2 questions, 1718), evaluating and implementing spiritual care (6 questions, 1924) and referral to experts (3 questions, 2527). the data were analyzed using descriptive statistics (frequency, percent, mean, and standard deviation) and inferential statistics (independent t - test, one - way anova test, pearson, and spearman correlation tests). in all statistical tests, the significance level (p < 0.05) was considered. before implementing the study, required information and rights of participants were given to research units and confidentiality of responses was emphasized. furthermore, showed that there was significant difference score of nurses' understanding from their competence in spiritual care in hiring and workshop (p < 0.05) and in other cases (gender, marital status, shift, income, and position), there was no significant difference (p > 0.05). based on the findings, mean sd conception of nurses from their competence in provision spiritual care was 95.2 14.5. questionnaire has minimum 27 score and maximum 135 score such that below 64 is low spiritual competence, 6498 indicates average spiritual care, and above 98 shows high spiritual competence. comparing mean scores of nurses' perception from their competence in providing spiritual care in term of demographic characteristics of the study for each category in competence questionnaire for spiritual care was significantly higher than average. individual support, professionalism, evaluating, and implementing spiritual care categories includes 6 questions in 5 point likert scale from 1 to 5; therefore, their score range was between 6 and 30 with mean 18. providing spiritual care for patients is influenced by personal, cultural, and educational factors. moreover, those who provide spiritual care should have spiritual and ethical competence. the findings of this study showed that the scores for nurses' spiritual care competence were between 38 and 135, with a mean of 95.2 14.5, which indicates that the perception of nurses of providing spiritual care for patients is average. most nurses who participated in this study gained an average score. in another study, the mean spiritual care competence of nurses was 97.5 13.6 which is consistent with our study. of course, these are expected for our society which has religious and spiritual values. however, there is a need for promoting spirituality in nurses. on the other hand, religious attitudes in iran may be effective on responses to the questions of the scale, and individuals might be evaluated themselves in higher level. the of the present study showed that the mean score for each category of the sccs was higher than average. the highest score was related to religious state of the patient which indicated that nurses respect the beliefs of patients even if their beliefs were different from theirs. the lowest score was observed for the referral category, and most nurses stated that they did not have the required knowledge. the communication score was 7.8 (1.4), and most nurses stated that their shifts were busy and they did not have enough time for establishing relationships with patients. a study conducted by pesut on freshman and senior nursing students showed that communication has the most important role in providing spiritual care. narayanasamy and wen considered the causes of this inattention to be the vague role of spirituality in nursing, the nonscientific nature of spirituality, environmental factors, and lack of suitable relationships between patients and nurses. although studies on the perception of nurses of their competence in providing spiritual care for patients are very limited, several studies have been conducted on other aspects of spiritual care. sabsevari et al. showed that the students' competence of spiritual care was higher than that of nurses, which may be caused by the higher knowledge of students compared to nurses regarding spiritual care. on the other hand , nursing students did not have to deal with issues such as work pressure, lack of time, and routine programs. wong et al. studied the perception of 429 chinese nurses in relation with spiritual care for patients and reported that nurses have a positive perception of spiritual care. they concluded that religious beliefs and education of nurses promote their perception of spirituality and spiritual care. stated that there is a relationship between nurses' spirituality and their performance in providing spiritual care. it seems that there is a relationship between spiritual care and performance and competence, and further research is recommended in this regard. in studying the relation between scores of spiritual care competence and individual characteristics of nurses, a significant difference was observed in hiring type and participation in ethics workshops which are consistent with the of sabzevari et al. participating in ethics workshops and receiving education on the concept of spirituality and becoming aware of others' views about spirituality helps nurses to achieve a higher level of spiritual perception, improve their attitude toward spirituality and spiritual care, develop their skills in recognizing patients' spiritual needs, and providing spiritual care. in addition, in iran's health system, nurses with the employment status of plan are newly graduated nurses with little work experience. sufficient work experience seems to increase maturity both for critically evaluating one's own nursing philosophy and providing expert care. although differences were observed in the scores of spiritual care competence regarding the level of education and work shifts of nurses, they were not significant based on the t - test. regarding the relation between participation in ethics workshops and spiritual care competence, it is suggested that nursing management provides conditions for the participation of nurses in educational courses including continuous education, workshops, and conferences for spiritual care. according to the findings, although the spiritual care competence of nurses is average, promoting and increasing the spiritual capacity and spiritual care competence in education and training of nurses are useful tactics which must be considered by nursing curriculum designers. one of the limitations of the present study was that it was conducted only on nurses of tabriz university of medical sciences, and its are not generalizable to the larger society of nurses in iran. qualitative studies can be promising in clarifying the nurses' experiences with spiritual care for patients and their competence. the findings provide preliminary insights into the nurses' perception of spirituality and the development of spiritual care in iran. one of the limitations of the present study was that it was conducted only on nurses of tabriz university of medical sciences, and its are not generalizable to the larger society of nurses in iran. qualitative studies can be promising in clarifying the nurses' experiences with spiritual care for patients and their competence. the findings provide preliminary insights into the nurses' perception of spirituality and the development of spiritual care in iran.

: spiritual care is an important part of health - care provision. spiritual care can improve patients' health. one of the requirements for providing appropriate spiritual care for patients is having the required competence.aim:this study was conducted to investigate the perception of health - care providers of their own competence in providing spiritual cares for patients hospitalized in medical - educational centers of iran.subjects and methods: this study is a cross - sectional, analytical research conducted on 555 nurses of medical - educational centers in tabriz, iran, in 2014. data were collected using a two - part questionnaire including demographic information and the spiritual care competence scale. data analysis was performed using descriptive (frequency, percentage, mean, and standard deviation) and inferential (independent t - test, pearson, spearman, anova with tukey test) statistics in spss software version 13.: showed that the mean score for nurses' perception of their competence in providing spiritual care for patients was average, that is, 95.2 14.4. mean score of nurses' perception of their competence in providing spiritual care in each aspect was significantly higher than average (p < 0.05). the highest score was related to individual support and consulting with patients, that is, 21.1 (4.0), and the lowest score was related to reference to experts, that is, 9.5 (2.3). the type of employment and participation in workshops had significant relationships with nurses' perception of their competence for providing spiritual care (p < 0.05).: the findings indicate that authorities and policymakers should take steps in planning for nurses' training for promoting their competence in providing spiritual care for patients; therefore, holding workshops is necessary.

venoarterial extracorporeal membrane oxygenation (va - ecmo) can maintain hemodynamic stability in the absence of an intrinsic cardiac rhythm or effective cardiac output and provide excellent mechanical circulatory support in such urgent or emergent situations. va - ecmo has been shown to be effective in patients with secondary cardiac failure due to drug overdose. although va - ecmo is a strong tool in such patients, several complications, including infection, can occur. we herein report the rare appearance of a vegetation in a patient treated with va - ecmo. a healthy teenage japanese girl was admitted to our hospital after experiencing out - of - hospital cardiac arrest. she had attempted to commit suicide by taking 4,950 mg of disopyramide and 12 mg of flunitrazepam, which was prescribed to her mother (she was diagnosed with paroxysmal atrial fibrillation). effective cardiopulmonary resuscitation was promptly commenced, and a laryngeal mask was inserted by paramedics. she was intubated, and sinus rhythm with wide qrs was restored after the administration of adrenaline 3 mg and atropine 1 mg as adjuvants. a large - volume gastric lavage followed by activated charcoal was performed to eliminate the drugs. despite medical therapy with intravenous catecholamine, her cardiac function deteriorated with the left ventricular ejection fraction decreasing to 13%. to provide mechanical cardiopulmonary support, the patient was cannulated for va - ecmo into the right femoral artery (17 fr cannula) and vein (21 fr cannula) percutaneously using the seldinger technique. an intra - aortic balloon pump (iabp) and catheter for continuous hemodiafiltration (chdf) and direct hemoperfusion were introduced into the left femoral artery and left internal jugular vein, respectively. the activated clotting time subsequently, the electrocardiography (ecg) improved to narrowing of the qrs complexes. the next day , transthoracic echocardiography (tte) showed that her cardiac function had gradually improved without any valvular abnormalities (fig . the patient was weaned from va - ecmo, the femoral artery and venous cannulae were surgically removed and the cannulation sites were repaired . blood cultures were subsequently performed, and vancomycin was administered . after obtaining the blood culture , which were positive for methicillin - sensitive staphylococcus aureus ( s. aureus), we switched the antibiotic to cefazolin. despite intravenous antibiotics, the fever persisted and the c - reactive protein level and white blood cell count increased to 28.95 mg / dl and 17,200/l, respectively. ten days later, tte showed a large mobile and solid mass attached to the apical part of the left ventricular apex without any valvular abnormalities (fig . a diagnosis of endocarditis associated with sepsis due to s. aureus, and an oscillating intracardiac mass documented by an echocardiogram was made according to the modified duke 's criteria. gentamicin was subsequently added as a standard therapy of infectious endocarditis, and the patient underwent urgent surgery (fig . a pedunculated mass originating from the apex of the left ventricle was exposed and excised with a substantial portion of the normal myocardium ( fig . after the operation, the patient was treated for 4 weeks with intravenous antibiotics ( 2 weeks of vancomycin ( 2 g / day), and 2 weeks of cefazolin (4 g / day) and gentamicin (180 mg / day), which were suitable for methicillin - sensitive s. aureus after the pathologic specimen confirmed s. aureus ) and had an excellent clinical response. b: a parasternal long - axis view showing a large vegetation attached to the apical part of the left ventricle. a: the arrow shows a vegetation that developed from the left ventricular endocardium. bleeding, hemolysis, and infection are common complications that contribute to va - ecmo - related morbidity and mortality. the overall infection rates in temporary mechanical circulatory support are as high as 30 - 40%. immobilization, a poor nutritional status, and indwelling catheters and tubes are all likely to contribute to the high incidence of infection. the risk of endocarditis is largely confined to patients with prolapse, thickened valve leaflets (> 5 mm), and mitral regurgitation. we considered three important factors in the development of vegetation at the apex of the left ventricle. a healthy cardiac endothelium is generally resistant to frequent bacteremia caused by daily activities. sepsis itself (direct bacterial activity, particularly from s. aureus) also causes endothelial damage. the apex is easily injured when the coronary flow is decreased because it is in a peripheral area. the third factor is circulation using va - ecmo, especially in patients with cardiac arrest. va - ecmo allows gas exchange and hemodynamic support while the blood is pumped from the venous system close to the right atrium on the atrial side (femoral artery). therefore, during cardiac arrest, little blood flow reaches the left ventricle, which makes it easy to form a vegetation in the left ventricle. the vegetation formed in the apex of the left ventricle in our patient. prophylactic antibiotics are not always administered prior to cannulation in urgent cases, as the focus is on saving the patient's life. additionally, the patient was afebrile 2 days after cannulation. the administration of antibiotics should be considered in cases in which repeat cannulation is required. in , we herein reported a patient with infective endocarditis in which a vegetation formed at the apex of the left ventricle. our findings showed that prophylactic antibiotics should be administered to patients treated with va - ecmo.

a healthy teenage japanese girl was admitted to our hospital after experiencing out - of - hospital cardiac arrest. she had attempted to commit suicide by taking 4,950 mg of disopyramide and 12 mg of flunitrazepam. mechanical cardiopulmonary support was started with percutaneous cannulation of the femoral vessels. several days later, a blood culture tested positive for staphylococcus aureus. transthoracic echocardiography showed a large mobile and solid mass attached to the apical part of the left ventricle. to the best of our knowledge, the anatomical location of a pedunculated mass originating from the apex is a rare condition.

neuropeptides are a subclass of peptides that can function as neuromodulators, neurotransmitters and hormones and have a critical role in many biological processes such as growth, learning, memory, metabolism and neuronal differentiation and disorders such as depression, parkinson s disease, and eating and sleeping disorders. most neuropeptides range in length from 3 to 40 amino acids and are produced by a complex post - translational processing. this processing includes removal of a signaling peptide, cleavage of precursor prohormones at basic amino acids (k and r), removal of c - terminal basic amino acids by carboxypeptidases, and post - translational modifications (ptms). mass spectrometry (ms) is a well - established technology to identify proteins and peptides. the shotgun proteomics implementation of the bottom - up approach relies on the direct protease digestion (typically with trypsin) with subsequent separation of the peptides in the first lc separation step for tandem mass spectrometry (ms / ms). in a subsequent step, the ing digested peptides are subjected to tandem mass spectrometry (ms / ms) to generate ms / ms spectra. database searching is a common approach to identify peptides and, consequently, proteins from ms / ms spectra. the overall strategy of database searches is to pair observed and theoretical or predicted spectra. the observed spectra arise from ms / ms experiments and the theoretical spectra are the of in silico prediction based on the known sequence of potential peptides in a database. most databases include proteins that have been empirically confirmed or predicted from genome sequence assemblies and/or est libraries. database search programs use different algorithms and, thus, differ in the capability to identify peptides. comparing the performance of mascot, sequest, sonar, x!tandem and spectrum mill, 15% of human serum and plasma ms / ms spectra similarly, on average 34% of the proteins from normal human ovarian epithelium was identified by mascot, omssa, sequest and x!tandem. out of 1837 human histone ms / ms spectra, inconsistencies among programs in peptide identification have been attributed to differences in the matching algorithms although simulated spectra have not been used to assess the performance of the programs. the same ms / ms database search programs used to identify proteins and peptides in general are also used to identify neuropeptides. however, the extrapolation of the performance of these programs to identify neuropeptides is not straightforward. first, the goals are different when characterizing proteins via shotgun proteomics and for a typical neuropeptide measurement. in a proteomics experiment, the proteins are digested into peptides via an enzyme and then the goal is to identify unique peptides from the protein with high enough confidence that the existence of the protein can be inferred. higher numbers or more unique peptides identified translate to higher evidence supporting the presence of the protein in the sample. on the other hand, neuropeptides already exist in the sample as endogenous peptides prior to sample preparation or enzymatic degradation. consequently, each individual neuropeptide requires the precise identification of the exact form of the peptide. the second distinctive feature is that the length of neuropeptides tends to be small and, thus, precise short sequence matches tend to be less statistically significant than the matches of potentially many or longer peptide products from shotgun proteomics. short lengths limit the statistical significance of the match of the peptide to a database and thus the capability to detect peptide matches beyond a user - defined statistical threshold. a third distinctive feature is that neuropeptides may from cleavages by multiple proteases. thus, the standard ms digestion model to generate peptides from proteins is not exactly applicable to neuropeptides because many of these may lack additional basic amino acids or in smaller peptides. consequently, the digestion model may not identify the correct peptide and fail to distinguish between shorter and longer forms of the same peptide. the fourth distinctive feature is that the proteins and peptides under consideration are synthesized as inactive precursors, that are converted to their mature forms by protein convertases (pcs) ing in bioactive proteins and peptides. generally, these endoproteases cleave the precursor substrates at the c - terminal side of single, paired, or tetra basic amino acid residues including arginine or lysine. subsequently the c - terminal basic residues of protein / peptide intermediates are eliminated by specialized carboxypeptidases leading to the mature peptides. these peptides may undergo additional post - translational modifications including c - terminal amidation, n - terminal acetylation, glycosylation, sulfation, and phosphorylation prior to the formation of the final bioactive peptides. this specialized processing is not modeled by protein identification programs used in shotgun proteomics. in summary, the goal in prohormone peptide ms studies is to identify individual and typically small peptides, and not to use the presence of unique peptides to infer the presence of a larger protein. after all, the presence of the protein angiotensinogen is not as important as detecting the forms of angiotensin present as each form (whether angiotensin i, ii or iii) implies something different. because of these differences in goals, the need to characterize the exogenous peptides in a sample creates a different set of factors that has a unique and still uncharacterized impact on the performance of the different protein search algorithms to identify neuropeptides. sample preparation, instrumental and algorithmic settings need to be tailored to minimize the influence of sample complexity and dynamic range, typically observed in neuropeptide studies. these settings can in peaks selected for ms / ms representing chimeras that contain more than one peptide with similar mass - to - charge (m / z) values. for example, from a single 875.79 m / z precursor peak, both the prosaas big len peptide (1744.964 da with charge state + 2) and rhombex-40 peptide (2623.345 da with charge state + 3) have been identified. a least one peptide is expected to be identified in these chimera spectra due to the difference in charge states. a more challenging situation occurs when the peptides in a chimera have similar theoretical mass and identical charge state. prevalence of chimera events that can lead to inaccurate identification has been estimated to range between 11 and 50% of the ms / ms trypsin - digested spectra. no large - scale, systematic study of the strengths and weaknesses of database search programs to identify neuropeptides and other potential peptides ing from prohormone processing have been reported. the unique characteristics of these peptides, compared to peptides ing from a tryptic digest justify the evaluation and recommendation of database programs and algorithms that best support the identification of neuropeptides. the aims of this study were: to compare the relative advantages of three complementary open - source search methods: omssa, x!tandem and crux to accurately identify prohormone peptides including neuropeptides; to evaluate the impact of ms factors such as charge on neuropeptide identification; and to offer guidelines to obtain the most comprehensive and accurate survey of the peptides in a sample. a comprehensive set of prohormone and peptide sequences were compiled from our two public repositories, neuropred (http://neuroproteomics.scs.illinois.edu/neuropred.html) and swepep (http://www.swepep.org), and complemented with information from uniprot (http://www.uniprot.org ; release 2011_01). neuropred was also used to predict the most likely and potentially cleaved peptides from 92 mouse prohormones. the final database consisted of 7850 peptides that ranged in length from 5 to 255 amino acids including experimentally confirmed neuropeptides and predicted peptides (table 1). peptides from mouse prohormones were used to simulate the observed or query spectra and generate the corresponding search or target database. the rationale for matching the observed data to the same counterpart in the database without the addition of a decoy database is 3-fold. first, a decoy database does not assist in determining if the algorithms can correctly match the spectra to the correct target. rather a decoy database provides a general measure of confidence among the matches. second, the simulated data share the same quality and thus the addition of decoy mass spectra does not aid in addressing quality differentials in the present study. a reverse decoy spectra of a short peptide has higher likelihood to be present in nature than that of a longer peptide, thus biasing the objective of these spectra to help assess the probability of a random match. the lack of known spectra with no target database entry prevented the comparison of performance across programs using receiver operating characteristics curves. among the database search programs available, these programs were selected because they are open source and this allows the investigation of the code, computation of matching scores and the algorithmic specifications. these three programs were compiled using the default settings and run on the same computer (a 3.00 ghz intel x9650 processor). these three programs compute a score indicator of the similarity (e.g., correlation) between the query and database spectra. the score is then used to compute an e - value (expected value or expected number of database matches by chance with scores equal or higher than the one observed) or p - value (the probability that the match between the query and target sequences is due to chance). the programs differ on the algorithm used to identify and score the matches and statistical significance indicator of each match. crux (version 1.37 released on december 22, 2011) is an alternative implementation of the sequest algorithm. peptide identification relies on searching a collection of spectra against an indexed sequence database, and returning a collection of peptide - spectrum matches (psms). crux option to calculate p - values from a weibull distribution of the cross - correlation scores was used in this study. although this approach is computationally intensive, this strategy maximizes sensitivity or true positive rate through the ability to identify peptides regardless of the quality of the spectra at the expense of higher rates of false positives or mismatches. x!tandem (http://www.thegpm.org/tandem ; version 2010.12.01.1 released on december 01, 2010) was developed to optimize speed and to minimize the computational requirements. the algorithm preprocesses the observed spectra to remove noise and technical artifacts, processes database peptide sequences with cleavage reagents, post - translational and chemical modifications and scores the peptide matches between the observed and predicted spectra. the scores are converted to hyperscores and the distribution of hyperscores of all matches is used to translate the hyperscore of each match into an e - value. the open mass spectrometry search algorithm (omssa ; version 2.1.7 released on june 15, 2010 ; http://pubchem.ncbi.nlm.nih.gov/omssa) centers on optimizing the speed of database searching approach. the scoring of each match assumes that the number of matches between observed and predicted peaks for a peptide sequence follows a poisson distribution. the lambda (or average) parameter of the poisson distribution is calculated as a function of the fragment ion tolerance, the number of predicted and observed peaks and the neutral mass of the precursor ion. omssa provides e- and p - values based on the dimensions of the target database. simulated spectra were used to compare the performance of the three database search programs. there are three advantages of simulating the observed peptides to be queried against a database. first, the use of simulated mass spectra overcomes the limited number of neuropeptides with mass spectra information of comparable quality obtained using the same or similar technologies. second, the analysis of simulated mass spectra that share the same quality level allows benchmarking the database search programs irrespectively of sample or data quality issues including low mass accuracy, noise and low signal - to - noise ratio. third, simulated mass spectra offers an absolute control of the peptides that should be detected and accurate evaluation of the number of true positives (detected and correctly identified peptides), false positives (detected but incorrectly identified peptides) and false negatives (missed peptides). ideal uniform spectra that have either + 1, + 2, and + 3 peptide charge states were simulated for each peptide precursor ion in the target database. for each peptide charge status, only + 1 charged b- and y - product ions (b- and y - ion series) were simulated with equal intensity. neutral losses of a water (18 da) and/or ammonia (17 da) were simulated when the ion contained either one of four water losing amino acids (ser, thr, glu, asp) or ammonia losing amino acids (arg, lys, gln, asn). neutral losses from b- and y - ion series occurred regardless of position of these amino acids in the ions. complementary scenarios of neutral mass loss and ion availability conditions were simulated across the three peptide charge states and searched against the database to investigate the impact of these situations on the identification of neuropeptides. the simulated query scenarios included: 1)all b- and y - ion series including all neutral mass losses due to water and ammonia. this scenario constitutes the baseline for comparison.2)only the possible b- and y - ion series excluding neutral mass losses.3)only the possible b - ion series including all neutral mass losses.4)only the possible y - ion series including all neutral mass losses.5)random 50% of b- and y - ion series including all neutral mass losses.6)random 25% of b- and y - ion series including all neutral mass losses.7)only scoring the b - ion series from b- and y - ion spectra including all neutral mass losses.8)only scoring the y - ion series from b- and y - ion spectra including all neutral mass losses. all b- and y - ion series including all neutral mass losses due to water and ammonia. this scenario constitutes the baseline for comparison. only the possible b- and y - ion series excluding neutral mass losses. only the possible b - ion series including all neutral mass losses. only the possible y - ion series including all neutral mass losses. only scoring the b - ion series from b- and y - ion spectra including all neutral mass losses. only scoring the y - ion series from b- and y - ion spectra including all neutral mass losses. the performance of the database search programs to identify peptides from chimera spectra was investigated. chimera representation was achieved by combining the simulated spectra from peptides that have similar theoretical mass values and have the same charge state. only peptides that were correctly identified by the three algorithms at e- or p - value < 0.01 with a single peptide simulated with all neutral losses and ions were used. the ing peptides were grouped such that the maximum difference in the theoretical mass of each group was within 0.4 da. individual spectrum was simulated for each peptide including all the b- and y - ion series, neutral losses and + 1 peptide charge state. chimera spectra were generated for each mass group by merging these individual simulated peptide spectra into a single spectrum using the average theoretical precursor mass for the precursor ion m / z value. the peptide identification search programs omssa, x!tandem and crux were evaluated using comparable algorithmic specifications and excluding ptms. the default values of the programs were used in addition to the following specifications: precursor ion tolerance: 1.5 da; product or fragment ion tolerance: 0.3 da; no fixed or variable modifications; whole protein (omssa) or enzyme: custom cleavage site (x!tandem and crux) to prevent cleavage since the detection of neuropeptides does not involve protease digestion; peptide length: 5255 residues; peptide ion charge: + 1, + 2, + 3; product ion charge: default values; no complete or partial modifications; and peptide mass: monoisotopic. for comparison purposes, crux probability scores (ranging from 0 to 1), x!tandem e - values (ranging from 1 10 to 1 10) and omssa e - values (ranging from 1 10 to 1 10) were transformed using a base 10 logarithm. the match or hit with lowest e- or p - value among all hits per input spectrum the 1 10 threshold based on a 1% bonferroni correction (0.01/7850 = 1.27 10 1 10) was used to determine if the match was significant while accounting for multiple testing. the overall significance and the correctness of the matched sequence of the simulated query - to - target matches were used to assess the capability of each search algorithm to detect neuropeptides and other prohormone peptides. this evaluation step allowed discrimination between obvious and dubious, yet correct, peptide identifications. a peptide match was deemed to be significant if the detection signal (e.g., e- or p - value) was lower (more significant) than a 1 10 threshold. this stringent threshold aimed to minimize the number of false peptide identifications because the percentage of matches that could be considered by chance (false positives) is less than a 1% bonferroni corrected significance threshold. there were three outcomes for each simulated spectra: the neuropeptide correctly matched the simulated peptide (true positive), incorrectly matched (false positive) or failed to match (false negative). a lower threshold e- or p - value < 1 10 was also investigated because neuropeptides tend to be short and thus true positives from the database matching process are unlikely to generate extreme e- or p - values. table 2 summarizes the from the three search methods across three peptide charge states. most peptides (approximately 7764 out of 7850 peptides across charges when all ions are available) were identified by these three programs regardless of e- or p - value level. among the 7764 peptides correctly matched by all three programs, 7022 were detected by all three programs followed by omssa and x!tandem (385 peptides), omssa alone (302 peptides), omssa and crux (7 peptides) at e- or p - value < 1 10 meanwhile 48 peptides were detected at e- or p - value > 1 10 by all three programs. thus, among the peptides detected by all programs regardless of statistical significance, omssa detected these peptides with higher statistical significance, followed by x!tandem and last crux (table 2). correctly matched peptide regardless of e- or p - value level on all three, two or one of the database search programs. missing columns (omssa+crux, x!tandem, omssa) are columns with 0 in all rows. all: omssa, x!tandem and crux; oc: only omssa and crux e- or p - value < 1 10; ox: only omssa and x!tandem e - value < 1 10; xc: only x!tandem and crux e- or p - value < 1 10; o: only omssa e - value < 1 10; n: no program e- or p - value < 1 10. missing columns (xc and x within omssa+x!tandem+crux, x in x!tandem+crux) are columns with 0 in all rows. simulated query scenarios: b + y ions + neutral mass loss: match using all b- and y - ion series including neutral mass losses; b + y ions - neutral mass loss: match using all b- and y - ion series excluding neutral mass losses; b ions + neutral mass loss: match only using the b - ion series including neutral mass losses; y ions + neutral mass loss: match only using the y - ion series including neutral mass losses; 50% ions + neutral mass loss: match only using random 50% of all ions including neutral mass losses; 25% ions + neutral mass loss: match only using random 25% of all ions including neutral mass losses. crux was the only program that detected all peptides regardless of significance level (table 2). across charges, approximately one peptide was detected by crux and x!tandem reaching e- or p - value < 1 10. approximately 85 peptides were detected by omssa and crux only but, of these, only approximately two peptides reached e- or p - value < 1 10 and this was in crux. from 23550 simulated spectra (7850 peptides 3 peptide charge states), omssa, x!tandem and crux had 23548 (99.9%), 22932 (97.4%) and 23139 (98.3%) correct identifications (true positives) at e- or p - value < 1 10. at e- or p - value < 1 10, omssa, x!tandem and crux had 23281 (98.9%), 22117 (93.9%) and 20890 (88.7%) true positive , respectively. the similar performance of the programs at the less significant threshold reiterates the findings summarized in table 2 that the crux algorithm provides lower significance . our are consistent with previous reports of a higher number of spectra matched by omssa than by x!tandem. figure 1 includes a venn diagram depicting the peptides correctly identified by the three database search programs for charge state 3 using information from all ions. insights into the features that are differentially accommodated by the assumptions and models used by each database search algorithm were drawn from the investigation of the peptides that were not identified by all three programs. venn diagram depicting the common and distinct true positive peptides identified from the three database search programs, x!tandem, omssa, and crux with peptide charge state + 3 using (a) all ion information; (b) only y - ion series information; (c) only b - ion series information. the length of the peptide had an impact on the statistical significance of the match in all the programs. the majority of the 109 (1%) charge + 1 peptides that were identified (using b and y ions and including neutral mass loss) by all three programs and reached e - value < 1 10 in at least one program were five amino acids long peptides. figure 2 depicts the relationship between the log10 transformed e- or p - values on peptides across peptide length. overall the correlation between the length of the query sequence and log10 transformation of the e- or p - values for omssa, crux and x!tandem was 0.1%, 86.8% and 46.7%, respectively although the relationship was nonlinear. comparison of omssa, crux, and x!tandem log10 (e- or p - values) averaged across peptide length and precursor charge states for all peptides and (inset) magnified for peptides up to 60 amino acids in length. there was a gradual increase in the number of peptide matches that have p - value < 1 10 with increased peptide length in crux although only peptides 46 amino acids long and higher surpassed this threshold. examination of the relation between query length and log - transformed e - values showed rapid increases up to 11 and 15 amino acids long peptides in omssa and x!tandem, respectively, before the log - transformed e - values stabilized. in contrast, the crux log - transformed p - values showed a gradual increase up to approximately 50 amino acids before the log - transformed p - values started to stabilize. consistent with our findings, small peptides between 600 and 700 da tend to be missed. a similar effect of peptide length on the distribution of the maxquant program p - scores between target and decoy database was observed. in that study, peptides with less than 15 amino acids had a higher likelihood of being incorrectly matched than peptides with 15 or more amino acids. the increase in e - values with decreasing peptide length is due to the corresponding increase in the number of expected matches by chance. the mean of the underlying poisson distribution used by omssa decreases with smaller peptides ing in larger e - values due to the increased probability of a random match. in particular , the detection of short peptides by omssa is negatively influenced by the tendency of small peptides to exhibit neutral mass losses. for peptides less than 12 amino acids, the correlations of log - transformed e- or p - values between omssa and x!tandem, omssa and crux, and x!tandem and crux were 78%, 63% and 52%, respectively. this also indicates that the selected threshold was more stringent in crux and x!tandem than for omssa. no program correctly detected five amino acids long peptides at e- or p - value < 1 10. omssa and x!tandem correctly detected all peptides longer than 7 and 11 amino acids, respectively at e - value < 1 10, when all ions were available excluding neutral mass loss. crux was the only program able to correctly match all peptides although only 12 peptides with less than ten amino acids had p - values < 1 10. at p - value < 1 10, 33%, 64%, 75%, 87%, 98%, 99% and 100% of the 5, 6, 7, 8, 9, 10, and 11 amino acids long peptides were detected with crux. this suggests that the significance calculation in crux is more stringent than in the other two programs. the positive association between the fraction of peptides detected and peptide size is partly due to the number of weibull samples because with 100 permutations only 61 of the peptides with charge state + 1 had p - value < 1 10 threshold ( not shown). consequently, adding further weibull samples especially for small peptides may increase the significance levels by providing more accurate density estimation. x!tandem was not able to correctly detect the 85 peptides that were five amino acids long which accounted for 1% of all peptides. across the different scenarios evaluated (ion availability, etc .), most of these peptides were not detected (80%) and the rest were incorrectly identified (mismatched). x!tandem was able to correctly match at e - value < 1 10 peptides at least ten amino acids long, and 94% of the peptides that were seven amino acids long and all peptides that were at least eight amino acids long were detected at e - value < 1 10 threshold, when all ions were available including neutral mass loss. similarly, the performance of omssa was also influenced by peptide size because most peptides at least ten amino acids long were detected at e - value < 1 10. however, 100%, 27%, 6%, and 1% of the peptides five, six, seven and eight amino acids long, respectively, did not reach significance in omssa. the statistical significance of the x!tandem matches was inferred using the lowest scores from the matches. consequently, the significance values assigned by x!tandem is negatively influenced when there are insufficient matches to provide an accurate estimate of the x!tandem score. at the other computational extreme, crux uses resampling to provide a statistical significance value for each peptide identified. resampling consists of random permutations of the peptide sequence that are subsequently matched to the database and scored. the implementation of resampling in crux is with replacement, which potentially allows the same sequence to be repeatedly sampled. this event is more likely with shorter peptides and high resampling specifications. unlike crux and x!tandem, the omssa e - value is derived from the assumption that the number of matches can be represented by poisson distribution and does not depend on the matches or generated sequences although it relies on the database size. the omssa formulation is also dependent on peptide size so that small peptides tend to be on the lower bound of significance due to the smaller proportion of ion matches than larger peptides. for example, if the poisson mean is equal to one, then the probability of zero ion matches is 0.37%. the few detection failures in this study were investigated using omssa because the e - value calculation offers more sensitivity. five neuropeptide sequences were not first ranked peptides in omssa across all simulated conditions. four of the peptides are processed from the highly homologous oxytocin - neurophysin 1 and vasopressin - neurophysin 2-copeptin prohormones. these peptides were further reduced to two sets of peptides after consideration of ambiguous cleavage sites that lead to two possible peptides within the homologue. the simulated spectra of the b- and y - ions without neutral mass loss were similar between these peptides with the maximum difference being 19.9 m / z and occurring at the b6 ion. another mismatch occurred with a penk (uniprot i d p22005) peptide due to the multiple occurrences of the met - enkephalin in a longer peptide. for simulated charge states + 1 and + 2 including neutral mass loss, a mismatch occurred between the two met - enkephalin peptides located at the c- and n - terminal. due to the similarity in sequence and e - values, these peptides were treated as homeometric peptides and were considered as correct matches. unlike x!tandem and crux, omssa failed to detect the peptide for all three charge states and a neutral mass loss for one peptide, a chromogranin b peptide (positions 592 to 652) predicted by the neuropred mouse model. also, omssa had one mismatch; a secretogranin ii peptide (positions 475 to 547) from a neuropred nonmammalian model matched to neurotensin (positions 87 to 156) with charge state + 3 and neutral mass loss at an e - value > 60. this suggests a weakness (or lower sensitivity) of the omssa algorithm to accommodate neutral mass losses. examination of both peptides indicated that 54% of the amino acids in each sequence were prone to lose water (28% of the amino acids) and ammonia (25% of the amino acids). as a approximately 2/3 of the ions can include neutral mass losses and omssa was not able to distinguish the series with and without neutral losses. combining identifications that were significant in at least two programs improves the average identification rate across all three charge states from 89% to 94% when all ions were available for scoring and including neutral mass loss. using a consensus approach, as has been advocated in the identification of proteins, can improve peptide identification because the probability of all programs incorrectly identifying a peptide is equal to or less than probability of the least accurate program being incorrect. while this consensus approach assists in the correct identification of peptides, it is less suitable to the goals of the present study because the individual programs helps us to understand the particular distributional features of the prohormone peptide population of mass spectra relative to protein database searches and recommends the best tools for particular neuropeptides. for example, a closer inspection of the few peptides (5%) that were not consistently identified across programs revealed that these peptides were correctly matched by at least crux and omssa although exhibited low scores, irrespectively of the programs, due to the small size of these peptides (ranging between 5 and 11 amino acids long). this suggests that for these few neuropeptides all three programs have comparable disadvantages but have complementary strengths and weaknesses to detect neuropeptides. the performance of the three programs in the identification of peptides when all ions from both series are available including and excluding neutral mass losses in the simulated spectra is summarized in table 3 for charge state + 1 and in supporting information tables 1 and 2 for all charge states. the inclusion of neutral mass losses in the simulated query spectra had minor influence on the overall detection of peptides across the programs. the average percentage of peptides that were detected at e- or p - value < 1 10 including neutral mass loss over all charge states was 98.3%, 94.4% and 89.5% in omssa, x!tandem, and crux, respectively. the average percentage of peptides that were detected at e- or p - value < 1 10 excluding neutral mass loss over all charge states was 98.9%, 93.9% and 88.6% in omssa, x!tandem, and crux, respectively. the opposite trend observed in omssa relative to the other two programs may be due to the extremely high percentage of peptides already identified including or excluding neutral mass loss. the percentage of peptides detected at low or nonsignificant values was five- and 10-fold higher in x!tandem and crux relative to omssa, respectively. for these peptides, inclusion of neutral mass loss improved the detection of peptides at low or nonsignificant levels in omssa and x!tandem by 1% and have the opposite effect in crux. peptide detection by crux or omssa was not largely affected by neutral mass loss. the inclusion of neutral mass loss noticeably influenced the significance levels of x!tandem matches that were already highly significant (e - value < 1 10). significance threshold (t) for matched to be considered significant at e- or p - value < 1 10. including or excluding neutral mass losses. unmatched: the program does not provide a match with the program setting. mismatched: the program provided an incorrect match. percentage of the matches that have e- or p - value < 1 10. the impact of neutral mass loss on peptide detection depended on the charge state. at the stringent threshold e - value < 1 10, peptides that have precursor charge state + 1 had more significant matches (93%) than precursor charge state + 3 (81%) in omssa. this difference decreased with less stringent thresholds and at the e - value < 1 10 threshold the difference in detection was only 1% between charge states + 1 and + 3. this may be partially explained by the assumption that + 2 product ions are present in precursor charge state + 3 and higher spectra but not present in charge state + 1 spectra. this assumption in a higher number of possible ions and a consequently a lower significant e - value even if the spectra lacks these highly charged product ions. a summary of the performance of the three programs in the identification of peptides when only b - ion series, y - ion series, random 50% of all ions, and random 25% of all ions are available including neutral mass losses, respectively for charge state + 1 is presented in table 4. likewise, supporting information tables 3, 4, 5, and 6 report the performance of the three programs for all three charge states. the percentage of correct identifications across all programs was 87%, 88%, 85% and 68% when b - ion series, y - ion series, random 50% and random 25% of the ions were available, respectively. the proportion of unidentified peptides in all programs was 8%, 6%, 7% and 14%, when b - ion series, y - ion series, random 50% and random 25% of the ions were available, respectively. significance threshold (t) for matched to be considered significant at e- or p - value < 1 10. b-, y - ion series, 50%, or 25% of the ions in the query are available. mismatched: the program provided an incorrect match. percentage of the matches that have e- or p - value < 1 10. the lower percentage of peptides identified in scenarios that had 50% and 25% of the ions available was mainly due to a poorer performance of x!tandem regardless of the charge state. the minimum length for a peptide to be detected at significance e - value < 1 10 were 13, 15, 14, and 81 amino acids for the y - ion series, b - ion series, 50% ions and 25% ions available, respectively, compared to ten amino acids when all ions were available. these trends are likely to be related to the number of ions that can potentially be available rather than the percentage of ions available. missing ions also impacted the detection of peptides by omssa. on average, 65 peptides across all three charge states were undetected when only 25% of all ions were available. these peptides were between five and eight amino acids long and only peptides with more than 25 amino acids had e - value < 1 10. there was a tendency for the number of undetected peptides by omssa to increase with increasing charge state when only 50% of ions were available. this is consistent with the observed trend in the presence of neutral loss simulation and suggests that the presence of neutral loss, rather than the absence of 50% of ions, was the factor driving the lower detection rate. however, when only 25% of the ions were available, charge state + 1 peptides were four times more likely to be undetected relative to higher charge states. these indicate that the absolute number of ions present is potentially more critical to the omssa algorithm than the relative percentage of ions available. overall, these findings highlight a diminishing return on accurate identification for additional ions used by omssa, with the detection e - value threshold dependent on the precursor charge state. longer peptides are expected to generate more ions, suggesting that the omssa scoring system based on the actual number of mass spectra peak matches needs to account for the overall peptide length. this adjustment is important for neuropeptides because the goal is identifying each form of these oftentimes short peptides. missing ions on the query had minor influence on the identification and significance level of the peptides in crux, unlike in omssa and x!tandem (table 4). venn diagrams depicting the peptides correctly identified at e- or p - value < 1 10 by all three database search programs, x!tandem, omssa, and crux using information from all ions or only y- or b - ion series for peptide charge state + 3 is depicted in the top, bottom left and bottom right corners of figure 2, respectively. figure 2 highlights that overlap among all three programs (particularly between omssa and x!tandem), and the ability of omssa to identify peptides scored at e - value < 1 10. the lesser overlap between programs when either one of the ion series is considered, stresses the relative advantage of crux when only b - ion series were available, and of omssa and x!tandem when only y - ion series were available for peptide identification. figure 3 presents the venn diagrams depicting the peptides identified at e- or p - value < 1 10 by all three database search programs using only 50% (left venn diagram) or 25% (right venn diagram) of all ion information for peptides with charge state + 3. the previous venn diagrams center on peptides detected at high significance levels and ignore the strength of crux to detect small peptides that have low p - values. venn diagram depicting the common and distinct peptides identified by all three database search programs with peptide charge state + 3 using only (a) 50% or (b) 25% of all ion information. the venn diagrams highlight the increasing detrimental impact of missing ions on the performance of x!tandem. the simulation of the random proportion of ions represents one type of incomplete fragmentation that is an important component of the differences between programs in peptide identification. peptides can be identified by the programs when incomplete fragmentation provided sufficient ions are present especially for large peptides. the challenge for these programs centers in assigning an appropriate significance threshold since most of the peptides were correctly matched regardless of program used. the low impact of relative ion availability on crux is possibly due to the lack of resampled peptides that share similar ion patterns. the omssa e - values even increased with fewer ions available because the e - value computation assumes that all possible ions are present. at e - value < 1 10 threshold, 17.3% and 6.9% of all correct peptide identifications did not reach significance threshold in random 25% and 50% proportion of ions, respectively, relative to 1.7% when all ions were available including neutral mass loss. a possible explanation is that with fewer ions present, the score of the correct match is insufficiently different from the score of incorrect matches with all ions, both leading to a low score and potentially mismatches. the search time of the three database search programs was a function of the number of neuropeptides in the search database. this computational comparison is empirical and that the database search can be easily computed in parallel because the experimental spectra can be independently analyzed. the computational time to evaluate all 7850 peptides x!tandem returned the fastest (averaged 23 cpu seconds), followed by crux with no p - value calculation (3.8 more time than x!tandem ; averaged 89 cpu seconds) followed by omssa (5.3 more than x!tandem ; averaged 123 cpu seconds). the crux p - value calculation adds considerable time due to the permutation - based approach to assess the statistical significance of the database match. this approach requires the generation and scoring of dummy sequences to obtain the weibull density for each match. the computation of p - values for 100 and 1000 dummy sequences required over 1 and 13 h of cpu time, respectively. the increase in time is linear on the number of sequences evaluated such that each sequence took approximately 47 cpu seconds. this resampling test approach is not limited to crux and a comparable increase in time would occur when this approach is used with x!tandem and omssa. an alternative approach to improve the speed of peptide matches offered by some programs is to search only one ion series. table 5 summarizes the performance of omssa and x!tandem in terms of number of peptides unmatched, mismatched or correctly matched at various significance levels by ion series scored for charge state + 1. supporting information tables 7 and 8 summarize the performance of the database search programs across match significance levels when the b- and y - ion series were scored, respectively for charge states + 1, + 2 and + 3. supporting information table 9 reports the number of peptides identified at e - value < 1 10 by both or either program. significance threshold (t) for matched to be considered significant at e- or p - value < 1 10. unmatched: the program does not provide a match with the program setting. mismatched: the program provided an incorrect match. percentage of the matches that have e- or p - value < 1 10. scoring only one of the ion series was noticeably detrimental to peptide detection for both omssa and x!tandem. the y - ion series provided a higher detection rate than the b - ion series at e - value < 1 10. the number of mismatched and unmatched peptides when one series was scored increase substantially in omssa compared to x!tandem. omssa had more false positive and false negative when scoring only one ion series. the number of correctly matched peptides at e - value > 1 10 was higher in x!tandem than in omssa and at e - value < 1 10 was higher in omssa than in x!tandem when either ion series was used for scoring. overall, the number of correctly matched peptides regardless of e - value was higher in omssa than in x!tandem when either ion series was used for scoring. the major reason for weaker performance of x!tandem when scoring one ion series was that the peptides had less significant e - values than when scoring both ion series. scoring using only y - ion series ed in fewer unmatched peptides (difference of 34), mismatched peptides (difference of 12) and peptides with less significant e - values (98% of peptides with the e - value < 1 10) in omssa. in both programs, higher charge states were associated with slightly poorer peptide detection with scoring based on the y - ion series being less affected than on the b - ion series. the length of the peptide was also critical when one ion series was used to score the matches between the query and target database mass spectra. the minimum length among the detected peptides was 10 and 13 amino acids in omssa and x!tandem, respectively, compared to six amino acids when both ion series were scored. the median length of the correctly identified peptides with both programs using the b- and y - ion series was 83 and 76 amino acids, respectively. also, the median length of the missed (false negative) peptides in both programs was seven and six amino acids when the b- and y - ion series were used, respectively. this reflects the issues of correctly identifying small peptides at e - value < 1 10. chimera spectra is a likely phenomenon in peptidomics measurements; this occurs when multiple peptides coelute in the same lc fraction and each peptide present contributes to the observed peaks in the tandem ms spectra, usually when the peptides are similar to each other. as neuropeptides span many orders of magnitude in concentration dynamic range, chimera spectra can be caused by peptides at vastly different levels. to evaluate the performance of the programs when spectra from multiple coeluted peptides are present, peptides that have similar mass and are likely to coelute were identified. of the 7649 peptides identified by all programs at e- or p - value < 1 10, 2049 peptides had at least one other peptide with theoretical mass 0.4 da. these peptides were split into 945 groups each including at least two peptides within a theoretical mass range or tolerance within group. of these, 804, 126, 12, and 3 groups included 2, 3, 4, and 5 peptides, respectively. table 6 summarizes the number of peptides identified from chimera spectra with precursor charge state + 1, all ions are available and including neutral mass losses by x!tandem, omssa and crux. crux had the best performance and x!tandem generally failed to identify peptides from chimera spectra regardless of the threshold used. at e- or p - value < 1 10 threshold, omssa, x!tandem and crux, correctly identified 81%, 43% and 99% of peptides, respectively. of these, crux only had three unmatched peptides at p - value < 10 meanwhile x!tandem only reported one peptide in the chimera spectra unless the other matches had the same score. omssa had a correct match rate similar to crux at e - value < 1 10 and lower at e - value < 1 10 threshold. a further decrease in the accuracy of peptide identification in chimeras was observed in small peptides for x!tandem and crux. at e- or p - value < 1 10 threshold, the correct identifications by x!tandem and crux were 39.1% and 98.5% in peptides less than 20 amino acids in length, and 37.6% and 91.8% in peptides less than 10 amino acids in length, respectively. reported that mascot correctly identified peptide a in 87% of chimera spectra containing 50% of peptide a and 50% of peptide b. number of peptides simulated in a chimera spectra. percentage of correctly matched peptides with an e- or p - value < 1 10. percentage of correctly matched peptides with an e- or p - value < 1 10. the present study demonstrated that although most neuropeptides and prohormone peptides with ideal ms / ms spectra can be identified using standard database search methods, a careful assessment of the accuracy of the match is still required. furthermore, the search must be optimized for the specific biological context, here prohormone cleaved neuropeptides. the from the present study indicate that the correct identification of peptides based on a single threshold across all spectra is challenging even when provided with ideal spectra and target database. a major component of this challenge was the scoring and assignment of a single significance threshold for all peptides. this problem is exacerbated when analyzing experimental data because the quality of the data and the specifications of the program have a large impact on the accuracy of peptide identification. crux was the only program able to correctly match all the peptides regardless of p - value. the e- and p - values rapidly become more significant with increasing peptide length before stabilizing at approximately 50 amino acids in crux and 13 amino acids in omssa and x!tandem. of the three programs, crux is better suited to detect short peptides although the p - value calculation in crux is more stringent. the typically short prohormone peptides have less significant e- or p - values because of the higher number of expected matches by chance. overall, indicated the need to optimize the scoring and associated e- or p - value calculation in database searches for neuropeptides and small peptides. a straightforward approach that does not require program modifications is to accept less significant matches for short peptides meanwhile keeping more significant thresholds for longer peptides. the peptide length that was associated with stabilization of e- and p - values (50 amino acids in crux and 13 for omssa and x!tandem) offer a good start. most small peptides were detected by one or two programs (crux or omssa) and thus the program consensus approach advocated for protein identification is not well suited to identify small peptides. crux had the best performance in the identification of peptides from chimera spectra and when ions were missing, omssa provided the most significant e - values; meanwhile, x!tandem returned fastest for peptides detected by all programs. a comprehensive evaluation of the impact of multiple factors on peptide identification was undertaken. additional simulations can help to assess the importance of other aspects of ms / ms on peptide identification. the evaluations performed in this study assumed that the peptides had ideal uniform spectra to avoid additional confounding factors. different peptide ion fragmentation methods (e.g., cid, hcd, etd) have different abilities to fragment that affect the performance of the database search tools. additional studies can consider the impact of the fragmentation method and ptms on the ability to identify neuropeptides. also, the identification of peptides using spectrum - to - spectrum search tools has been proposed in recent years. a study of the performance of spectrum - to - spectrum searches when applied to small prohormone peptide identification needs to be undertaken.

neuropeptide identification in mass spectrometry experiments using database search programs developed for proteins is challenging. unlike proteins , the detection of the complete sequence using a single spectrum is required to identify neuropeptides or prohormone peptides. this study compared the performance of three open - source programs used to identify proteins, omssa, x!tandem and crux, to identify prohormone peptides. from a target database of 7850 prohormone peptides, 23550 query spectra were simulated across different scenarios. crux was the only program that correctly matched all peptides regardless of p - value and at p - value < 1 102, 33%, 64%, and > 75%, of the 5, 6, and 7 amino acid - peptides were detected. crux also had the best performance in the identification of peptides from chimera spectra and in a variety of missing ion scenarios. omssa, x!tandem and crux correctly detected 98.9% (99.9%), 93.9% (97.4%) and 88.7% (98.3%) of the peptides at e- or p - value < 1 106 (< 1 102), respectively. omssa and x!tandem outperformed the other programs in significance level and computational speed, respectively. a consensus approach is not recommended because some prohormone peptides were only identified by one program.

in addition to transmission of genetic information from dna to proteins, rna is capable of performing a wide range of biological functions in cells, including catalysis, genetic control and molecular recognition. because the functions of rnas are largely determined by their diverse three - dimensional (3d) structures, tools capable of efficiently and accurately comparing two rna 3d structures are important in computational structural biology. currently, several popular and useful tools of aligning two rna 3d structure have been proposed based on heuristic approaches, such as sara, iparts, setter and rass. both sara and iparts align two rna 3d structures by using a similar approach, which reduces the 3d structures into one - dimensional (1d) sequences according to some local structure features in the nucleotide backbone conformation (i.e. backbone unit vectors used in sara and backbone pseudo - torsion angles used in iparts) and then applies traditional sequence alignment algorithms to align the ing 1d sequences. as to setter, it divides the rna 3d structure into non - overlapping local structural units, called generalized secondary structure units (gssus), and then obtains their structural alignment by using a comparison method based on a distance measured by rmsd (root mean square deviation) transformation between all possible pairs of gssus. rass develops a method based on elastic shape analysis, which treats the structures of rnas as 3d curves with their 1d nucleotide sequence encoded on additional three dimensions, so that the structural alignment of two rnas is performed in a joint sequence - structure space of six dimensions. the method we used to implement iparts is the so - called structural alphabet (sa)-based approach, which uses an sa of 23 letters to reduce rna 3d structures into 1d sequences of sa letters and applies traditional sequence alignment to these sa - encoded sequences for determining their global or local similarity. in fact, the accuracy performance of our iparts largely depends on the quality of the sa, which was constructed from a list of 117 rna 3d structures using the pseudo - torsion angles of their nucleotide backbones. it has been shown that for rnas, two pseudo - torsion angles (and) are sufficient to describe the backbone conformation of each nucleotide. actually, during the last 5 years after the introduction of our iparts, several hundreds of new rna 3d structures have been determined and already deposited in the pdb / ndb databases. these newly determined rna 3d structures should benefit us to improve the accuracy of our iparts by constructing a new and sufficiently high quality sa. in addition, as was reported in the study of rass, both 1d nucleotide sequences and 3d structures of rnas need to be taken into account when determining their functions, because 1d sequence carries side chain information of nucleotides, 3d structure carries the backbone geometry information of nucleotides and both types of information are different and can play important roles in determining rna functions. in this study, we have re - implemented our previous tool iparts as a new web server named iparts2 (meaning iparts version 2) by constructing a totally new sa, which consists of 92 elements with each element carrying both information of base (1d) and backbone geometry (3d) for a representative nucleotide, from a representative and sufficiently non - redundant list of 876 atomic - resolution rna 3d structures with 65154 nucleotides in total. this sa is significantly different from the one used in iparts, because the latter, constructed by using 117 crystal rna structures with 9527 nucleotides, consists of only 23 elements, each of which carries only the backbone geometry information of a representative nucleotide. like in iparts , we also equip iparts2 with two capabilities of aligning two rna 3d structures: (i) global alignment that can be used to determine their overall structural similarity and (ii) local alignment that can be used to find their locally similar substructures. it is worth mentioning here that the function of local alignment in iparts2 is unique when compared with other tools sara, setter and rass, because they all provide the function of global alignment only. for validation , we have used a benchmark dataset fscor with 419 rna 3d structures to test our iparts2 and compare the accuracy performance of its global alignment with its previous version iparts, as well as other popular tools sara, setter and rass. our experimental have finally shown that our current iparts2 indeed outperforms its previous version iparts and also achieves better accuracy than sara, setter and rass in rna alignment quality and function prediction. in this study, we have implemented iparts2 by using an improved sa - based algorithm as follows. first, 63402 non - terminal nucleotides from the rna 3d hub non - redundant list (version 1.89) of 876 rna 3d structures were classified into 23 conformation clusters according to their backbone pseudo - torsion angles. next, 23 capital letters were used to represent the center nucleotides of these 23 clusters and for each letter, four different colors were further used to separately represent four possible base types a, g, c and u of the corresponding center nucleotide. as a , we constructed an sa of 92 elements with each element (a letter on a colored ) carrying both information of backbone geometry (letter) and base ( color) for a representative nucleotide. finally, the sa was used to reduce input rna 3d structures into 1d sa - encoded sequences and a traditional sequence alignment, such as global alignment (without penalty to end gaps) or local alignment, was applied to them for determining their global or local similarity. in addition, for the accuracy of aligning two sa - encoded sequences, the statistical method proposed by henikoff and henikoff was applied to derive a blosum - like substitution matrix that can reward more similar sa - encoded sequences with high scores. we refer the reader to the supplementary data for the details of the above improved sa - based algorithm. it is worth mentioning here that the local alignment algorithm we used to implement iparts2 is slightly different from the one used in iparts, because we further utilized the technique mentioned in to modify the local alignment algorithm such that the local alignments returned by iparts2 are non - intersecting, where two alignments are said to be non - intersecting if they do not have a match or mismatch in common. usually, non - intersecting local alignments of rna structures are more of practical interest to the user. currently, iparts2 can be accessed by an easy - to - operate web interface as illustrated in figure 1. it provides the user two kinds of alignments for comparing two rna 3d structures: (i) global alignment for determining their whole structural similarity, and (ii) local alignment for finding common similar substructures. basically, iparts2 takes as input two rna 3d structures, each of which can be either a pdb / ndb i d or a pdb file uploaded by the user, their chain ids if they have multiple chains, and optionally the starting and ending residue numbers of substructures to be aligned. if required, the user can run iparts2 by modifying the default settings of all the parameters, including alignment method (whose default is global alignment), gap open and extension penalties (whose default values are 9 and 1, respectively), and number of suboptimal alignments (at least one). in the output page, next, iparts2 continues to show its running time, as well as its alignment , including structural alignment score (sas) (refer to the experimental section for its definition) between input rna 3d structures with corresponding raw score in parentheses, number of aligned nucleotide pairs, rmsd and optimal / suboptimal alignments of their sa - encoded sequences and corresponding rna sequences. note that each letter in the aligned sa - encoded sequences is displayed with a colored , which indicates the base type (a, g, c or u) of the corresponding nucleotide. finally, iparts2 shows a jsmol graphical display (without installing java plugin) of aligned rna 3d structures, so that the user can visually view, rotate and enlarge the 3d structures of input rna molecules and their structural superposition and download their alignment and pdb files. note that in the jsmol visualization, end - gap residues in global alignment or non - aligned residues in local alignment are displayed in light colors. first, we tested iparts2 by running its global alignment on a benchmark dataset called fscor and evaluated its accuracy in function assignment by comparing its receiver operating characteristic (roc) curve with those obtained by iparts and other existing popular tools, including sara and setter. the fscor dataset originally proposed in contains 419 rna 3d structures that are classified into 168 functional classes. we ran all the tools mentioned above locally by aligning all 87571 pairs of rna 3d structures in the fscor dataset. to take the quality of the structural alignments into account, the roc curves of all the tools were computed based on a geometric match measure called sas, which is defined to be (rmsd 100)/(number of aligned nucleotide pairs), instead of native alignment score. the reason is that, as suggested in, a better structural alignment should match more residues and also have lower rmsd, and the geometric match measure sas is better than the native alignment score to separate good structural alignments from less good ones. two rna structures in the fscor dataset are said to be functionally identical if they have the same deepest scor classification (i.e. their geodesic distance d = 0) or functionally similar if they differ at least in the deepest scor classification (i.e. d 2). to obtain the roc curve of each tool, the alignments of all pairs of rna structures computed by the tool are sorted by their sas values. a threshold of sas is then varied between the minimum and maximum of the sorted sas values for producing the points of the roc curve. for a fixed threshold, all pairs of aligned rna structures whose sas values are above the threshold are assumed positive and all below it negative. moreover, the pairs assumed positive are counted as true positives (tp) if they are functionally identical (d = 0) or similar (d 2) and false positives (fp) otherwise; the pairs assumed negative are counted as true negatives (tn) if they are functionally non - identical (d > 0) or dissimilar (d > 2) and false negatives (fn) otherwise. the point of the roc curve corresponding to the fixed threshold is then produced by plotting its tp rate tp/(tp + fn) on the y - axis and its fp rate fp/(fp + tn) on the x - axis. as a , the roc curves for all the evaluated tools mentioned above are displayed in figures 2 and 3 for d = 0 and d 2, respectively. these experimental have shown that our iparts2 outperforms its previous version iparts and other tools sara and setter for the function assignment in the fscor dataset, because iparts2 has the highest auc values of 0.914 and 0.772 for d = 0 and d 2, respectively. roc curves for d = 0 based on the sas values of all aligned pairs of rna 3d structures in the fscor dataset, where the auc values of iparts, sara, setter and iparts2 are 0.861, 0.883, 0.843 and 0.914, respectively. note that the auc value of rass computed by using the 67006 pairs of rna 3d structures is 0.892. roc curves for d 2 based on the sas values of all aligned pairs of rna 3d structures in the fscor dataset, where the auc values of iparts, sara, setter and iparts2 are 0.740, 0.761, 0.713 and 0.772, respectively. note that the auc value of rass computed by using the 67006 pairs of rna 3d structures is 0.758. next, we also compared the capabilities of iparts, sara, setter and iparts2 for the function assignment with rass using the fscor dataset. as mentioned before, rass is a recently developed tool of comparing two rnas by considering both information of their sequences (bases) and 3d structures (backbone geometry). when running rass on the fscor dataset, however, we noticed that for 20565 pairs among 419 rna 3d structures, rass was not able to provide their structural alignments so that their sas values were not able to be computed. therefore, for a fair comparison of all the evaluated tools, we calculated their roc curves only using those 67006 pairs of rna 3d structures whose structural alignments were able to be provided by rass. in this situation, iparts2 still performs better than all other tools, including rass, according to the auc values of their roc curves (refer to supplementary figures s5 and 6). for the of additional experiments, we refer the reader to the supplementary data. finally, for the running time comparison of all the tools mentioned before, we used five datasets containing two or more rna 3d structures of various lengths as follows: (i) five trna structures (1ehz : a, 1h3e : b, 1i9v : a, 2tra : a and 1yfg : a) with an average length of 76 nucleotides, (ii) three ribozyme p4-p6 domains (1gid : a, 1hr2:a and 1l8v : a) with an average length of 157 nucleotides, (iii) two domains v of 23s rrna (1ffz : a and 1fg0:a) with an average length of 496 nucleotides, (iv) two 16s rrna (1j5e : a and 4v4q : aa) with an average length of 1522 nucleotides and (v) two 25s rrna (4v7r : b1 and 4v7r : d1) with an average length of 3396 nucleotides. the average running times of all the tools were obtained by running them with their default parameters on local machine with intel cpus with 3.4 ghz and 32 gb of ram under linux system. as shown in table 1, setter is the fastest tool among all the five tools. however, our iparts2, as well as iparts, outperforms both sara and rass, and it can finish its alignment job in several seconds up to a couple of minutes. in this study, we have re - implemented our previous tool iparts into a new web server iparts2 by constructing a totally new sa of 92 elements, with each element carrying both information of base (1d) and backbone geometry (3d) for a representative nucleotide. according to our experimental on a benchmark dataset , iparts2 indeed outperforms iparts and also achieves better accuracy than other popular tools, such as sara, setter and rass, in rna alignment quality and function prediction. therefore, iparts2 can serve as a useful tool for aligning two rna 3d structures, which can further provide insight into structural and functional properties of rnas. ministry of science and technology of taiwan. funding for open access charge: ministry of science and technology of taiwan.

since its first release in 2010, iparts has become a valuable tool for globally or locally aligning two rna 3d structures. it was implemented by a structural alphabet (sa)-based approach, which uses an sa of 23 letters to reduce rna 3d structures into 1d sequences of sa letters and applies traditional sequence alignment to these sa - encoded sequences for determining their global or local similarity. in this version, we have re - implemented iparts into a new web server iparts2 by constructing a totally new sa, which consists of 92 elements with each carrying both information of base and backbone geometry for a representative nucleotide. this sa is significantly different from the one used in iparts, because the latter consists of only 23 elements with each carrying only the backbone geometry information of a representative nucleotide. our experimental have shown that iparts2 outperforms its previous version iparts and also achieves better accuracy than other popular tools, such as sara, setter and rass, in rna alignment quality and function prediction. iparts2 takes as input two rna 3d structures in the pdb format and outputs their global or local alignments with graphical display. iparts2 is now available online at http://genome.cs.nthu.edu.tw / iparts2/.

polycystic liver disease (pld) is a genetic inherited entity associated with polycystic renal disease due to mutations in pkd1 or pkd2 genes. surgical intervention is needed in cases presenting with massive hepatomegaly, or when complications such as cyst rupture, infection, hemorrhage or jaundice occur. obstructive jaundice is a rare finding usually associated with secondary causes rather than external cyst compression of the bile ducts. although there are reports in the literature of cyst - associated jaundice our experience suggests that a thorough workup to exclude secondary causes such as gallstones and malignancy is mandatory. she complained of chronic dull pain, satiety, weight loss, dyspnea and physical disability. the patient had had clay - coloured stools and dark urine the last two weeks before admission. physical examination revealed a large non - tender abdominal mass and no signs of chronic liver disease such as splenomegaly or ascites. liver function tests were compatible with obstructive jaundice, with total bilirubin 8.07 mg / dl (normal range < 1 mg / dl), with direct predominance (7.51 mg / dl) and elevation of alkaline phosphatase (337 u / l, normal range 50136u / l) and -gt (404 u / l, normal range 1585 u / l). ca19 - 9 value was 224 u / ml (normal range 037 u / ml). ultrasound examination of the abdomen showed multiple liver cysts ranging from 1.2 to 13 cm in diameter and dilated intrahepatic biliary ducts. computed tomography (ct) scan was performed using the standard protocol for hepatobiliary disease evaluation (slice thickness 35 mm, arterial - portal venous and delayed phases after contrast administration). percutaneous drainage of the hilar cysts was performed to confirm that subsequent fenestration or enucleation will resolve jaundice. however the persistence of cholestasis and the mild dilatation of intrahepatic bile ducts in the post drainage ct evaluation (fig . the patient underwent magnetic resonance imaging and magnetic resonance cholangiopancreatography ( mri - mrcp) that was compatible with the presence of possible neoplasmatic infiltration at the distal common bile duct, since duct compression was not marked enough to justify intrahepatic biliary dilatation and furthermore the distal segment of the common bile duct was not evident (fig . the abrupt termination of the middle segment of the common bile duct was indicative of neoplastic infiltration . the postoperative period was uneventful and the patient was discharged on the 9th postoperative day . at six - month follow - up autosomal dominant polycystic disease is genetically heterogeneous, with mutations in two distinct genes predisposing to the combination of renal and liver cysts ( ad - pkd1 and ad - pkd2). furthermore, davila et al. reported a second gene (sec6) related to pld. the disease is more frequent in women, and hepatic cysts can increase dramatically in number and size through the child - bearing years of early and middle adult life. the cysts in pld can also increase in size and number during pregnancy or simultaneously with the use of exogenous female steroid hormones. in one study it was shown that the use of estrogen in women with autosomal dominant polycystic kidney disease may selectively increase the severity of hepatic cystic disease. usually patients suffer from chronic dull abdominal pain, satiety, weight loss, dyspnea, physical disability and descensus. jaundice may rarely exist due to compression of the common bile duct by the cysts. in our experience, including this case, obstructive jaundice is usually associated with a co - existing underlying pathology such as gallstone disease or malignancy. in pld, liver failure or complications of advanced liver disease are rare. even with marked hepatosplenomegaly and portal hypertension, liver function is well preserved. thus jaundice is uncommon and requires further exploration to exclude benign or malignant disease. in our case other authors have reported co - existing choledocholithiasis and other complications of pld causing obstructive jaundice. in case of jaundice, standard pre and post contrast mri sequences are necessary to establish the presence of an underlying malignancy that may be suggested by the biliary dilatation seen at mrcp. mrcp is also helpful to estimate the intraductal extent of tumor infiltration, facilitating surgical planning. ercp can also help to confirm the cause of jaundice, presenting the further advantage of performing brushing or biopsy. the presence of the cholangiocarcinoma in the distal common bile duct, as was shown on imaging in our case, led the surgical team to perform a successful pylorus - preserving pancreatoduodenectomy with dominant liver cysts enucleation, which was considered the best therapeutic option for the patient. cholangiocarcinoma is the most common primary malignancy of the bile ducts and accounts for 1550% of obstructing bile duct tumors. factors that predispose to the development of cholangiocarcinoma include ulcerative colitis, primary sclerosing cholangitis, choledochal cysts, caroli disease, polyposis syndromes of the colon and clonorchis sinensis infestation. cholangiocacinomas are generally classified as intrahepatic (peripheral) lesions, hilar lesions, and distal ductal tumors. if no tumor mass is seen, diagnosis of hilar cholangiocarcinoma can be made by the presence of high - grade intrahepatic bile duct dilatation and the absence of right and left hepatic duct union. if the neoplasm is located at a lower level, as in our case, at the point of obstuction the duct will terminate abruptly or there may be associated eccentric thickening of bile duct wall. the reason of the nonvisibility of the cholangiocarcinoma on ct images in our patient could be attributed to cyst superimposition obscuring the lesion and to the infiltrative type of the neoplasm, as was proven on histopathology, characterized by the absence of tumor mass. mrcp is essential for the accurate estimation of obstruction level and the depiction of the characteristic morphologic features of stenosis or obstruction (abrupt termination of the bile duct as in our case). because of their intrinsic high tissue contrast and multiplanar capability, mri and mrcp are able to detect and preoperatively assess patients with cholangiocarcinoma, investigating all involved structures such as bile ducts, vessels and hepatic parenchyma. the main reason for surgical / imaging discrepancy is represented by the microscopic diffusion along the mucosa and in the perineural space. it should also be emphasized that the presence of multiple cystic liver lesions superimposed on the biliary ducts, displacing or distorting them, may obscure the presence of a cholangiocarcinoma. on the other hand, false - negative are also encountered with ercp washing or brushing in some patients due to the submucosal tumor growth. intrahepatic cholangiocarcinoma occurs rarely in patients with multiple liver cysts and tumor origin from cysts after in situ transformation of the epithelium has been shown in some cases. the prognosis of cholangiocarcinoma associated with pld is very poor and distant metastases are common. the possibility of cholangiocarcinoma should be considered in any patient with autosomal dominant polycystic kidney disease with significant abnormal liver function tests. after extensive review of the literature, it appears that coexistence of pld with distal common bile duct cholangiocarcinoma as in our case has not been reported so far. these consist of cyst hemorrhage, rupture, infection, uterine prolapse due to displacement, obstructive jaundice, portal hypertension, transudative and exudative ascites and budd - chiari syndrome. surgery is indicated in most cases, as medical treatment has failed to show any efficacy. use of somatostatin to block the secretin - induced secretion by hepatic cysts failed to demonstrate any significant effect on hepatic cyst growth size. cyst aspiration with sclerosis, open or laparoscopic cyst fenestration, combined hepatic resection and fenestration or liver transplantation are possible treatment options. aspiration combined with ethanol instillation to induce sclerosis of the cyst lining epithelium can be effective in patients with a few dominant cysts (type i pld few large cysts > 7 cm). cyst fenestration can be performed in patients with more diffuse pld (type ii pld patients with small cysts throughout the liver have a greater risk of persistence and recurrence of symptoms . combined hepatic resection and fenestration is more effective in reducing the hepatic mass and gastric compression . recurrence rates vary significantly in the literature with high postoperative morbidity rates ( 38100%). this procedure offers an additional advantage in the case of massive hepatomegaly and severe symptoms of gastric compression. resection addresses the problem of liver mass, but poses a significant risk of biliary ductal injury, vascular compromise, and liver insufficiency because cysts markedly distort the intrahepatic anatomy. postoperative morbidity is related to the presence of temporary ascites, pleural effusion and biliary leakage. in particular, ascites has been troublesome due to continued cyst secretion from residual fenestrated cysts, disruption of intrahepatic lymphatics and partial venous outflow obstruction. candidates for combined resection / fenestration should have at least two adjacent liver segments not involved by cysts and normal liver function. these patients should be also managed by experienced hepatobiliary surgeons at institutions with advanced intensive care and interventional radiological and gastroenterology support. liver transplantation has been performed in rare cases when the above - mentioned interventions were not an option. in patients who harbour diffuse pld, orthotopic liver transplantation is effective, but inherently assumes the risks of long - term immunosuppression and rejection. orthotopic liver transplantation is indicated for patients with progressive pld after resection / fenestration, patients with concurrent liver dysfunction and renal failure, and patients with diffuse pld without segmental sparing. jaundice presents infrequently in this group of patients, unless a secondary cause exists. in such situations a thorough diagnostic workup is mandatory to exclude the coincidence of benign or malignant disease.

although jaundice rarely complicates polycystic liver disease (pld), secondary benign or malignant causes can not be excluded. in a 72-year - old female who presented with increased abdominal girth, dyspnea, weight loss and jaundice, ultrasound and computed tomography confirmed the diagnosis of pld by demonstrating large liver cysts causing extrahepatic bile duct compression. percutaneous cyst aspiration failed to relief jaundice due to distal bile duct cholangiocarcinoma, suspected by magnetic resonance cholangiopancreatography (mrcp) and confirmed by endoscopic retrograde cholangiopancreatography (ercp). coexistence of pld with distal common bile duct cholangiocarcinoma has not been reported so far.

one of the six main strategies recommended by the world health organization (who) (mpower) for controlling the epidemic of tobacco use was providing smoking cessation services for individuals who are dependent upon tobacco. according to article 14 of the who framework convention on tobacco control, these services should be up - to - date and available at very low cost through a comprehensive health system. there is a wide array of smoking cessation therapies that include nicotine replacement therapy (nrt), zyban, champix, and behavioral interventions that do not rely on pharmacological support, cold turkey, acupuncture, hypnotism, group therapy, and booklet. electronic nicotine delivery systems (ends), of which electronic cigarettes (ecs) are the most common prototype, are devices that do not burn or use tobacco leaves, but instead vaporize a solution inhaled subsequently by the user. the main constituents of this solution, in addition to nicotine, are propylene glycol, with or without glycerol and flavoring agents. ends solutions and emissions may contain additional chemicals, some of them are considered to be toxicants. a primary intention of manufacturing this device was to allow use in public places where smoking is forbidden. extensive advertising and promotion included the argument that these devices would pose little risk due to passive exposure. to date, a most impressive number 460 types of this device have been designed and marketed with additional types continually in development. however, disadvantages and side effects have been reported in many articles, and the unfavorable effects of its secondhand vapor have been demonstrated in many studies. even after massive advertisements claiming the usefulness of these devices for quitting smoking, several studies found that ecs were not successful as a vehicle for smoking cessation. meanwhile , some studies indicated short - term effects in reducing the smoking - related harms. this trend has continued during more recent years. although there are still scientific documents indicating deleterious effects of these devices, no unified position against these devices has been established. despite a lack of support from scientific communities such as the pulmonary associations of europe and the usa and who, usage of this device are increasing steadily, especially among teenagers and nonsmoking young adults. the current study was designed and conducted to investigate and review all scientific published literature in recent years regarding ecs and to present a simple about their effects on quitting smoking and respiratory health. all the pubmed articles containing one of these words: electrical cigarette, ec, e - cigarette, ends in their title were gathered and reviewed by an expert panel. a checklist of the year of publication, number of articles, number of citations, and the of the articles was created and included the categories of effective and harmless; ineffective and harmful; and inability to draw . in the expert panel meeting, it was suggested to accept related articles (at least their abstracts) and also it was agreed to reject unpublished and duplicate articles and also opinion papers, which were seemingly irrelevant. articles were reviewed separately by two expert researchers who were trained and adjusted to reach a desired agreement for rating the articles. to check the reliability and inter - rater reliability, the inter - rater reliability was 76% before discussion; any discrepancies in answers were discussed and a consensus was achieved on subsequent review. after the training and pilot assessment, the researchers were ready to do the literature search. the first report of the researchers was observed again by the principal investigator, who determined when the assistants were ready to work alone. subsequently, the researchers selected and categorized the articles according to the following criteria: total number of articles, the number of articles whose had supported ecs as effective for quitting smoking and not harmful without side effects on respiratory health; the number of articles whose did not support these devices as effective for quitting smoking and/or harmful or with some side effects on respiratory health; and the number of articles without any definite . again to assess the reliability of each assistant, 10% of the articles were selected randomly and the recorded were compared by the principal investigator. the panel summed the number of supporting and not supporting articles to determine the scores as a simple quantitative review scale for ecs effects on respiratory health. one hundred and forty - nine articles were found in pubmed up to september 2014, the first one in 2009 and 4, 6, 15, 37, and 86 articles were published in the following years, respectively. one hundred and thirty - seven (91.9%) articles had attainable abstracts or full texts. sixty - eight of the 137 had no clear or on smoking cessation and presented news regarding ecs and called for a further investigation regarding its effects. twenty - four articles supported the device as an effective and nonharmful method for tobacco cessation. forty - five articles did not support the use of the device due to side effects and lack of success in tobacco cessation efforts. based on table 1, there were 21 more articles (65.2%) that concluded ecs were not effective for quitting smoking or had some side effects on respiratory health. the study in selection steps frequency of electronic cigarettes articles based on published year and the obtained a general question about electric cigarettes is whether this is an ineffective device or a proper treatment for smoking cessation. for other tobacco control methods heydari et al. in a comparative study on tobacco cessation methods demonstrated the use of nrt, champix, and zyban in combination with educational interventions as the most recommended method, but the e - cigarette, in contrast, received a score of only one among 25 articles in which 14 articles were without a clear , six were supportive articles, and five were not supportive. however, in the current study, ecs received a 21 score. in this study, we considered suitable methods for tobacco cessation, which received higher scores based on supportive best evidence. in recent years, the number of articles regarding ecs has increased noticeably and even doubled yearly, but the central finding is that in comparison with some other quit methods, the supportive articles are much fewer. in light of the paucity of reliable scientific support, it is probable that ecs can act as an escape from ongoing campaigns such as the who framework convention on tobacco control in 177 countries and additional established campaigns against smoking and preserve dependence on nicotine. three different studies of corey et al. in usa and lee et al. in korea and goniewicz and zielinska - danch in poland showed that there were an increasing usage of ecs among smokers and nonsmokers with a excessive use of cigarette smoking. a recent survey conducted in britain demonstrated that the use of ec among adults had risen in 2014. recently, the transnational tobacco companies have entered the ends market, and some of them are aggressively competing with the independent e - cigarette companies to gain market share. meanwhile, in iran, we had no study about the prevalence of using ecs, but two studies showed that ends was not a recommended method employed for cigarette quitting by physicians and smokers. the provisional agenda of the 6 conference of the parties to the who framework convention on tobacco control in moscow in 2014 demonstrated that only a few studies have examined whether the use of ends is an effective method for quitting tobacco smoking, and evidence is limited and does not allow firm to be reached. furthermore, it has been clearly mentioned that ecs were not recommended for smoking cessation by the who and any other scientific agency, so more investigation is needed in this regard. enough evidence to suggest that ecs are effective for quitting smoking is lacking, as is the evidence for the lack of their harm for respiratory system and thus being alternatives for smoking. a potential limitation of any review (including ours) is the possibility of publication bias. a potential limitation of any review (including ours) is the possibility of publication bias.

: in recent years, electronic cigarettes (ecs) have been heavily advertised as an alternative smoking device as well as a possible cessation method. we aimed to review all published scientific literature pertaining to ecs and to present a simple about their effects for quitting smoking and respiratory health.methods:this was a cross - sectional study with a search of pubmed, limited to english publications upto september 2014. the total number of papers which had ecs in its title and their positive or negative regarding ecs effects were computed. the number of negative papers was subtracted from the number of positive ones to make a score.:of the 149 articles, 137 (91.9%) were accessible, of which 68 did not have inclusion criteria. in the 69 remaining articles, 24 studies supported ecs and 45 considered these to be harmful. finally, based on this evidence, the score of ecs (computed with positive minus negative) was 21.: evidence to suggest that ecs may be effective and advisable for quitting smoking or a safe alternative for smoking is lacking and may instead harm the respiratory system. however, further studies are needed.

we report a case of hairy cell leukemia (hcl) initially misdiagnosed as plasma cell dyscrasia due to various clinical, morphological and immunophenotypic confounders. in a patient diagnosed of marrow plasmacytosis and serum monoclonal protein elsewhere and referred to our hospital, morphological evaluation of bone marrow aspirate smears and trephine biopsy, immunophenotyping, and molecular testing (brafv600e mutation) were done. clinically, the patient was asymptomatic; bone marrow revealed plasmacytosis, mastocytosis, and lymphocytosis with a few hairy cells. immunophenotyping showed features of hcl with aberrant cd10 expression and a large subclone of cd19 cells. a diagnosis of hcl with reactive plasmacytosis and mast cell hyperplasia was made and confirmed by immunophenotyping and molecular studies. hematopathologists must be aware of various confounding factors and should judiciously use flow cytometric and molecular studies for attaining a proper diagnosis of hcl. we also report a very rare immunophenotypic aberrancy (cd 19 negativity) in hcl. hairy cell leukemia (hcl) is an uncommon yet unique hematolymphoid neoplasm exhibiting a characteristic cytomorphology, immunophenotype, and well defined molecular features. it accounts for 2% of all lymphoid leukemias.1 typically, it presents with splenomegaly, pancytopenia, and monocytopenia; and shows a characteristic immunophenotype. the cells are universally cd19 with co - expression of cd25, cd11c, cd103 and cd123. patients of hcl can present with a spectrum of different clinical and pathological characteristics often puzzling a clinician or a pathologist. however, the clinical and pathological findings often complement each other to clinch the diagnosis of hcl. a correct diagnosis is mandatory as specific therapy in the form of purine analogues can provide long - term remissions in such patients.2 we present a case of hcl with atypical clinical and laboratory features confounding the primary hematological abnormality. a 69-year - old male with no known co - morbidities presented with complaints of breathlessness on exertion for 15 days. 91g / l, total leukocyte count (tlc) 2.310/l, and platelet count 122 10/l ] with the nadir absolute neutrophil count (anc) of 252/l. he was subjected to bone marrow evaluation which revealed plasmacytosis (plasma cells 10%). a serum protein electrophoresis (spep) performed subsequently, showed m - spike (0.3g / dl), though no immunofixation studies were done. he was referred to our center for further evaluation of suspected plasma cell dyscrasia. on the assessment at our center his pancytopenia recovered (hb-112 g / l, tlc-3.2 10/l, anc-1.4 10/l, platelets-522 10/l). a repeat bone marrow examination was performed to evaluate suspected plasma cell dyscrasia. bone marrow aspirate (bma) revealed 5% plasma cells; however showed 36% larger lymphoid cells with clumped chromatin and a moderate amount of pale basophilic cytoplasm. a few cells had grooved / reniform nucleus or cytoplasmic projections (figure 1a). trephine biopsy showed an interstitial infiltrate, typical of hairy cell leukemia (figure 1b, c) along with an increase in mast cells confirmed by mast cell tryptase immunohistochemistry (figure 1d). multiparametric flow cytometry (figure 2) was performed on the bma using four / six color antibody panels by lyse - wash - stain method (antibodies from bd biosciences, san jose, ca). a minimum of one lakh events was acquired on dual laser bd facs canto ii and analyzed using bd facs diva software. bright cd19 low side scatter events (5.3% of viable gated leucocytes) were gated which were positive for cd10, cd20, cd22, cd79b, surface ig, cd25, cd11c, cd103, and cd123. serendipitously, we found a large subclone of cells (15% of viable gated leucocytes) expressing exactly the same immunophenotype markers except for cd19, indicating its loss of expression from hairy cells. the fluorochrome related technical issues were ruled out as the cells showed similar profile using both anti - cd19pecy7 and anti - cd19apc - h7 (clone sj25c1, bd biosciences). the cd19 negative cells had an immune profile exactly similar to cd19+ve cells and revealed expression of hairy cell markers along with cd20, cd22, cd79b, cd45, and cd10. the plasma cells (cd38/cd138/cd19/cd81/cd56 and no light chain restriction figure 2) and mast cells (cd117/cd33/cd2/cd25) showed normal immunophenotype indicating reactive plasmacytosis and mast cell hyperplasia. a diagnosis of hairy cell leukemia with atypical features (cd19 negative subclone, cd10 positivity, reactive plasmacytosis and mast cell hyperplasia) was made which was subsequently confirmed by amplification - refractory mutation system polymerase - chain - reaction (arms - pcr) for braf v600e mutation (figure 1e). the patient remained asymptomatic, and his laboratory parameters remained normal; not warranting purine analogue therapy. a 69-year - old male with no known co - morbidities presented with complaints of breathlessness on exertion for 15 days. 91g / l, total leukocyte count (tlc) 2.310/l, and platelet count 122 10/l ] with the nadir absolute neutrophil count (anc) of 252/l. he was subjected to bone marrow evaluation which revealed plasmacytosis (plasma cells 10%). a serum protein electrophoresis (spep) performed subsequently, showed m - spike (0.3g / dl), though no immunofixation studies were done. he was referred to our center for further evaluation of suspected plasma cell dyscrasia. on the assessment at our center his pancytopenia recovered (hb-112 g / l, tlc-3.2 10/l, anc-1.4 10/l, platelets-522 10/l). a repeat bone marrow examination was performed to evaluate suspected plasma cell dyscrasia. bone marrow aspirate (bma) revealed 5% plasma cells; however showed 36% larger lymphoid cells with clumped chromatin and a moderate amount of pale basophilic cytoplasm. a few cells had grooved / reniform nucleus or cytoplasmic projections (figure 1a). trephine biopsy showed an interstitial infiltrate, typical of hairy cell leukemia (figure 1b, c) along with an increase in mast cells confirmed by mast cell tryptase immunohistochemistry (figure 1d). multiparametric flow cytometry (figure 2) was performed on the bma using four / six color antibody panels by lyse - wash - stain method (antibodies from bd biosciences, san jose, ca). a minimum of one lakh events was acquired on dual laser bd facs canto ii and analyzed using bd facs diva software. bright cd19 low side scatter events (5.3% of viable gated leucocytes) were gated which were positive for cd10, cd20, cd22, cd79b, surface ig, cd25, cd11c, cd103, and cd123. serendipitously, we found a large subclone of cells (15% of viable gated leucocytes) expressing exactly the same immunophenotype markers except for cd19, indicating its loss of expression from hairy cells. the fluorochrome related technical issues were ruled out as the cells showed similar profile using both anti - cd19pecy7 and anti - cd19apc - h7 (clone sj25c1, bd biosciences). the cd19 negative cells had an immune profile exactly similar to cd19+ve cells and revealed expression of hairy cell markers along with cd20, cd22, cd79b, cd45, and cd10. the plasma cells (cd38/cd138/cd19/cd81/cd56 and no light chain restriction figure 2) and mast cells (cd117/cd33/cd2/cd25) showed normal immunophenotype indicating reactive plasmacytosis and mast cell hyperplasia. a diagnosis of hairy cell leukemia with atypical features (cd19 negative subclone, cd10 positivity, reactive plasmacytosis and mast cell hyperplasia) was made which was subsequently confirmed by amplification - refractory mutation system polymerase - chain - reaction (arms - pcr) for braf v600e mutation (figure 1e). the patient remained asymptomatic, and his laboratory parameters remained normal; not warranting purine analogue therapy. hcl is a unique b - cell non - hodgkin lymphoma (nhl) characterized by splenomegaly, cytopenias affecting two or more lineages and morphologically by typical hairy cells. though the majority of cases have this typical presentation, there are scenarios in which the clinical, morphological or immunophenotypic features are atypical, leading to diagnostic confusion. the case presented here exemplifies this intriguing situation where the patient on evaluation for a lower respiratory tract infection was found to have cytopenias, had no palpable splenomegaly and the bone marrow showed only a few hairy cells along with confounders in the form of plasmacytosis and mastocytosis. all these together with a minor quantity of serum m protein led to initial misdiagnosis. however, its absence should not exclude a diagnosis of hcl.3 and more importantly, a changing trend has been observed in the symptomatology of hcl over the past 30 years. number of cases are being diagnosed at an early stage with a less marked splenomegaly.4 a co - existence of plasma cell myeloma with hcl as well as the development of myeloma in patients with hcl has been reported in the literature.5 at times, plasma cell myeloma / leukemia may mimic hcl also.67 clonal plasma cells were excluded by flow cytometry and spep studies. the initial report of small monoclonal band in spep from outside our institute might represent a transient monoclonal gammopathy, as has been reported previously with several infections.89 however, a wrong interpretation could not be conclusively resolved in the absence of immunofixation studies. the association of mast cell hyperplasia with hcl has been well characterized by macon et al.10 this has been attributed to the angiogenesis and further progression of the disease, confirmed by a latter study.11 there has also been a case report of systemic mastocytosis associated with a clonal hematopoietic non - mastcell lineage disease (sm - ahnmd) where the coexisting neoplasms were of both lymphoid and myeloid origin.12 our case shows a striking mast cell hyperplasia, however, a systemic mastocytosis has been ruled out based on immunophenotype studies. immunophenotype aberrancies have been well described in hcl, like negativity for cd103 or cd25; and positivity for cd10 or cd23.13 in our case, the cells showed positivity for cd10, and there was a subclone with absence of cd19 expression. while cd10 expression is relatively common (526% of cases) and explained by alternate origin of leukemic cells from germinal center,13 the absence of cd19 expression in hcl has not been previously reported in the literature. cd19 plays an important role in b - cell growth and differentiation and its expression increases as a b - cell matures. this characteristic is often the basis of using it in flow cytometry as a gating marker for the diagnosis and for minimal residual disease (mrd) testing in various b - cell malignancies. in fact, of all the b - nhls, hcl cases show the maximum level of expression of cd19.14 the abnormal immunophenotypic pattern should be borne in mind while performing the mrd analysis during follow - up. an alternate marker (cd20) a hematopathologist must be aware of these confounding factors and must deal such cases with a high index of suspicion and a supportive armamentarium of flow cytometry and molecular studies.

objectiveswe report a case of hairy cell leukemia (hcl) initially misdiagnosed as plasma cell dyscrasia due to various clinical, morphological and immunophenotypic confounders.methods and in a patient diagnosed of marrow plasmacytosis and serum monoclonal protein elsewhere and referred to our hospital, morphological evaluation of bone marrow aspirate smears and trephine biopsy, immunophenotyping, and molecular testing (brafv600e mutation) were done. clinically, the patient was asymptomatic; bone marrow revealed plasmacytosis, mastocytosis, and lymphocytosis with a few hairy cells. immunophenotyping showed features of hcl with aberrant cd10 expression and a large subclone of cd19neg cells. a diagnosis of hcl with reactive plasmacytosis and mast cell hyperplasia was made and confirmed by immunophenotyping and molecular studies.hematopathologists must be aware of various confounding factors and should judiciously use flow cytometric and molecular studies for attaining a proper diagnosis of hcl. we also report a very rare immunophenotypic aberrancy (cd 19 negativity) in hcl.

one common procedure to translate a tooth in the dental arch is sliding it along an arch - wire, which is associated with advantages such as decreased clinical treatment time, patient satisfaction, and three - dimensional control of tooth movements. however, a frictional force between the bracket and wire is unavoidable in the sliding procedure, with higher forces required to overcome it, in turn ing in the anchorage control and creating some risks. in orthodontic treatments, when the tooth - bonded brackets move along the wire, friction from the load naturally applied on contact points. friction accompanies all sliding techniques and is considered an uncontrolled factor. in sliding techniques, tipping, and the application of a load on the tooth, tipping movements begin and an angle develops between the wire and the bracket's slot; when the angle reaches a certain critical range, a contact is made between the wire and bracket edges, consequently producing adhesion between the two metallic bodies. then, the wire is subjected to a slow notching and plastic deformation; all these procedures lead to the inhibition of continuous tooth movements with numerous stops during tooth translation. overcoming this , obstacle requires excessive orthodontic forces of approximately 40 - 60%. at the same time, the increased forces increase the risk of anchorage loss, which is a major problem in orthodontic treatment. some techniques have been developed to overcome this problem, such as use of wires of different metals, shapes, and sizes, as well as application of extra - oral forces or use of temporary implants. furthermore, the use of nanoparticles, invented in the 1990s, has been emphasized to decrease frictional forces between two metallic surfaces as excellent solid lubricants. in order to utilize this characteristic of nanoparticles to decrease friction during orthodontic treatments, orthodontic wires or brackets coated 0.019 inch 0.025 inch orthodontic wires with inorganic fullerene - like nanoparticles of tungsten disulfide (ws2) and showed significantly reduced frictional forces on wires. reported reduced friction after coating nickel - titanium (niti) wires with nanoparticles of ws2 in the laboratory. furthermore, stainless steel (ss) orthodontic wires were subjected to significantly decreased frictional forces when coated with nanoparticles of carbone nitride (cnx) as suggested by wei et al. demonstrated a reduction in the frictional coefficient of zinc oxide (zno)-coated ss substrates in vacuum. appropriate benefits of nanoparticles are related to the followings: rolling effects that cause two surfaces to slide on each other due to the spherical shape of the particlesnanoparticles serve as spacers, preventing the contact between the two opposing surfacesthird - body material transfer, which only occurs when the nanoparticles are released from the coated surfaces by electrolysis and transfer to the opposing metal (bracket). rolling effects that cause two surfaces to slide on each other due to the spherical shape of the particles nanoparticles serve as spacers, preventing the contact between the two opposing surfaces third - body material transfer, which only occurs when the nanoparticles are released from the coated surfaces by electrolysis and transfer to the opposing metal (bracket). in the first stage of sliding, when there is no angle between the slot and wire, nanoparticles act as spacers and decrease the number of surface irregularities which come in contact with each other, leading to a reduced lower coefficient of friction. however, when an angle is created between the bracket and the wire, and the binding process is developed, nanoparticles are released and a solid lubricant film is formed on sliding surfaces. in the higher load applications, the saliva is pushed out of the gap between the wire and the slot completely and it is only the solid lubricant film of nanoparticles, which decreases frictional forces and allows sliding to occur. obviously, future clinical use of coated wires will depend on safe biocompatibility tests according to accepted procedures. considering possible toxicity of ws2, new self - lubricating coatings, in which metals other than ws2 have been used, should be prepared and analyzed. the aim of the present study was to assess the effect of zno spherical nanoparticle coatings on reducing frictional forces in sliding tooth movements. in this in vitro study, 80 orthodontic wires of 0.016 inch and 0.019 inch 0.025 inch (american orthodontics, usa) were used with and without zno nanoparticle coating. the studied devices included 40 ss brackets of the upper right centrals in 0.022 standard system (ultratrimm, dentaurum, germany), 40 ss brackets of the upper right centrals in 0.018 standard system (ultratrimm, dentaurum, germany), forty 0.016 inch ss straight wires (american orthodontics, usa) with and without spherical zno nanoparticle coating as well as 40 rectangular 0.019 inch 0.025 inch ss straight wires (american orthodontics, usa) with and without spherical zno nanoparticle coating. furthermore, a universal testing machine (huns field test equipment, h5k model ; england) was used to exert tensile and sliding movements between the wires and brackets. in order to coat wires with zno nanoparticles, the wires were first stored in an ultrasonic bath of ethanol solution for 30 min at 30c. then, 0.1 g of zno nanoparticles was added to the experimental tube containing ethanol solution and transferred to the water bath at 80c after mixing. nanoparticles were evenly distributed in the ethanol solution, followed by immersion of the wires in the solution separately. different time intervals were selected for coating the wires with zno nanoparticles (10, 15, 20, 30, 40, 50, and 60 min). sem images of the wires confirmed zno nanoparticle coating in this method. furthermore, a pilot study and assessment of frictional forces showed that the time interval of 10 min was the best choice for nanoparticle coatings. soaking of the wires in the solution for nanoparticle coating sem of a wire coated with zinc oxide the friction force calculations during the sliding procedure were performed after nanoparticle coatings and preparation of wires. central tooth brackets were bonded using a cyanoacrylate adhesive to an aluminum plate with a special bracket - mounting device in a fixed position. then, the aluminum plate was fastened with screws to a notch created on a special device designed for bracket carrying. then, it was attached to the base of a universal testing machine. in order to create an identical condition for all the specimens, the aluminum plate was positioned in three different notches angulated at 0, 5 and 10 to the long axis of the device, using a special screw holding instrument for the simulation of the 2-order bends. orthodontic wires were connected to the brackets by means of an elastomeric module (dentaurum). the upper end of the wire was inserted into a tension load cell of the universal testing machine, and a 150-g weight was connected to the lower end of the wire. the wires were then pulled through the bracket at a cross - head speed of 0.5 mm / s for 25 s while, the frictional forces were calculated by means of the universal testing machine. all the friction forces measured during this study were of kinetic type as no calculations were carried out at the baseline; however, after 0.1 s the friction values were calculated. friction measurements by means of a universal testing machine the mean and standard deviation of friction forces in each system, angulation and nanoparticle coating status were computed. three - way anova was used to analyze the effects of angulations, orthodontic systems and coating status on friction forces. two- and three - group comparisons were carried out using student's t - test and one - way anova, respectively; in addition, a post hoc tukey test was used for two - by - two comparisons. three - way anova showed that all the studied factors, including wire type (p < 0.0001), the angle between the bracket and wire (p < 0.0001), and coated versus uncoated wires (p < 0.0001), significantly affected the friction force; i.e., significantly different values of friction resistance were calculated regarding these variables. in 0.016 inch wires, the frictional force was estimated to be 1.5668 0.107 and 2.56 0.3401 n for the coated and uncoated wires in all the angles of the brackets and wires, respectively, suggesting significant reductions in friction (39%) following zno nanoparticle coating (student 's t - test : p < 0.0001). in 0.019 inch 0.025 inch wires of 0.022 bracket system, the frictional forces were 1.6912 0.18868 and 3.4485 0.32389 n for the coated and uncoated wires, respectively, in all three angles, showing substantial decrease (51%) after zno nanoparticle coating (student 's t - test : p < 0.0001). means, standard deviations and standard errors of frictional forces at different degrees in 0.016 inch wires, a significant reduction of friction force (32.48%) was observed at 0 for the zno - coated versus uncoated wires (student 's t - test : p < 0.0001). at 5 angle, friction force on the coated versus uncoated wires exhibited a significant reduction of 41.48% (student 's t - test : p < 0.0001). at 10 angle, a significant decrease in the friction force (41.23%) was demonstrated for coated versus uncoated wires (student 's t - test : p < 0.0001). mean frictional force of 0.016 inch wire at 0, 5 and 10 in 0.019 25 wires of 0.022 ss straight system, a statistically significant decrease in frictional force (approximately 52.17%) was observed at 0 angle for the zno - coated versus uncoated wires (student 's t - test : p < 0.0001). at 5 angle, the frictional force in zno - coated versus uncoated wires showed a significant reduction of 51.96% (student 's t - test : p < 0.0001). at 10 angle, a statistically significant decrease in frictional forces (48.99%) was observed for the coated versus uncoated wires (student 's t - test : p < 0.0001). means, standard deviations, and standard errors of frictional forces are presented in table 1 in each wire system, angulation and zno - coated or uncoated status. mean frictional force of 0.019 inch 0.025 inch wire at 0, 5 and 10 at combined coated and uncoated wires of 0.018 systems, the frictional force was 1.8528 0.427 n at 0 angle, 2.054 0.548 n at 5 angle, and 2.2835 0.61 statistically, significant increases were observed in frictional forces with the increasing angles between the brackets and wires (one - way anova : p < 0.002). as shown by tukey multiple comparisons test, the frictional force was differently reported at 0 and 10 angles (p < 0.001) while it was not so between 0 and 5 angles (p = 0.22) or 5 and 10 angles (p = 0.14). at both coated and uncoated wires of 0.022 systems, n at 0, 5 and 10 angles, respectively. slight and insignificant increases in frictional forces were found with increasing angles in this system (one - way anova : p = 0.109). the total frictional forces were 2.0634 0.55829 and 2.5698 0.92098 n in 0.016 inch and 0.019 inch 0.025 inch wire systems in three angles or coated and uncoated conditions. wires of 0.019 inch 0.025 inch system showed significantly higher frictional forces compared to 0.016 inch system (student 's t - test : p < 0.0001). their chemical and physical characteristics are substantially different from the same materials of larger sizes. along with the hypothesis suggesting frictional force reduction between orthodontic wires and brackets after coating with nanoparticles , we evaluated the effect of zno nanoparticle coating of wires on decreasing frictional forces. the showed a significant decrease in kinetic friction resistance to sliding in the zno - coated wires at different angles and both orthodontic systems of 0.018 and 0.022. the mean total frictional force in both wires and systems were estimated to be 1.629 n for coated and 3.0043 n for uncoated wires, demonstrating a reduction of 46% following nanoparticle coating. the frictional force significantly decreased to 32.48%, 41.48% and 41.23% at 0, 5 and 10 angles, respectively, following zno nanoparticle coating on 0.016 inch wires compared to the same uncoated wires. in addition, the mean friction resistance significantly decreased by 52.17%, 52.96%, and 48.99% at 0, 5 and 10 angles, respectively, after zno nanoparticle coating on 0.019 inch 0.025 inch wires compared to the same uncoated wires. the mean frictional forces in 0.019 inch 0.025 inch wires showed 51% of reduction after nanoparticle coating. furthermore, the mean frictional forces in 0.016 inch wires showed 39% of reduction after coating. the mechanism by which the friction force is reduced after nanoparticle coating has been explained by rapoport et al. and cizaire et al. during the first phase, when there is no angle between the bracket slot and the wire, i.e., when the bracket slot translates parallel to the wire, nanoparticles act as spacers decreasing the number of surface irregularities which come into contact with each other, leading to a decreased friction coefficient. as the angle between the slot and wire increases, the force increases at the edges of the slot, ing in more friction resistance at the uncoated wire. at this point , some nanoparticles seem to exfoliate ing in dry lubrication of the sliding process on the wires coated with nanoparticles. when the two materials are made of ss, like the uncoated wires, the friction coefficient increases with time, possibly due to the tribochemical reactions leading to oxidation. when the nano sheets are subjected to higher forces at interfacial areas, the sliding takes place between these thin sheets of the exfoliated nanoparticles at the interfaces, consequently reducing the coefficient of friction. in addition, zno nanoparticles act as a protection against the oxidation of metal surfaces, consequently decreasing friction resistance. concluded that decreased coefficient of friction after zno coating is related to their nanostructure properties which increase lubricating characteristics of the surfaces by participating in their plastic deformation and reducing friction in turn. 2011 ) demonstrated, using x - ray diffraction spectroscopy, that crystally preferred orientation of zno nanoparticles had a significant effect on their low frictional properties. studied the friction resistance of 0.019 inch 0.025 inch orthodontic wires after coating with fullerene - like nanoparticles of ws2 and showed substantial reduction of frictional forces after nanoparticle coating, somehow similar to our findings. showed that coating with fullerene - like ws2 nanoparticles significantly reduces arch - wire friction with the possible alleviation of the adverse complications of orthodontic treatment. these studies were carried out using fullerene - like nanoparticles of ws2 which is somehow different from zno nanoparticles used in the present study, though their effects on decreasing friction resistance were similar. one advantage of zno particles compared to ws2 is their biocompatibility with and safeness for human tissues. zno is not able to create a lubricious surface in powder or compact disc forms; however, nanostructure zno is capable of developing lubricious surfaces with a friction coefficient of 0.2. it seems that nanoparticle coatings on ss brackets and wires lead to reduced frictional resistance due to the removal of corrosion factors, too. in the present study, all the frictional forces were of kinetic type as no measurements were carried out at baseline and rather, all the calculations were performed after 0.1s. some argue that as the movement takes place and the applied forces overcome the static friction resistance, calculation of static friction becomes more important than kinetic friction. some others suggest a study of kinetic frictional force in the tooth sliding movements. during space closure procedures, in addition, overcoming static friction can not lead to tooth movement and it is the biologic resistance of periodontium that plays an important role. furthermore, the limitations of simulating kinetic friction assessments are fewer than static friction calculations. regarding the above - mentioned arguments, kinetic friction was measured in the present study. due to the positive effects of nanoparticle coatings on decreasing frictional forces between orthodontic wires and brackets, the coatings can be applied to other orthodontic appliances and materials, such as conventional brackets and self - ligating systems and to initial treatment of flexible wires like niti arches. with the improvement of coating methods and their approval for use in the oral cavity, friction during orthodontic treatments can significantly decrease, ing in better anchorage control with the consequent reduced treatment time and risk of root resorption. however, further studies are required to assess cellular toxicity of nanoparticles or their effect on different organs in order to approve their safety. following zno nanoparticle coating, the frictional force between brackets and wires significantly decreased in all the angulations and systems. due to the positive effects of zno nanoparticle coating on decreasing frictional forces, these nanoparticles might offer a novel opportunity to significantly reduce friction during tooth movement and the consequent better anchorage control, reduced treatment time and risk of root resorption.

: in the sliding technique, the reduced frictional forces are associated with rapid tooth movements and better control of the anchorage. recently, wire coating with different nanoparticles has been proposed to decrease frictional forces. this in vitro study was carried out to coat stainless steel (ss) wires with zinc oxide (zno) nanoparticles in order to determine the effect of this coating on friction between wires and orthodontic brackets.materials and methods: eighty 0.016 inch and 0.019 inch 0.025 inch ss wires with and without zno nanoparticles were used in 80 orthodontic brackets (0.018 and 0.022 systems). the coated wires were analyzed by sem and x - ray diffraction (xrd) observations. kinetic friction between the wires and orthodontic brackets were calculated using a universal testing machine. frictional forces were statistically analyzed using three - way anova, one - way anova, student's t - test and tukey multiple comparison tests.:coating with zno nanoparticles significantly influenced frictional force values (p < 0.0001). in 0.019 inch 0.025 inch wires, the frictional forces were 1.6912 0.18868 and 3.4485 0.32389 n in the coated and uncoated wires respectively, (51% reductions). in the 0.016 inch wires, the friction values were estimated to be 1.5668 0.10703 and 2.56 0.34008 n in the coated and uncoated conditions, respectively, (39% reductions).: due to the positive effects of zno nanoparticle coating on decreasing frictional forces, these nanoparticles might offer a novel opportunity to significantly reduce friction during tooth movement.

composite transposons are common mobile genetic elements (mges) responsible for the dissemination of genes responsible for bacterial adaptation and survival including those conferring antibiotic resistance and xenobiotic degradation (nojiri, shintani and omori 2004 ; bennett 2008). they consist of two insertion sequences (iss) that flank a segment of dna, which can transpose as a whole unit (including the two flanking is elements) and the active is element alone can also transpose out from the unit. recently, another mechanism for the translocation of dna within an is26-based composite transposon was described (harmer, moran and hall 2014 ; harmer and hall 2015). a single copy of the is element is excised together with flanking dna to form a circular molecule. to distinguish this from conventional transposition of is elements, the transposing region was called a translocatable unit (tu). this molecule can be formed by two different mechanisms: intramolecular replicative transposition and conservative transposition by excising out from the composite transposon (fig . most of the dna segments reported to be found on tus are antibiotic resistance genes, such as the kanamycin resistance gene in is26-apha1a tu and tetracycline resistance gene in is1216-tet(s) tu (ciric et al . 2014 ; harmer and hall 2015). the structures of composite transposons and tus. the composite transposons consist of two is elements (blue box) flanking dna segment (green box). the purple and red arrows represent the binding site of the dna primers for the amplification of composite transposon and tus, respectively. previously, studies on composite transposons and tus focused on cultivable bacteria. however, most of the bacteria in environmental samples have not yet been cultured in the laboratory. for example , more than 700 bacterial species have been identified in human oral cavity, but less than half of them can be cultivated (wade 2011). human oral metagenomic dna was used to screen for composite transposons and tus, as several tus were found in oral bacteria, including streptococcus oralis and s. infantis (ciric, mullany and roberts 2011 ; ciric et al . 2014) the aim of this work is to determine whether composite transposons and tus could be detected through pcr in metagenomic dna. to do this, pcr primers were designed to amplify dna flanked by is elements to check for the presence of composite transposons in oral metagenomic dna. then, another set of primers was designed to determine if tus derived from these putative composite transposons were present. saliva samples were collected from 11 healthy males and females from department of microbial diseases, university college london (ucl) eastman dental institute as described previously (tansirichaiya et al . all of the volunteers did not receive any antibiotic treatment for at least 3 months, and gave the written consent prior to the sample collection . the saliva collection and processing procedures were approved by the ucl ethics committee ( project number 5017/001) and are described previously (tansirichaiya et al . the amplifications on the human oral metagenome were performed with the primers listed in table s1 ( supporting information). the pcr reaction was carried out with an initial denaturation at 94c for 3 min, following by 35 cycles of (i) denaturation at 94c for 1 min (ii) annealing at 50c65c for 30 s and (iii) extension at 72c for 3 min for standard pcr, 10 min for long pcr and 5 min for q5 pcr, and final extension at 72c for 10 min. the standard pcr reaction was contained 15 l of 2x biomix red (bioline, london, uk), 50100 ng of dna template, 0.2 m of each primer and molecular grade water (sigma, dorset, uk) up to 30 l. the long pcr reaction contained 0.25 l of takara ex taq (5 units/l) (takara bio, saint - germain - en - laye, france), 4 l of dntp mixture (2.5 mm each), 5 l of 10x ex taq buffer, 0.2 m of each primer, 50100 ng of dna template and molecular grade water up to a total volume of 50 l. q5 pcr reaction consisted of 12.5 l q5 high - fidelity 2x master mix (neb, hitchin, uk), 0.2 m of each primer, 50100 ng of dna template and molecular grade water up to a total of 25 l. pcr amplicons were visualized by gel electrophoresis on 1% agarose gel stained with gelred nucleic acid stain (biotium, cambridge, uk). pcr products were purified by using either the qiaquick pcr purification kit or the qiaquick gel extraction kit (qiagen), following the manufacturer's protocols. the purified products were subsequently cloned into the pgem - t easy vector (promega, southampton, uk) and transformed into escherichia coli -select silver efficiency competent cells (bioline) by heat shock. bertani (lb) agar containing 100 g / ml ampicillin, 40 g / ml x - gal and 0.4 mm iptg, and incubated overnight at 37c. by using the blue - white screening, the white colonies (containing inserts) were subcultured into 5 ml of lb broth containing 100 g / ml ampicillin and incubated overnight in 37c shaker. the plasmid isolation was performed by using qiaprep spin miniprep kit (qiagen), as per the manufacturer's instruction. the inserts containing in each plasmid were sequenced using m13 forward and m13 reverse primers at the beckman coulter genomics (genewiz, essex, uk) with an abi 3730xl. if the initial sequencing reaction can not cover the sequences of the inserts, extra primers were designed and used for additional sequencings. the analysis of sequencing was performed with bioedit software version 7.2.0 (http://www.mbio.ncsu.edu/bioedit/bioedit.html). if the insert was sequenced using multiple primers, the sequences were assembled with cap contig function within the software (huang 1992). the vector sequences were initially trimmed from the sequences by using vecscreen analysis tool (http://www.ncbi.nlm.nih.gov/tools/vecscreen) and identified for the primer binding sites. the sequences were then analyzed by using blastn and blastx for the matching with the sequences in the databases, isfinder for the identification of is element and clustal omega for the alignment of the sequences (altschul et al . the sequences of all composite transposons ( cta1 to cta5) were submitted to the dna database with the accession numbers from kx305930 to kx305934. twelve is elements were selected for the screening of composite transposons, including those of the is26 family (is26, is240, is257 and is1216), is elements found in streptococcus spp. (the most prevalent bacteria in oral cavity) (is861, is1161, is1167, is1381 and is1548), and is elements commonly associated with plasmids and transposons (is3, is256 and is1485) (kreth, merritt and qi 2009 ; clewell et al . prior to the detection of composite transposons, the presence of each is element in oral metagenomic dna was determined by designing the pcr primers to amplify the iss . the amplicons of the expected size were sequenced to confirm the . among 12 is elements , the sequencing showed that 6 of them were confirmed to be present in the extracted oral metagenome, these were is26, is257, is1216, is1161, is1167 and is1485 . the amplicons from this pcr amplification could be either the dna segment flanked by two iss of a composite transposon or the dna segment carried by a tu structure . after the screening, five different putative composite transposon amplicons ( cta15) were identified, four were is1216-based amplicons and another was an is257-based amplicon (table 1 and table s1, supporting information). the first amplicon (cta1) contained two potential orfs: one predicted to encode a small multidrug resistance protein (qrg) and the other a hypothetical protein (similar to nad diphosphatase). it had 99% nucleotide identity to the is1216 composite transposon found on tn6087 of streptococcus oralis f.mi.5 (ciric, mullany and roberts 2011). the second amplicon (cta2) was similar to the first one, but it was missing 229 bp of the gene predicted to encode the hypothetical protein and a region between qrg and the flanking is1216. the is elements and orf in the dna segment are shown in blue and green, respectively. the dash boxes, arrow boxes and dotted lines represent the regions that are not present compared to the sequences in the database. the next structure (cta3) was similar to part of plasmid pil5 and plasmid pbl1 from lactococcus lactis subsp. the main part of this structure (84% of the query) had 98% nucleotide identity with orf14, 15 and partial orf16 from plasmid pil5, encoding a transposase, a universal stress - like protein and a mn / fe transporter - like protein, respectively. the matching part of pbl1 plasmid to this structure was an iss1-like element with 100% nucleotide identity. by analyzing the orf14 and the iss1-like element with isfinder, they both were matched to is1216 with 100% similarity. another structure (cta4), which was similar to the cta3, was also identified, but it had an additional 2329 bp compared to cta3. the extra nucleotides were the rest of orf16 sequences missing from cta3, and a transposase gene orf17 from pil5. sequencing analysis showed that the kanamycin resistance gene, knt, and a truncated rep gene were flanked by transposase genes. it had 99% identity to part of plasmid sap079a from staphylococcus aureus (mcdougal et al . both partial transposase genes were matched to is257 ( 100% and 99% nucleotide identity). as each of amplicons described above may have formed from a tu template, another set of primers were designed to amplify outward from the dna segments between the flanking iss (fig . the verification pcr was carried out by using biomix red and additionally using highly processive q5 polymerase . this was to make sure that the amplicons were not a of an early fall - off of the polymerase, leaving partial amplicons that could themselves act as primers in subsequent round of pcr . tus were detected in pcrs carried out with primers designed from the dna segments within cta2 and cta4 ; amplicons of the expected size were confirmed as containing a single entire copy of is1216 by dna sequencing ( fig . schematic of the products from the tu confirmation pcr of the sample ( a) cta2 and (b) cta4. the is elements and orf in the dna segment are shown in blue and green, respectively. by designing the primers to read outward from is elements, five different putative composite transposons were identified from human oral metagenomic dna, each containing different genes predicted to be involved in environmental adaptation. the qrg gene in samples cta1 and cta2 was predicted to encode a small multidrug resistance protein that confers resistance to cetyltrimethylammonium bromide (ctab), a cationic antiseptic (ciric, mullany and roberts 2011). for the sample cta5 this protein was shown to confer resistance by catalyzing the transfer of a nucleotidyl group to the 4'-hydroxyl group of the aminoglycoside ing in inactivating kanamycin drug (pedersen, benning and holden 1995). a gene (uspa) predicted to encode a universal stress protein was found in samples cta3 and cta4. the precise biological function of uspa remains unknown, but it was shown that the levels of uspa are elevated during a variety of stress conditions including heat, oxidant exposure, nutrient starvation and exposure to antibiotics including polymixins and cycloserine (kvint et al . 2003 ; nachin, nannmark and nystrom 2005). it was hypothesized to function in the reprogramming of cells toward defense and escape by enhancing the cell's capacity to withstand stresses and modulating activities related to motility and adhesion (nachin, nannmark and nystrom 2005). by designing another set of primers to determine the presence of tus based on each amplicon , we confirmed that cta2 and cta4 were likely to be present as small circular molecules as the entire predicted single copy of the expected is element could be amplified. in order to control for pcr artefacts that may from short primer extension within a chromosomally located composite transposon, we used the highly processive q5 dna polymerase that confirmed the of the biomix red pcr. the lack of positive for the tu pcr of cta1, cta3 and cta5 (which contained similar sized direct repeats) demonstrates that pcr artefacts are unlikely. this is the first time that tus were detected in metagenomic dna and also the first time that the stress adaptation gene uspa was found on a tu. there is a possibility that the tu amplicon could have arisen if the entire composite transposon was repeated in the host genome; however, we think that this is unlikely due to the inherent instability of large repeated units of mobile dna. the studies on tus are still in an early stage, and there are only a small number of identified examples. reports on the integration and excision of tus are based on is26 composite transposons. it was shown that is26 tu preferred to integrate with a preexisting is26 element via a conservative reaction catalyzed by the tnp26 transposase, rather than a replicative transposition to a new site (harmer, moran and hall 2014). an intact transposase gene was shown to be important for the integration and excision of the tus (harmer, moran and hall 2014 ; harmer and hall 2015). recently, it was shown that reca - dependent homologous recombination could also mediate the integration of a tu; however, it is not a major factor because it occurs at least two orders of magnitude lower efficiency than the reaction catalyzed by tnp26 (harmer and hall 2016). tus are similar to another recently described mge, called an unconventional circularizable structure (ucs) (palmieri, mingoia and varaldo 2013). ucss can be excised from a replicon that contains two direct repeats (drs) flanking a dna segment. after excision , it in a non - replicative circular structure containing the dna segment and one of the drs. the movement of tus and ucss can both occur in reca - deficient bacteria, suggesting that homologous recombination is not essential for their formation and insertion (azpiroz, bascuas and lavia 2011 ; harmer, moran and hall 2014). the difference between ucs and tu is that ucs has no recombinases gene to catalyze their insertion reactions (palmieri, mingoia and varaldo 2013). this pcr strategy to detect tus can also be applied to ucss by designing the primers based on the drs of the ucss. as it was shown that the is6 family of composite transposons can transpose either as a whole unit of composite transposons or as tus , the resistance genes associated with them may then have more chance to be transposed and spread in bacterial population (harmer and hall 2016). furthermore, composite transposons are often located on other mges such as plasmids and conjugative transposons, which can also facilitate their horizontal gene transfer. if the excised tus do not integrate into a replicon, they will presumably be lost from the population during cellular replication. however, in sample cta5, we found a truncated rep gene on a putative is257 composite transposon. this raises the possibility that tus can facilitate the movement of rep genes between dna molecules further adding to the complexity of mge biology. indeed, there are some possible structures representing such rep containing tu insertion reactions such as repa - repc that is flanked by is26 on tn6029 (reid, roy chowdhury and djordjevic 2015) and repb located next to is1216 on tn6079 ( de vries et al. 2011; , we have determined that a metagenomic approach can be used to recover both composite transposons and tus from oral metagenome by performing pcr amplification with dna primers based on the is elements. due to the fact that the primers were designed based on the is elements, using this approach could also amplify novel genes carried by those composite transposons. this method might also be a more promising approach for the detection of the tus in metagenome, as these small circular molecules are likely to be rare and therefore could be missed, or not assembled by metagenomic sequencing.

a composite transposon is a mobile genetic element consisting of two insertion sequences (iss) flanking a segment of cargo dna often containing antibiotic resistance (ar) genes. composite transposons can move as a discreet unit. there have been recently several reports on a novel mechanism of movement of an is26-based composite transposon through the formation of a translocatable unit (tu), carrying the internal dna segment of a composite transposon and one copy of a flanking is. in this study, we determined the presence of composite transposons and tus in human oral metagenomic dna using pcr primers from common is elements. analysis of ing amplicons showed four different is1216 composite transposons and one is257 composite transposon in our metagenomic sample. as our pcr strategy would also detect tus, pcr was carried out to detect circular tus predicted to originate from these composite transposons. we confirmed the presence of two novel tus, one containing an experimentally proven antiseptic resistance gene and another containing a putative universal stress response protein (uspa) encoding gene. this is the first report of a pcr strategy to amplify the dna segment on composite transposons and tus in metagenomic dna. this can be used to identify ar genes associated with a variety of mobile genetic elements from metagenomes.

beta - catenin - dependent signaling pathways play essential roles in various cellular processes and in normal tissue homeostasis. although -catenin was primarily known as a central component of the canonical wnt signaling, several other signaling pathways like those mediated by tyrosine kinases, pi3-kinases, and heterotrimeric g proteins can also regulate -catenin function. the regulation of -catenin by these signaling pathways is probably through the inhibition of the enzymatic activity of gsk-3. the proposed mechanism is that the activation of the above signaling pathways leads to phosphorylation (at serine 9) and, therefore, inactivation of gsk-3. the inhibition of gsk-3 may in protein stabilization and, thus, cellular accumulation of -catenin. for example, we have reported that the activation of the gq class of heterotrimeric g - proteins in xenopus oocytes or in hek293tcells leads to the inhibition of gsk-3 and cellular accumulation of -catenin. the cellular accumulation of -catenin can in the translocation of this protein into the nucleus. in the nucleus, -catenin interacts with the tcf / lef transcription factors and, therefore, regulates the transcription of many genes involved in diverse cellular processes, including proliferation, differentiation, migration, and apoptosis. in addition, -catenin has an important role in maintaining epithelial tissues by interacting with the e - cadherin cell - cell adhesion protein. given the critical role of -catenin in different cellular processes, the abnormal function of this protein has been observed in animal developmental disorders and also in several human diseases, including human malignancies. the role of -catenin - mediated signaling in colon cancer has been intensively investigated, and it has been well known that upregulation of -catenin oncogenic activities occurs in more than 85% of the sporadic forms of colon cancer and in almost all patients with familial adenomatous polyposis. in patients with colon cancer, the upregulation of -catenin is mainly due to the truncating mutations of the tumor suppressor, the apcgene, although in some patients stabilizing mutations of -catenin itself or inactivating mutations of axin have been reported. since the upregulation of the -catenin protein is an early event in colon cancer, the functional blockade of this protein for the prevention or treatment of colon cancer is a valuable clinical approach. we had previously observed a reduction in -catenin - mediated gene expression when the protein was produced at very high cellular concentrations. to find out the reason, we primarily used immunostaining methods; and during our immunofluorescence microscopy experiments in hek293 t cells , we noticed that the transfection of the cells with larger amounts of the -catenin plasmid ed in the formation of rod - shaped -catenin protein aggregates. in summary, in this paper, for the first time, we report that -catenin can form visible protein aggregates when expressed at high levels in hek293 t cells. the -catenin aggregate formation in the hek293 t cells was predominantly observed in the cell nucleus, suggesting that aggregate formation can negatively affect the transcriptional activity of -catenin. in total, 2 10 hek293 t cells were seeded in each well of 6-well plates and grown at 37c, 5% co2 in dmem supplemented with 10% fbs and antibiotics (100 g / ml of streptomycin and 100 units / ml of penicillin). at 60% confluency, the medium was replaced with a fresh medium containing 25 g / ml of chloroquine phosphate (ipca laboratories, india); and 2 hours later, the cells were transfected with various amounts of the -catenin expression plasmid. six hours after transfection, the medium was changed to a medium lacking chloroquine phosphate; and 48 hours later, the cells were harvested. protein concentration and western blotting experiments were performed as described previously. in order to study the quantity and cellular localization of the -catenin protein the experiments were performed as described previously. for the measurement of the expression of -catenin target genes , the cells were harvested 48 hours post - transfection with trypsin / edta (0.53 mm of edta and 0.05% trypsin in pbs) and washed twice with cold pbs. total rna was extracted from the cell pellets using the rnx - plus kit (cinnagen, tehran, iran) as described by the supplier. thereafter, 2 g of rna was treated with 1 u of dnase i in a total volume of 10 l at 37c for 30 minutes. the dnase enzyme was inactivated in 2.5 mm of edta at 65c for 10 minutes, and then the reaction was used for reverse transcription by adding 200 u of reverse transcriptase enzyme (fermentas), 1x rt buffer, 20 u of ribolock rnase inhibitor, 1 mm of dntp mix, and 0.2 g of a random hexamer primer, in a total volume of 25 l. pcr amplification was performed on 1 l of the reverse transcription reaction using 30 pmol of each primer and 2.5 u of taq polymerase in a total volume of 25 l. the amplification protocol involved denaturation at 95c for 60 seconds, annealing (gapdh at 59c, cyclin d1 at 57c, and luciferase at 62c) for 60 seconds, and extension at 72c for 60 seconds. the 30 cycles of pcr were followed by a final extension at 72c for 10 minutes. the pcr products were separated on a 1% agarose gel and visualized by ethidium bromide. the of the rt - pcr experiments were then quantified with the imagej software. oligonucleotide primers for reverse transcriptase - pcr reactions f: forward primer; r: reverse primer the gene expression are presented as mean standard error. the analysis of variance (anova) test was used to compare the means of the gene expression levels between the different treated groups. in total, 2 10 hek293 t cells were seeded in each well of 6-well plates and grown at 37c, 5% co2 in dmem supplemented with 10% fbs and antibiotics (100 g / ml of streptomycin and 100 units / ml of penicillin). at 60% confluency, the medium was replaced with a fresh medium containing 25 g / ml of chloroquine phosphate (ipca laboratories, india); and 2 hours later, the cells were transfected with various amounts of the -catenin expression plasmid. six hours after transfection, the medium was changed to a medium lacking chloroquine phosphate; and 48 hours later, the cells were harvested. in order to study the quantity and cellular localization of the -catenin protein, we used indirect immunofluorescence microscopy. for the measurement of the expression of -catenin target genes, the cells were harvested 48 hours post - transfection with trypsin / edta (0.53 mm of edta and 0.05% trypsin in pbs) and washed twice with cold pbs. total rna was extracted from the cell pellets using the rnx - plus kit (cinnagen, tehran, iran) as described by the supplier. thereafter, 2 g of rna was treated with 1 u of dnase i in a total volume of 10 l at 37c for 30 minutes. the dnase enzyme was inactivated in 2.5 mm of edta at 65c for 10 minutes, and then the reaction was used for reverse transcription by adding 200 u of reverse transcriptase enzyme (fermentas), 1x rt buffer, 20 u of ribolock rnase inhibitor, 1 mm of dntp mix, and 0.2 g of a random hexamer primer, in a total volume of 25 l. pcr amplification was performed on 1 l of the reverse transcription reaction using 30 pmol of each primer and 2.5 u of taq polymerase in a total volume of 25 l. the amplification protocol involved denaturation at 95c for 60 seconds, annealing (gapdh at 59c, cyclin d1 at 57c, and luciferase at 62c) for 60 seconds, and extension at 72c for 60 seconds. the 30 cycles of pcr were followed by a final extension at 72c for 10 minutes. the pcr products were separated on a 1% agarose gel and visualized by ethidium bromide. the of the rt - pcr experiments were then quantified with the imagej software. oligonucleotide primers for reverse transcriptase - pcr reactions f: forward primer; r: reverse primer spss, version 16, was used to analyze the statistically. the analysis of variance (anova) test was used to compare the means of the gene expression levels between the different treated groups. we had previously noticed that the overexpression and production of the -catenin protein at very high cellular levels leads to a decrease in the expression of the -catenin target genes (saghaeian jazi and a. najafi, unpublished ). to find out the reason, we first studied the cellular -catenin protein by immunostaining methods. hek293tcells were transfected with increasing amounts of an expression plasmid harboring the -catenin cdna, and then the cellular levels of -catenin were measured by western blotting. as was expected, the cells produced more -catenin protein when transfected with greater amounts of the plasmid (figure 1a). when immunofluorescence microscopy was used, fluorescent rod - like bodies were clearly seen in some cells (figure 1b). the aggregate structures were not observed in the absence of the -catenin antibody, suggesting that -catenin forms protein aggregates at high concentrations (figure 1b). hek293 t cells were seeded in duplicate and transfected with different amounts of the -catenin plasmid (the number on top of each panel). one group of cells was used for western blotting experiments to measure -catenin protein levels (a) and the other group was used for immunofluorescence staining of -catenin (b). the lowest panel represents the cells transfected with 3 g of the -catenin plasmid, but the primary antibody was omitted from the staining protocol to test the specificity of the -catenin antibody. the expression of the gapdh protein was used as a loading control for the blot shown in figure 1a. the rod bodies varied in length, and they were mainly seen in the cell nucleus (figure 2a). it was also observed that the precipitates of the -catenin aggregates could be recovered by centrifugation. nuclear extracts were isolated from the cells and centrifuged at 63000 g to separate soluble and insoluble forms of the -catenin protein. the 2fractions, after protein measurement, were used for western blotting experiments with the -catenin antibody (figure 2b). as is shown in this figure, the amount of both soluble and insoluble forms of -catenin increased when higher concentrations of the -catenin plasmid were used for cell transfection. it is likely that these -catenin protein aggregates had different sizes and only the heavier ones were precipitated during centrifugation. (a) fitc (left) and dapi (middle) staining of a hek293 t cell, overexpressing -catenin. the figure shows that the -catenin protein aggregates predominantly formed in the cell nucleus (the arrow). (b) hek293 t cells were transfected with increasing amounts of the -catenin plasmid; and 48hours after transfection, the cells were harvested and fractionated as described in reference 16. we then considered whether -catenin aggregates were present in physiological conditions or whether they were only the of overexpression experiments.. therefore, the -catenin proteins in these cells were carefully examined by immunofluorescence microscopy, but there was no indication of protein aggregation (figure 3). since the -catenin aggregate structures were mainly formed in the cell nucleus, we asked whether this could have any effect on the expression of -catenin target genes. the upregulation of cyclin d1 in response to the activation of the canonical wnt/-catenin signaling has been considered by many laboratories, including ours. therefore, we chose cyclin d1 as a native cellular -catenin - responsive gene. we also used luciferase under the control of -catenin - tcf / lef binding regulatory elements (ptopflash), as a -catenin - responsive reporter gene. as we intended to test the -catenin transcriptional activity more directly, we used rt - pcr experiments to measure the luciferase gene expression. the transcription of the above genes in the cells transfected with different amounts of the -catenin - encoding plasmid was measured. as is shown in figure 4, compared to that of the cells transfected with an empty vector, the transcription of the cyclin d1 and luciferase genes was upregulated (1.5 to 2-fold) in the cells transfected with 0.5 g of the b - catenin plasmid. interestingly, the transfection of the cells with 1.5 g of the plasmid either did not change or led to a decrease in the expression of the cyclin d1 and luciferase genes and the use of 3.0 g of the -catenin plasmid for cell transfection generally ed in a further decrease in gene expression (figure 4). interestingly, in some experiments, the transfection of the cells with 3.0 g of the -catenin plasmid lowered the transcription of the cyclin d1 and luciferase genes below the basal level (figure 4). it is worth mentioning that we observed some degree of variability in the gene expression , which may have been due to the difference in the efficiency of cell transfection from one experiment to another. collectively, the of these experiments suggest that -catenin is transcriptionally active only up to certain cellular levels and higher concentrations of this protein have a negative effect on the transcription of the target genes, perhaps due to the formation of inactive protein aggregate structures. rt - pcr experiments were performed to measure the expression of the cyclin d1 and luciferase genes in hek293 t cells transfected with varying amounts of the -catenin plasmid. to measure the luciferase gene, we also transfected the cells with 0.5 g of the reporter, top flash plasmid. the gene expression level was significantly different between the groups evaluated by the anova test (p=0.01). the of a western blot experiment measuring the corresponding -catenin protein levels is shown below the chart. we had previously noticed that the overexpression and production of the -catenin protein at very high cellular levels leads to a decrease in the expression of the -catenin target genes (saghaeian jazi and a. najafi, unpublished ). to find out the reason, we first studied the cellular -catenin protein by immunostaining methods. hek293tcells were transfected with increasing amounts of an expression plasmid harboring the -catenin cdna, and then the cellular levels of -catenin were measured by western blotting. as was expected, the cells produced more -catenin protein when transfected with greater amounts of the plasmid (figure 1a). when immunofluorescence microscopy was used, fluorescent rod - like bodies were clearly seen in some cells (figure 1b). the aggregate structures were not observed in the absence of the -catenin antibody, suggesting that -catenin forms protein aggregates at high concentrations (figure 1b). hek293 t cells were seeded in duplicate and transfected with different amounts of the -catenin plasmid (the number on top of each panel). one group of cells was used for western blotting experiments to measure -catenin protein levels (a) and the other group was used for immunofluorescence staining of -catenin (b). the lowest panel represents the cells transfected with 3 g of the -catenin plasmid, but the primary antibody was omitted from the staining protocol to test the specificity of the -catenin antibody. the expression of the gapdh protein was used as a loading control for the blot shown in figure 1a. the rod bodies varied in length, and they were mainly seen in the cell nucleus (figure 2a). it was also observed that the precipitates of the -catenin aggregates could be recovered by centrifugation. nuclear extracts were isolated from the cells and centrifuged at 63000 g to separate soluble and insoluble forms of the -catenin protein. the 2fractions, after protein measurement, were used for western blotting experiments with the -catenin antibody (figure 2b). as is shown in this figure, the amount of both soluble and insoluble forms of -catenin increased when higher concentrations of the -catenin plasmid were used for cell transfection. it is likely that these -catenin protein aggregates had different sizes and only the heavier ones were precipitated during centrifugation. (a) fitc (left) and dapi (middle) staining of a hek293 t cell, overexpressing -catenin. the figure shows that the -catenin protein aggregates predominantly formed in the cell nucleus (the arrow). (b) hek293 t cells were transfected with increasing amounts of the -catenin plasmid; and 48hours after transfection, the cells were harvested and fractionated as described in reference 16. we then considered whether -catenin aggregates were present in physiological conditions or whether they were only the of overexpression experiments.. therefore, the -catenin proteins in these cells were carefully examined by immunofluorescence microscopy, but there was no indication of protein aggregation (figure 3). since the -catenin aggregate structures were mainly formed in the cell nucleus, we asked whether this could have any effect on the expression of -catenin target genes. the upregulation of cyclin d1 in response to the activation of the canonical wnt/-catenin signaling has been considered by many laboratories, including ours. therefore, we chose cyclin d1 as a native cellular -catenin - responsive gene. we also used luciferase under the control of -catenin - tcf / lef binding regulatory elements (ptopflash), as a -catenin - responsive reporter gene. as we intended to test the -catenin transcriptional activity more directly, we used rt - pcr experiments to measure the luciferase gene expression. the transcription of the above genes in the cells transfected with different amounts of the -catenin - encoding plasmid was measured. as is shown in figure 4, compared to that of the cells transfected with an empty vector, the transcription of the cyclin d1 and luciferase genes was upregulated (1.5 to 2-fold) in the cells transfected with 0.5 g of the b - catenin plasmid. interestingly, the transfection of the cells with 1.5 g of the plasmid either did not change or led to a decrease in the expression of the cyclin d1 and luciferase genes and the use of 3.0 g of the -catenin plasmid for cell transfection generally ed in a further decrease in gene expression (figure 4). interestingly, in some experiments, the transfection of the cells with 3.0 g of the -catenin plasmid lowered the transcription of the cyclin d1 and luciferase genes below the basal level (figure 4). it is worth mentioning that we observed some degree of variability in the gene expression , which may have been due to the difference in the efficiency of cell transfection from one experiment to another. collectively, the of these experiments suggest that -catenin is transcriptionally active only up to certain cellular levels and higher concentrations of this protein have a negative effect on the transcription of the target genes, perhaps due to the formation of inactive protein aggregate structures. rt - pcr experiments were performed to measure the expression of the cyclin d1 and luciferase genes in hek293 t cells transfected with varying amounts of the -catenin plasmid. to measure the luciferase gene, we also transfected the cells with 0.5 g of the reporter, top flash plasmid. the gene expression level was significantly different between the groups evaluated by the anova test (p=0.01). the of a western blot experiment measuring the corresponding -catenin protein levels is shown below the chart. beta - catenin is a multifunctional protein which regulates different cellular activities. as a component of cell adherens junctions , -catenin physically interacts with the cell membrane protein, e - cadherin, to stabilize the epithelial tissues. in addition, as a signaling protein, nuclear -catenin interacts with the tcf / lef transcription factors to regulate the expression of many cellular genes encoding very important proteins, including growth factors, transmembrane receptors, and transcription factors. a list of these genes is available at the wnt - signaling homepage (www.stanford.edu/~rnusse/wntwindow.html). for years , -catenin has been the focus of research by scientists in the field of developmental biology, cancer biology, and cell and molecular biology. beta - catenin was primarily known as a central component of the canonical wnt signaling. upon interaction between some wnt ligands and their cognate receptors, the canonical wnt signaling becomes activated and leads to the chemical and functional modification of a protein complex (destruction complex), which is involved in the regulation of -catenin cellular stabilization. the activation of the canonical wnt signaling blocks gsk-3-mediated -catenin phosphorylation at a few serine or threonine residues located at the n - terminal segment of the protein. the phosphorylation of -catenin at these sites makes this protein susceptible to the proteasome degradation system, thereby decreasing the stabilization and cellular accumulation of -catenin. interestingly, the natural oncogenic mutants of -catenin carry mutations in the gsk-3 phosphorylation sites and these mutants are much more resistant to proteolysis and are, thus, dominantly active. the growth, proliferation, and survival of some human cancer cells are dependent on -catenin function, and the deregulation of this protein has been observed in some human cancers. the oncogenic function of -catenin has been highlighted in colorectal cancers since most patients carry genetic and epigenetic alterations leading to the upregulation of -catenin function. in this paper , we showed that the overexpression of -catenin in hek293 t cells might cause this protein to form aggregate structures. we also showed that the -catenin aggregate structures were mainly formed in the cell nucleus (figure 2). this was an interesting observation because it could be a mechanism for our previous finding that -catenin had a lower transcriptional activity at very high cellular concentrations. we repeated gene expression experiments and, consistent with previous , observed that the transcription of cyclin d1 was decreased when the cells were transfected with a higher amount of the -catenin - encoding plasmid (e.g. 3.0 g for each well of a 6-well plate) (figure 4). the decrease was also observed for the luciferase gene in the topflash plasmid (figure 4). in this construct, the luciferase gene is under the control of 3repeats of a -catenin - tcf / lef - binding element. these suggest that -catenin aggregate formation could functionally block -catenin - dependent gene expression. at least 2 other research groups have also noticed -catenin aggregates in cells having large amounts of this protein, and the protein regions necessary for the formation of such aggregates have been mapped. the most important region appears to be the armadillo repeat domain of -catenin since the expression of the proteins that bind to this domain (e.g. n - cadherin, tcf-4, and apc) can block the formation of aggregates. the formation of -catenin aggregates has been reported in several cell lines, including pc12, mdck, and nih3t3. here , we showed that -catenin aggregates were also able to form inhek293tcells, suggesting that the formation of these aggregate structures could occur in many cells. other laboratories have also discovered that -catenin aggregates are mainly found in cell nucleus, and it has been suggested that vinculin and lef-1 are also present with -catenin in the aggregates. an important question is whether -catenin can form aggregate structures at normal and physiological concentrations. in normal cells, -catenin is mainly found at the cell membrane (as a component of cell adherens junctions) and its intracellular concentrations is very low. however, some cancer cells have increased the intracellular protein levels of -catenin which provide them with growth and proliferative advantages. an appropriate example is the invasive sw480 colon cancer cell, which carries easily detectable amounts of intracellular -catenin (figure 3). however, we did not find any indication of -catenin aggregate formation in sw480 cells (figure 3). this was expectable, because if -catenin formed aggregate structures in the sw480 cells, this protein could not function as a potent oncogene in these cells. it is very interesting to know whether the cells like sw480 have a mechanism to block -catenin aggregates. it is also likely that -catenin protein levels in sw480 cells do not reach those levels to form protein aggregates. among the hek293 t cells transfected with 0.5 g of -catenin encoding plasmid , we found cells which had -catenin protein levels apparently higher than those of the sw480 cells, but these cells did not have visible aggregate structures (figure 1b). the shown in this paper only demonstrate that -catenin forms protein aggregation at very high cellular concentrations, but they do not measure the cellular levels of this protein which initiate protein aggregation. a stable transfection of hek293 t cells with -catenin, followed by a selection of different clones expressing different amounts of -catenin, might create a more defined direction toward estimating the -catenin concentrations required for aggregate formation. the formation of protein aggregates has been observed in several neurodegenerative diseases. in general, protein aggregation is toxic to cells because the aggregate structures can functionally block important cellular proteins. there are several studies indicating that the downregulation of the wnt/-catenin signaling pathway is involved in the pathogenesis of some neurodegenerative disorders, including amyotrophic lateral sclerosis, alzheimer s disease, and huntington s diseases. beta - catenin aggregate formation might be one of the mechanisms for the wnt/-catenin signaling deficiency in neurodegenerative diseases. interestingly, pinto and colleagues used nsc34 cells stably expressing the enzyme superoxide dismutase-1 (as an in vitro model) to study wnt/-catenin signaling in the neurodegenerative disease, amyotrophic lateral sclerosis. the authors suggested that the decrease in the wnt/-catenin pathway - dependent gene expression in the nsc34 cells was probably due to the cellular aggregation of -catenin. as was mentioned above, deregulation of -catenin activity has been observed in several human cancers and also in other human diseases, including neurodegenerative disorders. accordingly, further research is warranted with a view to establishing whether the aggregation of this protein is biologically relevant. in summary, in this paper, we report that -catenin can form visible protein aggregates when expressed at high levels in hek293 t cells, re - emphasizing the possible biological significance of this phenomenon. the -catenin aggregate formation in the hek293tcells was predominantly observed in the cell nucleus, suggesting that aggregate formation can negatively affect the transcriptional activity of -catenin.

: the canonical wnt signal transduction (or the wnt/-catenin pathway) plays a crucial role in the development of animals and in carcinogenesis. beta - catenin is the central component of this signaling pathway. the activation of wnt/-catenin signaling in the cytoplasmic and nuclear accumulation of -catenin. in the nucleus, -catenin interacts with the tcf / lef transcription factors and, therefore, participates in the upregulation or downregulation of some important genes involved in diverse cellular activities. in addition, -catenin is a critical component of the cadherin - mediated cell adherens junction. we had previously noticed that very high cellular concentrations of -catenin had a negative effect on the transcriptional activity of this protein and, therefore, the aim of this study was to find a mechanism for this negative interaction.methods:cell fractionation, western blotting, and immunofluorescence microscopy experiments were performed to measure -catenin protein levels and -catenin cellular localization in hek293tcells transfected with various amounts of a -catenin - encoding plasmid. also, total rna was extracted from the cells and used for reverse transcriptase - pcr experiments to measure the expression of the -catenin target genes. spss, version 16, was used to analyze the statistically.:we demonstrated that overexpression of -catenin led to the formation of rod - shaped protein aggregates. the aggregate structures were mainly formed in the cell nucleus and were heavy enough to be isolated by centrifugation. beta - catenin aggregate formation was accompanied by a decrease in the expression of the -catenin target genes used in this study.:since deregulation of -catenin function occurs in several human diseases, including cancer and neurological disorders, the of this paper further support the possible biological and clinical significance of -catenin aggregate formation.

although it has been known for five decades that guanine - rich nucleic acids can form four - stranded structures, research into quadruplex dna has rapidly escalated in recent years. one reason for continued interest is the demonstration that telomeres can and do fold into quadruplex structures in vivo. shortening of telomeres on chromosomal replication is considered to be a major cause of senescence, and cancer cells have been shown to generate an immortal phenotype by upregulating telomerase. the activity of telomerase is inhibited by the presence of g - quadruplexes, leading to the possibility of novel anticancer agents that work by binding to and stabilizing such quadruplexes. a second reason for interest is the observation that quadruplexes are found not only in telomeres but also in other parts of the genome. typically they are found in upstream promoters and in some cases have been shown to perform a regulatory function on downstream genes. quadruplexes are also formed by rna and again are likely to have regulatory roles on translation. for all these reasons, there is considerable interest in finding small molecules that bind to quadruplexes and stabilize them and that could act as markers for their presence. over the past few years, it has become abundantly clear that guanine - rich sequences can fold into quadruplexes in many different ways. a given sequence can also fold differently depending on solution conditions, including counterions (potassium or sodium), molecular crowding, and dehydration. a case in point is the human telomere sequence, hts, d, which has been observed in several conformations. this plasticity makes it all the more important to identify small molecules that bind specifically to particular conformations and stabilize them, especially if the function and dysfunction of quadruplexes in normal and abnormal cellular function are to be delineated. despite this importance only four x - ray structures involving an intramolecular quadruplex have been reported, all of which involve the all - parallel conformer with the ligand end - stacking on terminal g - tetrads. although, as outlined above, telomere sequences can take up a range of topologies, virtually all the other reported structures also involve ligands bound to all - parallel conformers, comprising tetramolecular or bimolecular quadruplexes. indeed, given this paucity of data and the range of potential telomeric conformer targets, it has been suggested that the design of small molecules to stabilize g - quadruplexes should also be directed toward ligands that selectively target antiparallel and hybrid type g - quadruplex folding topologies. the structural data obtained for small molecules bound to non all - parallel quadruplex conformers indicate that these telomeric structures could be targeted through specific interactions. for example the crystallographic structures of disubstituted aminoalkylamidoacridine derivatives bound to the dimeric antiparallel g - quadruplex formed from the oxytricha nova telomere sequence d(g4t4g4) reveal that while these structures display the expected end - stacking interaction, they also feature a second distinctive motif: the acridine moiety threads through the t4 diagonal loop. as part of a program to develop luminescent metal complexes as sequence and structure specific dna binding substrates, we have studied the quadruplex binding properties of dinuclear ruthenium(ii) complexes containing the tetrapyridophenazine (tpphz) ligand. although the central tpphz ligand in such complexes is planar, the octahedral coordination geometry about the ruthenium centers gives rise to a these studies have revealed that both , 1, and , 2, (where bipy = 2,2-bipyridine, phen = 1,10-phenanthroline), figure 1, bind to quadruplex dna with high affinities (> 10 m). (a) structures of complexes studied. (b) the two possible enantiomers of each of the metal centers in 1 and 2. (c) schematic of the two diastereomers of 1 and 2 relevant to this study: left; right. both these complexes display a dna light - switch effect, being essentially nonemissive in aqueous solution until dna binding induces a several orders of magnitude increase in their ru tpphz mlct - based luminescence. uniquely, the emission and binding affinities of 1 and 2 are sensitive to dna structure. while groove binding to all duplexes produces a relatively weak emission at > 675 nm, binding to quadruplexes produces more complex emission changes. intense blue - shifted luminescence (630 nm) and high affinity binding is observed only when the complex binds to antiparallel quadruplex structures containing external diagonal loops at least three bases in length. the presence of shorter lateral loops limits binding affinities by several orders of magnitude and in negligible emission. this difference in luminescence output means that, despite the only modest selectivity in binding affinities, quadruplex structures can be detected in the presence of duplex dna. indeed, this concept has been illustrated by recently reported cell studies with these complexes. fascinatingly, in cellulo studies reveal that, while 1 is only taken up by fixed cells, 2 is actively transported into live cells. confocal microscopy studies confirm that 2 is a selective luminescent stain for heterochromatin. furthermore, 2 displays distinctive noncolocalized multiple emission peaks, whose wavelengths are consistent with those obtained through in vitro studies, indicating that the complex is an in cellulo probe of dna structure. until now, these studies have used racemic mixtures of complexes 1 and 2. however, recently the qu group have shown that the -enantiomer of a nonemissive dinuclear nickel(ii) triple helicate complex displays a strong binding preference for specific quadruplex structures over duplex dna, while sugiyama and co - workers have demonstrated that a chiral helicene macrocycle can enantioselectively recognize quadruplex dna. furthermore, recent spectroscopic, crystallographic, and nmr studies on mono- and dinuclear ru(dppz) (dppz = dipyridophenazine) systems with duplex dna have also illustrated the importance of chirality in such interactions. in light of these studies, we discuss the dna binding preferences of enantiopure samples of 2 and also report nmr - based studies designed to delineate the structural details of quadruplex binding by 1 and 2, followed by further rationalization of the based on molecular dynamics (md) simulations in water. in previous studies, we have found that the luminescent binding response of rac-1 and rac-2 to duplex and quadruplex dna is effectively identical. in both cases, binding to duplex dna produces a 60-fold increase in emission, while binding to quadruplex produces a > 150 times increase in blue - shifted emission. furthermore comparisons of kb values for rac-1 and rac-2 revealed they are almost identical within experimental error. in the study reported herein, the interaction of enantiomerically pure complexes -2 and -2 with duplex and quadruplex dna was investigated through luminescence titrations using calf thymus dna (ct - dna) (supporting information figure s01) and the human telomere sequence (hts) d (figure 2). typical data for the luminescence response of -2, -2, and an unresolved diastereomeric mixture of 2 to the progressive addition of the unimolecular hts quadruplex d. conditions: 10 mm kh2po4/k2hpo4, 1 mm k2edta, 200 mm kcl, ph 7.0, 298 k, = 7 m. the cd spectrum of the hts sequence in uncrowded k solutions confirmed that it adopts an antiparallel basket conformation (supporting information figure s02), which is consistent with previous observations by reniuk et al. nmr and cd spectra of hts in 100 mm nacl are similar to those reported by wang and patel and indicate that the structure remains an antiparallel basket. characteristics for the interaction of ct - dna with either enantiomer in aqueous buffer solutions were found to be very similar. both show a very similar increase in steady - state luminescence, which is identical within experimental error to the changes observed for an unresolved diastereomeric mixture (see supporting information). indeed, fits of the data to standard binding models lead to estimates of binding affinities that are almost identical to those previously reported for the unresolved mixture (kb = 4.40 10 m), although it does appear that the binding affinity of -2 is slightly higher than that of -2 (table 1). by contrast, titrations of enantiomerically pure 2 with hts produced clear differences in the luminescent response of -2 and -2. addition of hts to -2 led to increases in emission that were around 20% larger than those observed for an unresolved diastereomeric mixture. more fascinatingly, -2 displayed a much smaller emission response than either -2 or the unresolved solution mixture: at binding saturation, the steady - state emission intensity of -2 is 6-fold less than that of -2 (figure 2). because the binding - induced light - switch effect observed for these complexes is due to transfer from a polar bulk aqueous environment into a less polar binding environment, these data indicate that bound -2 is much more solvent accessible than -2, thus implying structural differences in the binding complexes with hts for the two diastereomers. fits of the luminescence changes to a simple one set of identical binding sites model offers further evidence to support this hypothesis, as the binding affinity of -2 is around 40 times higher than that of -2 (table 1). the diastereomeric mixture contains 25% -2, 25% -2, and 50% -2, yet its emission intensity is roughly 85% the intensity of pure -2. this is almost exactly the value expected if -2 has the same emission intensity as -2. the therefore suggest that -2 binds in the same way as -2, i.e., that for binding to hts, chirality is possible at one end of the ligand but not both. as discussed before, addition of 2 (as a racemic mixture or as pure enantiomers) gives rise to hypochromic and bathochromic shifts in uv vis spectra, indicative of stacking of the aromatic rings against dna base pairs. a stacking mode of binding is also indicated by the strongly enhanced luminescence and the blue - shift of approximately 30 nm, which we have shown only occurs when the ligand is strongly shielded from solvent. shielding to this extent can only arise when the ligand is covered by quadruplex loops: in other words, it implies stacking over a tetrad plane and shielding by loops, rather than groove binding. furthermore, the markedly greater increase in luminescence for bound -2 implies significantly better shielding from solvent for this isomer. further evidence for this hypothesis was obtained by nmr studies to provide structural insights into the effects observed in our optical studies, the binding of 1 and 2 to hts was further investigated using a combination of nmr spectroscopy and simulated annealing coupled with restrained molecular dynamics simulations for structure determination. assignments of the folded quadruplex before addition of any complex are given in the supporting information (table s1). on addition of -2 to hts, severe line broadening of dna signals was observed by nmr, mainly from the lateral loop end (red dots, bottom end of figure 3). this implies that the ligand is binding at this end and causing structural perturbations concomitant with binding, which occur on a time scale in the millisecond range. unfortunately, this is a common observation in studies of dna / ligand interactions and it makes structure determination of the complexes difficult by severely reducing the information content of spectra. by contrast, addition of the more tightly binding -2 produced less severe relaxation - induced broadening although enough to abolish intermolecular noes. chemical shift changes occurred at both ends of the quadruplex, and intramolecular noes were broadened and lost at both ends. it therefore appears that whereas -2 binds mainly at the lateral loop end, -2 binds at both ends. taken together with the luminescence data, the implication is that binding of -2 at the diagonal loop end (top end of figure 3) is accompanied by a high degree of shielding of the ligand from solvent. this in turn implies that the ligand is stacked onto the tetrad underneath the diagonal loop. the antiparallel basket formed by hts. the colors show the residues still present (green), missing (red), and possible exchange doublet (yellow), upon addition of -2. all attempts to alter the solution conditions so as to bring back intermolecular noes were unsuccessful. the absorption and emission response of this complex to hts binding is very similar to that of 2: in particular, the enhancement and blue - shifting of its luminescence are very similar, indicating analogous modes of binding. these studies were carried out on a diastereomeric mixture as this had the advantage that both putative binding sites could be potentially investigated in a single experiment. addition of 1 to hts gave rise to chemical shift changes at both ends of the quadruplex. there was broadening of signals throughout, which led to a general reduction in the intensities of intramolecular noes, although the largest effects were seen at the lateral loop end (table 2). however, gratifyingly, a large number of new intermolecular noes could be seen to the ligand (figure 4). selected sections of spectra showing the new crosspeaks identified upon addition of a diastereomeric mixture of 1 to the hts sequence. in free solution, nmr resonances from the four symmetry - related positions of 1 have identical chemical shifts. however, in the presence of hts, most signals were split into four, in some cases with fairly large chemical shift changes. the increased complexity made it impossible to assign the ligand signals in the complex to individual positions and meant that, although we were able to observe 20 intermolecular noes in the complex, we were only able to assign the nucleotide signals (table 2). analysis of the noes reveals that they are not compatible with a single structure for the complex, because 13 derive from contacts at the diagonal loop end and seven from contacts at the lateral loop end. on the basis of the discussion above, , we expect -1 to bind mainly at the lateral loop end and -1 (and probably also -1) mainly at the diagonal loop end. as anticipated, the noes at the diagonal loop end are consistent with 1 binding under the diagonal loop. the experimentally observed noes from the lateral loop end were used to calculate structures for both -1 and -1 bound at the lateral loop end using restrained simulated annealing. the structure generated for -1 is shown in figure 5 and has no violations of the noe constraints greater than 0.5. molecular dynamics - based structure of -1 bound to the lateral loop end of hts, generated using experimentally observed noes for the interaction. while the tpphz ligand stacks on top of the tetrad bases, this interaction is reinforced by electrostatics: the positively charged ruthenium centers are located at the edge of the tetrad close to the anionic phosphate backbone. there is little perturbation to the quadruplex structure, with slight movement of the lateral loops to accommodate the ligand. bases in the loops partially shield the tpphz rings, as expected from the luminescence. there is little direct contact between the bipy ligands and the quadruplex, and therefore both the and complexes bind in a similar way, with similar energies. the observed noes were also used to calculate a structure for the complex bound at the diagonal loop end. the bipy rings fit neatly against the phosphate backbone making close van der waals contact. the diagonal loop holds the tpphz in place and shields it from solvent, as expected from the luminescence data. molecular dynamics - based structure of -1 bound to the diagonal loop end of hts, generated using experimentally observed noes for the interaction. left: illustrating the bipy ring at front left parallel to the dna backbone. right: showing how the 5 end of the dna backbone (front center) moves to avoid the ligand. molecular dynamics - based structure of -1 bound to the diagonal loop end of hts, generated using experimentally observed noes for the interaction. by contrast, attempts to use the same noes to calculate a structure with -1 bound at the same site in a very high - energy state (roughly 10 times higher). in this structure, one end of the ligand is able to fit straightforwardly, by displacing the terminal nucleotide of the quadruplex dna chain (figure 7). however, in this calculation, the other end of the ligand does not displace the dna backbone. instead, the calculation generates a number of physically impossible solutions, of which the lowest energy is shown in figure 7: the phosphate backbone passes through the middle of one of the aromatic bipy rings. the other solution is to displace one bipy ligand completely away from the tpphz plane. structures have been calculated for the and isomers of 2 in the same way and show similar features (supporting information figures s04 and s05). these calculations imply that the experimental noe data are compatible with the isomer binding at the diagonal loop end but not with the isomer binding at the same site. this is thus in agreement with the reached above, that both isomers bind at the lateral loop end, but only the isomer (and probably the isomer also) binds at the diagonal loop end. to investigate this issue further, unconstrained molecular dynamics simulations were carried out in a tip3p water model. to evaluate the impact of -1 and -1 complexes on the quadruplex structure when binding under the diagonal loop, molecular dynamics simulations were performed on free hts and its association with -1 and -1. for free hts, three independent simulations were undertaken using the structures presented in figures 57 (henceforth denoted a, b, and c) as starting conformations. these were then compared with simulations of the associations formed between the quadruplex and both diastereomers -1 and -1, labeled -1-hts and -1-hts, respectively. for the -1-hts simulation, the nmr - based structure shown in figure 6 was used as starting point, while for simulation of -1-hts, the starting structure was generated from -1-hts by replacing -1 with -1, superimposing the two ruthenium atoms and the tpphz bridging ligand. thus, only the spatial arrangement of the two ru(bipy)2 moieties was changed, in agreement with the respective diastereomers in the octahedral metal coordination sphere. further molecular dynamics simulation details, together with an extended discussion, are provided in supporting information. simulations a, b, and c of the free hts show that the g - tetrads yield low root mean - square deviations (rmsd), calculated relative to the starting structures, consistent with a minor conformational rearrangement experienced by these subunits throughout the 50 ns of simulation time, which is to be expected because they are held in place by hydrogen bonds. in contrast, the diagonal loops are more mobile (see supporting information figure s06) showing higher rmsd values. overall, the three independent simulations sampled significant hts conformational space as suggested by the representative conformations of simulations a, b, and c, which have slightly different structures with cross rmsd values collected in supporting information table s03 between 2.71 and 3.88. we then went on to look at the interaction of hts with the metal complex using the same method. figure 8 shows the rmsd values over the simulation time (using the unrelaxed starting structures as reference) for both the -1-hts and -1-hts associations. in both cases, after an initial jump due to the geometry relaxation using the ideal force field parameters, the values tend to stabilize. focusing on the rmsd values for -1-hts, the g - tetrad and the hts structure typically stabilize after the first five ns while the values for the diagonal loop oscillate. this loop mobility is assigned to the presence of -1, as it was not observed in simulations a, b, and c of free hts. apart from this increased loop mobility, the antiparallel basket is as stable as free hts was in simulations a, b, and c, so unsurprisingly the rmsds between the representative conformations of -1-hts and simulations a, b, and c are within the variability found for the calculated cross rmsds obtained in these three simulations (see supporting information table s03). variation of the rmsd values throughout the course of the md simulations for -1-hts (left) and -1-hts (right). the vertical black line marks the separation between the equilibration and collection simulation stages. by contrast, for -1-hts, all the rmsd values converge very quickly, including those associated with the diagonal loop. this indicates that complex -1 is able to fit under the loop without causing major g - dna conformational changes. indeed, the representative conformation is comparable to the representative conformation of the -1-hts simulation (with a rmsd value of only 1.55) and the representative frames of the free hts simulationsm a, b, and c, with cross rmsd values ranging from 1.54 to 2.81. this indicates that the observed experimental recognition of only -1 under the diagonal loop is not caused by the intrinsic loop cavity shape or size because both isomers are able to fit into the cavity. analyzing the representative conformations of -1-hts and -1-hts represented in figure 9, both ruthenium complexes bind under the diagonal loop with the tpphz ligand stacking over the top g - tetrad. complex -1 adopts a diagonal arrangement over the guanine bases and under the loop whereas in -1, the stacking of the tpphz ligand is more localized over two guanines of only one - half of the g - tetrad. representative snapshots of simulations -1-hts (top, magenta) and -1-hts (bottom, aquamarine). side and top views are presented on the left and center, respectively. to clarify this point, a surface representation was constructed for the position occupied by the tpphz ligand (excluding the hydrogen atoms) over a 50 ns collection period for the hts association with each of the diastereomers (figure 10). these surfaces clearly show a striking difference: in -1-hts, the tpphz ligand is able to float over the g - tetrad interacting with the four guanines. in contrast, in -1-hts, the tpphz ligand remains locked over two guanines of the g - tetrad throughout the entire simulation time. because tpphz is present in both dinuclear complexes, the difference in dynamic behavior must be caused by the stereochemistry of the bipy ligands in the octahedral ru(ii) coordination spheres. this is consistent with the observation that in -1-hts the diagonal loop appears to be more flexible, oscillating over the middle of both ru(bipy)2 moieties. on the other hand, in -1-hts, the loop is more rigid and locks the -1 complex movement over the g - tetrad. surface (isovalue = 1) representing the histogram of positions occupied by the tpphz atoms (excluding hydrogen) over the 50 ns collection period in -1-hts (left) and -1-hts (right). the above suggest that, although both -1 and -1 complexes can fit under the loop, sufficient hts loop conformational freedom to permit the complex entrance into the prefolded g - dna structure is only present for -1. in contrast, the stereochemistry of -1 appears to induce increased rigidity on the loop, preventing complex entrance into the loop arch. in other words, -1 does not bind under the diagonal loop because the loop arch does not fulfill the complex s stereochemical requirements. as mentioned above, the simulated annealing structure proposed for the binding of -1 to the diagonal loop end of hts corresponds to an impossible solution (figure 7), which could also be rationalized by our unconstrained md simulations in water. if one calculates the expected noes (not shown) from the representative conformations of simulations -1-hts and -1-hts (or from the relaxed structures obtained by molecular mechanics minimization), the protons that contact the ligand are quite different, meaning that the interaction of -1 and -1 under the loop in clearly distinct noes. -1-hts interaction ) are not suitable as restraints to generate a hypothetical -1-hts association with this binding mode. we have shown that -2 binds mainly at the diagonal loop end of hts, stabilized by a good steric fit under the loop. by contrast, both isomers also bind to b - dna, but the affinity of -2 is greater for hts than for b - dna and, importantly, when bound to hts the luminescence is more intense and is blue - shifted from 675 to 630 nm. studies with other ligands that bind to quadruplex dna have shown that compounds that bind strongly to one conformation also stabilize that conformation, as expected from thermodynamic arguments. we have previously shown that 2 is actively taken up by cells, and confocal images show that it generates punctate images centered mainly in the heterochromatin, as might be expected for a probe that highlights g - quadruplexes. it also has a wavelength and intensity of emission that is different for different quadruplex structures. -2 is therefore a useful tool for specifically stabilizing and imaging antiparallel basket structures with a diagonal loop. this study also confirms that the antiparallel structure of hts can be selectively targeted. in comparison with the use of antibodies to detect quadruplexes, small molecules like complex 2 and its analogues are much simpler to rationally design and potentially have wider applicability as they can be used directly on living cells. furthermore, and as this study indicates, because such systems can be made to target specific features of a quadruplex, they can be made specific to individual quadruplex structures. consequently, with the structural information obtained by this study, we are exploring this potential for enhanced specificity through informed design of derivatives of 2. although this work is intended to image antiparallel basket quadruplexes in living cells, it could subsequently be extended into molecular tools for selectively stabilizing quadruplexes. the racemic mixtures of the tpphz complexes were prepared by methods we have previously described. the hts oligonucleotide d was purchased from eurogentec biotechnology (southampton, uk), purified by hplc, and used without further annealing. samples for uv vis and luminescence titrations were in 10 mm kh2po4/k2hpo4 and 1 mm k2edta in 50200 mm kcl (ph 7.0, 298 k), in which dna was added to 10 m ligand, while samples for nmr were prepared in 50 mm nacl, ph 7, using 300 mm dna at 298 k. titrations were conducted with dna and ligand of the same order of concentration as 1/kb, shown to be the optimum values for obtaining accurate binding constants. the optimum temperature for observing noes to 1 was 283 k. cd spectra were recorded on a jasco j-810 spectrophotometer using a peltier variable temperature controller: 100 nm / min from 200 to 320 nm. luminescence measurements were carried out on a hitachi f-4500 fluorescence spectrophotometer using a 1 cm path length. binding affinities were obtained by fitting using origin 7.0 software to a standard one - set - of - binding - sites model. nmr experiments were carried out on bruker avance 800, 600, and 500 spectrometers. assignments were made using cosy, tocsy, and noesy spectra (mixing times 60 or 90 ms for tocsy, 100 ms for noesy), supported by h spectra were analyzed using felix (felix nmr, inc ., san diego, ca). calculations used simulated annealing over 8000 steps from 2000 to 100 k, using standard square - well potentials for noes. all calculations imposed planarity and hydrogen bonding in the tetrads plus planarity in tpphz and bipy polypyridyl ligands and octahedral geometry around the ruthenium. threading of the ligand into the complex was accomplished by starting with almost zero van der waals radii and increasing the radius in a geometric progression during the simulated annealing. for each complex, only the intermolecular noes relevant to that end were included, all specified as ambiguous noes to any ligand proton, with an upper limit of 5. convergence was improved by including restraints to position the tpphz ring close to the relevant tetrad plane. noes for the -1-hts and -1-hts complexes were calculated by numerical integration of the solomon equations. unconstrained md simulations were carried out using the amber ff99bsc0 set of parameters and charges for dna combined with general amber force field (gaff) parameters with extra terms and resp charges for both -1 and -1 complexes. these simulations were undertaken with the pmemd.cuda amber executable, able to accelerate explicit solvent particle mesh ewald (pme) calculations through the use of gpus with the new single precision fixed point (spfp) model.

we report dna binding studies of the dinuclear ruthenium ligand 4 + in enantiomerically pure forms. as expected from previous studies of related complexes, both isomers bind with similar affinity to b - dna and have enhanced luminescence. however, when tested against the g - quadruplex from human telomeres (which we show to form an antiparallel basket structure with a diagonal loop across one end), the isomer binds approximately 40 times more tightly than the , with a stronger luminescence. nmr studies show that the complex binds at both ends of the quadruplex. modeling studies, based on experimentally derived restraints obtained for the closely related 4 +, show that the isomer fits neatly under the diagonal loop, whereas the isomer is unable to bind here and binds at the lateral loop end. molecular dynamics simulations show that the isomer is prevented from binding under the diagonal loop by the rigidity of the loop. we thus present a novel enantioselective binding substrate for antiparallel basket g - quadruplexes, with features that make it a useful tool for quadruplex studies.

microglia are a type of neuroglia that support, nurture, and protect neurons which maintain homeostasis of the fluid that bathes neurons. it is an innate immune component of the central nervous system (cns) parenchyma. under physiological conditions, residential microglia are quiescent and scattered throughout the cns. occasionally, microglia are moderately activated to play the classic role as scavengers for maintaining and restoring the cns. activated microglia release proinflammatory cytokines such as interleukin-1 (il-1) and tumor necrosis factor- (tnf-) to induce inflammatory responses. furthermore, they also release neurotoxins like reactive oxygen species (ros) and nitric oxide (no), which amplify the inflammatory responses and cause neuronal damage in the cns. sustained overactivation of microglia is found in many neurodegenerative diseases such as multiple sclerosis, alzheimer's disease, parkinson's disease, hiv - associated dementia, and ischemia / reperfusion brain injury. endotoxins are high - molecular - weight complexes of lipopolysaccharide (lps) that are major components of the outer membranes of the cell walls of gram - negative bacteria. the most severe septic microvascular inflammatory responses, however, are caused by gram - negative bacteriemia, and these responses can be produced by an injection of lps. endothelial injury, activation of the coagulation cascade, platelet aggregation, and thrombocytopenia have all been shown to contribute to vascular fibrin deposition in lps - induced septic shock. lps is known to induce no and tnf- production in microglia through various extracellular signal - regulated kinase (erk), p38 mitogen - activated protein kinase (p38 mapk), and c - jun n - terminal kinase (jnk) pathways. ketamine, an anesthetic induction agent, is generally reserved for use in patients with severe hypotension or respiratory depression. as we described previously, ketamine (200 and 350 m) significantly inhibited platelet activation stimulated by collagen. on the other hand, ketamine has been reported to exert anti - inflammatory effects on macrophages and leucocytes in in vitro and in vivo studies. also reported that ketamine (300 ~ 1000 m) significantly inhibited some of the inflammatory responses in microglial cells stimulated by lps. however, the detailed mechanisms underlying the anti - inflammatory effects of ketamine in microglia stimulated by lps still have not been completely resolved yet. we therefore further examined the effect of ketamine in lps - induced microglial activation in primary cultures from rats and utilized the findings to further characterize the anti - inflammatory effects of ketamine. ketamine, lps (escherichia coli, serotype 0127 : b8), and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl - tetrazolium bromide (mtt) were purchased from sigma (st . louis, mo, usa); rpmi-1640 medium, fetal bovine serum (fbs), trypsin (0.25%), l - glutamine, and penicillin / streptomycin were from gibcobrl (gaithersburg, md, usa); deoxyribonuclease type i (dnase i) was from roche (indianapolis, ind, usa); anti - erk1/2, anti - phospho - erk1/2 (thr / tyr), anti - jnk1/2, anti - p38 mapk, and anti - phospho - jnk1/2 (thr / tyr) monoclonal antibodies (mabs) were from cell signaling (beverly, mass, usa); the anti - phospho - p38 mapk (ser) mab was from santa cruz (santa cruz, calif, usa); the horseradish peroxidase - conjugated secondary antibody was from amersham (buckinghamshire, uk); and the il-1 and tnf- enzyme immunoassay (eia) kits were from r&d systems (minneapolis, minn, usa). wistar rats (7 days old ; from the experimental animal center, college of medic ine, national taiwan university) were used in this study. all animal experiments and care were performed according to the guide for the care and use of laboratory animals (national academy press, washington, dc, 1996). wistar rats were deeply anesthetized with ether and transcardially perfused with normal saline until the lungs and liver were clear of blood. after perfusion, the brain was removed and kept in rpmi-1640 medium. after dissecting the meninges, the brain tissue was minced in ice - cold rpmi-1640 and treated with trypsin (0.25%) and deoxyribonuclease (10 mg ml) in rpmi-1640 for 2 hours at 37c. treated tissues were further minced in 10% fbs and centrifuged at 1000 rpm for 10 minutes. the tissue pellet was resuspended in rpmi-1640 and then seeded in 75 cm flasks at 37c (95% o2 and 5% co2). microglia were harvested from flasks of mixed glial cultures after shaking for 2 hours. cells were collected by centrifugation and then seeded at 5 10 cells ml. after incubation for 1 hour at 37c, nonadherent or weakly adherent cells were removed by gentle shaking and washed out. approximately 2 10 cells were obtained per brain used. to determine the purity of the microglia, these primary cultured cells were > 95% ox-42-positive indicating that they were composed of microglia. microglial viability after 24 hours of continuous exposure to different concentrations of lps (1 ~ 200 ng ml) and ketamine (100 ~ 500 m) was measured with a colorimetric assay based on the ability of mitochondria in viable cells to reduce the mtt as previously described. the percentage of cell viability was calculated as the absorbance of treated cells / control cells 100%. to determine no production from microglia, nitrite (a stable oxidative end product of no) accumulation in the media of microglia briefly, 100 l of supernatant was incubated with an equal volume of griess reagent (1% sulfanilamide and 0.1% naphthyl - ethylenediamine dihydrocholoride in 2.5% phosphoric acid). after a 30-minute incubation at room temperature, nitrite concentrations were calculated by regression with standard solutions of sodium nitrite prepared in the same culture medium. for determination of il-1 and tnf- production from microglia , microglia (5 10 cells ml) were plated onto 24-well culture plates for 24 hours. cells were pretreated with various concentrations of ketamine (100 ~ 500 m) or an isovolumetric pbs buffer for 30 minutes and then treated with lps (100 ng ml) for the indicated times (1 ~ 24 hours). after incubation with lps, supernatants were collected and immediately frozen at 70c. the il-1 and tnf- levels of the supernatants were measured using elisa kits according to the manufacturer's protocol. for determination of the expression of mapks in microglia, microglia (5 10 cells ml) were cultured on 24-well plates and treated with ketamine (100 and 250 m) or an isovolumetric pbs buffer for 30 minutes followed by the addition of lps (100 ng ml). at indicated times, cells were washed with ice - cold pbs buffer (ph 7.3). in addition, phosphatase inhibitors (10 mm sodium fluoride, 1 mm sodium orthovanadate, and 10 mm sodium pyrophosphate) were added to the lysis buffer for the phosphorylated mapk analysis. lysates were centrifuged, and the supernatant (50 g protein) was subjected to sds - page and electrophoretically transferred onto pvdf membranes (0.45 mm ; hybond - p ; amersham). after incubation in blocking buffer (50 mm tris - hcl, 100 mm nacl, 0.1% tween 20, and 5% dry skim milk ; ph 7.5) overnight at 48 hours and being washed three times with pbs buffer, blots were treated with either anti - phospho - erk1/2 (p42/44), anti - erk1/2, anti - phospho - jnk1/2 (p46/54), anti - jnk1/2, anti - p38 mapk, or anti - phospho - p38 mapk mabs (1:2000) in a pbs buffer for 3 hours. they were subsequently washed three times with pbs buffer and incubated with a peroxidase - conjugated goat anti - mouse or anti - rabbit antibody (1:3000) for 2 hours. blots were then washed three times, and the band with peroxidase activity was detected using film exposure with enhanced chemiluminescence detection reagents (ecl system ; amersham). densitometric analysis of specific bands was performed using a photo - print digital imaging system (ip-008-sd) with analytic software (bio-1dlight, vers . the experimental are expressed as the means s.e.m . and are accompanied by the number of observations . if a significant difference among the group means was noted, the difference between two groups would be assessed using the newman - keuls method . a p value of < .05 was considered statistically significant . according to a preliminary test, activation of microglia by lps ( 100 ng ml) induced a significant and marked increase in nitrite formation. therefore, an lps concentration of 100 ng ml was employed in the following experiments. in this study, the concentration of nitrite produced in the cell supernatant time - dependently increased from 0.5 0.0 (resting) to 6.7 0.3 m at 24 hours after lps treatment (figure 1). ketamine (100 and 250 m) concentration - dependently inhibited lps-(100 ng ml) stimulated nitrite production by approximately 40% and 60%, respectively, (figure 1). ketamine neither interfered with the griess reaction nor reacted with native no (data not shown). these demonstrate that ketamine markedly suppressed no production stimulated by lps in microglia. furthermore, neither ketamine (100 ~ 500 m) (figure 2) nor lps (100 ng ml) (data not shown) significantly affected the cell viability of microglia for 24 hours according to the mtt assay. lps (100 ng ml) induced a time - dependent increase in il-1 formation in microglia, and it reached a maximal level at 12 hours rising from 135.9 6.5 (resting) to 575.9 10.6 pg ml (figure 3). on the other hand, after pretreatment of cells with various concentrations of ketamine for 30 minutes followed by the addition of lps (100 ng ml) for 12 hours, we found that ketamine (100 and 250 m) concentration - dependently inhibited il-1 production by approximately 13% and 36%, respectively, (figure 3). on the other hand, activation of microglia by lps (100 ng ml) induced a significant increase in tnf- formation. the peak activation of tnf- formation occurred 3 hours after lps (100 ng ml) stimulation (resting, 1042.2 8.8 pg ml ; 3 hours, 1992.8 38.2 pg ml, n = 3) (figure 4). after pretreating cells with various concentrations of ketamine for 30 minutes followed by the addition of lps (100 ng ml) for 3 hours, only ketamine at the higher concentration (500 m) significantly inhibited tnf- production by approximately 11% (figure 4). to further investigate the inhibitory mechanisms of ketamine in lps - induced microglial activation, three major mapk signaling molecules were detected: erk1/2, jnk1/2, and p38 mapk. the immunoblot analysis revealed that treatment with lps (100 ng ml) induced rapid and marked time - dependent phosphorylation of erk1/2 (p42/p44), jnk1/2 (p46/p54), and p38 mapk, which reached maximal levels at approximately 45 minutes and then returned to the basal level (data not shown). after being pretreated with ketamine (100 and 250 m) for 30 minutes, phosphorylated erk1/2 stimulated by lps (100 ng ml) was markedly inhibited by ketamine in a concentration - dependent manner (figure 5). however, neither jnk1/2 (figure 6) nor p38 mapk (figure 7) phosphorylation stimulated by lps was significantly inhibited by ketamine (100 and 250 m). in this study, we demonstrate an anti - inflammatory effect of ketamine in primary cultured microglia. ketamine exhibited more potent activity at inhibiting both no and il-1 formation than tnf- in lps - stimulated microglia. this discrepancy, however, needs to be further investigated. the high concentration (500 m) of ketamine caused no significant changes in the number of viable cells estimated by the mtt reduction assay (figure 2). this finding excluded the possibility that the release of the inflammatory mediators was inhibited by the cytotoxic actions of ketamine. it is known that microglia play a key role in mediating inflammatory processes in the cns, which are associated with various neurodegenerative diseases. lps, a glycolipid derived from the membrane surface of gram - negative bacteria (i.e., an endotoxin), can trigger a series of inflammatory reactions in phagocytes such as microglia. with lps stimulation, microglia are activated to drastically change their cellular functions, producing various types of inflammatory mediators such as no, tnf-, and il-1. no and tnf- are two major inflammatory mediators. no is beneficial as a messenger or modulator, but in conditions such as oxidative stress, it is potentially toxic. no generation by activated microglia has been shown to cause excitotoxicity through inducing glutamate release and inhibiting neuronal respiration. tnf- and il-1 released from activated microglia also stimulate no production in glial cells and may have a direct effect on neurons through activating receptors that contain the death domains involved in apoptosis. in general, total plasma levels of ketamine are reported to be in the range of 33 ~ 94 m immediately after 2.0 ~ 2.2 mg kg i.v. therefore, we considered 100 m to be a higher clinically relevant concentration achievable during induction of ketamine anesthesia, assuming that protein binding is comparable in serum - supplemented media and plasma. our studies suggest that ketamine may modulate some of the inflammatory responses (i.e., no and il-1) of microglia stimulated by lps in vitro at the high range of clinically achievable concentrations. an adequate inflammatory reaction from the equilibrium between proinflammatory and anti - inflammatory influences. the survival rate in intensive care unit of patients with septic shock was improved when they received ketamine as a sedative. mapks play important roles in mediating cytokine (i.e., tnf- and il-1) release with lps - stimulated microglial activation. we thus further investigated the roles of mapks involved in ketamine - mediated suppression of inflammatory responses in lps - stimulated microglia. mapks are a family of serine - threonine kinases activated by many stimuli including growth factors and hormones in proliferative cells. mapks are able to regulate a number of transcription factors, cytoplasmic proteins, and downstream kinases. p38 mapk and jnk1/2 or stress - activated protein kinases, which include the 46-kda jnk1 and 54-kda jnk2 isoforms, are involved in death signaling processes. in the present study , we found that ketamine inhibited erk1/2 but not jnk1/2 or p38 mapk phosphorylation in lps - stimulated microglia. have reported that ketamine could abolish hyperglycemia - activated erk1/2 phosphorylation through inhibition of the n - methyl d - aspartate - mediated calcium influx, which subsequently reduces the hyperglycemia - exaggerated damage. in , although ketamine has been shown to exert anti - inflammatory effects on a variety of immune cells, the exact mechanisms responsible for these actions are not well understood. our suggest that ketamine's anti - inflammatory activity may be mediated, at least in part, by inhibition of erk1/2 phosphorylation in primary cultured microglia. however, more detailed anti - inflammatory mechanisms of ketamine in microglia need to be further investigated and classified.

microglia activated in response to brain injury release neurotoxic factors including nitric oxide (no) and proinflammatory cytokines such as tumor necrosis factor- (tnf-) and interleukin-1 (il-1). ketamine, an anesthetic induction agent, is generally reserved for use in patients with severe hypotension or respiratory depression. in this study , we found that ketamine (100 and 250 m) concentration - dependently inhibited lipopolysaccharide (lps)-induced no and il-1 release in primary cultured microglia. however, ketamine (100 and 250 m) did not significantly inhibit the lps - induced tnf- production in microglia, except at the higher concentration (500 m). further study of the molecular mechanisms revealed that ketamine markedly inhibited extracellular signal - regulated kinase (erk1/2) phosphorylation but not c - jun n - terminal kinase or p38 mitogen - activated protein kinase stimulated by lps in microglia. these suggest that microglial inactivation by ketamine is at least partially due to inhibition of erk1/2 phosphorylation.

cancer is a multifactorial disease and is one of the leading causes of death worldwide. the contributing factors include specific genetic , long - term exposure to various environmental stresses, and bias diet habit. all these risk factors finally reflect on the accumulation of molecular changes in cells, which contributes to the initiation of carcinogenesis. since some important mutated proteins, such as epithelial growth factor receptor (egfr), p53, and c - myc, have been recognized as important contributors for carcinogenesis, they have been increasingly taken as major targets for drug development in order to eliminate mutated cancer cells. although this common strategy can usually achieve significant effect initially, drug resistance usually comes along with relapsing disease sooner or later. this implies some missing links between the actual underlying carcinogenic mechanisms and current drug development strategies. recently, tumor microenvironment has been gradually recognized as a key contributor for cancer progression and drug resistance (figure 1). this concept implies that cancer is no longer an isolated cellular population; instead, it is the consequence of collaboration of different types of malcontrolled cells. in fact, as early as 1880s, steven paget proposed the seed and soil hypothesis, suggesting that a fertile soil (the microenvironment) is essential for the seed (the tumor cells) to grow. in this review, as the microenvironment is quite complicated, we would like to focus on the role of dysregulated immune responses and interactions between various components in the microenvironment in tumor progression, invasiveness, and even development of drug resistance. in addition, this review also discusses the current preclinical testing models and highlights their unsatisfying design, suggesting the need for some new strategies in future anticancer drug development. a large number of clinical survey have showed that chronic inflammation is an important risk factor for tumor formation. these findings that directly support immune mechanisms indeed, chronic overexpression of inflammatory mediators is a major characteristic of tumor microenvironment and may contribute to carcinogenesis, tumor progression, and metastasis. two types of pathways, intrinsic pathways and extrinsic pathways, lead to the formation of inflammatory microenvironment. intrinsically, genetic alterations within the neoplastic cells increase their production of inflammatory mediators. extrinsically, tumor - infiltrating cells, mainly immune cells like t cells, natural killer (nk) cells, macrophages, and dendritic cells, produce inflammatory mediators to form a microenvironment promoting cancer development and progression. although both anticancer innate and adaptive immune responses are primitively designed for recognizing abnormal cells and further cleaning up, they usually turn into anergy state at the site of chronic inflammation. the anergy state mainly from two major causes the gathering of immune regulatory / suppressor cells and accumulation of high concentration of immune inhibitory cytokines or associated ingredients. finding the existence of immune suppressor / regulatory cells is undoubtedly a great breakthrough in autoimmune and cancer research field. the most well - known immunosuppressor of lymphoid origin is regulatory / suppressor t cells (tregs), which coexpress surface markers such as cd4 and interleukin-2 receptor chain (il-2r, also known as cd25), as well as a particular intracellular protein called forkhead box p3 (foxp3). tregs are usually found around tumor mass in clinical specimens and may suppress the antitumor immune responses. albeit the control mechanism is still unclear, the expression of self - peptide recognized t - cell receptor (tcr) and cytotoxic t lymphocyte - associated antigen-4 (ctla-4, a costimulatory receptor) may play important roles. tregs can also secrete immune inhibitory cytokines, such as il-10 and tgf-, which can transform dendritic cells to a suppressive type and downregulate the activity of effector t cells, nk cells, and nkt cells. although m2 macrophage derives from monocytes and carries cd68 marker as m1 macrophage does, it can be discriminated from the m1 type by its cytokine profile and particular cell surface markers. m1 macrophage expresses ccr7, while m2 macrophage expresses cd163 in dominant m2c subtype or cd206 in m2a subtype. in general , m1 macrophage can produce a series of proinflammatory cytokines such as il-6, il-12, and tnf-, while m2 macrophage tends to produce immune inhibitory cytokine such as il-10 and tgf-. the other group of myeloid - origin suppressor cells is a diverse population named myeloid - derived suppressor cells (mdscs), which includes granulocytes, monocytes / macrophages, and dendritic cells, depending on the types and stages of the tumor that these immune cells infiltrated. mdscs present as an incompletely mature phenotype and thus may carry cd11b or cd33 markers as precursors of myeloid lineage cells do; they lack cd14 or hla markers which are mainly expressed in mature myeloid lineage cells. these cells can interfere with both innate and adaptive anticancer immunity, mainly through secreting il-10 and downregulating il-12 to promote th2 dominant immune environment. in addition, mdscs can enhance m2 macrophage formation by cell - cell contact interaction. moreover, mdscs suppress the function of t lymphocytes, not only through expressing arginase-1 to degrade l - arginine, which decreases the expression of cd3zeta chain and cell cycle regulator in t lymphocytes, but also through producing no, which inhibits expression of jak3, stat5, and mhc class ii and induces t - cell apoptosis. based on the knowledge that the recruitment and differentiation of immune suppressor cells should be tightly regulated by cytokine or corresponsive mediators, the source of these regulatory signals ought to be questioned. the immunosuppressive nature of tumor microenvironment may be primarily attributed to the ineffective priming of the immune system against tumor - associated antigen by immunogenic signal from the tumor itself, whereas all kinds of immune cells infiltrating the tumor may participate in the process. in addition to the cancer cells and immune cells, the surrounding stromal cells can also produce regulatory cytokines and mediators to participate in immune regulation. in recent years, many evidences show that the crosstalk between tumor cells and the tumor - infiltrating cells also contributes to these processes. for example, monocyte chemoattractant proteins, such as chemokine (c - c motif) ligand 2 (ccl2), secreted by many tumors mediate immunoinhibitory effects and facilitate tumor metastasis; blocking ccl2-ccr2 signalling by monoclonal antibodies has been shown to augment cd8 + t - cell - mediated responses elicited by immunotherapy and to inhibit metastatic seeding. ccl28 derived from tumor cells has also been shown to promote the recruitment of tregs and thereby promote tolerance of tumor and angiogenesis. ccl18 from tumor - associated macrophages has also been shown to promote cancer invasion and metastasis. in the case of non - small cell lung cancer (nsclc), it has been evidenced that the neoplasm and vicinal cells can release tgf- or cyclooxygenase-2 (cox-2) for recruiting tregs to tumor region. some inflammatory cytokines are consequent on long - term interplay of immune and cancer cells, such as prostaglandins, il-1, il-6, and il-13, which can trigger the expansion and activation of mdscs. in some cases , cancer cells can express or secrete human leukocyte antigen g (hla - g), through which they inhibit the immune surveillance function of nk or nkt cells. furthermore, our previous studies have demonstrated that lung cancer may secrete some mediators causing anergy of tumor - associated dendritic cells (tadcs) and promoting their secretion of some factors which in turn enhance cancer progression. by transplanting llc adenocarcinoma cells via tail vein injection to the mice with same genetic (c57bl/6 mice) to mimic the original lung tumor environment , we found that lung cancer cells could secrete galectin-1 to affect the differentiation of monocyte into tolerogenic dendritic cells with increased production of il-10. the carcinogenic mutation of cells and dysregulated immune responses are just preludes for cancer progression and invasion. as suggested by the seed and soil concept, since mutated cells are the foundation for the malignant disease, the tumor microenvironment may be quite important in fostering the tumor cells and may substantially assist them to acquire advanced invasion ability. therefore, when abundant evidence showed that the epithelial - mesenchymal transition (emt) phenomenon usually intimately correlate with chronic inflammatory situation, it is believed that certain favorable mediators which can facilitate cancer cells to evolve to much invasive type must exist in the inflammatory microenvironment around tumor mass. indeed, increasing evidences demonstrate that a variety of inflammatory mediators from cancer and tumor - infiltrating cells, such as il-1, il-6, and il-8, facilitate the development of tumor microenvironment in favor of tumor cell proliferation, motility, invasion, and emt and therefore increase their metastatic ability. emt is a specific process by which cells with highly polarized epithelial characteristics acquire the mesenchymal trait, which is widely believed to make the cells much movable and therefore play an important role in cancer invasion and metastasis. in the cellular and molecular level, some important changes take place during emt, including increased transcriptional repressors of e - cadherin (including snail, slug, twist, and zeb-1), e - cadherin degradation, and replacement of epithelial proteins (such as cytokeratins, apical actin - binding transmembrane protein-1, and zonula occludens-1) with mesenchymal proteins (such as vimentin and type 1 collagen). coincidentally, these molecular mechanisms are highly permissive in the chronic inflammation environment. the infiltrated immune cells can produce series of emt - favorable cytokines, such as tgf-, tnf-, and il-1. the key regulatory role of tgf- for emt has been recognized in various models. it has been noticed that tgf- induces emt in alveolar epithelial cells, making them transformed to fibroblasts / myofibroblasts. besides, tgf- signaling elicits expression of high mobility group a2 (hmga2) via smad transducers, which then upregulates the production of snail, slug, and twist and contributes to emt. tnf- alone may also mediate emt through promoting e - cadherin degradation, mainly via strengthening snail stability in an nf-b - dependent manner. il-1 and tgf- can induce cox-2 expression, which increased prostaglandin e2 (pge2) level, and subsequently induce emt through the downregulation of e - cadherin via the enhanced expression of transcriptional repressors, snail and zeb1. our recent studies found that lung cancer cells secret galectin-1, which promotes its migration, invasion, and emt. on the other hand, our previous studies found that galectin-1 secreted by lung cancer cells may promote differentiation of monocyte to specific tadcs, which can secrete amphiregulin to enhance cancer cell proliferation, emt, and therefore invasiveness. in addition to the interactions between cancer cells and immune cells, we have also investigated the interactions between lung cancer cells and bone. we have demonstrated that lung cancer cells can not only secrete il-8 to promote osteoclastogenesis but also trigger osteoblast to secrete bone morphogenetic protein-2 (bmp-2), which in turn promotes lung cancer migration, invasion, and emt. in addition to emt, a well - established tumor can also cooperate with adjacent stromal cells to build up highly specialized surrounding, such as vessel - rich or migration - favorable environment, facilitating further spreading out. after being influenced by abnormal paracrine signals from the tumor, the carcinoma - associated fibroblasts (cafs) are gradually formed from the normal stromal cells through the process called stromatogenesis. cafs are the main source of host - derived vegf and may therefore contribute to angiogenesis. cafs also secrete hepatocyte growth factor (hgf), which not only activate emt - related c - met pathway but also give lung cancer cells resistance to conventional epidermal growth factor tyrosine kinase inhibitors. the increased oxygen demand from uncontrolled - growing cancer and infiltrating immune cells brings about a hypoxic environment, which upregulates signal pathway dominated by hypoxia - inducible factor 1 (hif-1). the hif-1 subunit, which is normally controlled by ubiquitin - mediated degradation in normoxic condition, is stabilized in hypoxic condition and further binds to hif-1 chain to construct a functional heterodimer. binding of this heterodimer to hypoxia - response elements (hres) turns on the transcription of downstream genes involved in the regulation of cell survival, proliferation, extracellular matrix remodeling, angiogenesis, and invasiveness and may therefore contribute to cancer progression. for example, hif-1-mediated lipoxygenase pathway regulates the migration and invasion of epithelial ovarian cancer cells in hypoxic condition and promotes cancer metastasis. activation of slug by hif-1 increased the expression of membrane - type 4 matrix metalloproteinase (mt4-mmp, also known as mmp-17) in human cancer cells, which promotes in vitro invasiveness of the cells and in vivo colonization and growth of the cells in the lungs, via an emt - independent mechanism. hypoxia or overexpression of hif-1 reduces e - cadherin expression and increases cell migration, invasion, and metastasis in a twist - dependent manner, as shown in a study using non - small cell lung cancer, human hypopharyngeal carcinoma, tongue cancer, breast cancer cell lines, and clinical specimens from head and neck squamous cell carcinoma patients. the pleiotropic nature of cytokines in the microenvironment contributes to promoting cancer cell proliferation, bypassing apoptosis, inducing emt of cancer cells, enhancing chemokines to recruit immune suppressor cells aggregating around the tumor, and even driving the development of drug resistance. consequently, multiple beneficial elements for tumor invasion and metastasis accumulate over time in the tumor microenvironment, which make cancer therapy much more challenging. many anticancer drugs have been developed for targeting the crucial signal molecules which are usually overactivated in cancerous tissue. after immune suppressive mechanism has been gradually revealed, the attempt of using drug for manipulating immune response, in terms of immunotherapy, is already on the way. however, the attempt for developing cancer - curing medications is usually frustrating because the occurrence of drug resistance seems inevitable. the concept of tumor microenvironment can provide a sort of understandable reasons for explaining how cancer finally turns the effective drug into a failure. the underpinning mechanisms are so - called de novo mechanisms, which point out that the dynamic changes of the tumor surrounding can either give the cancer cell new immortal signal or fundamentally alter some default signal pathways and thus cancer cells finally can bypass the influence caused by the original drug. a new signal input which strengthens cancer cells can be given via soluble factors or physical cell - cell contact in specific tumor microenvironment. il-6 can be exemplified as a soluble factor which deeply influence the treatment outcome in multiple myeloma models. the high concentration of il-6 usually exists in the bone marrow microenvironment to where the malignant b cells home. il-6 transmits major survival signals through various pathways, including pi3k / akt, ras / raf / mek - erk1/2, jak / stat3, shp2/raftk, and src - family tyrosine kinase pathways, and each of these pathways may give the cancer cell alternative surviving reliance other than original intrinsic mutation. as for the survival signal given by the direct cell contact, the malignant immune cells also acquire survival - related signal when their surface integrin binds to certain extracellular matrix in bone marrow sanctuary, such as fibronectin, vitronectin, laminin, and collagens, and further activates downstream associated factors. this signal cascade finally modulates cytoskeleton remodeling, which then regulates cell proliferation, differentiation, and the motile ability. as shown by these examples, de novo mechanisms provide the rational explanation that initially functional drug may lose their targeting function after cancer cells gain more versatile survival ability after being fostered by proper microenvironment. in addition to the myeloma model, the drug resistance driven by de novo mechanisms has been demonstrated in solid tumor models as well. some studies have even shown that cancer cells contacting specific extracellular matrix are able to turn chemotherapy into a proliferation - promoting signal, which contributes to drug resistance. for example, exposure to cisplatin induces proliferation of oral carcinoma cells while these cells adhere to carcinoma matrix through the function of integrin-1, which transmits nf-b - dependent signal into the cells. the angiogenesis - triggered resistance to chemotherapy a study using human non - small cell lung cancer cell lines and clinical specimens showed that higher expression of vegf receptor-2, a vital angiogenesis - related receptor, in cancer cells was associated with the increased level of hif-1 expression and resistance to platinum - based chemotherapy. however, even though angiogenesis is the common leading cause of cancer progression, abruptly targeting the crucial contributing factor, vegf, is still risky. the tumor microenvironment can serve as a clonal selection niche or compensatory substance providing source and thus make the resistance happen. based on the assumption that tumor mass consists of multigenotypic population, the vegf - targeting therapy may just play a selection pressure for selecting adapting tumor cells. according to certain observations from human cancer studies, anti - vegf therapy usually eventually in regrowth of clonal populations with the characteristics of expressing higher compensatory factors such as vegf, fibroblast growth factor (fgf), placental growth factor (pgf), and platelet - derived growth factor (pdgf). alternatively , the other tumor population with greater invasive ability would be favored after antiangiogenic therapy application, while the mechanisms remain under exploration. in addition, while the abnormal tumor vasculature is usually stagnant and functions poorly, anti - vegf therapy reduced vessel size and tortuosity with more pericyte coverage of the remaining normalized vessels. the growth factors pericytes secrete may facilitate vascular structure stabilization and normalization, which makes the tumors more adapting. overall, the microenvironment may make the therapeutic outcome deviate from the original treatment purpose. since carcinogenesis is based on a complex individual genetic , the outer environmental stimulation, and the delicate interplay between cancer cells, surrounding stromal cells, and infiltrating immune cells, the drug applying model should be chosen with caution to ensure adequate simulation of the clinical situation. because in vitro cell culture system lacks the relevance of physiological clues for drug implementation, the investigation of curing efficacy through in vivo model is inevitable prior to the clinical application. murine model has the advantages of easy manipulation, high fecundity, and close genetic to human. thus, the usage of murine model as preclinical in vivo trial is widely accepted. mouse is a good animal model for assessing maximum tolerated dose of potential drugs (or drug toxicology). however, the mismatch between murine model and clinical cases in evaluating cancer progression activity or anticancer efficacy of drugs is usually acknowledged. this mismatch mainly comes from, as mentioned in several review literatures, the impossibility in simulating all detailed carcinogenic mechanisms in human, especially failure to create the same tumor microenvironment. even though many advanced murine models have been developed for addressing this issue, there are still much challenges waiting for breakthrough. xenografting human tumor to immune deficient mice (nude or severe combined immunodeficiency mice) has once been a keystone model for preclinical assessment of anticancer drug efficacy. the major concern comes from the implanting site of tumor, which is usually located in subcutaneous region for easy observation of the drug's growing inhibition and tumor mass shrinking effect. nonetheless, since subcutaneous region usually differs from tumor orthotropic architecture, it casts the doubt for further clinical treatment efficacy, because the drug penetrating ability or tumor evolving course may be quite different from the actual clinical situation. the previous survey about comparing the drug activity in phase i clinical trial with the corresponsive xenograft model showed that only 3.8% of drug with efficacy in xenograft murine model has positive effect in human. the poor correlation in the drug effect between murine xenograft models and human beings also proposed other flaws of the murine model. although the major purpose of clinical drug application is not only delimitating / eliminating the original tumor but also prohibiting cancer relapse / metastasis, the xenograft model almost never does well because it can not simulate the participating process of immune system and the phenomena of tumor metastasis. orthotropically implanting human tumor to corresponsive tumor site on immune deficient mice takes the advantages to mimic the architecture of tumor primitive growth environment. the similar histological features as the tumor original site also provide a more faithful microenvironment for assessing the targeting ability of the drug. by comparing the growth inhibiting effect of doxorubicin in mice implanting with human colon cancer cells ectopically or orthotopically, it is understandable that the effect can be quite different, from 80% inhibition in subcutaneous region to about 40% inhibition in orthotopic region. nonetheless, the necessity of using immune deficient mice is the major limitation for orthotopic model, as the contribution of immune cells to tumor progression is neglected. to retain the immune function, the murine cancer syngeneic model, using immune component mice inoculated with mice - originated cancer, seems to be more preferable. the highly coherent correlations between drug fighting against intraperitoneally injected p388 or l1210 cell line (both are mice leukemia cell lines) and clinical application are persuasive. subsequently, the murine subcutaneously injected b16 melanoma model and intravenously injected lewis lung carcinoma model are developed in an attempt to screen the potential drug for treating the same type of cancer in human. however, the different cell characteristics between human tumors versus mice tumors finally drive the divergence of potential drug screening . actually, certain drug compounds which work in human - mouse xenograft model have shown negative response in the murine cancer syngeneic model. taxol is one of such drugs that might be neglected if only relies on l1210 murine syngeneic test. humanized mice and gene - modified mice are much advanced model for resolving the limitations that existed in the aforementioned models. humanized mice allow the orthotropic implanting human tumor to be fostered in human - like immune condition through transplanting human stem cells or t cells from the donor of cancerous tissue to the immune deficient mice. gene - modified mice can be used in much wide application. through performing transgenic, knock - out, and knock - in technology to the mice, the mice can be modified to be more humanized via inserting human genome sequence in, or contributing to certain gene defect and representing autochthonous tumor models. all the above make the animal model more suitable for carrying out human cancer research. nonetheless, certain technique limitations of these models are still waiting to conquer. except much more capital and time investment to create these models, it is still uncertain whether the pharmaceutical efficacy in translation from mice to human can be highly improved. since the tumor microenvironment contributes to many aspects of carcinogenesis and cancer progression and therefore offers promising treatment targets, any new inputs of tumor microenvironment may become the incentive of future anticancer drug development. after further understanding the tumor microenvironment, it is undoubtedly that the concept for drug development required great revolution. although the suppressive immunity is predominant in tumor microenvironment, immunomodulation should be used carefully as an anticancer treatment modality. since the interaction between stromal and cancer cells is so essential for further tumor progression, the new signal molecules which play key roles for the crosstalk should be taken into account while seeking future treatment target. the environmental - mediated drug resistance points out that the drugs might turn into failure in a long timescale. to avoid the future resistance, the multitargeting drug or the cocktail drug application strategy may give a more favorable long - term outcome. indeed, treatments targeting cancer cells as well as key components of the tumor microenvironment, as compared to chemotherapy alone, significantly improve the clinical outcomes. to narrow down the gap between the experimental and clinical application of anticancer drugs, developing a preferable animal model seems inevitable. in , because all the new directions for drug development are based on the wide knowledge of tumor microenvironment, understanding the mechanisms modulating tumor microenvironment may facilitate the design of a novel anticancer therapy and may obtain greater success in cancer eradication.

recent advances in cancer therapy encounter a bottleneck. relapsing / recurrent disease almost always developed eventually with resistance to the initially effective drugs. tumor microenvironment has been gradually recognized as a key contributor for cancer progression, epithelial - mesenchymal transition of the cancer cells, angiogenesis, cancer metastasis, and development of drug resistance, while dysregulated immune responses and interactions between various components in the microenvironment all play important roles. future development of anticancer treatment should take tumor microenvironment into consideration. besides, we also discuss the limitations of current pre - clinical testing models that mainly come from the impossibility in simulating all detailed carcinogenic mechanisms in human, especially failure to create the same tumor microenvironment. with the cumulating knowledge about tumor microenvironment , the design of a novel anticancer therapy may be facilitated and may have better chance for success in cancer eradication.

the rate of infant hiv infection in the usa has plummeted with the advent of routine hiv testing during pregnancy and the availability of potent antiretroviral therapy. these public health advances shift focus to prevention of other comorbid conditions in hiv - infected women and their infants. herpes simplex virus type 2 infections are prevalent among women and among persons with hiv infection. in resource - limited settings with high hiv prevalence such as the central african republic, hsv-2 antibody prevalence among hiv - infected women is 91%. studies have reported an increased risk of hiv infection in infants born to hsv-2- and hiv - coinfected women or women who have clinical genital herpes during pregnancy. the risk is likely mediated by an increase in plasma and/or mucosal hiv rna during hsv reactivation and may be abrogated by antiretroviral therapy. less attention has been given to the potential for increased risk of neonatal herpes in infants of coinfected women. persons with hiv and hsv-2 have increased rates of genital hsv reactivation, and, if they have advanced immunosuppression, have a higher rate of mucosal hsv shedding. because hsv genital shedding during labor is the strongest risk factor for neonatal herpes (relative risk > 300), such hiv- and hsv-2-infected women could be at increased risk for transmitting hsv to their newborns. neonatal herpes is a devastating disease for infants with a 30% mortality rate in the case of adequately treated disseminated disease. to assess the potential for hsv transmission to the neonate among hiv - infected women, we compared rates of hsv-2 infection and genital hsv shedding among hiv - infected and hiv - negative women women with known hiv infection who delivered at the university of washington medical center (uwmc), a tertiary care referral center, between 1989 and 1996 were included in the study. additionally, women without known hiv infection delivering at uwmc between 1995 - 96 were included. all women were receiving comprehensive prenatal care at uwmc or affiliated clinics. during the study period , type - specific hsv serologies were included in routine prenatal care at our institution as part of a large, continuing study of hsv in pregnancy approved by the university of washington institutional review board. genital swabs were obtained in a subset of women expected to deliver vaginally as part of an ongoing study of infant exposure to hsv during birth. genital secretions were obtained from the labia majora and minora as well as perianal and periclitoral areas with a dacron - tipped swab. a second swab was collected from the ectocervix, endocervix, and posterior vaginal fornices during a speculum exam. hiv serologic testing was performed using a commercial enzyme - linked immunosorbent assay (genetic systems hiv-1/hiv-2 plus o eia, bio - rad, redmond, wa) with western blot confirmation for samples testing positive. genital swabs were evaluated by real - time quantitative hsv dna polymerase chain reaction (pcr) assay. the prevalence of hsv-1 and hsv-2 antibodies and the median and range of log copies of hsv shed were compared among women with and without hiv infection. categorical variables were compared using chi - square or fisher's exact test, and continuous variables were compared using the mann - whitney test. risk ratios with 95% confidence intervals (cis) were also calculated for the difference between these groups. during the study interval, 75 known hiv seropositive women had a total of 85 deliveries included in this analysis. during 1995 - 1996, there were 3099 consecutive women admitted to labor and delivery who were not known to be hiv infected, and 3051 (98%) of these women had hsv serology testing available; these were included as the comparator group. the median age was 27 (range 17, 37) for hiv - seropositive women and 29 (range 15, 49) for hiv - negative women (p = .6). among hiv - seropositive women, seronegative women, 46% were white, 34% black, and 20% were other races. nulliparous women comprised 31% of hiv - seropositive and 34% of hiv - seronegative women. among 75 hiv - seropositive women, 71.2% had antibody to hsv-2 (28.7% to hsv-2 only and 42.5% to hsv-2 and hsv-1), 21.9% to hsv-1 only, and 6.8% were hsv seronegative. in contrast, among 3051 hiv - seronegative women, the hsv-2 seroprevalence rate was 30.3% (11.1% seropositive for hsv-2 only and 19.2% seropositive for both hsv-1 and hsv-2), while 50.6% were hsv-1 seropositive only and 19.1% were hsv seronegative (p < .001 for the difference in frequency of hsv-2 antibody between hiv seropositive and hiv seronegative women). in a subset of hsv-2 seropositive women in the study, the swab of genital secretions obtained at the time of delivery was evaluated with hsv dna pcr swabs. among 26 hiv - positive, hsv-2-seropositive women who were evaluated, none had genital lesions, and all had swabs obtained for hsv from genital secretions. among 635 hiv - negative, hsv-2-seropositive women who were evaluated, 13 had lesions at delivery, and a swab for hsv was obtained from the remaining 622 for hsv detection. vaginal deliveries were common in both groups of hsv-2-infected women without lesions as 79% of hiv - positive women and 96% of hiv - negative women delivered vaginally. genital hsv was detected in 8 (30.8%) of 26 hiv-, hsv-2-infected women at the time of delivery. seven of these women were hsv-2 pcr positive only, and one was hsv-2 and hsv-1 positive by pcr swab. specifically, hsv dna was detected in all 8 vulvar swabs, and in 4 of the 8 hsv was also detected in the cervical swabs. among the 622 hiv seronegative women who had swabs taken for pcr, 59 (9.5%) women had hsv detected. of 59 women who had hsv detected, 27 were positive both at vulva and cervix, 24 only at the vulva, and 6 only at the cervix; an additional 2 women were positive at the cervix but vulvar swabs were not available. the risk of hsv detection among hiv - seropositive women was 3.2-fold higher (95% ci 1.6 to 6.5, p = .001) than among hiv - seronegative women (table 1). quantitative amount of hsv in the swabs did not differ significantly between hiv - seropositive and hiv - seronegative women with the median number of virion copies per ml of log 3.54 (range 2.85, 5.69) for hiv - positive women versus log 3.90 (range 2.17, 6.92) for hiv - negative women (p = .99, figure 1). our study showed that hsv-2- and hiv - coinfected pregnant women were more likely to shed hsv at delivery than their hiv negative counterparts. the quantitative amounts of shedding did not differ between hiv - positive and hiv - negative women, perhaps reflecting the fact that all had established hsv-2 infection. viral shedding is the strongest risk factor for transmission of hsv from the mother to the neonate at birth. while most transmissions to newborns occur from pregnant women who have recently acquired genital hsv and have not developed a detectable antibody response by the time of delivery, women with established hsv-2 infection are also at risk for transmitting hsv to their neonate, but at a much lower rate. prior studies have addressed the role of hsv-2 in increasing the risk of perinatal hiv transmission, especially in africa where hsv-2 infection affects most hiv-1-seropositive pregnant women and highly active antiretroviral therapy is not universally used during pregnancy. drake et al. showed that genital ulcers were associated with increased plasma hiv-1 rna and increased risk of intrapartum transmission of hiv and calculated that 14% of hiv-1 transmissions were attributable to maternal hsv-2 ulcers. study in zimbabwe suggested that 28% of intrapartum hiv transmissions are potentially attributed to prevalent maternal hsv-2. also concerning this cohort is the additional 17% (29 of 193) of initially hsv-2-seronegative women who subsequently seroconverted to hsv-2 in the immediate peripartum period. this suggests that a substantial number of women acquire new hsv-2 infection peripartum, an event associated with a 3050% risk of hsv transmission to the neonate. we are aware of a single - case report of hsv transmission to the neonate from an hiv - infected woman. in this case , the hsv infection was acquired at the end of pregnancy. of note, this case was observed in a resource - rich setting, underscoring that a diagnostic workup for neonatal hsv is less likely to be routinely performed in the developing world. to our knowledge, no systematic study evaluating the incidence of neonatal hsv in resource - poor areas with high hiv prevalence has been done. our study was limited by a relatively small number of hiv - positive pregnant women. in addition, we focused on women who are hsv-2 seropositive, who are at lesser risk for transmitting neonatal herpes than women who acquire genital hsv in late pregnancy. further studies of the risk of neonatal hsv among hiv - infected women should include women who are at risk for hsv acquisition in the peripartum period. additionally, while routine heel sticks on infants born to the presumed hiv - negative women during did not reveal any unrecognized hiv infections, many of these women did not have a confirmed negative hiv test, as the study was done prior to routine hiv testing in pregnancy. while suppressive therapy for hsv is recommended, and utilized, for prevention of genital lesions at labor and cesarean deliveries for women with a clinical history of genital herpes, the impact of this approach on neonatal hsv is unknown. the effect of this strategy on the high rate of hsv shedding in labor among hiv - infected, hsv-2-seropositive women has not been studied. in addition, antiviral therapy for hsv is used infrequently in resource - poor countries. suppressive therapy with acyclovir and valacyclovir has been shown to reduce plasma and genital hiv rna levels by 0.250.50 log but not to impact the risk of sexual transmission of hiv. ongoing studies will evaluate whether valacyclovir can reduce the risk of mother to child hiv transmission during late pregnancy, the intrapartum period, and breastfeeding.

objective. to compare genital hsv shedding among hiv - positive and hiv - negative women. methods. women with and without known hiv infection who delivered at the university of washington medical center between 19891996 had hsv serologies done as part of clinical care. genital swabs from hsv-2-seropositive women were evaluated by real - time quantitative hsv dna pcr. . hsv-2 seroprevalence was 71% and 30% among 75 hiv - positive and 3051 hiv - negative women, respectively, (p < .001). hsv was detected at delivery in the genital tract of 30.8% of hiv - seropositive versus 9.5% of hiv - negative women (rr = 3.2, 95% ci 1.6 to 6.5, p = .001). the number of virion copies shed per ml was similar (log 3.54 for hiv positive versus 3.90 for hiv negative, p = .99). . our study demonstrated that hiv-, hsv-2-coinfected women are more likely to shed hsv at delivery.

a four - month - old female infant presented to the emergency department of the children s hospital in winnipeg, manitoba, with full - thickness burns of the anterior lower limbs. according to the infant s mother, the burns had been sustained two weeks previously while visiting family in karachi, pakistan, when an electronic steamer used to relieve the infant s nasal congestion slipped and spilled hot water over her legs. she was taken to an emergency department in karachi, where she was treated with oral amoxicillin - clavulanate and daily dressing changes. within one week, her wounds became infected. at this time the family left pakistan without further intervention in the hope of continuing her treatment in winnipeg. on the way to winnipeg , the infant was taken to the montreal children s hospital (montreal, quebec). during her < 24 h stay, her wounds were evaluated and her antimicrobial therapy was stopped due to diarrhea. on presentation in winnipeg, the infant s temperature was 39.1c, her heart rate was 204 beats / min, her respiratory rate was 36 breaths / min, her blood pressure was 114/64 mmhg and her oxygen saturation was 99% on room air. examination of her lower limbs revealed 15% body surface area of full - thickness burns, encompassing areas of both legs and feet. she was born in canada at 40 weeks gestation via emergency caesarean section due to fetal bradycardia. initial investigations revealed a white blood cell count of 2910 cells / l (28% neutrophils and 54% lymphocytes), a hemoglobin level of 102 blood, urine, ear swabs and surveillance swabs for methicillin - resistant staphylococcus aureus (mrsa) and vancomycin - resistant enterococci were collected for culture. the patient was taken to the operating room, where her wounds were debrided, the aforementioned gangrenous toes were amputated, and swabs from the left leg and right foot were submitted to the laboratory for microbiological investigations. antimicrobial susceptibility testing was performed using the vitek2 system (biomrieux, canada), with minimum inhibitory concentrations (mics) interpreted using 2013 clinical and laboratory standards institute (clsi) breakpoints. two different strains of mrsa (isolates a and b) were isolated from the nares, as well as the ears, the left leg and the right foot. one isolate was a canadian mrsa strain type 7 (usa400) according to pulsed - field gel electrophoresis, while the other mrsa had a unique pulsed - field gel electrophoresis pattern that did not match any of the existing canadian mrsa strain types. multidrug - resistant (mdr) strains of klebsiella pneumoniae (isolate c) and pseudomonas aeruginosa (isolate d) were recovered from wounds on the left leg and right foot (table 1). the k pneumoniae isolate had a relatively elevated meropenem mic of 1 mg / l, which is at the clsi defined breakpoint for susceptibility. ciprofloxacin was added to the treatment regimen based on the susceptibility pattern of the p aeruginosa isolate (table 1, isolate d). given the broad - spectrum antibiotics and severe burns, the patient was also given fluconazole prophylaxis. on day 7 postadmission, the patient s skin grafts were noted to be necrotic in an area of previously exposed tarsal bone. purulent material adjacent to the first metatarsal bone of the right foot was submitted to the laboratory, and ultimately yielded p aeruginosa and providencia stuartii on culture (isolates e and f ; table 1). this new p aeruginosa isolate exhibited a different susceptibility pattern compared with the previously isolated p aeruginosa, and was susceptible to amikacin and tobramycin but resistant to meropenem (table 1). given the presumptively infected bone, the patient completed six weeks of combined antimicrobial therapy (vancomycin, continuous infusion meropenem, ciprofloxacin and amikacin) for osteomyelitis. she improved rapidly following the addition of amikacin and was discharged home with no further complications. the mdr k pneumoniae (isolate c) and p aeruginosa (isolate d) isolates were forwarded to the national microbiology laboratory in winnipeg, manitoba, for further evaluation. two multiplex polymerase chain reactions (pcrs), one for the detection of beta - lactamase genes (shv, tem, ctx - m, oxa-1 and cmy-2) and one for the detection of carbapenemase genes (kpc, ndm, imp, vim, ges and oxa-48) were used as previously described. the k pneumoniae isolate (isolate c) was positive for shv, tem, ctx - m, oxa-1 and oxa-48, and was considered to be an extended - spectrum beta - lactamase (esbl) producer and molecular class d oxa-48 car - bapenemase producer. the p aeruginosa isolate (isolate d) was positive for ges by pcr and sequencing confirmed that it possessed ges-13, a molecular class a carbapenemase. the carbapenemase pcr was also performed on the p stuartii isolate (isolate f) and the second isolate of p aeruginosa (isolate e); these were both negative. carbapenemases are beta - lactamase enzymes capable of hydrolyzing carbapenem antimicrobials. while some bacteria intrinsically produce a carbapenemase, p aeruginosa and many members of the family enterobacteriaceae acquire carbapenemases through mobile genetic elements such as plasmids. the global dissemination of carbapenemase - producing bacteria is of great concern because these organisms are often mdr, leaving clinicians with few therapeutic options from which to choose. ges beta - lactamases (ges-1 to ges-23 ; www.lahey.org) are a group of molecular class a enzymes with extended - spectrum properties. the presence of lys-104 has been associated with increased activity against oxyimino - beta - lactams, mainly ceftazidime and aztreonam, whereas asn-170 lends the enzyme weak car - bapenemase activity. ges-13 was first isolated in a mdr strain of p aeruginosa from a patient with a respiratory infection in athens, greece. laboratory detection of ges enzymes in p aeruginosa relies on molecular methods because a specific phenotypic test does not exist. in the case described here, the decision to investigate for possible carbapenemase production was made based on the patient s travel history. to our knowledge, oxa - type carbapenemases are molecular class d enzymes that have been primarily associated with acinetobacter baumannii. in 2001, the first case of an oxa-48-producing k pneumoniae was reported from istanbul, turkey. for several years , oxa-48 was identified only in patients hospitalized in turkey or with some link to this country. however, more recently, the plasmid - mediated oxa-48 and related variants have been detected in enterobacteriaceae from the middle east, north africa, india, europe and north america. although oxa-48 displays weak activity against carbapenems and extended - spectrum cephalosporins, isolates harbouring this enzyme often produce other esbls. identification of oxa-48-producing enterobacteriaceae in the clinical laboratory setting is challenging due to the lack of a specific phenotypic test. furthermore, these isolates may test susceptible to carbapenems, albeit with relatively elevated mics. in a recent study by potron et al, 68.6% and 69.5% of 105 oxa-48-producing enterobacteriaceae were susceptible to imipenem and meropenem, respectively, according to current clsi breakpoints. poirel et al have proposed that carbapenemase production among enterobacteriaceae be suspected for isolates with an ertapenem mic 0.5 mg / l, or an imipenem or meropenem mic molecular - based techniques (pcr) remain the gold standard for detection of oxa-48 among enterobacteriaceae. in our case, the oxa-48-producing k pneumoniae isolate was resistant to ertapenem (mic 4 mg / l) and had a relatively elevated meropenem mic of 1 mg / l (table 1). on molecular testing, this isolate was positive for shv, tem, ctx - m, oxa-1 and oxa-48 by pcr. the ctx - m enzyme was likely responsible for the extended - spectrum cephalosporin resistance demonstrated by the isolate, as has been previously reported. the present case highlights several of the challenges associated with mdr organisms. as the frequency of worldwide travel continues to increase , clinicians will need to be aware of not only local epidemiology but also global trends in antimicrobial resistance. treatment of infections caused by mdr organisms may require complicated and potentially toxic antimicrobial combinations. the regimen used in the present case ed in excellent clinical response but required a prolonged hospital stay for the medications to be effectively delivered. the extended use of an aminoglycoside was well tolerated in our pediatric patient; however, nephrotoxicity from aminoglycosides may be a greater concern in older age groups and/or patients with underlying renal impairment. evidence for the use of continuous beta - lactam infusions is limited, particularly in the pediatric population. given the k pneumoniae carbapenem mic of 1 mg / l found in our patient, combined with abnormal blood flow in a burn setting with infected bone, it was the option pursued due to concern over achieving sufficient drug levels in the targeted tissues. while the need for multiple antibiotics made drawing specific about the role of the continuous infusion difficult, the clinical success of the approach was notable. we report the first case of a ges-13 carbapenemase - producing p aeruginosa in canada, recovered from the wounds of an infant who sustained burns while travelling in pakistan. also recovered from the patient s wounds were two isolates of mrsa, an mdr isolate of p stuartii, and an oxa-48 carbapenemase and ctx - m esbl - producing k pneumoniae. this case highlights the importance of international travel as a risk factor for infection with carbapenemase - producing bacteria. the travel history here prompted testing for carbapenemase production in the p aeruginosa isolate (isolate d). without this history, it is likely that molecular testing would not have been performed and the ges-13 enzyme would have gone undetected. this case also illustrates the difficulty faced by clinical microbiology laboratories in detecting oxa-48-producing enterobacteriaceae because many of these isolates remain susceptible to imipenem and meropenem based on current clsi breakpoints.

a case of osteomyelitis in an infant following a burn injury sustained in pakistan caused by a ges-13-producing pseudomonas aeruginosa (the first reported in canada) and an oxa-48 producing klebsiella pneumoniae is described. the present case serves to highlight the importance of international travel as a risk factor for infection with carbapenemase - producing bacteria and the challenges in the laboratory detection of these organisms.

essential properties of transition - metal complexes that are intimately linked to the electronic and steric aspects of ligands in the primary coordination sphere include redox properties, light absorption, and emission. additionally, in supermolecule complexes where spatially distinct chromophores are introduced, the latter may intervene in determining photophysical properties, for example, through electron or energy transfer. concerning emission, the quantum yield and luminescence lifetime are important characteristics, which ultimately define applicability in light - emitting and sensing architectures. we and others have previously applied an approach of harnessing reversible electronic energy transfer between energetically - matched chromophore pairs exhibiting complementary kinetic behavior (see below and the supporting information, si) in order to enhance the performance of several underperforming luminescent metal complexes based on ruthenium, osmium, copper, and rhenium as luminophores and photosensitizing agents. modification of the photophysical properties of cyclometalated iridium complexes is of particular interest because of their central role in multiple applications requiring highly efficient emission such as electroluminescence, sensing, and bioimaging. equally, this would add to the rather limited number of matched chromophore pairs. in this context, here we report a straightforward structural modification of a cyclometalated iridium complex (see model complex 1), involving the judicious integration of an auxiliary matched organic chromophore, in order to obtain a much longer - lived luminescent complex, while retaining a similar emission quantum yield. this modification could, in principle, broaden the scope of functions in multicomponent artificial photoactive arrays by changing excited - state properties, including the luminescence lifetime and oxygen sensitivity. a key to success was the introduction of a non - conjugated aliphatic spacer between the pyrene group and the adjacent 2,2-bipyridine because direct attachment of the pyrene to the ancillary ligand in quenching of the excited iridium center. the auxiliary organic chromophore was anticipated to play the desired role if the newly introduced triplet level was essentially isoenergetic with the emissive triplet metal - to - ligand charge - transfer (mlct) state and exhibits slow inherent deexcitation. this would enable reversible intercomponent excited - state energy transfer, with the organic subunit acting as an energy reservoir, leading to a net luminescence lifetime increase. on the basis of luminescence data of 1, vide infra, pyrene was selected as an appropriate candidate to play the desired role (triplet energy at 2.09 ev ; phos = 11000 s); see prototype 2 in chart 1. all of the starting materials and solvents were commercially available and were used as received. solvents and acids were received from fisher except for diethyl ether (sigma - aldrich) and 2-ethoxyethanol (acros organics). silica gel (60, 0.0400.063 mm, 230400 mesh) was received from alfa aesar, 2-bromopyridine (99%) from aldrich, and tetrabutylammonium hydroxide (tbaoh30h2o) from sigma - aldrich; 1-naphthaleneboronic acid and tetrakis(triphenylphosphine)palladium were received from acros organics and 2,2,6,6-tetramethyl-3,5-heptanedione, boron trifluoride diethyl etherate, and potassium hexafluorophosphate from alfa aesar; ircl3xh2o was received from heraeus. h nmr spectra were recorded using a bruker aviii 300 spectrometer, and c nmr spectra were recorded using a bruker aviii 400 spectrometer. chemical shifts were expressed in ppm and referenced to the residual chcl3 peak (7.26 ppm for h and 77.16 ppm for c). mass spectrometry experiments were performed by means of electrospray ionization on a synapt g2-s hdms mass spectrometer (waters ltd ., manchester, u.k .) or a qstar elite mass spectrometer (applied biosystems). elemental analysis (c, h, and n) was performed on a thermo finnigan ea flash 2000 analyzer at the cesamo analytical center, university of bordeaux, talence, france. compound 3 (100 mg, 0.079 mmol) was dissolved in a ch2cl2/meoh (9:1, v / v) mixture (20 ml) and degassed by bubbling argon. 4,4-di - tert - butyl-2,2-bipyridine (85 mg, 0.316 mmol, 4 equiv) was added and the solution heated to reflux overnight under an argon atmosphere. the solvent was evaporated, and the remaining orange solid was dissolved in meoh and precipitated with a saturated aqueous solution of kpf6. the precipitate was filtered, washed with water and cold meoh, and dried on the filter. the solvent was reduced and added dropwise to et2o to precipitate 1 and remove the excess bipyridine. after filtration, 1 was obtained as an orange solid (114 mg, 0.112 mmol, 71%). h nmr (300 mhz, cdcl3): 8.55 (d, j = 8.5 hz, 4h), 8.42 (s, 2h), 7.86 (t, j = 7.7 hz, 2h), 7.74 (dd, j = 8.1 and 1.0 hz, 4h), 7.68 (d, j = 5.8 hz, 2h), 7.55 (ddd, j = 8.5, 6.9, and 1.3 hz, 2h), 7.38 (t, j = 7.2 hz, 2h), 7.317.23 (m, 4h), 7.177.08 (m, 2h), 6.26 (d, j = 8.3 hz, 2h), 1.41 (s, 18h). h nmr (300 mhz, cd3cn): 8.64 (t, j = 8.7 hz, 4h), 8.51 (d, j = 1.7 hz, 2h), 7.95 (ddd, j = 8.6, 7.5, and 1.6 hz, 2h), 7.78 (dd, j = 8.1 and 1.2 hz, 2h), 7.757.69 (m, 4h), 7.58 (ddd, j = 8.5, 6.9, and 1.5 hz, 2h), 7.457.36 (m, 4h), 7.33 (d, j = 8.3 hz, 2h), 7.07 (ddd, j = 7.3, 5.8, and 1.3 hz, 2h), 6.34 (d, j = 8.3 hz, 2h), 1.39 (s, 18h). compound 5 (142 mg, 0.172 mmol) was dissolved in 20 ml of degassed ch2cl2/meoh (9:1, v / v). after further degassing, 4-methyl-4--2,2-bipyridine (bpy - pyr ; 103 mg, 0.258 mmol, 1.5 equiv) was added. the mixture was heated to reflux (40 c) overnight under an argon atmosphere. the solvent was evaporated to dryness, and the crude powder was dissolved in 20 ml of acetonitrile. a saturated aqueous solution of kpf6 (100 ml) was added, and the mixture was stirred at room temperature for 1 h. the solvent was gently evaporated until a precipitate formed. the mixture was left in the a refrigerator for 2 h, and the precipitate was filtered, washed with water, and dried under vacuum. the powder was then dissolved in a minimum amount of ch2cl2, precipitated in pure diethyl ether (to remove the remaining unreacted ligand), left in the freezer for 30 min, filtered, and washed with diethyl ether. the column was prepared with pure ch2cl2, and the complex was adsorbed on the silica using pure ch2cl2 as the eluent. the column was eluted first with ch2cl2 to eliminate the fast - migrating impurities, and then the eluent was changed to ch2cl2/acetonitrile (80:20, v / v) to collect an orange fraction. anion exchange was performed again using acetonitrile and saturated kpf6 in water, and 2 was obtained as an orange powder (0.160 g, 0.139 mmol, 81%). h nmr (300 mhz, cdcl3): 8.53 (dd, j = 10.3 and 6.7 hz, 4h), 8.43 (d, j = 5.5 hz, 2h), 8.20 (d, j = 9.3 hz, 1h), 8.13 (t, j = 8.0 hz, 2h), 8.057.90 (m, 5h), 7.887.77 (m, 3h), 7.72 (dd, j = 13.5 and 7.8 hz, 2h), 7.657.43 (m, 6h), 7.37 (dt, j = 10.5 and 7.2 hz, 2h), 7.24 (dd, j = 13.0 and 8.2 hz, 2h), 7.106.99 (m, 2h), 6.996.91 (m, 1h), 6.86 (dd, j = 5.6 and 1.1 hz, 1h), 6.25 (dd, j = 15.1 and 8.3 hz, 2h), 3.863.65 (m, 2h), 3.37 (t, j = 7.5 hz, 2h), 2.51 (s, 3h). hrms. calcd for c59h44f6irn4op (2h2o): c, 60.97; h, 3.82; n, 4.82. found: c, 60.91; h, 3.72; n, 4.94. solutions for spectroscopic studies were degassed by multiple freeze pump thaw cycles, and the cell was blowtorch - sealed. electronic absorption spectra were recorded on dilute solutions in 1 cm quartz cells using a varian cary-50 spectrophotometer. the frequency - tripled nd: yag amplified laser system (30 ps, 30 mj at 1064 nm, 20 hz, ekspla model pl 2143) output was used to pump an optical parametric generator (ekspla model pg 401), producing tunable excitation pulses in the range 4102300 nm. the residual fundamental laser radiation was focused into a high - pressure xenon - filled breakdown cell, where a white - light pulse for sample probing was produced for nanosecond timescale measurements. for longer timescales (micro- and milliseconds), the white - light probe was obtained using an ensemble of light - emitting diodes (roithner lasertechnik, from 365 to 710 nm) working in flash mode, coupled with a multifurcated fiber - optic cable (eight cores, avantes). all light signals were analyzed by a spectrograph (princeton instruments acton model sp2300) coupled with a high - dynamic - range streak camera (hamamatsu c7700). accumulated sequences (sample emission, probe without and with excitation) of pulses were recorded and treated by hpdta (hamamatsu) software to produce two - dimensional maps (wavelength vs delay) of transient absorption intensity in the range 300800 nm. emission spectra were recorded on the steak camera setup (uncorrected) and a horiba jobin yvon fluorolog 3 equipped with a hamamatsu r928p pmt (corrected, figure 2). emission quantum yields of the complexes were determined upon comparison with an optically dilute cl2 standard (r) in air - equilibrated water (= 0.028) according to the equation = r(i / ir)(ar / a)(/r), where r refers to the reference sample, i is the integrated emission intensity, a is the absorbance at the excitation wavelength, and is the refractive index of the solvent. samples were equally studied on the subpicosecond time scale: this experiment was based on a femtosecond 1 khz ti: sapphire system producing 30 fs, 0.8 mj laser pulses centered at 800 nm (femtopower compact pro) coupled with an optical parametric generator (light conversion topas c), and frequency mixer was used to excite samples at the maximum of the steady - state absorption band. white - light continuum (3601000 nm) pulses generated in a 2 mm d2o cell were used as the probe. the variable delay time between excitation and probe pulses was obtained using a delay line with 0.66 fs resolution. white - light signal and reference spectra were recorded using a two - channel fiber spectrometer (avantes avaspec-2048 - 2). a home - written acquisition and experiment control program in labview made it possible to record transient spectra with an average error of less than 10 o.d. a temporal chirp of the probe pulse was corrected by a computer program with respect to a lorentzian fit of a kerr signal generated in a 0.2 mm glass plate used in place of the sample. to obtain the sensing films, different mixtures were prepared (dye concentration of 1.5 mgml) and shaken on a vortex - genie 2 (scientific industries, bohemia, ny) equipped with a homemade holder. a nanostructure prepared by ilford imaging switzerland following the procedure previously published was also used as the support matrix. this nanostructure is called ap200/19, and it is based on a poly(ethylene terephthalate) thin plate coated by courting coating with aluminum oxide hydroxide, which provides a positively charged nanostructured film with a pore diameter of 19 nm and a total pore volume of 20 mlm. once all of the components were dissolved in chloroform, a laurell model ws-400b-6npp / lite spin coater (north wales, pa) was used to spin - coat the respective mixture on the supports. both polystyrene (ps) and ap200/19 membranes were transparent and showed a thickness between 2 and 7 m. the luminescence measurements were obtained by means of a varian cary - eclipse luminescence spectrometer equipped with a xenon flash lamp, czerny turner monochromators, and a r-928 photomultiplier tube with manual or automatic voltage. for gas mixing, two mass - flow controllers (mfcs) of type el - flow model f-201cv bronkhorst high - tech (ruurlo, the netherlands) these tubes connect the mfcs and a flow - through cell specially designed for the spectrometer. the o2-gas station was controlled by a home - written labview 8.2 program connected to a flow bus interface (bronkhosrt) that pilots the bronkhosrt mfcs via rs-232. a time trace curve was used to record i0 and the intensity i at different oxygen partial pressures, which were calculated from the measured oxygen / nitrogen flows, assuming a constant environmental pressure of 1000 mbar. naphthlypyridine (npy)-based cyclometalated iridium complexes display mlct - based emission centered around 600 nm, which can be fine - tuned depending on the coligands present in the primary coordination sphere. the corresponding energy of the emissive state closely approaches that of the triplet state of pyrene (vide supra), making this combination of chromophores potentially suitable to introduce reversible interchromophore electronic energy transfer within the complex and dramatically modify observed luminescence properties, as demonstrated for complexes based on other metals. to test this possibility, two molecular cyclometalated iridium complexes were prepared, namely the model complex and the related bichromophoric complex having an appended pyrene group (chart 1). the synthetic strategy employed to obtain 1 and 2 the reaction of 2-(naphthalen-1-yl)pyridine with iridium(iii) chloride hydrate gave the corresponding chloro - bridged dinuclear iridium complex, 3, which precipitated from the reaction solvent mixture 2-ethoxyethanol / water. owing to the low solubility of this chloro - bridged dimer in common deuterated solvents (chloroform, dichloromethane, acetonitrile, and dimethyl sulfoxide), satisfactory h nmr characterization was not possible and 3 was initially used without further purification. reaction with an excess of tbubpy in a ch2cl2/meoh solvent mixture followed by anion exchange with pf6 gave 1 as an orange solid, which was reasonably soluble in cdcl3 and cd3cn. the same standard protocol was employed for the synthesis of complex 2, using bpy - pyr as the ancillary ligand. however, the ing material was contaminated with an unidentified impurity, as seen in h nmr spectra (figure s7 in the si). purification attempts by column chromatography, on 20 20 cm thin - layer chromatography plates, by reprecipitation, and by recrystallization were all unsuccessful. to obtain pure 2, reacting the dimer with 2,2,6,6-tetramethylheptane-3,5-dione in the presence of tbaoh gave a mononuclear intermediate complex, 4, which is highly soluble in common organic solvents. when previous synthetic methods were adapted, the ancillary ligand was removed upon reaction with bf3 in acetonitrile to give the bis(solvato) complex 5. this bis(acetonitrile) complex was subsequently reacted with bpy - pyr in a dichloromethane / meoh solvent mixture, yielding pure 2 after anion metathesis and purification by column chromatography on silica gel. the complex was characterized by h nmr and high - resolution mass spectrometry (hrms), and the purity was assessed by elemental analysis. this synthetic strategy provides both an approach to purification of chloro - bridged iridium dimers, if a chloride source is present during acid degradation of the acetylacetonate - based complex, and a method to obtain bis(solvato) complexes without the use of silver salts to remove chlorides from the dimer. electronic absorption spectra of 1 and 2 in acetonitrile at room temperature (figure 1) are dominated by ligand - based absorption bands in the uv spectral region, and similar mlct absorption bands are observed in the visible spectral region for both molecules. additional pyrene absorption bands are observed for 2, which retain their vibronic fine structure, implying only weak ground - state coupling between the two chromophores due to the integrated aliphatic spacer unit. as such, each chromophore luminescence quantum yield in an air - equilibrated ch3cn solution compared to (bpy = 2,2-bipyridine) in h2o. electronic absorption spectra of 1 (dot - dashed line) and 2 (solid line) in acetonitrile. photoluminescence spectra show mlct - based red emission for acetonitrile solutions of both 1 and 2 (em max = 625 nm ; figure 2) with similar emission quantum yields in degassed acetonitrile (degas = 0.1). while the latter molecule shows a degas/air ratio of 26, a much higher value of 190 is obtained with 2, which is consistent with a much longer excited - state lifetime; which would enhance diffusion - limited quenching by dissolved oxygen. photoluminescence spectra of 1 (dot - dashed line) and 2 (solid line) in degassed acetonitrile at room temperature (exc = 413 nm). time - resolved spectroscopies in the subpicosecond to millisecond regimes give further information on the nature of the excited molecule and a clear insight into excited - state processes in the supermolecule. an emission lifetime of 8.3 s was obtained for 1 in a degassed acetonitrile solution (figure 3), while a luminescence lifetime that is over 25 times longer (215 15 s) was measured for a micromolar solution of 2. extrapolating to infinite dilution gave an apparent deexcitation rate of 4400 s, or = 225 s, much longer than that of the parent chromophore. luminescence decay in the 580620 nm range of dilute 1 (a) and 2 (b) in degassed acetonitrile at room temperature (ex = 465 nm). complementary transient absorption spectroscopy elucidates the management of energy by the excited molecule prior to emission, and transient absorption signatures for both pyrene and iridium complexes have been described. excitation into the mlct absorption band of 2 at 465 nm rapidly led to population of the pyrene triplet, denoted by a characteristic tn t1 absorption at 410 nm (see figure 4). the kinetics of deexcitation of this absorption band exactly parallels those of the emission, clearly showing that while energy is principally located on this triplet (see the si), it is quantitatively transferred to the metal center, where it is subsequently emitted. this observation implies the presence of quasi - isoenergetic excited states on the adjacent chromophores permitting rapid and reversible electronic energy transfer between them, leading to a dynamic excited - state equilibrium. transient absorption map of 2 showing deexcitation of the equilibrated bichromophoric molecule in acetonitrile at room temperature (ex = 465 nm). low - temperature phosphorescence measurements were undertaken to elucidate the energies of the pertinent states and relative energy levels of 1 and 2. at 77 k, mlct emission (em max = 572 nm) could be observed from 1, while emission of bichromophoric 2 was located further to the red (em max = 595 nm) and is ascribed to pyrene emission from this lower - lying state. assuming similar mlct levels in both complexes (at rt, they show similar emission spectra), only a small energy gap is expected between the pyrene triplet and the mlct state in 2, which could enable reversible interchromophore electronic energy transfer at room temperature. because such a small energy gap can not be measured with sufficiently high precision in this fashion, the energy gap was determined using analysis of data from time - resolved spectroscopies (vide infra), which also gave unambiguous evidence for this unusual phenomenon. the establishment of a dynamic excited - state equilibrium from an initial non - equilibrated excited state can be observed in real time by transient absorption spectroscopy, and a 5 ns rise time of the pyrene triplet absorption signature (see the si) was measured. this value gives the rate of establishment of equilibrium (k = 2 10 s) and is equal to the sum of the rate constants for forward (kf) and backward (kb) electronic energy - transfer processes. the relative kf and kb values can not be determined by direct observation based on transient absorption signatures because the iridium center ground - state bleaching signal overlaps with the transient mlct absorption signal. rather, along with the excited - state equilibrium constant (keq, which describes the distribution of energy between the constituent chromophores), kf and kb can be estimated using the inherent deexcitation properties of the constituent chromophores and the observed lifetime decay of 2 (2 = 225 10 s), upon application of eqs 1 and 2, where mlct and pyr correspond to the time constants for the decays of the excited iridium moiety and pyrene, respectively. corresponds to the fraction of excited pyrene - like triplets, and corresponds to the fraction of excited mlct - like triplets in the equilibrated population.12keq was thus estimated to be 27.8 2, which means that the equilibrated population is predominantly (96.5%) in favor of the organic chromophore. consequently, kf and kb were determined at 1.9 10 and 6.9 10 s, respectively. determination of keq allowed the energy gap between the triplet levels on the adjacent chromophores to be estimated at 680 cm (assuming e rt ln keq). the ultrafast mlct - to - mlct intersystem crossing (isc) rate was estimated using femtosecond transient absorption spectroscopy upon excitation of the mlct absorption band. on the basis of rapid changes in the spectrum at around 520 nm, the isc rate was ca. 10 10 s. this high value corresponds to that previously determined (14 10 s) for related cyclometalated iridium complexes and implies that, following excitation, ultrafast isc precedes a slower intercomponent energy transfer, which then leads to an excited - state equilibrium. the ensemble of rate constants for pertinent processes is shown in the jablonski diagram in figure 5. jablonski diagram showing pertinent energy levels and kinetics of interchromophore energy transfer and luminescence of 2. vr = vibrational relaxation, isc = intersystem crossing, and reet = reversible electronic energy transfer. kf and kb correspond to the rates of forward and backward energy transfer, respectively. because a long excited - state lifetime is important for efficient oxygen detection using luminescent probes, the oxygen - sensing properties of dye 2 were evaluated in solid hosts. we followed our previously reported methodology measuring emission intensities, in both a polymeric ps membrane and a nanostructured metal oxide matrix (ap200/19). a significantly better performance with ap200/19 compared to ps was observed because of improved oxygen permeability; between 0 and 10% o2, the stern volmer constants are 1103 and 294 bar for ap200/19 and ps, respectively (see the si). these make 2 one of the most sensitive iridium - based dyes and is highly promising for lifetime - based sensing methods, which are currently being investigated. in summary, time - resolved spectroscopies conclusively show for the first time that excited - state equilibration is reached in a bichromophoric iridium complex after a few nanoseconds via reversible intercomponent electronic energy transfer and subsequent emission of 2 is delayed (= 225 s), without compromising the emission quantum yield. as well as offering an extremely long excited - state lifetime, excellent initial were obtained for low - concentration oxygen detection and are under further investigation. additionally, a specific synthetic strategy was necessary to obtain 2 as a pure material. this strategy should prove useful in preparing pure chloro - bridged iridium dimers and bis(solvato) complexes without utilizing silver salts to remove chlorides.

a cyclometalated iridium complex is reported where the core complex comprises naphthylpyridine as the main ligand and the ancillary 2,2-bipyridine ligand is attached to a pyrene unit by a short alkyl bridge. to obtain the complex with satisfactory purity , it was necessary to modify the standard synthesis (direct reaction of the ancillary ligand with the chloro - bridged iridium dimer) to a method harnessing an intermediate tetramethylheptanolate - based complex, which was subjected to acid - promoted removal of the ancillary ligand and subsequent complexation. the photophysical behavior of the bichromophoric complex and a model complex without the pendant pyrene were studied using steady - state and time - resolved spectroscopies. reversible electronic energy transfer (reet) is demonstrated, uniquely with an emissive cyclometalated iridium center and an adjacent organic chromophore. after excited - state equilibration is established (5 ns) as a of reet, extremely long luminescence lifetimes of up to 225 s , compared to 8.3 s for the model complex, without diminishing the emission quantum yield. as a , remarkably high oxygen sensitivity is observed in both solution and polymeric matrices.

hairtail (trichiurus lepturus), ecologically warm water fish species, belonging to family trichiuridae, widely distributed on the coast of the yellow sea, south sea and jeju island in the korean peninsula and the several sea areas in china under the natural ecosystem. the food consumption of this species has increased considerably in various types of restaurants (including restaurants specializing in serving hairtails roasted and soy - sauce glazed cutlass fish with radish or other vegetables) for a long time. however, in spite of their economic and scientific significances, a little information currently exist regarding the physiological (huh, 1999 ; cha & lee, 2004) and ecological levels (zhang & sohn, 1997 ; park et al ., only the biological fisheries feature, distribution and migration of hairtail ( t. lepturus) in korean waters were investigated (kim et al ., 1998 ; particularly, clustering analysis of the genetic distance among various fishes and/or mollusks species or populations apart from geographic sites using pcr is of little quantity ( klinbunga et al ., 2000 ; mccormack et al ., 2000 ; park et al ., 2005 ; yoon & kim, 2010 ; song & yoon, 2013), although genetic variation and species - specific and region - specific markers was assessed by molecular biological methods (partis & wells, 1996 ; cagigas et al ., 1999). in the present study, to elucidate the genetic distances and differences between geographical hairtail populations, the author performed a clustering analysis of two hairtail populations collected from korea and china. muscle tissues were collected separately from hairtail (trichiurus lepturus) individuals from korea in the yellow sea and china in the east sea, respectively. pcr analysis was performed on dna samples extracted from a total of 22 individuals using different eight oligonucleotides primers. hairtail muscle was collected in sterile tubes, immediately placed on devrepy ice, and stored at 40c until the genomic dna extraction. the extraction / purification of genomic dna was performed under the experimental conditions previously described (yoon & kim, 2004). eight primers, opa-07 (5-gaaacgggtg-3), opa-20 (5-gttgcgatcc-3), opb-14 (5-tccgctctgg-3), opb-15 (5-ggagggtgtt -3), opb-17 (5-agggaacgag-3), opb-18 (5-cca cagcagt-3), opd-16 (5-acccggtcac-3) and urp-07 (20-mer) were used to generate the bandsharing values and genetic distances which could be clearly scored. pcr was performed using two programmable dna thermal cyclers (perkin elmer cetus, norwalk, ct, usa ; mj research inc ., the concentration of the extracted genomic dna was measured by optical density at 260 nm by a spectrophotometer ( beckman coulter, buckinghamshire, uk). the electrophoresed agarose gels were illuminated by ultraviolet rays, and photographed using a photoman direct copy system (peca products, beloit, wi, usa). the degree of variability was calculated by use of the dice coefficient (f), which is given by the formula: f = 2 nab/(na+nb), where nab is the number of bands shared between the samples a and b, na is the total number of bands for sample a and nb is the total number of bands for sample b (jeffreys & morton, 1987 ; yoke - kqueen & radu, 2006). euclidean genetic distances within- and between - populations were also calculated using the hierarchical dendevrepogram program systat ver.10 (spss inc ., chicago, il, usa). muscle tissues were collected separately from hairtail (trichiurus lepturus) individuals from korea in the yellow sea and china in the east sea, respectively. pcr analysis was performed on dna samples extracted from a total of 22 individuals using different eight oligonucleotides primers. hairtail muscle was collected in sterile tubes, immediately placed on devrepy ice, and stored at 40c until the genomic dna extraction. the extraction / purification of genomic dna was performed under the experimental conditions previously described (yoon & kim, 2004). eight primers, opa-07 (5-gaaacgggtg-3), opa-20 (5-gttgcgatcc-3), opb-14 (5-tccgctctgg-3), opb-15 (5-ggagggtgtt -3), opb-17 (5-agggaacgag-3), opb-18 (5-cca cagcagt-3), opd-16 (5-acccggtcac-3) and urp-07 (20-mer) were used to generate the bandsharing values and genetic distances which could be clearly scored. pcr was performed using two programmable dna thermal cyclers (perkin elmer cetus, norwalk, ct, usa ; mj research inc ., the concentration of the extracted genomic dna was measured by optical density at 260 nm by a spectrophotometer ( beckman coulter, buckinghamshire, uk). the electrophoresed agarose gels were illuminated by ultraviolet rays, and photographed using a photoman direct copy system (peca products, beloit, wi, usa). the degree of variability was calculated by use of the dice coefficient (f), which is given by the formula: f = 2 nab/(na+nb), where nab is the number of bands shared between the samples a and b, na is the total number of bands for sample a and nb is the total number of bands for sample b (jeffreys & morton, 1987 ; yoke - kqueen & radu, 2006). euclidean genetic distances within- and between - populations were also calculated using the hierarchical dendevrepogram program systat ver.10 (spss inc ., chicago, il, usa). oligonucleotides primers were used generating a total of 777 scorable fragments in hairtail population from korea and 783 in population from china, respectively, ranging in size of dna fragments from larger than approximately 150 to larger than 2,400 bp (fig . 1). the complexity of the banding patterns varied devrepamatically between primers and/or geographically separated locales. various researchers have studied the sizes of dna fragments in the pcr profiles of barramundi (lates calcarifer) (partis & wells, 1996), brown trout (salmo trutta) (cagigas et al ., 1999), crucian carp (carassius carassius) (yoon & park, 2002), and yellowfin tuna (thunnus albacares) (diaz - jaimes & uribe - alcocer, 2003). particularly, the oligonucleotides decamer primer, opf-10 produced 11 amplified fragments, with sizes from 200 bp to 600 bp (diaz - jaimes & uribe - alcocer, 2003). six primers were also commonly used, generating a total of 602 scorable bands in catfish, and 195 in the bullhead population, respectively, ranging in dna fragment size from approximately 100 bp to more than 2,000 bp (yoon & kim, 2004). the similarity matrix based on the average bandsharing values of all of the samples within hairtail population from korea ranged from 0.784 to 0.922, whereas 0.658~0.843 within population from china (table 1). the average bandsharing value (meansd) within hairtail population from korea showed 0.8590.031, whereas 0.7520.039 within population from china. also, bandsharing values between two hairtail populations ranged from 0.473 to 0.611, with an average of 0.5420.059. 04 showed the highest level (0.922) within hairtail population from korea, whereas the value between individual no. 01 and no. 08 showed the lowest level (0.784). also, the bandsharing value between no. 19 showed the highest level (0.843) within hairtail population from china, whereas the value between no. as compared separately, the bandsharing values of individuals within hairtail population from korea were comparatively higher than those of individuals within population from china. additionally, the bandsharing value between individual no. 02 and no. 12 showed the highest level (0.611) between two geographic hairtail populations, whereas the value between individual no. 04 and no. the bandsharing values between two hairtail populations, with an average of 0.5420.059, as calculated by bandsharing analysis, were different from the of yoon & park stated that the average level of bandsharing obtained by the five decamer primers used was 0.4000.050 in the wild crucian carp population, contrast with 0.6900.080 observed in the cultured crucian carp population. pcr - generated electrophoretic profiles in korean (lane 1 - 11) and chinese hairtail (lane 12 - 22) amplified by oligonucleotides primers opa-7 (a), opa-20 (b), opb-14 (c), opb-15(d) and opb-17(e). amplified products were electrophoresed on a 1.4% agarose gel and detected by staining with ethidium bromide. 100 bp ladder marker was utilized as a dna molecular size marker (m). similarity matrix including bandsharing values (bs) calculated using nei and li's index of the similarity of korean and chinese hairtail populations, respectively the hierarchical dendevrepogram ed from reliable oligonucleotides primers, indicating two genetic clusters composed of cluster 1 (koreanhair1~koreanhair11) and cluster 2 (chinesehai12~chinesehai22). the longest genetic distance (0.476) displaying significant molecular difference was also between individual no. 01 within hairtail population from korea and no. 22 from chinese. in the present study , pcr analysis has revealed significant genetic distances between two hairtail population pairs (p<0.05). and yoon & kim. via the cluster analysis of genetic similarity values obtained from genetic data, the genetic distance ranged from 0.091 to 0.316 within and among four natural spanish populations of brown trout (salmo trutta) (cagigas et al . the principal aspect of the dendevrepogram was also a remarkable separation of sample 1 from the others, which were closely grouped . accordingly, pcr analysis generated on the pcr data showed that the geographic hairtail population from korea in the yellow sea was more or less separated from geographic hairtail population from china in the east china sea . high levels of genetic polymorphisms and the existence of population differentiation between two hairtail populations showed pcr approach is one of the suitable tools for individuals and/or population biological dna studies . as stated above, using several oligonucleotides primers, this pcr analysis has been applied to identify specific / polymorphic markers particular to breed, species and geographical population, as well as genetic polymorphism / diversity in numerous organisms ( partis & wells, 1996 ; mccormack et al ., 2000 ; klinbunga et al . , 2000 ; diaz - jaimes & uribe - alcocer, 2003). hierarchical dendevrepogram of genetic distances showing the relatedness among different individuals of hairtail population from korea (koreanhair01~koreanhair11) and population from china (chinesehai12~chinesehai22) generated according to the bandsharing values and similarity matrix.

pcr analysis generated on the genetic data showed that the geographic hairtail (trichiurus lepturus) population from korea in the yellow sea was more or less separated from geographic hairtail population from china in the south sea. the average bandsharing value (meansd) within hairtail population from korea showed 0.8590.031, whereas 0.7520.039 within population from china. also, bandsharing values between two hairtail populations ranged from 0.470 to 0.611, with an average of 0.5420.059. as compared separately, the bandsharing values of individuals within hairtail population from korea were comparatively higher than those of individuals within population from china. the hierarchical dendevrepogram ed from reliable oligonucleotides primers, indicating two genetic clusters composed of cluster 1 (koreanhair1~koreanhair11) and cluster 2 (chinesehai12~chinesehai22). the genetic distances between two geographic populations ranged from 0.038 to 0.476. individual no. 11 within hairtail population from korea was genetically closely related with no. 10 (genetic distance=0.038). the longest genetic distance (0.476) displaying significant molecular difference was also between individual no. 01 within hairtail population from korea and no. 22 from chinese. in the present study , pcr analysis has revealed significant genetic distances between two hairtail population pairs (p<0.05).

key clinical messagethis case demonstrates the rare coexistence of a prolactinoma with craniopharyngioma and documents its radiological growth. this case suggests that patients with pituitary neoplasms should be followed closely and although prolactinomas can often be managed medically, a coexistent other lesion may require surgery for histological assessment and to reduce mass effect.

though pregnancy and labor are considered a physiological process the potential for catastrophic complications is constant and may develop in a matter of minutes.. global prevalence of samm (defined as severe life threatening obstetric complication necessitating urgent medical intervention in order to prevent likely death of the mother) varies from 0.015 to 8.23%. samm which require high dependency unit (hdu) interference. the uk department of health defined hdu care as a level of care which lies in between a general ward and an intensive care unit (icu). it typically involves the patients with single organ failure and patients who are at a high risk of developing life threatening complications. in western india the incidence of mothers requiring intensive care unit is around 5.48 per 1000 deliveries. in eastern india we retrospectively analyzed the demographic parameters, reason for admission, course of the stay, prognostic factors and final outcome in hdu requiring cases. the aim was to review the obstetric admissions to our institutional hdu in terms of hdu utilisation rate, indications for admission, interventions needed and ultimate fetomaternaloutcome. this retrospective cohort study was conducted from may 2007 to may 2011 in the department of obstetrics and gynaecology, ipgme and r, kolkata after ethical permission was granted from institutional ethical committee. a dedicated 14 bedded hdu complying with standard recommendation of size, equipment, medical and paramedical staffs is present. of the total 5052 deliveries conducted over a period of four years a total these obstetric patients 57 parturients required hdu during their course of treatment and were included in this study. obstetric morbidity was defined as morbidity originating from any cause related directly to pregnancy or its management during antepartum, intrapartum or postpartum period (up to 42 days after delivery). maternal demographic characteristics included age, past obstetric history and history of any underlying medical disorder. relevant data regarding obstetric events, indications for hdu transfer / admission, interventions required, length of stay, eventual outcomes were collected, reviewed, tabulated and analyzed. antenatal mothers were monitored clinically along with cardio tocography, biophysical profile and doppler study. all patients were individualized and managed with invasive or non - invasive measures as and when required. statistical data was analyzed by graph pad prism version 4.03 (graph pad software . in corporation, 2005). fisher's exact test was employed to compare categorical variables between study and control subjects. demography of our study population revealed mean age of patients with only obstetric morbidity and cases with prior medical disease at 24.6 4.23 and 24.9 4.33 years respectively. thirty one primipara (54.38%) and 26 multipara (45.61%) were observed to have required hdu admission. mode of delivery was either vaginal or abdominal as per obstetric indication and a majority (73%) had delivered at home. forty eight mothers (84.21%) received no prior antenatal care. on examination anemia was present in all patients with haemoglobin level ranging between 6 to 9 gm / dl. hypotension, tachycardia and fever were observed in 29 (50.87%), 56 (98.29%) and 22 (38.59%) women respectively. hypertension was present in 12 women with blood pressure ranged between 140/90 and 200/ 120mmhg. other disease specific features were splenomegaly, gum bleeding and icterus. interventions required during hdu stay were inotropes, antibiotics, mechanical ventilation and central venous monitoring. nine out of 10 patients with acute kidney injury (aki) required hemodialysis while the tenth patient improved spontaneously on third day of delivery with antibiotics, inotropes and blood transfusion. indications for hdu utilization as described in table 4 showed that thirty nine (68.12%) women presented with various obstetric complications like; septicemia (20/57 = 35.08%), hypertension in 12 cases (21.05%) which included pre - eclampsia, eclampsia and two women with hellp (hemolysis, elevated liver enzymes and low platelet count), postpartum hemorrhage (pph) (17/57 = 29.82%), antepartum hemorrhage including one placenta previa and one abruption placenta case (2/57 = 3.5%), post surgical aki (10/57 = 17.54%), uterine perforation during abortion (2/57 = 3.5%), uterine rupture due to placenta percetra (1/57 = 1.57%) and one ruptured ectopic pregnancy. sepsis was mainly peureperal, postoperative, following criminal abortion or due to pyelonephritis, chrioamnionitis and following acute blood loss. one of these patients with attempted criminal abortion at 24 weeks of gestation had sigmoid colon injury, for which colostomy was initially carried out and then dead baby delivered vaginally. post surgical aki patients included 7 women with history of lscs and 3 cases that required hysterectomy for pph. eighteen (31.57%) obstetric patients with medical disorders required hdu. the disorders included (ppcm) peripartum cardiomyopathy, systemic lupus erythematus, grade iv ms with twins, infective endocarditis with dengue, atrial tachycardia, idiopathic dcm, chronic demylinatingpolyneuro radiculopathy (cidp), acute pancreatitis, takayasu arteritis, deep vein thrombosis (dvt) with pregnancy, thalassemia intermedia, hepatitis e and one of the each patient with non specificaortoarteritis and acute gall bladder syndrome. table 6 compared the patients with only obstetric complications with those having pre - existing medical disorders. obstetric group (group a) had mean gestational age of 35.8 6 weeks at delivery where as patients with medical disorders (group b) had 32.5 9 weeks. morbid sequelae like respiratory failure, cardiac failure, prolonged hospital stay and prolonged time for recovery were observed more with group b. five maternal deaths (8.77%) occurred in the group with medical disorders (group b) compared to two (3.5%) in group - a. causes of maternal mortality in obstetric group were cardiac failure in eclampsia and post hemorrhage sepsis leading to multi - organ failure and dic (disseminated intravascular coagulation). in group - b mortality occurred in a patient with acute pancreatitis, one sle case with grade iv nephropathy, one patient with ppcm who presented postpartum with ejection fraction (ef) at 23%, one patient with hepatitis e who developed hepatic encephalopathy and one patient with dvt succumbed after pulmonary embolism. demography particulars of the study population clinical profile at admission in hdu investigations and interventions required in hdu observed obstetrical indications for admission in hdu observed medical indications for admission in hdu comparison of obstetric and non obstetric group in terms of maternal outcome fifty seven pregnancies ed in 48 live births. one patient with eclampsia delivered still born at 32 weeks. in non obstetric group fetal demise was observed in sle, ppcm, severe ms with twin pregnancy and the case with acute pancreatitis. during the 4 year study period 5052 mothers delivered and 57 patients required hdu admission. thus obstetric admission in hdu was 11.2 per 1000 deliveries. this data from eastern india differed from that of western india, where incidence of icu utilization by obstetric patients was 5.4 per 1000 deliveries, during 5 years. the incidence varies widely among developed nations also:1.3 in 10 years in hong kong, 2.4 over two years in netherlands, 10.2 in 4 years in dublin (ireland) and 26.7 in 23 years in uk. unfortunately, data regarding hdu requirement for obstetric causes from other developing nations is lacking. it is interesting to note that despite gross socio economic differences hdu / icu utilization rate here, was almost comparable to some of the developed countries like ireland and uk. limited accessibility and inadequate availability of hdu, icu services and higher mortality prior receiving medical attention may help explain this contradiction. we feel that this above incidence of hdu utilization reveals just the tip of the iceberg. the indications leading to hdu admission were analyzed among the obstetric patients with only pregnancy induced complications. sepsis accounted for the majority (35.08%) of admissions, followed by pph (29.82%) and severe hypertensive disorders (bp160/100mmhg)of pregnancy (21.05%). common causes of sepsis were massive obstetric hemorrhage, chorioamnionitis, uti, puerperal infections and sequelae of operative interventions including criminal abortions. the common offending pathogens were escherichia coli, klebsiella, staphylococcus aureus, pseudomonas aeruginosa, bacteroids and anaerobes. the underlying factors responsible for sepsis were unsupervised home delivery in unhygienic environment, failure to administer necessary antibiotics, rising trend of operative intervention and increased incidence of pph occurring in the of maternal malnutrition and anemia. it has been postulated that anemia predisposes to susceptibility to sepsis. of the whole study population forty eight (84.21%) cases were unbooked and referred with unsupervised no previous history of antenatal care. on analyzing the association of sepsis with surgical procedures, we observed that almost 21.05% (12/57) of cases developed sepsis after various operative procedures (two criminal abortions, seven lscs and three hysterectomies indicated for pph). in other studies the important obstetric causes for hdu admission revolve around pph and hypertensive disorders. sepsis ranked least in all the above series. although in our study more commonly sepsis was associated patients requiring hdu for obstetric reasons only, while hongkong study observed sepsis mostly among non obstetric cases. in this study pph and hypertensive disorders were the next two common causes. in rural india majority of the deliveries are conducted at home or at health centre's with inadequate infrastructure. naturally unsupervised deliveries, dogmatic traditional approaches during birth, failure to use of uterotonics and underlying anemia continue to make pph responsible for almost 28% of maternal mortality in india. it has been observed that anemia and poor nutrition contribute to the risk of hemodynamic compromise arising from blood loss during delivery and this increases the maternal morbidity. regarding hypertensive patients requiring hdu care, the probable reasons appeared to be lack of timely diagnosis and inappropriate management coupled with ignorance of life threatening complications like hellp and eclampsia. among non obstetric complications we observed various medical disorders necessitating hdu admission. majority were patients with cardiac disease ppcm, grade iv ms with twins, infective endocarditis with dengue, atrial tachycardia and idiopathic dcm. anticipatory admissions included a patient with atrial tachycardia requiring emergency lscs and another with cidp. keeping in mind the imminent risk of respiratory failure in cidp she was kept admitted in hdu and later delivered by lscs at 35 weeks due to progressive fetal growth restriction (fgr) (baby weight 2.1 kg). the patient with atrial tachycardia had a heart rate of 150 - 170/min in her last trimester, which remained refractory to treatment and ultimately subsided after delivering the baby. emergency admissions included life threatening obstetrical complications along with medical disorders like sle, ms with twins, non specificaortoarteritis and hypertensive retinopathy with superimposed pre eclampsia etc. immediate maternal disease related morbidities were significantly increased in the obstetric cases with prior medical disease, these included cardiac failure, respiratory failure, and prolonged hospital stay and increased recovery time. majority of women from this group also delivered prior to term. in subsequent follow - up patients were found to have developed crf, chronic hypertension and persistent left ventricular dysfunction. in the present series patients with medical disorders had more mortality in comparison to obstetric group (5/18 vs. 2/39 ; p 0.05). fetal outcome was also worse in the non obstetric category with more incidence of premature babies, fgr, still birth and early neonatal death. maternal mortality was 12.28% and fetal mortality was 17.54% (stillborn-4, early neonatal death-3, abortions-2, ectopic-1). the other indian study from western india reported fetal and maternal mortality of 52% and 21.6% respectively. in contrast in developed countries maternal mortality of hdu admissions was nil while prenatal mortality was 1.05% to 8%. one salient point noted was that unbooked patients and those referred from remote rural areas had worse prognosis. in this study maternal mortality and or transfer to iccu (intensive coronary care unit)/itu (intensive therapeutic unit) were taken as worst outcome end points. the main reasons were poor nutrition coupled with unsupervised births, illegal abortions, absence of modern diagnostic / therapeutic amenities, anesthetic hazards and finally delay in referral and necessary intervention. also attributed high maternal age, absence of prenatal care, transfer to icu > 24 hours after onset of acute problem and severity of illness at the time of admission as assessed by apache ii score to be the factors responsible for maternal mortality. we failed to find any significant relation between maternal mortality or morbidity with age, parity and gestational age. improved treatment strategies for obstetric hemorrhage and sepsis along with timely management of critically ill patients in the high - dependency unit may help decrease maternal mortality and morbidity as a high - dependency care unit fulfils the needs of at least half of the obstetric population who require higher acuity care and simultaneously save considerable expenditure. emphasis on early detection of maternal problems and prompt referral to tertiary centers could minimize the prevalence of multiple organ failure and mortality in these women. our findings highlight the need for establishing a high dependency unit in all such centre's in order to avoid unnecessary admission to the intensive care unit and to ensure proper management. again, since puerperal morbidity has now become a focal parameter for quality of maternal care, a continued psychosocial follow - up of these patients should ideally be implemented to ensure better quality of life. this review is a reminder that constant vigilance, judicious judgment along with provision of adequate resources are still the major stepping stones on the road to maternal safety.

aim: to analyze the hdu requirement in an obstetric population in terms of utilization rate, indications for admission, interventions required and gestational outcome.setting and design: a retrospective observational study was carried out from may 2007 to may 2011 in the dept. of obstetrics and gynecology and hdu of ipgme and r, kolkata.materials and methods: data related to obstetric history, pre - existing medical problems, indications for hdu admission, interventions required, length of stay and outcome were collected and were analyzed.:our obstetric hdu utilization rate was 11.2 per 1000 deliveries. out of total 57 subjects 48 had no prior antenatal care. majority (68.42%) admitted in hdu with only obstetric reasons, while 31.57% required hdu for pre - existing medical diseases. the major obstetric indications were septicemia (35.08%), pph (29.08%) and hypertension was observed in 21.05% of women. other less common causes included post surgical acute kidney injury, aph, chrioamnionitis and pyelonephritis. half of the women with pre - existing medical disease had cardiovascular problems. patients with medical diseases had more pre - term labor (10 vs 5 ; p 0.05), respiratory failure (9 vs 2 ; p 0.05), cardiac failure (7 vs 1 ; p 0.05), duration of stay more than 10 days (15 vs 6 ; p 0.05), fetal growth restriction (6vs 3 ; p 0.05) and prolonged recovery time. maternal mortality was 12.28% and fetal mortality was 17.54%.: early screening of high risk mothers, vigilant antenatal care and proper maintenance of asepsis during delivery and postpartum period can reduce hdu utilization rate and can in healthier outcome.

worldwide, more than 14 million new cases of cancer were diagnosed in 2012 (ferlay et al ., 2013), and the annual number of incident cancers is expected to reach 24 million in the next two decades, reflecting population ageing, trends towards earlier detection and increasing exposure to risk factors. it is estimated that between a third and a half of all cases are preventable through reduction of modifiable exposures, including smoking, unhealthy diet, physical inactivity, alcohol consumption, infections or occupational hazards (vineis and wild, 2014). however, the translation of available evidence on the causes of cancer into preventive action will also depend on the population s health - related beliefs, including the perception of susceptibility to the disease, as well as specific knowledge of its determinants and preventive measures (sarafino and smith, 2011). this study aims to describe different aspects of health - related knowledge of cancer in the portuguese population, including the perception of risk and knowledge of the leading causes of cancer and the main preventive behaviours. the present analysis was based on a national survey conducted in 2012, aiming to assess knowledge and health behaviours of the portuguese population aged between 16 and 79 years. a stratified probabilistic sampling procedure was used to identify 150 geographical units, among which a total of 585 starting points were designated for the selection of households through standard random route procedures. all of the potentially eligible dwellers were identified in each selected household and only the one whose previous birthday was closest to the date of this contact was invited; a total of 1624 valid interviews were obtained (response rate : 70.8%). participants were evaluated through face - to - face interviews conducted using a structured questionnaire. statistical analyses were carried out using stata, version 11.1 (stata corp lp, college station, texas, usa). the associations between explanatory variables and cancer - related knowledge were estimated through adjusted (sex, age, education) regression coefficients or prevalence ratios (pr), with 95% confidence intervals (95% ci), using linear and poisson regression, respectively. all estimates were weighted to be representative of the portuguese population. the survey was approved by the ethics committee of the university of porto, and all participants provided written informed consent. the proportion of nonrespondents ranged from 13.4%, when participants were asked to select the most frequent cancer in portugal (fig . 1a), to 63.5%, when the leading cause of cancer was to be named (fig . for all questions, the frequency of nonresponse decreased with education, and older participants were less likely to estimate the lifetime risk of cancer ( p for trend=0.001). knowledge of cancer frequency (a), leading cause of cancer (b) and behaviours for cancer prevention (c). percentage of participants selecting each option from a list of possible answers. includes skin (melanoma), skin (with no other specification), liver, oesophagus, pancreas, leukaemia and other cancers. percentage of participants naming each cause of cancer (open question), on the basis of a qualitative data analysis (thematic coding), defined to include the most frequent answers. includes smoking, unhealthy diet, consumption of alcoholic beverages, sun exposure, overweight / obesity, lack of physical activity and other unhealthy lifestyles. includes poor medical care, air pollution, exposure to chemicals or toxic products, consumption of medicines and other diseases. includes doing regular physical activity, taking multivitamins, being weighed regularly, taking regular measurements of blood pressure and other behaviours. the mean estimate for the lifetime risk of cancer was 37.0%, being lower in men (=6.93, 95% ci : 10.74 to 3.12) (fig . breast cancer was identified as the most frequent in portugal ( 47.5% among respondents) (fig . men were less likely to mention breast cancer ( pr=0.68, 95% ci : 0.560.81) and more likely to refer to lung cancer as the most frequent (pr=2.05, 95% ci : 1.492.82). the most educated participants referred to prostate cancer less often (> 12 vs. 04 years : pr=0.36, 95% ci : 0.140.93). in terms of the leading cause of cancer, lifestyles (mostly smoking) were the most frequently referred to (72.0% among respondents) (fig . those with higher educational levels were less likely to report lifestyles ( > 12 vs. 04 years : pr=0.71, 95% ci : 0.580.88) and more likely to mention genetics (> 12 vs. 04 years : pr=3.37, 95% ci : 1.796.37). reference to genetic causes increased with age, up to the 6069 year age group. not smoking was identified as the most important preventive behaviour by 40.2% of the respondents (fig . men were more likely to select not smoking ( pr=1.32, 95% ci : 1.081.60) and less likely to indicate having regular blood analysis (pr=0.51, 95% ci : 0.290.88). more educated participants (> 12 vs. 04 years) were less likely to select not smoking (pr=0.65, 95% ci : 0.460.90) and having regular blood analysis (pr=0.37, 95% ci : 0.140.99), and more likely to choose a healthy diet (pr=1.58, 95% ci : 1.002.51) and having regular health check - ups (pr=2.11, 95% ci : 1.333.34). a more frequent reference to a healthy diet was observed with increasing age (p for trend=0.008). our show gaps in specific knowledge related to cancer and, therefore, a large potential for improvement, as observed previously (adlard and hume, 2003). however, the interpretation of these is subjective and needs to consider that the different dimensions of cancer - related knowledge may have distinct implications for prevention efforts. for instance, compared with limited perception of the population s risk, the high proportions of nonresponse or inaccurate answers in terms of preventive behaviours are likely to reflect more relevant gaps in knowledge. cancer is estimated to affect approximately one - quarter of the portuguese population before age 75 (ferlay et al ., 2013), which is less than the estimated by the participants in our study, although the lifetime risk may be higher as the overall incidence of cancer further increases after 75 years of age. the use of an open - ended numeric scale may have inflated the estimates and contributed towards higher proportions of nonresponse (woloshin et al ., 1999). our findings may also reflect the increasing number of survivors (pacheco - figueiredo et al ., 2013), who may share their experience with others, and the negative perception of cancer by the general population. the sex differences observed may from the fact that men are less likely to search for cancer - specific information (rutten et al . , 2006), despite having a higher risk of cancer (ferlay et al ., 2013). among the most frequent malignancies, breast cancer was identified as the most common in portugal, which may reflect the existence of screening programmes and the large coverage of breast cancer by the mass media (lewison et al ., 2008). the high proportion of participants identifying lifestyles as the leading cause of cancer or not smoking as the most important preventive behaviour, especially among men, is in accordance with the global efforts at tobacco control observed in europe in the last few years, as well as with the higher prevalence of smoking in men (carreira et al ., 2012). the increasing use of sophisticated technologies for the detection of asymptomatic diseases at early stages (webster, 2002), as well as misconceptions on the effectiveness of some screening procedures, may have contributed towards blood analysis and regular check - ups being often identified as preventive behaviours, and may reflect a blurring of the boundaries between primary and secondary prevention. previous investigations have shown that more educated individuals were more likely to seek cancer - related information (rutten et al ., 2006), including about hereditary cancers, which is in accordance with the patterns observed in our study on the variation in cancer - related knowledge according to education. the present study provides baseline data on health - related knowledge of cancer prevention, which may be used for the planning and evaluation of awareness - raising and primary prevention interventions in portugal. the present study provides baseline data on health - related knowledge of cancer prevention, which may be used for the planning and evaluation of awareness - raising and primary prevention interventions in portugal.

the increasing number of new cases of cancer highlights the relevance of primary prevention for cancer control, which is influenced, among other factors, by the population s health - related knowledge. therefore, we aimed to describe cancer - related knowledge in portugal, including perception of risk, awareness of cancer causes and preventive behaviours. we evaluated 1624 portuguese - speaking dwellers, aged between 16 and 79 years, through face - to - face interviews conducted using a structured questionnaire. we computed adjusted (sex, age, education) regression coefficients and prevalence ratios, using linear and poisson regression, respectively, to quantify associations with cancer - specific knowledge. the proportions of nonresponse ranged from 13.4 to 63.5% for the most frequent cancer in portugal and the leading cause of cancer, respectively. the mean of the estimated lifetime risk of cancer in the portuguese population was 37.0%. a total of 47.5% of the respondents identified breast cancer as the most frequent in portugal, 72.0% named lifestyles as the leading cause of cancer and 40.2% selected not smoking as the most important preventive behaviour. lower levels of education were associated with higher proportions of nonresponse, but not consistently with inaccurate knowledge. men provided lower estimates of the lifetime risk of cancer, indicated breast cancer less frequently and more often lung cancer as the most frequent, and were more likely to select not smoking as the most important preventive behaviour. the present study provides relevant data on knowledge of cancer prevention, which may be used for the planning and evaluation of awareness - raising and primary prevention interventions in portugal.

one of the major infectious diseases that causes significant mortality around the world is malaria. currently, primaquine (pq, figure 1) has been used as the drug to treat the liver stage of this disease. however, a major concern for primaquine is that its metabolites are able to cause hemolytic anemia, particularly in glucose-6-phosphate dehydrogenase (g6pd) deficient patients. the hemotoxicity is related to the conversion of hemoglobin to methemoglobin, which can not carry molecular oxygen, and the simultaneous generation of reactive oxygen species, such as superoxide radical and hydrogen peroxide. from various experimental studies , it is known that the degree of hemotoxicity varies in different primaquine metabolites. for example, 5-hydroxyprimaquine, 5,6-dihydroxyprimaquine, and 6-methoxy-8-(n - hydroxy)aminoquinoline generate more methemoglobin than the parent molecule. although the attempt to discover less toxic antimalarial drugs has attracted significant attention, the chemical mechanism of how methemoglobinemia is caused remained unknown over the past several decades, which, unfortunately, significantly hampered the discovery of new and safer antimalarial drugs. since the methemoglobinemia involves a redox reaction, we believe that electron transfer processes are the key to understanding its mechanism. based on our extensive density functional theory (dft), molecular dynamics, and quantum mechanics / molecular mechanics (qm / mm) studies, we tested the possibilities that (i) pq and its derivatives are not involved in the electron transfer process or that (ii) they act as the electron acceptor, and showed proof against both proposed mechanisms. the third possibility is that pq and its derivatives act as the electron donor in the redox process, which is in fact supported by our computational studies. specifically, we found that upon binding to hemoglobin, 5-hydroxyprimaquine is able to donate an electron to the hemoglobin - bound o2. in the meantime these two electrons help the conversion of o2 to h2o2 and simultaneously generate methemoglobin. furthermore, we also showed that an electron - donating group (edg) at the 5-position makes it easier for the corresponding primaquine derivative to lose an electron. in contrast, an electron - withdrawing group (ewg) at the 5-position makes this process more difficult. hence, a 5-position ewg - substituted primaquine derivative may generate less methemoglobin, which is worth considering in the future development of this class of drugs. in addition to these studies, we also investigated the methemoglobinemia potential and the feasibility of formation of the hydroxylated derivatives of npc1161, a developmental antimalarial compound with better efficacy and lower toxicity. in this study , we further considered the effect of a substituent at all other positions of primaquine on its ionization potential. the obtained from this work may be used to predict the potential of these primaquine derivatives to generate methemoglobin and guide the future design of this class of drugs. geometries were optimized in the gas phase using the b3lyp method with the 6 - 31g(d, p) basis set. frequency calculations were also performed at this level to confirm that all the optimized structures correspond to minima on the potential energy surface and to obtain zero - point vibrational energies (zpve). relative energies in the gas phase were obtained by performing single point calculations at the b3lyp/6 - 311+g(2df, p) level based on the above optimized geometries, and these were corrected with the zpve from the smaller basis set, that is, b3lyp/6 - 311+g(2df, p)//b3lyp/6 - 31g(d, p) + zpve. all the gas phase energies reported in this work were obtained at this level. to investigate the effects of the polarity of the environment, the optimized gas - phase structures were used for single point calculations employing the integral equation formalism polarizable continuum model (ief - pcm) at the b3lyp/6 - 311+g(2df, p) level. a dielectric constant of 78.36 was used to model aqueous solution. the ionization potentials (ips) were calculated according to the following definition: the atomic orbital contributions to the highest occupied molecular orbital (homo) were obtained by performing population analysis using gaussian 09. the b3lyp method has been used previously for calculation of ips that agree well with experiment. previously, we studied the interaction between 5-hydroxyprimaquine and hemoglobin, which led to our proposed methemoglobinemia mechanism. in this study, we first considered the effect of an -oh group at all other exocyclic positions on the ionization potential (ip) of primaquine. an extended side chain conformation was used for all the pq derivatives considered in this work, as was done in our previous study. the ips of all the derivatives are listed in table 1. when any of the exocyclic positions is substituted with an -oh group, the ip of the ing derivatives is smaller than that of pq itself. in the gas phase, 5-oh - pq has the smallest ip of 585.3 kj mol, while 3-oh - pq has the largest ip of 620.1 kj mol, which is 34.8 kj mol higher in energy than that of 5-oh - pq and is still 3.2 kj mol less than that of pq. in solution, the ips of all the derivatives significantly decrease by 128.0135.1 kj mol, most likely due to the stabilization effect of the solution. however, compared with the gas phase, the same trend was observed in solution. for example, 5-oh - pq has the smallest ip, while 3-oh - pq has the largest ip, 1.4 kj mol less than that of pq. according to our previously proposed mechanism that the methemoglobinemia caused by the pq derivatives may be determined by their ionization potentials, hydroxylation at any of the exocyclic positions should make the corresponding derivative able to generate more methemoglobin. in addition, the 5-oh substituted derivative should be able to generate the most significant methemoglobinemia, because it has the smallest ip. in addition to the hydroxylated derivatives, we also considered all the possible methylated derivatives. similar to the effect of the hydroxyl group, the -ch3 substituent at the 5-position in the smallest ip in both the gas phase and solution, compared with the same substituent at all other positions. however, the difference between the ip of 5-ch3-pq and of those pq derivatives with the same substituent at other positions is much smaller than the differences found for the hydroxylated derivatives. specifically, the ip of 5-oh - pq is smaller than those of the other -oh substituted derivatives by 26.234.5 kj mol in solution. in contrast, the ip of 5-ch3-pq is smaller than those of the other -ch3 substituted derivatives by only 6.012.4 kj mol in solution. this is likely due to the weaker electron - donating ability of the -ch3 group compared with the -oh group. for comparison, the ips of pq in the gas phase and in solution are also listed. the calculated ips of all possible nitro and trifluoromethyl derivatives are listed in tables 3 and 4, respectively. it can be seen that all of them have larger ip than the parent pq molecule both in the gas phase and in solution, which is the opposite of the effect of having an edg substituent at the exocyclic position. for both the nitro and trifluoromethyl compounds, the 4-position substituted derivatives have the lowest ip in the gas phase, while the 3-position substituted derivatives have the lowest ip in solution. this is different from the edg - substituted derivatives, in which substitution at the 5-position in the smallest ip. however, it should also be noted that the ips of the 2-, 3-, and 4-position substituted derivatives are quite close, with the largest difference being only 7.7 kj mol. the largest ip was found with substitution at the 5-position in the gas phase and at the 7-position in solution. however, the difference between the ips of the 5-position and 7-position substituted derivatives is very small and is within 2 kj mol. hence, the 5-position seems to be particularly sensitive to the substituent with respect to change in the ip. specifically, an edg at this position in the lowest ip both in the gas phase and in solution. in contrast, an ewg at this position in the largest ip in the gas phase and the second largest ip in solution, which is only marginally smaller than the largest ip. for comparison, the ips of pq in the gas phase and in solution are also listed. for comparison, the ips of pq in the gas phase and in solution are also listed. it has been previously shown that the ip of a molecule is determined in part by its highest occupied molecular orbital (homo). in order to understand the significant effect of a substituent at the 5-position, we plotted the homo of primaquine, which is shown in figure 2. it can be seen that the homo is primarily localized on the aminoquinoline ring as well as the exocyclic nh moiety at the 8-position. the contribution of the individual atomic orbitals to the homo was also analyzed and is provided in table 5. it can be seen that the 2p orbital of c5 contributed the most (0.28) to the homo. hence, any substituent at this position should have the largest effect on the ip. this thus explains the above findings that either an edg or an ewg at this position in the largest effect on the ip. in contrast, the contributions of the atomic orbitals of c2, c3, and c4 to the homo are all much smaller than that of c5. the atomic orbital that makes the second largest contribution to the homo is n8 (table 5). as a , any substituent at this position should also in a considerable change to the ip compared with the parent compound. therefore, the ips of the molecules having an -oh, -ch3, or -cf3 substituent on the 8-amino group were calculated and are listed in table 6. it was again found that an edg (-oh, -ch3) at the n8-position decreases the ip while an ewg (-cf3) at this position increases the ip. for both the -oh and -cf3 substituents, the change of ip is more significant for substitution at n8 than for the same substituent at the 5-position. it should be noted that in the optimized structure of the radical cation of the 8-n - oh derivative, the proton of the n - oh moiety is transferred to n1, probably due to the better delocalization of the positive charge on the aminoquinoline ring. for comparison, the ips of pq in the gas phase and in solution are also listed. the in this work provide insights into the future design of less hemotoxic antimalarial drugs. we recently proposed that the methemoglobinemia caused by the primaquine derivatives may be determined by their electron - donating ability. if one wants to lower the hemotoxicity of primaquine by adding an exocyclic substituent, the findings in this work suggest that an ewg should be considered. in addition, among all the possible positions, the 5- and 7-positions deserve particular attention, because a substituent at these positions should have a larger effect than those at other positions. we note that tafenoquine (figure 3), a promising antimalarial drug candidate that has entered clinical trials, has a -cf3 exocyclic substituent, although it is not directly connected to the c5 position of the aminoquinoline ring. however, the efficacy of the ing derivative against the malaria parasite will also need to be taken into account. it has been known that when this position is substituted by a hydroxyl group in 6-methoxy-8-aminoquinoline (figure 1), the ing 6-methoxy-8-(n - hydroxy)aminoquinoline derivative generates much more significant amounts of methemoglobin than 6-methoxy-8-aminoquinoline does. this is in agreement with our finding that an edg substituent at n8 decreases the ip. further experimental studies should also be performed to determine the advantages of placing an ewg at this position. in this work, the ionization potentials of the exocyclic edg- and ewg - substituted primaquine derivatives were considered. it was found that for all the positions, an edg causes the ip to decrease. however, among all the possible exocyclic positions, the 5- and 7-positions each play a special role. in solution, an edg at the 5-position in the smallest ip, while an ewg at the 7-position in the largest ip. this can be explained by the contribution of each atomic orbital to the homo of primaquine. it was found that p - orbitals from c5 and c7 are among the first three atomic orbitals with the largest contribution to the homo of primaquine. the atomic orbital with the second largest contribution to the homo is that of n8. hence, any substituent at the n8 position should also have a considerable effect on the ip. when the 8-amino group is substituted by a -cf3 group, the ing derivative has a larger ip compared with placing the same substituent at any other position. the mechanism of the methemoglobinemia caused by primaquine - based antimalarial drug has been unknown for decades. as a , a rational approach to the development of pq - based antimalarial drugs with less methemoglobin generation was lacking. our previous studies suggested that the potential for methemoglobin generation by primaquine derivatives is determined in part by their ability to lose an electron. the reported in this study further suggest that the future design of less hemotoxic primaquine - based antimalarial drugs should consider use of an ewg as an exocyclic substituent, in particular at the c5, c7, or n8 positions, because substituents at these positions have the most significant effect on their ionization potentials.

the effect of an exocyclic substituent on the ionization potential of primaquine, an important antimalarial drug, was investigated using density functional theory methods. it was found that an electron - donating group (edg) makes the ionization potential decrease. in contrast, an electron - withdrawing group (ewg) makes the ionization potential increase. among all the exocyclic positions, a substituent at the 5- or 7-position has the largest effect. this can be explained by the contribution of the atomic orbitals at those positions to the highest occupied molecular orbital (homo). in addition, a substituent at the n8-position has a considerably large effect on the ionization potential because this atom makes the second largest contribution to the homo. these findings have potential implications for the design of less hemotoxic antimalarial drugs. we suggest that it is worth considering placement of an ewg at the 5-, 7-, or n8-positions of primaquine in future drug discovery attempts.

flightless i (flii) is a multifunctional protein of the gelsolin family of actin - remodelling proteins. there are eight members of this family in mouse and humans, each containing one or two gelsolin domains consisting of three repeated gelsolin motifs of between 125 and 150 amino acids in length. flii contains 6 repeat gelsolin motifs and an additional 11 leucine rich repeat (lrr) domains not present in other family members. it has been found to play roles in many processes including actin regulation, transcription and inflammation. flii is distributed across many cellular compartments, as would be expected for such a multifunctional protein, including the nucleus, cytosol and lysosomes. in vivo flii overexpressing mice (flii) have impaired healing with larger, less contracted wounds, reduced cell proliferation and delayed epithelial migration. in contrast, mice with reduced levels of flii (flii) have improved wound healing with increased epithelial migration and enhanced wound contraction. wounds in flii overexpressing mice also show significantly elevated levels of collagen i and overexpression of collagen is a major contributing factor to hypertrophic, or excessive scar formation. given flii s known role in processes that are all involved in regulating tissue repair it is not surprising that it could alter the course of wound healing and scar formation. unlike many gelsolin family members, which enhance actin polymerisation and cap actin filaments, flii binds actin filaments and actin monomers and inhibits actin polymerisation. flii associates with focal adhesions, which are specialized structures that link the actin cytoskeleton to the surface integrin receptors and anchor cells to the extracellular matrix, and can alter their formation. cells with reduced levels of gelsolin migrate slower, while a reduction in flii levels leads to an increase in migration. both fibroblasts and keratinocytes, cells typically found in wounds, that have less flii migrate faster in vitro and in vivo and vice versa. the impaired wound healing seen in mice overexpressing flii could in part be due to the ability of flii to inhibit cell adhesion and migration. however, flii has several other functions, which could also contribute to its negative role in tissue repair. flii binds to hormone - activated nuclear receptors, including the estrogen and thyroid hormone receptor, as well as the coactivators grip1and carm1. flii positively regulates hormone - stimulated gene expression by the estrogen receptor through its gelsolin region and is involved in the recruitment of the chromatin remodelling complex sw1/snf to estrogen - responsive promoters. thus, flii has the ability to alter transcription in part through its gelsolin domains. our new data has shown that in fibroblasts flii is found in the nucleus of some but not all cells (fig . one and 2) and it is probably this pool of flii which may well be responsible for regulating transcription in these cells. our new data further suggests that flii may have distinct roles in different cell types or under specific conditions. we show that unlike fibroblasts, macrophages have little to no flii in the nucleus whether they were activated or not suggesting that its roles could differ depending on cell type or stimulus. in recent years it has becoming increasingly obvious that flii has an important role in dampening inflammation. unlike other gelsolin family members flii has 11 lrr domains in the n - terminus. these lrr domains share nearly 50% similarity to the lrr domains of the immune related receptor toll - like receptor (tlr) 4. they can bind to pathogen - associated molecular pattern (pamps) molecules, such as the gram - negative bacteria cell wall component lipopolysaccharide or to damage - associated molecular pattern (damps) molecules such as hmgb1 that are released from damaged and dying cells, as well as extracellular matrix cleavage products. their binding in turn activates intracellular tlr signaling pathways that ultimately lead to the secretion of cytokines. typically both damps and pamps are present in wounds. the importance of these domains in flii was first hinted at by mouse knockout studies of flii and other gelsolin family members. apart from flii, mice lacking members of the gelsolin family are viable, but with actin defects. in contrast, homozygous disruption of the flii gene in mice leads to very early failure of embryonic development with impaired cellularization and gastrulation of the embryo indicating that flii is essential developmental regulator and has additional important functions, which could be related to the role of the lrr domains. we have recently shown a pool of flii is located in the cytosol and this pool may in part be responsible for its role in dampening inflammation. although inflammation appears to be a necessary part of the normal adult wound healing process, excessive activation of tlr receptors and the subsequent increased or prolonged inflammatory response can induce considerable tissue damage which can lead to impaired healing. flii is upregulated in mouse wounds peaking around day 7 when the inflammatory stage of tissue repair is being switched off. whether flii is playing a role in dampening inflammation during tissue repair has yet to be tested in vivo. in macrophages flii is located in a complex with the tlr adaptor protein myd88 through its interaction with nucleoredoxin. binding of flii to this complex inhibits myd88 binding to tlr4, which in the inhibition tlr signaling pathways and reduces cytokine secretion. we recently found a pool of flii localized to late endosomes / lysosomes in fibroblasts and macrophages where it may also have a role in dampening inflammation. flii binds to caspase-1 and in doing so inhibits the maturation of the cytokine pro - interleukin-1 to pro - interleukin-1 in macrophages, thus reducing its secretion. exactly where in the cell pro - interleukin-1 is cleaved to form the mature secreted form is controversial; however, there is data to suggest it may take place in the lysosome and that the mature form can be secreted from this compartment. flii was thought to be solely an intracellular protein, however, our recent study has shown that in vitro flii is constitutively secreted by at least two cell types typically found in wounds; macrophages and fibroblasts. this secretion from fibroblasts can be upregulated in response to wounding and by macrophages in response to lps stimulation. the upregulation in secretion after wounding suggest this pool of flii may play a role during the repair process. in macrophages flii localizes to late endosomes / lysosomes but not to compartments typically associated with the classical secretory pathway, for example the golgi complex in macrophages. similar are shown here for primary fibroblasts (figs . 1 and 2). flii does not colocate with the trans - golgi network and recycling endosome - associated snare protein vti1b in primary fibroblasts (fig . however, a pool of flii colocalizes with the lysosomal enzyme cathepsin d in these cells ( fig . our recent data shows that flii is secreted from macrophages via late endosomes / lysosomes in a manner regulated by rab7 and stx11 . this data suggests that flii may therefore not only affect cellular activities via its intracellular / nuclear functions but it may also have important extracellular activities . primary fibroblasts were fixed with methanol, immunostained for flii ( mouse anti - flii antibody) in combination with the recycling endosome snare protein vamp3 (a) or the trans - golgi complex and recycling endosome snare vti1b (b). (a) primary fibroblasts were fixed with methanol, immunostained for flii (mouse anti - flii antibody) and the late endosomal / lysosomal enzyme cathepsin d (catd). flii co - localizes with cathepsin d in late endosomes / lysosomes in fibroblasts. in vivo given flii s important role in wound healing we have now looked to see whether flii is secreted into wound fluid from a number of sources. we find that secreted flii is also present in acute wound fluid from patients undergoing abdominoplasty and in blister fluid as well as in chronic wound fluid taken from patients with venous leg ulcers (fig . exactly what role flii is playing in the wound fluid is currently unclear ; however our suggest that flii can form a complex with the bacterial cell wall protein lipopolysaccharide ( lps). an antibody to the first llr domain is able to inhibit formation of this complex suggesting that the lrr region might be involved in this process. altering the level of secreted flii in the media showed that flii can negatively influence the lps induced production and secretion of cytokine, such that cells stimulated with lps in the presence of media with higher levels of flii have reduced production and secretion of tnf. the clinical investigations were conducted under approval from the women s and children s health network human research ethics committee, adelaide, australia, in accordance to the declaration of helsinski principles and with written informed consent. (a) wound fluid collected from patients undergoing abdominoplasty, from blister fluid and from patients with venous leg ulcers was immunoblotted for flii and albumin. flii is secreted into both acute and chronic wounds. prolonged or augmented inflammation can induce significant tissue damage unfavorable to the repair process thus the body has developed mechanisms that finely tune and regulate tlr activation. for example , surface tlr expression is downregulated after activation and at the same time soluble tlrs are secreted that compete with their membrane - associated forms for binding to ligands, thus limiting the stimulation of tlr signaling and inflammation. it is possible given the timing of flii s upregulation after injury that flii could be potentially playing a role in limiting the inflammatory response both from within the cells and in the extracellular matrix. it will be interesting in the future to see whether this is the case.

intracellular flightless i (flii), a gelsolin family member, has been found to have roles modulating actin regulation, transcriptional regulation and inflammation. in vivo flii can regulate wound healing responses. we have recently shown that a pool of flii is secreted by fibroblasts and macrophages, cells typically found in wounds, and its secretion can be upregulated upon wounding. we show that secreted flii can bind to the bacterial cell wall component lipopolysaccharide and has the potential to regulate inflammation. we now show that secreted flii is present in both acute and chronic wound fluid.

to evaluate the association of elevated serum lipids with retinal hard exudates formation, the occurrence clinically significant macular edema (csme), occurrence and severity of diabetic retinopathy (dr) and loss of vision in type 2 diabetics. type 2 diabetic patients seeking ocular evaluation for diabetic retinopathy were included in this cross - sectional study. they were assessed for presence and severity of diabetic retinopathy (dr), presence of hard exudates, clinically significant macular oedema (csme) and best corrected visual acuity (bcva). totally 330 patients were included, of which 141/330 had diabetic retinopathy of any grade. retinal hard exudate formation, was found to have statistically significant correlation with the presence of dyslipidemia (p=0.02), increased total cholesterol (p=0.002) and ldl levels (p=0.001). on multivariate analysis, after correcting for duration, glycemic control and albuminuria, increased cholesterol remained significantly associated with increased hard exudate formation (p=0.02). elevated cholesterol also showed independent association with visual loss (p=0.04). the occurrence csme showed a statistically significant correlation with dyslipidemia (p=0.04) and increased ldl levels (0.04), which did not persist on multivariate analysis. elevated serum lipids showed a significant association with retinal hard exudate formation, csme and loss of vision in type 2 diabetics. lipid lowering agents may help in reducing the occurrence of these retinal findings and loss of vision in diabetic patients. while correlation between the various components of serum lipids and increased hard exudate formation and clinically significant macular edema (csme) has been demonstrated by some studies, others have failed to do so. in addition the role of dyslipidemia in the in the severity of retinopathy is still unclear. the aim of this study was to evaluate the relationship between the various components of serum lipids with retinal hard exudate formation, csme and the occurrence and increasing severity of diabetic retinopathy. all patients referred to the department of ophthalmology of our tertiary care hospital (over a period of 18 months), for evaluation and management of diabetic retinopathy (dr), after informed consent were included into this cross sectional study. inclusion criteria were as follows: type 2 diabetesfitness to undergo a dilated fundus examination and fundus photograph. exclusion criteria were as follows: pregnancy, accelerated hypertension, active infection, co - existing ocular disorders like uveitis, opaque or hazy mediaretinal disorders like retinal vein / artery occlusions, retinitis pigmentosa, vitreoretinal degenerations and dystrophies, high myopia andrecent ocular surgeries (< 6months). accelerated hypertension, co - existing ocular disorders like uveitis, opaque or hazy media retinal disorders like retinal vein / artery occlusions, retinitis pigmentosa, vitreoretinal degenerations and dystrophies, recent ocular surgeries (< 6months). best - corrected visual acuity (bcva) was assessed using illuminated snellen's chart. the bcva of the worst eye was utilized for analysis converting it to decimal equivalent for the purposes of statistical analysis. detailed fundoscopy was done both with indirect ophthalmoscope with 20d lens and slit lamp biomicroscopy with 78d lens. a stereoscopic 30-degree color photograph centered on the macula was obtained using topcon fundus camera. patients were divided into two groups; group 0: without retinopathy, group 1: with retinopathy of any stage, for the purpose of deriving the occurrence of retinopathy. for grading the severity of retinopathy, group i patients were further grouped using the modified early treatment of diabetic retinopathy study (etdrs) protocol as follows: group 1 patient with mild - moderate non - proliferative diabetic retinopathy (npdr), group 2 patients with severe npdr and group 3 patients with proliferative diabetic retinopathy (pdr). grading of hard exudates was done based on wisconsin grading, by comparing patients retinal findings with the standard photographic plates 3, 4 and 5. then they were grouped as group 0 no retinopathy, group 1 patients with retinopathy but no hard exudate, group 2 patients with retinopathy but hard exudates less than or equal to standard plate3, group 3 less than or equivalent to standard plate 5 and group 4 less than or equivalent to plate 4. patients were assessed for the presence of clinically significant macular edema using slit - lamp biomicroscopy assessment with a 78d lens. the definition utilized in diagnosing csme was the presence of one or more of the following retinal thickening at or within 500 micron of center of maculahard exudates at or within 500 micron of center of the macula if associated with adjacent retinal thickening.zone or zones of retinal thickening 1 disc area in size, at least part of which is within one disc diameter of center of macula. retinal thickening at or within 500 micron of center of macula hard exudates at or within 500 micron of center of the macula if associated with adjacent retinal thickening. zone or zones of retinal thickening 1 disc area in size, at least part of which is within one disc diameter of center of macula. patients were then grouped as either group 0 no retinopathy, group 1 retinopathy present but no features of csme and group 2 csme present. serum lipid measurements were done using fasting samples, to analyze total cholesterol, cholesterol components and triglycerides utilizing the dade dimension series using photometric enzymatic method. for the purpose of analysis dyslipidemia was defined as serum total cholesterol > 160mg / dl, triglyceride levels > 150mg / dl, ldl levels > 100mg / dl and hdl<40 for men and < 50 for women mg / dl according to ncep expert panel. there were 210 males and 120 females, with an age range of 32 - 85 yrs and mean (sd) of 56.41(+9.91) years. diabetic retinopathy of any severity was found in 141/330(42.7%) patients, with mild to moderate npdr in 86/330(26.1%), severe npdr in 28/330 (8.5%) and pdr in 27/330(8.2%). of the 141 with diabetic retinopathy, 57/141 had mild hard exudate formation and 38/141 had grade 2 or harder exudate formation. csme was present in 58/141 (41.1%) retinal hard exudate formation was found to have statistically significant correlation with the presence of dyslipidemia (p=0.02), increased total cholesterol (p=0.002) and ldl levels (p=0.001) and the correlation with triglyceride levels showed a trend towards significance (p=0.07) on multivariate analysis, increased total cholesterol showed a statistically significant association with increased retinal hard exudate formation (p=0.02), whilst the other variables did not. the occurrence csme showed a statistically significant correlation with dyslipidemia (p=0.04) and increased ldl levels (0.04), which did not persist on multivariate analysis. neither the occurrence of dyslipidemia nor the increased levels of the various components of serum lipids showed a statistically significant correlation with the occurrence and increasing severity of diabetic retinopathy. elevated total cholesterol also showed a statistically significant correlation with decreased bcva (p=0.01) and this association remained, even on multivariate analysis (p=0.02). the correlation of elevated ldl with decreased bcva showed a trend towards significance (p=0.06). in our study we have found that elevated cholesterol were significantly associated with retinal hard exudate and reduced visual acuity. elevated ldl cholesterol and presence of dyslipidemia showed association with csme and retinal hard exudates. these find concurrence with studies like the etdrs and wesdr, while they contrast with findings of ausdiab study. like the of our study, the wesdr study did not find a correlation between serum lipids and the incidence and increasing severity of diabetic retinopathy. the diabetes control and complications trial (dcct) however showed a relationship with the occurrence of retinopathy and elevated very low and low density lipoproteins. in some of our patients even with grossly abnormal lipids there was retinopathy indicating that abnormal lipids may not be the only risk factor. some recent studies have shown lipid lowering drugs to significantly cause regression of hard exudate deposits and improvement in vision. although the existing data including ours is observational, they suggest serum lipid lowering may help in preventing visual loss. in our study findings has added to the growing evidence that dyslipidemia and specifically increased total cholesterol and ldl are significant risk factors for the development of retinal hard exudates, csme and decreased vision.

aim: to evaluate the association of elevated serum lipids with retinal hard exudates formation, the occurrence clinically significant macular edema (csme), occurrence and severity of diabetic retinopathy (dr) and loss of vision in type 2 diabetics.materials and methods: type 2 diabetic patients seeking ocular evaluation for diabetic retinopathy were included in this cross - sectional study. they were assessed for presence and severity of diabetic retinopathy (dr), presence of hard exudates, clinically significant macular oedema (csme) and best corrected visual acuity (bcva). retinal findings were correlated to serum lipids levels using univariate and multivariate analysis.:totally 330 patients were included, of which 141/330 had diabetic retinopathy of any grade. retinal hard exudate formation, was found to have statistically significant correlation with the presence of dyslipidemia (p=0.02), increased total cholesterol (p=0.002) and ldl levels (p=0.001). on multivariate analysis, after correcting for duration, glycemic control and albuminuria, increased cholesterol remained significantly associated with increased hard exudate formation (p=0.02). elevated cholesterol also showed independent association with visual loss (p=0.04). the occurrence csme showed a statistically significant correlation with dyslipidemia (p=0.04) and increased ldl levels (0.04), which did not persist on multivariate analysis. however the there was no correlation with the occurrence and severity of diabetic retinopathy: elevated serum lipids showed a significant association with retinal hard exudate formation, csme and loss of vision in type 2 diabetics. lipid lowering agents may help in reducing the occurrence of these retinal findings and loss of vision in diabetic patients.

vaginismus is defined according to dsm iv - tr as recurrent or persistent involuntary spasm of the musculature of the outer third of the vagina, which interferes with coitus and causes distress and interpersonal difficulty. the inclusion of spasm in the definition has been questioned as it has not been consistently documented. it has been classified as primary when the woman has never experienced non - painful penetrative sexual intercourse and as secondary when she has experienced non - painful penetrative vaginal intercourse in the past. vaginismus is comorbid with dyspareunia; sensitivity and specificity of the distinction between the two, however, has been doubtful. pain due to inflammation, infections, trauma, radiotherapy, muscular and neurological causes may contribute to psychological causes. classical psychoanalytic theory conceptualized vaginismus as a conversion disorder caused by unresolved psychosexual conflicts in early childhood. vaginismic women have been characterized as fixated or regressed to the pre - oedipal or oedipal stages. vaginismus is believed to be a psycho - physiologic disorder due to fear from actual or imagined negative experiences with penetration and/or organic pathology. women with vaginismus have also been noted to have a lack of sex education. in this case report , we discuss the successful treatment of vaginismus with sex therapy based on a model proposed by keith hawton. a 25-year - old lady sought consultation with the psychiatry outpatient services for sexual dysfunction. she reported of tightness of vagina and introital pain while attempting sex with her husband. patient's husband disclosed that few months back when they got engaged, she had expressed apprehensions about having painful sexual intercourse. after the wedding, patient had postponed attempts at penetrative intercourse for 10 days. whenever penetration was attempted, she would not part her legs and begin to cry. she had initially consulted gynecologists who diagnosed the condition as primary vaginismus. on their advice, after about 6 weeks, the couple consulted psychiatry services on advice by the gynecologist. the patient reported of sadness, ideas of worthlessness and depressive symptoms over the past 56 weeks. the family of origin was religious; sex was not openly discussed in keeping with local cultural norms. her mental status examination revealed depressed affect, ideas of hopelessness and worries about non - consummation of marriage. the patient underwent five sessions (weekly) of sex therapy with the first author being the primary therapist. the sessions included the husband and the couple initially participated jointly in educative sessions with the primary therapist. the exercises were carried out at home by the patient and her husband. in the first session, normal reproductive anatomy and physiology of the sexual act were explained. the patient was made comfortable with her genitals by asking her to look at the area in the mirror. kegel's exercises help control the pubococcygeus muscle which surrounds the entrance to the vagina. in the next couple of sessions , she was advised to insert her fingers into her vagina and move them around, initially one finger, later two fingers. only after the patient became comfortable with these over three sessions, vaginal containment with lubrication and local anesthesia provided by 5% lignocaine jelly was advised. vaginal containment involved the patient in female superior position, guiding penile penetration with her hands and the couple remaining still, concentrating on the pleasant sensations they experience. after a month of initiating therapy, the patient was able to indulge in normal sexual intercourse without the need for local anesthesia. james marion sims first coined the term vaginismus in 1862 at an address to the obstetrical society of london. vaginismus is thought to be one of the most common female psychosexual dysfunctions but the exact prevalence rate among the general population is not known. however, in sexual dysfunction clinics, the rates vary from 5 to 17%. this condition can in significant interpersonal problems and marital discord. botulinum toxin injection and hypnosis are the other approaches that have been tried. there are no randomized controlled trials available to garner evidence for treatment of vaginismus. discussed here, an eclectic approach was used involving education, graded insertion of fingers, kegel's exercises and usage of anesthesia with vaginal containment. the use of ssri escitalopram may also have aided the therapy by providing anxiolysis and relief from depression. the report demonstrates a successful approach toward managing vaginismus in a clinical setting. there is a need for randomized controlled trials to establish efficacy and bolster these approaches.

vaginismus is defined as recurrent or persistent involuntary spasm of the musculature of the outer third of the vagina, which interferes with coitus and causes distress and interpersonal difficulty. in this report , we describe the successful treatment of vaginismus in a 25-year - old lady based on a model proposed by keith hawton. the eclectic approach involved education, graded insertion of fingers, kegel's exercises and usage of local anesthesia with vaginal containment along with the prescription of escitalopram.

the determination of an accurate working length is a critical step in endodontic therapy. establishing the working length at the apical constriction the apical constriction (minor apical diameter) is the narrowest apical portion of the root canal with a variety of morphological variations that make its identification unpredictable. electronic devices for assessing the root canal length have gained popularity and eliminate many of the problems associated with radiographic measurements. based on suzuki's discovery that electrical resistances between the periodontal ligament and oral mucosa registered constant values of 6.5 k, sunada in 1962 developed the first electronic apex locator (eal). since then, different generations of eals have been developed. whilst the simplest devices measure resistance, other devices measure impedance using either high frequency, two frequencies, or multiple frequencies. in addition, some systems use low frequency oscillation and/or a voltage gradient method to detect the canal terminus. kyoto, japan ), a dual frequency device, based on the ratio method , has been investigated extensively as regards its accuracy and its efficacy in the presence of various irrigants. sybronendo mini apex locator (sybronendo, sybron dental, glendora, ca, usa) is multifrequency based and is also claimed to be accurate in the presence of various intracanal conditions, but has not been investigated much. thus, the purpose of this in vitro study was to compare the time tested root zx with the newly introduced sybronendo mini apex locator in the presence of various intracanal irrigants. sixty extracted, straight, single - rooted permanent human teeth with mature apices were selected for this study. residual soft tissue on the root surface was removed by soaking the teeth in 5% sodium hypochlorite (nice chemicals, india) for 3 h. the type i canal configuration was confirmed by using digital radiograph (gendex, dentsply) in mesiodistal and labiolingual planes. teeth with resorption, curvatures, open apices, or radiographically invisible canals were excluded. the teeth were decoronated at the level of cementoenamel junction with a diamond disc to allow access to the root canal and to provide a stable reference for all measurements. the coronal portion of each canal was preflared using sequential gates glidden drills # 4, # 3, and # 2 (mani inc ., japan), irrigated with saline and pulp extirpated with a barbed broach (spirocolorinox, dentsply). teeth were numbered 160 and the actual length (al) was determined by introducing a size 10 or 15 k - file (mani inc ., japan) into the canal until its tip emerged through the major apical foramen at 10 magnification under a stereomicroscope (wild m2z, heerbrugg, switzerland). the long axis of the tooth was placed perpendicular to the line of sight and the tip of the file was positioned tangential to the major apical foramen. after carefully adjusting the silicone stopper to the reference point, the file was withdrawn from the root canal, and the distance between the file tip and silicone stopper was measured with a digital caliper (mitutoyo co., japan) to the nearest 0.5 mm; 0.5 mm was subtracted from this length and recorded as al. to simulate the periodontium, this study used the in vitro model as designed by donnelly. a polystyrene specimen bottle (40 ml) was filled with warmed gelatin solution and refrigerated for 2 h to allow gelatin to set. the apical two - third of the root was embedded in gelatin, and the tooth was stabilized to the lid of a container with auto - polymerizing resin as described by higa et al. the lip electrode was also placed in gelatin through another opening in the lid. experimental set - up used in the study the irrigants tested were: 0.9% saline (denis chem ., india), 1% sodium hypochlorite (naocl) (nice chemicals pvt . ltd ., india), 2% chlorhexidine digluconate (chx) (dentochlor, ammdent, india), and 17% disodium edetate solution (edta) (canalarge, ammdent, india). two eals tested in this experiment were: root zx (j. morita mfg corp ., kyoto, japan) and sybronendo mini apex locator (sybron endo, sybron dental, glendora, ca, usa). depending on the size of the canal, # 15 or # 20 k - file (mani inc ., japan), was attached to the file holder and introduced into the canal. for root zx , the meter's 0.5 mm reading was set between the apex and 1 (factory setting) as indicated by a flashing bar and was used for electronic measurements. for each one of the devices, the file was gently inserted into the root canal until the apex signal was displayed. the file was then gently retracted until the display showed a flashing image of the root canal and a flashing bar between apex and 1 (0.5 reading) for root zx and 0.5 blue led was on for sybron mini. the silicone stopper on the file was carefully adjusted to a reference point, and the file was withdrawn to measure the distance between the silicone stopper and the file tip to the nearest 0.5 mm. the canal length was assessed twice by two operators individually for each of the eal and individual irrigants, amounting to four readings per tooth. to prevent cross - contamination: (a) fresh gelatin was used for the individual irrigant, and (b) the root canals were irrigated with ethanol and dried with paper points. the obtained (in millimeters) were recorded. the difference between the median of electronically measured length (el) and the al were calculated for each tooth for all irrigants, and al0.5 mm was used to evaluate the accuracy of the two eals. the relative conductivity and the ph of irrigants were also determined using a calibrated conductivity meter (conductivity meter 304, systronics ltd, india) and a digital ph meter (digital ph meter 335, systronics ltd, india). a paired t - test was employed to statistically analyze the significance of mean difference between el and al. one - way anova was employed to assess the difference among various irrigants in their estimations of the canal length. inter operator agreement was calculated through the kappa co - efficient range from 0.7 to 0.88 which are highly significant for all the four irrigants for both the apex locators. the analysis was performed with statistical and presentational system software (spss 16.0, spss inc, chicago, il). the mean and standard deviation of actual length (al) and electronic length (el) measurements obtained by root zx and sybron mini in the presence of various irrigants are shown in table 1. the mean differences between the electronic and the al were 0.002 mm and 0.21 mm for root zx and sybron mini, respectively. the effect of irrigant on the canal length determinations measured with root zx and sybron mini is as shown in table 2. mean (sd) of al and el measurements with root zx and sybron mini in the presence of various irrigants mean difference between the actual length and the electronically determined length by root zx and sybron mini in the presence of various irrigants in the root canal (mm) the measurements of root zx in the presence of saline (p=0.209) and 1% naocl (p=0.443) were closer to the al and with no significant difference between them, while significant differences were observed with 2% chx (p=0.001) and 17% edta (p=0.005). sybron mini, in the presence of saline, 1% naocl and 17% edta, gave measurements which were shorter than the al and the were significant (p=0.000), whereas, 2% chx was more accurate (p=0.542) and without significance. although statistically significant differences existed between the irrigants, the majority of the readings were within the acceptable range of 0.5 mm for both eals. the overall accuracy of measurements within 0.5 mm of al by root zx and sybron mini was 88.3% and 87.5%, respectively. the distribution of measurements of root zx and sybron mini with various irrigants is presented in table 3. distance between al and el (al - el) with various irrigants for root zx and sybron mini the of conductivity testing of the irrigants ranked from most to least conductive were: 1% naocl>17% edta>0.9% saline>2% chx, and ph from high to low: 1% naocl>17% edta>0.9% saline>2% chx. the first - generation eals were resistance - based and the second - generation eals were impedance - based apex locators. the main shortcomings of these eals included poor accuracy in the presence of fluids and pulp tissue, and the need for calibration. the frequency - based third - generation eals have more powerful microprocessors and are able to process mathematical quotient and algorithm calculations required to give accurate readings. kyoto, japan ) is a third - generation eal that uses dual frequency and comparative impedance principle is based on the ratio method for measuring canal length. this method simultaneously measures the impedance values at two frequencies (8 and 0.4 khz) and calculates a quotient of impedances. root zx requires no calibration, and can be used when the canal is filled with a strong electrolyte. the sybronendo's mini apex locator uses a sophisticated, multifrequency measurement system to calculate the distance from the tip of the file to the foramen by measuring changes in impedance between two electrodes. according to the manufacturer, an all - digital signal and an 80% shorter cable than other eals the fourth - generation apex locators do not process the impedance information as a mathematical algorithm, but instead they take the resistance and capacitance measurements separately and compare them with a database to determine the distance to the apex of the root canal. however, there is still a concern as to whether high electroconductive irrigants such as saline, anesthetic solution, and sodium hypochlorite can affect the of these new - generation eals performance. the gelatin model was used in this in vitro study to simulate the periodontium, has the advantage of simplicity, ease of the use and the ability to have a strict control over the experimental conditions tested. it is generally accepted that apical constriction is on average located 0.51.00 mm short of the apex. this study employed the 0.5 reading (apical constriction) on the display of root zx. in addition, the 0.5 reading on the display of sybron mini was suggested as apical constriction and used as an apical endpoint for all the length measurements. the manufacturer of sybron mini does not correlate any histologic landmark with the readings. to evaluate the accuracy of eals, the 0.5 mm range from al was chosen, which is considered clinically acceptable and highly accurate. in vivo studies have shown the accuracy of root zx to be varying from 82.3% to 96.2% within 0.5 mm. the of our study for root zx is in general agreement with a previously reported in vitro study. the overall accuracy of sybron mini in this study with various irrigants was 87.5%; however, with naocl the accuracy was 93.3% comparable to a previous study of 97.5% accuracy with naocl as irrigant. the difference in electroconductivity of various irrigants could be the reason for lowered overall accuracy of sybron mini. the literature review revealed that there are no studies evaluating the accuracy of sybron mini in the presence of various irrigants. the irrigants investigated were: 1% naocl, with tissue solvent and antibacterial activity; 2% chx with antibacterial activity even against enterococcus faecalis; 17% edta, a chelator which facilitates canal preparation and removes the smear layer; and normal saline with only flushing action served as a control. 1% naocl was used in this study because in vitro studies found that, 1% naocl dissolved pulp tissue entirely in the course of an endodontic treatment session and studies indicate that the accuracy of eals is not significantly influenced by different concentrations of naocl. in the presence of saline , the accuracy of root zx and sybron mini within 0.5 mm was 95%, which was in agreement with a previous study, and 88.3%, respectively. 1% naocl found the accuracy of root zx within 0.5 mm to be 75%, while weiger et al. de camargo et al. found the accuracy of sybron mini with 1% naocl to be 97.5% (1 0.5 mm from total length, meter reading 1), while dassuno et al. the of our study with 1% naocl with root zx and sybron mini within 0.5 mm were 90% and 93.3%, respectively. with 2% chx in the canals the accuracy of root zx and sybron mini was 86.7% and 93.3%, respectively, and with 17% edta solution this was 81.6% and 75%, respectively. jenkins et al. found the accuracy of root zx was not influenced by 0.12% chx or 17% edta. found measurements with 17% edta with root zx were similar to dry canals or filled with 3% naocl or normal saline. there were no studies to compare the accuracy of sybron mini with 0.9% saline, 2% chx, and 17% edta. the 1% naocl was most electroconductive (66 ms) and had a highly alkaline ph (11.72), followed by 17% edta (40 ms, ph 7.01) and accordingly the measurements with these solutions were short of al, with both eals. the 2% chx had poor electroconductivity (1 ms, ph 6.5) and measurements were longer with both root zx (p=0.001) and sybron mini (p=0.542).. the better performance of sybron mini with 1% naocl and 2% chx could possibly be due to its multifrequency mechanism and shorter transmission line. the major limitation of this in vitro study is the length measurements recorded to the nearest 0.5 mm, which is from a statistical point of view gross; since an error tolerance of 0.5 mm was used to assess the accuracy of the eals. better statistical could have been achieved if the measurements were made to the nearest 0.01 mm. the authors have used 0.5 mm accuracy for the length measurements since this was easy to transfer and reproduce clinically. the obtained in this in vitro study can not be applied to the clinical situation, but can provide an objective assessment of a number of variables that are not practical to test clinically. at best the eals should be used as an adjunct, and not as the only method to determine the canal length in endodontic therapy. under the conditions of this in vitro study, root zx was more accurate compared to sybronendo mini apex locator.with 1% naocl as irrigant, there was a tendency toward shorter measurement, whereas longer measurements were recorded with 2% chx for both the devices.sybronendo mini was more accurate with 1% naocl and 2% chx than root zx. root zx was more accurate compared to sybronendo mini apex locator. with 1% naocl as irrigant , there was a tendency toward shorter measurement, whereas longer measurements were recorded with 2% chx for both the devices. further, in vivo studies with different irrigants are needed to better evaluate the accuracy of sybronendo mini apex locator.

aim: this study was designed to compare the accuracy of root zx and sybronendo mini, electronic apex locators (eals), in the presence of various irrigants.materials and methods: sixty extracted, single - rooted human teeth were decoronated and the root canals coronally flared. the actual length (al) was assessed visually and teeth mounted in the gelatin model. the electronic length (el) measurements were recorded with both eals in the presence of 0.9% saline; 1% sodium hypochlorite (naocl); 2% chlorhexidine digluconate (chx), and 17% edta solution, at 0.5 reading on display. the differences between the el and al were compared.:the accuracy of el measurement of root zx and sybron mini within0.5 mm of al was consistently high in the presence of naocl and found to be least with edta.:el measurements were shorter with 1% naocl, whereas longer with 2% chx for both the devices. sybron mini was more accurate with 1% naocl and 2% chx than root zx.

during 20092013, a total of 31 adult foxes with signs of a neurologic disorder were brought to the rspca norfolk wildlife hospital in east winch, united kingdom. the foxes exhibited abnormal behavior, lack of fear, reduced alertness, aimless wandering, circling, facial muscle twitching, hind limb paresis, and visual abnormalities. cases were only detected when free - living foxes became debilitated and were taken to the wildlife rescue center. once in captivity, diseased foxes had good appetite and generally survived with no substantial disease progression or death, but they showed no evidence of natural recovery. after a few weeks, the foxes were usually euthanized because they did not respond to (nonspecific) medical treatment. samples were stored in 10% neutral buffered formalin and embedded in paraffin, and 4 m thick sections were stained with hematoxylin and eosin and evaluated for the presence of histologic lesions. all foxes had similar histologic findings consisting of chronic multifocal or diffuse lymphoplasmacytic meningoencephalitis oriented on the forebrain with a predilection for cortical gray matter (figure 1 ; table 1 ; technical appendix figure 1). characteristic histopathologic features were nonspecific perivascular cuffing, rod cell proliferation, spongiosis, neuronal necrosis, moderate to severe gliosis, neuronal satellitosis, and neurophagia. histopathologic changes suggested viral, protozoal, microsporidial, immune - mediated, or idiopathic disease. immunohistochemistry of brain samples was negative for canine distemper virus, canine adenovirus, borna disease virus, toxoplasma gondii, and neospora canium (data not shown). serologic test for canine distemper virus, rabies virus, n. canium, and tickborne encephalitis virus were negative, and ziehl - neelsen and giemsa staining for microsporidia were negative. minor white matter involvement, the duration of animal survival, and the current absence of documented rabies cases in the united kingdom eliminated rabies virus as the cause of the neurologic disorder. a ) multifocal, randomly distributed areas of severe encephalitis and meningitis in the cerebrum (original magnification 40). gray and, to a lesser extent, white matter of the cerebrum showed randomly dispersed areas of astrocytosis, gliosis, and infiltration with lymphocytes and plasma cells. blood vessels in affected areas show perivascular cuffing with distention of virchow - robin spaces with up to 10 layers of lymphocytes and plasma cells (arrow). axons in affected white matter showed degeneration, characterized by formation of spheroids, shrinkage, and fragmentation; axon sheaths containing microglia or macrophages; and presence of gitter cells in surrounding neuropil. cerebellum was mildly affected, and meninges, especially of the cerebrum, were frequently distended with lymphocytes and plasma cells. individual neuronal cell bodies were frequently surrounded by up to 5 glial cells (i.e., sattelitosis) and showed margination of nissl substance, hyperchromasia, degeneration, and necrosis. * bed, bedfordshire; cam, cambridgeshire; ct, cycle threshold values of real - time pcr; ess, essex; ffpe, formalin - fixed paraffin - embedded tissue; lei, leicester; lin, lincolnshire; nd, not determined; neg, negative; nor, norfolk; pos, positive; suf, suffolk. neurologic signs were abnormal behavior, lack of fear, reduced alertness, aimless wandering, circling, facial muscle twitching, progressive weakness of hind legs, and visual abnormalities. samples were analyzed by using a viral metagenomics approach with the 454 sequence platform (gs junior ; roche, basel, switzerland). taqman real - time pcr. serum samples from 6 of the foxes (vs71000016) were available for virus discovery studies. to perform the studies , we used a viral metagenomics approach with the 454 sequence platform (gs junior ; roche, basel, switzerland) as described previously (table 1). more than 22,000 reads were analyzed as described previously (technical appendix figure 2). the complete genome sequences of circoviruses from 3 foxes were obtained; the sequences were 99% identical at the nucleotide level (genbank accession nos . the fox circovirus genomes had an ambisense organization characteristic of circovirus ( technical appendix figure 3). phylogenetic analysis revealed that the genomes were closely related to those of the recently described canine circoviruses, displaying 92% amino acid identity in the rep protein and 89% nt sequence identity across the entire genome (technical appendix figure 4). on the basis of the suggested criteria demarcating species, the fox and canine circoviruses belong to the same species. a diagnostic real - time fox circovirus pcr was performed targeting the rep - coding sequence on 32 serum samples from foxes with and without neurologic signs (table 1). viral nucleic acid was extracted by using the magna pure lc total nucleic acid isolation kit (roche, indianapolis, in, usa) and amplified by real - time pcr by using primers vs756 (5-tccgagatagcc ggcgtggta-3), vs757 (5-cccggccacagatcaagtactta-3), and vs758 (5-fam - atccaactccggaggaggagga - tamra-3) and the taqman universal master mix (applied biosystems, foster city, ca, usa). in addition to samples vs71000016, another 14 fox serum samples were positive for fox circovirus, indicating that the virus had infected foxes in multiple counties in the united kingdom during past years (table 1 ; technical appendix figure 5). clinical data indicated that 77% of circovirus - positive foxes had signs of neurologic disease, compared with only 47% of circovirus - negative foxes (table 2). fox circovirus was present in male and female foxes and in adults and juveniles (table 2). in addition, fox circovirus was detected by real - time pcr in brain samples of 2 of 4 foxes with neurologic disease (vs7100017 and 19 ; cycle threshold value > 35) but not in the brain tissues of 2 foxes without disease. the detection of fox circovirus nucleic acid in the cerebrum of foxes with neurologic disease was confirmed by using the rnascope 2.0 in situ hybridization kit (advanced cell diagnostics, hayward, ca, usa) and a rep gene specific probe according to the manufacturer s instructions. multifocal fox circovirus rna signal was detected and associated with the aforementioned histologic lesions in the cerebrum (figure 2). specifically, rna signal was detected in mononuclear cells in perivascular cuffs, inflammatory infiltrates in the neuropil, and neuronal somata in cerebral gray matter of circovirus - positive foxes with neurologic disease. no circovirus signal was found in control foxes with lymphocytic cuffs due to other (known) viral infections or in control foxes without neurologic disease (figure 2). * or, neurologic signs were abnormal behavior, lack of fear, reduced alertness, aimless wandering, circling, facial muscle twitching, progressive weakness of hind legs, and visual abnormalities. specific transcripts in brain tissue of foxes with neurologic disease showing in situ hybridization of cerebrum with fox circovirus replication initiator protein gene specific probe (original magnification 200). the serum sample from this fox was negative for circovirus, and the animal did not exhibit signs of neurologic disease. both animals had neurologic disease, and their serum samples were positive for fox circovirus (see table 1 for more information regarding these foxes). black arrows indicate mononuclear cells in perivascular cuffs, blue arrows show inflammatory infiltrates in the neuropil, and red arrows point to staining in neuronal somata in cerebral gray matter of circovirus positive animals with neurologic disease. our findings indicate that circoviruses commonly cause systemic infections in wild foxes in the united kingdom and can be detected in the brains of foxes with neurologic disease. it has been suggested that circoviruses are involved in a plethora of diseases in pigs, dogs, and birds. the canine circovirus may be associated with development of vasculitis in dogs, and an overall virus prevalence in serum samples of 3% has been reported. however, we found that the prevalence of fox circovirus in serum samples from foxes with and without neurologic disease was much higher and more comparable to the prevalence of porcine circoviruses among pigs. instead, fox circoviruses may be associated with development of neurologic disease directly or as a contributory complicating cofactor. cycloviruses, which belong to a proposed new genus in the family circoviridae, were recently found in serum and cerebrospinal fluid of humans with paraplegia and acute infections of the central nervous system, suggesting that viruses from the family circoviridae may have neurologic tropism more commonly than previously anticipated. however, a causal link between circovirus infection and disease in humans and animals remains to be proven. because the prevalence of circoviruses in foxes was relatively high and closely related circovirus species seem pathogenic for both dogs and foxes, additional surveillance is warranted to clarify the epidemiology and pathogenicity of circoviruses in foxes. histopathologic features of brain tissues from foxes with possible circovirus - induced neurologic disease and relative abundance of broad taxonomic categories in metagenomic sequences obtained from fox serum samples.

a fox circovirus was identified in serum samples from foxes with unexplained neurologic signs by using viral metagenomics. fox circovirus nucleic acid was localized in histological lesions of the cerebrum by in situ hybridization. viruses from the family circoviridae may have neurologic tropism more commonly than previously anticipated.

she was diagnosed with subfoveal cnv secondary to age - related macular degeneration (amd) and the best - corrected visual acuity of the right eye was 20/50. pdt with verteporfin was performed according to the standard protocol of the treatment of age - related macular degeneration with photodynamic therapy investigation and repeated after 5 months.13 the visual acuity of the involved eye did not change. fifteen months after the second pdt, fluorescein angiography of the affected eye revealed persistent subfoveal cnv and the best corrected visual acuity remained 20/50 (fig . 1a, 2a). combined pdt according to the same standard protocol and 1.25 mg intravitreal bevacizumab injection was performed on the same day. one day after the treatment, the patient's vision had decreased to counting fingers. fundus examination and optical coherence tomography (oct) showed serous retinal detachment involving the macula (fig . , the patient was initiated on an oral steroid ( triamcinolone 24 mg # 1) to complete a two week course. one week into steroid therapy, the visual acuity remained the same, but oct findings of the right eye showed decreased serous retinal detachment (fig . 2c). the vision slightly improved to 20/200 upon completion of the two week steroid course and fluorescein angiography showed decreased leakage of fluorescein dye ( fig. there have been several reports about serous retinal detachment after pdt treatment.7,9,14 mennel et al.7 quantified transient serous retinal detachment in cnv after pdt using oct. kim et al.9 also suggested that serous retinal detachment might develop following pdt but might also resolve spontaneously several days following treatment. however, there is neither a published report of serous retinal detachment after the combined use of pdt and intravitreal bevacizumab injection nor following intravitreal bevacizumab injection alone. several mechanisms may be responsible for subretinal fluid accumulation after combined treatment with pdt and intravitreal bevacizumab injection. the pdt may induce fluid leakage from the cnv itself or damage of retinal pigment epithelium causing an alteration of the blood - retinal barrier.7,9 bevacizumab may cause instability of the intraretinal and subretinal fluid and subsequent serous retinal detachment by rapidly modulating the permeability and activity of the cnv.10,12 in our patient, there was no evidence of increased subretinal fluid after the first two treatments of pdt alone and the pdt protocol was the same for all three treatments. occurrence of the serous retinal detachment just after combined pdt and intravitreal bevacizumab injection suggests the interaction of these two modalities as a possible causal role. however, the definitive causation of serous retinal detachment in pdt alone, intravitreal bevacizumab injection alone or combined treatment can not be determined. a two week course of oral steroids was used to manage the serous retinal detachment after the combined treatment of pdt and intravitreal bevacizumab injection. kim et al.9 injected triamcinolone into the vitreous in a patient with serous retinal detachment following pdt, whereas, we elected to use a more conservative management with an oral steroid. in , combined pdt and intravitreal bevacizumab injection can be associated with serous retinal detachment which may cause sudden visual loss. additional studies are needed to establish the standard protocol, safety and complications regarding the combined treatment of pdt and intravitreal bevacizumab injection.

we report a case of serous retinal detachment following combined photodynamic therapy (pdt) and intravitreal bevacizumab injection in subfoveal choroidal neovascularization (cnv).a 53-year - old woman was diagnosed with subfoveal cnv secondary to age - related macular degeneration (amd) and treated with combined pdt and intravitreal bevacizumab injection. one day after treatment, the patient experienced a sudden decline of vision and optical coherence tomography (oct) showed serous retinal detachment involving the macula. she was managed conservatively with an oral steroid beginning on the second day of the combined treatment and the subretinal fluid started to decrease one week following the initiation of steroids.this case suggests that combined pdt and intravitreal injection of bevacizumab can be associated with serous retinal detachment. additional studies are needed to establish the safety and complications following this treatment regimen.

to assess attitudes and practices of documentation and coding education for emergency medicine residents (emrs). questions regarding documentation teaching methods were formulated into online surveys for program directors (pds) and emrs. fifty - three of 104 pds and 446 of 576 emrs who received the survey completed it. although 93% of emrs and 63% of pds believe proper chart documentation is an important skill, only 18% of emrs and 25% of pds believe their program s teaching was adequate. emrs who received formal lectures and feedback reported higher comfort levels with their knowledge of documentation (3.3 1.1 vs. 4.5 1.4, p < 0.05) than those who did not receive formal lectures and feedback. although most physicians who were surveyed agreed that documentation and coding is a vital skill, many emrs and pds report inadequate instruction. resident education may benefit from broader implementation of formal lectures and formal feedback on documentation and coding skills.

purposes: to assess attitudes and practices of documentation and coding education for emergency medicine residents (emrs).methods: questions regarding documentation teaching methods were formulated into online surveys for program directors (pds) and emrs.:fifty-three of 104 pds and 446 of 576 emrs who received the survey completed it. although 93% of emrs and 63% of pds believe proper chart documentation is an important skill, only 18% of emrs and 25% of pds believe their program s teaching was adequate. eleven percent of emrs reported that they were comfortable with their knowledge of documentation. emrs who received formal lectures and feedback reported higher comfort levels with their knowledge of documentation (3.3 1.1 vs. 4.5 1.4, p < 0.05) than those who did not receive formal lectures and feedback.:although most physicians who were surveyed agreed that documentation and coding is a vital skill, many emrs and pds report inadequate instruction. resident education may benefit from broader implementation of formal lectures and formal feedback on documentation and coding skills.

in 2008 a 57-year old man was referred for treatment of polycythemia vera (pv). one year earlier he had been admitted with symptoms resembling an episode of transitory cerebral ischemia (tci). the patient also had a history of multiple sclerosis (ms), vitamin b12 deficiency and tobacco smoking. the ms was not being treated at this point and the b12 deficiency was treated with cyanocobalamin 1 mg / day. at that time the hemoglobin concentration (hgb) was elevated at 18.5 g / dl, the hematocrit (hct) was 54%, and the white blood cell count (wbc) was 11.010/l. a cerebral ct - scan showed a hypodense area compatible with an infarction of indeterminable age. the patient was treated with acetylsalicylic acid 75 mg / day, dipyridamole 200 mg 2 times / day along with simvastatin 40 mg / day. the patient was phlebotomized once before discharge. unfortunately, although the elevated blood cells should have raised the suspicion of pv, the patient was not referred to a department of hematology, and no jak2-v617f mutation analysis was done at this time. the patient was referred to the department of hematology in 2008 by his general practitioner because of sustained elevated hgb - concentrations and platelet counts along with fatigue. at the time of the pv diagnosis the wbc was 12.010/l, and the platelet count 48510/l, the mcv 91 fl and b12 vitamin was elevated at 882 pmol / l. the red cell mass and plasma volume were both expanded, and serum - epo was lowered at 1 a bone marrow biopsy was compatible with pv with a slightly hypercellular bone marrow with panmyelosis and depleted iron stores, displaying no reticulin fibrosis and a peripheral blood - smear was without leucoerythroblastosis. 1 illustrates the treatment and responses in hematological parameters along with the jak2-v617f allele burden. approximately 13 months after the pv - diagnosis, treatment with hydroxyurea (hu) 500 mg / day was initiated in order to reduce the need of phlebotomies and to normalize elevated leukocyte and platelet counts. eighteen days later the patient was admitted to a department of neurology with convulsions and fever, being suspected of an attack of ms. clinically a pneumonia was suspected, and a chest x - ray revealed multiple pulmonary infiltrates. it was concluded that the alveolitis likely was induced by hu, since the patient steadily improved after hu was discontinued. at follow - up in the hematological out - patient clinic the patient had a normal hct and the platelet count consequently, treatment with alendronate 70 mg / week was initiated and continued for 18 months, until the patient changed treatment to teriparatide a pth analog for two years. afterwards alendronate was reintroduced. during these 56 months, after initiation of alendronate, the patient was largely in complete hematological remission (the platelet count was temporarily above 40010/l on some occasions) without need for further phlebotomies, and the jak2-v617f mutation status 44 months after pv - diagnosis revealed a marked decrease in the allele burden from 64.0% to 21.4% (fig . 1). the patient had no need of phlebotomies or cytoreductive treatment to reduce elevated cell counts, and no thrombohemorrhagic events occurred. subsequent serial measurements of the jak2-v617f allele burden have shown sustained values below 20% and even below 10% on some occasions. two follow - up bone marrow biopsies at 33 and 53 months after institution of statin and bisphosphonate combination therapy (64 and 84 months after pv - diagnosis) displayed stable disease with remaining features of pv. despite this, the vascular dilatation found in the initial bone marrow biopsy had disappeared in the two following biopsies (fig . this case report demonstrates for the first time a remarkable hematological and molecular response with a marked sustained decrease in the jak2-v617f allele burden during statin and bisphosphonate combination therapy of a patient with pv . both agents potently inhibit the mevalonate pathway, which has been suggested as a therapeutic target in multiple cancer types and also in the treatment of mpns . an association between chronic inflammation and the development and progression of mpns has been proposed, and both statins and bisphosphonates possess potent anti - inflammatory, anti - neoplastic, anti - thrombotic and anti - angiogenic properties unrelated to the cholesterol lowering effects of statins,, . these effects are probably mediated by inhibiting the synthesis of the important isoprenoid intermediates such as farnesylpyrophosphate ( fpp) and geranylgeranylpyrophosphate (ggp). when activated these pathways induce increased cellular growth, proliferation, migration and oxidative stress. importantly, simvastatin (and other statins) induce apoptosis and inhibit jak2-v617f - dependent cell growth in mpn cell lines. furthermore, the mpn - associated jak2-v617f kinase localization to lipid rafts and its signaling is inhibited by statins. also, the pro - inflammatory cytokines tnf - alpha and il-6 are decreased during statin treatment in a wide variety of inflammatory conditions, tnf - alpha being able to facilitate clonal expansion of jak2-v617f - positive cells in mpns. vegf mediated neo - angiogenesis may in part be responsible for the bone marrow fibrosis observed in myelofibrosis,. this effect may be observed in the bone marrow of this patient, where the cd34 staining revealed vascular dilatation in 2008 but not in the following two biopsies. release of vegf from the tumor cells may be responsible for the vascular dilatation observed. regarding the reduction in jak2-v617f allele burden, the patient only received treatment with hu for 18 days during the initial disease course. thus, it is reasonable to conclude, that the ensuing marked decrease in the jak2-v617f allele burden over the first 44 months after the pv diagnosis was not related to hu - treatment. although hu has been shown to reduce the jak2-v617f allele burden in some studies, other studies have failed to reproduce this effect. importantly, the effect of hu on peripheral blood cell counts and the jak2-v617f allele burden is but temporary with rising cell counts within a few days after hu being discontinued. we believe that the response is a of the treatment with simvastatin and from month 31 the addition of alendronate. however, since 44 months elapsed between the first two jak2-v617f analyses, we are unable to relate the decrease in the jak2-v617f allele burden directly to the initiation of alendronate treatment. interestingly, during the two years of teriparatide treatment, when alendronate was paused, the jak2-v617f allele burden was relatively stable. the following stabilization of the disease parameters might suggest that a long - term bisphosphonate treatment is redundant, and instead a short - term treatment plan with bisphosphonate followed by continuous statin treatment might be a better strategy. during this period the patient was treated with the platelet inhibitors asa and dipyramidole. dipyramidole is a phosphodiesterase inhibitor similar to anagrelide which is used in the treatment of essential thrombocytosis to reduce platelet count, but not in the standard treatment of pv. dipyramidole has been shown to inhibit the proliferation of peripheral blood mononuclear cells from patients with cml and aml in - vitro, and could have influenced the hematological response in this patient. on the other hand dipyramidole likewise, there is no evidence to suggest that asa could have caused the response. prior case reports have described hematological remission in patients with myelofibrosis during treatment with bisphosphonates, but a phase ii study investigating the effects of zoledronic acid on patients with myelofibrosis showed responses in only 1 of 16 patients. in , we report complete hematological response in concert with a partial molecular response in a patient with pv treated with alendronate and simvastatin. although bisphosphonate monotherapy as illustrated by delforge et al. may rarely be beneficial in the late myelofibrosis stage, the highly remarkable response in our patient on combination therapy with statin and bisphosphonate, possibly exhibiting different but synergistic blocking effects in the mevalonate pathway, is certainly an encouraging stimulus for further experimental and clinical research on the potential role of these old drugs in the treatment of mpns alone or adjuvant to hu, interferon-2a or jak1/2 inhibitors. furthermore, a greater response may be expected in the earlier stages of the mpn disease (et or pv), before the bone marrow becomes fibrotic. besides, a relatively small number of responders may still be beneficial, when taking into account the relatively low toxicity of these treatments.

we report a 57-year old man with polycythemia vera, who had a remarkable hematological and molecular response during treatment with simvastatin and alendronate. the patient was treated with this combination for 56 months, and during this period the patient has been in complete hematological remission. the jak2-v617f allele burden has dropped from 64% to sustained values below 20%, and follow - up bone marrow biopsies have revealed no change in pv features, without any regular cytoreductive treatment.

case 1 was a 6-year - old, previously healthy girl from the family of 7 siblings of consanguineous parents living in a rural area of kuwait. for the last 10 days, she complained for pain in muscles of lower limbs, clumsiness, and difficult walking. , she had limping gait and symmetrically painful muscles on palpation, without signs of trauma. however, she had preserved deep tendon reflexes and sphincter control, and sensory appeared intact. whole blood count, liver, renal, electrolyte profiles, creatine kinase enzyme, erythrocyte sedimentation rate, c - reactive protein, and cerebrospinal fluid investigations (cell and protein counts) were normal. due to presumed guillain - barre syndrome, she received immunoglobulins intravenously with mild improvement afterward. case 2 was her elder 10-year - old brother who came 4 days later to the same hospital with nearly same symptoms and signs, however pain in the muscles was less severe. cases 3 and 4 were 2 other brothers (8 years and 12 years old) who after another 2 days were admitted for the same problems, then all 4 were transferred from the local hospital to our neuropediatric unit. on admission, 18 days after the first symptoms, the girl was still complaining of severe pain in the lower limb muscles, also generated by light touch of the extremities, and she was clumsy. the 3 affected brothers complained of only mild, movement - related muscular pain and had mild gait disturbance. the 3 other siblings of the same family (a 14-year - old girl and two boys of 2 and 3 years) were unaffected. as an exposure to a common environmental agent (toxin or drug) was the most probable explanation, the parents (who first denied) were specifically asked for any possible poisons in the house. the father then remembered that he was using a pesticide inside the house to get rid of cockroaches and brought one empty can to us. it proved to be diacidol 60% (iupac) containing 60% of diazinon, a colorless thiophosphoric acid ester a nonsystemic organophosphate used to control cockroaches, ants, and flees in residential buildings. however, the father insisted that the insecticide was used just before they left the house for a week, for a trip to saudi arabia, and that upon return they cleaned the house completely. with enigma why not all family members were affected, we additionally asked about the circumstances. finally, the father remembered that the 4 affected children were playing football with the can of diacidol in the garden for an hour before their trip. he also told us that all affected children had had mild abdominal cramps and diarrheal symptoms during the trip. unfortunately, hand - on toxicology service was not available at that time and tests to determine cholinesterase activity in red blood cells and/or serum pseudo cholinesterase were not possible. being aware of this stumbling point in the diagnostic process, and complaints of leg pain provoked by touch, suggestive of a sensory neuropathy, we performed electromyography / nerve conduction study (emg / ncv) studies in 2 most affected siblings (cases 1 and 2). however, we started gabapentin reaching the therapeutical dose of 30 mg / kg / d, and the symptoms improved. on discharge, only the girl was still complaining of mild pain in the muscles. on follow - up after 6 months, abbreviations: adm, abductor digigit minimi; ul / ll, upper / lower limb; cv, conduction velocity (m / s), tl, terminal latency (ms); a, amplitude (m wave); mv, motor nerve, amplitude of action potential; v, sensory nerve; n, normal. decrement study were done in the right adm / right nasalis / left nasalis. the clustering of cases in a temporal proximity in a family evoked a challenging pathway in search for a common cause. the diagnosis of guillain - barre syndrome, as first suspected in the girl, became less probable when the brother (case 2) was admitted for the same problems. viral, autoimmune, or metabolic myopathies seemed unlikely as complete blood counts, creatine kinase, liver enzymes, renal and electrolyte profiles were normal, and serology tests were negative. organophosphate - induced delayed polyneuropathy is a rare neurotoxicity effect, occurring 1 to 5 weeks following acute cholinergic crisis or after a period of mild or no clinical features, ing in muscle weakness, pain, and paresthesiae. although the mechanism is not well understood, organophosphate - induced delayed polyneuropathy is considered not to be due to the effects on acetylcholinesterase itself but to the inhibition of an enzyme in the nervous system, called neuropathy target esterase. in regard to this possibility , initial diarrheal symptoms and abdominal cramps could be interpreted as mild muscarinic effect of organophosphate. indeed, one study confirmed that only pinpoint pupils and diarrhea are enough for early triage in pediatric exposure to insecticides. however, further course of otherwise not straightforward symptoms were actually dominated by nicotinic effects (muscle weakness and cramps) and subtle neuropathic signs (sensitivity to touch). the neuropathy in organophosphate - induced delayed polyneuropathy is commonly described as motor predominant, and if sensory symptoms are present, they are always milder than the motor component. in our cases, however, the small sensory nerves involved in organophosphate neuropathy can also give rise to normal , thus by no means excluding its presence. clinical signs of organophosphate - induced delayed polyneuropathy in children are otherwise rarely reported, and are much milder than in adults, as it appeared also in our cases. given that the volume of exposure was not perfectly clear, we postulate that the condition in our cases was due to short - lasting contact, low exposure level, and not on the body parts where almost complete absorption occurs, that is, scrotum and axilla. in view of possible additional inhalation route, as the house has been sprayed, the reported history was not supportive. regarding potential therapies for neuropathic pain as described in this setting, we have chosen gabapentin with subsequent improvement in symptoms. in an earlier similar study in adult cases, carbamazepine was successfully used. however, owing to its ability to inhibit neuronal hyperactivity along the pain pathways and less side effects, currently gabapentin, along with pregabaline, has become mainstay of treatment for various neuropathic pain syndromes and in these cases a reasonable choice. so far, only 1 study has been reported specifically related to diazinon - related family poisoning by combined inhaled and cutaneous route, however, with severe symptoms and course. one might reasonably argue whether there was another, unknown environmental toxic agent (heavy metal, drug) to induce described temporal pattern of events. under the circumstances described , the authors stand for the answer grounded on disclosed contact and subsequent transcutaneous organophosphate absorption, carefully excluding other differentials. in , we believe that our illustrative cases can further contribute to the better awareness and understanding of variable spectrum of transcutaneous route of organophosphate poisoning.

contamination or transcutaneous absorption of organophosphates (op) is rare and there exist only few reports of such manner of poisoning. we report four children from the same family in whom temporal proximity of the disease onset, a detailed interrogation of parents and exclusion of other clinical differentials, led to the diagnosis of transcutaneous intoxication with organophosphates (diazinon). the contamination occurred during the game with a freshly used poison can. uncommon clinical picture was marked by delayed signs predominantly reflecting certain nicotinic effects (muscle weakness, cramps) along with subtle neuropathic features occurring throughout a few weeks after initial event. our illustrative cases can further contribute to the better awareness and understanding of variable spectrum of transcutaneous route of op poisoning.

a drug intended for use in humans should have an ideal balance of pharmacokinetics and safety, as well as potency and selectivity. human oral bioavailability is an important pharmacokinetic property which describes the fraction of an administered drug that reaches the systematic circulation and its site of action, to exert its pharmacological and therapeutic effects. bioavailability is 100% when a medication is administered parenterally as it goes straight into the bloodstream and is usually completely used by the body. however, when a medication is administered via other routes (such as orally), its bioavailability decreases. prediction of oral bioavailability is not an easy task, as bioavailability depends on superposition of two processes: absorption and liver first - pass metabolism. absorption in turn depends on solubility and permeability of compounds, as well as interactions with transporters and metabolizing enzymes in gut wall. permeability further depends on the size of the molecule, as well as its capacity to make hydrogen bonds, its overall lipophilicity and possibly its shape and flexibility. molecular flexibility, for example, as evaluated by counting the number of rotatable bonds, has been identified as a factor influencing bioavailability.- the bioavailability of drugs from oral formulations is also influenced by many physiological factors including gastrointestinal fluid composition, ph and dynamics, transit and motility and transport. these factors may vary with age, gender, race, food, and disease. oral bioavailability is denoted by the letter f. to lower the attrition rate of drug development there is a need to develop strong and accurate computational methods that can predict and prioritize compounds before they are synthesized or moved towards to preclinical and clinical development. various prediction models are reported in the literature on known oral bioavailable drugs such as statistical models, mechanistic models, qsar / qspr models, genetic programming, artificial neural networks, machine learning classification, etc. we have selected oral bioavailability data from various literature studies. the whole dataset comprises of 1664 drugs. redundancy was completely removed by manually screening and selected dataset for this study comprises of chemically diverse 511 drugs. drugs having oral bioavailability less than 30% were regarded as low orally bioavailable drugs and drugs with oral bioavailability 30% or more were regarded as high orally bioavailable. class labels were defined as 1 for high oral bioavailability and 0 for low oral bioavailability. further the whole dataset of 511 drug molecules was randomly split into training set of 384 drugs and test set of 127 drugs. training set was used for training various classifiers, while testing set was not exposed to the system during descriptor selection, learning, kernel selection, and hyper - parameter selection phases. in classification problem usually the data that is to be classified is associated with a large number of features or descriptors. as a feature or descriptor selection is a process of identifying and removing as much of the irrelevant and redundant information as possible. the removal of irrelevant and redundant information often improves the performance of machine learning algorithms. twelve optimal descriptors were selected using the sequential forward feature selection (sffs) algorithm. iteratively algorithm adds to the basis each feature which was not previously selected and retains the feature subset that in the highest estimated performance. the search terminates after the accuracy of the current subset can not be improved by adding any other feature. sffs is stated as: given a feature set x-{xi | i=1 n}, find a subset ym = {xi, , the set of optimal descriptors include molecular mass ( ma), molecular surface area (msa), molecular volume (mv), molecular refractivity (mr), total hydrogen count (hc), partition coefficient (logp), rotatable bonds (rtb), total polar surface area (tpsa), solubility index (logs), shape flexibility index (sfi) sum of e - states indices (sesi) and count of hydroxyl groups (hyg). different feature values for dataset falls in different ranges hence to avoid the discrepancy we have further scaled down these numeric values between 1 to 1. such scaling facilitates better representation of feature values in kernel function and also avoid numerical difficulties during the calculation. in this process , input vector for training as well as the test set has been quantified as x = (x1, x2, , x13), each labeled by corresponding y = 0 or y = 1 depending on whether it represents high orally bioavailable drug or low orally bioavailable drug, respectively. training set was then subjected to the support vector machine (svm) classifier, which involved fixing several hyper - parameters which further determines the function optimized by svm. it is extremely crucial and has a profound impact on the performance of trained classifier. we used several kernels: linear, polynomials, and radial bias function (rbf) initially to determine which of them is applicable to our data and is able to classify it efficiently. we found rbf as the suitable classifier function (as the number of features was not very large in comparison to the dataset) for which training errors on low oral bioavailability data (false negatives) outweigh errors on high oral bioavailability data (false positives). k(xi, xj) = exp (| | xi xj | |). this kernel is best for the data in which the class - conditional probability distribution function approaches the gaussian distribution. it maps the non - linear data into a higher dimension space where data is linearly separable. its exponential nature can be expanded into an infinite series, giving rise to an infinite - dimension polynomial kernel. however, this kernel is bit difficult to design, in the sense that it is difficult to arrive at an optimum and choose the corresponding c that works best for a given problem. this has been taken care by running grid parameter search exploring all combinations of c and with each cross - validation routine, where ranged from 2 to 2 and c ranged from 2 to 2. to identify an optimal hyper - parameter set we have performed a two - step grid - search on c and with the use of 10 folds cross - validation, by dividing training set into 10 subsets of equal size (~38 drugs each having 12 descriptors). pairs of (c ;) have been tried and the one with the best cross - validation accuracy has been picked. using rbf kernel, the best cross - validation accuracy was obtained at = 0.0078125 and c = 512. the obtained showed a good classification accuracy of 88.54% during the cross - validation. we have selected oral bioavailability data from various literature studies. the whole dataset comprises of 1664 drugs. redundancy was completely removed by manually screening and selected dataset for this study comprises of chemically diverse 511 drugs. drugs having oral bioavailability less than 30% were regarded as low orally bioavailable drugs and drugs with oral bioavailability 30% or more were regarded as high orally bioavailable. class labels were defined as 1 for high oral bioavailability and 0 for low oral bioavailability. further the whole dataset of 511 drug molecules was randomly split into training set of 384 drugs and test set of 127 drugs. training set was used for training various classifiers, while testing set was not exposed to the system during descriptor selection, learning, kernel selection, and hyper - parameter selection phases. in classification problem usually the data that is to be classified is associated with a large number of features or descriptors. as a so first and foremost step is to reduce the dimensions. feature or descriptor selection is a process of identifying and removing as much of the irrelevant and redundant information as possible. the removal of irrelevant and redundant information often improves the performance of machine learning algorithms. twelve optimal descriptors were selected using the sequential forward feature selection (sffs) algorithm. sffs algorithm starts with an empty set of features. in first iteration, algorithm considers all feature subsets with only one feature. iteratively algorithm adds to the basis each feature which was not previously selected and retains the feature subset that in the highest estimated performance. the search terminates after the accuracy of the current subset can not be improved by adding any other feature. sffs is stated as: given a feature set x-{xi | i=1 n}, find a subset ym = {xi, , xm}, with m < n, that optimizes an objective function j(y). the set of optimal descriptors include molecular mass (ma), molecular surface area (msa), molecular volume (mv), molecular refractivity (mr), total hydrogen count (hc), partition coefficient (logp), rotatable bonds (rtb), total polar surface area (tpsa), solubility index (logs), shape flexibility index (sfi) sum of e - states indices (sesi) and count of hydroxyl groups (hyg). different feature values for dataset falls in different ranges hence to avoid the discrepancy we have further scaled down these numeric values between 1 to 1. such scaling facilitates better representation of feature values in kernel function and also avoid numerical difficulties during the calculation. in this process, input vector for training as well as the test set has been quantified as x = (x1, x2, , x13), each labeled by corresponding y = 0 or y = 1 depending on whether it represents high orally bioavailable drug or low orally bioavailable drug, respectively. training set was then subjected to the support vector machine (svm) classifier, which involved fixing several hyper - parameters which further determines the function optimized by svm. it is extremely crucial and has a profound impact on the performance of trained classifier. we used several kernels: linear, polynomials, and radial bias function (rbf) initially to determine which of them is applicable to our data and is able to classify it efficiently. we found rbf as the suitable classifier function (as the number of features was not very large in comparison to the dataset) for which training errors on low oral bioavailability data (false negatives) outweigh errors on high oral bioavailability data (false positives). k(xi, xj) = exp (| | xi xj | |). this kernel is best for the data in which the class - conditional probability distribution function approaches the gaussian distribution. it maps the non - linear data into a higher dimension space where data is linearly separable. its exponential nature can be expanded into an infinite series, giving rise to an infinite - dimension polynomial kernel. however, this kernel is bit difficult to design, in the sense that it is difficult to arrive at an optimum and choose the corresponding c that works best for a given problem. this has been taken care by running grid parameter search exploring all combinations of c and with each cross - validation routine, where ranged from 2 to 2 and c ranged from 2 to 2. to identify an optimal hyper - parameter set we have performed a two - step grid - search on c and with the use of 10 folds cross - validation, by dividing training set into 10 subsets of equal size (~38 drugs each having 12 descriptors). pairs of (c ;) have been tried and the one with the best cross - validation accuracy has been picked. using rbf kernel, the best cross - validation accuracy was obtained at = 0.0078125 and c = 512. the obtained showed a good classification accuracy of 88.54% during the cross - validation. to optimize the svm parameters and c, 10-fold cross - validation was applied on each of the training datasets bin, exploring various combinations of c (2 to 2) and (2 to 2). in 10-fold cross - validation, the training dataset (384 drugs, each having 12 descriptors) was spilt into 10 subsets, each of equal size, where one of such subsets was used as the test dataset while the other subsets were used for training the classifier. the process is repeated 10 times using a different subset of a corresponding test and training datasets, hence ensuring that all subsets are used for both training and testing. a twofold grid optimization has been considered and the shown suggests that the optimized c and were found to be 512 and 0.0078125, respectively. contour plot of grid search showing optimum values of hyper - parameter the best combination of and c that was obtained from grid based optimization is used for training a rbf - based svm classifier using entire training data (384 drugs each having 12 descriptors). the obtained showed a good classification accuracy of 88.54% during the cross - validation. the reported accuracy on the training datasets depicts the effectiveness and reliability of this prediction method; but still it may or may not give the equivalent or better accuracy when applied on the novel drugs, i.e. drugs with an unknown oral bioavailability profile. therefore, it is extremely important to test the svm classifier on the non - cross validated test set which is out - of - sample and independent of the training set data. we applied the svm classifier on the whole test set (127 ligands each having 12 descriptors), the classifier incurred an accuracy of 96.85% by using the rbf kernel with = 0.0078125 and c = 512. this prediction accuracy suggests that svm - based prediction of oral bioavailability can be considered as a helpful tool in drug discovery and development. the efficiency of a classifier was further evaluated with the help of various quantitative variable: (a) true positive (tp), represents total number of correctly classified high orally bioavailable drugs, (b) true negative or (tn), represents total number of correctly classified low orally bioavailable drugs (c) false positive (fp), represents total number of incorrectly classified low orally bioavailable drugs, (d) false negatives (fn), represents total number of incorrectly classified high orally bioavailable drugs. using these quantitative variables, several statistical metrics were calculated to measure the effectiveness of the oral bioavailability - svm classifier. sensitivity (sn) and specificity (sp) metrics, which indicate the ability of a prediction system to classify the high and low orally bioavailable drugs, were calculated by equations and and receiver operating characteristic curve (roc) for the same was plotted. receiver operating characteristic (roc) plot for a classifier with optimized values of c and sn (%) = *100. to indicate an overall performance of the classifier system; accuracy (ac), for the percentage of correctly classified drugs and the matthews correlation coefficient (mcc) were computed as follows: ac = *100. mcc= / (tn+fp) (tn+fn) (tp+fp) (tp+fn). sensitivity (sn) came out to be 95.60% with a false positive proportion (fp) of 0.79% whereas specificity (sp) came out to be 97.30% with a false negative (fn) proportion of 3.15%. similarly youden's index (youden 's index = sensitivity + specificity 1) was 0.929 and matthews correlation coefficient (mcc) was found to be 0.909. the overall accuracy (ac) calculated using equation was 96.1% which is significantly higher than existing methods. the area under roc curve was found to be 0.943 with a standard error of 0.0253. the prediction model derived from svm can serve as primary tool for generating some idea about oral bioavailability of ligands. user just needs to calculate the 12 physicochemical descriptors, as these values are prerequisite for prediction of oral bioavailability through the generated svm model. the ligand with unknown oral bioavailability can be tested against the prediction model. for given 12 physicochemical properties this svm model can predict the oral bioavailability of the ligand under consideration. at preliminary level, this model can predict that whether the oral bioavailability of the ligand under study is low or high. numerous attempt have been made to predict oral bioavailability of drugs and ligands by computational and experimental method in past. some of those prediction models are listed in table 1 along with the current study and the model generated by svm seems to be more satisfactory in terms of prediction accuracy. comparative study of some of the oral bioavailability prediction models with current study absorption of drug taken orally is a complex process and, although related to drug physicochemical properties, it is related in fairly complex ways. physiological and environmental conditions influence the bioavailability of drugs such as the presence or the absence of food, residence time of the drug in contact with the small intestinal epithelium, etc and make the absorption prediction further complex. failure to appreciate this complexity in attempting to build models may lead to the generation of model with low confidence. an alternative approach to modeling oral bioavailability is to develop structure - based models for the properties contributing to the absorption process, such as solubility and permeability (included in presented model as logs and logp). for example, if a potential drug is expected to have poor oral bioavailability due to low - intrinsic aqueous solubility, then this is a property amenable to manipulation by the formulation scientist. on the other hand, if the compound is both poorly soluble and permeable, along with a significant metabolic liability, optimization may be very difficult if not impossible. such candidates present high risks to successful development and should be identified as such early in the drug identification and development process. the svm classifier with radial basis function kernel with = 0.0078125 and c = 512 applied on the test datasets. it suggests that while considering chemoinformatics approaches into account, svm - based prediction of oral bioavailability can be a significantly important tool for drug development and discovery at a preliminary level.

objective: a computational model for predicting oral bioavailability is very important both in the early stage of drug discovery to select the promising compounds for further optimizations and in later stage to identify candidates for clinical trials. in present study, we propose a support vector machine (svm)-based kernel learning approach carried out at a set of 511 chemically diverse compounds with known oral bioavailability values.material and methods: for each drug, 12 descriptors were calculated. the selection of optimal hyper - plane parameters was performed with 384 training set data and the prediction efficiency of proposed classifier was tested on 127 test set data.:the overall prediction efficiency for the test set came out to be 96.85%. youden's index and matthew correlation index were found to be 0.929 and 0.909, respectively. the area under receiver operating curve (roc) was found to be 0.943 with standard error 0.0253.:the prediction model suggests that while considering chemoinformatics approaches into account, svm - based prediction of oral bioavailability can be a significantly important tool for drug development and discovery at a preliminary level.

patients diagnosed with diffuse dme at samsung medical center between september 2003 and august 2004 were enrolled. diffuse dme was defined as macular thickening corresponding to csme on biomicroscopy with findings of diffuse fluorescein leakage without a responsible microaneurysm on angiography and increased cmt (> 250 m) on optical coherence tomography. eyes in the combination group underwent modified macular grid / focal laser photocoagulation three weeks after ivta. four milligrams of triamcinolone were injected intravitreally after sterilization with betadine using a sterile lid speculum. modified grid laser photocoagulation, which consisted of grid patterned laser burns on the capillary non - perfusion area, retinal thickening of the parafoveal region, and direct photocoagulation on the leaking microaneurysms were performed as described previously. all patients underwent a complete ocular examination, including assessment of best corrected visual acuity on a snellen chart, applanation tonometry, slit lamp examination, dilated fundus examination utilizing biomicroscopy, fundus fluorescein angiography, and optical coherence tomography (oct ; stratus oct ver . responses after treatment were evaluated with respect to best corrected visual acuity and central macular thickness on oct . best corrected visual acuity was converted to a logarithmic scale ( logmar) for statistical analysis. slit lamp biomicroscopy, fundus examination, and measurement of intraocular pressure were conducted at each follow - up visit. this study was initially performed as a prospective study for six months; the are described in a previous report. after the initial six - month follow - up, visits were made every 3 to 4 months at the physician's discretion (swk). oct examination was performed when 1 ) funduscopy revealed any macular change or 2 ) visual acuity changed. additional treatment was applied at least six months after the initial treatment. if the funduscopy and oct showed apparent macular edema, additional treatment (such as macular photocoagulation, ivta, a combination of the two, or pars plana vitrectomy with ivta followed by macular photocoagulation) the choice of additional treatment was based primarily on the tomographic and angiographic appearance of the recurrent dme. for diffuse dme with cystoid intraretinal fluid or subretinal fluid accumulation, ivta and laser photocoagulation were considered if the eye had previously been included in the group receiving only ivta. in the most intractable cases, sequential triple therapy of vitrectomy and ivta followed by macular laser photocoagulation was performed. the demographics and clinical characteristics of the patients (age, duration of diabetes, number of prior focal / grid laser photocoagulation treatments, central macular thickness, and logmar visual acuity) were analyzed by a two - tailed t - test. sex, extent of diabetic retinopathy, and presence of systemic hypertension were evaluated with fisher's exact test. initial response was determined at the six - month follow - up visit in eyes that completed the three - year follow - up. initial response was defined as resolution of macular edema (cmt measured via oct < 250 m). kaplan - meier survival analysis with log ranks for dme recurrence was employed to evaluate the duration of dme resolution. recurrence of dme was defined as 1 ) cmt greater than 250 m or 2 ) the need for additional treatment of macular edema in eyes that had initially responded to treatment. patients diagnosed with diffuse dme at samsung medical center between september 2003 and august 2004 were enrolled. diffuse dme was defined as macular thickening corresponding to csme on biomicroscopy with findings of diffuse fluorescein leakage without a responsible microaneurysm on angiography and increased cmt (> 250 m) on optical coherence tomography. eyes in the combination group underwent modified macular grid / focal laser photocoagulation three weeks after ivta. four milligrams of triamcinolone were injected intravitreally after sterilization with betadine using a sterile lid speculum. modified grid laser photocoagulation, which consisted of grid patterned laser burns on the capillary non - perfusion area, retinal thickening of the parafoveal region, and direct photocoagulation on the leaking microaneurysms were performed as described previously. all patients underwent a complete ocular examination, including assessment of best corrected visual acuity on a snellen chart, applanation tonometry, slit lamp examination, dilated fundus examination utilizing biomicroscopy, fundus fluorescein angiography, and optical coherence tomography (oct ; stratus oct ver . responses after treatment were evaluated with respect to best corrected visual acuity and central macular thickness on oct . best corrected visual acuity was converted to a logarithmic scale ( logmar) for statistical analysis. slit lamp biomicroscopy, fundus examination, and measurement of intraocular pressure were conducted at each follow - up visit. this study was initially performed as a prospective study for six months; the are described in a previous report. after the initial six - month follow - up, visits were made every 3 to 4 months at the physician's discretion (swk). oct examination was performed when 1 ) funduscopy revealed any macular change or 2 ) visual acuity changed. additional treatment was applied at least six months after the initial treatment. if the funduscopy and oct showed apparent macular edema, additional treatment (such as macular photocoagulation, ivta, a combination of the two, or pars plana vitrectomy with ivta followed by macular photocoagulation) the choice of additional treatment was based primarily on the tomographic and angiographic appearance of the recurrent dme. for diffuse dme with cystoid intraretinal fluid or subretinal fluid accumulation, ivta and laser photocoagulation were considered if the eye had previously been included in the group receiving only ivta. in the most intractable cases, sequential triple therapy of vitrectomy and ivta followed by macular laser photocoagulation the demographics and clinical characteristics of the patients (age, duration of diabetes, number of prior focal / grid laser photocoagulation treatments, central macular thickness, and logmar visual acuity) were analyzed by a two - tailed t - test. sex, extent of diabetic retinopathy, and presence of systemic hypertension were evaluated with fisher's exact test. initial response was determined at the six - month follow - up visit in eyes that completed the three - year follow - up. initial response was defined as resolution of macular edema (cmt measured via oct < 250 m). kaplan - meier survival analysis with log ranks for dme recurrence was employed to evaluate the duration of dme resolution. recurrence of dme was defined as 1 ) cmt greater than 250 m or 2 ) the need for additional treatment of macular edema in eyes that had initially responded to treatment. the mean follow - up period was 30.7 11.2 months (range, 6 to 41 months) for the combination group and 32.5 10.1 months (range, 6 to 40 months) for the ivta group. among 86 eyes from 74 patients, 67 eyes from 56 patients completed the three - year follow - up. of those 67 eyes, two in the combination group and two in the ivta group were excluded from analysis because pars plana vitrectomy was performed for reasons other than macular edema. three eyes (two eyes in the combination group and one eye in the ivta group) underwent pars plana vitrectomy for proliferative diabetic retinopathy complicated by vitreous hemorrhage. one eye in the ivta group was subjected to pars plana vitrectomy for an epiretinal membrane. clinical and demographic characteristics at baseline and at six months for patients who did and did not complete the three - year follow - up are summarized in table 1. no significant differences between those who did and did not complete follow - up were observed at baseline or at six months. thirty - seven eyes in the combination group and 26 eyes in the ivta group were evaluated for three years. baseline features, including visual acuity, cmt, stage of retinopathy, mean duration of diabetes, lens status, and number of prior macular photocoagulation procedures, did not differ between the two groups (table 2). throughout the three - year follow - up period , macular edema was not observed in nine of 37 eyes (24.32%) in the combination group that did not receive additional treatment and in only one of 26 eyes (3.85%) in the ivta group (p = 0.028) (table 3). in eyes with initial response, recurrence of dme was absent in nine of 17 eyes (52.94%) in the combination group and in one of nine eyes (11.11%) in the ivta group. in these eyes, macular edema was absent for an average of 19.88 months (up to 30 months) in the combination group and 10.33 months in the ivta group (p = 0.027) (fig . the mean number of additional treatments during the three - year follow - up was 0.92 0.92 in the combination group and 1.88 1.18 in the ivta group ( p = 0.001) (table 4). although bcva and cmt improved six months after treatment in both groups, the improvement was greater in the combination group than in the ivta group (table 2). bcva and cmt were evaluated at one-, two-, and three - year follow - ups. for the nine eyes in the combination group that completed the three - year follow - up without additional treatment, logmar visual acuity measurements at baseline, six months, and three years were 0.80 0.34, 0.66 0.37, and 0.53 0.48, respectively. the respective cmt values were 481.9 177.5, 157.5 12.9, and 172.0 37.4 m. because only three eyes in the ivta group were exempt from additional treatment after the one - year follow - up, statistical analysis and comparison of bcva and cmt were not feasible. nine (34.6%) eyes in the ivta group and eight (21.6%) eyes in the combination group experienced iop elevation in excess of 21 mmhg after initial treatment. these eyes were treated with topical glaucoma medication, and iop normalized after treatment in most cases. trabeculectomy was performed in one eye due to intractable intraocular pressure elevation that normalized after surgery. cataract extraction was performed in 13 (38.2%) of 34 phakic eyes in the combination group compared to seven (26.9%) of 26 phakic eyes in the ivta group. the mean time to cataract extraction was 15.54 months in the combination group and 19.14 months in the ivta group. other injection - related complications, including infectious endophthalmitis, vitreous hemorrhage, and retinal detachment, were not observed. the mean follow - up period was 30.7 11.2 months (range, 6 to 41 months) for the combination group and 32.5 10.1 months (range, 6 to 40 months) for the ivta group. among 86 eyes from 74 patients, 67 eyes from 56 patients completed the three - year follow - up. of those 67 eyes, two in the combination group and two in the ivta group were excluded from analysis because pars plana vitrectomy was performed for reasons other than macular edema. three eyes (two eyes in the combination group and one eye in the ivta group) underwent pars plana vitrectomy for proliferative diabetic retinopathy complicated by vitreous hemorrhage. one eye in the ivta group was subjected to pars plana vitrectomy for an epiretinal membrane. clinical and demographic characteristics at baseline and at six months for patients who did and did not complete the three - year follow - up are summarized in table 1. no significant differences between those who did and did not complete follow - up were observed at baseline or at six months. thirty - seven eyes in the combination group and 26 eyes in the ivta group were evaluated for three years. baseline features, including visual acuity, cmt, stage of retinopathy, mean duration of diabetes, lens status, and number of prior macular photocoagulation procedures, did not differ between the two groups (table 2). throughout the three - year follow - up period, macular edema was not observed in nine of 37 eyes (24.32%) in the combination group that did not receive additional treatment and in only one of 26 eyes (3.85%) in the ivta group (p = 0.028) (table 3). in eyes with initial response, recurrence of dme was absent in nine of 17 eyes (52.94%) in the combination group and in one of nine eyes (11.11%) in the ivta group. in these eyes, macular edema was absent for an average of 19.88 months (up to 30 months) in the combination group and 10.33 months in the ivta group (p = 0.027) (fig . the mean number of additional treatments during the three - year follow - up was 0.92 0.92 in the combination group and 1.88 1.18 in the ivta group ( p = 0.001) (table 4). although bcva and cmt improved six months after treatment in both groups, the improvement was greater in the combination group than in the ivta group (table 2). bcva and cmt were evaluated at one-, two-, and three - year follow - ups. for the nine eyes in the combination group that completed the three - year follow - up without additional treatment, logmar visual acuity measurements at baseline, six months, and three years were 0.80 0.34, 0.66 0.37, and 0.53 0.48, respectively. the respective cmt values were 481.9 177.5, 157.5 12.9, and 172.0 37.4 m. because only three eyes in the ivta group were exempt from additional treatment after the one - year follow - up, statistical analysis and comparison of bcva and cmt were not feasible. nine (34.6%) eyes in the ivta group and eight (21.6%) eyes in the combination group experienced iop elevation in excess of 21 mmhg after initial treatment. these eyes were treated with topical glaucoma medication, and iop normalized after treatment in most cases. trabeculectomy was performed in one eye due to intractable intraocular pressure elevation that normalized after surgery. cataract extraction was performed in 13 (38.2%) of 34 phakic eyes in the combination group compared to seven (26.9%) of 26 phakic eyes in the ivta group. the mean time to cataract extraction was 15.54 months in the combination group and 19.14 months in the ivta group. other injection - related complications, including infectious endophthalmitis, vitreous hemorrhage, and retinal detachment, were not observed. we previously reported on a six - month comparison between ivta monotherapy and combined ivta and laser photocoagulation. this comparison revealed that combined therapy ed in greater improvement in bcva and cmt. among the 86 eyes from 74 patients who were recruited in a previous study, clinical and demographic characteristics of the patients who did and did not complete follow - up were compared for the evaluation of unexpected biases due to follow - up loss. a comparison of clinical and demographic data at baseline between the combination group and ivta group among patients who completed follow - up revealed no significant differences (table 2). therefore, we assumed that unexpected bias from loss to follow - up was not significant. compared with only one of 26 (3.85%) eyes in the ivta group, nine of 37 (24.32%) eyes in the combination group sustained their normalized macular thickness up to the final follow - up visit. the proportion with persistent resolution of dme was significantly higher in the combination group than in the ivta group (p = 0.028). the duration of dme resolution was also significantly longer in the combination group than in the group receiving ivta only (p = 0.027). seventeen eyes that initially responded to combination therapy had a significantly longer dme - free period than nine eyes in the ivta group. it is also noteworthy that nine of the 17 eyes (52.9%) showing an initial response to combination therapy did not require additional treatment for diffuse dme for three years. these suggest that a combination of ivta and laser photocoagulation may have long - lasting effects with a lower recurrence rate. the mean number of additional treatments in the combination group was 0.92, which was significantly smaller than the number in the ivta group (1.88). in a large clinical trial conducted by the drcr network, the mean number of treatments in eyes that underwent macular grid / focal photocoagulation was reported to be 3.1, and the mean frequency of treatments in eyes receiving a 4-mg intravitreal triamcinolone injection was 4. this discrepancy is believed to arise from the difference in the mode of additional treatments. because our study targeted only diffuse dme, which is thought to be more intractable, we employed not only monotherapy (such as ivta or laser photocoagulation), but also combination therapies (including pars plana vitrectomy, ivta, and laser photocoagulation) that may have a longer duration of action. because most eyes (23 of 26 eyes) in the ivta group required additional treatment after the one - year follow - up, a comparison of visual acuity and central macular thickness between the combination group and ivta group was not feasible. bcva and cmt improved gradually throughout the follow - up period in eyes in the combination group that did not undergo additional treatment. these changes in bcva and cmt correspond with from an earlier study that reported sustained improvement with gradual augmentation of visual acuity and cmt after macular grid / focal photocoagulation at the three - year follow - up. we previously reported on the improvement in bcva and cmt after macular focal / grid laser photocoagulation combined with ivta at six months. in another study, although cmt improvement at six months was better in the combination group, the difference in bcva among the combination, laser, and ivta groups was not statistically significant. the mean cmt of eyes in the former study was 525.4 m, compared to 401.4 m in the latter study. although improvement in bcva did not immediately follow resolution of dme, improvement in cmt would be expected to contribute to the stabilization or improvement of bcva in the long - run, as described in a previous study. we hypothesized that macular grid / focal laser photocoagulation after ivta would have its own role in 1 ) reduction of diabetic macular edema as a conventional concept of macular grid / focal photocoagulation and 2 ) maintenance of reduced macular thickness from ivta. reported that eyes with severe macular edema (> 400 m) responded poorly to macular grid / focal photocoagulation, while eyes with moderate macular edema (retinal thickness < 400 m) responded well. we assume that macular grid / focal laser photocoagulation reduces retinal thickness by driving the equilibrium toward the absorption of intraretinal / subretinal fluid. a recent report from the drcr network suggested that intravitreal ranibizumab with prompt or deferred laser therapy is more effective through at least two years than is prompt laser treatment alone or combination therapy with ivta and macular grid / focal treatment. however, in a subgroup analysis limited to pseudophakic eyes, eyes treated with intravitreal triamcinolone combined with laser therapy showed comparable outcomes to those treated with intravitreal ranibizumab with prompt or deferred laser treatment. in their analysis of all eyes (including phakic eyes), intravitreal triamcinolone combined with laser therapy failed to show effectiveness, unlike our main outcomes. in their study, however, we prefer laser photocoagulation three weeks after the transitory reduction of cmt with ivta to simultaneous application of laser photocoagulation and ivta. we assume that the decreased foveal thickness and restoration of retinal transparency achieved by ivta may selectively facilitate the delivery of laser energy to the photoreceptors and retinal pigment epithelia. therefore, it is possible that the interval between ivta and macular grid / focal photocoagulation can lead to dissimilar . in addition, intravitreal triamcinolone combined with laser treatment increased subsequent cataract surgery, which can induce pseudophakic macular edema of varying severity. as a all cataract surgeries were performed by an experienced cataract surgeon without complications after we confirmed complete resolution of macular edema and lack of neovascular activity. these may be unknown confounding factors that account for the difference in outcomes between this study and the recent study from the drcr network. intravitreal administration of an anti - vascular endothelial growth factor (vegf) agent is one of the most promising treatment modalities for dme and has several advantages compared to ivta. recent studies have demonstrated favorable without significant complications, such as elevated intraocular pressure or cataract progression. however, because dme recurrence after administration of an anti - vegf agent is common, repeat administration is often required, which can be hazardous. the long - term effectiveness of combination therapy for dme shown in this study may be helpful in attempts to maintain the effect with fewer injections, using modalities such as anti - vegf and laser photocoagulation. recently, a large clinical trial showed that a combination of intravitreal ranibizumab injection and prompt or deferred laser treatment ed in greater visual improvement than did a combination of ivta and prompt laser photocoagulation, although both treatments ed in significant anatomical improvement. although anti - vegf injection and laser photocoagulation demonstrated more favorable outcomes, considering the different mode of action, a combination of ivta and laser photocoagulation may also be an alternative treatment option, particularly in pseudophakic eyes. the primary weakness of this study is that it was originally designed as a prospective study with a six - month follow - up. thus, after the initial six months, the follow - up intervals were irregular. treatment for persistent or recurrent dme after the initial six months depended on the physician's discretion based on angiographic and tomographic findings, not on a given protocol. however, despite these weaknesses, because this study includes long - term from a combination regimen, this report provides a long - term perspective on the clinical course of treatment after combination therapy for dme. in summary, this study presented the superiority of combination therapy at six month and three year follow - ups. although combination therapy showed more favorable than ivta monotherapy, dme recurrence was common. therefore, we suggest that macular laser photocoagulation following resolution of edema through ivta can be an alternative therapeutic option for the treatment of recurrent or intractable dme.

purposeto report the three - year outcomes of macular laser photocoagulation following intravitreal injection of triamcinolone acetonide (ivta) for diffuse diabetic macular edema (dme).methodsa prospective, randomized controlled study was completed. eighty - six eyes of 74 patients with diffuse dme were randomized into two groups. eyes assigned to the combination group (n = 48) were subjected to macular laser photocoagulation three weeks after ivta. eyes in the ivta group (n = 38) underwent ivta alone. central macular thickness was measured by optical coherence tomography, and the number of additional treatments and mean time to recurrence were assessed.thirty-seven eyes in the combination group and 26 eyes in the ivta group completed the three - year follow - up. recurrence of dme after initial treatment was not observed for nine of the 37 (24.3%) eyes in the combination group or for one of the 26 (3.9 $) eyes in the ivta group (p = 0.028). dme was absent for 19.9 months after treatment in the combination group compared to 10.3 months in the ivta group (p = 0.027). the mean number of additional treatments was 0.92 in the combination group and 1.88 in the ivta group (p = 0.001). in the subset of subjects who completed the three - year follow - up demonstrated that laser photocoagulation following ivta is more effective than ivta monotherapy for diffuse dme. combination therapy required fewer additional treatments and ed in a lower recurrence rate than ivta monotherapy.

dexmedetomidine, an 2 agonist, has been studied widely as an adjuvant to local anaesthetics in regional anaesthesia techniques to enhance the quality and duration of analgesia. dexmedetomidine is highly selective (8 times more selective than clonidine) and a specific 2 adrenergic agonist, having analgesic, sedative, antihypertensive and anaesthetic - sparing effects when given by the systemic route. dexmedetomidine produces manageable hypotension and bradycardia, but the striking feature of this drug is the lack of opioid - related side effects such as respiratory depression, pruritus, nausea and vomiting. addition of dexmedetomidine to local anaesthetic drugs during peripheral nerve blocks may also prove beneficial for surgical patients. the role of dexmedetomidine as an adjuvant to local anaesthetic agents in upper limb peripheral nerve blocks has been extensively studied. a dose of 150 g of dexmedetomidine has been associated with minimal side effects. however, other studies have shown that dexmedetomidine even at 30 g can cause significant compromise, which challenges its use in peripheral nerve blocks in day - care surgeries. besides, there is no study suggestive of any appropriate dose of dexmedetomidine as an adjuvant in supraclavicular brachial plexus block. hence, the present study was conducted with the primary aim of assessing the duration of analgesia of two different doses of dexmedetomidine, 50 and 100 g added to 0.5% levobupivacaine, in patients posted for upper limb surgeries under supraclavicular brachial plexus block. the secondary outcomes measured were the onset and duration of sensorimotor blockade, haemodynamic variables and adverse effects in both the groups. after approval of the hospital ethical committee, patients were explained about the total procedure and only those who gave written consent were included in the study. one hundred american society of anesthesiologists (asa) physical status i and ii patients, aged 1860 years, undergoing upper limb surgeries under supraclavicular brachial plexus block, were enrolled in this prospective, randomised trial. patients on adrenoreceptor agonist or antagonist therapy, those with known sensitivity to local anaesthetics, second or third degree heart block, renal and hepatic insufficiency, uncontrolled diabetes and hypertension, pregnant and lactating females, drug abusers and psychiatric patients were excluded from the study. the 10 cm visual analogue scale (vas) (0, no pain and 10, worst pain imaginable) was explained during the pre - operative visit. one hundred patients were randomised using a computer - generated randomisation list. the sealed envelope was opened by an anaesthesiologist not involved in the study who then prepared the drug solution according to randomisation. the anaesthesiologist performing the block and observing the patient was blinded to the treatment group. patients in group ld50 received 29 ml of 0.5% levobupivacaine plus 50 g of dexmedetomidine diluted in 1 ml of normal saline (total 30 ml). patients in group ld100 received 29 ml of 0.5% levobupivacaine plus 100 g of dexmedetomidine diluted in 1 ml of normal saline (total 30 ml). consort diagram showing the number of patients included and analysed after shifting the patients to the operation theatre, non - invasive monitors such as blood pressure, oxygen saturation (spo2) and electrocardiogram were applied, and their baseline values were recorded. supplemental oxygen was provided through nasal cannula at 4 l / min to all patients. sedation was provided by iv administration of midazolam 1 mg and fentanyl 30 g before the block. neural localisation was achieved using a nerve locator connected to a 21-gauge, 50-mm - long stimuplex needle. the stimulation frequency was set at 1 hz, and the intensity of the stimulating current was initially set to deliver 1.5 ma and was then gradually decreased. the position of the needle was considered to be acceptable when an output current < 0.5 ma still elicited a slight distal motor response in the forearm and hand. on negative aspiration for blood, sensory and motor blockade were assessed for every 2 min after completion of injection till 30 min and then for every 30 min after the end of surgery till the first 12 h, thereafter hourly until the block had completely worn off. for sensory loss assessment , we used pinprick test with a 3-point scale: 0-no block, 1-analgesia (loss of sensation to pinprick) and 2 loss of touch. motor blockade was evaluated by the ability to flex the elbow and hand as: 0 full flexion / extension movement in hand and arm against resistance, 1 movement against gravity but not against resistance, 2 flicker of movement in hand but not in arm and 3 no movement (complete motor block). onset of sensory blockade was defined as the interval between the end of injection and sensory blockade evidenced by loss of sensation to pinprick or by a score of 1 on pinprick response. onset of motor blockade was the interval between the end of injection and complete motor paralysis of wrist and hand. the duration of sensory blockade was defined as the time interval between sensory blockade and reappearance of the pinprick response. the duration of motor blockade was defined as the time interval between maximum motor blockade and complete movement of wrist and fingers. duration of analgesia was taken as the time interval between the onset of sensory blockade and the first dose of rescue analgesic given to the patient. a complete block was defined as one associated with grade 2 sensory anaesthesia and grade 3 motor block and only these patients were included for further study. patients with sensory block of grade 0, 1 and motor block of grade 0, 1 and 2 were considered to have incomplete block and hence were excluded from further analysis and converted to general anaesthesia. post - operative pain was assessed using vas (0 no pain to 10 worst pain) for every hour till the block lasted. post - operative heart rate (hr), systolic blood pressure, diastolic blood pressure, mean arterial pressure (map) and spo2 were recorded for every 2 h for the first 6 h and thereafter for every 4 h till the need for rescue analgesia. rescue analgesia was provided with injection diclofenac sodium 75 mg intramuscularly when vas 3 cm. the number of diclofenac injections given to each patient during the first 24 h of the post - operative period was recorded. the time between the complete sensory block and the first analgesic request was recorded as the duration of analgesia. the incidence of side effects (bradycardia, hypotension and sedation) was also recorded. sedation score was assessed according to the modified ramsay sedation scale from 1 to 6 as follows: 1 = anxious, agitated, restless; 2 = cooperative, oriented, tranquil; 3 = responds to commands only; 4 = brisk response to light glabellar tap or loud noise; 5 = sluggish response to light glabellar tap or loud noise and 6 = no response. bradycardia was defined as a decrease in hr by 20% from the baseline value or an absolute hr < 50 beats per min; which was managed by 0.5 mg iv bolus of atropine. hypotension was defined as fall in blood pressure by 20% from the baseline or an absolute map < 60 mmhg; which was managed by iv crystalloids (200 ml of ringer lactate / normal saline) or increments of mephentermine 3 mg iv. sample size calculation was done based on a pilot study of ten patients (5 in each group). the duration of analgesia in pilot study in two groups was 870.9 168.2 min and 750.2 221.4 min, respectively. to detect an observed difference of 2 h in the duration of analgesia between the groups, with a type 1 error of 5% and a power of 80%, the minimum sample size required was 37 in each group. data were checked, entered and analysed using spss version 19 for windows (ibm corp ., armonk quantitative data were represented as mean standard deviation, and for qualitative data, number and percentages were used . students ' t - test was used as test of significance to find an association for quantitative data . chi - square test was used as test of significance to find the association for qualitative data . one patient from group ld50 and one from group ld100 were excluded from the study due to incomplete / failed block . a total of 98 patients ( 49 in each group) were included in the study. both the groups were comparable with respect to age, height, weight, bmi, sex ratio, asa physical status and the duration of surgery. there was no statistical significance in baseline haemodynamic parameters and type of fractures between the two groups (p > 0.05). type of fractures in the study patients the sensory and motor block onset was significantly faster in group ld100 than in group ld50. the mean sensory block onset time was 12.82 3.8 min in group ld50 as compared to 8.15 1.7 min in group ld100 (p = 0.026). the mean motor block onset time was 17.8 6.3 min in group ld50 as compared to 14.3 4.2 min in group ld100 (p = 0.032). the duration of sensory block was prolonged in group ld100 (997.7 102.3 min) when compared to group ld50 (756.2 138.5 min) (p = 0.001). the duration of motor block was also prolonged in group ld100 (902.4 122.8 min) when compared to group ld50 (635.6 187.6 min) (p = 0.001). the duration of analgesia was significantly prolonged in group ld100 (1033.6 141.6 min) when compared with group ld50 (776.4 138.6 min) (p = 0.001). about 16/49 patients (32.65%) in group ld50 required diclofenac sodium injection as rescue analgesia, whereas 7 out of 49 patients (14.28%) in group ld100 required rescue analgesia in the first 24 h of post - operative period. characteristics of block in each group rescue analgesic requirement in post - operative period (p = 0.037) the incidence of adverse effects namely sedation and bradycardia was significantly higher in group ld100 compared with group ld50. however, the incidence of hypotension was statistically not significant between the groups (p = 0.056). hypotension was treated with 200 ml bolus of crystalloids (ringer lactate / normal saline) and mephentermine 3 mg iv with no further decrement. significantly more number of patients in group ld100 had higher sedation score (> 3) than those in group ld50. of this prospective, randomised, double - blinded study demonstrate that addition of 100 g dexmedetomidine to 0.5% levobupivacaine produces longer duration of analgesia compared to 50 g dexmedetomidine in supraclavicular brachial plexus block. the higher dose of dexmedetomidine also hastens the onset and prolongs the duration of sensory and motor block. fewer patients (14.28%) in group ld100 required diclofenac sodium injection as rescue analgesic than patients (32.65%) in group ld50. the incidence of bradycardia was observed in more patients (44.9%) in ld100 group, compared to ld50 group. dexmedetomidine is a potent and a highly selective 2 adrenergic agonist having sedative, sympatholytic and analgesic effects and has been described as a safe and effective additive in many anaesthetic applications and analgesic techniques. it is available as a preservative - free solution and contains no stabilisers or additives. the main interest of our study was to evaluate the efficacy and safety of two doses of perineurally administered dexmedetomidine in providing adequate intraoperative anaesthesia and prolongation of the duration of analgesia in supraclavicular brachial plexus block. found that dexmedetomidine enhanced the duration of bupivacaine anaesthesia and analgesia of sciatic nerve block in rats without any evidence of histopathological damage to the nerve. the action of dexmedetomidine in peripheral nerve blockade seems to be due to increase in hyperpolarisation - activated cation current that prevents the nerve from returning to its resting membrane potential. found that high concentrations of dexmedetomidine inhibit compound action potential (cap) in frog sciatic nerves without 2 adrenoceptor activation. their showed that dexmedetomidine reduced the peak amplitude of caps reversibly in a concentration - dependent manner. these findings provide the essential justification and rationale of our human studies. in our study, the onset of sensory and motor block was earlier with the higher dose of dexmedetomidine (100 g). in a recent study by marhofer et al. they compared three drug regimens with ropivacaine 0.75%, interaction of ropivacaine 0.75% with systemic dexmedetomidine or perineural dexmedetomidine on ulnar nerve block. onset of motor block was faster, and the duration of motor block was significantly prolonged by the perineural administration of dexmedetomidine. zhang et al. reported prolonged duration of analgesia in patients who received a higher dose of dexmedetomidine (100 g) in 40 ml of 0.33% ropivacaine when compared to 50 g of dexmedetomidine in axillary brachial plexus block. they also found that addition of 100 g of dexmedetomidine to ropivacaine produced prolonged duration of sensory and motor block compared to the ropivacaine alone group but concurrently increased the incidence of hypotension and bradycardia. concluded that dexmedetomidine (100 g) when used as an additive to 40 ml of 0.5% levobupivacaine prolonged axillary brachial plexus block duration. they showed that dexmedetomidine shortened the sensory block onset time, motor block onset time, and prolonged the duration of the sensory block, duration of the motor block and post - operative analgesia. swami et al. concluded that dexmedetomidine (1 g / kg) when added to local anaesthetic (35 cc, bupivacaine 0.25%) in supraclavicular brachial plexus block enhanced the duration of sensory and motor block and also the duration of analgesia. keplinger et al. assessed the dose dependency of dexmedetomidine when added to ropivacaine for peripheral nerve blockade. in their study, all volunteers received an ulnar nerve block with 22.5 mg ropivacaine alone (r), or mixed with 50 (rd50), 100 (rd100) or 150g (rd150) dexmedetomidine. there was a significant dose - dependent increase in the mean duration (sd) of analgesia with dexmedetomidine: r: 8.7 h, rd50: 16.4 h, rd100: 20.4 h and group rd150: 21.2 h. sedation was also enhanced in a dose - dependent manner. the analgesic effect of levobupivacaine in supraclavicular brachial plexus block was potentiated in a dose - dependent manner by adjuvant dexmedetomidine. in our study, fewer patients in ld100 group required diclofenac sodium injection as rescue analgesia (p < 0.05). similarly, ammar and mahmoud also found that significantly lower iv morphine (4.9 mg vs. 13.6 mg) was given as rescue analgesic in the bupivacaine plus dexmedetomidine group while comparing with plain bupivacaine group in infraclavicular brachial plexus block. in the present study, the incidence of adverse effects namely sedation and bradycardia was significantly higher in group ld100 compared with group ld50. sedative properties of dexmedetomidine are attributable to its lipophilic nature ing in systemic absorption when administered perineurally. reported significant sedation with the higher doses of dexmedetomidine (1.5 g / kg) in caudal ropivacaine compared with plain ropivacaine for post - operative analgesia in paediatric day - care patients. one hundred microgram dexmedetomidine added to levobupivacaine in brachial plexus block produces a longer duration of analgesia than 50 g.

and aims: the ideal dose of dexmedetomidine for brachial plexus block is a matter of debate. this study was carried out to evaluate 50 g or 100 g of dexmedetomidine added to 0.5% levobupivacaine, with regard to the duration of analgesia. our study also sought to assess the onset and duration of sensorimotor blockade, haemodynamic effects, sedation and adverse effects.methods:one hundred adult patients undergoing upper limb surgeries under supraclavicular brachial plexus block were randomly allocated into two groups. group ld50 received 29 ml of 0.5% levobupivacaine plus 50 g of dexmedetomidine diluted in 1 ml of normal saline. group ld100 received 29 ml of 0.5% levobupivacaine plus 100 g of dexmedetomidine diluted in 1 ml of normal saline. duration of analgesia was the primary outcome. onset and duration of sensorimotor blockade, haemodynamic variables, sedation score, and adverse effects were secondary outcomes. the data were analysed with students' t - test and chi - square test.:the onset of sensory block and motor block was 14.82 3.8 min and 19.75 6.3 min, respectively, in group ld50, while it was 11.15 1.7 min and 14.3 4.2 min, respectively, in group ld100. the duration of analgesia was significantly prolonged in group ld100 (1033.6 141.6 vs. 776.4 138.6 min ; p = 0.001). the incidence of bradycardia and sedation was observed in significantly more patients in group ld100. significantly fewer patients in group ld100 required rescue analgesia.:the 100 g dose of dexmedetomidine in brachial plexus block hastens the onset and prolongs the duration of sensorimotor blockade and analgesia, but with higher incidence of bradycardia and sedation.

aseptic technique should be used for all survival surgical procedures. disinfect the surgical work surface with commercial disinfectant and prepare sterile surgical packs of instruments, drapes, gauze, swabs, sutures, and scalpel blades by autoclaving. a surgical mask, hair bonnet and sterile gloves should be worn. a germinator dry bead sterilizer is also used to resterilize surgical instruments between procedures if multiple rat surgeries will be done during one session. prewarm a water - jacketed homeothermic blanket and place under an absorbent pad in order to prevent hypothermia of the rat during surgery. place spontaneously hypertensive rat (or other rat strain of choice) into an induction chamber and induce anesthesia with 5% isoflurane (anesthesia machine should be set to 1.0 l / min o2 and 1.0 l / min n2o). shave the throat and left neck region beyond the prospective incision site using clippers (oster a5 with # 10 blade). apply betadine to a gauze pad and disinfect the skin starting from the center of the surgical region, spiraling outward. rinse with sterile gauze pad containing 70% ethanol, moving pad in a similar pattern. place rat in sterile stockinette or cover with a sterile surgical drape. under an operating microscope, a ventral midline incision is performed and the superficial fascia is dissected. beneath the superficial fascia, there is glandular tissue to the left and three muscles which form a triangle: the sternohyoid, which lies midline over the trachea; the digastric (easily identified with its shiny white tendinous portion); and lastly, the sternomastoid muscle. careful sharp and blunt dissection is performed within the triangle to identify the carotid artery (exclusive blunt dissection may be preferred by some to minimize accidental tissue damage). the external, internal, and common carotid arteries (eca, ica, cca) are exposed. the vagus nerve is seen coursing along the lateral aspect of both common and internal carotid arteries and is sharply dissected off the common and internal carotid arteries. two eca branches are then dissected sharply, the first branch heading medially and the second branch heading laterally. both branches are cauterized and cut, which allows for greater ease in mobilizing the larger vessels. the hyoid bone may be encountered and this will limit the extent of rostral dissection. the external carotid artery is tied off as distally as possible with a 6 - 0 silk suture. another 6 - 0 silk suture is placed loosely around the eca near the bifurcation with the ica. make sure not to occlude the vessel as the intraluminal suture to be used for the occlusion will be going through here at a later step. an initial partial arteriotomy is created between the two silk suture ties on the external carotid artery. introduce a 2.2 -3.0 cm length of 4 - 0 monofilament nylon suture, with a kink 2.0 cm from its rounded, silicon - coated tip, into the eca lumen down toward the cca where the microsurgical clip is located. cut the remaining portion of the eca (at the site of the partial arteriotomy) to free the stump and position the stump below the bifurcation of the eca and ica; this will more easily allow the intraluminal suture to slide into the ica. tighten the silk suture around the eca stump to secure the intraluminal nylon suture and prevent bleeding, and then remove the microvascular clip from the ica. open the clip slowly before removing it to check for bleeding. continue advancing the nylon suture from the eca to ica lumen to the middle cerebral artery (mca). this length is typically 18 - 20 mm and is the reason for placing a kink in the suture prior to insertion. if this occurs with much of the nylon suture still present outside of the vessel, it indicates that the suture is likely entering the pterygopalatine artery (see note below). pull back and curve the suture slightly to continue along the ica, which will run more medially. additionally, dissection of the origin of the ppa may be done to better visualize the path of the intraluminal filament. continue to insert the nylon suture until resistance is felt at and after the 2 cm kinked position. at this point mca occlusion can be confirmed by monitoring the reduction in regional cerebral blood flow using a laser doppler flowmeter (see materials table for one equipment source). also note that the origin of the pterygopalatine artery off of the ica can be directly tied off, if preferred, in order to avoid accidental intubation of this vessel with the intraluminal suture. start the timer and record occlusion start time. remove the microclip from the cca. close the incision (dermis, panniculus carnosus, subcutaneous tissue layers) quickly with 3 - 0 silk suture (a simple continuous pattern will facilitate reopening for reperfusion) and carefully place the rat in a recovery cage. check that the cage floor around the nose and mouth are free of bedding material and monitor recovery from anesthesia. shortly before the occlusion period should end, re - anesthetize the rat, disinfect the incision site with betadine and 70% ethanol (3 cycles, as before) and reopen the incision by removing the closing sutures. withdraw the occluding suture partway from the ica until the suture end is visible through the ica. do not fully remove the suture from the ica / eca! place a microclip on the ica above the end of the intraluminal suture. completely remove the occluding suture and tightly tie off the eca stump. moisten the region with several drops of sterile saline and close the incision layers (dermis, panniculus carnosus, subcutaneous tissue) with 3 - 0 silk suture using a simple interrupted pattern. administer 0.05 mg / kg buprenorphine (or other appropriate post - operative analgesic following your institutional guidelines) into the peritoneal space. after the rat has recovered, test for behavioral indication of infarction by holding the rat by the tail and observing whether the rat can turn to both sides. simple scoring scales can be used to record initial post - infarct behavorial functioning (see discussion). additional injections of buprenorphine (same dosage as above) should be given every 6 to 8 hours for 24 hr of pain relief.. a simplified diagram of the cranial circulatory system of the rat is shown with a silicon - coated intraluminal suture occluding the origin of the mca. the oa and st branches off of the left eca have been ligated and a suture tie around the eca stump holds the intraluminal suture in place. aca, anterior cerebral artery; ba, basilar artery; cca, common carotid artery; eca, external carotid artery; ica, internal carotid artery; mca, middle cerebral artery; oa, occipital artery; pca, posterior cerebral artery; pcoma, posterior communicating artery; ppa, pterygopalatine artery; st, superior thyroid artery. representative magnetic resonance imaging of coronal sections of rat brain 24 hours after 1 hour transient mcao. similar infarct patterns can be seen with more advanced mri techniques such as diffusion - weighted imaging and apparent diffusion coefficient mapping. representative coronal sections of rat brain stained with ttc 24 hours after 1 hour transient mcao. ttc staining reveals white (unstained) infarcted regions of cerebral cortex and striatum in the same rat as that shown in figure 2. note that the general pattern of focal ischemic lesions is similar to that seen in the mri t2-weighted images, although the final infarct area determined histologically may be slightly smaller than the t2 lesion. aseptic technique should be used for all survival surgical procedures. disinfect the surgical work surface with commercial disinfectant and prepare sterile surgical packs of instruments, drapes, gauze, swabs, sutures, and scalpel blades by autoclaving. a surgical mask, hair bonnet and sterile gloves should be worn. a germinator dry bead sterilizer is also used to resterilize surgical instruments between procedures if multiple rat surgeries will be done during one session. prewarm a water - jacketed homeothermic blanket and place under an absorbent pad in order to prevent hypothermia of the rat during surgery. place spontaneously hypertensive rat (or other rat strain of choice) into an induction chamber and induce anesthesia with 5% isoflurane (anesthesia machine should be set to 1.0 l / min o2 and 1.0 l / min n2o). shave the throat and left neck region beyond the prospective incision site using clippers (oster a5 with # 10 blade). apply betadine to a gauze pad and disinfect the skin starting from the center of the surgical region, spiraling outward. rinse with sterile gauze pad containing 70% ethanol, moving pad in a similar pattern. under an operating microscope, a ventral midline incision is performed and the superficial fascia is dissected. beneath the superficial fascia, there is glandular tissue to the left and three muscles which form a triangle: the sternohyoid, which lies midline over the trachea; the digastric (easily identified with its shiny white tendinous portion); and lastly, the sternomastoid muscle. careful sharp and blunt dissection is performed within the triangle to identify the carotid artery (exclusive blunt dissection may be preferred by some to minimize accidental tissue damage). the external, internal, and common carotid arteries (eca, ica, cca) are exposed. the vagus nerve is seen coursing along the lateral aspect of both common and internal carotid arteries and is sharply dissected off the common and internal carotid arteries. two eca branches are then dissected sharply, the first branch heading medially and the second branch heading laterally. both branches are cauterized and cut, which allows for greater ease in mobilizing the larger vessels. the hyoid bone may be encountered and this will limit the extent of rostral dissection. the external carotid artery is tied off as distally as possible with a 6 - 0 silk suture. another 6 - 0 silk suture is placed loosely around the eca near the bifurcation with the ica. make sure not to occlude the vessel as the intraluminal suture to be used for the occlusion will be going through here at a later step. an initial partial arteriotomy is created between the two silk suture ties on the external carotid artery. introduce a 2.2 -3.0 cm length of 4 - 0 monofilament nylon suture, with a kink 2.0 cm from its rounded, silicon - coated tip, into the eca lumen down toward the cca where the microsurgical clip is located.., redlands, ca, usa ). cut the remaining portion of the eca (at the site of the partial arteriotomy) to free the stump and position the stump below the bifurcation of the eca and ica; this will more easily allow the intraluminal suture to slide into the ica. tighten the silk suture around the eca stump to secure the intraluminal nylon suture and prevent bleeding, and then remove the microvascular clip from the ica. open the clip slowly before removing it to check for bleeding. continue advancing the nylon suture from the eca to ica lumen to the middle cerebral artery (mca). this length is typically 18 - 20 mm and is the reason for placing a kink in the suture prior to insertion. after a variable length of nylon suture if this occurs with much of the nylon suture still present outside of the vessel, it indicates that the suture is likely entering the pterygopalatine artery (see note below). pull back and curve the suture slightly to continue along the ica, which will run more medially. additionally, dissection of the origin of the ppa may be done to better visualize the path of the intraluminal filament. continue to insert the nylon suture until resistance is felt at and after the 2 cm kinked position. at this point mca occlusion can be confirmed by monitoring the reduction in regional cerebral blood flow using a laser doppler flowmeter (see materials table for one equipment source). also note that the origin of the pterygopalatine artery off of the ica can be directly tied off, if preferred, in order to avoid accidental intubation of this vessel with the intraluminal suture. close the incision (dermis, panniculus carnosus, subcutaneous tissue layers) quickly with 3 - 0 silk suture (a simple continuous pattern will facilitate reopening for reperfusion) and carefully place the rat in a recovery cage. check that the cage floor around the nose and mouth are free of bedding material and monitor recovery from anesthesia. shortly before the occlusion period should end, re - anesthetize the rat, disinfect the incision site with betadine and 70% ethanol (3 cycles, as before) and reopen the incision by removing the closing sutures. withdraw the occluding suture partway from the ica until the suture end is visible through the ica. do not fully remove the suture from the ica / eca! place a microclip on the ica above the end of the intraluminal suture. moisten the region with several drops of sterile saline and close the incision layers (dermis, panniculus carnosus, subcutaneous tissue) with 3 - 0 silk suture using a simple interrupted pattern. administer 0.05 mg / kg buprenorphine (or other appropriate post - operative analgesic following your institutional guidelines) into the peritoneal space. after the rat has recovered, test for behavioral indication of infarction by holding the rat by the tail and observing whether the rat can turn to both sides. simple scoring scales can be used to record initial post - infarct behavorial functioning (see discussion). additional injections of buprenorphine (same dosage as above) should be given every 6 to 8 hours for 24 hr of pain relief. occlusion of the middle cerebral artery by endovascular suture. a simplified diagram of the cranial circulatory system of the rat is shown with a silicon - coated intraluminal suture occluding the origin of the mca. the oa and st branches off of the left eca have been ligated and a suture tie around the eca stump holds the intraluminal suture in place. aca, anterior cerebral artery; ba, basilar artery; cca, common carotid artery; eca, external carotid artery; ica, internal carotid artery; mca, middle cerebral artery; oa, occipital artery; pca, posterior cerebral artery; pcoma, posterior communicating artery; ppa, pterygopalatine artery; st, superior thyroid artery. representative magnetic resonance imaging of coronal sections of rat brain 24 hours after 1 hour transient mcao. similar infarct patterns can be seen with more advanced mri techniques such as diffusion - weighted imaging and apparent diffusion coefficient mapping. representative coronal sections of rat brain stained with ttc 24 hours after 1 hour transient mcao. ttc staining reveals white (unstained) infarcted regions of cerebral cortex and striatum in the same rat as that shown in figure 2. note that the general pattern of focal ischemic lesions is similar to that seen in the mri t2-weighted images, although the final infarct area determined histologically may be slightly smaller than the t2 lesion. rodent models of cerebral ischemia can be classified as global or focal and as reversible or irreversible. we use a reversible focal ischemia model in order to mimic the reperfusion injury that can occur following recanalization in human stroke patients. while the rat shares the advantage of similar cranial circulation to the human, the extensive intracranial collateral circulation due to the circle of willis and leptomeningeal anastomoses in inconsistent infarct volumes. we use the spontaneously hypertensive rat (shr) strain because infarct size is greater in shrs exposed to focal cerebral ischemia compared to normotensive rats. stroke induction in shrs is also more consistent and may generate less mortality than in other commonly used strains. in addition, physiological parameters should be monitored throughout the surgery, because fluctuations can add to the variability in infarct volumes; these parameters include blood pressure, arterial o2 and co2 levels, hypothermia, and hyperglycemia, which can exacerbate ischemic injury. hypothermia is of particular concern because it can lessen the degree of neuronal ischemic injury, and therefore, placing the rat on a thermoregulatory heating pad during surgery is essential. we employ commercially prepared silicon - coated sutures in this procedure in an attempt to increase consistency in the infarct size. traditionally, intraluminal sutures used to occlude the mca have been prepared by flame - rounding a 3 - 0 nylon suture tip or using a hot glue gun to coat the suture tip with a small glue bead. these procedures produce sutures with varying tip diameters and thus, may require several attempts at occlusion before finding a suture that matches the vessel diameter of a given rat. additional variations on the mcao method described in this video include more distal occlusion, sparing the lenticulostriate branches in order to have a pure cortical infarct, and simultaneous occlusion of the mca and ipsilateral common carotid artery to reduce collateral blood flow. the functional effects of stroke can be assessed using a variety of behavioral tests, in which deficits in specific tasks are reflected in a simple scoring scale. for example, bederson et al. developed a neurological score grading rats on the extent of forelimb flexion in an elevated body position, asymmetric resistance to a lateral push, and open field circling behavior. rats extending both forelimbs to the floor when elevated and exhibiting no other deficits were graded " normal ", whereas rats with contralateral forelimb flexion only were classified with " moderate deficits ". " severe grade 2 " rats displayed decreased resistance on the contralateral side to a lateral force and " severe grade 3 " rats additionally engaged in circling behaviors. lower grade behavioral deficits were always observed in the next higher grade (e.g., grade 2 and 3 animals also displayed forelimb flexion) and these scores were predictive of differences in infarct size. thus, such a simple scoring system allows for a rapid, consistent semi - quantitative assessment of the functional deficits from stroke. measurement of the extent of cerebral infarction is commonly accomplished by histological staining for tissue damage using ttc, cresyl violet (nissl stain) or hematoxylin and eosin. magnetic resonance imaging techniques, including diffusion - weighted mri to visualize the infarct at early time points after occlusion, allow for the determination of an infarct volume in each individual rat without the need for harvesting tissue. this is especially valuable in studies aimed at determining the efficacy of a neuroprotective treatment following stroke; imaging the rat after mcao but prior to treatment administration gives the investigator confidence that all experimental and control animals experienced similar strokes to start, reducing the confounding effects of variability in stroke induction. the authors have no conflicting interests to disclose.this protocol was approved by the institutional animal care and use committee at university of wisconsin - madison school of medicine and public health and abides by the national institutes of health guidelines for the use of experimental animals.

stroke is the leading cause of disability and the third leading cause of death in adults worldwide1. in human stroke , there exists a highly variable clinical state; in the development of animal models of focal ischemia, however, achieving reproducibility of experimentally induced infarct volume is essential. the rat is a widely used animal model for stroke due to its relatively low animal husbandry costs and to the similarity of its cranial circulation to that of humans2,3. in humans, the middle cerebral artery (mca) is most commonly affected in stroke syndromes and multiple methods of mca occlusion (mcao) have been described to mimic this clinical syndrome in animal models. because recanalization commonly occurs following an acute stroke in the human, reperfusion after a period of occlusion has been included in many of these models. in this video , we demonstrate the transient endovascular suture mcao model in the spontaneously hypertensive rat (shr). a filament with a silicon tip coating is placed intraluminally at the mca origin for 60 minutes, followed by reperfusion. note that the optimal occlusion period may vary in other rat strains, such as wistar or sprague - dawley. several behavioral indicators of stroke in the rat are shown. focal ischemia is confirmed using t2-weighted magnetic resonance images and by staining brain sections with 2,3,5-triphenyltetrazolium chloride (ttc) 24 hours after mcao.

the contura multi - lumen balloon (mlb) by senorx is a five - channel breast brachytherapy balloon developed for accelerated partial breast irradiation (apbi) using high dose rate iridium-192. the device is designed to improve upon the utility of single channel breast brachytherapy by offering multiple channels for the sake of dose optimization. because of its close proximity, the single channel device is not always suitable, as it can lead to unacceptably high skin dose, ing in poor cosmesis. the contura mlb design includes four stable treatment channels that surround a fifth central channel. this geometry offers greater ability to optimize the treatment dose distribution, especially with regard to skin, rib and lung. target tissue conformance to the balloon surface is another important consideration in this type of apbi. however, up to 10% of the planning target volume (ptv) may be displaced by air or fluid and still be considered acceptable. the contura has a vacuum port that can remove air and fluid from the surrounding lumpectomy cavity (other devices do not have this feature) and thereby improve tissue conformance to the balloon surface. the contura device is inflated with a solution of saline and iodine contrast (isovue - m 300, bracco diagnostics) to a volume ranging from 28 - 64.5 cm (4 - 5 cm diameter contura), depending on lumpectomy cavity size. the vendor recommends a 3% contrast solution by volume with the saline to assure optimal imaging using either ct or simulator. most commercial treatment planning systems are not capable of computing the perturbation effects that may from air pockets or contrast material. earlier studies have investigated dose perturbation effects associated with certain partial breast brachytherapy devices. this study evaluates the dosimetric effects of high atomic number contrast and air pockets for the contura device. the experimental setup for the dose perturbation measurements used a water phantom with a waterproof markus parallel plate ionization chamber (ptw) and k602 electrometer (cnmc best). the chamber was supported on a motorized vertical drive assembly with the incident surface overlying the upper contura surface. the contura was inflated to 37 cm (42 mm diameter) and supported horizontally in a ring stand with a clamp. two flexible needle source transfer tubes connected the nucletron microselectron indexer to the central contura channel (# 5) and to the channel oriented closest to the ionization chamber (channel # 1). the channel attachments were made above the water surface by bending the contura stem vertically. the incident surface of the parallel plate chamber was positioned adjacent to the upper surface of the contura (senorx) and a motorized support raised the chamber for data collection (right). the outer contura channels are 5 mm from the central channel at mid cross - section (left) the determination of the sweetspot (ir-192 source position that ed in the maximum ionization current) was performed for each channel and repeated for each experimental condition. baseline ionization measurements were made at distances from 1 - 51 mm from the contura surface without any air bubble or contrast. the following seven test conditions were achieved using a 60 cc syringe and then tested for comparison to determine dose perturbation effects: 1 cm, 2 cm, 3 cm and 4 cm air bubble, and 3%, 6% and 9% contrast solutions. corrections were applied to account for temperature and pressure variations and for the source decay during several days of the measurements. the experimental setup was performed twice and the reported are the average of the two data sets. dpf was defined as the ratio of dose with and without air or contrast medium. figures 2 and 3 demonstrate that higher doses by 2 - 4% from the introduction of 1 - 3 cm of air. the dimensions of the air volumes were not evaluated but these indicate that the path length of air toward the point of measurement is not proportional to the volume of air introduced. with two sets of data taken, the uncertainty in the measurements was in the range of 0.9 2.4%. the 9% solution in 4% lower dose close to the contura balloon and moderates with distance to 2 - 3%. the air pocket and the central and off - center channel for each measurement condition are similar but more pronounced by about 1% for the central channel. for the two measurement sessions the reproducibility of air volume perturbation did not vary by more than 0.9% with standard deviation of 0.3%. the reproducibility of the contrast perturbation experiments was within 2.4% for the central channel and 1.5% for the off - center channel with standard deviations within 0.3% dose perturbations due to air pockets with the hdr iridium source in the central contura (senorx) channel (# 5) (data collected 1 mm to 51 mm from contura surface) 1 - 4 cc air bubble, no contrast, channel 1. dose perturbations due to air pockets with the hdr iridium source in the contura (senorx) channel # 1 (data collected 1 mm to 51 mm from contura surface) 3 - 9% contrast, no air bubble, channel 5. dose perturbations due to different iodinated contrast solutions (by volume) with the hdr iridium source in the central contura (senorx) channel (# 5) (data collected 1 mm to 51 mm from contura surface) 3 - 9% contrast, no air bubble, channel 1. dose perturbations due to different iodinated contrast solutions (by volume) with the hdr iridium source in the contura (senorx) channel # 1 (data collected 1 mm to 51 mm from contura surface) dose perturbations ing from air pockets and high atomic number contrast have been studied in accelerated partial brachytherapy devices. based on earlier dose perturbation studies of the single channel mammosite , similar would be expected for the contura, at least from the central channel 5. those studies demonstrated that high z contrast causes dose reduction while the presence of air leads to increased dose. this study also demonstrates that channel location does not impact significantly on the perturbation effects. although air bubble dimensions were not evaluated, the experimental conditions would be comparable in the clinical situation. brachytherapy dose measurement precision is always limited in non rigid phantoms. in this study deflection and compression of the contura balloon this represents a limitation on the that can be drawn as well as differences from previously reported for the mammosite. in this study the effect of air appears to be more significant while the effect of contrast is less. however, the trends are clear and consistent and demonstrate the importance of following vendor instructions and sound procedures to ensure accurate dose delivery. vendor instructions recommend 3% contrast solution by volume and that is shown here to cause clinically insignificant dose perturbation effect. dose perturbation effects due to air and high z contrast in a multichannel breast brachytherapy device have been measured. the reported here are similar to earlier reported for a single central channel device. in the absence of inhomogeneity correction incorporation of ct data for planning should be developed to offer improved dose computation accuracy. for that reason, it is important to follow the appropriate guidelines for the use of contrast and to minimize the presence of air in order to limit dose perturbation effects in patient treatment.

purposea study was conducted to determine the dosimetric effects ing from air pockets and high atomic number (z) contrast medium within a multichannel breast brachytherapy device.material and methodsa 5 - 6 cm diameter contura (senorx) brachytherapy device was inflated using 37 cm3 of saline. baseline dose falloff from an hdr iridium-192 source was measured with the iridium source centered in the central channel and an anterior off - center channel. data were collected at distances from 1 to 50 mm. comparison studies were conducted with identically inflated volume containing varied air pocket volumes (1 - 4 cm3) and concentrations of contrast solution (3%, 6%, and 9% by volume). dose perturbation factors (dpf) were computed and evaluated.dose perturbations due to air pockets and contrast solutions were observed. as the volume of air increased, the dpf increased by approximately 2.25%/cm3. the effect was consistent for both channels. the contrast effects were more complex. the 3% contrast media had minimal dose perturbation. the 6% contrast solution caused dose reduction of 1.0% from the central channel but 1.5% dose increase from the anterior channel. the 9% contrast solution caused dose reductions by 4.0% (from central channel) and 3.0% (from anterior channel). the dpf from all contrast solutions moderated with increasing distance.dose perturbations due to air pockets and high - z contrast solution can be significant. it is important to control these effects to avoid dose errors.

five of the articles deal directly or indirectly with children's mental health matters in the context of medicaid. this overview compares and discusses the findings of these articles in some detail before briefly outlining the remaining articles on more specialized topics. the president's new freedom commission on mental health issued its final report in july 2003, setting forth a number of key goals and findings. among those particularly relevant to matters discussed in this issue mental health is essential to overall health , and goal 3, that disparities in mental health services should be eliminated. in 2004 a key part of that agenda will be the conduct of research to understand disparities in mental health treatment and provide a basis for their elimination. the first three articles in this issue contain findings that underscore the continued existence of the disparities noted by the commission, and, to some extent, particularize those disparities the article by larson, miller, sharma, and manderscheid examines data on service use and payments for children in racial / ethnic subgroups in medicaid programs of four states, and compares the service use of children treated for mental health / substance abuse conditions with those without such conditions. the authors note previous findings that mental health problems among children and adolescents affect about 10 to 20 percent of children age 9 - 13, and that treatment rates appear to be increasing. most importantly, they note that previous evidence suggests that the overall rate of diagnosable mental health / substance abuse disorders is comparable across racial and ethnic groups. in this article , the authors present updated analyses of medicaid data that predate many state health care reform initiatives in order to provide baseline data for the analysis of reforms. study ed in a number of complex findings concerning demographic differences in treatment rates and types of conditions treated for various groups. particularly striking are the findings that: nearly all diagnoses are more common among medicaid recipients who are white; mental health / substance abuse diagnoses among white claimants are over two times the rate of diagnoses of children in other racial or ethnic groups combined; and major depression, bipolar disorders, and other psychoses are nearly three times more common among white child / adolescent claimants than youth in other race / ethnicity groups. not surprisingly, similar findings of concern related to disparities in the actual use of mental health / substance abuse services, such as physician services and inpatient hospital care. their article closes with some helpful suggestions as to approaches to address disparities in diagnosis and treatment of mental health / substance abuse disorders, noting that, ultimately, public insurance programs such as medicaid must use multiple points of leverage to increase access, address stigma and misperceptions of care, and influence the quality of care delivered. the article by saunders and heflinger examines the effects of introducing medicaid managed care into a previously fee - for - service (ffs) environment on children and adolescents' access to behavioral health care services, and on the mix of such services that will be available. it does this by comparing access and service mix in mississippi (ffs) and tennessee (managed care). it also examines access and service mix in these states based on race, sex, age, and medicaid enrollment category. the study found, among other things, that although each state experienced positive annual growth in behavioral health service access (with the exception of tennessee 's overnight services), female and minority youth were less likely to access behavioral health services, both overall and by type of service. offer evidence that managed care not only reduces access to behavioral services overall and both access to and mix of inpatient services , but it also may lead to reductions in specialty outpatient services as well. in the medicaid categories, the authors report a consistent pattern of lower access to behavioral health services among poverty - related youth and greater access of foster care youth relative to youth on supplemental security income. on the other hand, the authors state: nevertheless, the news is not all bad for managed care explaining that tennessee experienced significant positive increases in case management services. this suggests that the problem of reduced access to mental health service providers is offset by increased use of the services of case managers. the article by cook et al. examines the association between caregivers' (parents and families) satisfaction with services and the likelihood that children with severe emotional disturbance will receive mental health services. focuses on caregivers' satisfaction with services provided under managed care (as opposed to ffs) arrangements that are increasingly used to control costs in programs for low - income children and their families. the study confirmed a robust association between caregivers' prior level of satisfaction with features of medicaid - funded behavioral health care plans and children's later mental health service utilization. moreover, it identified particular areas in which caregivers were least satisfied, and thus, areas for possible improvement in service delivery by focusing on improving caregiver satisfaction. the area most in need of improvement was the adequacy of plans' information about the availability of services and providers. also sources of dissatisfaction were the number of forms to be filled out, the willingness of plans to pay for inpatient hospital or residential care, the inability to find providers willing to accept the plans, and the truthfulness of information provided about plan benefits and services. consistent with the findings of saunders and heflinger, cook et al. found that children in managed care plans were significantly less likely to use a number of services. they also note a trend toward lesser likelihood of psychiatric inpatient care (as well as other services) among those enrolled in managed care, and counsels: efforts to control the rising costs of health care must not occur at the expense of this vulnerable group of america's children. in closing, they suggest a number of policy protections to avoid this , including increasing the involvement of caregivers in the design and implementation of managed care arrangements. the three articles in this issue devoted directly to children's mental health in the medicaid context, when viewed together, suggest that the baseline from which we must work to eliminate disparities in access and quality of mental health / substance abuse services to minority or other underserved populations presents a great challenge. in addition, these articles suggest that the increasing use of managed care, with its inherent pressure toward controlling health care costs, tends to exacerbate that challenge. the article by baugh, pine, blackwell, and cibrowski concerning medicaid spending for central nervous system and antipsychotic drugs further illustrates the challenge of meeting the goals of the president's new freedom commission on mental health. it shows that, in 1998, central nervous system drugs were the most expensive therapeutic category of drugs for state medicaid programs. mental health is essential to overall health , it is critical that these important drugs be provided to consumers as needed. at the same time, mounting cost - control pressures in connection with meeting this need can be expected to increase the trend toward managed care arrangements, which to date have a relatively poor track record in terms of removal of disparities in access to quality mental health / substance abuse treatments by minorities and other underserved populations. the article by holmes and deb examines whether, in one state (indiana), community mental health centers differ in their ability to serve at - risk populations. it succeeded in identifying certain exemplary centers whose practices may be worth emulating, as well as centers operating on a sub - par level. the empirical model used in this study in indiana may be useful for evaluating community mental health centers' performance in other states as a basis for improving medicaid service delivery nationwide. the article by cotterill and thomas reports the findings of an empirical analysis of per case and per diem models of prospective payment for medicare inpatient psychiatric care. their study supports the viability of the per diem model and identifies directions for future research. the article by cromwell, maier, gage, drozd, osber, richter, greenwald, and goldman addresses limitations in previous studies of the costs of medicare psychiatric inpatients caused by the use of claims and provider cost reports that failed to identify differences in patient characteristics and routine costs. this article is based on new primary data from 66 units in 40 facilities nationwide to measure the times spent by staff in caring for medicare patients. the study identifies key patient characteristics associated with high staffing days, including severe psychiatric diagnosis, deficits in activities of daily living, and assaultive or agitated behaviors. the article by larson, miller, sharma, and manderscheid examines data on service use and payments for children in racial / ethnic subgroups in medicaid programs of four states, and compares the service use of children treated for mental health / substance abuse conditions with those without such conditions. the authors note previous findings that mental health problems among children and adolescents affect about 10 to 20 percent of children age 9 - 13, and that treatment rates appear to be increasing. most importantly, they note that previous evidence suggests that the overall rate of diagnosable mental health / substance abuse disorders is comparable across racial and ethnic groups. in this article, the authors present updated analyses of medicaid data that predate many state health care reform initiatives in order to provide baseline data for the analysis of reforms. study ed in a number of complex findings concerning demographic differences in treatment rates and types of conditions treated for various groups. particularly striking are the findings that: nearly all diagnoses are more common among medicaid recipients who are white; mental health / substance abuse diagnoses among white claimants are over two times the rate of diagnoses of children in other racial or ethnic groups combined; and major depression, bipolar disorders, and other psychoses are nearly three times more common among white child / adolescent claimants than youth in other race / ethnicity groups. not surprisingly, similar findings of concern related to disparities in the actual use of mental health / substance abuse services, such as physician services and inpatient hospital care. their article closes with some helpful suggestions as to approaches to address disparities in diagnosis and treatment of mental health / substance abuse disorders, noting that, ultimately, public insurance programs such as medicaid must use multiple points of leverage to increase access, address stigma and misperceptions of care, and influence the quality of care delivered. the article by saunders and heflinger examines the effects of introducing medicaid managed care into a previously fee - for - service (ffs) environment on children and adolescents' access to behavioral health care services, and on the mix of such services that will be available. it does this by comparing access and service mix in mississippi (ffs) and tennessee (managed care). it also examines access and service mix in these states based on race, sex, age, and medicaid enrollment category. the study found, among other things, that although each state experienced positive annual growth in behavioral health service access (with the exception of tennessee 's overnight services), female and minority youth were less likely to access behavioral health services, both overall and by type of service. offer evidence that managed care not only reduces access to behavioral services overall and both access to and mix of inpatient services , but it also may lead to reductions in specialty outpatient services as well. in the medicaid categories, the authors report a consistent pattern of lower access to behavioral health services among poverty - related youth and greater access of foster care youth relative to youth on supplemental security income. nevertheless, the news is not all bad for managed care explaining that tennessee experienced significant positive increases in case management services. this suggests that the problem of reduced access to mental health service providers is offset by increased use of the services of case managers. the article by cook et al. examines the association between caregivers' (parents and families) satisfaction with services and the likelihood that children with severe emotional disturbance will receive mental health services. focuses on caregivers' satisfaction with services provided under managed care (as opposed to ffs) arrangements that are increasingly used to control costs in programs for low - income children and their families. the study confirmed a robust association between caregivers' prior level of satisfaction with features of medicaid - funded behavioral health care plans and children's later mental health service utilization. moreover, it identified particular areas in which caregivers were least satisfied, and thus, areas for possible improvement in service delivery by focusing on improving caregiver satisfaction. the area most in need of improvement was the adequacy of plans' information about the availability of services and providers. also sources of dissatisfaction were the number of forms to be filled out, the willingness of plans to pay for inpatient hospital or residential care, the inability to find providers willing to accept the plans, and the truthfulness of information provided about plan benefits and services. consistent with the findings of saunders and heflinger, cook et al. found that children in managed care plans were significantly less likely to use a number of services. they also note a trend toward lesser likelihood of psychiatric inpatient care (as well as other services) among those enrolled in managed care, and counsels: efforts to control the rising costs of health care must not occur at the expense of this vulnerable group of america's children. in closing, they suggest a number of policy protections to avoid this , including increasing the involvement of caregivers in the design and implementation of managed care arrangements. the three articles in this issue devoted directly to children's mental health in the medicaid context, when viewed together, suggest that the baseline from which we must work to eliminate disparities in access and quality of mental health / substance abuse services to minority or other underserved populations presents a great challenge. in addition, these articles suggest that the increasing use of managed care, with its inherent pressure toward controlling health care costs, tends to exacerbate that challenge. the article by baugh, pine, blackwell, and cibrowski concerning medicaid spending for central nervous system and antipsychotic drugs further illustrates the challenge of meeting the goals of the president's new freedom commission on mental health. it shows that, in 1998, central nervous system drugs were the most expensive therapeutic category of drugs for state medicaid programs. mental health is essential to overall health , it is critical that these important drugs be provided to consumers as needed. at the same time, mounting cost - control pressures in connection with meeting this need can be expected to increase the trend toward managed care arrangements, which to date have a relatively poor track record in terms of removal of disparities in access to quality mental health / substance abuse treatments by minorities and other underserved populations. the article by holmes and deb examines whether, in one state (indiana), community mental health centers differ in their ability to serve at - risk populations. it succeeded in identifying certain exemplary centers whose practices may be worth emulating, as well as centers operating on a sub - par level. the empirical model used in this study in indiana may be useful for evaluating community mental health centers' performance in other states as a basis for improving medicaid service delivery nationwide. the article by cotterill and thomas reports the findings of an empirical analysis of per case and per diem models of prospective payment for medicare inpatient psychiatric care. their study supports the viability of the per diem model and identifies directions for future research. the article by cromwell, maier, gage, drozd, osber, richter, greenwald, and goldman addresses limitations in previous studies of the costs of medicare psychiatric inpatients caused by the use of claims and provider cost reports that failed to identify differences in patient characteristics and routine costs. this article is based on new primary data from 66 units in 40 facilities nationwide to measure the times spent by staff in caring for medicare patients. the study identifies key patient characteristics associated with high staffing days, including severe psychiatric diagnosis, deficits in activities of daily living, and assaultive or agitated behaviors.

the following overview discusses and compares the findings and implications of the articles in this issue of the health care financing review that deal with mental health topics particularly children's mental health in the medicaid context. it also briefly describes articles concerning prospective payments for psychiatric patients under medicare.

medulloblastoma (mb) is the most common malignant brain tumor in children, but in adults the disease is rare and accounts for less than 1 % of all intracranial malignancies. due to the infrequent occurrence of this disease in adults, not much was known until recently about the biology and genetics of adult mb and there are no prospective mb trials for this particular age group. most centers therefore treat adults either by radiotherapy alone, by glioblastoma protocols, or by using pediatric mb protocols, although it is well known that toxicity profiles vary greatly between children and adults, leading to dose - limiting toxicity in a majority of adults that are treated on pediatric protocols. medulloblastoma is not a single disease but in fact comprises a collection of clinically and molecularly diverse tumor subgroups both in children and in adults. the current consensus is that there are four major subgroups named wnt, shh, group 3, and group 4. wnt mbs are characterized by activated wnt signaling, mostly caused by mutations in b - catenin, and they have an excellent outcome with survival rates of > 90 %. genomically they are very stable, except that almost all cases have lost an entire copy of chromosome 6. interestingly, it is the adult cases that tend to lose only parts of chromosome 6. shh mbs are characterized by shh signaling, caused by mutations in ptch1, smo, or sufu, and/or amplifications of gli1 or gli2, which all lead to constitutive activation of the shh signaling pathway. genomically they are characterized by frequent loss of chromosome arm 9q, which harbors the ptch1 gene. a subset of shh tumors have amplified the mycn oncogene, which in this subgroup is associated with a poor outcome. in general these patients have an intermediate outcome, although there are strong differences in prognosis depending on histology. desmoplastic histology is associated with a much better outcome than cases with a classic histological pattern, while large cell / anaplastic (lca) histology predicts a very poor outcome. group 3 and 4 tumors are less well characterized, but they contain most of the chromosome 17 aberrations that are frequently found in medulloblastoma. small subsets of these subgroups have amplifications of either the myc (group 3) or the mycn oncogene (group 4). the worst outcome is seen for group 3 tumors, while group 4 tumors have more of an intermediate outcome similar to the shh subgroup. recent meta - analyses performed on all published datasets of medulloblastomas analyzed and categorized into subgroups either by gene expression profiling or immunohistochemistry, and which included infants (< 4 years) (167 ; 18 %), children (416 years) (599 ; 63 %), and adults (> 16 years) (177 ; 19 %), showed that the same four molecular subgroups (wnt, shh, group 3, and group 4) are found across all age groups, but they occur at strikingly different frequencies within each age group (table 1) (and references therein). in adults, the shh subgroup forms by far the largest subgroup, accounting for 57 % of all tumors. other tumors in this age group are mainly characterized as wnt (13 %) or group 4 (28 %), while group 3 tumors are very rare in adults (2 %).comparing survival rates for the four subgroups in adult patients versus those in pediatric patients showed some remarkable differences. in particular, group 4 adult patients fare much worse than the group 4 pediatric patients, and have a similar poor outcome as the group 3 patients (table 1 and fig . adult patients with wnt tumors also tend to do worse than their pediatric counterparts, who almost all survive . patients with shh tumors in the pediatric or adult age group have similar outcomes, and desmoplastic histology in adults remains associated with a better outcome than tumors with classic or lca histology ( table 1 and fig . all desmoplastic cases ( 31/175) in adults were classified as shh tumors, but the opposite is not true: not all shh tumors in adults are of desmoplastic histology (31/100). the majority are of classic histology (67/100), unlike the shh tumors in infants where the majority display desmoplastic histology (63/90). metastatic disease at diagnosis, present in 32 % of all pediatric mb patients, is much less frequent in adult mb patients (7 %). unlike in pediatric patients, where it is more frequently associated with group 3 and 4 tumors, metastasis is present in all subgroups in adults, but it is not a significant marker for outcome in this age group. myc and mycn amplifications occur only rarely in adult mbs, but when present they still predict a poor outcome (fig . 1overall survival ( os) analyses of molecular and histological subgroups within adult medulloblastomas using kaplan meier plots and log - rank tests. tumor data are combined from gene expression studies and tissue microarray (tma) analyses as described in plus 17 new adult cases that were recently added to our mb tmas. a os analysis of molecular subgroups among all adult medulloblastoma patients (n = 158). b os analysis of classic, desmoplastic, and lca histological subgroups among all adult medulloblastoma patients. c os analysis of myc or mycn amplified adult medulloblastomas versus nonamplified adult medulloblastomas. d, g, j os analyses of patients harboring 10q loss versus patients with a balanced 10q, either in all adult medulloblastoma patients (d), in shh medulloblastomas only (g), or in group 4 medulloblastomas only (j). e, h, k os analyses of patients harboring 17p loss versus patients with a balanced 17p, either in all adult medulloblastoma patients (e), in shh medulloblastomas only (h), or in group 4 medulloblastomas only (k). f, i, l os analyses of patients harboring 17q gain versus patients with a balanced 17q, either in all adult medulloblastoma patients (f), in shh medulloblastomas only (i), or in group 4 medulloblastomas only (l). numbers next to the kaplan meier plots indicate the total number of patients per subgroup and the number of events in that subgroup. ns not significanttable 1overview of medulloblastoma molecular subgroup distribution, histological subgroup distribution, and metastatic groups in infants (age < 16 years), children (age 416), and adults (age > 16)infantschildrenadultspercentageospercentageospercentageosmolecular subgroupswnt1na12961382shh577718815781group 334292655225group 485744782839histological subgroupspercentageospercentageospercentageosclassic434980797968desmoplastic43888861888large cell / anaplastic15261248320metastatic stagepercentageospercentageospercentageosm0686668819371 m + 32503265752data are from meta - analyses performed on published datasets of medulloblastomas analyzed and categorized into subgroups either by gene expression profiling or immunohistochemistry os overall survivalnumbers indicate the frequency each subgroup occurs within that age categoryfor each subgroup the percentage of patients is shown that is still alive 5 years after medulloblastoma diagnosis as determined by kaplan meier analysis overall survival (os) analyses of molecular and histological subgroups within adult medulloblastomas using kaplan tumor data are combined from gene expression studies and tissue microarray (tma) analyses as described in plus 17 new adult cases that were recently added to our mb tmas. a os analysis of molecular subgroups among all adult medulloblastoma patients (n = 158). b os analysis of classic, desmoplastic, and lca histological subgroups among all adult medulloblastoma patients. d, g, j os analyses of patients harboring 10q loss versus patients with a balanced 10q, either in all adult medulloblastoma patients (d), in shh medulloblastomas only (g), or in group 4 medulloblastomas only (j). e, h, k os analyses of patients harboring 17p loss versus patients with a balanced 17p, either in all adult medulloblastoma patients (e), in shh medulloblastomas only (h), or in group 4 medulloblastomas only (k). f, i, l os analyses of patients harboring 17q gain versus patients with a balanced 17q, either in all adult medulloblastoma patients (f), in shh medulloblastomas only (i), or in group 4 medulloblastomas only (l). numbers next to the kaplan meier plots indicate the total number of patients per subgroup and the number of events in that subgroup. ns not significant overview of medulloblastoma molecular subgroup distribution, histological subgroup distribution, and metastatic groups in infants (age < 16 years), children (age 416), and adults (age > 16) data are from meta - analyses performed on published datasets of medulloblastomas analyzed and categorized into subgroups either by gene expression profiling or immunohistochemistry numbers indicate the frequency each subgroup occurs within that age category for each subgroup the percentage of patients is shown that is still alive 5 years after medulloblastoma diagnosis as determined by kaplan meier analysis interestingly, shh mbs are the only subgroup that occur in a bimodal age distribution. they are frequent in infants and adults (both 57 %), whereas they are quite rare in children (18 %). this unusual age distribution of shh tumors suggested that these tumors in infants and adults may not be the same and may even have a different cellular origin. interestingly, recent data showed that shh medulloblastomas may indeed arise from different precursor cells in either the cerebellum or brain stem. however , whether these different origins are in addition linked to the difference between shh medulloblastomas in infants and adults remains to be seen, but it is known that medulloblastomas in adults mostly occur in the cerebellar hemispheres while medulloblastomas in children more often arise in the vermis and the 4th ventricle. showed by expression profiling and cytogenetic analyses that pediatric and adult shh mbs are indeed transcriptionally and genetically distinct. most notably, mycn amplifications and chromosome 10q deletions were less frequent in adult shh tumors than in pediatric shh tumors. however, adult shh mbs harboring 10q deletions and/or gli2 amplifications appeared to have a much worse prognosis as compared to pediatric shh medulloblastomas with the same genetic aberrations. current treatment decisions for medulloblastoma are still largely based on the clinical variables of metastatic disease at diagnosis and extent of surgical resection both for pediatric and adult patients. for pediatric patients, age is also taken into account, as patients younger than 4 years of age are usually not treated with radiotherapy, especially those with standard risk. however, stratifying patients in only two major risk categories, standard and high - risk, inappropriately simplifies the true clinical and molecular heterogeneity of medulloblastoma. we therefore recently proposed a molecular risk stratification system for pediatric medulloblastomas based on cytogenetic aberrations (myc / mycn amplifications, chromosome 6 and 17 aberrations). however, as has been shown, pediatric and adult medulloblastomas are distinct in terms of genomic aberrations and their impact on clinical outcome. myc / mycn amplifications are very rare in adult medulloblastoma and chromosome 6 aberrations do not have the prognostic value in adult medulloblastoma patients as they have in pediatric medulloblastoma patients. we therefore proposed a different algorithm for the molecular stratification of adult medulloblastomas based on aberrations of chromosome 10 and 17. this system may now need a further adjustment to acknowledge the fact that distinct molecular subgroups exist in medulloblastoma, including in the adult age group. as shown previously, loss of 10q, loss of 17p, and gain of 17q, all demonstrate prognostic significance in adult mb and all of them predict a poor outcome (fig . this is largely driven by the shh subgroup, in which these three markers clearly show prognostic significance ( fig . all adult patients tend to have a poor prognosis, and the three copy - number markers therefore do not show as significant a prognostic effect as they do for shh tumors ( fig . 1j l).consequently, the dna copy number status of chromosome 10 and 17 will be most useful as molecular markers for risk stratification when combined with subgroup assessment. for subgroup assessment , the nanostring assay can be used, which predicts the tumor - specific subgroup with high accuracy, based on the expression level of 22 subgroup - specific signature genes. alternatively, a panel of immunohistochemistry - based markers (b - catenin, sfrp1, npr3, kcna1) can be assessed, as has been shown in previous publications. of note , it is clear that these emerging biological risk criteria in mb will need prospective validation using multivariate analysis and taking into account classical prognostic factors (extent of surgery, metastatic disease). the recent progress that has been made in the genetic analysis of adult medulloblastomas has led to a much better understanding of these tumors and how they differ from pediatric medulloblastomas. the same four molecular subgroups exist in adult medulloblastoma as they do in pediatric medulloblastoma, but they occur at different frequencies and they also carry a different prognostic significance when compared with their pediatric counterparts. molecular stratification algorithms using subgroup assessment and subgroup - specific biomarkers will therefore also be useful for treatment stratification of adult medulloblastomas in the setting of clinical trials. as shh medulloblastomas form the majority among adult medulloblastomas, they are of particular interest for molecularly targeted therapies, using for instance smo inhibitors. initial reports treating shh medulloblastomas in humans or mice were hopeful, but the effects were only temporary. tumors quickly became resistant to these drugs either due to mutations in smo or to amplification of downstream signaling members such as mycn, gli1, or gli2. as these amplifications are already present in some primary (untreated)shh tumors, further research of larger adult medulloblastoma cohorts is needed, for instance by full genome sequencing technologies, to assess to what extent adult medulloblastomas might or might not be responsive to these shh pathway inhibitors. these sequencing efforts may also reveal other potential targets for rational (combination) therapies in a subgroup - specific manner.

medulloblastoma encompasses a group of aggressively growing cancers that arise either in the cerebellum or brain stem. they present primarily in children, with 8085 % of medulloblastomas being diagnosed in patients of 16 years and younger. in adults, medulloblastomas are rare and account for less than 1 % of intracranial malignancies. due to the low incidence of medulloblastoma in adults, the biology and genetics of adult medulloblastomas have long been poorly understood. many centers therefore still treat adults either by radiotherapy only or by using glioblastoma protocols (both often noncurative), or with standard pediatric medulloblastoma regimes (often associated with dose - limiting toxicity).current clinical staging systems discriminate between standard - risk or high - risk patients based on clinical and histological parameters. however, clinico - pathological features often fail to accurately predict treatment response. in children, molecularly defined risk assessment has become important to improve survival of high - risk patients and to decrease treatment - related toxicity and long - term sequelae in standard - risk patients. however, several recent studies have shown that adult and pediatric medulloblastomas are genetically distinct and may require different algorithms for molecular risk stratification. moreover, four subtypes of medulloblastoma have been identified that appear at different frequencies in children and adults and that have a different prognostic impact depending on age. molecular markers such as chromosome 10q and chromosome 17 statuses can be used for molecular risk stratification of adult medulloblastoma, but only in a subgroup - specific context. here we present an overview of the current knowledge of the genomics of adult medulloblastoma and how these tumors differ from their pediatric counterparts.

anxiety disorders, such as post - traumatic stress disorder, social phobia, specific phobias, panic and obsessive - compulsive disorders, are among the most common mental disorders in humans (olesen et al ., 2012). these disorders are associated with problems to extinguish learned fear responses and also to consolidate extinction memories (myers and davis, 2007 ; milad et al ., 2009). to date, the most effective strategies in the treatment of anxiety disorders include use of pharmacological and cognitive strategies (nutt, 2005). however, significant drawbacks to current therapy exist including lack of treatment response and also a lack of long - term beneficial effect of combining available drugs with exposure - based therapy (barlow et al ., 2000 ; davidson et al ., 2004 ; foa et al ., 2005 ; yehuda and ledoux, 2007 ; norberg et al ., 2008). clinical interventions which rescue deficits in fear extinction acquisition and consolidation would constitute important treatment options in these disorders. along these lines, pharmacological and genetic silencing studies, predominantly in normally behaving rodents and using massed extinction training paradigms, have identified a number of neurobiological mechanisms that govern acquisition of fear extinction learning and extinction consolidation. acquisition of extinction learning requires n - methyl - d - aspartate (nmda) receptor 2b (sotres - bayon et al ., 2007), -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (ampa) (zushida et al ., 2007 ; yamada et al . , 2009) and metabotropic glutamate 7 (mglu7) (fendt et al ., 2008) receptor activities in addition to gabaergic signalling , amongst others. following acquisition of extinction, there is a consolidation phase which lasts up to several hours which serves to stabilize plastic events into long - term memory (mcgaugh, 2000). activation of nmda receptors (davis, 2011), brain - derived neurotrophic factor (bdnf) signalling (chhatwal et al . , 2006 ; soliman et al ., 2010) and inhibition of histone deacetylases (hdac) (guan et al ., 2009 ; 2011), amongst others, are important for consolidation of extinction. the present study used isogenic 129s1/svimj (s1) mice which display deficient extinction acquisition, poor recovery of fear - induced suppression of heart - rate variability, enlarged dendritic arbours in basolateral amygdala neurons and functional abnormalities in cortico - amygdala circuitry mediating fear extinction (hefner et al . in the current study we reduced the intensity of fear conditioning and observed that weak fear conditioning allowed for extinction acquisition in s1 mice but revealed deficient extinction retrieval . recent findings show that impaired extinction acquisition and dysfunctional cortico - amygdala circuitry can be rescued by a novel zinc restricted diet ( whittle et al ., 2010), which interestingly did not affect either fear learning or fear expression. also, recent findings reveal that the s1 fear extinction phenotype can be rescued by fluoxetine (a serotonin - selective reuptake inhibitor) (camp et al ., 2012) which is of clinical relevance as serotonin - selective reuptake inhibitors are first - line treatment for anxiety disorders (nutt, 2005). considering the well - known disadvantages of long - term ssri treatments, we screened for novel treatments which rescue both deficient extinction acquisition and extinction consolidation / retrieval in s1 mice. evidence suggests that deep brain stimulation (dbs) of the nucleus accumbens (acbc) can enhance extinction - like behaviour in intractable obsessive - compulsive disorder patients, which is characterised by avoidance behaviours that fail to extinguish (lipsman et al . , 2010 ; greenberg et al ., 2010 ; grant et al ., furthermore, a small clinical study involving patients suffering from treatment - resistant depression has shown that dbs of the acbc can enhance various measures of cognition independent of mood status ( bewernick et al ., 2012). however, there are also reports of no effect of acbc - dbs in mood disorder patients (grubert et al ., 2011). very recently, dbs of the acbc during extinction training reduced fear expression and strengthened extinction memory in normally behaving rats (rodriguez - romaguera et al ., 2012) potentially showing the utility of dbs of the acbc as a novel fear reducing adjunct during exposure - based therapy here, we went beyond using normally behaving rodents and assessed whether dbs of the acbc during extinction training can rescue deficient extinction acquisition and extinction consolidation / retrieval in s1 mice. pharmacological compounds which enhance glutamatergic signalling, including dcs (nmda receptor partial agonist), pepa (ampa receptor potentiator) or amn082 (mglu7 receptor agonist), can facilitate fear extinction in normally extinguishing animal models and in clinical studies (myers et al ., 2011). we have previously shown that prior extinction training administration of dcs is ineffective in rescuing deficient extinction learning in s1 mice (hefner et al ., 2008). however, it remains unknown whether dcs can rescue deficient extinction consolidation / retrieval once at least some extinction learning is induced, which we revealed in weak fear conditioned s1 mice. furthermore, it is not known whether pepa or amn082 can reduce fear in an animal model of impaired extinction. drugs inhibiting hdac proteins to prevent the removal of acetyl groups on histone tails is a promising approach in central nervous system disorders associated with disturbed learning and memory (kazantsev and thompson, 2008). interestingly, inhibiting hdacs has been shown to enhance fear learning (guan et al ., 2009) and rescue deficits in fear learning in mouse models of anxiety or neurodegeneration (li et al ., 2006 ; dash et al ., 2009 ; kilgore et al ., 2010). facilitation of fear extinction by hdac inhibition has been reported in normally extinguishing mice (bredy et al . , 2007 ; lattal et al ., 2007 ; bredy and barad, 2008 ; guan et al ., however, it is not known whether inhibiting hdacs can improve extinction learning in animal models of impaired extinction . thus, we tested whether valproic acid ( vpa), a dual hdac inhibitor and enhancer of gabaergic signalling or ms-275, a more specific hdac inhibitor (khan et al ., 2008 ; bantscheff et al ., 2011), can rescue deficient extinction in s1 mice. subjects were male 35 month old 129s1/svimj (s1) mice. for experiments performed at the university of innsbruck, mice (obtained from charles river, germany) were housed (45 per cage) in a temperature- (22 2 c) and humidity- (5060%) controlled vivarium under a 12 h light / dark cycle (lights on at 7:00 a.m.). for experiments conducted at the national institutes of health, mice (obtained from the jackson laboratory, usa) were housed (2 per cage) in a temperature (22 1 c)- and humidity (45 15%)-controlled vivarium under a 12 h light / dark cycle (lights on, 6:00 a.m.). all experimental procedures were approved by the austrian animal experimentation ethics board and by the national institute on alcohol abuse and alcoholism animal care and use and austrian ethical committees on animal care and use (bundesministerium fr wissenschaft und verkehr, kommission fr tierversuchsangelegenheiten) and followed the national institutes of health guidelines outlined in using animals in intramural research and the local animal care and use committees. for experiments performed at the university of innsbruck, mice were conditioned in a 25 25 35 cm chamber with transparent walls and a metal rod floor, cleaned with water and illuminated to 300 lux (context a). after a 120 s acclimation period, there were 3 pairings of a 120 s, 80 db white noise conditioned stimulus (cs) and a 2 s scrambled foot shock unconditioned stimulus (us) (0.6 ma unless stated otherwise), with a 120 s inter - pairing interval. there was a 120 s no - stimulus consolidation period after the final pairing before mice were returned to the home cage. extinction training was performed the next day in a 25 25 35 cm cage with a solid grey floor and black walls, cleaned with a 100% ethanol and illuminated to 10 lux (context b). after a 120 s acclimation period, there were cs - alone trials (16 unless stated otherwise), with a 5-sec inter - cs interval. stimulus presentation was controlled by a tse operant system (tse, bad homburg, germany). extinction retrieval was conducted the following day by repeating the extinction training procedure but with 2 cs trials. freezing was measured as an index of fear (blanchard and blanchard, 1969), manually scored based on dvd recordings of the duration of the cs, defined as no visible movement except that required for respiration, and converted to a percentage by a trained observer blind to the animals' group. for experiments performed at niaaa, mice were conditioned in a 27 27 11 cm chamber with a metal - rod floor, cleaned with a 79.5% water/19.5% ethanol/1% vanilla - extract solution (context a). after a 180 s acclimation period, there were 3 pairings (60120 s inter - pairing interval) of the conditioned stimulus (cs ; 30 s 80 db, 3 khz tone) and the unconditioned stimulus (us ; 2 s, 0.6 ma scrambled foot shock), in which the us was presented during the last 2 s of the cs. stimulus presentation was controlled by the med associates videofreeze system (med associates, burlington, vt, usa). 24 h after conditioning, extinction training was conducted in a novel context (context b) (cylinders with black / white - chequered walls and a solid plexiglas opaque floor cleaned with a 1% acetic acid/99% water solution) housed in a different room from conditioning. after a 180 s acclimation period, there were 16 cs presentations (5-sec inter - cs interval). after a 180 s acclimation period, there were 3 cs presentations (5-sec inter - cs interval). freezing (no visible movement except respiration) was scored every 5 s by an observer blind to condition / treatment and converted to a percentage. procedures and apparatuses for normal fear conditioning were as described above and involved 3 pairings of the cs with a 0.6 ma us. the weak fear conditioning procedure was the same with the exception that the us was 0.3 ma. mice were randomly assigned to either weak or normal fear conditioning and tested for extinction training and retrieval as above (fig . mice were anaesthetized with a mixture of ketamine / xylazine ( 80/5 mg / kg) injected intraperitoneally (i.p .). using a stereotaxic frame, electrodes (ms303 - 3-b - spc, bipolar, twisted, 8 mm, plastics one, usa) the coordinates were + 1.10 mm anterior to bregma, + 1.45 mm lateral from midline, 4.65 mm ventral according to the atlas of (franklin and paxinos, 2008). electrodes were fixed to the skull with 2 stainless steel screws and dental cement (havard cement, richter & hoffmann harvard dental gmbh, germany). after surgery animals were individually caged and received buprenorphin (0.1 mg / kg injected intraperitoneally) every 8 h for 3 days to minimise pain. after 45 days of recovery, mice were conditioned via 5 pairings of the cs with a 0.7 ma us. extinction training began with 2 cs - alone trials without dbs to measure fear expression in the absence of any influence of dbs before presenting 16 cs - alone extinction trials. dbs (130 hz, 100 a, 60 s pulse width) was applied via an a310 accupulser and a365 stimulus isolator (world precision instruments, sarasota, usa) throughout the cs period during each 16 cs extinction trials (fig . sham controls were connected to the stimulator but received no current . at the completion of testing, the localization of electrodes was confirmed from inspection of cresyl violet stained coronal sections ( fig . mice were conditioned via 3 pairings of the cs with a 0.6 ma us . louis, usa) or saline vehicle was injected i.p. in a volume of 10 ml / kg body weight 2 h prior to extinction training (fig . the dose, route and timing of administration was based on previous studies showing extinction facilitating effects of vpa in mice ( bredy et al . , 2007 ; bredy and barad, 2008) and that 2 h is required before maximal histone acetylation is observed (tremolizzo et al ., 2005). mice were conditioned via 3 pairings of the cs with a 0.6 ma us. 6 mg / kg amn082 (tocris bioscience, bristol, united kingdom) or saline + 0.5% methylcellulose vehicle was administered per oral (p.o .) via gavage in a volume of 10 ml / kg body weight 2 h prior to extinction training (fig . the dose, route and timing of administration was based on previous studies showing extinction facilitating effects of amn082 in mice ( fendt et al ., 2008). mice were conditioned via 3 pairings of the cs with a 0.6 ma us. 10 or 30 mg / kg pepa (sigma, st . louis, usa) or saline + 0.45% nacl + 33% (2-hydroxypropyl)--cyclodextrin vehicle was injected i.p. in a volume of 10 ml / kg body weight 15 min prior to extinction training (fig . the doses, route and timing of administration was based on previous studies showing extinction facilitating effects of pepa in mice ( zushida et al . mice were conditioned via 3 pairings of the cs with a 0.6 ma us . 5 or 10 mg / kg ms-275 ( sigma, st . louis, usa) or saline + 25% dmso vehicle was injected i.p. in a volume of 10 ml / kg body weight 2 h prior to extinction training (fig . the doses, route and timing of administration was based on a previous study showing that maximal increases in histone acetylation occurs 2 h following s.c . mice were conditioned via 3 pairings of the cs with a 0.3 ma us . 10 mg / kg ms-275 ( eubio, vienna, austria), 15 mg / kg dcs (sigma, st . louis, usa) or saline + 25% dmso vehicle was injected i.p. in a volume of 10 ml / kg body weight immediately (< 2 min) after extinction training (fig . the doses, route and timing of administration of ms-275 was based on our earlier experiment and the doses, route and timing of administration of dcs was based on previous studies showing extinction facilitating effects in rats and humans ( walker and davis, 2002 ; ressler et al ., 2004 ; all data were examined for equal variances using levene 's test before performing parametric tests . data were analyzed using analysis of variance ( anova), with repeated measures for trial / trial - block, or by student's t - test. we have previously found that the level of fear expression in s1 mice can be modulated by the intensity (shock amplitude, shock - tone trial number) of fear conditioning (camp et al ., 2009). therefore, we asked whether extinction in s1 was graded by the intensity of conditioning. there was a significant and similar increase in freezing across 3 conditioning trials in mice given 0.3 ma and 0.6 ma shocks (fig . block interaction for freezing ( f = 8.71, p < 0.001 ). post hoc tests revealed that the weak shock group displayed lower freezing than the 0.6 ma group on blocks 38, but not blocks 1 or 2 (fig . however, during extinction retrieval, freezing was not different between groups ( t - test : p > 0.05) (fig . these show that while this weak conditioning procedure did not reduce fear learning or expression compared to normal conditioning, it did allow for significant fear reduction during the extinction learning trial in s1 mice . however, extinction memory was not successfully consolidated / retrieved on the next day . we first examined the effects of dbs of the acbc, applied during extinction training, on impaired extinction in s1 mice . during conditioning, freezing increased across trials and did not differ between groups ( fig . dbs during extinction training did not affect freezing, as compared to sham - stimulated controls, as both groups showed no change in freezing across trial - blocks ( fig . freezing was significantly lower in dbs than sham controls during extinction retrieval ( t16 = 2.96, p < 0.01) (fig . these show that dbs of the nucleus accumbens rescued extinction retrieval, but not extinction acquisition, in s1 mice . we next examined the effects of 3 diverse pharmacological compounds, applied acutely prior to extinction training, on impaired s1 extinction . our first experiment tested the effects of vpa . during conditioning, freezing increased across trials and did not differ between groups ( fig . there was a significant group trial block interaction for freezing during training ( f = 3.24, p < 0.01 ). post hoc tests showed freezing was significantly lower in the vpa group relative to vehicle, on trial - blocks 28 (fig . freezing was again significantly lower in the vpa than the vehicle group ( t15 = 4.75, p < 0.001) (fig . our next experiment examined the effects of pre - extinction - administered amn082 . during conditioning, freezing increased across trials and did not differ between groups ( fig . there was a significant treatment trial - block interaction for freezing during extinction training ( f = 4.82, p < 0.001 ). post hoc tests showed significantly lower freezing in the amn082 treated group as compared to vehicle on trial - blocks 38 (fig . freezing was also significantly lower in the amn082 group than the vehicle group during extinction retrieval ( t14 = 4.24, p < 0.001) (fig . the of this experiment indicate rescue of impaired s1 extinction learning and retrieval by amn082 . we next studied the effects pepa applied before extinction . during conditioning, freezing increased across trials and did not differ between groups ( fig . there was no effect of treatment on freezing during extinction training and neither group showed a reduction in freezing across trial - blocks ( fig . this experiment shows that, like pepa, application of ms-275 prior to extinction training failed to rescue impaired s1 extinction . our observation that s1 mice can exhibit extinction learning after weak conditioning, but still have a deficit in extinction retrieval, led us to test whether two drug treatments shown here ( mcs-275) and previously (dcs) (hefner et al ., 2008) to be ineffective in rescuing extinction after normal conditioning would be effective after weaker conditioning. freezing increased across conditioning trials, and treatment groups did not differ from one another. furthermore, increased expression of phosphorylated extra cellular - regulated kinase (perk), a marker of cell plasticity (sweatt, 2004), is observed in brain regions critical for extinction learning including the medial prefrontal cortex, orbitofrontal cortex, and a small subregion of the lateral part of the central amygdala following dbs in the acbc (rodriguez - romaguera et al ., 2012), indicating that many of exactly those areas are targeted by acbc dbs that have been shown to be aberrantly activated in extinction - impaired s1 mice (whittle et al ., 2010). collectively, our reveal for the first time that dbs of the acbc rescued deficient extinction retrieval in an animal model of impaired extinction, most likely by positively interfering with the documented cortico - limbic extinction circuitry failure accompanying the impaired extinction. we have previously revealed that enhancing the activity of ionotropic nmda receptors, via administration of dcs, is ineffective in inducing extinction acquisition in s1 mice (hefner et al ., 2008). here, we investigated whether enhancing the activity of ionotropic ampa receptors by administration of pepa, or metabotropic mglu7 receptors, by administration of amn082, could rescue the extinction acquisition deficit in s1. administration of amn082, but not pepa, prior to an extinction training session induced fear extinction and also reduced fear during a retrieval test in s1 mice. the lack of extinction promoting effect of pepa is in contrast with published studies in normally behaving mice (zushida et al ., 2007). it is likely that pepa, like dcs, facilitates the consolidation of extinction learning rather than inducing extinction learning per se (davis et al ., 2006). evidence supporting this hypothesis is that long - term potentiation elicited by the ampa receptor glutamate receptor 1 is necessary for the formation of emotional memories (humeau et al ., 2007). the present finding that amn082 rescued deficient extinction acquisition in s1 mice extends recent studies showing that amn082, a specific allosteric modulator of mglu7 receptors (mitsukawa et al ., 2005), impairs the acquisition of conditioned fear as well as facilitates between - session extinction in normally behaving rodents (fendt et al ., 2008 ; siegl et al ., thus, amn082, in addition to dietary zinc - restriction ( see introduction), constitute rare examples of treatments which enhance extinction learning, but not fear learning. moreover, these show that amn082 can rescue extinction deficits in a psychopathological animal model, suggesting that amn082 be used during extinction - based therapy to induce extinction learning in individuals with pathological fear. at present, it is difficult to understand the extinction promoting effect of amn082 (o'connor et al ., 2010). mglu7 receptors, located entirely pre - synaptically, are widely distributed throughout the central nervous system (ohishi et al ., 1995). activation of this receptor generally inhibits glutamatergic and gabaergic synaptic transmission (schoepp, 2001), although facilitation of glutamatergic transmission has also been reported in specific brain regions (millan et al . , 2002 ; li et al ., 2008 ; martin et al ., 2010). given the wide - spread distribution of mglu7 receptors and their location on both glutamatergic and gabaergic axon terminals, the cumulative excitatory and inhibitory effects of systemic application of amn082 is difficult to predict at present as precise knowledge of the location of the receptor in the microcircuits underlying fear extinction acquisition is lacking. furthermore, recent findings reveal that a major metabolite of amn082 inhibits serotonin-, dopamine- and noradrenaline - transporters (sukoff rizzo et al ., 2011). as chronic treatment with the selective serotonin re - uptake inhibitor fluoxetine reduces fear in s1 mice (camp et al ., 2012) and protects against the return of fear in normally extinguishing mice (karpova et al ., 2011), we can not exclude the contribution of enhanced monoaminergic neurotransmission in amn082-induced reduction of fear. a meta - analysis of published data shows that dcs is effective in reducing fear when combined with fear extinction or exposure therapy (norberg et al ., 2008). from normally extinguishing rodents show that dcs, administered immediately post extinction training, can lower fear by enhancing extinction memory consolidation (ledgerwood et al ., 2003). clinically, dcs, combined with exposure - based therapy, is effective in reducing fear in patients with so - called simple fears including acrophobia, social anxiety, obsessive compulsive and panic disorders (graham et al ., 2010). however, in most cases beneficial effects of dcs were only apparent after a few exposure sessions further suggesting that the primary mechanism of dcs is to consolidate fear extinction memories. along these lines, we have previously published that prior extinction training administration of dcs is ineffective in rescuing deficient extinction learning in s1 mice (hefner et al . using a novel behavioural finding that s1 mice display impaired extinction consolidation / retrieval we tested whether dcs is effective in lowering fear when administered following successful fear reduction in extinction learning . conclusively demonstrate that dcs can rescue deficient extinction learning only when administered during the extinction consolidation phase and that the efficacy of dcs is gated by the ability of s1 mice to acquire (at least to some extent) extinction acquisition. these using a psychopathological animal model have clinical implications as they strengthen the suggestion that dcs be used as an add - on drug to facilitate reductions in fear by exposure therapy in specific anxiety disorders (norberg et al . recent studies have demonstrated that histone acetylation is dynamically regulated following successful extinction learning ( levenson et al . , 2004 ; fontan - lozano et al ., 2008 ; bousiges et al ., 2010 ; peleg et al ., 2010 ; monsey et al ., 2011 ; stafford et al ., 2012), and furthermore, that pharmacological or genetic silencing of hdac enzyme isoforms can enhance fear extinction (bredy et al ., 2007 ; lattal et al ., 2007 ; bredy and barad, 2008 ; , 2009 ; monsey et al ., 2011). here, we first assessed whether ms-275, which is, using a chemoproteomic approach a hdac1- 2- and 3-isoform inhibitor (bantscheff et al ., 2011), or using purified rhhdacs primarily a hdac1- and 9-isoform inhibitor (khan et al ., 2008), could rescue deficient extinction consolidation / retrieval in weak fear conditioned s1 mice. we revealed that post extinction training administration of ms-275, at a dose with demonstrated hdac inhibitory properties (simonini et al ., 2006), it is likely that combined inhibition of hdac1-, hadac2- and hdac3-isoforms contributes to the observed rescue of deficient extinction consolidation / retrieval in s1 mice. pharmacological and/or genetic silencing of hdac1- or hdac2-isoforms have been shown to enhance the consolidation of fear and/or extinction memories (guan et al ., 2009 ; bahari - javan et al ., 2012) and that genetic silencing of the hdac3-isoform enhances long term memory in the object recognition test (mcquown et al ., 2011). notwithstanding, our data show for the first time that preferentially selective hdac inhibitors such as ms-275 can rescue profound extinction consolidation / retrieval deficits in a psychopathological animal model and thus suggest that such compounds be used as an add - on drugs to facilitate reductions in fear in exposure - based therapy. the extinction consolidation / retrieval - promoting effect of ms-275 was specific as revealed that following fear conditioning, in which s1 mice display deficient extinction acquisition, prior extinction training administration of ms-275 did not induce extinction acquisition or reduce fear during a retrieval test. this indicates that rescue of deficient extinction acquisition requires mechanisms beyond hdac inhibition. as enhancing gabaergic activity has been shown to significantly contribute to the molecular mechanisms underlying fear extinction , we tested whether vpa, a pharmacological compound which enhances gabaergic signalling (mimaki et al ., 1984 ; miller et al ., 1988 ; 2006) in addition to exhibiting robust hdac inhibition (kramer et al ., 2003 ; khan et al ., 2008), can rescue impaired extinction acquisition and deficient extinction consolidation / retrieval. indeed, our revealed that prior extinction training administration of vpa rescued both deficient extinction acquisition and deficient extinction consolidation / retrieval in s1 mice. this in a psychopathological animal model further extends findings showing prior extinction training administration of vpa potentiates reductions in fear extinction in normally extinguishing b6 mice (bredy et al . , 2007 ; bredy and barad, 2008) and, when administered prior to cognitive behavioural therapy, facilitates extinction in healthy humans (kuriyama et al ., 2011). our current using a psychopathological animal model reveals that prior exposure - based extinction training administration of vpa, acutely applied, can rescue impaired extinction acquisition and deficient extinction consolidation / retrieval. specifically, to date, in preclinical animal models of impaired fear learning and neurodegeneration, cognitive enhancing effects of vpa have been shown only with chronic prior fear conditioning administration (li et al ., 2006 ; dash et al ., 2009 ; kilgore et al ., 2010). our present in a psychopathological animal model demonstrates the utility of a single vpa treatment in combination with exposure - based therapy to rescue impaired extinction acquisition and deficient extinction consolidation / retrieval. furthermore, a number of small clinical studies demonstrate that chronic vpa monotherapy, for a minimum of eight weeks, reduces fear in social anxiety- (kinrys et al ., 2003), panic- (primeau et al ., 1990 ; keck et al ., 1993 ; woodman and noyes, 1994 ; baetz and bowen, 1998) and obsessive - compulsive- (cora - locatelli et al ., beneficial effects of chronic vpa monotherapy have also been reported in combat veterans with ptsd ( fesler, 1991 ; otte et al ., 2004), however, lacking effects are also reported (davis et al ., 2008 ; hamner et al ., is that up to 25% of patients within the afore - mentioned studies are reported to stop medication due to adverse effects ( including nausea, dizziness, fatigue, sedation and gastrointestinal complaints). our current data suggests that acute vpa treatment, combined with exposure - based therapy may be an effective and novel clinical strategy to reduce fear in anxiety patients with minimal adverse effects. in summary, we show that s1 mice are a unique psychopathological animal model as they display deficient extinction acquisition and deficient extinction retrieval, which can be experimentally dissociated by choosing different experimental conditioning setups. using this mouse model the present data identify novel therapeutic targets that induce fear reductions when combined with extinction, resembling exposure - based therapy. different pharmacological and non - pharmacological treatments that target cellular and molecular mechanisms with a documented or putative role in extinction memory formation within relevant brain areas and circuitries were chosen. this study reveals that dbs of the acbc during exposure - based therapy may be a novel non - pharmacological treatment strategy to overcome impairments in reducing learned fear. furthermore, that pharmacological enhancement of nmda receptor activity or inhibition of hdac1-, hdac2- and hdac3-isoforms, may rescue deficient extinction retrieval only following successful reductions in fear during extinction training, which can have important implications for the use of such agents in human exposure therapy. on the other hand, enhancing mglu7 activity or enhancement in gabaergic activity in tandem with broad inhibition of hdac isoforms could be a novel pharmacological treatment strategy to rescue both, impairments in extinction acquisition and extinction retrieval.

anxiety disorders are characterized by persistent, excessive fear. therapeutic interventions that reverse deficits in fear extinction represent a tractable approach to treating these disorders. we previously reported that 129s1/svimj (s1) mice show no extinction learning following normal fear conditioning. we now demonstrate that weak fear conditioning does permit fear reduction during massed extinction training in s1 mice, but reveals specific deficiency in extinction memory consolidation / retrieval. rescue of this impaired extinction consolidation / retrieval was achieved with d - cycloserine (n - methly - d - aspartate partial agonist) or ms-275 (histone deacetylase ( hdac) inhibitor ), applied after extinction training. we next examined the ability of different drugs and non - pharmacological manipulations to rescue the extreme fear extinction deficit in s1 following normal fear conditioning with the ultimate aim to produce low fear levels in extinction retrieval tests. showed that deep brain stimulation (dbs) by applying high frequency stimulation to the nucleus accumbens (ventral striatum) during extinction training, indeed significantly reduced fear during extinction retrieval compared to sham stimulation controls. rescue of both impaired extinction acquisition and deficient extinction consolidation / retrieval was achieved with prior extinction training administration of valproic acid (a gabaergic enhancer and hdac inhibitor) or amn082 , while ms-275 or pepa (ampa receptor potentiator) failed to affect extinction acquisition in s1 mice. collectively, these data identify potential beneficial effects of dbs and various drug treatments, including those with hdac inhibiting or mglu7 agonism properties, as adjuncts to overcome treatment resistance in exposure - based therapies.this article is part of a special issue entitled cognitive enhancers.

globally, alcohol causes 4% of all deaths and contributes 5% to the global burden of disease. alcohol consumption has increased globally over years and india being one of the most populous countries contributes significantly to the alcohol - attributable burden. among 1549-year - old men in india, the prevalence of daily and weekly use of alcohol is 9.4% and 26.7%, respectively. studies indicate that about 80% of patients relapse within a year of detoxification. among patients under treatment, it is important to examine the factors that contribute to relapse. sociodemographic factors such as living alone, low socioeconomic status, family history of alcoholism, and psychosocial stressors have been associated with increased risk for relapse. aspects such as religion, taking part in self - help groups, and proper follow - up visits tend to reduce relapse risk. identifying specific factors contributing to relapse could pave way for optimizing treatments at the individual level. personality traits have found to predict treatment outcome in diseases such as obesity, hyperopia, and various surgical treatments. in psychiatry, personality traits have been linked to depression, schizophrenia, and withdrawal severity in substance dependence. with regard to alcoholism, the novelty seeking trait has been found to predict relapse in alcohol - dependent males and harm avoidance alcohol dependence has been associated with higher neuroticism scores and lesser conscientiousness scores. in a longitudinal study, extraversion at 14 years of age predicted alcohol dependence at 30 years of age. in the indian context, chaudhury et al. studied psychological aspects in alcohol - dependent individuals and showed that they had significantly high neuroticism, extroversion, anxiety, depression, and psychopathic deviation and significantly low self - esteem as compared to normal control subjects. however, there are no indian studies to our knowledge correlating personality traits and alcohol dependence with particular reference to treatment outcome. adult participants with alcohol dependence diagnosed by diagnostic and statistical manual of mental disorders - fourth edition (dsm - iv) were recruited from the inpatient and outpatient wards of a tertiary care de - addiction facility in india. from the participants who met the inclusion / exclusion criteria, data included age, gender, education and employment status, marital status, satisfaction with life (swl), age at first drink, and smoking history. the study was designed to prospectively re - assess the participants at the end of 3 months. pharmacological treatment was standard detoxification regimen, followed by anticraving measures and multivitamin supplements as prescribed by trained psychiatrists. at the completion of 3 months follow - up, patients were assessed for relapse / abstinence from alcohol. we defined relapse as any drink in the past 3 months and abstinence as continuous abstinence from any alcoholic beverage after the recruitment. questionnaires administered at baseline were revised neo personality inventory (neo - pi - r), swl, mini - international neuropsychiatric interview (mini), and alcohol use disorders identification test (audit). at 3 months, patients were followed up by direct / phone interview and assessed for relapse / abstinence. neo - pi - r is the most often used tool to measure personality according to the five - factor model. alphas for the domains range from 0.86 to 0.92 for self - report. revised neo personality inventory domains and facets the mini is a short - structured clinical interview which enables researchers to make diagnoses of psychiatric disorders according to the dsm - iv. it is a 28-item questionnaire assessing the warning signs of relapse, and the scores give out the probability of drinking in next 2 months based on whether they were drinking / abstinent in the last two months. questionnaires administered at baseline were revised neo personality inventory (neo - pi - r), swl, mini - international neuropsychiatric interview (mini), and alcohol use disorders identification test (audit). at 3 months, patients were followed up by direct / phone interview and assessed for relapse / abstinence. neo - pi - r is the most often used tool to measure personality according to the five - factor model. alphas for the domains range from 0.86 to 0.92 for self - report. revised neo personality inventory domains and facets the mini is a short - structured clinical interview which enables researchers to make diagnoses of psychiatric disorders according to the dsm - iv. it is a 28-item questionnaire assessing the warning signs of relapse, and the scores give out the probability of drinking in next 2 months based on whether they were drinking / abstinent in the last two months. fifty - four patients came for follow - up up to 3 months, and the aware scores were obtained from them. thus, 3-month follow - up information was available for a total of 82 (82.8%) patients, of whom three died due to alcohol - related complications and 34 maintained abstinence. we considered the 17 patients who lost follow - up and could not be interviewed through phone as relapsers. we excluded the three patients who died of alcohol - related complications from the study. alcohol use duration, body mass index, smoking scores measured as fagerstrom test for nicotine dependence, and swl did not predict abstinence / relapse at 3-month follow - up. family history of alcoholism was available for 85 patients, and among them, 63.53% had a positive family history. among the 8 females included in the baseline, one died, 4 relapsed, and 3 remained abstinent. females who relapsed had lesser age at first drink and later age of presentation when compared with females who maintained abstinence in follow - up. comparison of abstainers versus relapsers among our study group, there was a significant difference between the relapsers and abstainers (p = 0.005) with regard to the socioeconomic status. all three patients who had current diagnosis of social anxiety disorder relapsed (p = 0.025), and 60% of patients with moderately high suicidal thoughts relapsed (p = 0.006). the mean age at first drink among relapsers was 20.13 (4.62) and was significantly lower compared to the mean age at first drink of abstainers (p = 0.021). in our study group, there was no significant difference in neo - pi - r domain and facet scores between relapsers and abstainers. e4 (activity) facet of the extraversion domain in the neo - pi - r significantly correlated with the baseline drinking scores (r = 0.204, p = 0.042, n = 99) and aware scores (r = 0.276, p = 0.043, n = 54). there was a significant negative correlation between the e2 (gregariousness) facet and swl scores (r = 0.211, p = 0.036, n = 99). revised neo personality inventory t - scores -relapsers versus abstainers revised neo personality inventory domain and facet scores relapsers versus abstainers correlation between e4 (activity) domain and alcohol use disorders identification test scores correlation between e4 (activity) domain and advanced warning of alcohol relapse scores although personality factors have been well correlated with substance use, studies linking personality and treatment outcomes are scarce, especially with regard to auds. in this context , we examined the relation between personality domains based on the big five model, with the treatment outcomes in treatment - seeking alcohol - dependent patients. earlier studies established a correlation between problem drinking and the personality domains, especially with the extraversion. in our study, after controlling for age, gender, age at first drink, swl, smoking, marital status, and socioeconomic status, e4 facet (activity) of the extraversion domain correlated significantly with the baseline audit scores (r = 0.204, p = 0.042, n = 99) and aware scores (r = 0.276, p = 0.043, n = 54). this suggests that people who score high on extraversion tend to be more involved in drinking. higher risk for relapse as measured by aware scores might be associated with the severity of initial drinking. however, in our study group, the correlation between the baseline audit scores and follow - up aware scores was not significant (r = 0.138, p = 0.320, n = 54). thus, the risk for relapse appears to be associated with higher activity facet of the extraversion domain rather than the heavy drinking at the baseline. the increased risk for relapse among people who have impulsive suicidal attempts in the past has been documented. among our study group, social anxiety disorder is an important comorbid illness often found among alcohol - dependent patients. over one - third of the patients diagnosed with social phobia have auds in their lifetime. in our population, therefore, attention should be given to those people with the past suicidal ideations and comorbid social phobia when treating for alcohol dependence. there was a significant negative correlation between the swl scores and the e2 (gregariousness) facet (r = 0.211, p = 0.036, n = 99). thus, among people with alcohol dependence, it can be construed that people who tend to be more sociable and less satisfied with their lives tend to cope up with substances. there was a significant difference in the age at first drink among relapsers and abstainers with relapsers having lesser age at first drink. our study suggests that factors related to extraversion, specifically, high activity might be associated with higher involvement in drinking as well as higher risk for early relapse. our study also suggests that substance use could be one of the ways of coping up among people who are more sociable people and yet less satisfied with their lives. people with comorbid social anxiety disorders and suicidal ideations should be given more focus as they tend to relapse to alcohol. our study also suggests that earlier the age of first drink, higher is the relapse risk. this has important implications for alcohol control policies and tailoring treatment needs for the patients.

: studying personality profiles allows researchers to generate important hypotheses in risk factors and correlates of alcohol use / misuse. studies examining the association between personality traits and treatment outcome are limited in india. we studied the correlation between personality and treatment outcome in patients with alcohol dependence.methods:adult participants with alcohol dependence were recruited from the inpatient and outpatient wards of de - addiction unit of a tertiary care facility in india using a prospective design and followed up after 3 months. questionnaires administered were revised neo personality inventory (neo - pi - r), alcohol use disorders identification test, and advanced warning of alcohol relapse (aware).: out of 99 recruited participants (92% males) with mean age of 37 (8.36) years, 82 (82.8%) patients were followed up to 3 months. e4 (activity) facet of the extraversion domain in the neo - pi - r significantly correlated with the baseline drinking scores (r = 0.204, p = 0.042, n = 99) and aware scores (r = 0.276, p = 0.043, n = 54). there was a significant negative correlation between the e2 (gregariousness) facet and satisfaction with life scores (r = 0.211, p = 0.036, n = 99). age at first drink was significantly lower among relapsers (p = 0.021).: our study suggests that factors related to extraversion, specifically, high activity might be associated with higher drinking as well as higher risk of alcohol relapse. predicting alcohol relapse by studying the personality traits would help clinicians in improving treatment outcomes.

acute liver failure (alf) is a critical condition that can occasionally lead to death. ho et al. have reported that infectious diseases, alcohol abuse, and malignancy are several risk factors associated with poor prognosis in alf patients. on - line hemodiafiltration (olhdf) uses a large amount of sterile dialysate as a substitution fluid and helps patients with alf to achieve restoration of consciousness. one of the advantages of olhdf is that it removes ammonia, which could cause disturbances of consciousness in alf patients. olhdf is one of the most effective artificial liver support devices in the treatment of alf, and managing olhdf without infections is preferable. in japan as well as the usa, even patients with alf should wait for a proper liver donor for deceased donor liver transplantation or living donor liver transplantation. we report a patient with alf associated with benzbromarone use who received olhdf via an arteriovenous fistula to avoid infectious complications, and he was successfully rescued by liver transplantation. a 59-year - old japanese man who had liver dysfunction for over 1 year was referred to the former hospital with fatigue and jaundice. prior to developing liver dysfunction, benzbromarone 50 mg daily, benidipine 4 mg daily, and pravastatin 5 mg daily were all prescribed. after he had been diagnosed with liver dysfunction, ursodeoxycholic acid 400 mg daily was prescribed. the laboratory examinations on admission to the former hospital showed the following values: total bilirubin, 8.1 mg / dl; aspartate transaminase (ast), 1,457 iu / l; alanine transaminase (alt), 1,696 iu / l; prothrombin time (pt), 69%, and pt international normalized ratio (pt - inr), 1.33. eight days after admission to the former hospital, the laboratory examinations showed the following values: total bilirubin level, 21.6 mg / dl; ast, 340 iu / l; alt, 529 iu / l; pt, 38%, and pt - inr, 1.82. although he had received conservative treatment, disorientation, drowsiness, and incontinence appeared 14 days after his prior hospitalization, and he was diagnosed as having alf with grade 2 hepatic encephalopathy. the patient was transferred to the chiba university hospital for treatment of the alf. on admission, his body height and weight were 1.63 m and 60.2 kg, respectively. on physical examination, deep jaundice, abdominal distension, and leg edema were observed. based on his medical history, we suspected that the benzbromarone was responsible for his hepatic injury. ct imaging demonstrated heterogeneous hypoattentuation and atrophy of the liver with massive ascites (fig . the model for end - stage liver disease ( meld) score of the patient was 24. he was registered as a potential liver recipient, and we continued medical treatment. until liver transplantation, intermittent olhdf was performed to improve the disturbances in his level of consciousness. surgical construction of an arteriovenous fistula was performed in the right forearm 12 days after admission to our unit. after evaluating the condition of his blood vessels, the fistula was constructed in the right forearm. the deceased donor liver transplantation was successfully performed without any infectious complications 53 days after admission to our unit. the volume of his liver was 730 g, and histology of the liver revealed submassive necrosis in the right lobe and massive necrosis in the left lobe (fig . 2). there was no evidence of liver cirrhosis, supporting the diagnosis of alf rather than acute - on - chronic liver failure. during his hospitalization, no symptoms of infectious complications were observed ( fig. the clinical course of alf is associated with rapidly progressive multiorgan failure and devastating complications such as encephalopathy and coagulopathy. reported that bacterial bloodstream infection was found in 35% of cases with infectious complications in autoimmune alf. infection is also an important prognostic factor for morbidity and mortality in hemodialysis and olhdf patients with alf. vascular access - related infection occurs frequently, and patients with arteriovenous fistulas for hemodialysis are at lower risk of death and infections when compared to patients with catheters. in addition, moura et al. reported that patients who have arteriovenous fistulas for vascular access have higher health - related quality of life scores when compared to patients using central venous catheters. the patient in this report was initially admitted to the intensive care unit in our hospital. after he received an arteriovenous fistula, he was able to walk and perform rehabilitation training in a general patient room. our patient successfully avoided the risk of infectious diseases by having an arteriovenous fistula created in the right forearm for dialysis. his level of consciousness was maintained by intermittent rather than continuous olhdf, and this might also have been beneficial to avoid other infections. there have been several reports that benzbromarone is occasionally associated with alf. when prescribing benzbromarone, clinicians should pay attention to the possibility of liver dysfunction. there may be no evidence to support this assumption, and not all patients transplanted for alf who require temporary renal support via a dialysis catheter develop infections. in , forming an arteriovenous fistula for dialysis may be a beneficial option in the management of alf, although the excellent outcome in our patient was most likely related to the excellent care and surgical technique of the transplant team.

on - line hemodiafiltration (olhdf) is one of the treatment options in the management of acute liver failure (alf) in japan. it is essential to avoid infection in the management of alf. in fact, infection is one of the prognostic factors in alf. in this report , we present a middle - aged japanese man with alf associated with benzbromarone use. he was successfully managed without infection until liver transplantation by creating an arteriovenous fistula for olhdf. utilizing an arteriovenous fistula for olhdf, rather than inserting a vascular access catheter, is a beneficial option to avoid infectious diseases in the management of alf.

nevoid hyperkeratosis of the nipple and the areola (nhna) of the breast is a rare condition which is characterized by verrucose thickening and caf au lait pigmentation of the nipple and areola. first described in the medical literature by tauber in 1923 as a benign dermatologic change in the nipple and areola, it may involve the nipple, the areola or both. athough, in most cases, nhna is a benign condition, and the location and the potential recurrence may have serious consequences on the breast, of both functional and aesthetic nature. nevoid hyperkeratosis can be managed surgically or by conservative modalities; however, it can either threaten the breast function or it can lead to a bad aesthetic due to mismanagement. a 19-year - old greek girl presented to our plastic surgery unit with a bilateral nevoid hyperkeratosis. she complained that the lesions appeared 7 years ago in both breasts, without any other symptoms apart from the local changes. there was not any remarkable past medical history; her family medical history was also unremarkable. therefore, she visited our department asking for a surgical treatment. the nevoid hyperkeratosis of the areola before the surgery on examination, there was no sign or history for any endocrine disease; menarche occurred at 13 year. serology for hepatitis viruses (a, b, c), human immunodeficiency virus and venereal disease research laboratory test (vdrl) was negative. imaging studies revealed no hepato - splenomegaly, enlarged lymph nodes or abdominal or mediastinal masses. a punch biopsy revealed hyperkeratosis, acanthosis and papillomatosis thus confirming a vha type 3 according to the classification of levy frankel. we performed a surgical shaving of the right nipple and areola; we also performed surgical resection of the left areola without shaving of the left nipple. the areolae were repaired with skin graft from the internal surface of the thigh under general anaesthesia. surgical shaving of the left nipple and areola two years after operation, the patient is well; there is no evidence for a recurrence of the disease. less than 90 cases, mainly sporadic, have been reported in the literature.. it mostly affects women in the second or third decade of life, mainly during pregnancy. it is believed that today it is more common than in the past; no evident explanation is provided for that, but it may be due to more accurate diagnosis. the diagnosis is histologically confirmed; deferential diagnosis includes paget's disease, superficial basal cell carcinoma, dermatophytosis and bowen's disease. although it is considered as benign condition, it may accompany other more serious systemic disorders. according to levy and frankel, it can be classified into the following three types: type 1: hyperkeratosis of the nipple and areola representing an extension of a verrucosus (epidermal) nevus, usually unilateral in both sexes.type 2: hyperkeratosis of the nipple and areola associated with other dermatoses such as ichthyosis, ichthyosiform, acanthosis nigricans, darier's disease, cutaneous t - cell lymphoma, chronic eczema and erythroderma. it may also be a manifestation of graft versus host reaction (gvhr) following allogeneic bone marrow transplantation. this type may be bilateral.type 3: this type is also known as idiopathic or nevoid hyperkeratosis of the nipple and areola. it is usually bilateral and it affects both the nipple and areola in more than 70% of the cases. according to some authors, it may appear at puberty or during pregnancy in women, and in men treated with diethylstilbestrol for prostatic carcinoma. type 1: hyperkeratosis of the nipple and areola representing an extension of a verrucosus (epidermal) nevus, usually unilateral in both sexes. type 2: hyperkeratosis of the nipple and areola associated with other dermatoses such as ichthyosis, ichthyosiform, acanthosis nigricans, darier's disease, cutaneous t - cell lymphoma, chronic eczema and erythroderma. it may also be a manifestation of graft versus host reaction (gvhr) following allogeneic bone marrow transplantation. type 3: this type is also known as idiopathic or nevoid hyperkeratosis of the nipple and areola. this unusual variant, according to obayachi et al. it is usually bilateral and it affects both the nipple and areola in more than 70% of the cases. according to some authors, it may appear at puberty or during pregnancy in women, and in men treated with diethylstilbestrol for prostatic carcinoma. the therapeutic options to nhna can be summarized as follows: conservative approach includes keratolysis as salicylic acid 6%, lactic acid lotion, topical steroids, topical trietinoin, oral vitamin a and calcipotriol 2.non-conservative methods are cryotherapy, laser and surgery. conservative approach includes keratolysis as salicylic acid 6%, lactic acid lotion, topical steroids, topical trietinoin, oral vitamin a and calcipotriol 2. the surgical management of nhna was first applied by mehregan et al. in 1977. in managing nhna , one has to consider the need for restoring function and aesthetic appearance of the breast especially in the young. surgery seems to be preferable due to a longer lasting and more aesthetically acceptable . our own case is now free of any discomfort or evidence for a local relapse. to the best of our knowledge

nevoid hyperkeratosis of the breast is a rare condition affecting the nipple, the areola or both. it appears in both sexes and it can by lateral or unilateral. it can also accompany other skin diseases or systemic conditions including malignancies. treatment may not be easy due to aesthetic consequences but surgery seems to be the most preferable therapeutic option. we report such a case successfully managed by surgical intervention.

caesarean section in the second stage of labour is a technically difficult procedure, especially when performed after an operative vaginal delivery has been attempted and when the fetal head is deeply impacted within the pelvis. therefore, a second stage caesarean section may be associated with increased maternal and fetal morbidity. although operative vaginal births are also associated with fetal trauma , significant maternal and fetal trauma can also occur during a caesarean section that is performed during late second stage of labour. the rising rates of caesarean section at full dilatation not only are a concern for the delivery in question but also may have a negative impact on woman's future pregnancies and deliveries. a recent 10-year study of operative delivery in a large london teaching hospital has shown a trend to choose a ventouse (vacuum extractor) over forceps and opting for delivery in the operating theatre as well as a small increase in the rate of caesarean section at full dilatation. this study also showed an increase in failed instrumental delivery (correlation coefficient 0.93, p < 0.05) which was thought to be due to both instrument failure and a reluctance to attempt instrumentation during second stage of labour. other studies have also noted the rise in numbers of caesarean sections at full dilatation and both the royal college of obstetricians and gynaecologists and the american college of obstetricians and gynaecologists have advocated the need for further training on instrumental vaginal deliveries. the aim of this study is to review the determinants for a failed operative vaginal delivery and thereby emergency caesarean sections at full dilatation as well as to determine associated fetal and maternal morbidity. all women who delivered by caesarean section after a failed instrumental delivery at st. georges hospital, london, between july 2007 and june 2012, were identified. this london teaching hospital has over 5000 deliveries a year, with three tiers of obstetricians (registrar st3 - 5, senior registrar st6 - 7, and consultant) working on labour ward. there was always at least the registrar plus senior registrar or consultant on site 24 hours a day, seven days a week. all of the women whose case notes were obtained were over 37 weeks of gestation and had a cephalic presentation. a proforma was created and completed from the case notes of each woman, detailing characteristics as well as details surrounding the labour and delivery. maternal complications that were considered were haemorrhage, intraoperative complications, and genital tract trauma. neonatal morbidity included apgar scores, cord arterial ph, and evidence of scalp or fetal lacerations and cephalhematoma. information regarding the use of instruments, the total number of instruments (with different types of forceps being classed as two separate instruments), the number of pulls with each instrument during the delivery, and the number of times the cup detached from the fetal head was also recorded. georges hospital are performed using the kiwi omnicup and metal and silastic cups are not used. this study was deemed exempt from the need for ethical approval as it is a retrospective observational analysis performed by review of case notes with no clinical interventions and with showing no identifiable patient data. a total of 119 women from a cohort of 26,856 deliveries required a caesarean section (0.44%) after failed operative delivery. our overall failed instrumental delivery rate (total number of failed instrumental deliveries / total number of instrumental deliveries) was 5.1%. case notes were obtained for a total of 119 women. of these 119 women, 22 were delivered for ctg (cardiotocograph) abnormalities and the other 97 because of failure to progress in the second stage of labour. the other 13 women had only one previous delivery; therefore in total there had been 15 previous deliveries. with respect to their previous deliveries, 5 women had had a previous caesarean section at 8 cm, 2 had an elective caesarean section for breech, 4 had a spontaneous vaginal delivery, and 4 had required an operative vaginal delivery during their previous labour. characteristics of women who had a failed instrumental vaginal delivery (fid) are given in table 1. 25% of women in our study had a postpartum haemorrhage (table 2) and almost half of all women sustained maternal trauma at the time of the attempted operative vaginal delivery or caesarean section (table 3). 40 out of 106 neonates had a low apgar score or an umbilical cord arterial ph of < 7.1 (table 5). in 13 cases (10.9%), to the best of our knowledge, our study is the largest study that analyzed the determinants as well as maternal and fetal outcomes for emergency caesarean sections performed for fid over a 5-year period. a number of studies have previously looked at predictors of failed operative vaginal delivery and have concluded that risk factors for fid includedpersistent op presentation;birthweight > 4 kg;maternal body mass index > 30;mid - cavity delivery or when 1/5th of the fetal head is palpable per abdomen. persistent op presentation; maternal body mass index > 30; mid - cavity delivery or when 1/5th of the fetal head is palpable per abdomen. murphy et al. also concluded that instrumental delivery, whether successful or not, was associated with increased risk of maternal trauma and increased neonatal trauma (if there were > 3 pulls). multiple instrument usage was associated with increased neonatal trauma as well as initial attempt at vaginal delivery by an inexperienced operator. considering previous deliveries in multiparous women, hoskins and gomez in 1997 found that having a previous caesarean section at full dilatation reduced the chance of a successful subsequent vaginal delivery to 13%. this is compared to a success rate of 73% and 67%, respectively, if their previous caesarean section was at 69 cm or 5 cm or less. malposition was a key factor in our cohort of women who had a failed instrumental delivery. in only 29% of women was the fetal head in a direct, right, or left occipitoanterior position. there are no randomized control trials looking at the optimal method of delivery when there is malposition. options include manual rotation and direct traction forceps, rotational vacuum extractor, or keilland forceps and each of these options has its own relative merits and demerits. however, keilland forceps require additional expertise because of the additional risks they confer. therefore, in our unit, only those who can demonstrate competency and regularly perform keilland forceps delivery are permitted to do so. tempest et al. suggest that women are more likely to need a caesarean section if rotational ventouse rather than keilland forceps is used to assist the birth (or 8.2 ; 95%ci 4.5414.79) and the adverse maternal and neonatal outcomes are comparable when delivery is by keilland forceps compared to failed rotational ventouse and subsequent caesarean section. in our unit, the kiwi omnicup is the recommended instrument for rotational deliveries. it was chosen as the first instrument in 91 of the 119 cases (76%) with 36 (40%) of them having a second instrument (nonrotational or rotational forceps) applied. in 2001 vacca reported a 98% success rate for the kiwi omnicup in his cohort which included 18 nonrotational and 32 rotational deliveries. however, more recent randomized control trials in the united kingdom concluded that the kiwi omnicup was less successful at achieving a successful vaginal delivery when compared to a standard cup (34% versus 21%) and thereby increases the rates of sequential instrument use. however, operator experience and skill need to be considered whilst interpreting the data. whether the use of the kiwi cup rather than other rotational instruments is a factor for the failed instrumental rate can not be determined from our data as this comparison could not be made. from our data , it can also be seen that failed instrumental deliveries are more common out - of - hours with 60% occurring between 2001 and 0759. whilst it is not possible to conclude that lack of competency and experience contributed to failed instrumental births, instrumental deliveries are predominantly undertaken by trainees during out - of - hours. lack of consultant presence on labour ward during out - of - hours has been an issue which the royal college of obstetrics and gynaecology has been attempting to address over recent years. in our study, a large proportion of trials of instrumental delivery were by trainees, although most of these were by obstetricians with over 5-year experience. the impact of the shortening of obstetric training within the uk as a of the european working time directive may have ed in trainees being less skilled and consequently having a higher failure rate of instrumental deliveries compared to their consultant colleagues. of the women that required syntocinon, 35% commenced syntocinon in the later stages of labour (at or more than 8 cm). this illustrates the importance of carefully assessing the causes of secondary arrest of labour and having senior input if instrumental vaginal delivery is subsequently required in these cases. more than 80% of women also had a second stage lasting for more than four hours. the national institute for clinical excellence intrapartum guidelines stated that after 2 hours of active pushing, primiparous women should have a diagnosis of delay made (i.e., failure to progress) and plans should be put in place for an operative delivery to occur enabling primiparous women to be delivered within 3 hours of the active second stage starting. this illustrates the importance of having definite endpoints in the second stage of labour and to strike the right balance between promoting normality and reducing the risks of a prolonged second stage of labour. the station of the fetal head may also be a determinant of failed instrumental delivery. according to the royal college of obstetrics and gynaecology, mid - cavity delivery is defined as when the leading point of the fetal skull is above station plus 2 cm but not above the ischial spine. just over 95% of our cases are therefore defined as mid - cavity and therefore, should be performed by an experienced operator because of the need for a high level of clinical and technical skill. body mass index of over 30 is generally thought to be a risk factor for failed instrumental delivery although this was not borne out in our analysis. fetal factors that contribute to a failed instrumental delivery are difficult to be predicted, both antenatally and during the intrapartum period. for example, a fetal weight of more than 4 kg is associated with increased likelihood of failed instrumental delivery but there is no good evidence to support the use of ultrasound for estimation of fetal weight due to its inaccuracy. clinical skills therefore remain important in the diagnosis and management of failure to progress in second stage. it has been reported that clinical examination was found to be significantly more likely within 10% of the actual weight than an ultrasound derived estimation of fetal weight (58% versus 32% ; rr 1.65 ; 95% ci 1.421.69). it is therefore unlikely that fetal factors such as weight could be used to predict the likelihood of either successful or failed instrumental delivery. when considering maternal outcomes associated with fid, approximately 25% of women in our study lost more than 1000 ml at the time of their caesarean section. in the study by murphy et al. , only 10% of women lost more than 1000 ml at the time of their caesarean section but this was significantly more than those women who achieved a vaginal delivery (adjusted or 2.8, 95% ci 1.17.6). their group also showed that increased blood loss was less likely with an experienced obstetrician but in our cohort that did not appear to be the case. this increase in blood loss with a fully dilated caesarean section as compared to vaginal delivery was also noted by ebulue et al. in 2008 we run regular fire drills on estimation of blood loss in our unit for all staff and therefore it is very likely that the higher ebl noted in our study reflects a more accurate estimation of blood loss at delivery. in addition, obstetric trainees were involved in delivery of 80% of cases who sustained a postpartum haemorrhage of > 1000 ml (table 2). maternal trauma sustained at the time of delivery can occur either at the time of attempted vaginal delivery or during the emergency caesarean section following fid. in our study, a total of 66 episodes of maternal trauma were documented. eight women sustained trauma via two separate mechanisms whereas 61 women did not sustain any trauma at the time of delivery. therefore , 48% of women sustained trauma at the time of their failed instrumental vaginal delivery or caesarean section. over 25% of the women who sustained trauma had vaginal / perineal injuries. there is no evidence to support the routine use of episiotomy at the time of operative vaginal delivery. macleod and murphy surveyed practicing obstetricians with regard to operative delivery and the use of episiotomy. they found that a restrictive approach was preferred for deliveries using a ventouse (72%) but a routine approach for forceps (73%). even with such an approach, episiotomies should not be performed until the stage where delivery is deemed to be imminent. therefore, it is essential to avoid an episiotomy when the fetal head is at station 0 or plus 1 cm when there is minimal or no descent with traction, to avoid an inappropriate episiotomy. our study highlights the fact that both the incidence and severity of maternal trauma are greater when an emergency caesarean was performed for fid, where the primary indication was failure to progress in labour. therefore, optimization of management of second stage of labour and providing experienced obstetric input is paramount to avoid these complications. neonatal outcomes at the time of failed operative delivery and subsequent caesarean have been considered by a number of studies in the past. unfortunately, it is difficult to compare our data with these studies due to a wide variation in neonatal complications (neonatal unit admissions, jaundice, sepsis, and seizures) that have been considered by individual studies. much of the available evidence suggests that sequential instrumentation should be avoided if possible because of the increased neonatal morbidity. murphy et al. found that the use of sequential instruments was associated with increased neonatal trauma (adjusted or 3.1, 95% ci 1.56.8 and adjusted or 4.4, 95% ci 1.314.4, for completed and failed deliveries, resp .). in our study, 34 women (29%) had sequential instruments with either ventouse and forceps or nonrotational and rotational forceps. loss of scalp tissue and laceration of the eye (table 4) highlight operator factors and the need to determine the fetal position accurately, if necessary, using an ultrasound scan to identify fetal orbits, to avoid these complications. emergency caesarean section during second stage of labour is associated with maternal and fetal complications and also has the potential to negatively influence a woman's birth experience. our study has shown that failed instrumental delivery is more likely with fetal malposition, prolonged second stage of labour, use of oxytocin for secondary arrest, and lack of operator experience. although current guidelines on operative vaginal delivery do identify risk factors that may increase the incidence of failed instrumental delivery, there are no scoring systems to aid obstetricians in determining the likelihood of failure. based on the findings of our study that analyzed emergency caesarean sections for fid in 119 women, we have formulated a failed instrumental delivery score to aid clinicians on the shop floor in determining the likelihood of failure (table 6). we have suggested that if the failed instrumental delivery score is 8, there is an increased likelihood of a failed instrumental vaginal birth and hence a trial of instrumental vaginal delivery in the theatre should be considered and the consultant on call should be alerted in view of associated increased maternal and fetal morbidity due to fid. we sincerely hope that use of such clinical scoring system based on key parameters that could be easily determined prior to attempting an instrumental vaginal delivery would help clinicians to ensure availability of an experienced clinician and also to conduct delivery in an appropriate environment with a ready recourse to caesarean section.

objectives. to review the determinants for a failed operative vaginal delivery and to examine associated fetal and maternal morbidity. design. retrospective observational study. setting. large london teaching hospital. method. a retrospective review of case notes during a 5-year period was carried out. . overall 119 women (0.44%) out of 26,856 births had a caesarean section following a failed instrumental delivery, which comprised 5.1% of all operative vaginal births. 73% had a spontaneous onset of labour and 63% required syntocinon at some time prior to delivery. 71.5% of deliveries were complicated by malposition. only 20% of deliveries were attended by a consultant obstetrician. almost 50% of women and 8.4% of neonates sustained trauma at the time of either their failed instrumental delivery or the caesarean section. . emergency caesarean section during the second stage of labour is associated with maternal and fetal complications. a failed instrumental delivery score' (fids) may aid practitioners in predicting an increased likelihood of a failed operative vaginal birth and therefore to consider a trial of operative vaginal delivery in the theatre. senior input should also be sought because a failed operative vaginal birth is associated with increased maternal and fetal morbidity.

congenital hypothyroidism (cht) is the most common congenital endocrine disorder with a world - wide incidence around 1 in 3500 to 4000 live births. reduced thyroid hormone production in babies with cht has a major detrimental effect on central nervous system development and growth. most babies with cht have thyroid gland agenesis or dysgenesis with a poorly formed or absent gland. a minority (~20%) have a normally sited gland but an underlying single gene defect preventing the normal process of thyroid hormone production within the gland (dyshormonogenesis). although germline mutations in thyroid transcription factors 1 and 2 (ttf-1 and ttf-2) and pax-8 (paired box transcription-8) have been identified as aetiological risk factors for dysgenesis or agenesis, they only explain a small percentage of cases (around 2%). it is important to highlight the fact that iodine deficiency is a well recognised and important cause of neonatal thyroid dysfunction in some parts of the world. an increasing incidence of cht has been suggested from an analysis of data including that from new york state and mexico, although no similar increase was shown in a similar study of data from quebec. previous studies in the united kingdom have suggested that cht is more prevalent in asian sectors of the population and that prevalence has increased. studies also suggest that the prevalence of hypothyroidism in scotland has increased, with a study from the same area of scotland demonstrating an increased population prevalence of hypothyroidism in young people compared to previously published rates. the incidence of cht has also been suggested to vary seasonally in a number of studies in different geographical areas including the west midlands of england, finland, japan , and australia. however, seasonality also has been not observed in a number of other studies, including those in the north west of england, the netherlands, saudi arabia, canada, norway, france and switzerland. should seasonal variation in cht risk exist, this would suggest that an unknown environmental factor may be involved in the disease's aetiology. temporal trends in risk are usually unlikely to include genetic factors, unless either population shifts in germline mutations being more prominent in a particular geographical area or environmental influences on germline mutations or epigenetic changes have increased in prevalence over the study period. circulating thyroid stimulating hormone (tsh) levels are measured as part of screening programmes for cht across many parts of europe, japan, and increasingly in north america. in the uk, neonatal screening for cht began in 1979 in scotland and in 1981 in the remainder of the uk after a recommendation from the uk department of health. this paper describes the incidence of elevated tsh levels in newborns in the north of england over an eleven - year period and examines whether seasonal variation in incidence exists in this geographical area. around 35 000 infants in the northern region of england, comprising north east england (the area from teesside extending north into northumberland) and north cumbria, are screened every year in a single centre by measuring blood spot tsh levels. data on all cases, including dates of birth, were available from 1994 to 2005 inclusive. we opted to refer to tsh rather than cht in this study for the following reasons. the extent to which cases of suspected cht are investigated will vary from one unit to another. we felt that this was likely to be the case in our region of the uk as well. there is no definitive test or tests that can identify the underlying thyroid gland abnormality in this condition. even the combination of isotope scanning and ultrasonography does not reveal an underlying diagnosis in all infants. the sensitivity and specificity of tests such as isotope scanning is suboptimal with potentially misleading information generated by factors such as early thyroxine therapy. some studies have used thyroxine intervention as confirmation of underlying cht but the threshold for intervention will vary with time and from clinician to clinician and centre to centre. hence some babies with raised tsh values and thyroid hormone values within the laboratory normal range will be treated whilst others will not. ultimately, biochemistry is the most important parameter; a baby with a raised tsh but normal imaging will require thyroxine treatment whilst a baby with normal biochemistry but abnormal imaging will not. during the period of the study the screening centre moved between the royal victoria infirmary (rvi), newcastle and the university hospital of north durham (uhnd), durham. the screening blood spot tsh method and cut - off value for screening failure also changed during the study from a manual radioimmunassay method (1994march 1998) to an acs-(beyer) chemiluminometric assay (april 1998february 2003) and then a delfia (perkin elmer) fluoroimmunometric assay (march 2003present) (table 1). interassay coefficients of variation (cv) for blood spot tsh assays were 16.5%, 9.4%, and 8.8% for the manual radioimmun assay method at tsh values of 22.0, 38.6, and 74.1 interassay cv for blood spot tsh assays were 7% and 6% for the acs chemiluminometric assay at tsh values of 14 mu / l, respectively, and 11% and 12% for the delfia fluoroimmunometric assay at tsh values of 16 nine replicates over 9 analytical runs were used to calculate inter assay precision for the acs assay and 42 replicates over 10 analytical runs for the delfia assay. to ensure that cut - off values were comparable across the different screening methods used, prior to a change in method blood spot samples received as part of the screening program were analysed by both methods (radioimmunoassay v acs-180, n = 2634 ; acs-180 v delfia, n = 682). revised cut - off values were established by comparing the using scatter charts and using least squares linear regression. there was a highly significant correlation between the 2 methods when the assay was changed from ria to acs-180 in 1998 (p < .001 ; r = 0.94) and when it was changed from acs-180 to delfia in 2003 (p < .001 ; r = 0.99). 100% agreement for screening passes and failures was obtained using the revised cut - off values. values identified as being greater than 20 mu / l by the radioimmunassay method, 10 mu / l by the acs method, and greater than 6 mu / l by the delfia method were followed by analysis of a repeat blood spot from the screening card. they were deemed to be screening failures if the final blood spot value was again greater than 10 mu / l (acs) or 6 mu / l (delfia). all infants where the paediatrician was subsequently notified of an increased value and hence were classed as neonatal screening test failures were included in the analysis. the yearly incidence of elevated tsh values in newborns was calculated as the number of cases in each year per 100,000 live births born in the northern region. seasonal variation in incidence was assessed using the edwards test for seasonality with an adjustment for variable month length. all statistical analyses were performed using the statistical software package stata, version 9.0 (statacorp, texas). approvals for this study were obtained from the newcastle and north tyneside local research ethics committee and the patient information advisory group for england and wales. between 1994 and 2005 inclusive, there were 213 cases of elevated tsh values in newborns in the northern region of england. the ratio of female to male cases was 1.3: 1. over the study period, the average annual incidence was 59.94 per 100,000 live births. the annual number of cases of tsh elevation in newborns in the northern region and annual incidence per 100,000 live births are shown in table 2. incidence increased significantly over the study period (p < .0001) from 37 per 100,000 in 1994 to a peak of 92.8 in 2003. the number of cases by month of birth is reported in table 3. despite peak number of cases in may and in the august october period , there was no significant evidence of seasonal variation in the number of cases (p = .16). nor was there evidence of seasonal variation with sex - specific seasonality analyses (p = .17 for females and 0.59 for males). despite advances made in identifying genetic risk markers for cht, there remains a great deal to be explained in terms of the aetiology of the disease. this study showed an increasing incidence of elevated tsh values in newborns in the northern region of england between 1994 and 2005, but did not find evidence of seasonal variation in the number of cases. many other studies have depended primarily on biochemistry including tsh rather than other investigations when making a diagnosis of cht. given the high risk of subclinical hypothyroidism and morphological abnormalities in false - positive patients we suspect that our figures for raised tsh will be closely linked to the number of actual cases of cht. unfortunately we do not have detailed information on outcome in these children because they were managed in more than 10 different hospitals by an even greater number of clinicians. more detailed data were therefore not available to allow us to assess changes in permanent cht or to analyse the data with respect to different aetiologies. an increasing temporal trend in incidence of cht has recently been reported in new york state, with a 138% increase between 1978 and 2005. excluding new york state, nationwide united states data suggest a 73% increase between 1987 and 2002. however, this is in contrast to research conducted in quebec, canada, where no changes in incidence were seen over a 16-year period. a real temporal trend, aside from changes in diagnostic procedures which can lead to increases in incidence, suggests either an increasing exposure to an environmental risk factor, or a changing distribution of risk factors among the population. the incidence rates in this study dropped slightly after 2003 and it remains to be seen whether this is a true decline or simply random variation. the division between a screen positive and screen negative in a screening programme such as this is not linked to robust outcome measures and the screening threshold and management of cases with mild thyroid dysfunction varies between regions. we were keen to establish that the change in incidence was not simply a reflection of change in assay methodology or laboratory practice (as opposed to seasonality where we would not expect assay change to have the same impact). all births in the study region were screened in a single centre at any one time. the physical location of this centre changed originally in april 1998 from newcastle to durham and again in april 2005 from durham to newcastle. the move in 1998 also corresponded to a change in the laboratory assay with a further change in assay in 2003. the different assay methods were rigorously compared to ensure that there would be no difference in the number of cases identified as a of the change. to this end a large number of samples were analysed and there was no difference in screening passes or failures with 100% concordance. it is of note that the increasing incidence in raised tsh values was most striking during the period when tsh was measured only by the acs method although we suspect that this represents a true increase because the rise had commenced prior to the change in methodology and continued after this changed to the delfia assay. many other studies of cht or elevated tsh levels have encountered similar issues regarding data interpretation as assay methodology has changed. in terms of changes in the population structure, two previous studies from england have reported an increased incidence of cht among asians. however, the northern region of england has a population of 3.1 million, of which less than 2% are from ethnic minorities, with low levels of migration. therefore, while the data are not available to assess directly, it is unlikely that the increased incidence is related to changes in population structure and with it changes in genetic risk factor profiles. exposure to environmental factors such as chemicals or increasing levels of other risk factors such as maternal iodine deficiency or high prenatal iodine exposures or low birth weight infants may be suggested by an increasing temporal trend whereas infections or seasonally varying dietary factors or chemical exposures, such as dioxin and polychlorinated biphenyl, may be suggested by evidence of seasonal variation in the number of cases. the potential role of a suboptimal maternal iodine status in some parts of the north of england should be highlighted and clearly warrants further study. we found little evidence of seasonal variation of elevated tsh levels in newborns, in line with a number of previous reports of no seasonality. in contrast, a number of previous studies have reported seasonal variation in a number of different geographical areas , including a different part of england. gu et al. also found sex - specific seasonal patterns of incidence in japan. however, sex - specific analyses also showed little evidence of seasonal variation in this study. the issue of statistical power should be considered when interpreting our and it is possible that with a larger sample a seasonal effect may have been found. it is also possible that differences in findings may reflect differences in the underlying populations. our sex ratio (f : m) of 1.3: 1 was significantly less than the sex ratio of 2.8: 1 previously shown in a study from scotland that used thyroxine prescription data as a surrogate for hypothyroidism in children and young people and less than the ratio of 2.1: 1 reported for cases of true cht from the same country. this underlines the importance of taking factors such as iodine status into consideration in future work. in , we have observed a significant increasing trend in the incidence of elevated tsh levels in newborns, a surrogate for increasing levels of cht, since 1994. whilst the reasons for the increase are unclear, it would appear from this analysis that seasonally varying factors are not involved. it is also unlikely to be due to a change in the population distribution of genetic risk factors, although environmental determinants of genetic mutations and epigenetic factors can not be ruled out.

previous studies of congenital hypothyroidism have suggested an increasing incidence and seasonal variation in incidence, which may suggest nongenetic factors involved in aetiology. this study describes the incidence of elevated thyroid stimulating hormone (tsh) values in newborns, a surrogate for congenital hypothyroidism, measured as part of the screening programme for congenital hypothyroidism, over an eleven - year period, and assesses whether seasonal variation exists. all infants born in the northern region of england are screened by measuring levels of circulating tsh using a blood spot assay. data on all 213 cases born from 1994 to 2005 inclusive were available. annual incidence increased significantly from 37 per 100,000 in 1994 to a peak of 92.8 per 100,000 in 2003. there was no evidence of seasonal variation in incidence. the reasons for the increasing incidence are unclear, but do not appear to involve increasing exposure to seasonally varying factors or changes in measurements methods.

a total of 8,333 type 1 diabetes cases, 9,947 controls, and 3,997 families were genotyped at rs10272724 using taqman (supplementary methods). cases were diagnosed with type 1 diabetes before 17 years of age (mean age at diagnosis = 7.8 years) and were from the juvenile diabetes research foundation / wellcome trust diabetes and inflammation laboratory genetic resource investigating diabetes study (http://www.childhood-diabetes.org.uk/grid.shtml). controls were obtained from the british 1958 birth cohort (n = 6,899 ; http://www.cls.ioe.ac.uk/studies.asp?section=000100020003) and the wtccc uk blood service (ukbs) sample collection (n = 3,048). stata version 10 (statacorp lp, college station, tx) was used to perform association analyses (http://www.stata.com). rs10272724 was in hardy - weinberg equilibrium in unaffected parents and control subjects (p > 0.05). case - control data were modeled using logistic regression, with disease status as the outcome variable and counts of the minor allele (coded 0, 1, and 2) as the independent variable, assuming a multiplicative allelic effects model. families were analyzed using the transmission disequilibrium test (supplementary methods). the interdependency of rs10272724 and rs4948088 in the 7p12 region was examined by stepwise logistic regression. peripheral blood mononuclear cells (pbmcs) were purified from heparinized blood diluted 1:1 in pbs (without ca and mg, gibco, invitrogen, carlsbad, ca), and 15 ml aliquots were layered onto 10 ml aliquots of lympholyte (cedarlane laboratories ltd ., burlington, ontario) followed by centrifugation at 800 g for 20 min at room temperature. the harvested pbmc layer was washed twice with ice - cold pbs and centrifuged at 300 g for 10 min at 4c. pellets were resuspended in trizol (invitrogen) and stored at 80c in aliquots of 10 10 cells / ml. total rna from 1 10 pbmcs in trizol was prepared using chloroform extraction followed by purification with the rneasy mini kit (qiagen, hilden, germany), according to the manufacturer s instructions. rna quality was assessed using an agilent 2100 bioanalyser, and concentration was evaluated by nanodrop (thermo scientific, waltham, ma). first strand dna synthesis was carried out on 1 g of rna using superscript iii rt kit and oligo - dt (invitrogen). quantitative (q)pcr primers and probe were designed to two transcripts of ikzf1, herein referred to as qpcr assays contained 5 l of 1:10 dilution of oligo - dt primed cdna, prepared as described above, in 20 l assays. cycle threshold (ct) values were measured using a 7900ht abi prism (applied biosystems, carlsbad, ca) and analyzed using sds v2.1 software (abi). qpcr reactions were run in triplicate, and the ct for the transcript level qpcrs was calculated using the ikzf1 isoform 1 or isoform 2 qpcr ct value minus the single copy gene 2 microglobulin qpcr ct value. expression values were compared via one - way anova using prism software (graphpad software inc ., la jolla, ca). correlation between rs10272724 and expression in three types of cell lines (primary fibroblasts, epstein barr virus - immortalized lymphoblastoid cell lines, and phytohemagglutinin - stimulated primary t - cells) derived from umbilical cord samples of 75 newborns of western european origin via the gencord project was examined in silico using the publicly available hapmap online gene expression variation (genevar) resource (http://www.sanger.ac.uk/resources/software/genevar/). nine probes that passed quality control assessment (supplementary table 1) were evaluated for correlation of mrna expression with rs10272724 genotype by linear regression using the genevar 2.0.1 java tool (supplementary methods). a p < 0.0056 significance threshold was used within each cell type based on a bonferroni correction for testing nine transcripts. blood for qpcr experiments was collected from 88 nondiabetic donors (rs10272724 : 44 tt, 33 ct, 11 cc) selected from a pregenotyped bioresource and processed within 4 hours (www.cambroidgebioresource.org.uk). all dna samples were collected with ethical approval from the national health service cambridgeshire research ethics committee. written consent was obtained from all individuals. a total of 8,333 type 1 diabetes cases, 9,947 controls, and 3,997 families were genotyped at rs10272724 using taqman (supplementary methods). cases were diagnosed with type 1 diabetes before 17 years of age (mean age at diagnosis = 7.8 years) and were from the juvenile diabetes research foundation / wellcome trust diabetes and inflammation laboratory genetic resource investigating diabetes study (http://www.childhood-diabetes.org.uk/grid.shtml). controls were obtained from the british 1958 birth cohort (n = 6,899 ; http://www.cls.ioe.ac.uk/studies.asp?section=000100020003) and the wtccc uk blood service (ukbs) sample collection (n = 3,048). stata version 10 (statacorp lp, college station, tx) was used to perform association analyses (http://www.stata.com). rs10272724 was in hardy - weinberg equilibrium in unaffected parents and control subjects (p > 0.05). case - control data were modeled using logistic regression, with disease status as the outcome variable and counts of the minor allele (coded 0, 1, and 2) as the independent variable, assuming a multiplicative allelic effects model. families were analyzed using the transmission disequilibrium test (supplementary methods). the interdependency of rs10272724 and rs4948088 in the 7p12 region was examined by stepwise logistic regression. peripheral blood mononuclear cells (pbmcs) were purified from heparinized blood diluted 1:1 in pbs (without ca and mg, gibco, invitrogen, carlsbad, ca), and 15 ml aliquots were layered onto 10 ml aliquots of lympholyte (cedarlane laboratories ltd ., burlington, ontario) followed by centrifugation at 800 g for 20 min at room temperature. the harvested pbmc layer was washed twice with ice - cold pbs and centrifuged at 300 g for 10 min at 4c. pellets were resuspended in trizol (invitrogen) and stored at 80c in aliquots of 10 10 cells / ml. total rna from 1 10 pbmcs in trizol was prepared using chloroform extraction followed by purification with the rneasy mini kit (qiagen, hilden, germany), according to the manufacturer s instructions. rna quality was assessed using an agilent 2100 bioanalyser, and concentration was evaluated by nanodrop (thermo scientific, waltham, ma). first strand dna synthesis was carried out on 1 g of rna using superscript iii rt kit and oligo - dt (invitrogen). quantitative (q)pcr primers and probe were designed to two transcripts of ikzf1, herein referred to as qpcr assays contained 5 l of 1:10 dilution of oligo - dt primed cdna, prepared as described above, in 20 l assays. cycle threshold (ct) values were measured using a 7900ht abi prism (applied biosystems, carlsbad, ca) and analyzed using sds v2.1 software (abi). qpcr reactions were run in triplicate, and the ct for the transcript level qpcrs was calculated using the ikzf1 isoform 1 or isoform 2 qpcr ct value minus the single copy gene 2 microglobulin qpcr ct value. expression values were compared via one - way anova using prism software (graphpad software inc ., la jolla, ca). correlation between rs10272724 and expression in three types of cell lines (primary fibroblasts, epstein barr virus - immortalized lymphoblastoid cell lines, and phytohemagglutinin - stimulated primary t - cells) derived from umbilical cord samples of 75 newborns of western european origin via the gencord project was examined in silico using the publicly available hapmap online gene expression variation (genevar) resource (http://www.sanger.ac.uk/resources/software/genevar/). nine probes that passed quality control assessment (supplementary table 1) were evaluated for correlation of mrna expression with rs10272724 genotype by linear regression using the genevar 2.0.1 java tool (supplementary methods). a p < 0.0056 significance threshold was used within each cell type based on a bonferroni correction for testing nine transcripts. blood for qpcr experiments was collected from 88 nondiabetic donors (rs10272724 : 44 tt, 33 ct, 11 cc) selected from a pregenotyped bioresource and processed within 4 hours (www.cambroidgebioresource.org.uk). all dna samples were collected with ethical approval from the national health service cambridgeshire research ethics committee. written consent was obtained from all individuals. the minor allele of rs10272724 (t > c) near ikzf1 was protective from type 1 diabetes (odds ratio 0.87 , p = 4.8 10 ; table 1, supplementary table 2). no evidence of association of rs10272724 with sex or age - at - diagnosis was obtained (p > 0.1). some samples overlapped with those used in the previous gwa study for type 1 diabetes. however, in each of the sample sets used by barrett et al. and in our unique samples, the effect is in the same direction and the overall significance is increased, suggesting the effect is not solely attributable to the original samples (table 1). the minor allele of rs10272724 was also protective in the families with type 1 diabetes, i.e., under - transmitted to affected offspring (table 1 ; relative risk 0.87 , p = 7.6 10). combined, these indicate that the minor allele, c, of rs10272724 at 7p12.2 is convincingly associated with a reduced risk of type 1 diabetes (p = 1.1 10). reported a replicated association with rs4948088 (c > a) with type 1 diabetes in the 7p12.1 region, 554 kb downstream of ikzf1. however, this snp, marking a confirmed type 1 diabetes locus (http://www.t1dbase.org/page/regions), is not in ld with rs10272724 in ikzf1 (d = 0.02, r = 0.0001), and we found by regression analysis that the two effects were independent as both snps improve a model with the other snp included (p < 5.5 10). association of rs10272724 (t > c) near ikzf1 in 8,333 type 1 diabetes cases, 9,947 control subjects, and 3,997 families with type 1 diabetes maf, minor allele frequency; rr, relative risk. * no evidence of deviation from a multiplicative allelic effects model was obtained (p = 0.33), so p values assuming multiplicative allelic effects are reported. the overall p value was obtained by combining the p value from the case - control sets and the family transmission disequilibrium test using fisher s method for combined probability. analyzed three datasets in their gwa study, two of which overlap with the samples in the current study. used the illumina 550 k snp chip to genotype rs10272724 in set 1. genotypes were 99.6% concordant between the illumina platform and taqman in the 3,850 cases and 3,772 controls genotyped using both technologies. affymetrix 500 k mapping array genotypes for neighboring snps were used to impute rs10272724 genotypes in set 2 by barrett et al. because rs10272724 was not genotyped by affymetrix. t1dgc, type 1 diabetes genetics consortium; wtccc, wellcome trust case - control consortium. the relative abundance of two different sets of ikzf1 transcripts in mrna extracted from pbmcs isolated from 88 nondiabetic individuals was assessed using qpcr to determine the association of rs10272724 alleles with gene expression. no evidence of allele - specific expression was obtained (p > 0.1 ; fig . the probe originally used ( illumina i d ilmn_1676575) contains two high - frequency snps in its target, rs62447207 (g > t) and rs62447208 (c > g) in ld with rs10272724 (r = 0.76), rendering it unreliable, as evidenced by the absent ikzf1 probe in the latest genevar data from the study by dimas et al. next, correlation of rs10272724 genotype and expression of nine transcripts from other genes within 1 mb of rs10272724 in three types of cell lines was tested using the latest genevar dataset by dimas et al. no correlation was observed between rs10272724 and expression of any of the five neighboring genes (, supplementary fig . 1). association of ikzf1 expression with rs10272724 (t > c) genotype in 88 unaffected individuals. ct were calculated using the ikzf1 isoform 1 or isoform 2 qpcr ct value minus the single copy gene 2 microglobulin (b2 m) qpcr ct value. we provide evidence that the minor allele of rs10272724 (c), in near - perfect ld with the minor, c - all susceptible, allele of rs4132601 (g), is protective from type 1 diabetes. of the nearby genes in the region, ikzf1 appeared to be the most likely candidate causal gene for type 1 diabetes in this region given its causal role in c - all and its known role in lymphocyte development. however, our analysis revealed that the previously reported correlation of ikzf1 mrna expression with rs4132601 may be inaccurate given complications with the probe used in the data accessed by papaemmanuil et al. furthermore, an ikzf1 genotype - phenotype correlation at rs10272724 was not confirmed by our qpcr analysis of pbmcs. ikzf1 is now an attractive candidate causal gene in type 1 diabetes, and a functional link between rs10272724 and ikzf1 may yet be elucidated on examining specific isoforms of ikaros. we note that our qpcr assay evaluated the expression of two transcripts conserved across 10 splice variants of ikzf1, spanning six of the seven identified active and dominant - negative isoforms of the protein. in addition, many allele - specific effects on gene expression are known to be tissue or cell - type specific and may even be restricted to particular phases of development. another all - related gene, af4/fmr2 family member 3 (aff3), has been associated with type 1 diabetes (j. cooper, c.w ., and j.a.t ., unpublished observations), so our report also confirms a second genetic link between these diseases. aff3 has been implicated as a susceptibility allele in rheumatoid arthritis (rs10865035 and rs9653422), further highlighting the connection between autoimmunity and lymphoid cancers. our finding with ikzf1 marks the third ikaros family member to be associated with type 1 diabetes, the others being the transcription factors ailios (ikzf3) on chromosome 17q21.2 and eos (ikzf4) on chromosome 12q13.2, whose targets include bcl-2 and foxp3, respectively. ikaros family members interact to coordinate functions of immunologic development and homeostasis, so it will be important to explore the effect of these interactions in disease etiology. the more than 30 reported interaction partners of the ikaros family members (http://www.t1dbase.org) suggest the role of ikzf1 in type 1 diabetes could be subtle and yet far reaching. interactions with the histone deacetylase and chromodomain - helicase - dna - binding families of proteins suggest chromosome remodeling events could be involved. ikaros interactions with the notch and stat protein families also suggest that signaling events that affect t - cell activation and maturation could affect the ultimate development of a diabetogenic, leukemia - protected or nondiabetogenic, leukemia - susceptible t - cell repertoire. thus, further investigation is warranted to elucidate the phenotypic effect of the genetic feature marked by rs10272724, its impact on ikzf1, and the role of ikaros in autoimmunity.

objectiveikzf1 encoding ikaros, an essential regulator of lymphopoiesis and immune homeostasis, has been implicated in the development of childhood acute lymphoblastic leukemia (c - all). because recent genome - wide association (gwa) studies have linked a region of the 3-utr of ikzf1 with c - all susceptibility, we tested whether ikzf1 is associated with the autoimmune disease type 1 diabetes.research design and methodsrs10272724 (t > c) near ikzf1 at 7p12 was genotyped in 8,333 individuals with type 1 diabetes, 9,947 control subjects, and 3,997 families of european ancestry. association was tested using logistic regression in the case - control data and by the transmission disequilibrium test in the families. expression data for ikzf1 by rs10272724 genotype were obtained using quantitative pcr of mrna / cdna generated from peripheral blood mononuclear cells from 88 individuals, whereas expression data for five other neighboring genes were obtained from the online genevar dataset.the minor allele of rs10272724 (c) was found to be protective from type 1 diabetes (odds ratio 0.87 ; p = 1.1 1011). rs10272724 was not correlated with levels of two transcripts of ikzf1 in peripheral blood mononuclear cells.the major susceptibility genotype for c - all confers protection from type 1 diabetes. our finding strengthens the link between autoimmunity and lymphoid cancers. further investigation is warranted for the genetic effect marked by rs10272724, its impact on ikzf1, and the role of ikaros and other family members, ailios (ikzf3) and eos (ikzf4), in autoimmunity.

homocysteine is an amino acid which has sprung into prominence in the past few decades. elevated homocysteine has also served as an early marker for insulin resistance due to the effects of insulin on homocysteine metabolism and renal clearance. these relationships of homocysteine to disease states in the nonpregnant adult population have been extrapolated to link it to the pregnancy specific conditions of gestational diabetes mellitus and hypertensive disorders of pregnancy. homocysteine levels decline during pregnancy, and the levels are the lowest during second trimester of pregnancy and increase in the second half of the third trimester of pregnancy. hence, samples taken within strict time frame, such as 4 weeks (between 8 to 12 weeks of gestation), would have a better success at correlating the homocysteine levels with the pregnancy outcome, by minimising the gestational age bound variation of homocysteine. in addition, most maternal complications such as hypertensive disorders of pregnancy and gestational diabetes mellitus develop much later, so timing the sample collection before 12 weeks would sufficiently predate the onset of complications. serum homocysteine levels in pregnancy have been linked to preeclampsia , recurrent abortions , and low birth weight. but evidence on this is conflicting with some studies stating that serum homocysteine values have no correlation to maternal and fetal outcome. hence, there is a need for this study to shed light on these conflicting opinions regarding the effect of homocysteine levels on both maternal and fetal outcomes. to correlate the levels of homocysteine in late first trimester of pregnancy (812 weeks) with the maternal and fetal outcome of pregnancy, especially with regard to development of hypertensive disorders of pregnancy and gestational diabetes mellitus. to estimate the homocysteine levels in late 1st trimester (812 weeks) and to correlate it with prior history of (i) first, second, and third trimester pregnancy losses, (ii) hypertensive disorders of pregnancy and gestational diabetes mellitus, (iii) fetal malformations, and (iv) preterm delivery and birth weight. to correlate the homocysteine levels with the present pregnancy parameters, namely, (i) hypertensive disorder of pregnancy, (ii) gestational diabetes mellitus, (iii) pregnancy loss, (iv) amniotic fluid volume and meconium staining of amniotic fluid, and (v) birth weight. it was a prospective observational cohort study comprising antenatal women who attended the antenatal outpatient department of a tertiary care university level health centre. the study was started after obtaining the institutional ethics committee approval and was conducted from august 2009 to july 2011. 110 women were invited to participate in the study and 100 agreed to participate in the study. ten women refused to participate in the study as they were from distant places from our institute and hence could not come in the early morning in fasting state for the homocysteine test. subjects were enrolled at 8 to 12 weeks gestation and known diabetics or hypertensives on treatment were excluded. at enrollment, a questionnaire was collected regarding age, period of gestation, parity, abortions with respective period of gestation and whether induced or spontaneous, history of previous fetal malformations, history of hypertensive disorders of pregnancy or gestational diabetes mellitus in previous pregnancies, and birth weight of previous children and whether the previous deliveries were term or preterm births. venous blood samples were taken after overnight fasting for serum homocysteine estimation and serum separated by centrifugation and sera assayed for homocysteine by chemiluminescence assay technique using a well - calibrated fully automated chemiluminescence assay system the advia centaur cptm immunoassay system (siemens, germany) which is an automated, random access direct chemiluminescent immunoassay analyzer. routine examination included blood pressure recordings, pedal edema, urine albumin and sugar, symphysio fundal height, and clinically amniotic fluid level status. glucose challenge test was done at 32 weeks of pregnancy, and if abnormal, 100 gram oral glucose tolerance test (ogtt) was done to diagnose gestational diabetes mellitus. antenatal ultrasound was done if there was clinical suspicion of iugr (e.g., symphysio fundal height less than 4 cm than corresponding to period of gestation), and in case of malpresentations, hypertensive disorders of pregnancy (and other risk factors for iugr) and before induction of labour. doppler ultrasound of umbilical and middle cerebral artery was done in case of iugr and preeclampsia to do assess the risk of fetal morbidity in these cases. statistical analysis was done using graphpad instat software; using unpaired t - test for comparison of two parametrically distributed groups of data, unpaired t - test with welch correction was used for comparison of two parametrically distributed groups of data with unequal variances. mann - whitney u test was used for comparison of two nonparametrically distributed groups of data, and one way anova was used for more than two parametrically distributed groups of data. kruskal - wallis test was used for comparison of more than two parametrically distributed groups of data. p value of 0.05 was taken as significant and 0.001 was taken as highly significant. of the 100 antenatal women recruited, 10 were lost to follow up thus leaving 90 subjects whose outcomes were analysed. the ages of the subjects were in the range of 21 to 33 years with a mean age of 24.76 2.6 years. the bmi of the subjects ranged from 15.5 kg / m to 33.2 kg / m and the mean was 21.70 6.23 there was no correlation between the homocysteine levels and the age, bmi, the period of gestation, or the number of folic acid tablets taken by the subjects. of the recruited 100 women, 14 women had past history of hypertensive disorders of pregnancy, 5 women had previous gestational diabetes mellitus, 6 had a previous preterm delivery, and 2 had a previous fetal malformation. there was significantly elevated homocysteine levels (p = 0.0359) among women with prior history of hypertensive disorders of pregnancy. however, the difference in homocysteine levels between those with and without past history of gestational diabetes mellitus was not statistically different (p = 0.054). there was no statistically significant difference of homocysteine levels with history of prior preterm deliveries (p = 0.8348) or with history of previous fetal malformation (p = 0.078) (table 1). of the 100 antenatal women, 27 women had previous one and 9 women had previous two first trimester pregnancy losses, 9 women had previous one and 3 had previous two second trimester pregnancy losses, and 9 women had previous one third trimester pregnancy loss. there was no statistically significant elevation of homocysteine levels in those with history of prior first trimester pregnancy losses (p = 0.1687). there was statistically significant elevation of homocysteine levels in those women with history of prior second trimester pregnancy losses (p = 0.0307). there was highly significant elevation of homocysteine levels in those women with history of prior third trimester pregnancy losses (p < 0.0001). comparing women with no history of prior pregnancy losses in any trimester and those with pregnancy losses in any trimester, there was highly significant elevation of homocysteine levels in the latter group (table 2). there was no significant correlation between prior birth weights and the serum homocysteine levels (table 2). the present pregnancy outcome of the 90 women who completed follow - up (10 women were lost to follow up) was then analysed. of the 90 women, 18 developed hypertensive disorders of pregnancy (hdp) and 7 developed gestational diabetes mellitus (gdm); 2 patients had a fetus with a congenital malformation and 8 patients had a pregnancy loss (including 2 stillbirths). of the 84 antenatal women whose delivery outcomes were analysed: 18 women had oligohydramnios, 17 women had meconium stained amniotic fluid, and 11 women delivered low birth weight babies (birth weight < 2500 gm). the homocysteine levels were statistically elevated in those who went on to develop hdp than those who did not develop hdp (p = 0.0011). there was no significant difference (p = 0.6312) in homocysteine levels between those who developed and those who did not develop gdm. the power of the study to detect a difference in gdm was 0.42 (table 3). there was significant elevation in homocysteine levels (p = 0.0002) among those who suffered a pregnancy loss when compared to those who had a live birth in the current pregnancy. there was no statistically significant difference in homocysteine levels (p = 0.6621) between those who had a fetus with a congenital malformation and those who had a morphologically normal fetus. there was statistically significant increase in homocysteine levels in women with oligohydramnios on comparing with women with normal amniotic fluid levels (p < 0.001), and women with meconium stained amniotic fluid had higher homocysteine levels than those with clear amniotic fluid (p = 0.0037). the serum homocysteine levels were significantly elevated (p = 0.0224) for those women who gave birth to low birth weight babies than those whose babies weighed above 2500 grams at birth (table 4). serum homocysteine is not significantly correlated with the age of the subjects, which is in agreement with another indian study by das et al.. serum homocysteine levels are not significantly associated with body mass index, in concordance with a study by han et al.. there was no significant variation with the mean period of gestation at which the samples were taken with the serum homocysteine concentrations. this may be due to the factor that the time window in which the samples were taken itself was short, and the study by murphy et al. and dodds et al. on the homocysteine levels longitudinally through pregnancy suggests that the homocysteine levels may be more stabilised from 8 weeks of gestation onward up to the middle of second trimester; there is a reduction in homocysteine levels prior to 8 weeks and a rise in homocysteine levels in the third trimester. there was no significant correlation between homocysteine levels and the number of folic acid tablets taken in correlation with the prior studies. the difference in homocysteine levels in those with prior first trimester losses did not reach statistical significance in this study. however, when all prior pregnancy losses were taken together, the difference in homocysteine levels was statistically significant; the same statistical significance held true with those who had prior second or third trimester losses. this can be compared to other studies, which have also showed that prior early pregnancy losses and stillbirths are reflected in higher homocysteine levels. those with prior hypertensive disorders of pregnancy also had increase in homocysteine levels, in concordance with other studies. prior preterm birth was not significantly associated with homocysteine levels, in contrast to a study by kramer et al. which saw an association of preterm birth with higher homocysteine levels, but the proposed mechanism of decidual vasculopathy of the placenta due to higher homocysteine level could not be proven by that study. the serum homocysteine levels was not different between those who had a previous fetal malformation in contrast with the hordaland homocysteine study which showed an increased incidence of malformations, particularly neural tube defects, in those mothers with elevated homocysteine levels. there was a declining trend of prior birth weights with higher homocysteine levels confirmed by other studies. with reference to the index pregnancy, the serum homocysteine levels were significantly different between those who went on to develop hypertension during their pregnancy, and those who remained normotensive, in conformance with prior studies. post priori power calculation has shown that the power to detect a difference in hypertensive disorder of pregnancy was 0.95 which indicates that the present study was adequately powered to show that elevated homocysteine is associated with development of hypertensive disorders of pregnancy. the serum homocysteine levels were not significantly different between those who developed gestational diabetes mellitus and those who maintained normal glucose tolerance, similar to a study by idzior - walu et al. however, it is in contrast to a study by tarim et al. who found a significantly elevated homocysteine level in antenatal women with gestational diabetes mellitus. nevertheless, much can not be drawn from the present study as the post priori power calculated was 0.42 only. the serum homocysteine levels were not different between those who had fetuses with congenital malformations and normal fetuses, in conformance with the study of wang et al. this is in concordance with several other studies which also showed an increase in the rate of spontaneous abortions and stillbirths in pregnancies with elevated homocysteine levels. the difference in homocysteine levels between those with oligohydramnios and normal amniotic fluid level status and those with clear and meconium stained amniotic fluid has been shown to be statistically significant in this study. however, there is a lack of previous studies to show this association. however, this can be taken as an extrapolation of the higher incidence of preeclampsia , fetal growth restriction, and impairment of placental transport that has been documented in previous studies. this can also be taken as an extrapolation of the increased incidence of hypertensive disorders of pregnancy and its associated placental insufficiency. the difference in serum homocysteine levels between those with low birth weight babies and those whose birth weight was above 2500 grams was statistically significant. this is in conformance with most studies but one study contradicted stating that there was no statistical difference. the a priori power calculation in the study was based on prior study on serum homocysteine levels in hypertensive disorders of pregnancy. due to paucity of data on serum homocysteine levels in gestational diabetes the post priori power calculation was 0.42 which indicates that this study may not have had the power to detect a difference in homocysteine levels in gestational diabetes. the number of cases was small and definite can not be derived from this study. however, this study is the first of its kind in this ethnic population in a developing country. further studies will be needed to strengthen these . though the number of folic acid tablets taken prior to the sample collection for homocysteine is quantified (by memory recall of the patients) , the number of folic acid tablets taken by the patients after the sample collection during the rest of the pregnancy may be a confounding factor, especially due to the fact that though folic acid is routinely recommended during first trimester, the focus shifts to iron during the second and third trimester, notwithstanding the fact that many iron preparations contain folic acid in addition to iron. this is a limitation of this study since homocysteine values vary with folate and b12 levels. serum homocysteine levels in late first trimester (8 to 12 weeks) of pregnancy are significantly associated with prior pregnancy losses, particularly in the second and third trimesters and with prior hypertensive disorders of pregnancy. with reference to the current pregnancy, increased serum homocysteine levels are also significantly associated with hypertensive disorders of pregnancy, pregnancy loss, oligohydramnios, meconium stained amniotic fluid, and low birth weight. however, raised homocysteine levels are not significantly associated with body mass index or with gestational diabetes mellitus and fetal malformations, neither in the past pregnancies nor in the current pregnancy.

aim. to revisit the role of first trimester homocysteine levels with the maternal and fetal outcome. methods. this was a cohort study comprising 100 antenatal women between 8 and 12 weeks of gestation. serum homocysteine levels were checked after overnight fasting. . there were significantly elevated homocysteine levels among women with prior history of hypertensive disorders of pregnancy and prior second or third trimester pregnancy losses. there was no significant difference in homocysteine levels among women with previous gestational diabetes mellitus, preterm deliveries, or fetal malformations. homocysteine levels were significantly elevated in those who developed hypertensive disorder of pregnancy, oligohydramnios, and meconium stained amniotic fluid, had a pregnancy loss, or delivered a low birth weight baby. there was no significant difference in homocysteine levels for those who developed gestational diabetes mellitus. . increased first trimester serum homocysteine is associated with history of pregnancy losses, hypertensive disorders of pregnancy, and preterm birth. this is also associated with hypertensive disorders of pregnancy, pregnancy loss, oligohydramnios, meconium stained amniotic fluid, and low birth weight in the current pregnancy. this trial is registered with clinicaltrials.gov ctri/2013/02/003441.

most sudden onset sensorineural hearing loss occurs unilaterally, with an the incidence of bilateral involvement of less than 5%.1 ) various causes, such as infection, vascular event, coagulation disorders, neoplasm, and demyelinating disease, are related to sudden sensorineural hearing loss, however in most cases the causes are idiopathic.2 ) although rarely reported, deafness can also be attributed to vertebrobasilar ischemia.3 ) the internal auditory artery (iaa) provides the main blood supply to the cochlear nerve and cochlea. the iaa is usually a branch of the anterior inferior cerebellar arteries (aica), however it could originate from the posterior inferior cerebellar arteries (pica) or directly from the basilar artery. due to its absolute absence of collateral blood supply and very high - energy metabolism, the inner ear is particularly vulnerable to vertebrobasilar ischemia.4 ) although most sudden hearing loss due to vertebrobasilar ischemia is associated with other combined neurologic signs or symptoms, vertebrobasilar ischemia can also develop as isolated sudden sensorineural hearing loss. we report on an uncommon case of sudden bilateral sensorineural hearing loss, related to vertebrobasilar occlusion without other neurologic deficit. a 64-year - old patient was admitted to the emergency room with the complaint of sudden bilateral hearing loss. two days earlier, the patient had suddenly developed vertigo and vomiting, and sequentially noticed bilateral hearing loss the following day. the patient had non - insulin dependent diabetes mellitus, hypertension, and a history of heavy smoking, but had no previous history of hearing impairment, head trauma, meningitis, autoimmune diseases, or ototoxic drugs. on neurological examination, no abnormal findings in the external auditory canal and eardrum were observed during examination using an otoscope. blood tests, including complete blood count, serum electrolyte, liver function test, urea nitrogen, creatinine, and high - sensitivity c - reactive protein (hscrp) showed normal . pure tone audiogram showed severe sensorineural hearing loss of 73 decibels (db) on the left side and 86 db on the right side (fig . brain magnetic resonance image diffusion weighted imaging ( mri dwi) and mr angiography (mra) (fig . 2) showed a multifocal cerebellar infarction in the bilateral pica territory and bilateral vertebral and basilar artery occlusion, respectively. occlusion of the right proximal vertebral artery and basilar artery, and severe stenosis of the left distal vertebral artery were observed on transfemoral cerebral angiography (fig . we concluded that the bilateral iaa might be compromised with basilar artery occlusion, ing in bilateral sensorineural hearing loss . sometimes, the iaa is also a branch of pica or basilar artery, whose occlusion would directly cause hypoperfusion of the iaa . the patient was treated with anticoagulation, heparin and warfarin for three months, and was then changed to aspirin . two weeks later, a follow up pure tone audiogram recorded improvement on both sides, to 58 db on the left and 71 db on the right ( fig . rapid notice of such an event and initiation of proper management are critical to prevention of grave . although various neurological deficits, such as dysarthria, numbness, weakness, and ataxia, occur mainly in vertebrobasilar ischemia, isolated bilateral sensorineural hearing is possible, but rare.5) previous studies have reported incidence of vertebrobasilar occlusion in sudden sensorineural hearing loss as approximately 1.2% and only 1.4% of patients with vertebrobasilar occlusive disease had bilateral hearing loss.6 - 7 ) in this case, the cause of isolated bilateral sensorineural hearing impairment might be iaa territory ischemia. tranfemoral cerebral angiography also showed occlusion of the right proximal vertebral artery and basilar artery and severe stenosis of the left distal vertebral artery. in the current report, the mechanism of sudden bilateral hearing loss is that an atheromatous plaque within the basilar artery extended into the aica orifice and a profound degree of hypoperfusion in both aicas may have caused selective injury of the inner ear. another possible mechanism is that isolated bilateral sensorineural hearing impairment could be a symptom of basilar artery or pica occlusion. although the auditory system including inner ear and auditory nerve is usually supplied by the iaa, a branch of aica, the iaa can arise from the pica or directly from the basilar artery.3 ) the inner ear is vulnerable to ischemia for the following reasons. first, the inner ear is supplied from an end artery, while other auditory system, such as the auditory nerves in the internal auditory, have several anastomosing vessels. in addition, the cochlea requires higher energy for work than the vestibular structure.6 ) verebrobasilar ischemia could have a poor prognosis with severe truncal ataxia or evolve into locked - in syndrome or coma; some patients have eventually died.8 - 9 ) there was no recommended treatment with anticoagulation in total stenosis of intracranial arteries, however, we began anticoagulation therapy for prevention of ongoing cerebral infarction and the patient had resolved by 2 weeks.10 ) as mentioned earlier, despite its rareness, occlusion or stenosis of the vertebrobasilar artery, aica, and pica could lead to bilateral sensorineural hearing loss. when attempting to determine the etiology of isolated bilateral deafness, it should be kept in mind that clinicians should consider the possibility of vertebrobasilar occlusive disorder especially in patients with risk factors for stroke and presenting with other neurologic signs.

isolated bilateral deafness is a rare but possible symptom of vertebrobasilar ischemia, primarily due to occlusion of the anterior inferior cerebellar arteries or their branch, the internal auditory artery. we reported on uncommon case of sudden bilateral sensorineural hearing loss without typical neurological symptoms ing from vertebrobasilar ischemia. we performed the available examinations, including otoscopy, laboratory tests, and pure tone audiogram, however we were not able to identify the cause of bilateral sensorineural hearing loss. brain magnetic resonance image showed the cerebellar infarction of the posterior inferior cerebellar artery territory. brain magnetic resonance angiography showed bilateral vertebral and basilar artery occlusion. we suggest vertebrobasilar ischemia as a cause of sudden isolated deafness.

micronutrients are known to play an important role in health and the development of an effective immune system. in tropical and subtropical regions schistosomiasis is a global health burden with over 200 million people infected by one of five schistosoma trematode species. schistosoma haematobium is the causative agent of urogenital schistosomiasis and is widely distributed in africa. simultaneously, according to the global progress report on vitamin and mineral deficiency, more than half of africa's population lack critical vitamins and minerals. deficiencies in iron and vitamin a each rank among the top 10 leading causes of death in developing countries through disease. a recent study in nigeria showed that infection with s. haematobium affected growth and nutritional status of children. it is clear that micronutrient supplementation though programmes such as expanded programme of immunisation (epi) and child health days can help reduce under 5 mortality, which is the stated aim of millennium development goal 5. with growing calls for integrated approaches to improving human health, it is important to characterise the interaction between micronutrient deficiencies and the immune response to schistosomiasis so that public health programs can plan their interventions accordingly. helminth infection including infection by schistosomes, modulates the host immune response, manifesting as diminished allergic responses, amelioration of autoimmune disease, and chronic parasitic infection. immunomodulation is mediated by regulatory t cells (treg) through direct contact stimulation and il-10 production. while the switch to th2 which occurs during helminth infection is an effective antiparasitic response, it is unclear whether superimposition of regulatory responses primarily benefits the worms or the host. downregulation of the inflammatory response would reduce host mediated immunopathology but also reduce protection. these effects are seen as a diminished allergic response, amelioration of autoimmune disease and chronic parasitic infection. traditionally vitamin a has been known for its role in vision, with deficiency ing in xerophthalmia, which is the leading cause of preventable childhood blindness. however, it has a wide range of physiological functions and is essential for haematopoiesis and prevention of anaemia, as well as immune function. it is acquired from foods such as liver, milk, cheese, eggs, green leaves, carrots and ripe mangos. vitamin a has now been implicated in the development of th2, th17 and treg responses through the activation of retinoid receptors. retinoic acid activates the foxp3 transcription factor, which stimulates the development of nave t cells into treg. hypovitaminosis a is an immunodeficient state linked to decreased antibody production, typically diminished th2 antibodies ige, igg1, and iga. it is produced in the skin when 7-dehydrocholesterol reacts with uvb radiation to form vitamin d3, which modified in the liver to form 25(oh) vitamin d3, and converted to its active metabolite 1,25(oh)2 vitamin d3 in the kidney. they are then metabolised by the liver in the same manner as cutaneously derived vitamin d3. a role has been suggested for vitamin d in diseases with an immunological aetiology such as psoriasis, multiple sclerosis and diabetes mellitus. it suppresses the th1 cytokines ifn- and il-2, and upregulates il-4 to create a th2 polarisation. vitamin d can stimulate treg through production of tgf-1 and cd25 expression by cd4 t cells. it also diminishes expression of dendritic cell (dc) costimulatory markers cd40, cd80, and cd86, again linked to treg induction. anaemia affects 1.62 billion people worldwide, and around 500 million of those people have iron deficiency anaemia. a causal relationship between infection with s. japonicum and iron deficiency anaemia has been established. it is linked to increased infectious mortality and morbidity, and can itself be caused by chronic infection. its relationship with infection is complex as both pathogen and host use body iron stores. it has been shown that iron supplementation during active infection can increase the infectious load of some pathogens. experimental studies on mice have found that those with high iron indices had a significantly increased fibrosis around egg granulomata. iron deficiency is associated with igg1, ige, and treg responses whereas iron supplementation has been linked to th1 responses and decreased il-10. the soluble transferrin receptor (stfr) is a diagnostic tool for differentiating between iron deficiency anemia (ida) and anemia of chronic disease since ferritin levels reflect amounts of stored iron while the stfr reflects the functional iron compartment. a few studies have shown a recent review of data collected in zimbabwe between 1980 and 2006 showed that a significant proportion of preschool children, school children, and adult women (lactating or pregnant) experienced malnutrition with significant proportions of these groups suffering from vitamin a and iron deficiencies. the aim of this study was to determine the relationship between the micronutrients vitamin a, d, and iron as well as a measure of inflammatory responses c - reactive protein (crp) and schistosome - specific cytokine levels in zimbabweans exposed to s. haematobium infection. the study received ethical and institutional approval from the medical research council of zimbabwe and the university of zimbabwe, respectively. permission to conduct the work in this province was obtained from the provincial medical director. informed consent / assent was obtained from all participants or their parents / guardians prior to enrolment into the study. project aims and procedures were explained to the community, school children, and their teachers prior the study, and survey was conducted amongst all compliant participants. after sample collection, all participants were offered treatment with the standard dose of 40 mg / kg body weight of the antihelminthic drug praziquantel. the study was conducted in two rural villages in the mashonaland east province of zimbabwe (3130e ; 1745s) where s. haematobium is endemic. participants were part of a larger immunoepidemiology study which was carried out between 2002 and 2005, and the study area is described in detail elsewhere. drinking water is collected from open wells while bathing and washing is conducted in two main rivers in the villages. most families maintain a garden located near the river where water is collected for watering the crops and the schools surveyed were all in close proximity to rivers. all samples used in this study were obtained at baseline in 2002 were selected using following criteria: participants should be life - long residents in this area (assessed by questionnaire), should not have received antihelminthic treatment prior this study, should have provided at least two urine and 2 stool samples on consecutive days to allow parasitological diagnosis, should have been test negative for soil transmitted helminth and s. mansoni as well as negative for hiv and plasmodium falciparum, should have provided a blood sample to obtain sera. furthermore, only sera samples were used for these analyses, which have not been used previously and therefore were defrosted for the first time. following these criteria samples from 40 people aged 754 years (13 male, 27 female) data were subsequently separated into 3 age groups: 710 years (n = 6), 1120 years (n = 23), 21 + years (n = 11), which represent a typical age - infection profile for s. haematobium as shown in figure 1(a). parasitology samples (at least 2 urine and 2 stool samples collected on 3 three consecutive days) and 20 ml of venous blood were collected from each participant. stool samples were processed following the kato - katz procedure to detect s. mansoni eggs and other intestinal helminths, while the urine filtration method was used to detect s. haematobium eggs in urine samples. serum samples obtained from 20 ml of venous blood from each participant were frozen and stored in duplicate at 20c in the field and transferred to a 80c freezer in the laboratory. one complete set of the samples was subsequently transported frozen from zimbabwe to the uk, stored at 80c and defrosted for the first time for use in this study. small aliquots of blood were used to prepare thick and thin smears for the microscopic detection of plasmodium parasites. the parasite - specific cytokines ifn-, (marker for th1 responses) il-4, il-5 (markers of th2 responses), and il-10 (marker for regulatory responses) were measured by enzyme linked immunosorbent assays (elisa) in supernatants obtained after stimulation of whole blood samples using cercarial, egg, and adult schistosome antigens following published methods. spontaneous cytokine production was determined in unstimulated controls containing media alone while the mitogen concanavalin a (cona) was used as a positive control for the restimulations. values of cytokines obtained from the media alone incubations were subtracted from those of the antigen - specific restimulations to remove the effects of cytokine production in the statistical analyses. micronutrients and c reactive protein (crp) were measured using enzyme linked immunosorbent assay (elisa) kits according to manufacturers' instructions. serum transferrin receptor (stfr) is a marker of iron deficiency and is required for lymphocyte activation and proliferation. ferritin is a marker of iron status, but rises with inflammation and this was measured by an elisa kit from bioquant (cat . crp is an inflammatory marker and was measured by an elisa kit from anogen ( cat . retinol binding protein a measure of vitamin a status was assayed using an elisa kit from phoenix pharmaceuticals ( cat . # ek-028 - 28), and 25(oh) vitamin d was used to assess the inactive vitamin d status although through a kit from immunodiagnostik (cat . vitamin d status was described using previously published ranges ( replete 50.00 nmol / l, mild deficiency 25.0049.99 nmol / l, moderate deficiency 12.5024.99 nmol / l, severe deficiency 12.49 nmol / l). the world health organisation reference range for ferritin was used (female normal range 15.0150.0 g r&d systems provided a 2.597.5 percentile range ( 8.728.1 nmol / l) for stfr from a survey of 225 ethnically diverse participants of both sexes. their mean value for afro - carribeans was significantly higher than for other ethnic groups. there is no published reference range for rbp, although the world health organisation has produced retinol reference ranges for use in public health. the ratio of stfr / log ferritin (stfr - f index) has been suggested as an alternative estimate of body iron, so this was also calculated in this study and used in the statistical analyses. for the statistical analyses, host infection intensity was recorded into infection status, that is, infected and uninfected, cytokine absorbencies were square root transformed, and levels of all micronutrients were log transformed to satisfy the assumptions of parametric tests. in order to determine if the relationship between micronutrients and immune responses differed between schistosome infected versus uninfected people, a multivariate analysis of variance (manova) was conducted. the dependent variables were the transformed micronutrient data and the independent variables were cytokine levels, infection status (infected / uninfected) age (categorical ( 710 years, 1120 years, 21 + years) ), sex (categorical male / female). the effects of interactions between infection status and micronutrients were also included in the manova model. sequential sums of squares were used to calculate the test statistics so that the potentially confounding effects of all other variables could be allowed for testing for the effects of infection status which was entered last in the single effects list. schistosome infection prevalence in the study population was 60% (95% ci : 4375%) and the mean infection intensity was 39.3 eggs/10 ml urine (sem = 13.5) with a range of 0362 eggs/10 ml urine. infection intensity followed the typical schistosome age - infection pattern, rising with age to a peak in childhood and declining thereafter (figure 1(a) ). the study population had a mean rbp of 0.23 ng / ml with a range of 00.63 ng / ml. 25(oh) vitamin d titres in this population were low when compared to published values with 32.8% (n = 12) of the population being classified as vitamin d replete (50.00 nmol / l); 17.9% (n = 7) were mildly deficient (2549.90 nmol / l), 10.3% (n = 4) were moderately deficient (12.5024.90 nmol / l), and 38.5% (n = 15) were severely deficient (12.49 levels of crp were within the normal range while 28.6% ( n = 10) of the participants had elevated stfr based on the 95 percentile data provided with the assay as detailed in the methods section. the statistical analyses showed that sex affected only levels of ferritin, which was significantly lower in females and did not have a significant effect on levels of any of the other micronutrients (table 1). age significantly affected levels of rbp, with rbp levels falling with age (r = 0.315, p = 0.033) as shown in figure 1, but did not affect levels of any of the other micronutrients of crp. although figure 1(b) shows differences in the age profile of crp levels, the statistical analyses show that after allowing for other variables such as sex and for example, age, there are no significant differences in crp levels between the 2 age groups. overall, there was a significant positive association between rbp and levels of parasite - specific il-10 (p = 0.049, = 0.314) as well as between ferritin and parasite - specific il-4 (p = 0.035, = 0.317). in some cases, the relationship between the cytokine levels and micronutrients varied with schistosome infection status as shown in table 1. thus, levels of vitamin d showed a significant negative correlation with il-4 in egg positive children but no association in egg negative children (figure 2(a) ). levels of parasite - specific ifn- showed a significant positive correlation with stfr in egg negative people but a negative but nonsignificant association in egg positive people (figure 2(b) ). in egg positive people levels of parasite - specific il-5 went down with ferritin levels but went up in egg positive people although this later association was not significant (figure 2(c) ). when considering the ratio of stfr, levels of both ifn- and il-4 went down with the stfr - f index in egg positive people and up in egg negative people as shown in figures 2(d) and 2(e). this study describes the micronutrient status of a rural black zimbabwean population and then characterises the relationships between micronutrients and immune responses to schistosomiasis. while this study showed that there was vitamin d deficiency in the population, levels of all other micronutrients and markers of inflammation were within normal ranges. the global micronutrient report in 2001 has classified zimbabwe as having a vitamin a deficiency prevalence of 1015%. the study population had easy access to good dietary sources of micronutrients, including fortified foods (margarine and some vegetable oils during the study period were fortified with vita) as well as from home - grown vegetables. iron supplementation for pregnant women at ante - natal clinics and targeted vitamin a supplementation were not commenced in zimbabwe until 2 years after this current study was conducted. in this study serum retinol levels declined with age which is contradictory to reports from primary aged school children in zimbabwe and kenya which show retinol levels increasing with age. work on rbp levels in exercise programs in south korean women revealed a larger decrease in older women than younger women after a structured exercise regime. this is consistent with our finding that rbp decreased with age, since our study captures a wider age range than the 2 previous studies in primary school children. however, the major occupation amongst our population is subsistence farming and so they are likely to be more physically active, therefore it is not clear whether our observations represent a normal decline in rbp with age, or whether there is an interaction between physical activity, age, and rbp level. found no association between s. haematobium infections with serum retinol levels in zimbabwe, similar to observations in this current study. interestingly, friis et al. found, a strong negative association between s. mansoni infection and serum retinol levels in both zimbabwe and kenya, which suggests that the intestinal niche of s. mansoni infection may interfere with vitamin a absorption. however, experimental studies show that vitamin a deficiency leads to reduced schistosome - specific antibody responses, which may suggest that vitamin a deficiecy leads to susceptibility to s. mansoni infections. however, all participants of our study were negative for s. mansoni and therefore it was excluded as confounding factor. it has also been shown that all trans retinoic acid (atra) binds retinoic acid receptors, which induce foxp3 expression polarizing immune responses towards a regulatory phenotype. our finding that rbp is correlated with il-10 suggests that vitamin a may be important in augmenting schistosome - specific regulatory responses. vitamin d produced the most surprising data, with 38.5% of subjects being severely deficient. there is a paucity of vitamin d surveys in africa compared to those conducted in western countries. since no clinical examination were conducted in this study, it is impossible to say whether the deficiencies observed in this study are associated with pathology or remained asymptomatic. production of pre - vitamin d3 occurs in the skin under the influence of ultraviolet light. most studies of vitamin d levels have been in caucasian populations with reference to osteoporosis. it is possible that our findings may be explained by ethnic differences in skin pigmentation and skin uv penetration. given that the reference ranges come from studies on osteoporosis, they may not be applicable in zimbabwean population. nonetheless, they remain an important starting point for analysis and suggest that further work is required to examine the biological relevance of these categories to immunology. in this study, vitamin d levels in egg negative children showed a significant positive association with il-4 levels, consistent with the role of vitamin d in upregulating il-4 to polarize responses towards a th2 phenotype. iron deficiency is one of the most prevalent micronutrient deficiencies in the world affecting at least half of all pregnant women and young children in developing countries. in a survey conducted by the ministry of health and child welfare in 1997, 9% of the surveyed population (pregnant women, lactating women, preschool children, and adult males) had depleted iron stores that is, ferritin. at the time of the study, pregnant and postpartum women were not offered iron supplementation by local healthcare providers, thus pregnancy and childbirth - related iron and blood loss may explain why male participants have significantly higher levels of ferritin. in this study, while ferritin levels were within normal ranges, stfr levels were elevated in 28.6% of the population. ferritin is an indicator of stored iron reserves in the body while stfr indicates the functional iron component of the body and becomes elevated soon after the onset of iron deficiency. ferritin is often decreased in iron deficiency anaemia, but can be raised in inflammatory conditions. however, we observed normal crp levels, which excluded excess inflammation in the participants. similarly the lack of association between schistosome infection intensity / status and levels of stfr implies that schistosome infection does not explain the elevated levels of stfr. in this population the measures of body iron (stfr - f index) showed a negative association with ifn- and il-4 in egg positive people, while il-5 levels showed a positive association with ferritin in the same people. iron supplementation has been shown to increase dendritic cell stimulation and promote th1 responses, but also an increased burden of immunopathology in those already infected. however, increased ifn- is seen in iron deficiency, where it has a role in preserving iron stores. thus in this population the inverse association between measures of body iron and the cytokines ifn- and il-4 may be adaptive to preserving iron stores during schistosome infection. the study showed that while levels of vitamin a and iron where within normal ranges, there was a deficiency of vitamin d in 67.2% of the study population as well as elevated levels of stfr in 28.6% of the participants. thus, the 2 indicators of iron levels suggested that although levels of stored iron were within normal levels (normal ferritin levels), levels of functional iron (measure by stfr) may have been reduced in some participants. schistosome infection intensity or status was not associated with levels of any of the micronutrients, but altered the relationship between parasite - specific il-4 and il-5 and the measures of iron levels (ferritin and stfr). cohort studies following a larger group of people through a cycle of antihelminthic treatment will clarify the effects of helminth infection on micronutrient levels and their subsequent effect on immune responses.

micronutrients play an important role in the development of effective immune responses. this study characterised a populations exposed to schistosome infections in terms of the relationship between micronutrients and immune responses. levels of retinol binding protein (rbp ; vitamin a marker), vitamin d, ferritin and soluble transferrin receptor (stfr), and c reactive protein (crp) were related to levels of schistosome specific cytokines (ifn-, il-4/5/10) in 40 zimbabweans (754 years) exposed to schistosoma haematobium infection. 67.2% of the participants were deficient in vitamin d. rbp levels were within normal ranges but declined with age. the two indicators of iron levels suggested that although levels of stored iron were within normal levels (normal ferritin levels), levels of functional iron (stfr levels) were reduced in 28.6% of the population. schistosome infection alone was not associated with levels of any of the micronutrients, but altered the relationship between parasite - specific il-4 and il-5 and levels of ferritin and stfr.

posterior reversible encephalopathy syndrome (pres) refers to a clinico - radiological entity characterized by headache, confusion, visual disturbances, seizures, and posterior transient changes on neuroimaging. we report a child with pres revealing post - streptococcal acute glomerulonephritis (psgn). a 9-year - old girl presented to the er with history of low - grade fever for 7 days, sudden onset headache for 2 days, altered sensorium and three episodes of tonic clonic seizures since the previous day and loss of vision over the past 12 h. on examination, she was afebrile, irritable with altered sensorium, and mild puffiness of face. her blood pressure (bp) was 136/100 mm hg (> 95 percentile for her age). she had no other focal neurological deficits and had no signs of any meningeal irritation. she was started on anti - hypertensive (sublingual nifedepine), fluid and salt restriction, anti - edema measures, anticonvulsants, and other supportive care. investigations revealed hemoglobin 10.6 gm / dl, total count 18 500 cells / mm (polymorphs 87%, lymphocytes 10%), platelets 404 000 cells / mm; esr 9 mm; c - reactive protein < 0.6 mg / dl; raised blood urea nitrogen 40 mg / dl; and creatinine 0.65 mg / dl. her serum electrolytes and liver function tests were normal. the urine collected after admission was cola - colored and urinalysis revealed plenty of rbcs with albuminuria 2 +. computed tomography (ct) of brain revealed symmetric occipital hypodense lesions with cerebral edema. anti - streptolysin - o titer was positive (571 iu / ml) and complement c3 level was low (40 mg / dl). computed tomography of brain at admission showing areas of hypodensity in the bilateral occipital lobes white matter with mild edema her bp gradually returned to normal range, and she slowly regained vision and sensorium within 10 h of hospitalization. imaging appearances and complete restoration of visual function following normalization of bp, a diagnosis of pres with psgn was made. follow - up ct scan 2 weeks after the first study showed complete resolution of the previous abnormal lesions on a 1-year periodic follow - up in our unit, the child had no further recurrence of symptoms. follow - up ct scan of brain 2 weeks after the first study revealed complete resolution of the white matter abnormality in the occipital lobes posterior reversible encephalopathy syndrome, also known as reversible posterior leukoencephalopathy syndrome (rpls) was initially described by hinchey et al. in 1996. it is a clinico - radiological entity characterized by neurological signs (headache, seizures, vomiting, altered mental status, visual disturbances especially cortical blindness, focal neurological deficits) and radiological abnormalities of occipital white matter, usually bilateral, characterized by cerebral edema with hypodense signals on ct scan; and hyperintense signals on t2 weighted images by mri. the most common presenting symptoms were headache, seizure, altered consciousness, and cortical blindness. hypertensive encephalopathy, pre - eclampsia, eclampsia, systemic lupus erythematosus, wegener granulomatosis, minimal change nephrotic syndrome, chronic renal failure, post - transplantation, hemolytic uremic syndrome, acute intermittent porphyria, thrombotic thrombocytopenic purpura, vasculitis, malignancies, hypercalcemia, oxybutynin, intravenous immunoglobulins, organ transplantation, certain immunosuppressive, and cytotoxic drugs are among the known conditions associated with pres. two possible mechanisms proposed in the pathophysiology of pres are: (i) vasospasm due to acutely increased bp and (ii) loss of autoregulation. in the first hypothesis, it has been suggested that vasospasm contributes to ischemia and cytotoxic edema at regions of the arterial border zone. the second, more recent hypothesis is supported by diffusion images suggesting that dilation develops in cerebral arterioles due to autoregulatory failure. the objective of cerebral autoregulation is to keep blood flow constant, and to protect the brain during changes in bp; however, sudden and severe increases in bp can impair autoregulation, and lead to arteriolar vasodilatation and endothelial dysfunction (breakdown of blood brain barrier) leading to extravasations of plasma and red blood cells causing vasogenic edema. the lesions of pres have a predilection for the parieto - occipital region, because the posterior cerebral arterial circulation supplied by the vertibro - basilar system has a lower level of sympathetic innervation and, therefore, is frequently involved. the role of neuro - imaging is to establish the initial diagnosis and to exclude other causes of neurological symptoms and signs. in pres, noncontrast ct (ncct) is sufficient to make the diagnosis in a proper clinical setting, revealing areas of low attenuation in posterior white matter. on mri brain, bilateral symmetrical edema in the parieto - occipital region is hyperintense on t2-weighted and fluid - attenuated inversion recovery (flair) sequences, and hypointense on t1-weighted sequences. diffusion - weighted imaging (dwi) can differentiate this condition from other major diseases such as infarction that are diffusion restricted. pres occurs most commonly in the setting of known hypertension or use of immunosuppressive agents. though the association between psgn and pres has been reported earlier, pres revealing acute glomerulonephritis is extremely rare in children. in our case, the girl presented with neurological symptoms, was found to be hypertensive, later developed gross hematuria after admission, and subsequently diagnosed with acute glomerulonephritis. our case highlights the possibility that cortical blindness may develop as a complication of acute glomerulonephritis in children. prevention of the occurrence of neurological deficits in children with acute glomerulonephritis and hypertensive encephalopathy requires careful evaluation and appropriate management of hypertension. in , it is important to consider this diagnosis in children presenting with encephalopathy and seizures in an appropriate clinical settings. pres is a treatable and reversible cause of acute encephalopathy with blindness, as long as an early diagnosis and appropriate treatment is made. without prompt treatment , the syndrome may lead to permanent brain injury or neurological sequelae such as chronic epilepsy. we need to be aware of this unusual neurological complication, as early recognition may improve prognosis.

the association between hypertensive encephalopathy and cortical blindness in children with acute glomerulonephritis is extremely rare. we report the case of a 9-year old girl who presented with headache, seizures, altered sensorium, hematuria, and transient cortical blindness as a complication of hypertensive encephalopathy which showed complete reversal following normalization of blood pressure and an underlying post - infectious acute glomerulonephritis was revealed.

homeostasis is a fundamental concept in physiology; hence, it is a subject of the greatest interest for medicine. in the present review , some aspects of the concept and possible further developments that could have an impact also in the clinical practice are analysed. our proposal is based on the classical assumption of the interstitial fluid (isf) as the internal medium for multicellular organisms. against this , a central aspect is discussed; namely the concept of the hierarchic role of the isf of the various organs in triggering homeostatic responses, especially of those involving overriding controls. in particular, we propose that the brain isf has the highest hierarchic role in human beings, providing the optimal environment for brain cell survival and complex functions, hence allowing the central nervous system (cns) to carry out its complex whole - body integrative actions, i.e., to operate as the uppermost controller that allows a free and independent life of higher vertebrates. against this , the crucial role of the kidneys for internal medium homeostasis will be revised according to the proposal that homer smith put forward more than fifty years ago in an extraordinary book. as a matter of fact, homer smith pointed out, on the basis of evolutionary observations, that the functional interconnections between the brain and kidneys in the internal medium homeostasis are a basic requisite for a free and independent life of higher vertebrates. hence, it can be surmised that cns operates as the uppermost controller of the internal medium homeostasis not exclusively but especially thanks to its synergistic interactions with the kidney. the clinical evidence supports such a view as discussed below and reported in recent studies. in particular, in this review, the brain / kidney synergistic roles in h2o / na balance and brain temperature control is discussed. actually, data are presented supporting the view that these two parameters are interrelated and have deep effects on the cns higher integrative actions. furthermore, the concept of allostasis, hence of a set - range of optimal values for internal medium parameters is assumed. this view is further developed by considering the possible functional meaning of the rhythmic oscillations of the chemico - physical parameters inside their set - range that, according to our proposal, should be considered as a basic component of the homeostatic control. thus, the present proposal suggests that isf represents the real internal medium, since the maintenance of its homeostasis and in several instances the appropriate rhythms of some chemico - physical parameters within their appropriate set - range is the main factor for a free and independent life of higher vertebrates. in particular, the main focus of the present review is the suggestion that h2o / na balance and brain temperature play a crucial role in certain brain integrative actions. a special emphasis will be given to their rhythmic oscillations within their set - range that can have important modulatory actions on psychic homeostasis. as a matter of fact, psychic homeostasis (see section below entitled ' body and psychic homeostasis ' for a definition) refers to complex behavioural and bodily responses optimizing, inter alia, the interactions of a human subject with his socio - cultural environment (i.e., the so - called supra - systems). it should be underlined that psychic homeostasis can sometimes override bodily homeostasis regulatory mechanisms, i.e., the controls aimed to optimize human being interactions with his external physical environment. the need to characterize the complexity of the human being has led to a distinction between two elements: the soma and psyche. thus, it has been proposed that two highly complementary homeostatic control processes are in operation in human beings: i ) the somatic physiological homeostasis, which via the integrative actions of the different apparatuses is capable of maintaining important chemico - physical parameters of the internal milieu within optimal set - ranges, allowing a free and independent life to the organism; and ii ) the psychic homeostasis, which is aimed to an equilibrated mental condition via a proper resetting action of the different instances of the inner world and social environment that the subject has to harmonize. in agreement with such a view, freud proposed the principle of' psychic homeostasis' as a basic concept supporting his meta - psychology in his famous book' the interpretation of dreams'. to indicate the psychic homeostasis in its proper set - range (corresponding to a psychic state of subjective well - being) the term eudaimonia (also mentioned as eudaemonia), that consists of the words' eu' (' good ') and' daimn' (' spirit '), has been proposed. thus, it could be described as a condition of dynamic balance between different appeals within the psychic sphere of the subject also in front of challenges of the social and physical environment. these aspects were further expanded into the concept of' predictive psychic homeostasis' that designates the capability to create (via the integrated actions of various brain - body mechanisms) a psycho - physical state of readiness that anticipates potential threats. thus, predictive psychic homeostasis by avoiding possible future allostatic psycho - physical overloads is of a basic relevance for both eudaimonia and internal milieu homeostasis. the survival value of predictive psychic homeostasis is emphasised by the evidence that it can sometimes override bodily homeostasis regulatory mechanisms. it should be noted that both body homeostasis and psychic homeostasis are often jointly conditioned by the pattern of endocrine signaling. in particular, alterations of anterior pituitary hormones leading to somatic disturbances have been demonstrated in stress and mood disorders, including major depression. thus, hypothalamic - pituitary - adrenocortical hormones have deep effects on both body homeostasis and psychic homeostasis and it is interesting to point out that both are modulated by circadian secretion rhythms. in other words, human cns high integrative actions link together human basic physiology with the subject's supra - systems that play a basic role in psychic homeostasis. thus, for the human being psychic homeostasis and bodily homeostasis are two inseparable aspects of his health. such a view reminds aphorisms of ancient medicine and philosophy that have proposed the soul serenity (eudaimonia, i.e., the good spirit ; see also the discussion) as the primary aim of subject's well - being. obviously, eudaimonia is deeply dependent on gratifying interactions between the individual human being and his socio - cultural environment. the need to characterize the complexity of the human being has led to a distinction between two elements: the soma and psyche. thus, it has been proposed that two highly complementary homeostatic control processes are in operation in human beings: i ) the somatic physiological homeostasis, which via the integrative actions of the different apparatuses is capable of maintaining important chemico - physical parameters of the internal milieu within optimal set - ranges, allowing a free and independent life to the organism; and ii ) the psychic homeostasis, which is aimed to an equilibrated mental condition via a proper resetting action of the different instances of the inner world and social environment that the subject has to harmonize. in agreement with such a view , freud proposed the principle of' psychic homeostasis' as a basic concept supporting his meta - psychology in his famous book' the interpretation of dreams'. to indicate the psychic homeostasis in its proper set - range (corresponding to a psychic state of subjective well - being) the term eudaimonia (also mentioned as eudaemonia), that consists of the words' eu' (' good ') and' daimn' (' spirit '), has been proposed. thus, it could be described as a condition of dynamic balance between different appeals within the psychic sphere of the subject also in front of challenges of the social and physical environment. these aspects were further expanded into the concept of' predictive psychic homeostasis' that designates the capability to create (via the integrated actions of various brain - body mechanisms) a psycho - physical state of readiness that anticipates potential threats. thus, predictive psychic homeostasis by avoiding possible future allostatic psycho - physical overloads is of a basic relevance for both eudaimonia and internal milieu homeostasis. the survival value of predictive psychic homeostasis is emphasised by the evidence that it can sometimes override bodily homeostasis regulatory mechanisms. it should be noted that both body homeostasis and psychic homeostasis are often jointly conditioned by the pattern of endocrine signaling. in particular, alterations of anterior pituitary hormones leading to somatic disturbances have been demonstrated in stress and mood disorders, including major depression. thus, hypothalamic - pituitary - adrenocortical hormones have deep effects on both body homeostasis and psychic homeostasis and it is interesting to point out that both are modulated by circadian secretion rhythms. in other words, human cns high integrative actions link together human basic physiology with the subject's supra - systems that play a basic role in psychic homeostasis. thus, for the human being psychic homeostasis and bodily homeostasis are two inseparable aspects of his health. such a view reminds aphorisms of ancient medicine and philosophy that have proposed the soul serenity (eudaimonia, i.e., the good spirit ; see also the discussion) as the primary aim of subject's well - being. obviously, eudaimonia is deeply dependent on gratifying interactions between the individual human being and his socio - cultural environment. the french physiologist claude bernard introduced the concept of the internal environment of an organism, upon which walter cannon proposed the concept of homeostasis. a crucial aspect is obviously the definition of internal medium and the characterization of its distinctive features in physiological terms. initially bernard postulated that blood was the milieu interieur, or internal environment, exchanging substances and operating as an optimal environment for cells metabolism of higher animals. thus, he proposed the concept of the fixity or constancy of the internal environment as essential to the vital processes by stating:' the fixity of the milieu supposes a perfection of the organism such that the external variations are at each instant compensated for and equilibrated. the stability of the internal environment is the condition for the free and independent life'. later on the interstitial fluid, as the environment with which the cells of a multicellular organism exchange, was proposed and the concept of' homeostasis' was introduced by cannon. the new term was defined as follows:' the constant conditions which are maintained in the body might be termed equilibria. that word, however, has come to have fairly exact meaning as applied to relatively simple physico - chemical states, in closed systems, where known forces are balanced. the coordinated physiological processes which maintain most of the steady states in the organism are so complex and so peculiar to living beings - involving, as they may, the brain and nerves, the heart, lungs, kidneys and spleen, all working cooperatively - that i have suggested a special designation for these states, homeostasis. it means a condition - a condition which may vary, but which is relatively constant. homeostasis, at least in the narrow sense, is about preserving the status quo, regulation to achieve viability through resistance to change.' furthermore, cannon adapted the idea of homeostasis to the organism as a whole, hence referring to both physiological and psychological aspects of control mechanisms. as mentioned above, this broadening of the homeostasis concept to the psychic aspects is of peculiar relevance for the human being and it will be considered in the present review. let us discuss with some detail the concept of allostasis that was introduced in 1988 by sterling, as a further development of some aspects of the concept of homeostasis. in fact, allostasis points out that the living systems are endowed with the adaptability property, hence the control mechanisms operate for a continuous adjusting to change, not simply by restoring, but rather by altering equilibrium settings in order to face in an optimal fashion the new environmental inputs. thus, not a set - point for the controlled parameter but rather a set - range is maintained (fig . , allostasis describes the processes through which organisms actively maintain a dynamic steady state of conditions for basic parameters necessary not simply for their survival but rather for optimal interactions with the environment . it should be underlined that allostatic mechanisms can also adapt the organisms to probable future loads ( bayesian approach) and this is obviously especially true for organisms that are endowed with a complex cns. thus, the concept of allostasis was introduced to underline both physiological and psychological change and adaptation to diverse present and surmised future circumstances. obviously, the behavioural and physiological anticipatory responses to probable future events emphasize the crucial role of a complex cns, particularly for responses allowing the so - called predictive allostasis. we should also mention another far - sighted proposal of cannon, since he underlined that the internal environment with which the cells exchange is not simply a watery environment but rather a' fluid matrix' whose chemical and also physical characteristics, such as temperature and pressure, are of a basic importance. it should be noted that the fluid matrix forming the internal medium is the product of the organism itself and it can play a basic role in the intercellular communication processes. the evidence that the internal medium and in particular the ecm is produced by the organism according to its functional needs implies a broader view of homeostasis, since the self - construction of the internal medium is in some way related to concepts introduced in the 1970s by varela et al and discussed by others by stating:' a living system is a system capable of self - reproduction and self - maintenance through a regenerative network of processes which take place within a boundary of its own making and regenerates itself through cognitive or adaptive interactions with the medium'. thus, a living system can be characterized by two notions: i ) the first one is' autopoiesis', a term indicating the ability of the system to transform external matter / energy into an internal process of self - maintenance and production of its own components. autopoiesis, therefore, is concerned with internal structure and describes a system organized as a network of interactions capable of cyclically reproducing the components to allow the system's self - perpetuation; and ii ) the second one can be called' cognition' to indicate that the interaction with the environment is implemented on the basis of the internal logic of the living system. the environment, in other words, does not prescribe or determine changes to the organism, it is the structure of the living system and its previous history of perturbations that determine what reactions a new perturbation will induce. cognition, therefore, concerns the relationship of the system with the environment. it describes a system able to sense the external world in order to produce a response to perturbations either by self - correction of its disturbed organization (homeostasis), or by reorganizing itself into a different self - perpetuating network of interactions (adaptability). there are, of course, various levels of cognition (corresponding to different levels of life 's complexity) from very simple mechanisms of cell sentience up - to complex functions performed by nervous systems. this view captures the essence of cellular life by recognizing that life is a cyclic process that produces the components that in turn self - organize in the process itself, and all within a boundary of its own making. such a self - constructed machine continuously operates to maintain critical chemico - physical parameters within a suitable set - range in spite of perturbing influences. as pointed out by wiener in his classical book , the mechanisms allowing the processes of maintenance of the values of critical parameters within suitable set - ranges that allow survival of the living beings notwithstanding the external environment changes can be described according to cybernetic models. during the middle of the past century, norbert wiener pointed out that the concept of homeostasis was common to animals and to automatic systems. thus, he defined cybernetics as the entire field of the theory of communication and control in the living beings and in the automatic systems. during the 1940's and 1950's , cybernetics had a crucial influence on the birth of various modern sciences: control theory, computer science, information theory, automata theory, artificial intelligence and artificial neural networks, cognitive science, computer modelling and simulation science, dynamical systems, and artificial life. however, after these disciplines had become fully independent, cyberneticists felt the need to further develop their field to distinguish an approach emphasizing autonomy, self - organization, cognition from more mechanistic control strategies followed in control engineering and computer science. in the early 1970's, this effort became known as' second - order cybernetics' and provided a thoughtful revision of concepts of particular relevance for biology and physiology. in particular, the negative feedback (fb) is a type of control central to both homeostasis and cybernetics, since it can explain how a living being or an automatic system can operate for maintaining its steady state in spite of disrupting influences from the external environment (fig . 1). the fb control can be described as follows: let us suppose that a stress from the external environment acts upon a system of an organism and such a system is under a fb control. a sensor detects the stress signal and converts it into signals that are meaningful for the internal control mechanisms of the organism. a controller compares the signals to the desired set - points, and issues error signals if there are discrepancies. thus, each error signal refers to the difference between the optimal value of a variable (set - point) and the value returned by the homeostatic mechanism(s) during the persisting perturbation. the error is interpreted by an activator, which triggers the appropriate response of effectors to restore the value of the variable close to its set - point or, according a more realistic view, within a suitable set - range (fig . as pointed out above, in a living being, several regulatory mechanisms are continuously activated to produce the homeostatic responses ; hence, in analyzing the allostatic controls the following aspects should at least be considered : i) redundancy and inter - dependence, since several negative feedbacks are directly or indirectly involved in the control of the same functional parameter or of functional parameters strictly interdependent (e.g., blood volume and arterial blood pressure); ii ) push - pull controls (e.g., glucagon / insulin) allowing a precise control of the parameter; and iii ) russian doll organization of controls of increasing miniaturization. thus, it is possible to recognize fb control at the systems (set of apparatuses) level, at the level of organs, at the level of tissues, at the level of the cells, at the level of the molecular networks. the crucial role for overriding controls is played by the cns via its interactions with the peripheral apparatuses especially for parameters, such as arterial blood pressure, involved in facing challenging conditions (e.g., in fight or flight conditions). taken together , it can be stated that homeostasis implies the regulated activation of several dynamic and potentially predictive multilevel processes organized according to a russian doll pattern. furthermore, as proposed by' brain - body medicine', the cns plays a crucial role in homeostasis by interacting with practically all the peripheral organs. in this context, the brain / kidney interactions for the h2o / na and brain temperature control that are interrelated parameters of basic importance for cns integrative actions, will be discussed. as discussed below, such an assumption can also be surmised by deductions based on the evolutionary . during the middle of the past century, norbert wiener pointed out that the concept of homeostasis was common to animals and to automatic systems. thus, he defined cybernetics as the entire field of the theory of communication and control in the living beings and in the automatic systems. during the 1940's and 1950's , cybernetics had a crucial influence on the birth of various modern sciences: control theory, computer science, information theory, automata theory, artificial intelligence and artificial neural networks, cognitive science, computer modelling and simulation science, dynamical systems, and artificial life. however, after these disciplines had become fully independent, cyberneticists felt the need to further develop their field to distinguish an approach emphasizing autonomy, self - organization, cognition from more mechanistic control strategies followed in control engineering and computer science. in the early 1970's, this effort became known as' second - order cybernetics' and provided a thoughtful revision of concepts of particular relevance for biology and physiology. in particular, the negative feedback (fb) is a type of control central to both homeostasis and cybernetics, since it can explain how a living being or an automatic system can operate for maintaining its steady state in spite of disrupting influences from the external environment (fig . 1). the fb control can be described as follows: let us suppose that a stress from the external environment acts upon a system of an organism and such a system is under a fb control. a sensor detects the stress signal and converts it into signals that are meaningful for the internal control mechanisms of the organism. a controller compares the signals to the desired set - points, and issues error signals if there are discrepancies. thus, each error signal refers to the difference between the optimal value of a variable (set - point) and the value returned by the homeostatic mechanism(s) during the persisting perturbation. the error is interpreted by an activator, which triggers the appropriate response of effectors to restore the value of the variable close to its set - point or, according a more realistic view, within a suitable set - range (fig . 1). as pointed out above, in a living being, several regulatory mechanisms are continuously activated to produce the homeostatic responses; hence, in analyzing the allostatic controls the following aspects should at least be considered: i ) redundancy and inter - dependence, since several negative feedbacks are directly or indirectly involved in the control of the same functional parameter or of functional parameters strictly interdependent (e.g., blood volume and arterial blood pressure); ii ) push - pull controls (e.g., glucagon / insulin) allowing a precise control of the parameter; and iii ) russian doll organization of controls of increasing miniaturization. thus, it is possible to recognize fb control at the systems (set of apparatuses) level, at the level of organs, at the level of tissues, at the level of the cells, at the level of the molecular networks. the crucial role for overriding controls is played by the cns via its interactions with the peripheral apparatuses especially for parameters, such as arterial blood pressure, involved in facing challenging conditions (e.g., in fight or flight conditions). taken together, it can be stated that homeostasis implies the regulated activation of several dynamic and potentially predictive multilevel processes organized according to a russian doll pattern. furthermore, as proposed by' brain - body medicine', the cns plays a crucial role in homeostasis by interacting with practically all the peripheral organs. in this context, the brain / kidney interactions for the h2o / na and brain temperature control that are interrelated parameters of basic importance for cns integrative actions, will be discussed. as discussed below, such an assumption can also be surmised by deductions based on the evolutionary . as stated in the general premise, it is proposed that the brain isf plays the highest hierarchic role among the isf of the different organs of the human body in triggering homeostatic responses of fundamental importance. such a strong assumption does not deny the relevance of the holistic view of the human body as proposed by' brain - body medicine', but it is aimed at suggesting a frame to organize the data indicating that the isf dyshomeostasis reduces to a great extent the cns integrative actions that allow a free and independent life. as mentioned above, to support our assumption, we focus our analysis on two parameters, namely the h2o / na and brain temperature control and the cns / kidney synergistic interactions. as an introduction to this subject , a preliminary analysis is proposed on the complex fluid and cellular movements among the various brain fluid compartments, since they are involved not only in the metabolic support to neurons and glial cells and in the clearance of waste molecules from the brain, but also in the brain interactions with the systemic apparatuses. in an interesting study, brinker et al published a very useful diagram showing the complex fluid and cellular exchanges between the brain fluid compartments and we will refer to it for our proposal. actually, according to our view, it is possible to organize the brain fluid compartments distinguishing a' major cerebrospinal fluid (csf) circulation' (black arrows in fig . 2) from an' inter - compartments fluid circulation' (blue arrows in fig . 2) from a' csf intra - ventricular local circulation' characterized by gentle ebbs (broken arrows in fig . 2). the schematic representation suggests a special hub status for isf in view of its multiple connections with the other fluid compartments. furthermore, a privileged status for isf is pointed out by the limiting barriers that regulate its cellular and fluid exchanges with the other compartments. actually, isf is protected by a highly selective barrier from the cerebral blood circulation and by a permeable barrier formed by gap junctions in the pia and ependymal layer and by the brain tissue microarchitecture (e.g., tortuosity and viscosity of the brain ecm) from csf. furthermore, it should also be pointed out that isf and virchow - robin space (vrs) are separated only by the glial barrier through which also cells can move to isf. as indicated in fig. 2, csf operates as an interface between the major and minor circles. in addition, csf exchanges signals with isf not only directly but also indirectly via its reciprocal interactions with the vrs. thus, csf secretion, composition and circulation have a central importance for isf homeostasis. as far as the secretion of csf is concerned, the choroid plexus (cp) has been proposed as the main locus for the secretion and clearance of csf. thus, at cp the blood - csf barrier secretes and purifies csf, generates intracranial pressure and maintains the csf composition. therefore, the cp secretory epithelium plays a basic role for brain homeostasis and integrative actions via multiple transport and secretory functions that support csf homeostasis and its fluid dynamics. as far as csf composition is concerned, it is important to compare at least some of its main chemico - physical parameters with those of plasma and extracellular fluid (ecf). two highly selective barriers separate csf and isf from the blood, while they are separated from each other by easily permeable boundaries. thus, if isf has the highest hierarchic order among the brain isf, csf should be also considered in view of its continuous renewal and circulation as a crucial fluid compartment for brain integrative functions and as a good mirror of brain isf. on the other hand each of these will contribute to plasma composition according to its volume, composition and access to plasma. thus, brain isf also in view of the blood - brain barrier (bbb) will not greatly contribute to plasma composition notwithstanding its high hierarchic order. these aspects are illustrated in fig. 2 and in table i where some of the main chemico - physical parameters of plasma, ecf and csf are presented. as far as csf circulation i.e. , the' third circulation' according to cushing is concerned, it has been shown that adult cp secretes csf that flows through the ventricles into the subarachnoid space, then over the top of the brain, with some csf flowing down to the lumbar sac. the exit of csf is mainly to the blood at the arachnoid granulations but also to the lymph system through the nasal cribriform plate or via the spinal nerve roots. however, csf flow is not unidirectional since it has been shown that not only is a pulsatile flow but also characterized by up and down movements throughout the entire brain with local fluid exchanges with isf, circumventricular organs (cvos) and vrs. furthermore, it should be underlined that the csf has not only gentle and bidirectional ebbs and flows that create mixing, but it has also been shown that the single layer of ciliated ependymocytes in contact with the csf beat in a periodic manner, generating localized microscale (beating of cilia) effects on near - wall csf dynamics (fig . 2). this action may contribute in clearing debris from the ventricle walls, and may enhance mixing, which may be particularly relevant for neuroendocrine communication or even for signal detection. thus, while some short - distance volume transmission (vt)-signalling can rely upon this action of the ependymal cilia close to the walls of lateral ventricles, long - distance vt - signalling could be mainly driven by wall motion and cp pulsation, hence by csf dynamics in the centre regions of the ventricles, according to the tide hypothesis. thus, it has been suggested to distinguish a major csf circulation that is the classical one from the cp to the arachnoid granulations, from a local csf micro - circulation that is mainly confined close to the ciliated walls of ventricles. while the former plays a role as nourishing liquor and long - distance pathway for vt signal migration, the latter one is mainly involved in short distance migration of vt signals and csf flow - mediated neuronal guidance. furthermore, the csf circulation around blood vessels penetrates from the subarachnoid space into the vrs allowing cell exchange between blood and brain. as proposed by bechter et al, csf is also a diffusion pathway for pathogenic agents causing neuropsychiatric diseases. actually, it has been shown that blood - borne inflammatory cells enter the brain via vrs or via cp and clinical evidence supports the relevance of an immunological crosstalk between periphery and intrathecal immunity in neurological and psychiatric diseases. the fluid movements at the barriers are driven by osmotic and hydrostatic gradients or by active transporter processes. aquaporins and other transporters play a fundamental role in the control of fluid exchange at the glial, endothelial, and cp barrier. in particular, the water influx into the vrs and, hence, interstitial flow is regulated by aquaporin-4 localized in the end feet of astrocytes. it is interesting to note that the fluid movements into and out of the vrs depend on respiratory and cardiac pressure pulsations and can be an important component of the tide hypothesis for vt signal diffusion in the brain. a special role of tanycytes for brain - body interactions has also been proposed, since tanycyte - like cells are a characteristic feature of all cvos and they display well - organized tight junctions around their cell bodies that can represent a bbb displaced from the vascular to the ventricular side. thus, tanycytes may play an important role in regulating the exchange between blood, csf and isf, and hence in regulating the brain - body interactions, particularly in some organs that are deeply involved in the control of internal medium as the kidney. the assumption of peculiar brain / kidney interactions finds an indirect support from comparative physiology and evolutionary studies. in the famous and fascinating book cited above, homer smith proposed that the following processes do indicate a parallel evolution of the nervous system and kidneys (fig . 3): i ) the increased complexity of the renal apparatus has allowed a progressively more precise control of the volume and composition of the internal medium; ii ) the precise control of the volume and composition of the internal medium has allowed the establishment of a progressively more complex nervous system; and iii ) the organism endowed with a complex cns has become capable of multidimensional allostatic controls, i.e., of complex dynamic predictive homeostasis, particularly for chemico - physical parameters that are highly relevant for cns integrative actions. accordingly, some aspects will be discussed as to how a complex cns operates to allow interconnections between the brain and kidneys for the homeostatic controls of sodium concentrations and brain temperature. as far as plasma sodium concentrations are concerned it should be noted that this parameter not only has a restrict set range (135 meq / l < < 147 meq / l), but also that hyponatremia causes important cns symptoms (e.g., amnesias, headaches, epilepsy). as far as cerebral temperature is concerned, it should be noted that brain deep structures are at 12c above the body core temperature. thus, blood in the cerebral circle is at a a lower temperature than the deep brain structures hence cerebral blood flow besides providing nutrients to the brain and allowing the clearance of its metabolic waste products has also the function of absorbing heat especially from the active brain regions. the osmotic regulation of water homeostasis and body core temperature are functionally related, since the maintenance of body water homeostasis is critical for preventing hyperthermia, as evaporative cooling is the most efficient means of dissipating excess body heat. as far as water homeostasis is concerned, its control is mainly achieved by the regulation of water intake and water loss by the kidneys. the former is achieved by sensations of thirst that motivate water intake, whereas the latter is regulated by the antidiuretic action of vasopressin. vasopressin (also known as antidiuretic hormone ( adh) secretion and thirst are stimulated by increases in the osmolality of the ecf, as well as by decreases in blood pressure and/or blood volume, signals that are precipitated by water depletion associated with the excess evaporative water loss required to prevent hyperthermia. thus, it can be deduced that thermoregulation and osmotic regulation of water homeostasis are functionally interdependent. let us briefly mention two important recent contributions on the mechanisms involved in this integrated homeostatic control. actually, adh enhances thermo - sensitivity of warm - sensitive neurons and decreases thermo - sensitivity of cold - sensitive neurons. such adh modulatory actions promote heat loss and are probably involved in the adh - induced hypothermia. the basic role of adh for both osmotic regulation of water homeostasis and cerebral homoeothermic control are schematically summarized in fig. another mechanism involved in the integration of thermal and the osmotic regulation of water homeostasis has also been described, that is based on the transient receptor potential - vanilloid (trpv) family of ion channels that respond both to osmotic signals and also are stimulated by increases in body temperature. as described in the recent study by noda et al, at least two independent sensing systems in the cvos are involved in monitoring osmolality and body - fluid volume, namely na(x) channels and trp channels. in particular, na(x) channels have been demonstrated to play a role as sensors and trp channels as osmosensors, but these channels are also temperature - sensitive. let us briefly describe these two molecular mechanisms involved in the control of na / h2o and cerebral temperature: i ) na(x) channels are located in perineuronal processes and in the ependymal cells of the subfornical organ and organum vasculosum lamina terminalis (ovlt) and are activated by hypernatremia. their activation causes a reduction in na assumption; and ii ) trpv channels, such as the trpv1 and trpv4 are expressed at the level of the supraoptic nucleus and at the level of the ovlt. these channels are activated by hyper - osmolality but also by increases in the cerebral temperature. in other words, there are brain regions (particularly cvos) and central molecular mechanisms (e.g., trpv) allowing brain - kidney interactions in the control of ecf osmolality and cerebral temperature. thus, apart from the mechanism that is dependent on adh modulatory actions on hypothalamic thermo - receptors and via such an action integrate thermal and osmotic regulation, the mechanism that is dependent on tprv channels whose activation is directly modulated by fluid osmolality and cerebral temperature should also be considered. the triggering of these mechanisms also depends on multiple neural and humoral signals from the periphery. the latter ones can reach the brain via the cerebral circulation and from the blood can reach the brain integrative centres, particulatly those located in the cvos, since they are outside the bbb. in the frame of the basic problem already faced by claude bernard, that is of the definition of internal medium and the characterization of its distinctive features in physiological terms, we propose that there is a hierarchic order among the isf and we maintain that brain isf is the real' internal medium' of higher vertebrates since it is the most important isf for triggering the complex responses allowing a free and independent life and this is particularly true for human beings. as mentioned above, this assumption does not deny the holistic view of the human organism but it gives a further aspect to the' brain - body medicine' that has recently been investigated also for a surprising new aspect, namely the synergistic role between brain and gut microbiota. thus, while the general relevance of the brain / body interactions are a main subject of investigations the main highly focused subject of our paper is how brain circuits and kidney functions can modulate brain isf composition. thus, according to our proposal, brain isf represents the' core fluid compartment' that provides an optimal environment for development, survival and, together with csf, it allows vt intercellular communications among the brain complex cellular networks. thus, brain isf is likely a crucial functional component of the multifaceted integrative cns actions that are involved in most of the dynamic predictive homeostatic mechanisms and overriding controls. the crucial role of brain isf is also indicated by the evidence that does exchange signals with the other brain fluid compartments but only in a highly regulated way (fig . our view is that brain isf has the highest hierarchic role in triggering dynamic homeostatic responses involved in the balance of volume and sodium concentrations of the ecf as well as the cerebral temperature control . as discussed above, it is suggested that these two functionally interrelated parameters play a crucial role for the high level integrative actions of cns as those involved in the control of the psychic state . in agreement with such a view many clinical studies demonstrate correlations between the water / sodium balance, homoeothermic balance and psychic conditions of the subject . actually, it has been reported that : i) psychic stresses increase the plasma and csf levels not only of cortisol but also of adh; ii ) adh plasma levels are increased in depressed patients; iii ) epidemiological studies have demonstrated a correlation between depression and habitats with a high salinity; iv ) schizophrenic patients have alterations in the control of body temperature; and v ) rpv1 channels beside responding to the osmotic signals are also activated by cerebral temperature and at the level of the cerebral cortex are altered in depression. it has been introduced the term of psycho - physic allostasis to indicate the responses aimed not only to the maintenance of the internal medium homeostasis but also to the broader condition of well - being of the subject hence to his eudaimonia (16,17, see section ' body and psychic homeostasis '). this condition of well - being especially depends on the interactions between the systems of the organism and the supra - systems. thus, eudaimonia does depend from the interactions between the human being and external physical environment but even more from the interactions of the subject with his socio - cultural environment. according to our proposal, the brain isf and its' mirror fluid' the csf have the highest hierarchic role since they allow optimal conditions for cns integrative actions. in particular, body - fluid and core temperature controls are two chemico - physical parameters that are essential for a free and independent life of human beings that is possible only if their cns operates in optimal conditions. furthermore, we have proposed that in several instances an appropriate oscillatory rhythm (often but not exclusively a circadian rhythm) of a chemico - physical parameter within its appropriate set - range is an essential component of allostasis. thus, in several instances the load error is the of the discrepancy between the internal medium value and not simply the set - range values but the appropriate oscillatory rhythm that the chemico - physical parameter under scrutiny should have. a consequence of such an assumption is that dyshomeostasis can be actually present even if the chemico - physical parameter under scrutiny is within its appropriate set - range but with inappropriate rhythmic oscillations. thus, a careful analysis of chemico - physical parameters dynamic patterns should be considered and not only at plasmatic level but also at csf level. as a matter of fact , it is interesting observing that the concentration rhythms of sodium are differentially regulated (fig . 5) in the csf in comparisons with the sodium concentrations rhythms in the systemic circulation. this aspect has clinical implications not only since it has been shown that a correlation exists between the rising levels of csf sodium levels and the timing of migraine onset but also since as recently stated water and sodium homeostasis is inextricably coupled to the cns integrative actions. in this regard, neuroscience describes an inverse relationship between the intensity of the neuropil function and the amount of water it contains with different shrinkage the ecm according to the neuronal activity. as discussed above, these variations in the ecm perviousness have profound effects on vt signals diffusion hence also regulate the exchange of signals isf / blood, isf / csf, isf / vrs. thus, exchanges between blood - born and brain - born vt signals depend also at some extent on the ecm hydration and composition. this could be one important feature characterizing brain - kidney interactions since as mentioned above integrative centres for the feedback mechanisms involved in na / water and cerebral temperature homeostasis are localized at cvos level that is outside the bbb but separated by barriers from isf. against this and on the bases of recently published data it has been proposed that (na), osmolality and cerebral temperature are continuously monitored in the brain in particular at cvos level and are strictly regulated thanks to brain - kidney interactions to maintain the optimal set - range for brain isf that, in turn, is a necessary prerequisite for the brain integrative actions. furthermore, on the basis of the clinical data above mentioned it has been proposed that (na), osmolality and cerebral temperature are interconnected parameters playing a fundamental role in the psychic allostasis. thus, it is surmised that clinical evaluations of these parameters are of paramount importance for the psychic homeostasis of the subject and could be modulated by optimizing his interactions with the socio - cultural environment in which he lives as well as by psycho - therapy. in other words, it could be proposed the potential relevance of monitoring internal medium (na) and cerebral temperature during psycho - therapy treatments like the ones administrated to patients suffering of post - traumatic stress disorders. thus, it could be relevant to evaluate the physical (internal medium parameters) and psychological (eudaimonia) therapeutic effects produced by addressing the patient's inner speech in such a way of favoring his predictive psychic allostasis to peaceful scenarios. this could lead to a better dealing with the stressing actions of supra - systems and the traumatic memory traces that he has to face.

in this review, the aspects and further developments of the concept of homeostasis are discussed also in the perspective of their possible impact in the clinical practice, particularly as far as psychic homeostasis is concerned. a brief historical survey and comments on the concept of homeostasis and allostasis are presented to introduce our proposal that is based on the classical assumption of the interstitial fluid (isf) as the internal medium for multicellular organisms. however, the new concept of a hierarchic role of isf of the various organs is introduced. additionally, it is suggested that particularly for some chemico - physical parameters, oscillatory rhythms within their proper set - ranges should be considered a fundamental component of homeostasis. against this , we propose that the brain isf has the highest hierarchic role in human beings, providing the optimal environment, not simply for brain cell survival, but also for brain complex functions and the oscillatory rhythms of some parameters, such as cerebrospinal fluid sodium and brain isf pressure waves, which may play a crucial role in brain physio - pathological states. thus, according to this proposal, the brain isf represents the real internal medium since the maintenance of its dynamic intra - set - range homeostasis is the main factor for a free and independent life of higher vertebrates. furthermore, the evolutionary links between brain and kidney and their synergistic role in h2o / na balance and brain temperature control are discussed. finally, it is surmised that these two interrelated parameters have deep effects on the central nervous system (cns) higher integrative actions such those linked to psychic homeostasis.

the transfusion of red blood cell (rbc) concentrates in critically ill patients remains controversial and has generated much research and debate in the medical literature. a recent, large, noninferiority randomized clinical trial adds an important piece to this quite complicated' puzzle'. in stable critically ill anemic (hemoglobin < 9.5 g / dl) children between 3 days and 14 years of age , this study demonstrated that a restrictive strategy, where the threshold hemoglobin concentration was 7 g / dl, significantly decreased transfusion requirements without increasing adverse outcome, defined as a composite of death and development of new or progressive organ failure, when compared to a liberal strategy with a threshold hemoglobin of 9.5 g / dl. anemia is common in critically ill patients and in a large number of rbc transfusions. several studies reported that up to 50% of adult or children who were hospitalized in an intensive care unit received rbc transfusions. interestingly, all these observational studies reported that hemoglobin level, rather than clinical or physiological factors, drives transfusion decision. the adequacy of any hemoglobin concentration in a given clinical situation depends on whether a sufficient amount of oxygen is carried to the tissues to meet their metabolic requirements. the optimal hemoglobin threshold for rbc transfusion in different populations, and especially in critically ill patients, remains unknown. the study of lacroix and colleagues confirms the reported by two other randomized trials that evaluated the impact of a restrictive strategy on the outcome of critically ill adults and preterm infants. using 30-day mortality as the primary outcome in 838 euvolemic adult critically ill patients, hbert and colleagues demonstrated that a restrictive transfusion strategy was at least as effective as a liberal one. in addition, applying a liberal transfusion strategy ed in a significantly higher multiple organ dysfunction score, a composite outcome taking into account 30-day mortality and the number of organ failures. this deleterious effect might be attributed to the fact that rbc units transfused in this study were not leukocyte - reduced, in contrast to the rbc units used in the study by lacroix and colleagues. two' before and after' studies in adults and premature infants and one meta - analysis of randomized controlled trials have reported that leukoreduced rbc transfusion could significantly improve the outcome of high risk patients. it has been decided, therefore, to repeat a prospective controlled randomized study to compare hemoglobin thresholds of 7 versus 9 g / dl. using a composite primary outcome including death before home discharge or survival with any of severe retinopathy, bronchopulmonary dysplasia or brain injury on cranial ultrasound in 451 infants with birth weight < 1,000 g, kirpalani and interestingly, the thresholds developed in this study were based on whether or not the infant was receiving respiratory support. although not specified, as the study was performed after 1999 and included canadian centers, it may be reasonably assumed that the authors used leukoreduced rbc units. the of this study are in contrast with those of bell and colleagues, who reported in a smaller trial (n = 100) that infants in the restrictive - transfusion group were more likely to have intraparenchymental brain hemorrhage or periventricular leukomalacia. however, this combination was not a pre - specified outcome and the study was powered for the primary outcome of number of transfusions. in all these studies, the use of a restrictive approach was associated with a decreased number of transfusions and, in most of them, with a decrease in the number of patients exposed to rbc transfusion. using a more liberal approach to achieve a higher hemoglobin concentration in an attempt to increase oxygen delivery and thus tissue oxygenation in stable critically ill patients does not appear to be associated with a significant clinical benefit. several authors have suggested that the rbc storage process could affect the ability of rbcs to transport and deliver oxygen, this phenomenon being responsible for the lack of apparent improvement in tissue oxygenation after transfusion. human studies on the effects of stored rbcs are scarce and controversial. in nine healthy volunteers undergoing acute isovolemic hemodilution, there were no differences in the ability of transfused fresh (stored < 5 hours) or stored (> 3 weeks) rbcs to reverse the neurocognitive deficit observed during acute anemia. in critically ill patients, the effect of rbc storage on gastric mucosal oxygenation remains controversial. in a randomized multicenter pilot trial, hbert and colleagues did not observe differences in mortality rates or life - threatening complications in patients transfused with fresh (median age 4 days) versus old (median age 19 days) rbcs. in the study of lacroix and colleagues, the average length of storage was about 16.0 10 days in both strategy groups. the effect of rbc storage time on primary outcome was not evaluated. for stable critically ill patients with a hemoglobin concentration ranging from 6 or 7 to 10 g / dl, there is increased evidence that a restrictive transfusion approach based on a predefined hemoglobin concentration does not influence outcome. the decision to transfuse such patients would, therefore, depend primarily on clinical judgment, taking into account the ability of the patient to increase cardiac output and oxygen extraction, and the level of tissue oxygen demand. it remains to be demonstrated that, in high risk patients, a symptomatic transfusion strategy is as effective, or possibly superior, to a hemoglobin - based transfusion strategy. this is the aim of the ongoing' focus' study comparing these two strategies in patients 50 years of age or older who undergo surgical repair of a hip fracture and who have clinical evidence for cardiovascular disease or cardiovascular risk factors. although the study of lacroix and colleagues adds an important piece to the' puzzle', it still remains incomplete.

in stable critically ill children, the adoption of a restrictive transfusion strategy based on a predefined hemoglobin threshold of 7 g / dl significantly decreased transfusion requirements without affecting outcome. these strengthen previous observations made in volume resuscitated adults when a similar blood transfusion strategy was used. it also indirectly corroborates studies reporting the beneficial effects of leukoreduction of red blood cell (rbc) transfusion units on patient outcome. this study indicated that the maintenance of a higher hemoglobin concentration with rbc transfusion in an attempt to increase tissue oxygen delivery is not associated with a clinical benefit. this may be related to the storage process, which could affect the ability of rbcs to transport and deliver oxygen to the tissues. this point, however, remains controversial. it should also be remembered that increasing hemoglobin concentration will not always in a greater oxygen delivery, as transfusion related increased blood viscosity could be associated with a reduction in blood flow. further research should compare a symptomatic transfusion strategy to a hemoglobin - based strategy on the outcome of high risk patients.

the removal of infected carious dentin is an exacting procedure routinely accomplished during tooth preparation, prior to placing a restoration. although explorer - verified hardness equal to that of normal dentin is traditionally considered the ideal endpoint of excavation, caries indicator dyes have been developed to provide a more objective and easily recognized visual differentiation for this endpoint.14 these dyes also distinguish between the outer layer of very soft highly infected carious dentin and the deeper layer of somewhat softened uninfected or at most lightly infected dentin.5,6 caries detector (kuraray america, ny, ny) and caries finder red (danville materials, san ramon, ca) are two representative products, consisting of 1% acid red 52 dye (sulforhodamine b) in propylene glycol.7 a recent approach to minimizing unwanted staining by caries indicator dyes has been to change the solvent for the dye compound. the rationale is based upon two studies that showed diminished diffusion into porous tissues of dyes dissolved in higher molecular weight solvents.810 instead of propylene glycol (mw=76) (pg) or a mixture of pg and water as used in many currently marketed caries dye products, new formulations using larger molecules such as polypropylene glycol (mw=300, for example) (ppg) have been proposed. in 2005, a us patent application was filed for this type of caries detecting solution.11 this application discloses a range of inventive examples including solutions containing various mixtures of ppg with a molar weight of 300, polyethylene glycol with molar weights of 400 and 4000, pg, glycerin and water. two new caries indicator dye products are now available in japan (caries check red and caries check blue, nishika co., yamanashi, jp) consisting of 1% acid red 52 or brilliant blue dye in 300 mw ppg. a few studies do indicate, at least indirectly, that ppg - based dye solutions may provide a more conservative excavation endpoint. when the final excavated surfaces determined by pg - based dye solution or ppg - based dye solution were compared using micro - vickers hardness (mvh), it was found that the ppg dye - determined group was significantly softer than the pg dye - determined group (mean mvh 32.7 vs. 44.7).12 since hardness generally increases with increasing depth in dentin carious lesions this would suggest a shallower, more conservative endpoint for the ppg dye - determined specimens.3 because both groups were found to be free of bacteria histologically, it was concluded that the ppg dye - determined endpoint would be preferable. however, since hardness generally decreases with increasing depth in normal dentin, the clinical interpretation of hardness differences is somewhat obscured. after this initial report, studies incorporating laser fluorescence comparisons pointed toward a similar , at least for permanent teeth. the rationale for using laser fluorescence values (dd) (diagnodent, kavo, usa) to assess differences in excavation endpoints was based upon a study of the spectral autofluorescence characteristics of carious lesions, as well as general guidelines for interpretation of dd values when detecting carious lesions in occlusal fissures.1315 in extracted carious teeth, it was shown that the mean mvh was significantly lower and dd values significantly higher in the ppg dye - determined group versus the pg dye - determined group.16 in another study, a similar was found for the group mean dd value in permanent teeth but not in primary teeth.17 another study using extracted teeth containing acute or chronic carious lesions also found that the mean dd value was higher for the ppg dye - determined group versus the pg dye - determined group.13 in a clinical study, this same regarding dd values was confirmed for permanent teeth but not for primary teeth.8 one of these studies also found that all specimens first excavated to an endpoint indicated with the ppg - based dye could subsequently be re - stained with the pg - based dye, once again suggesting that ppg - based dye solutions may indicate a more conservative endpoint for excavation.13 more direct confirmation of this apparently more conservative endpoint indicated by ppg - based dyes is necessary for several reasons. first, although these initial studies do demonstrate a statistically significant difference in mean mvh and dd value between sample groups, it is not clear whether a difference exists in all carious lesions or just certain ones. in addition, although microhardness does generally increase with increasing depth in a dentin carious lesion, the relationship between microhardness and depth is neither linear nor constant from tooth to tooth.18 similarly, although dd values do generally decrease with increasing depth in a dentin carious lesion, this inverse relationship is not linear and certainly not constant from tooth to tooth.19 this is true both at the unexcavated lesion surface and across the pg dye - guided excavation front.19 in light of these variables, and to assess clinical implications for cavity preparation, it is necessary to investigate the differences between the actual physical locations of surfaces created by ppg dye - guided excavation and those created by pg dye - guided excavation. the purpose of this study is to determine the difference in the location of the caries dye staining endpoint indicated by 1% acid red 52 dye in pg versus that indicated by 1% acid red 52 dye in ppg, in freshly extracted human permanent posterior teeth containing primary dentin carious lesions. dye solutions were made by completely dissolving 0.100 g acid red 52 (sulforhodamine b, # s-9012, sigma chemical co., st . louis, mo) in 10.00 ml propylene glycol (sigma # p-1009) or in 10.00 ml polypropylene glycol, (triol type, mw=300) (# 160 - 17605, wako chemicals usa, richmond, va) at room temperature. solutions were stirred by hand for ten minutes and vortex - mixed for two minutes twenty - four hours later. freshly extracted, unrestored human permanent posterior teeth with primary occlusal carious lesions were collected under an irb - exempt protocol. teeth were stored in sterile distilled water at 4c for up to two weeks prior to processing. the outer surface of each specimen was cleaned with a soft - bristle toothbrush and sterile distilled water, sectioned horizontally at the dentino - enamel junction, the root portion discarded and the pulp tissue removed from the crown portion. two opposing axial surfaces were ground flat, parallel to each other and perpendicular to the previous horizontal section plane using an 8 240 grit carborundum disc mounted in a water - lubricated surface polisher (model 900, electron microscopy sciences, hatfield, pa). in preparation for splitting , a continuous fine groove was cut about 1 mm deep in the center of each ground axial surface running occlusogingivally and connecting across the occlusal surface approximately bisecting the external surface of the carious lesion. the groove was made with a 1 thin diamond disc mounted in a lowspeed handpiece. to provide identical reference marks on both split tooth halves, two to six orientation notches about 2 mm deep were made with a # 57 carbide bur across and perpendicular to the fine groove at various locations, but not in the region of the carious lesion. the crown specimens were fractured along the groove using a 3/8 steel chisel and mallet yielding two segments, each containing a split surface showing the carious lesion in cross - section. one of the two surfaces from each crown specimen, chosen at random, was stained with the ppg - based dye and the other with the pg - based dye. two drops of dye were applied for ten seconds, rinsed under running tap water for ten seconds, the surface blotted damp - dry with a cotton gauze square and then observed under 2.6x loupe magnification. specimen pairs were discarded if they had not fractured along the fine groove or were missing tooth structure, if no lesion was observed in dentin or if the lesion extended to the pulp chamber, if the lesion was too dark to permit differentiation of the red dye staining, if the lesion was less than 1 mm into dentin, or if a previously unobserved restoration was detected. of the 41 specimens originally collected, 18 were accepted for further analysis. as controls, three of the 18 fractured specimen pairs were stained on both surfaces with 1% sulforhodamine b in pg. color digital images were then made of each fracture surface. using a digital microscope and camera (optem zoom-100, qioptiq, rochester, ny) (dp-11, olympus america, melville, ny) at 10x magnification and with ring light illumination (# eke, schott - fostec, auburn, ny) , image files were created with the following settings: white balance 3000k, resolution set at hq 17121368 pixels, iso 100, ring light brightness 70, and 1/15 sec exposure. images were saved as.jpg files. to standardize the orientation of the fracture surface relative to the camera, both a machinist square was fastened to the stand base to fix the position of a removable aluminum block on which specimens were mounted using a thin layer of boxing wax. for linear calibration, a millimeter grid was fixed to the block. image pairs were analyzed using a digital image analysis software program (image pro discovery 4.5, media cybernetics, silver spring, md). for each specimen, one of the two image pairs was opened, flipped left - to - right, and magnified 3x. using a graphic tablet and digital pen (intuos 3, wacom, vancouver, wa) the most pulpal extent of the red dye - staining the other image of the pair was then opened, magnified 3x, and the pulpal extent of the dye - staining marked with a one pixel - wide blue line. this was accomplished by selecting a rectangular region of interest on one image that included both the blue or yellow line as well as the millimeter reference grid, edge of the aluminum mounting block and reference notches in the specimen surface. the selected area was copied and pasted into the other image using a 50% translucency setting for the paste operation, providing a means to visually align the two image pairs on the reference notch edges and aluminum mounting block edge, while permitting both the blue and yellow marked lines to be clearly seen. the distance between the yellow and blue lines was then measured using the software s linear measurement tool at 2x magnification after calibration based on the millimeter grid image. distance was measured from line to line (l - l distance) at five locations beginning in the center of the lesion, with two additional measurements on either side, spaced 0.5 mm apart, perpendicular to the most occlusally located line and recorded in millimeters to two decimals. this measurement protocol was repeated once for all 15 experimental samples and for two of the three control samples, providing a total of 150 experimental (ten per sample) and 50 (five or ten per sample) control l - l distance measurements. for each of the control and experimental specimen image pairs, mean l - l distance values were calculated. using these means, a weighted average was calculated for the combined control group and for the combined experimental group. the weighted averages were based on adjustment of the six or fifteen mean l - l distance values from each specimen group by the variance of the individual l - l distance values within that group. a 95% confidence interval was calculated for the weighted averages. to evaluate the test method, a 3-factor anova (specimen, measurement, replication) on rank - transformed data was carried out on the control and experimental data from the individual specimens (control 6, experimental 15), using repeated measurements of each test pair, and replication of the measurement protocol. prior to the anova, the data in both the control and experimental groups were analyzed for normality using the shapiro - wilk test. all statistical analysis used sas v9.1 software (sas institute, cary, nc). for 12 of the 15 experimental specimen image pairs, the line corresponding to ppg dye staining was located more occlusally (shallower) throughout its length than the line corresponding to pg dye staining. for two image pairs, the ppg dye staining line was predominately located more occlusally, but there were areas where the two lines were coincident or where the pg dye staining line was shallower. for these two specimen image pairs, this was true for both iterations of the image analysis protocol. in the specimen # 4 image pair, the pg dye staining line was shallower for 12% (first iteration) and 51% (second iteration) of the line length, and coincident for 11% (first iteration only). in the specimen # 8 image pair, the pg dye staining line was shallower for 14% and 19% of the line length and coincident for 5% and 13%, respectively. for one specimen image pair (# 1), the dye staining lines were coincident for 2% of the line distance in one iteration only, and elsewhere the ppg dye staining line was shallower. mean l - l distances were small, ranging from 0.0377 mm to 0.0952 mm. mean l - l distances were larger than for the controls, ranging from 0.153 mm to 0.506 mm, while individual distances ranged from 0.12 mm to (+) 0.66 mm. table 3 presents the data for the weighted averages of the means for the control and experimental specimen image pairs. for the control specimen image pairs, the weighted average l - l distance was 0.70 mm, with a 95% confidence interval of 0.51 mm to 0.89 mm, versus a 0.298 mm l - l distance and 95% confidence interval of 0.2140 mm to 0.357 mm for the experimental group. the weighted average l - l distance for the experimental group was about four times that of the control group, with no overlap and 0.151 mm between the two confidence intervals. the shapiro - wilk test for normality indicated that the control data was normally distributed (p=.1226) but that the experimental data was not normally distributed (p=.0003). therefore, anova on ranks was used to detect effects by groups. at a significance level of p=.05, the anova on ranks detected a significant effect by specimen and measurement, but not by replication in the control data. table 4 summarizes the anova on ranks by effects for control and experimental groups. the 0.298 mm weighted average l - l distance for all experimental specimens is clinically relevant since it is possible to remove dentin in increments of this magnitude, potentially ing in more conservative cavity preparations and even preventing unnecessary pulp exposures in some instances. this advantage is somewhat limited, however, because 0.3 mm represents perhaps one or two careful applications of a hand excavator or round bur, and because the l - l distance ranged considerably: from 0.12 mm to 0.66 mm within the specimens. with an aggressive excavation technique exceeding 0.3 mm or even less per increment, any advantage from a more conservative ppg - based caries dye endpoint would often be negated. however, in some cases, careful excavation using this ppg - based dye could actually prevent exposure in deep lesions approaching the pulp. because carious lesions differ in type and amount of bacterial load, nutrient availability, and morphology and because dentin itself varies according location, age and reaction pattern, considerable variation would be expected in l - l distances among other specimen sets such as primary teeth, more chronic lesions, very active lesions, root lesions, and lesions associated with restorations. the of this study should be interpreted with caution, especially for clinical application. since no difference was found in dd values for excavation surfaces created using pg - based versus ppg - based dyes in primary teeth in two previous studies, it may be that no l - l distance difference exists in primary teeth. for this reason, the present study needs to be repeated for primary teeth.8,17 other solvents or solvent mixtures as well as dyes other than sulforhodamine b may produce different , and would also need to be tested. the fractured dentin surface used in the present study does not include a smear layer as would sometimes be produced clinically by burs or hand excavators, and may, therefore, indicate a more conservative endpoint since a smear layer might stain with dye, having originated from elsewhere in the preparation. therefore, the present study may represent a more idealized staining compared to some clinical situations. the differences in the weighted averages between the control and experimental groups as well as the on the anova on ranks analysis indicate that the present method is useful for differentiating staining endpoints between caries dyes. the method was able to detect a relatively small l - l distance, approximately four times the average error seen in the control group which itself was very small. in both groups, a specimen effect was detected by anova as would be expected for clinical specimens varying in lesion location, activity, size, etc. effect was detected in the control group and almost in the experimental group (p=0.0510), also expected due to lesser variations in measurement orientation versus dentin tubule orientation, for example. effect was not detected in either group, indicating an acceptable degree of consistency between runs. for future studies , errors might be reduced by more precise machining of the splitting groove and orientation notches, and by color - corrected thresholding of the stained specimen surface. in the present study, any light pink staining encountered on the dye - stained fracture surface was treated as non - stained, and therefore the dye - stain demarcation line was drawn shallow to the light pink staining, at the border of red and light pink staining. in previous studies using dd or mvh to detect endpoint differences in pg - based versus ppg - based caries dyes, the light pink staining in the pg group was sometimes kept in place and sometimes removed prior to surface testing.8,13,16,17 in the present study, had the dye - stain demarcation line been drawn at the border of non - stained and light pink - stained dentin, l - l distances would have been greater in some instances. further study is indicated to determine the tendency of ppg - based dyes to stain dentin light pink, and then to characterize those areas according to hardness, bacterial load, etc. there are no long - term clinical trials showing improved clinical outcomes for any dye - based excavation endpoints versus conventionally - determined endpoints, let alone for any one type of dye solution. in fact, clinical studies comparing outcomes for excavation methods in general are quite limited. in one clinical study of restorations in primary teeth, no differences were found at one year regarding marginal adaptation and secondary caries in the chemo - mechanical excavation group compared to the conventional hand excavation group.20 in another study of restorations in primary teeth followed for six months, no difference was detected in the survival rate of restorations in the chemo - mechanical excavation group compared to the conventional bur excavation group.21 factors such as restoration longevity, margin integrity, tooth structure integrity, pulpal health, and secondary caries are all relevant considerations. in this regard, ppg - based dye excavation should also be compared to other excavation methods such as chemo - mechanical, polymer bur, and fluorescence - aided excavation, in vitro and clinically.2224 until such studies are completed, the optimal endpoint for excavation of carious dentin will remain a matter of debate, based primarily on indirect evidence. under the experimental conditions and compared to pg - based sulforhodamine b caries dye solution, ppg - based dye solution provides a significantly shallower excavation endpoint by 0.298 mm ( 95% confidence interval 0.240 mm

objectivesthis study determined the difference in the location of the caries dye staining endpoint of 1% acid red dye in propylene glycol versus that of 1% acid red dye in polypropylene glycol.methodsfreshly extracted permanent molar crowns with primary occlusal carious lesions were chisel - split axially to expose the lesion in cross - section on both halves. one half was stained with propylene glycol - based dye and the other with polypropylene glycol - based dye. for the control group, both halves were stained with propylene glycol - based dye. the dye staining front was marked on digital images of the stained split surfaces, and the images were aligned using reference notches. the distance between the marked staining front lines was measured in five locations, and the measurement protocol was repeated. weighted averages and a 95% confidence interval for the distance between marked staining front lines were calculated for the control and experimental groups.the weighted average distance for the experimental group (0.298 mm, 95% confidence interval 0.240 mm 0.357 mm) was about four times that of the control group (0.070 mm, 95% confidence interval 0.051 mm 0.089 mm). generally, the marked staining line for the polypropylene glycol - based dye specimens was located shallow (occlusal) to the propylene glycol - based staining line (range 0.12 mm to 0.66 mm).the staining endpoint of 1% acid red dye in polypropylene glycol is shallower than that of 1% acid red dye in propylene glycol. the method is useful for comparing staining endpoints of caries dye formulations. (eur j dent 2008;2:2936)

heterogeneous diffusion dynamics of molecules play an important role in many cellular signaling events, such as of lipids in plasma membrane bioactivity. however, these dynamics can often only be visualized by single - molecule and super - resolution optical microscopy techniques. using fluorescence lifetime correlation spectroscopy (flcs, an extension of fluorescence correlation spectroscopy, fcs) on a super - resolution stimulated emission depletion (sted) microscope , we here extend previous observations of nanoscale lipid dynamics in the plasma membrane of living mammalian cells. sted - flcs allows an improved determination of spatiotemporal heterogeneity in molecular diffusion and interaction dynamics via a novel gated detection scheme, as demonstrated by a comparison between sted - flcs and previous conventional sted - fcs recordings on fluorescent phosphoglycerolipid and sphingolipid analogues in the plasma membrane of live mammalian cells. the sted - flcs data indicate that biophysical and biochemical parameters such as the affinity for molecular complexes strongly change over space and time within a few seconds. drug treatment for cholesterol depletion or actin cytoskeleton depolymerization not only in the already previously observed decreased affinity for molecular interactions but also in a slight reduction of the spatiotemporal heterogeneity. sted - flcs specifically demonstrates a significant improvement over previous gated sted - fcs experiments and with its improved spatial and temporal resolution is a novel tool for investigating how heterogeneities of the cellular plasma membrane may regulate biofunctionality.

lipolysis describes the hydrolysis of triacylglycerols (tgs), commonly referred to as fat. in the mid-19 century the great french physiologist claude bernard (bernard, 1856) noted that the pancreatic juice of mammals was able to efficiently degrade fat in the form of butter and oil. his observation led to the partial characterization of a pancreatic fat - splitting ferment by balser (balser, 1882), langerhans (langerhans, 1890), and flexner (flexner, 1897). the importance of lipolysis to general metabolism became apparent when whitehead (whitehead, 1909) discovered that fat (tgs) could not enter cells in its unhydrolyzed form. the absolute requirement for tg hydrolysis for the cellular uptake or release of fatty acids (fas) and glycerol defines three processes in vertebrate physiology where lipolysis is essential: gastrointestinal lipolysis mediates the catabolism of dietary fat; vascular lipolysis is responsible for the hydrolysis of lipoprotein - associated tgs in the blood; and intracellular lipolysis catalyzes the breakdown of tgs stored in intracellular lipid droplets (lds) for subsequent export of fas (from adipose tissue) or their metabolism (in nonadipose tissues). although fundamental aspects of lipolysis were understood early on, it took more than a century to identify, isolate, and characterize the main fat - splitting ferments, which have been called lipases since 1900. the chief lipolytic enzymes of the gastrointestinal tract are lingual lipase, gastric lipase, pancreatic lipase, and pancreatic lipase - related proteins 1, 2, and 3. vascular tg hydrolysis depends on lipoprotein lipase (lpl) and hepatic tg lipase. intracellular lipolysis of tgs involves neutral (ph - optimum around ph 7) and acid lipases present in lysosomes (ph optimum between ph 45). well - characterized neutral tg hydrolases include adipose triglyceride lipase (atgl) and hormone - sensitive lipase (hsl), whereas lysosomal acid lipase (lal) is the most important lipase in lysosomes. besides an active serine site, these enzymes share no obvious structural homologies and are unrelated to the pancreatic lipase family. lipolysis is the catabolic branch of the fa cycle that provides fas in times of metabolic need and removes them when they are present in excess. fas are essential as substrates for energy production and the synthesis of most lipids, including membrane lipids and lipids involved in cellular signaling. accordingly, all uni- and multicellular organisms are able to synthesize fas de novo (endogenous fas) from carbohydrate and/or protein metabolites. despite their fundamental physiological importance, an oversupply of fas is highly detrimental. increased concentrations of nonesterified fas disrupt the integrity of biological membranes, alter cellular acid - base homeostasis, and elicit the generation of harmful bioactive lipids. these effects, in turn, impair membrane function and induce endoplasmic reticulum (er) stress, mitochondrial dysfunction, inflammation, and cell death. collectively, these deleterious effects are subsumed under the term lipotoxicity (unger et al ., 2010). as a countermeasure, essentially all cells are able to detoxify nonesterified fas by esterification with glycerol to yield inert tgs. additionally, higher organisms store fas in a specialized organ (i.e., adipose tissue), which supplies fas to other high - demand tissues, such as liver and muscle (exogenous fas). the carefully regulated balance of fa esterification and tg hydrolysis creates an efficient buffer system, allowing sufficient fa flux without nonphysiological increases in cellular nonesterified fa concentrations moreover, fa cycling creates metabolic intermediates that can be utilized in anabolic processes or as extra- or intracellular signaling molecules. we summarize recent advances in understanding the enzymatic mechanisms of the lipolytic process and the (patho)physiological impact of lipolysis on energy homeostasis and cellular signaling. neutral hydrolysis of tgs to fas and glycerol requires three consecutive steps that involve at least three different enzymes: atgl catalyzes the initial step of lipolysis, converting tgs to diacylglycerols (dgs); hsl is mainly responsible for the hydrolysis of dgs to monoacylglycerols (mgs) and mg lipase (mgl) hydrolyzes mgs. in adipose tissue, atgl and hsl are responsible for more than 90% of tg hydrolysis (schweiger et al ., 2006). although most nonadipose tissues also express atgl and hsl, expression levels are low in some tissues, raising the question of whether other lipases are additionally required for efficient lipolysis. , 2004; villena et al., 2004; zimmermann et al., 2004 ), belongs to the family patatin domain - containing proteins including nine human and eight murine members. the patatin domain was originally discovered in lipid hydrolases of the potato and other plants and named after the most abundant protein of the potato tuber, patatin. because some members of the family act as phospholipases, the proteins were officially named patatin - like phospholipase domain - containing protein a1 to a9 (pnpla19) (wilson et al ., 2006). unfortunately, this name is misleading because it implies that all members of this family are phospholipases. however, several pnpla proteins have only minor or no phospholipase activity. a more appropriate designation for the family orthologous enzymes are found in essentially all eukaryotic species, including vertebrates, invertebrates, plants, and fungi. , the active site of the enzyme contains an unusual catalytic dyad (s47 and d166) within the patatin domain (rydel et al ., 2003). this domain comprises 180 aa and is embedded within a 250 aa sandwich structure at the protein's nh2-terminal half. the cooh - terminal half has a predominantly regulatory function and contains a predicted hydrophobic region for ld binding (duncan et al ., 2010 ; schweiger et al ., loss of this region increases the specific in vitro activity of atgl against artificial tg substrates but blunts the intracellular activity due to the inability of the truncated enzyme to bind to cellular lds . regulation of atgl expression and enzyme activity is complex ( lass et al ., 2011). atgl mrna expression is elevated by peroxisome proliferator - activated receptor (ppar) agonists, glucocorticoids, and fasting, whereas insulin and food intake decrease expression. more recently, it was shown that mtor complex 1-dependent signaling reduces atgl mrna levels (chakrabarti et al ., 2010). conversely, activation of foxo1 by sirt1-mediated deacetylation activates lipolysis by increasing atgl mrna levels. sirt1 silencing has the opposite effect (chakrabarti et al ., 2011). the abundance of atgl (and hsl) mrna does not always correlate with cellular lipase activity. for example, isoproterenol and tumor necrosis factor- reduce atgl (and hsl) mrna levels in adipocytes (kralisch et al ., 2005) but, conversely, stimulate lipase activities and fa and glycerol release. the discrepancy between enzyme mrna levels and activities is explained by the extensive posttranslational regulation of atgl and hsl (discussed below). at least two serine residues in atgl can be phosphorylated (s406 and s430 in the murine enzyme) (bartz et al ., 2007). in contrast to hsl (see below), atgl modification is not protein kinase a (pka)-dependent (zimmermann et al ., 2004). sul recently showed that amp - activated kinase (ampk) phosphorylates s406, leading to increased hydrolytic activity of murine atgl (ahmadian et al ., 2011). the role of ampk in the regulation of lipolysis has been controversial, with data showing that ampk induces (gaidhu et al . , 2009 ; yin et al ., 2003), inhibits (daval et al ., 2005 ; gauthier et al ., 2008), or has no effect (chakrabarti et al ., 2011) on lipolysis. interestingly, in the nematode caenorhabiditis (c.) elegans, ampk - mediated phosphorylation of atgl-1 (the worm ortholog of mammalian atgl) at different phosphorylation sites inhibits tg hydrolysis (narbonne and roy, 2009), delays the consumption of tg stores, and prolongs life span during the stress - induced dauer larval stage. (cgi-58), for full hydrolase activity (lass et al ., 2006). cgi-58 was originally discovered in a screen comparing the proteomes of humans and c. elegans. the gene is now officially named / hydrolase domain - containing protein-5 (abhd5), owing to the presence of an / hydrolase domain commonly found in esterases, thioesterases, and lipases. however, cgi-58 is unlikely to exhibit hydrolase activity due to the fact that asparagine-153 (n153) in cgi-58 replaces a nucleophilic serine residue that is required in the active site of enzymatically functional members of the esterase / thioesterase / lipase family. interestingly, substitution of n153 by serine does not convert cgi-58 into a lipid hydrolase for tgs, dgs, mgs, or short fa - glycerol esters (a. lass et al ., unpublished). in the epidermis of the skin, cgi-58 may also stimulate another, currently unknown, tg hydrolase distinct from atgl (radner et al ., 2010). importantly, two laboratories showed that cgi-58, at least in vitro, exhibits enzymatic activity as an acylcoa - dependent acylglycerol-3-phosphate acyltransferase (agpat) (ghosh et al . it may affect phosphatidic acid or lysophosphatidic acid signaling ( brown et al ., 2010). recently, (yang et al ., 2010b) discovered a specific peptide inhibitor for atgl. the protein was originally identified in blood mononuclear cells to act at the g0 to g1 transition of the cell cycle. consistent with this function, it was named g0g1 switch protein 2 (g0s2). human and murine g0s2 have a predicted primary structure of 103 aa. the protein is found in many tissues, with highest concentrations in adipose tissue and liver. consistent with lipase activities, g0s2 expression is very low in adipose tissue during fasting but increases after feeding (yang et al ., 2010b). conversely, fasting or ppar-agonists increase hepatic g0s2 expression (zandbergen et al ., 2005). the protein localizes to multiple cellular compartments, including lds, cytoplasm, er, and mitochondria. the different localizations may reflect multiple functions for g0s2 in regulating lipolysis, the cell cycle, and, possibly, apoptosis via its ability to interact with the mitochondrial antiapoptotic factor bcl2 (welch et al ., 2009). in vitro, ld binding and inhibition of atgl depend on a physical interaction between the nh2-terminal region of g0s2 (involving aa 2742) and the patatin domain of atgl (lu et al ., 2010). elucidation of whether g0s2 also regulates tissue - specific lipolysis in vivo will require the characterization of g0s2 transgenic and knockout mouse models. ld - associated proteins participate in the cgi-58-mediated regulation of atgl (figure 1, left). in hormonally nonstimulated white and brown adipocytes, perilipin-1 interacts with cgi-58, preventing its binding to and, thus, induction of atgl. upon -adrenergic stimulation, protein kinase a (pka) phosphorylates perilipin-1 at multiple sites, including the critical serine-517 residue, causing the release of cgi-58. thus, -adrenergic stimulation of pka induces atgl activity by phosphorylation of perilipin-1 and not by direct enzyme phosphorylation. consistent with this model, frameshift mutants of perilipin-1 in humans (l404fs and v398fs) fail to bind cgi-58, leading to unrestrained lipolysis, partial lipodystrophy, hypertriglyceridemia, and insulin resistance (gandotra et al ., 2011). atgl - mediated tg hydrolysis in nonadipose tissues with high fa oxidation rates, such as muscle and liver, follows another mechanism. in these tissues, perilipin-1 is replaced by perilipin-5 (figure 1, right). during fasting, perilipin-5 recruits both atgl and cgi-58 to lds by direct binding of the enzyme and its coactivator. formation of the ternary complex involves the cooh - terminal region of perilipin-5 (aa 200463) (granneman et al ., 2011). recent data suggest that it is involved in the interaction of lds with mitochondria and inhibits atgl - mediated tg hydrolysis (wang et al ., 2011). whether perilipins-2, -3, and -4 also interact with either atgl or cgi-58 is disputed. overexpression of perilipin-2 in hepatocyte cell lines inhibits atgl activity by restricting its physical access to lds. direct protein - protein interaction is probably not required (bell et al ., 2008 ; listenberger et al ., 2007). recently, several groups reported that pigment epithelium - derived factor (pedf) induces tg hydrolysis in adipose tissue, muscle, and liver, via atgl (borg et al ., 2011 ; pedf is a widely expressed 50 kd protein of the noninhibitory serpin family of serine protease inhibitors ( filleur et al ., 2009). it exhibits a large spectrum of bioactivities, including antiangiogenic, antitumorigenic, neuroprotective, antioxidative, and antiinflammatory effects. pedf binds to atgl and activates its enzymatic activity (borg et al ., 2011 ; notari et al ., 2006 although the mechanism remains to be clarified, atgl activation by pedf may be involved in the pathogenesis of insulin resistance and the development of hepatosteatosis . another important aspect of atgl regulation was identified by genetic analyses of ld formation in drosophila ( d.) melanogaster l2 cells (beller et al ., 2008 ; guo et al ., compelling showed that atgl delivery to lds requires functional vesicular transport . in the absence of essential protein components of the transport machinery, such as adp - ribosylation factor 1 ( arf1), small gtp - binding protein 1 (sar1), the guanine - nucleotide exchange factor golgi - brefeldin a resistance factor (gbf1), or deficiency of the coatamer protein coat - complex i and ii , atgl translocation to lds is blocked and the enzyme remains associated with the er (soni et al ., 2009). the process requires physical binding of atgl to gbf1 (ellong et al ., 2011). in the early 1960s, it was noted that a lipolytic activity present in adipose tissue was induced by hormonal stimulation. a landmark paper published by d. steinberg's group (vaughan et al ., 1964) although this classic work originally noted that hsl is a much better dg hydrolase than tg hydrolase, standard textbook knowledge perpetuated the that hsl was rate - limiting for the catabolism of fat stores in adipose and many nonadipose tissues. this view required revision when hsl - deficient mice efficiently hydrolyzed tgs (osuga et al ., 2000). hsl - deficient mice showed no signs of tg accumulation in either adipose or nonadipose tissues; instead, they accumualted large amounts of dgs in many tissues, suggesting that in vivo the enzyme was more important as a dg- than a tg - hydrolase (haemmerle et al ., 2002). although originally somewhat controversial (rydn et al ., 2007), it is now accepted that atgl is responsible for the initial step of lipolysis in human adipocytes, and that hsl is rate - limiting for the catabolism of dgs (bezaire et al ., 2009). in addition to dgs, hsl also hydrolyzes ester bonds of many other lipids (e.g., tgs, mgs, cholesteryl esters, and retinyl esters) and short - chain carbonic acid esters (fredrikson et al ., 1986). highest mrna and protein concentrations are found in white adipose tissue (wat) and brown adipose tissue (bat); low expression is detected in many other tissues, including muscle, testis, steroidogenic tissues, and pancreatic islets (holm et al ., 2000). alternative exon usage leads to tissue - specific differences in mrna and protein size (holst et al ., in adipose tissue, the hsl protein comprises 768 aa . unlike atgl, with orthologous enzymes found across all eukarya, hsl is less ubiquitous phylogenetically . for example, no hsl ortholog is known in birds, c. elegans, d. melanogaster, and saccharomyces ( s.) cerevisiae. interestingly, the closest structural relatives to hsl are found in prokaryotes (e.g., lipase 2 in moraxella ta144) (langin et al ., 1993). functional studies have delineated in hsl an nh2-terminal lipid - binding region, the / hydrolase fold domain including the catalytic triad, and the regulatory module containing all known phosphorylation sites important for regulation of enzyme activity (holm et al ., 2000). since atgl and hsl hydrolyze tgs in a coordinated manner, it is not unexpected that they share many regulatory similarities. in adipose tissue, hsl enzyme activity is strongly induced by -adrenergic stimulation, whereas insulin has a strong inhibitory effect. while -adrenergic stimulation regulates atgl primarily via recruitment of the coactivator cgi-58 (see above), hsl is a major target for pka - catalyzed phosphorylation (strlfors and belfrage, 1983). other kinases, including ampk, extracellular signal - regulated kinase, glycogen synthase kinase-4, and ca / calmodulin - dependent kinase, also phosphorylate hsl to modulate its enzyme activity (lass et al ., the enzyme has at least five potential phosphorylation sites, of which s660 and s663 appear to be particularly important for hydrolytic activity ( anthonsen et al ., 1998). enzyme phosphorylation affects enzyme activity moderately (an approximate 2-fold induction). for full activation , hsl must gain access to lds, which, in adipose tissue, is mediated by perilipin-1. simultaneously with hsl, pka also phosphorylates perilipin-1 on six consensus serine residues. as a , hsl binds to the nh2-terminal region of perilipin-1, thereby gaining access to lds (miyoshi et al ., 2007 ; shen et al ., 2009 ; wang et al ., 2009). together, hsl - phosphorylation and enzyme translocation to lds coupled with atgl activation by cgi-58 in a more than 100-fold increase in tg hydrolysis in adipocytes (figure 1). for example, receptor - interacting protein 140 (rip-140) was shown to induce lipolysis by binding to perilipin-1, increasing hsl translocation to lds, and activating atgl via cgi-58 dissociation from perilipin-1 (ho et al ., 2011). in nonadipose tissues, such as skeletal muscle, hsl is activated by phosphorylation in response to adrenaline and muscle contraction (watt et al ., 2006). these tissues lack perilipin-1, and it remains to be determined which alternative mechanisms regulate hsl access to lds. insulin - mediated deactivation of lipolysis is associated with transcriptional downregulation of atgl and hsl expression (kershaw et al ., 2006 ; kralisch et al ., additionally, insulin signaling in phosphorylation and activation of various phosphodiesterase ( pde) isoforms by pkb / akt (enoksson et al ., 1998), pde - catalyzed hydrolysis of camp, and inhibition of pka. these actions halt lipolysis by preventing phosphorylation of both hsl and perilipin-1, activation and translocation of hsl, and activation of atgl by cgi-58. in addition to its peripheral action, insulin also acts centrally via the sympathetic nervous system to inhibit lipolysis in wat. elegant studies by scherer and coworkers (scherer et al ., 2011) showed that increased insulin levels in the brain inhibit hsl and perilipin phosphorylation, leading to reduced hsl and atgl activities. mgl is considered to be the rate - limiting enzyme for the breakdown of mgs derived from extracellular tg hydrolysis (by lpl), intracellular tg hydrolysis (by atgl and hsl), and intracellular phospholipid hydrolysis (by phospholipase c and membrane - associated dg lipase and). the enzyme localizes to cell membranes, cytoplasma (sakurada and noma, 1981), and lds (unpublished data). mgl received significant attention following the realization that glycerophospholipid - derived mg 2-arachidonylglycerol (2-ag) is a major agonist for endocannabinoid signaling and is inactivated by the hydrolytic activity of mgl (see mg - signaling, below). the importance of mgl for efficient degradation of mgs was recently confirmed in mutant mouse models (chanda et al ., 2010 ; schlosburg et al ., 2010 ; taschler et al ., lack of mgl impairs lipolysis and is associated with increased mg levels in adipose and nonadipose tissues alike . mgl shares homology with esterases, lysophospholipases, and haloperoxidases, and contains a consensus gxsxg motif within a catalytic triad ( s122, a239, and h269 for mouse mgl) that is typical of lipases and esterases. very recently, the crystal structure of mgl was solved (bertrand et al ., 2010 ; the enzyme exhibits the classic fold of the / hydrolases, crystallizes as a dimer, and exhibits a wide, hydrophobic access to the catalytic site . an apolar helix - domain lid covers the active site and mediates the interaction of mgl with membrane structures and the recruitment of substrate . experiments with atgl - deficient mice and small - molecule hsl inhibitors revealed that atgl and hsl are responsible for more than 90% of the lipolytic activity in wat and cultured adipocytes ( schweiger et al ., 2006). in nonadipose tissues, the contribution of other neutral lipases to the catabolism of stored tgs may be more prominent. for example, in the liver of fasted mice, atgl accounts for less than 50% of neutral tg hydrolase activity (reid et al ., 2008). this activity is physiologically important because atgl - deficient mice develop hepatosteatosis (haemmerle et al . however, the pronounced remaining activity of hepatic tg hydrolase(s) in atgl - deficient mice indicates that other lipases contribute to the highly dynamic turnover of tgs. this view is supported by the observation that mice lacking atgl in the liver have no apparent defect in vldl biogenesis (wu et al ., 2011), although assembly and secretion of hepatic vldl particles require substantial mobilization of hepatic tg stores. because hsl is also poorly expressed in hepatocytes several members of the carboxylesterase / lipase family and the pnpla family have been suggested as potential tg hydrolases. one of them, carboxyl esterase-3/triglyceride hydrolase-1 (ces-3/tgh-1, ortholog of human ces-1), has gained major interest because the recent characterization of ces-3/tgh-1-deficient mice provided compelling evidence that the enzyme participates in the assembly and secretion of hepatic vldl (wei et al ., 2010). how this biological function conforms to the strict luminal localization of tgh-1 in the er remains to be elucidated. structural relatives of atgl within the pnpla family were also considered as potential tg hydrolases. for example, pnpla4 and -5 exhibit tg - hydrolase, dg transacylase, and retinylester hydrolase activity in vitro (kienesberger et al ., the member with highest homology to atgl is adiponutrin ( pnpla3), with over 50% aa identity within the patatin domain. adiponutrin was originally discovered as a nutritionally regulated adipose - specific transcript of unknown function (baulande et al ., 2001). interest in adiponutrin increased tremendously when h. hobbs and colleagues found a strong genetic association between a nonsynonymous aa change (i148 m) in adiponutrin and susceptibility to develop nonalcoholic fatty liver disease (nafld) (romeo et al ., 2008). several other groups confirmed and extended this important finding by showing robust associations of i148 m with alcoholic- and nonalcoholic liver disease, hepatic fibrosis, and liver cirrhosis (krawczyk et al ., 2011 ; tian et al ., 2010 ; the close similarity to atgl as well as the presence of conserved structural motifs typical for lipases / esterases ( sandwich structure and the gxsxg motif within a catalytic dyad) suggest a lipase function for adiponutrin. in accordance with this assumption, several groups reported that adiponutrin acts as a tg hydrolase and additionally exhibits dg transacylase activity (he et al . , 2010 ; huang et al ., 2011 ; jenkins et al ., 2004 ; lake et al ., however, the expression profile generated in response to fasting / feeding and the induction of adiponutrin gene expression by srebp1a / c and chrebp argued against an in vivo role of adiponutrin in lipolysis ( dubuquoy et al . , 2011 ; he et al ., 2010 ; kershaw et al . was also confounded when pnpla3-deficient mice exhibited no detectable phenotype in lipid, lipoprotein, or energy metabolism ( basantani et al . overexpression of the i148 m variant of adiponutrin caused tg accumulation ( he et al ., 2010), whereas overexpression of wild - type adiponutrin in the liver created no obvious phenotype (he et al ., 2010). in addition to classical lipolysis by extralysosomal neutral lipases, tgs and cholesteryl esters can also be hydrolyzed by lal. lal is thought to catabolize primarily lipoprotein - associated lipids subsequent to their receptor - mediated endocytosis and fusion with lysosomes. accordingly, the contribution of lal activity to lipolysis of intracellular lds was not considered relevant. given the lysosomal localization of lal, it was not intuitively obvious how lipids from lds would enter lysosomes. addressing this, singh and colleagues reported compelling evidence linking lipolysis to macroautophagy (singh et al ., 2009a). macroautophagy is a lysosomal pathway that degrades superfluous or damaged organelles as well as cytoplasmic inclusions, such as misfolded protein aggregates (levine and kroemer, 2008). these cytoplasmic cargos are trapped inside double - membrane vesicles (autophagosomes) that ultimately fuse with lysosomes, where their contents are degraded. subsequently, lipids and aa are released into the cytosol and contribute to energy and aa supply in times of starvation. thus, along with lipolysis, macroautophagy is one of two conserved responses to organismal and cellular fasting. , 2009a ) found that, in addition to conventional neutral lipases, autophagy of lds is required for fasting - induced lipolysis in murine liver and cultured hepatocytes. they showed that recruitment of microtubule - associated protein 1 light chain 3 (lc-3) and formation of a regional membrane through conjugation of autophagy - related protein 7 (atg7) gives rise to double - membrane vesicles that engulf portions of cytoplasmic lds (autolipophagosomes). the autolipophagosomes ultimately fuse with lysosomes, where their lipid content is degraded by lal. chronic fat feeding impairs the autophagic removal of lipid stores in the liver, prompting excessive hepatic lipid deposition. , 2010a ) strengthened these findings by showing that hepatic atg7 expression is severely impaired in ob / ob mice, contributing to the hepatosteatosis in these animals. while the effects of autophagy in genetically obese mice and in mice fed high - fat diets seem consistent, a role for autophagy in lipid metabolism of normal mice remains controversial. first, autophagy appears to be predominantly relevant in the liver after abnormally long fasting periods. normally, during shorter fasting periods the hepatic fat content increases due to the induction of adipose tissue lipolysis and increased fa supply to the liver. consistent with this prediction, hotamisligil and colleagues did not observe hepatic steatosis or changes in serum tg or fa levels in lean mice following sirna - mediated suppression of atg7, arguing that lipoautophagy is not involved (yang et al ., 2010a). second, hepatosteatosis as a of atg7 deficiency was observed in some but not all studies. although atg7 deficiency leads to severe liver enlargement, it is controversial whether tgs accumulate. in fact, uchiyama and colleagues reported that hepatic atg7 deletion upon starvation inhibits ld formation both in vivo and in vitro, which leads to a lower hepatic tg content (shibata et al . consistent with a role for lc3 in ld formation, rnai - mediated suppression of lc3-expression prevented ld formation in a panel of different ( hepatic and nonhepatic) cell lines. interestingly, lc3 localized to the surface of lds, and the authors argued that lipidation of lc3 by phosphatidylethanolamine (formation of lc3-ii), which is the initial step in autophagosome formation during autophagy, is also required for ld formation. a potential role of autophagy in lipogenesis but not in lipolysis is consistent with the finding that external administration of fas induces, rather than inhibits, autophagy when lds are formed in the fasting liver (tang et al ., 2011). a role for autophagy in lipogenesis also became evident from analysis of adipose tissue in atg7-deficient mice. assuming a lipolytic defect , we speculated that ablation of autophagy in adipocytes would in an obese phenotype (zechner and madeo, 2009). in contrast, however, adipose - specific knockout of atg7 ed in lean mice with reduced adipose mass, enhanced insulin sensitivity, and an elevated rate of -oxidation (singh et al ., 2009b). the adipocytes contained smaller, multilocular lds and exhibited normal basal lipolysis. in line with this, inhibition of autophagy in cultured adipocytes using atg7 sirna blocked tg accumulation (singh et al . these data argue for a currently poorly understood role of autophagy in the biogenesis of lds . interestingly, while adipose - specific atg7-deficient mice display reduced wat mass, bat mass increases ( baerga et al ., 2009 ; argued that inhibition of white adipocyte differentiation may lead to a defect in lipogenesis or that blocked autophagy may promote wat to bat transdifferentiation . in summary, autophagy may have pleiotropic roles in lipid metabolism depending on the cell- or tissue - type . in the liver , autophagy may contribute to lipolysis under a high - fat diet or prolonged fasting . , autophagy appears to be involved in adipocyte differentiation and lipogenesis but not in lipolysis . the role of autophagy in the breakdown of fat in other lipolytically active tissues, such as muscle, macrophages, and steroidogenic cells remains to be determined . textbook knowledge tells us that tgs are the most efficient way to store large amounts of fas as an energy reserve . consistent with this view, cellular lds were long seen as a relatively inert storage depot for fat in adipose tissue that is mobilized at times of increased energy demand . this view changed when it was realized that 1) lds are present in essentially all cell types, including those for which mere energy storage does not seem to be the main purpose; 2 ) lds, particularly in nonadipose tissues, undergo very dynamic changes of formation and degradation; and 3 ) lds represent a reservoir of bioactive lipids and lipid - derived hormones in adipose and nonadipose tissues. a role for neutral lipid metabolism in signaling gained substantial interest when it was noted that increased cellular tg concentrations are strongly associated with insulin resistance in skeletal muscle and liver (cohen et al . the relatively inert nature of tgs makes it unlikely that they interfere directly with insulin signaling . the concept that tgs themselves are not the culprit was also supported by the so - called athletes ' paradox . endurance athletes accumulate more tgs in lds of skeletal myocytes than do untrained individuals, yet their muscle is highly insulin - sensitive . similarly, mice that lack atgl accumulate large amounts of fat in numerous tissues ( including skeletal muscle, cardiac muscle, liver, kidneys, and macrophages) but exhibit increased insulin sensitivity (haemmerle et al ., 2006 ; increased insulin sensitivity is observed despite the fact that atgl - deficiency leads to an insulin - secretion defect in pancreatic islets ( peyot et al ., 2009). in humans , atgl - deficiency leads to neutral lipid storage disease with myopathy (nlsdm), with a similar lipid phenotype as observed in atgl - deficient mice (fischer et al ., 2007). patients lacking the atgl coactivator cgi-58 not only develop neutral lipid storage disease but also exhibit a severe skin defect (neutral lipid storage disease with ichthyosis, nlsdi) (lefvre et al ., 2001). to date, defective pancreatic insulin production and alterations in insulin sensitivity have not been reported in patients with nlsdm or nlsdi. in , cellular tg content can be a marker of insulin resistance under certain physiological conditions but is not a regulator of insulin signaling. besides their powerful role as energy substrates and precursors of other lipids, fas or fa derivatives can bind to and activate members of the nuclear receptor family of transcription factors that control the expression of genes involved in lipid and energy homeostasis and inflammation. the ppar family consists of four members: ppar, ppar-1 and -2, and ppar (also designated ppar). ppar and ppar are highly expressed in oxidative tissues and regulate genes involved in substrate delivery, substrate oxidation, and oxidative phosphorylation (oxphos). in contrast, ppar is more important in lipogenesis and lipid synthesis, with highest expression levels in wat. the full transcriptional activity of ppars requires the binding of cognate lipid ligands, heterodimerization with another nuclear receptor (retinoid - x receptor, rxr), and interaction with a number of transcriptional coactivators, including ppar coactivator-1 (pgc-1). in addition to fas, other lipid ligands also have been described to activate ppars, such as acyl - coas, glycerol - phospholipids, and eicosanoids. fas involved in signaling originate from import of exogenous fas (from circulating fa - albumin complexes or from lpl - mediated hydrolysis of plasma vldl and chylomicrons) or from endogenous de novo synthesis. recently it was shown that neither source of fa can generate ppar ligands directly; rather, a cycle of fa esterification and rehydrolysis is required (haemmerle et al ., 2011) lipolysis - impaired atgl - deficient mice exhibit a severe defect in ppar signaling in oxidative tissues such as liver (ong et al ., 2011), macrophages (chandak et al ., 2010), and bat (ahmadian et al ., 2011). the most dramatic phenotype is observed in cardiac muscle (haemmerle et al ., 2011). the reduced expression of ppar target genes in atgl knockout animals causes severe mitochondrial dysfunction, decreased rates of substrate oxidation and oxphos, massive cardiac lipid accumulation, and lethal cardiomyopathy within a few months after birth. hsl deficiency is also associated with moderately decreased ppar target - gene expression but does not generate a comparable cardiac phenotype, indicating the specific importance of atgl activity in the generation of ppar ligands or ligand precursors. nlsdm or nlsdi in humans due to the deficiency of atgl or cgi-58, respectively, may also lead to reduced ppar signaling and defective oxphos. although not proven experimentally, this assumption stems from the finding that nlsdm patients also develop systemic tg accumulation and cardiomyopathy. in many patients, this condition is lethal if they do not undergo heart transplantation (hirano et al ., 2008). importantly, at least in mice, the mitochondrial defect can be prevented by application of ppar activators, such as wy16453 or fenofibrate (haemmerle et al ., 2011). treatment of atgl - deficient mice leads to increased ppar signaling, disappearance of cardiac steatosis, and improved mitochondrial function and oxphos, as well as prolonged survival. whether pharmacological ppar activation will also be beneficial for patients with nlsdm is currently not known but remains a promising possibility. in addition to the instrumental role of atgl in ppar signaling, the enzyme may also affect ppar function. (festuccia et al ., 2006) showed that rosiglitazone - mediated ppar activation and lipid accumulation are associated with increased lipolysis in wat of rats and that increased lipolysis was due to induction of atgl and mgl. although it seems counterintuitive that lipolysis is induced during increased tg synthesis, it is conceivable that this step is required to promote ppar-activated expression of lipogenic genes. moreover, the fact that hsl - deficiency also leads to downregulation of ppar target - gene expression in wat (shen et al ., 2011 ; zimmermann et al ., 2003 it is well established that both plasma and cellular fa concentrations correlate positively with increased insulin resistance ( boden and shulman, 2002). increased cellular concentrations of nonesterified fas, particularly palmitate, can drive the synthesis of lipotoxic lipids such as ceramides, which interfere with functional insulin signaling (summers, 2010). additionally, fas can directly or indirectly via increased production of reactive oxygen species activate redox - sensitive serine kinases, which, in turn, inactivate the insulin response (vallerie and hotamisligil, 2010). yet , not all fa species seem to have the same inhibitory effect on insulin signaling. whereas palmitate consistently decreases the insulin response, palmitoleate actually enhances the insulin signal in liver and muscle (cao et al ., 2008). its effects on insulin signaling in liver and muscle suggest that this fa is a lipokine with endocrine function. additionally, it is conceivable that hepatic palmitoleate also contributes to insulin sensitization in a paracrine fashion. whether lipolysis contributes to the generation of palmitoleate or other fas with a downstream effect on insulin signaling requires additional studies. atgl - deficient mice have low plasma fa concentrations and are highly insulin - sensitive, arguing for a protective role of reduced lipolysis and low fa levels. whether low plasma fas in hsl - deficient mice also affect insulin sensitivity is controversial (mulder et al ., 2003 ; park et al ., 2005 ; voshol et al ., the potential of dgs to act as second messengers was discovered approximately 50 years ago when researchers realized that dgs affect many metabolic and mitogenic activities via activation of protein kinase - c ( pkc). metabolic regulation involves suppression of insulin signaling via phosphorylation of insulin receptor substrate-1, leading to insulin resistance in muscle and liver (samuel et al ., 2010). only one dg stereoisomer, 1,2-diacyl - sn - glycerols (1,2-dgs), is able to activate pkcs, whereas the others, 1,3-diacyl - sn - glycerols (1,3-dgs) and 2,3-diacyl - sn - glycerols (2,3-dgs), lack this bioactivity (boni and rando, 1985). 1,2-dgs activate conventional and novel pkc isoforms after recruitment of the enzymes to the plasma membrane by receptor of activated c kinase (rack) proteins (turban and hajduch, 2011). accordingly, both stereo - specific and location - specific preconditions are required for dgs to activate pkcs. classical signaling 1,2-dgs derive from phospholipase c (plc)-mediated hydrolysis of phosphatidylinositol-4,5-phosphate in the plasma membrane.. both products of the enzymatic reaction, 1,2-dgs and inositol-1,4,5-phosphate (ip3), are potent second messengers. whereas 1,2-dgs remain plasma membrane - associated, ip3 dissociates and induces ca release from the er, which is required in addition to 1,2-dgs for activation of conventional pkcs. although plcs generate the correct stereoisomer (1,2-dgs) in the correct cellular location for pkc activation, it remains controversial whether other cellular sources also contribute to the production of signaling 1,2-dgs. de novo synthesis via dual acylation of sn - glycerol-3-phosphate by acyl - coa glycerol-3-phosphate acyltransferases (gpats) and acyl - coa acylglycerol-3-phosphate acyltransferases (agpats), and subsequent dephosphorylation of phosphatidic acid by phosphatidic acid phosphohydrolases (papases) also leads to the formation of 1,2-dgs (figure 3). however, this pathway of dg synthesis is restricted to er membranes. accordingly, a model proposing activation of pkc by er - associated 1,2-dgs needs to include pkc localization to the er or contact sites between the plasma membrane and the er membrane. the third potential source of dgs derives from the lipolysis of ld - associated tgs by atgl (figure 3). however, our unpublished observations showed that the enzyme preferentially hydrolyzes sn-1 and sn-2 ester bonds but not sn-3 esters. this indicates that atgl generates 1,3-dgs and 2,3-dgs but not 1,2-dgs. in accordance with the subsequent hydrolysis of 1,3-dgs and 2,3-dgs by hsl , this enzyme has a stereo - preference for the hydrolysis of fas in the sn-3 position of dgs (rodriguez et al ., 2010). in tgs, hsl preferably hydrolyses sn-1 ester bonds (fredrikson and belfrage, 1983). therefore, additionally, it is questionable whether ld - associated dgs would dissociate from lds to participate in the recruitment and activation of pkc at the plasma membrane. from all this , it seems unlikely that lipolytically generated dgs act as signaling mediators. in a recent review, shulman and colleagues (samuel et al ., 2010) summarized numerous animal and human studies providing evidence that cellular dg concentrations account for the development of lipid - induced insulin resistance in type 2 diabetes, lipodystrophy, and other conditions. consistent with this hypothesis, mice lacking dg - kinase-, the major enzyme that inactivates the dg signal, have increased dg levels and increased insulin resistance (chibalin et al ., 2008). however, considering the structural complexity of dg species and their localization in different cellular compartments, a general correlation between total cellular dg concentrations and insulin resistance seems unlikely. this is supported by studies where increased total cellular dg concentrations in mutant mouse models were not associated with insulin resistance. for example, hsl - deficient mice accumulate large amounts of dgs in adipose and many nonadipose tissues due to defective dg catabolism. yet, most studies agree that this does not lead to pkc hyperactivation or a severely defective insulin response (mulder et al ., 2003 ; park et al ., 2005 ; voshol et al ., similarly, cgi-58 silencing in the liver leads to increased dg levels, but normal ( chow diet) or increased (high - fat diet) glucose tolerance and insulin sensitivity (brown et al ., 2010). taken together , determination of the specific 1,2-dg concentrations in the plasma membrane may provide a more reliable predictor for lipid - induced, pkc - mediated insulin resistance than total cellular dg concentrations. the signaling potential of mgs was recognized when it was found that the phospholipid - derived mg 2-ag activates cannabinoid receptors (cbr), thereby regulating food intake, lipid metabolism, and energy homeostasis. the endocannabinoid system (ecs) refers to a group of neuromodulatory lipids (endocannabinoids, ecs), two g protein - coupled receptors (cbr1 and cbr2), and enzymes involved in the synthesis and degradation of ecs (di marzo, 2009). the best - characterized ecs are n - arachidonoyl ethanolamine (aea, anandamide) and 2-ag. their biological effect is mimicked by -tetrahydrocannabinol (thc), the major psychoactive component of marijuana. the ecs regulates a diverse spectrum of physiological processes, including motor function, pain, appetite, cognition, emotional behavior, and immunity. in the nervous system, 2-ag acts as a retrograde messenger, inhibiting presynaptic neurotransmitter release (alger and kim, 2011) subsequently, 2-ag is internalized into the presynaptic terminal and inactivated by the mgl reaction, forming glycerol and arachidonic acid. the ecs is active in neurons and nonneuronal cells such as immune cells, hepatocytes, and adipocytes. treatment of obese patients with the cbr1-antagonist rimonabant (christopoulou and kiortsis, 2011) and studies with animal models lacking cbr1 revealed that blockade of the ecs reduces food intake, decreases lipogenesis, and increases energy consumption. conversely, an overactive ecs has a central orexigenic effect and reduces energy expenditure, promoting lipid deposition in peripheral tissues like the liver and wat (cota, 2008). because of these biological effects obese patients may have an overactive ecs, which stimulates appetite and promotes lipid deposition (perkins and davis, 2008). it is generally assumed that signaling 2-ag originates from the degradation of glycerophospholipids containing arachidonic acid in the sn-2 position (figure 3). various isoforms of plc generate 1,2-dgs (see above), which are subsequently hydrolyzed by dg lipase (dagl) to 2-ag. whether hsl also participates in the hydrolysis of plasma membrane - associated 1,2-dgs to generate 2-ag is not known. current evidence suggests that at least two isoforms of dagl (dagl and dagl) exist in the brain and liver (bisogno et al ., 2003). mice lacking dagl exhibit a substantial decrease in brain and spinal cord 2-ag levels, whereas dagl appears to be more important in peripheral tissues, such as the liver (gao et al ., 2010). whether the catabolism of arachidonic acid - containing tgs in lds by atgl and hsl also contributes to the cellular 2-ag and arachidonic acid pool is not known. recent studies using an mgl - specific small - molecule inhibitor (jzl184) and mgl knockout mice provided compelling evidence that mgl is the major enzyme in the degradation of 2-ag and other mgs esterified with long - chain fas (chanda et al ., 2010 ; schlosburg et al ., 2010 ; taschler et al ., animals lacking mgl or mice treated with jzl184 show abnormally high amounts of various mg species in the brain and peripheral tissues . in the brain, lack of mgl activity leads to a more than 20-fold increase in 2-ag, suggesting that mgl - deficiency could lead to hyperactivation of the ecs . indeed, jzl184 treatment of mice provoked cannabimimetic effects in mice, including analgesia, hypothermia, and hypomotility ( long et al ., however, genetic ablation of mgl in mice did not in a hyperactive ecs or any obvious phenotype . this surprising observation was explained by desensitization of brain cbr1 leading to functional antagonism, and highlights the important role of 2-ag as a retrograde neurotransmitter ( chanda et al ., 2010 ; 2010). obviously, increased brain 2-ag concentrations provoke counter - regulatory mechanisms similar to those observed when animals are chronically fed cbr agonists (lichtman and martin, 2005). although mgl - deficiency in mice does not produce cannabimimetic effects, the lack of mgl activity substantially affects lipolysis and metabolism in adipose tissue and nonadipose tissues (taschler et al ., 2011). mgl deficiency in the accumulation of mgs and a reduction of circulating tg and glycerol levels in fasted animals. unexpectedly, and in contrast to the proposed role of the ecs in obesity - related metabolic diseases, mgl knockout mice exhibit improved insulin sensitivity and glucose tolerance when fed a high - fat diet. the cause for this finding may be complex, considering that mgl - deficiency is associated with desensitized cbrs. investigation of mice lacking mgl, specifically in the brain or peripheral tissues, should help to unravel the question of whether central or peripheral effects cause attenuation of insulin resistance. the first observation to indicate that lipolysis is linked to efficient cell - cycle progression was reported in the yeast s. cerevisiae. yeast expresses three tg lipases of the patatin domain - containing family termed tgl3 to 5 (czabany et al ., 2007). tgl4 is a functional ortholog of mammalian atgl (kurat et al ., 2006). deletion of tgl3 and tgl4 abolishes virtually all cellular tg lipase activity and causes a marked delay of entry into the cell division cycle of starved cells upon refeeding (kurat et al ., 2009). tgl4 is activated via phosphorylation by the cyclin - dependent kinase cdk1/cdc28 (ortholog of mammalian cdc2). this suggests that tg levels oscillate during the cell - division cycle to either deposit de novo synthesized fas in tgs or, conversely, to provide fas during phases of increased demand. tgl4 phosphorylation and activation occur at the g1/s transition of the cell - division cycle, which coincides with bud emergence and requires increased amounts of membrane lipids. pah1 phosphorylation and inactivation occur at the g2/m transition of the cell cycle, indicating that a window exists during the cell cycle in which both the initial step of lipogenesis and lipolysis may operate in parallel. this is feasible because both activities are confined to different organelles, namely the er and lds, respectively. the specific checkpoint proteins that regulate cell - cycle progression in response to lipolysis are currently unknown. recent evidence shows that the synthesis of phosphatidylinositol (pi), a precursor for signaling molecules in cell - cycle regulation in yeast (e.g., ip3 and inositol - containing ceramides), strongly depends on intact lipolysis (gaspar et al ., 2011). thus, cell cycle - regulated tg lipolysis may provide critical precursors for signaling molecules for cell division. a highly interesting study recently demonstrated that mgl promotes the oncogenic properties of mammalian cancer cells (nomura et al ., 2010). the authors demonstrated that overexpression or disruption of mgl activity increased or decreased, respectively, the proliferation of cancer cells, and that mgl is highly expressed in aggressive tumor cell lines or primary tumors. the study also provided evidence that mgl influences tumor proliferation by metabolic effects rather than by cbr - dependent mechanisms. growth of tumor cells in response to mgl - knockdown was not impaired after addition of exogenous nonesterified fas or in mice fed a high - fat diet. this led to the that mgl affects the concentration of fa - derived tumorigenic lipid metabolites, such as lpa and pge2. although the involved lipid signal(s) requires identification, these studies clearly designate mgl as an interesting target for cancer therapy. lipolytic signaling may also be causally involved in the pathogenesis of cancer - associated cachexia (cac). in a recent study, das et al. (das et al ., 2011) demonstrated that atgl - deficient mice are protected against tumor - induced loss of adipose tissue and skeletal muscle. atgl - deficient mice maintained body weight and composition despite increased circulating factors that induce lipolysis, muscle proteolysis, and apoptosis (e.g., tnf, interleukin-6, and zinc--glycoprotein 1). this suggests that lipolysis is integrated in a signal transduction network that eventually leads to the loss of adipose tissue and muscle. this view is also consistent with the observation that the activity of lipolytic enzymes and release of fas and glycerol are increased in adipose tissue of cancer patients with cachexia (agustsson et al . , 2007 ; das et al ., 2011 ; rydn et al ., it is also unclear whether the signal originates from lipolysis in one tissue ( such as adipose tissue) and promotes wasting in an endocrine manner or whether wasting requires autonomous lipolysis in all tissues that are affected by wasting. although the underlying mechanism is not yet defined, this study suggests that inhibition of lipolysis may help to prevent cachexia in patients with cancer or other chronic diseases. recent discoveries of enzymes and regulatory factors have led to a revision of our perception of lipolysis. additionally, we have just begun to address the role of lipolytic products and intermediates in cellular signaling. important topics for future investigations include: 1 ) better understanding of the biochemical factors and processes that coordinately regulate the lipolytic machinery in response to hormonal activators and inhibitors, 2 ) the physiological function of lipolysis in numerous nonadipose tissues and the tissue - specific differences in lipolytic mechanisms, and 3 ) the characterization of lipolytic signals and the molecular mechanisms of their effects on gene transcription, the cell cycle, and cell growth. the recent examples of lipases affecting tumor proliferation or cancer - associated cachexia emphasize the potential importance of lipolysis in human disease.

lipolysis is defined as the catabolism of triacylglycerols stored in cellular lipid droplets. recent discoveries of essential lipolytic enzymes and characterization of numerous regulatory proteins and mechanisms have fundamentally changed our perception of lipolysis and its impact on cellular metabolism. new findings that lipolytic products and intermediates participate in cellular signaling processes and that lipolytic signaling is particularly important in many nonadipose tissues unveil a previously underappreciated aspect of lipolysis, which may be relevant for human disease.

the prospective investigation conducted by fleischhackl and coworkers, reported in the previous issue of critical care, sets out to determine whether young students have the physical and cognitive skills to implement cardiopulmonary resuscitation (cpr). in this investigation, the average time from the last class of cpr instruction to the evaluation session was 120 days. it is not clear whether such a large gap in time between initial instruction and skills testing may have affected testing performance, except that good performance could indicate good retention. students tested also included those with special learning needs, which may skew the examination in an unfavorable direction. nevertheless, the outcomes were generally very good. as the investigators demonstrated, students as young as 9 years are able to effectively learn cpr skills, including automated external defibrillator deployment, correct recovery position, and emergency calling. as in adults, physical strength may have limited the depth of chest compressions and ventilation volumes, but perhaps the key finding was that skills retention was good. these findings are consistent with other studies in which none of the students aged 9 to 10 years could compress the chest to the depth recommend by the guidelines, but 45% of students aged 13 to 14 years old could. studies also have found that with retraining, cpr performance can improve in school - aged children. although the study by fleischhackl and coworkers did not specifically address this retraining, it would have been interesting to know how well these students would have retained their learned skills several months later, because it is well known that cpr skills rapidly deteriorate after initial training. intuitively, the higher the number of persons trained in cpr skills in a given community, the more frequently it is performed. for example, in los angeles, where the relative percentage of citizens trained in cpr is estimated to be relatively low, only a small percentage of bystanders performed cpr and just 1.4% of out - of - hospital cardiac arrest victims survived. however, 10-fold improvements in survival rates (> 15%) have been reported in seattle, where the frequency of bystander - performed cpr is one of the highest in the nation. in essence, one of the most effective means of improving surviving for out - of - hospital cardiac arrest is to attempt to train all individuals across a given community, and experience has shown that having captive audiences for training, such as in school systems, is a major component. when closely examining such numbers, the survival improvements are not linear but may actually be logarithmic. young children between the ages of 10 and 14 years only account for approximately 15% of the population in the usa, and they are not in the main target age group for cpr except for perhaps drowning incidents. however, there are multiple benefits from teaching school - aged children cpr beside the concept of capturing entire generations of cpr - trained citizens. children older than 10 years of age are teachable and capable of abstract thought, and most have the coordination and physical strength to perform cpr. the cpr kits that are currently being promoted by the american heart association are designed to train individuals who are as young as 8 years old in less than a half hour. it has been demonstrated that using such a kit that contains a self - instructional video and an inflatable manikin not only promotes retention but also has a multiplier effect. one study found that distributing cpr training kits to students aged 12 to 14 years ed in another 2.5 persons trained per student. furthermore, early training can lay the foundation for a sense of social obligation and reinforce cpr knowledge and follow - up training, so that by the time a student graduates from high school cpr skills are well engrained and can easily called upon in an emergency situation. if government agencies enforced mandatory age - appropriate cpr and first aid training in schools, similar to how schools practice evacuation and file drills, then one could only imagine the impact this could have on the number of individuals capable of intervening in out - of - hospital cardiac arrest and, in turn, the number of lives saved.

the usefulness of basic cardiopulmonary resuscitation (cpr) training in school systems has been questioned, considering that young students may not have the physical or cognitive skills required to perform complex tasks correctly. in the study conducted by fleishhackl and coworkers, students as young as 9 years were able to successfully and effectively learn basic cpr skills, including automated external defibrillator deployment, correct recovery position, and emergency calling. as in adults, physical strength may limit the depth of chest compressions and ventilation volumes given by younger individuals with low body mass index; however, skill retention is good. training all persons across an entire community in cpr may have a logarithmic improvement in survival rates for out - of - hospital cardiac arrest because bystanders, usually family members, are more likely to know cpr and can perform it immediately, when it is physiologically most effective. training captured audiences of trainees, such as the entire work - force of the community or the local school system, are excellent mechanisms to help achieve that goal. in addition to better retention with new half hour training kits, a multiplier effect can be achieved through school children. in addition, early training not only sets the stage for subsequent training and better retention, but it also reinforces the concept of a social obligation to help others.

both laryngoscopy as well as endotracheal intubation individually contribute to the hemodynamic pressor response following endotracheal intubation. it has also been shown that the type of laryngoscopic blade influences the degree of hemodynamic response. videolaryngoscopes have shown varying such as pentax aws (pentax corporation, tokyo, japan) has an attenuated response, whereas glidescope (saturn biomedical system inc ., burnbaby, canada) has shown similar hemodynamic response compared to macintosh laryngoscopy and endotracheal intubation. however, there are no studies evaluating the hemodynamic response of c - mac video laryngoscope (karl storz gmbh & co. kg, tuttlingen, germany) for endotracheal intubation. hence, we compared the hemodynamic response to oral endotracheal intubation using mccoy and c - mac laryngoscopy with that of conventional macintosh laryngoscopy in adult patients posted for elective surgery under general anesthesia. one recent study has shown that c - mac videolaryngoscopy needed less duration of laryngoscopy for successful intubation compared to macintosh laryngoscopy even in lateral position. duration of laryngoscopy is an expected variable to affect the degree of hemodynamic response to endotracheal intubation. hence, we hypothesized that the mccoy or c - mac laryngoscopy produces an attenuated hemodynamic response to laryngoscopy and oral endotracheal intubation compared to macintosh laryngoscopy. with the institute ethics committee's approval (csp - med/14/feb/12/34 dated 13 - 03 - 2014) and informed consent from all patients, this prospective randomized parallel group study was carried out. the procedures followed were in accordance with the ethical standards of the institutional research ethics committee standards and with that of the helsinki declaration of 1975, as revised in 2000. we included ninety american society of anesthesiologists (asa) i patients of 1840 years of age posted for elective surgery under general anesthesia. pregnant women, patients undergoing emergency surgery and those with airway abnormalities, and anticipated difficult airway (mallampati class iii and iv, thyromental distance < 6 cm, inter - incisor distance <3 cm, and cervical instability) were excluded from the study. in addition, the patients in whom laryngoscopy lasted for more than 30 s and if more than one intubation attempt was needed were also excluded. the study population was randomly allocated into three groups, namely group a (n = 30) laryngoscopy with macintosh laryngoscope (blade size 3) control group, group b (n = 30) laryngoscopy with mccoy laryngoscope (blade size 3), and group c (n = 30) laryngoscopy with c - mac video laryngoscope (d - blade). randomization was done by computer - generated random numbers and concealed by sealed envelope technique. this was done by a separate anesthesiologist who was not involved in performing laryngoscopy or data collection during the study. laryngoscopy and intubation were performed by a single senior anesthesiologist in all cases, who was familiar and experienced in intubation using both mccoy and c - mac laryngoscope. endotracheal tubes of size 8.5 mm i d in males and 7.5 mm i d in females were used. the endotracheal tubes were loaded with stylet shaped in a hockey stick fashion in all patients. standard monitoring was done with electrocardiogram ii and v leads, noninvasive blood pressure, and pulse oximetry (phillips intellivue mp50 ., philips healthcare, netherlands). after preoxygenation for 3 min with 100% oxygen, anesthesia was induced with midazolam 1 mg, fentanyl 2 mcg / kg, and thiopentone 5 mg / kg intravenously, and maintained with sevoflurane 2% in 100% oxygen. after checking for mask ventilation vecuronium 0.1 mg / kg was administered intravenously. at the end of 3 min, etco2 was maintained below 40 mmhg to avoid the effects of hypercarbia on the hemodynamic variables during the study period. no other medications were administered or procedures performed during the 10 min data collection period after endotracheal intubation. the study parameters monitored were heart rate (hr), systolic blood pressure (sbp), diastolic blood pressure (dbp), and mean arterial pressure (map). the above parameters are measured at the following intervals: baseline (bl before induction), just before intubation (t0), and 1 min (t1), 3 min (t3), 5 min (t5), and 10 min (t10) after intubation. the first reading of all the parameters after connecting the monitor inside the operating room and before preoxygenation was taken as bl reading. all the study parameters were collected and documented by the same observer who is blinded for the type of laryngoscope used. other parameters measured are duration of laryngoscopy with a stop clock by an independent observer. duration of laryngoscopy was defined as the time from the insertion of laryngoscope into the oropharynx till the appearance of first etco2 curve. intubation response was defined as: the hemodynamic changes in terms of hr, sbp, dbp, and map that occurs immediately and within 10 min after oral endotracheal intubation. significant hemodynamic response that would warrant intervention is defined in the study as a change in hr or blood pressure with a 20% change from bl. decrease in blood pressure or hr was treated with injection ephedrine 6 mg intravenous boluses. sample size calculation was done based on a pilot study done by us prior to the study with ten patients in each group comparing the hemodynamic response to laryngoscopy and oral endotracheal intubation with macintosh, mccoy, and c - mac videolaryngoscope. comparison of macintosh and c - mac group needed a sample size of 25 in each group to detect an effect size of 10 mmhg in the systolic pressure at a standard deviation (sd) of 12.8 with a power of 80% and alpha error of 0.05 whereas comparison of macintosh and mccoy group needed a sample size of about 23 patients in each group to detect an effect size of 13.6 mmhg in systolic pressure at a sd of 16 with a power of 80% and alpha error of 0.05. sample size calculation based on the data of previous study comparing the hemodynamic response with macintosh and mccoy laryngoscopy also arrived at a similar sample size. the collected data were analyzed with spss for windows, version 16.0 (spss inc ., chicago, il, usa). to describe about the data descriptive statistics, mean and hr, dbp, and demographic data had a normal distribution whereas sbp and map had a skewed distribution. the demographic data were analyzed by one - way analysis of variance. to find the significant difference between the bivariate samples in independent groups, the unpaired sample t - test was used for normal data and mann - whitney u - test for skewed data. for the repeated measures, the repeated measures of anova with adjustment for multiple comparisons to control the type i error, with bonferroni test was used for normal data and friedman followed by wilcoxon signed rank test for skewed data. in all the above statistical tools, the p < 0.05 was considered significant level. those patients who needed intervention with ephedrine were excluded from the study, since the subsequent readings would be affected by its administration. the demographic data in terms of age, weight, and height was similar in all groups. there was no statistically significant difference in the bl values of all the study parameters among the three groups. comparison of demographic data among groups on studying each group separately, in group a (macintosh), there was no statistically significant increase in any of the study parameters at all study intervals after intubation compared to the bl value. whereas in group b (mccoy), there was a statistically significant increase in hr response at 1 min interval (t1) from bl value with p = 0.003, and at other time intervals , there was no significant rise from bl in any of the study parameters. comparison of mean heart rate and systolic blood pressure of group b and group c with group a comparison of mean diastolic blood pressure and mean arterial pressure in group b and group c with group a there was a statistically significant increase in the hr at 1 min (t1) (p = 0.001) and 3 min (t3) (p = 0.004) interval from the bl hr in group c. whereas there was a statistically significant increase in dbp (p = 0.01) and map (p = 0.03) at t1 interval compared to the bl in group c (c - mac). at other time intervals, there is no rise but a significant fall in the values compared to the bl value. table 2 compares the changes in hr and sbp of group b and group c with that of group a. the difference in hr at 3 min interval (t3) after intubation between group a and group c was statistically significant t = 2.782, p = 0.008. the hr was significantly higher in group c compared with group a at 3 min (t3) interval. at other time intervals , there is no significant difference in hr on comparing group b and group c with that of group a. there was a significant difference in sbp observed when comparing group a with group c u = 294, p = 0.01, and r = 0.42 at 1 min (t1) after intubation. at other intervals, there was no statistically significant difference in sbp on comparing group b and group c with that of group a. table 3 compares the changes in mean dbp and mean artery pressure of group b and group c with that of group a. there is a statistically significant difference in dbp observed between group a and group c, t = 2.301, p = 0.03 at 1 min interval (t1) after intubation. at other time intervals, there are no statistically significant changes in dbp on comparing group b and group c with that of group a. there is a statistically significant difference in mean artery pressure observed on comparing group a with group c; u = 320, p = 0.04, and r = 0.35 at 1 min interval (t1) after intubation. at other intervals, there are no statistically significant changes in map on comparing group b and group c with that of group a. we found that c - mac laryngoscope has higher hemodynamic response to tracheal intubation compared to conventional macintosh laryngoscopy and intubation in these asa i patients. while comparing the macintosh with mccoy laryngoscopy , we found that there is no significant difference in terms of hemodynamic response to orotracheal intubation between the two laryngoscopic methods. some of the previous studies have shown that there is no difference in hemodynamic response between mccoy laryngoscope and conventional macintosh laryngoscopy. one study comparing mccoy and macintosh laryngoscope found that the mccoy group had less hemodynamic response when fentanyl was not included as premedicant, but there was no difference when fentanyl was used as premedicant. in our study, both the macintosh and mccoy group did not show any significant increase in the study parameters, but there was a decreasing trend after intubation. this can be attributed to the difference in the inclusion criteria compared to other studies, namely the asa status and the age group. unlike earlier studies, we included only the asa i patients belonging to 1840 years of age group in our study. a recently published study compares the hemodynamic response to endotracheal intubation with macintosh and c - mac videolaryngoscope in cardiac surgical patients. they found no significant change between the two groups in terms of the hemodynamic response to laryngoscopy and endotracheal intubation. this particular study has been done in heterogeneous cardiac surgical patients with varied cardiac pathology coming for cabg, valvular surgeries, etc. the patients were on drugs such as beta blockers which itself would have influenced the degree of hemodynamic response to endotracheal intubation, while our study has shown that c - mac has an increased hemodynamic response to intubation compared to macintosh laryngoscopy and endotracheal intubation. the difference in the study population would have contributed to the difference in the outcome between the two studies. the major limitation was the difficulty in blinding with this study design which could have led to a potential bias in the study. however, we ensured that a separate anesthesiologist not knowing the type of laryngoscopy is involved in data collection. secondly, the learning curve of the new technique of laryngoscopy with c - mac videolaryngoscope has not been established and this would have affected the hemodynamic response to endotracheal intubation. the authors did this to avoid the potential bias that would happen when a wide variable group such as asa ii patients was included. such patients may have conditions such as hypertension, diabetes, and hypothyroidism, which can affect the hemodynamic response to oral endotracheal intubation. furthermore, conducting the entire study in controlled hypertensives will be technically difficult to recruit patients as well as to standardize the confounding factors such as drug therapy. moreover, the authors felt that attenuation of hemodynamic response to endotracheal intubation is also important in these asa i patients while providing general anesthesia. our study showed that mccoy and macintosh laryngoscopies have similar hemodynamic response to direct laryngoscopy and endotracheal intubation, but c - mac video laryngoscopy and endotracheal intubation have an increased hemodynamic response than conventional macintosh laryngoscopy and intubation in patients undergoing general anesthesia.

and aims: earlier studies have shown that the type of laryngoscope blade influences the degree of hemodynamic response to endotracheal intubation. the aim of the study was to evaluate the hemodynamic response to oral endotracheal intubation with c - mac laryngoscopy and mccoy laryngoscopy compared to that of macintosh laryngoscopy in adult patients under general anesthesia.material and methods: this is a prospective randomized parallel group study. ninety american society of anesthesiologists i patients were randomly allotted into three groups. group a macintosh laryngoscopy (control group). group b laryngoscopy with mccoy laryngoscope. group c laryngoscopy with c - mac video laryngoscope. heart rate (hr), systolic blood pressure (sbp), diastolic blood pressure (dbp), and mean arterial pressure (map) were monitored at baseline (just before induction), just before intubation (t0), 1 min (t1), 3 min (t3), 5 min (t5), and 10 min (t10) after intubation. intergroup comparison of study parameters was done by unpaired sample t - test for normal data and mann - whitney u - test for skewed data. for within - group comparison, the repeated measures of anova for normal data and friedman followed by wilcoxon signed rank test for skewed data were performed.:in c - mac group, the hr was significantly higher than the macintosh group at 3 min after intubation, whereas sbp, dbp, and map were significantly higher at 1 min. mccoy group showed a similar response compared to macintosh group at all time intervals.:c-mac video laryngoscope has a comparatively greater hemodynamic response than macintosh laryngoscope.

take a maximum aliquot of 13 ml of sample and store it at -20 c in a labeled conical centrifuge tube. measure and record the optical density of the sample by placing a couple of drops of urine in the refractometer. filter the sample through a 0.2 um filter. measure out the volume of sample below according to the optical density 1.000 - 1.0091.00 ml1.010 - 1.0190.50 ml1.020 - 1.0500.25 ml + 0.25 ml h2o the specified volume is then transferred to a reactivial containing the following internal standards: 500 nanomoles (nmoles) 3 creatine; 10 nmoles d3 methylmalonic acid; 100 nmoles each of the following c3 lactate, c3 pyruvate, c2 n glycine, d3 serine, d5 phenylalanine, d11 hexanoylglycine, n2 orotate, d4 sebacic acid, c6 glucose, d6 inositol and d5 tryptophan. 20 microliters (l) of a 7.5 units/l solution of urease (calzyme laboratories catalog no . 116a0100) is added to the sample, which is then flushed and sealed under co2 through an inert septum. the sample is held at 37c for 30 minutes with more carbon dioxide gas added at 15 minute intervals to maintain pressure. 20 l more of the urease solution is added, the vial is flushed with carbon dioxide, and the sample maintained at 37c for another 15 minutes. 500 l of 30:70 acetone: methanol is added, the rubber septum is replaced with a teflon coated septum, and the sample is chilled at -20 c for 15 minutes. solids are removed by centrifugation at 1500 rpm x 10 minutes then decanted into a clean 2.0 cc reactivial (supelco / sigma) add triethylammonium trifluoroacetate (tea / tfa) (sigma) as follows: 20 l for 1.00 ml samples40 l for 0.5 ml, or less, samples 20 l for 1.00 ml samples 40 l for 0.5 ml, or less, samples top off with acetonitrile and place under a nitrogen stream at 70 c until constant volume is achieved (tea / tfa will remain) (~ 15 minutes). repeat step 13, up to 4 times until a precipitate forms (~ 10 minutes each). top off with methylene chloride, being careful of boil over, and dry (~ 4:00 minutes). add mstfa (n - methyl - n - trimethylsilyltrifluoroacetamide) (thermal scientific) at the following rates: 150 l for 1.00 ml samples200 l for 0.50 ml, or less, samples 150 l for 1.00 ml samples 200 l for 0.50 ml, or less, samples cap under a nitrogen atmosphere and incubate at 70 c for 1 hour. transfer to microvials, under a nitrogen atmosphere, for analysis on gas chromatograph /mass spectrometer. place microvials for automated injection by the agilent 5975 gc / ms: instrument temperatures are: injector 200 c, interface 250 c, oven 80 c for 1 minute; ramp at 4 c / minute 80 - 130 c, ramp at 6 c/ minute 130 - 200 c, ramp at 12 c/ minute 200 - 285 c, hold for 10 minutes.. mass spec: source 230 c, quad 150 c, scan 50 - 650 amu at 2.46 scans / sec. take a maximum aliquot of 13 ml of sample and store it at -20 c in a labeled conical centrifuge tube. measure and record the optical density of the sample by placing a couple of drops of urine in the refractometer. filter the sample through a 0.2 um filter. measure out the volume of sample below according to the optical density 1.000 - 1.0091.00 ml1.010 - 1.0190.50 ml1.020 - 1.0500.25 ml + 0.25 ml h2o the specified volume is then transferred to a reactivial containing the following internal standards: 500 nanomoles (nmoles) 3 creatine; 10 nmoles d3 methylmalonic acid; 100 nmoles each of the following c3 lactate, c3 pyruvate, c2 n glycine, d3 serine, d5 phenylalanine, d11 hexanoylglycine, n2 orotate, d4 sebacic acid, c6 glucose, d6 inositol and d5 tryptophan. 20 microliters (l) of a 7.5 units/l solution of urease (calzyme laboratories catalog no . 116a0100) is added to the sample, which is then flushed and sealed under co2 through an inert septum. the sample is held at 37c for 30 minutes with more carbon dioxide gas added at 15 minute intervals to maintain pressure. 20 l more of the urease solution is added, the vial is flushed with carbon dioxide, and the sample maintained at 37c for another 15 minutes. 500 l of 30:70 acetone: methanol is added, the rubber septum is replaced with a teflon coated septum, and the sample is chilled at -20 c for 15 minutes. solids are removed by centrifugation at 1500 rpm x 10 minutes then decanted into a clean 2.0 cc reactivial (supelco / sigma) add triethylammonium trifluoroacetate (tea / tfa) (sigma) as follows: 20 l for 1.00 ml samples40 l for 0.5 ml, or less, samples 20 l for 1.00 ml samples 40 l for 0.5 ml, or less, samples top off with acetonitrile and place under a nitrogen stream at 70 c until constant volume is achieved (tea / tfa will remain) (~ 15 minutes). repeat step 13, up to 4 times until a precipitate forms (~ 10 minutes each). top off with methylene chloride, being careful of boil over, and dry (~ 4:00 minutes). add mstfa (n - methyl - n - trimethylsilyltrifluoroacetamide) (thermal scientific) at the following rates: 150 l for 1.00 ml samples200 l for 0.50 ml, or less, samples 150 l for 1.00 ml samples 200 l for 0.50 ml, or less, samples cap under a nitrogen atmosphere and incubate at 70 c for 1 hour. transfer to microvials, under a nitrogen atmosphere, for analysis on gas chromatograph /mass spectrometer. place microvials for automated injection by the agilent 5975 gc / ms: instrument temperatures are: injector 200 c, interface 250 c, oven 80 c for 1 minute; ramp at 4 c / minute 80 - 130 c, ramp at 6 c/ minute 130 - 200 c, ramp at 12 c/ minute 200 - 285 c, hold for 10 minutes. column: 25 m, 320 micron i d, 0.5 micron film thickness db-5. mass spec: source 230 c, quad 150 c, scan 50 - 650 amu at 2.46 scans / sec. the urease method has been cited 62 times in the medical literature with various modifications. matsumoto's group simplified the procedure for high - throughput neonatal screening and reported the from 16000 patients. kuhara and others have reported the use of the method in several cases of inborn error diagnosis and follow - up. rhead also confirmed the method's utility for clinical diagnosis and follow - up of inborn errors. the method has been applied to urine of bears, knock - out mice, elephants and homogenates of whole fruit flies and their larvae. culture media from cryptococcus before and after site - directed mutagenesis were also analyzed, without the urease step. the method has been applied to human nutritional assessment in medical students, down syndrome patients and demented elderly veterans after loading the subjects with oral doses of the amino acids tryptophan, methionine and isoleucine. all eight b - vitamins were assessed by quantifying the breakdown products of the three amino acids which, among them, require all 8 vitamins at some point in their degradation. the toxic effects of pharmaceuticals and their mitigation by vitamin supplementation has been reported. amniotic fluid samples from normal and down syndrome pregnancies were analyzed and reported. the metabolic screening lab is a clia - licensed clinical laboratory owned by saint louis university, a non - profit corporation. dr. shoemaker does not directly profit from laboratory revenues, but may benefit indirectly from laboratory productivity. none of the methods, techniques, , normal ranges, macros, software, libraries or are considered proprietary and are freely available to interested parties.

every infant born in the us is now screened for up to 42 rare genetic disorders called " inborn errors of metabolism ". the screening method is based on tandem mass spectrometry and quantifies acylcarnitines as a screen for organic acidemias and also measures amino acids. all states also perform enzymatic testing for carbohydrate disorders such as galactosemia. because the can be non - specific, follow - up testing of positive is required using a more definitive method. the present report describes the " urease " method of sample preparation for inborn error screening. crystalline urease enzyme is used to remove urea from body fluids which permits most other water - soluble metabolites to be dehydrated and derivatized for gas chromatography in a single procedure. dehydration by evaporation in a nitrogen stream is facilitated by adding acetonitrile and methylene chloride. then, trimethylsilylation takes place in the presence of a unique catalyst, triethylammonium trifluoroacetate. automated injection and chromatography is followed by macro - driven custom quantification of 192 metabolites and semi - quantification of every major component using specialized libraries of mass spectra of tms derivatized biological compounds. the analysis may be performed on the widely - used chemstation platform using the macros and libraries available from the author. in our laboratory, over 16,000 patient samples have been analyzed using the method with a diagnostic yield of about 17%--that is, 17% of the samples reveal findings that should be acted upon by the ordering physician. included in these are over 180 confirmed inborn errors, of which about 38% could not have been diagnosed using previous methods.

the patients referring to hospitals emergency department (ed) needing immediate care comprise 78% of all patients. minutes or even the seconds are crucial for these patients since, 75 - 85% of mortality occurs in the first 20 min post - events (such a s head injury). most of the injuries either manage or progress within the first 10 min when major decisions are made. time limit, high number of clients, various clients, lack of information about them, limitation of diagnostic interventions, and the urgency of selecting related treatment are amongst ed features. from the patients viewpoint, the, long waiting time interval ing in patients dissatisfaction with emergency services is a major problem in hospitals eds, as well as their pre - hospital phases. basically, increase of wait time is one of the major reasons for the crowd in eds ing in patients leave with no physicians evaluation, a delay in treatment, patients dissatisfaction and jeopardizing their lives. on the other hand, a decrease in wait time to receive emergency services brings about on time treatment, a decrease in hospitalization time interval, lower treatment costs and saving in hospital resources. meanwhile, the most important criterion used to evaluate eds is patients waiting time to receive diagnostic and treatment services. triage is one that is the system, which can be easily administrated and manage the time of diagnosis and treatment with regard to patients status. triage is a process that an emergency disease or an injury is classified for the patients referring to eds in order to provide an appropriate level of treatment and care, be prioritized and transferred in the shortest possible time. most of times, nurses are the first health staffs admitting the patients to diagnose their problem and administrate emergency care for them. previous studies have been already conducted on patients time waste in eds with regard to their satisfaction in iran, but not on the effect of triage on wait time decrease in eds. accordingly, there is a few studies in iran regarding waiting time and discharge time in emergency department; for instance, study in the kashani hospital in esfahan has been shown that the average time for patients to complete the discharge process in ed was 4.9 h; the other in kerman has showed that mean for wait time in ed in bahonar hospital was about 7 h. both studies indicated that long wait time directly affect patients dissatisfaction. however, the effect of triage on wait time and discharge time did not measure in these studies. evaluation of ed wait time interval and patients point of view may improve the quality of emergency care at ed. due to feasibility and a lack of similar study in shahid rajaee hospital in karaj, the present study was designed to investigate the effect of triage on wait time to receive treatment services and patients satisfaction those referring to karaj ed. this is a quasi - experimental study, which was conducted on the patients referring to ed of shahid rajaee hospital in karaj during 2009. experimental condition was the triage as intervention, which was made on cases group vs. control group that did not have triage (see below). according to quasi - experimental design, wait time and patient satisfaction were as dependent variables and then triage was manipulated to check its effect on both groups considering wait time and patient satisfaction. its emergency department provides both inpatient and outpatient services for internal cardiac and traumatic patients care. five nurses work in morning shift, four in evening shift, and four nurses in each night shift. considering previous similar studies and due to its feasibility , the samples were considered as 600, by means of 300 cases and 300 in experiment group. all patients in experiment group were triaged at the time of their entrance vs. control group that did not triage. patients those come to the ed were included in the study; except those needing cardiopulmonary resuscitation (cpr) at the time of their arrival; and those who had no vital signs, which was no need for their triage, were left out from the study. a questionnaire including demographic questions, as well as two sections of patient satisfaction and time measurement was used to collect the data. age, sex, referral route and time measurement included information concerning time of arrival and time of the first visit by a physician were considered. satisfaction measurement section contained 11 questions covering patients satisfaction with ed services concerning personnel's behavior in admission, existence of facilities and equipments, and ed staffs reaction time to start emergency services. it is important to beer in mind that the data collection tool is a national and standard questionnaire that had been made by in ministry of health and medical education and had been used already and confirmed regarding its validity and reliability. the principal researcher filled the questionnaire after getting consent from the clients with no intervention in their triage. the data were collected through interview with patients, or their accompanying if patients are not quite alert and conscious. using random block sampling method, starting the first day of the study conducting, the principle investigator attends at ed first in morning following in evening and night shift, respectively. questionnaire of satisfaction was filled at the time of discharge or their transferring to ward for inpatients cases; and at the time of leaving ed for outpatients. then, the data of wait time for the first visit in ed were collected and satisfaction with the services was sought and then triage was administrated. after primary triage of the patients, they were classified and transferred to ed to be visited by a general physician and to receive related care. there were two physicians present in each shift (one for class one referrals and one for outpatients of class two and three). wait time was measured from early arrival of the patients to triage room (prioritizing with triage system) to the general physicians visit. the data were analyzed by spss version 13 (spss, chicago, il), as a means of t - test to evaluate the effect of triage on wait time to receive treatment services in experiment vs. control group. mann whitney test was used to compare patients satisfaction to test the effect of triage in tow different groups. the frequency of sex (male and female), education level (illiterate, primary school, secondary school, high school, associate degree, bachelor 's degree and over) marital status (single, married, divorces) and referral times to ed (first, second or over) was compared in both experiment and control groups. the study was approved by the ethics committee of university of social welfare and rehabilitation, tehran, iran. the interviewees then signed an informed consent form or verbally consented to participate in the study. the study was approved by the ethics committee of university of social welfare and rehabilitation, tehran, iran. the interviewees then signed an informed consent form or verbally consented to participate in the study. table 1 compares characteristics (sex, education level, marital status and referral times) between experiment and control groups. as table shows, regarding educational level, close to two thirds of experiment group belong to illiterate and primary school compare to about half percent in control group. in total, comparison of characteristics among patients referring to ed in shahid rajaee hospital in karaj, iran in both experiment and control groups in 2011 table 2 presents time variable effect between wait time to receive ed physician first visit in experiment, and control groups. there was a significant difference between mean wait time in experiment and control groups (10.69 min in control vs. 8.91 min in experiment group). comparison of mean, median, minimum and maximum of wait time in patients referring to ed in shahid rajaee hospital in karaj, iran in both experiment and control groups in 2011 table 3 presents satisfaction in experiment and control groups that reveals higher satisfaction in triaged patients compared to control group (p = 0.01) comparison of mean satisfaction in patients referring to ed in shahid rajaee hospital in karaj, iran in both experiment and control groups in 2011 table 2 presents time variable effect between wait time to receive ed physician first visit in experiment, and control groups. there was a significant difference between mean wait time in experiment and control groups (10.69 min in control vs. 8.91 min in experiment group). comparison of mean, median, minimum and maximum of wait time in patients referring to ed in shahid rajaee hospital in karaj, iran in both experiment and control groups in 2011 table 3 presents satisfaction in experiment and control groups that reveals higher satisfaction in triaged patients compared to control group (p = 0.01) comparison of mean satisfaction in patients referring to ed in shahid rajaee hospital in karaj, iran in both experiment and control groups in 2011 this quasi- experimental study showed that there was a significant difference in wait time and patients satisfaction in experiment, triaged clients; and control groups, those who received routine services. miro et al. also managed to decrease wait time through triage. as a wait time for visiting of the patients decreased from 6.8 min to 4.5 min (p = 0.004), which is consistent with our findings in this study. however, the earlier study did not focus on patient satisfaction, as a of the triage. moreover, tamburlini et al. with regard to evaluation of triage function in ed observed that both wait time and patients crowding could decreased after educating the nurses and establishment of a triage system in ed. this may also imply the value of nurse skills as a means of their continuous education related to their jobs, an important factor that was already pronounced in reducing pre - hospital time interval of post crash events. our study revealed that triage could significantly ed shorten wait time and increase patients satisfaction in experiment group. in a study conducted on patients satisfaction from ed services, wait time has been indicated as an important factor by the patients and their accompanying persons. in overall hossoein zadeh, amer, anderson, edvin and trial all yielded similar and claimed that wait time has an invert association with patients satisfaction in eds. in a study conducted in saudi arabia, close to two third of the subjects indicated wait time was the main reason for patients dissatisfaction from ed services, and observed a significant association between patients satisfaction and wait time. this also implies more care about the wait time for both emergency services and patients satisfaction. researcher presence may affect personnel's function and possibly speed up of personnel, as a means of hawthorne effect; however, in order to deal with it, they were confirmed that the will keep confidentially with no report to hospital authorities. moreover, the observations of the first 3 days were left out in the data in order to diminish bias. although, hawthorne effect might have been some effect, we believed that the effect seems to be so little. in addition, due to a lack of enough alertness of 6 patients, principal investigator has to ask the questions with help of patient accompanies. however, it was just a few cases that could not affect the of the study and its generalization to the patient as respondent. in , triage could not only significantly decrease the time interval between patients arrival and their first visit by a physician but increase patients satisfaction. with regard to the vital role of triage education in ed of hospitals and the fact that it can increase the speed of ed services , triage can improve the quantity of treatment services, as well as patients satisfaction. since, reduction of wait time interval and patient satisfaction is one important goal for nurses in emergency ward, finding from this study may improve nursing performance in relation to their work in the ed. researcher presence may affect personnel's function and possibly speed up of personnel, as a means of hawthorne effect; however, in order to deal with it, they were confirmed that the will keep confidentially with no report to hospital authorities. moreover, the observations of the first 3 days were left out in the data in order to diminish bias. although, hawthorne effect might have been some effect, we believed that the effect seems to be so little. in addition, due to a lack of enough alertness of 6 patients, principal investigator has to ask the questions with help of patient accompanies. however, it was just a few cases that could not affect the of the study and its generalization to the patient as respondent. in , triage could not only significantly decrease the time interval between patients arrival and their first visit by a physician but increase patients satisfaction. with regard to the vital role of triage education in ed of hospitals and the fact that it can increase the speed of ed services , triage can improve the quantity of treatment services, as well as patients satisfaction. since, reduction of wait time interval and patient satisfaction is one important goal for nurses in emergency ward, finding from this study may improve nursing performance in relation to their work in the ed.

: long wait time interval in emergency department (ed) of hospitals, from the patients point of view in ed is a major problem causing patients dissatisfaction and may increasing in patient morbidity and indirectly nurses dissatisfaction. evaluation of wait time intervals in ed and giving nursing feedback may improve the quality of services, as well as patient satisfaction. the present study was designed to investigate the effect of nursing triage on receiving treatment of wait time interval and satisfaction of the patients referring to ed in shahid rajaee hospital.materials and methods: this study was conducted on patients those referring to shahid rajaee hospital in karaj, iran employing quasi experimental design d ividing in two experiment and control groups during 2009.this is a quasi - experimental study of which the data were collected by standard questionnaire covering patient satisfaction and measuring wait time. t - test, mann - whitney and frequency analysis were used to evaluate the effect of triage on wait time from receiving treatment services and patients satisfaction.:the findings showed that there was a significant difference between experiment and control groups regarding wait time from receiving treatment services and patients satisfaction.:triage could significantly reduce the wait time interval between patients entrance to ed to receive treatment services and enhance patients satisfaction. it may help nursing in emergency ward to have better performance and indirectly their satisfaction.

weak acid ionization plays a central role in many chemical, biological, and industrial processes. measuring and predicting the free energy of this process (i.e., pka values) have become important experimental and theoretical tools, enabling control over and insight into acid / base chemistry and ph - dependent biomolecular transformations. although a large number of theoretical methods have been developed to predict pka values (see recent reviews and and references therein ), less attention has been given to understanding the molecular - scale mechanism of acid dissociation. this is largely due to the complexity and cost of analyzing the full free energy surface, which involves not only a chemical reaction but also significant solvent and solute reorganization. instead, most pka methods rely on the use of thermodynamic cycles that break the complex process of deprotonation into computationally tractable steps. for small molecules, this cycle typically combines the gas phase dissociation energy, calculated with high - level quantum mechanical (qm) calculations, with de / solvation free energies of the reactant and product species, calculated with continuum solvent approaches. while the gas phase energies are quite accurate, the simple continuum description of solvation free energies often requires parameter adjustment to reproduce all of the entropic and enthalpic complexities that are inherent in molecular solvation. they have been improved by hybrid approaches that include some number of explicit water molecules in the solvation free energy analysis. in conjunction with methodological refinements , these qm - continuum solvent models have enabled pka calculations of small acids to within a few units of the experimentally determined values. in contrast, the suite of methods that have been developed to predict biological pka values have typically used a thermodynamic cycle in which the solute remains in a solvated environment. each has advantages and drawbacks as well, discussed in ref, however none has yet demonstrated the ability to predict pka values within a few pka units of the experimental value for all test cases. it has been suggested that challenging moieties (e.g., buried residues that have large pka shifts or those with strong coupling to conformational changes or other titration sites) will require methods that better capture the underlying physics. these highlight how interesting and nuanced a biomolecular system can be. while it is clear that protonation states influence everything from stability to binding and reactivity, the details of their influence is still sometimes poorly understood. few methods to date have simulated the actual process of interest, the exchange of an excess positive charge from an acid to bulk water. to do so involves calculating the free energy surface for proton dissociation in the bulk phase environment, from which one learns about the molecular mechanism and rate. this requires three things: a method that describes the underlying physics of bond formation and cleavage in the bulk phase environment, a method that is efficient enough that when combined with enhanced sampling approaches can capture the distribution of phase space that defines a free energy in the condensed phase (where entropy and energy are often a similar magnitude), and a reaction coordinate that is flexible enough to track the transferring excess charge defect. the first of these requirements is most obviously filled by qm approaches, which have been used in a handful of helpful studies to probe acid dissociation. parrinello molecular dynamics (cpmd) to calculate the free energy profile of histidine dissociation. although the chosen reaction coordinate limited their analysis to stopping just beyond the transition state, they were able to calculate the correct relative pka value by subtracting the equivalent profile for water autodissociation. similarly, park et al. used cpmd in combination with metadynamics to sample the configurational space of acetic acid in bulk water. while their trajectories were too short to sufficiently converge the free energy surface, they were able to observe and characterize multiple protonation and deprotonation events. these reactions occurred along a well - characterized pathway where the excess proton is briefly shared between the acid and solvating water. they also noted the existence of a shallow minimum in the free energy surface corresponding to the existence of a contact ion pair (cip) that is separated from the protonated state by a small energy barrier. in an alternative approach that still describes the bond dissociation at the ab initio level, uddin et al. recently used qm / mm to calculate the free energy surfaces for several small molecules. although they obtained quite accurate pka values, their method can not describe the mechanism of dissociation since they include only one water molecule and the acid in the qm region. hence, this method changes the physical process from the dissociation of a delocalized charge defect to proton transfer followed by separation of a localized hydronium cation and acid anion in a solvating mm environment. just as for thermodynamic cycles, their show that sampling an alternative pathway between reactant and product states can yield accurate pka values for small molecules. another approach that describes the bond dissociation process is reactive md (rmd). the efficiency of these models allows them to sample reactive dynamics on much longer length and time scales than ab initio md. since they are parametrized to work with mm force fields, they also avoid the boundary issues suffered by qm / mm calculations. both of these factors make rmd models ideal for simulating reactions in large, complex systems with slow dynamics. proteins and proton exchange membranes are two important examples of such systems. without sufficient sampling in these types of systems, the final can be strongly influenced by the initial conditions. a common criticism of rmd models is that they are only approximations to the true quantum mechanical behavior of the system. while this is certainly true, if the functional form is both flexible enough and parametrized correctly, then the reactive model will retain the ability to accurately reproduce the potential and free energy surfaces from which it was parametrized. the multistate empirical valence bond (ms - evb) method is a rmd force field that has been used to characterize proton transport in many condensed phase and biological environments. it is especially well suited to the challenge of acid ionization since it inherently defines a center of excess charge that can be used to track reactions involving proton transport, thereby avoiding issues with geometric reaction coordinates. although ms - evb has been used to study weak acids and amino acid dissociation, these efforts involved a larger degree of empiricism since the pka value was needed to fit the msevb potential. it has been a long sought goal to find a procedure that would minimize the empiricism in rmd models, such that the bulk property of interest was derived entirely from quantum data in combination with extensive sampling. this work reports the achievement of that goal, a multiscale approach to calculate the free energy profile for acid ionization that is based entirely on qm data and yields an accurate absolute pka value. an iterative procedure, in the spirit of adaptive force matching, is used to sample the reactive phase space, obtain reference ab initio data (qm / mm forces), and fit a rmd potential. care has been taken to modify the functional form such that it is sufficiently flexible to reproduce the qm / mm reference data and, in principle, capture the essential physics. our approach is applied to aspartic acid (asp) and to glutamic acid (glu). both of these amino acids play crucial roles in proton and ion transport in biological channels and pumps and are also commonly involved in salt bridges that influence protein dynamics, structure, and binding. we show that accurate estimates of the pka values of both asp and glu are obtained from the ing reactive models, which is the first time a reactive model has been able to accurately predict the correct pka without being explicitly parametrized to do so. finally, we discuss the mechanistic description our models provide of acid deprotonation in water. to emphasize that these models were fit entirely to qm / mm data and without adjustments to match the experimental pka , we will hereafter refer to them as multiscale reactive molecular dynamics (ms - rmd) models. it should be noted, however, that the ms - rmd asp and glu models are parametrized to work with a refined version of the ms - evb3 hydronium model that accurately describes a proton solvation and transport in water. ms - rmd is similar to the ms - evb framework that has been successfully used to model proton solvation and transport in many aqueous systems. the power in this approach lies in its ability to describe electronic delocalization as a linear combination of topologically distinct states. for a given configuration, for example, state |i could be a protonated amino acid in a box of water (figure 1a). state |j would have the same coordinates but have a topology describing a cip between a solvated hydronium ion and a deprotonated amino acid (figure 1b). at each step in the simulation , a state search algorithm first determines all the possible states based on geometric criteria and then calculates the energy of each state. the lowest energy state is termed the pivot state and is the start of the state search algorithm at the next step. since the number of waters, and therefore the number of possible states, grows exponentially with distance from the pivot state, only states in the first three solvation shells several different bonding topologies are shown for a given set of nuclear coordinates, r. dashed lines surround the protonated molecule, as defined by the bonding topology. the reactive system is described by the following hamiltonian:1where r is the vector describing the nuclear coordinates, hij is the sum of mm potential terms for state i, and hij is the coupling between states |i and |j. the details of these terms will be provided in the force field section. with the hamiltonian defined this way, the relative weight of each state is described by the components of the eigenvector, ci:2finally, forces are calculated using the hellmann feynman theorem. these forces are then passed to a standard md integrator such as velocity verlet. free energy calculations require a continuously varying reaction coordinate (rc) to describe the process of interest. the evb formalism provides a convenient reference for the rc; the center of the excess charge (cec):3 in this equation, ri is the geometric center - of - charge for the protonated molecule in state i, and ci is the relative weight of that state. we then use the distance between the cec and the center of mass of the asp or glu carboxyl group to describe the progress of the deprotonation reaction. the diagonal elements of the ms - rmd hamiltonian matrix are derived from the standard charmm mm force field. the protonated form uses all of the standard parameters with the exception of the acidic o h bond. this bond is replaced with a morse potential to allow dissociation:4where r is the bond length and d, , and r0 are parameters fit to reproduce the bond length and frequency of the harmonic potential it replaces while still allowing for a reasonable bond dissociation energy. the deprotonated form of amino acid uses all of the standard charmm bonded and nonbonded terms and parameters. since the charmm force field was not originally intended for use in reactive simulations, additional repulsive terms are used between the carboxyl oxygens of the deprotonated model and the hydronium oxygen and hydrogens. these terms help to correct for the overattraction at close distances due to the use of point charges. the functional forms for the repulsions are the same as those used in the ms - evb3 hydronium model:56where b, b, b, c, and c are fitted parameters. following the logic in previous work, and to avoid parameter redundancy, doo and doh were fixed the same values used in ms - evb3. the sum of gaussians term in eq 5 is included to help the fitted potential to reproduce the correct asymmetric solvation structure around the hydronium, and the same switching function is used as given in eq 9 of ref. the asp and glu models are designed to work with a refined version of the ms - evb3 force field, herein referred to as msevb 3.1. this refinement uses the same functional forms for the hamiltonian but revised parameters. using a genetic algorithm, the fitting parameters were optimized using the original ab initio data sets as well as potential energy surface scans for the eigen ion at the same level of the original ab initio calculations. furthermore, the oxygen partial charge of the hydronium is an adjustable parameter (the charge for the hydrogens is automatically determined to maintain the hydronium + 1 total charge). parameters for this force field are presented in the supporting information. in this study, the limiting species are the de / protonated asp or glu models and the ms - evb 3.1 solvated proton in spc - fw water. the ms - rmd force field is parametrized to smoothly switch from one protonated species to another. the asymmetry of the reaction necessitates several modifications to the original ms - evb equations, which were designed with water in mind. the off diagonal coupling term, hij, is designed to reproduce the correct transition state geometry. previous ms - evb models used a complex off - diagonal term to describe a symmetric reaction pathway between two waters. however, the asymmetry of the asp - water system was better fit by a simple gaussian potential:7where roh is the distance between the deprotonated asp oxygen and the excess proton. the other parameters determine the shape and size of the gaussian and are fit to the qm / mm data. in practice, protonation reactions occurring between different species require a constant energy term (vii) to be added to the deprotonated state. this term accounts for the difference in energy ing from different mm force fields. without it, the protonated and deprotonated asp potential energy surfaces would be offset by hundreds of kilocalories per mole, and no reaction would ever take place. this difference is due primarily to electrostatics and can be estimated by subtracting the coulomb energy of the most favorable hydronium state (containing the favorable electrostatic interactions between the hydronium cation and amino acid anion) from the coulomb energy of the protonated (and neutral) amino acid state. figure 2 shows a plot of the average value of this term as a function of rc. since vii controls the relative stability of the protonated and deprotonated states, it was used in past work to tune the behavior of the model to reproduce experimental quantities such as pka. in the current work, an iterative fitting approach is used to rigorously determine the value of vii along with all other ms - rmd parameters. plot of the difference in coulomb energy between the protonated asp state and the lowest energy non - asp state. at short distances, it is similar in some ways to that used in previous work in which ms - rmd models were force matched from aimd data. there are, however, a few important differences, including the use of qm / mm instead of aimd, the use of empirical functional forms instead of tabulated potentials, and the use of an iterative scheme for sampling configuration space starting from a guessed hamiltonian. these choices were partially motivated by the success that has been demonstrated with the adaptive force matching method by wang and co - workers. reactive hamiltonian in order to generate a set of configurations along the reactive pathway. next, high - level qm / mm calculations are performed to collect the atomic forces for those configurations. the new reactive hamiltonian is then used to generate new configurations via umbrella sampling, and the process is repeated until the parameters reach the desired convergence. details of each step are discussed in the text. due to the nonlinearity of several of the reactive force field parameters, the reactive model is fit to the qm / mm reference data using a genetic algorithm to minimize the residual:8here, nc and na are the number of configurations and the number of atoms in each configuration, respectively. w(rij) is the weight for each atom that, unless specified otherwise, is set to 1. fij is the atomic force from the current ms - rmd parameter set and fijqm / mm is the reference force from the qm / mm calculation. the fitting calculations were run in parallel and used 4000 genomes (parameter sets) per generation. to lessen the danger of overfitting the first step followed the uniformly distributed mutation scheme outlined in section 3.1 of ref. the range of parameters was chosen to be as broad as possible without allowing unreasonable values. for example, c3 in the off - diagonal term would be unreasonable if it were greater than the aspo once a converged parameter set was reached with the uniform distribution, the mutation scheme was switched to the normally distributed scheme described in section 3.2 of ref. this scheme is very good at quickly finding a local minimum and was therefore used to find the best genome in the vicinity of the from the first step. since the second scheme is easily trapped in local minima, it was not ideal for use on its own. the combination described here was found to quickly and reliably converge on the optimum solution. the discrete recombination scheme described in section 2.2 of ref is used with both mutation schemes. the nature of the reactive model introduces additional complexity into this otherwise simple scheme. vii, which directly controls the depth of the protonated well relative to the deprotonated cip, is a constant that is only included for states in which the amino acid is protonated. the off - diagonal term acts over a broader range spanning the protonated amino acid and cip configurations but also has a negligible effect once the cip dissociates. in contrast, the repulsive terms, which are only applied to the deprotonated amino acid, are significant at longer distances and negligible at distances below the transition state. furthermore, since both vii and the repulsive terms are added to the diagonal matrix elements, they tend to have correlated behavior if fit simultaneously. thus, the value of vii for the first iteration after generating new qm / mm data is chosen to be the average value described in figure 2. this value has been found to be within a few kilocalories per mole of the final value of vii and is therefore a good initial approximation. holding the value of vii fixed, the off - diagonal and repulsive terms can be fit to the full set of qm / mm reference forces. once the off - diagonal and repulsive terms reach their optimum value for the current value of vii, umbrella sampling is used to generate a pmf with the model. since vii s effect is most important at and around the transition state, a range of rc values immediately surrounding the transition state is chosen from the pmf, and configurations from that range are then used to fit a new value of vii. using this new value of vii, the off - diagonal and repulsive terms are refit while vii is again held constant. this procedure fits an empirical model from solely qm / mm data and in models that correctly predict the bulk phase pka values for both asp and glu. solution simulations of asp and glu include one solute molecule solvated by 486 and 467 waters, respectively. to reduce interactions with the charged backbone protonatable sites, the n - termini were capped with an acetyl group and the c - termini were capped with methylamine. the systems were equilibrated in the npt ensemble at 1 atm and 310 k for 200 ps before changing to the nvt ensemble with a cubic box of 24.55486 on a side for asp and 24.24938 for glu. all reactive simulations were run with a modified version of the lammps simulation package. the rc was chosen to be the distance between the cec and the center - of - mass of the amino acid s side chain carboxylic acid. umbrella sampling was used to evenly sample the rc. for the asp system, 25 windows were spaced every 0.36 starting at a rc value of 1.0. the glu system used 36 windows spaced every 0.25 with 20.0 kcal / mol restraints. each production window was further equilibrated for 100 ps, and then statistics were collected for 1.7 ns. the pka is calculated from the ing pmf using the following equation:9where w(r) is the free energy from the pmf and is the product of the simulation temperature and the boltzmann constant. the integral is calculated from zero to the transition state, as denoted by. c is the standard state concentration whose value is 1660 / molecule and from the entropic freedom that is gained by the proton when it dissociates from the acid. atomistic configurations for the qm / mm calculations were selected from the umbrella sampling trajectories. in order to ensure a uniform distribution along the rc, individual configurations were sorted by their rc value into 60 0.067 wide bins. five configurations were then selected at random from each bin, giving a total of 300 configurations for each iteration. qm / mm was performed in cp2k using b3lyp with the double - zeta basis set. unrestricted dft was used to allow the most accurate calculation of forces near the dissociation barrier. b3lyp was chosen over mp2 because recent studies have shown comparable accuracy with a reduced computational cost for water and the solvated excess proton. calculations were run on 256 intel sandy bridge cores and on average completed within 10 min. the qm region included the entire amino acid residue and all of the waters found by the ms - rmd state search. because proximity to classical point charges reduces the accuracy of forces calculated on qm atoms, an additional 3 buffer layer of qm water was added around the qm atoms. all together, this in a qm region containing an average of 208 atoms, or one asp / glu and 61 waters. in total, four iterations were needed for asp parameters to converge, while glu parameters converged in three iterations. parameters for the new asp and glu models are presented in table 1. these parameters were fit to qm / mm reference forces using the previously described iterative scheme to ensure convergence. it must be noted that the asp and glu models were parametrized using the same method, but entirely independent data sets. the fact that the final parameters for each model are so similar is not surprising, however, given the molecular similarity and small difference in experimental pka values. as the next section discusses, the pka predicted by each model is a very good estimate of the experimental value. the fact that the models are able to capture such subtle differences is evidence that the methodology works well. the potential of mean force (pmf) of deprotonation describes the free energy of the process as a function of the rc. to obtain a free energy change between any two points on the pmf, one simply integrates the pmf. figure 4a shows the pmf for deprotonation of asp, and figure 4b shows the pmf for glu (black lines). as depicted in figure 5, the rc gives the distance between the center - of - mass of the carboxylic moiety and the cec. rc values around 1.3 correspond to the protonated amino acid, while values between 2.1 and 5 correspond to the stable cip. values above 5.5 represent an excess proton separated from the anionic acid by bulk solvent. pmfs and cmax distributions from the final (a) asp and (b) glu models. the colormap in the gives the cmax probability distribution normalized for each rc value. this distribution describes the extent of charge delocalization and, by extension, the solvation structure. snapshots from umbrella sampling trajectories illustrating the types of structures suggested by the cmax distributions and the 2d - rdfs. arrows indicate the region of the pmf where the windows were run, while the distances in the box are the center of the harmonic restraint. the position of the cec is shown as a yellow sphere. in eigen structures, the cec is nearly aligned with the central water s oxygen. in zundel structures, the protonated forms of asp and glu are much more stable than the deprotonated forms, which is consistent with their status as weak acids. evaluating the integral in eq 9 estimates the pka values for asp and glu to be 3.82 0.17 and 4.56 0.18, respectively. these are both in very good agreement with the experimental ranges of 3.71 to 3.90 for asp and 4.15 to 4.31 for glu. the barrier that prevents protonation is due to the cost of forming a zundel - like arrangement between the acid and hydronium. the depth and extent of the cip varies with the system; however its existence has been predicted in a variety of weak acid systems simulated with different methods. when preparing a simulation to calculate a pmf of deprotonation and a pka, care must be taken to ensure that the rc is sampled far enough beyond the cip to ensure bulk - like properties. if this is not done, then the pmf from which the pka is calculated will be shifted and the ing pka will neither be accurate nor reflect the quality of the model. fortunately, sampling well beyond the cip is not a problem with ms - rmd models due to their efficiency. however, care needs to be taken when running qm / mm simulations to ensure that a large enough qm box and enough solvating waters are used to not only sample beyond the cip but also to avoid boundary issues. with the pmf in hand, one the ms - rmd methodology conveniently provides a measure of the structure of the solvated complex. it has been shown that the square of the largest component of the ground state eigenvector (cmax, from c in eq 3) describes the solvated structure. a value of 1 indicates the limiting case of an entirely localized excess charge, while values less than that quantify the degree of charge delocalization. eigen structures, where the excess charge is shared among a central hydronium and three h - bound water molecules, have a cmax value around 0.65. zundel structures, which share the excess charge more equally between two water molecules, have a cmax value closer to 0.5. it should be emphasized that there is always additional delocalization to other surrounding water molecules, even for these limiting eigen- and zundel - like cations. by plotting the cmax probability density as a function of the rc, we gain insight into the structural changes that accompany deprotonation. this probability density is plotted as a colormap in figure 4. at low rc values, both asp and glu have an average cmax greater than 0.9, which indicates that the structure and dynamics mostly resemble the limiting case of a protonated acid in bulk water with little charge transfer to the surrounding water molecules. this is notably different than the protonated water molecule, which always involves a significant amount of charge delocalization. as the proton begins to dissociate, the cmax decreases as the proton goes through a clear zundel - like transition between the acid and solvating water. beyond the transition state, the system begins to resemble an eigen cation where one of the solvating waters is replaced with the acid anion. however, the eigen structure seen in the cip is distinctly different from that seen in bulk water, as evidenced by a cmax of 0.73. the close proximity of the anionic acid helps to stabilize the hydronium, leading to a more localized charge. further evidence of the uniqueness of the cip is that there is a well - defined zundel transition around 4 linking the cip to the bulk - like structure at longer distances. eigen transitions in bulk, the water around the anionic amino acid is more structured, as evident in the distinct zundel - like transition at a rc value around 4. figure 5 shows snapshots of the typical structures found at different rc values and characteristic of significant regions in the pmf. the bonding topology reflects o h distances less than or equal to 1.6 , which is commonly considered to be the length of a hydrogen bond. it is also interesting to look at the structural changes that occur directly around the cec. to do so, the two - dimensional radial distribution functions (2d - rdfs) between the cec and surrounding water oxygens (ow) and water hydrogens (hw) are shown in figure 6. a slice along the first dimension of the 2d - rdfs gives a traditional 1d - rdf, which describes the probability of finding the indicated pair a given distance apart. scanning the second dimension shows how the solvation structure changes as the reaction progresses according to the rc. in combination with the cmax analysis, the 2d - rdfs show that the solvent has well - defined rearrangements as the proton dissociates from asp and travels to bulk. figure 6a shows the 2d - rdf for asp s cec ow distance. once asp is deprotonated, the first peak is near 2.5 , which is characteristic of the eigen structure. when the rc reaches 4 , the peak distance drops to around 1.5 , which is characteristic of a slightly asymmetric zundel cation where the cec resides close to the midpoint of the o o vector. the 2d - rdf showing asp s cec 2d - rdfs for (a) cec ow and (b) cec hw with asp. these plots show how the water structure changes around the cec as deprotonation occurs. 2d - rdfs for (a) cec ow and (b) cec hw with glu. we have presented a procedure for fitting the parameters of a ms - rmd model to reproduce the forces from qm / mm calculations. due to the efficiency of ms - rmd , we are able to collect and analyze data from large time and length scales that can reveal intricate behavior and is essential for converged bulk phase thermodynamic properties. this new methodology was used to parametrize new models of both asp and glu that correctly predict the correct experimental pka values. this is the first time that a ms - rmd model has been able to reproduce the experimental pka values without any fitting to experimental data. multi - nanosecond trajectories were analyzed to extract important information about the mechanism underlying the deprotonation process. it is shown that the deprotonation process follows a well - defined series of zundel to eigen transitions as the excess proton travels from asp to bulk solution. this work is considered continued progress toward the goal of having flexible and systematic algorithms to reliably make a multiscale connection between accurate electronic structure calculations and efficient empirical models to describe complex reactive processes. as more accurate ab initio methodologies (e.g., those explicitly accounting for electronic correlation) become computationally tractable for qm / mm of condensed phase systems, the procedure presented herein and related force matching algorithms will be invaluable tools for mapping high level data into efficient rmd models that can significantly extend the time and length scales of reactive simulations to explore complex phenomena. while the presented herein are important, the true test of this procedure will be to apply it in biological systems where the pka of individual residues can be shifted by several pka units. proton transport in proteins is very sensitive to the underlying protonatable residue models, and it is therefore crucial to have a procedure to ensure that those models are physically accurate. furthermore, biological systems are orders of magnitude larger and have much slower dynamics than the systems presented here. while it is conceivable that qm / mm md simulations could reach the same sort of time scales as the solution simulations presented here, they would be prohibitively expensive to run the length - and time - scales needed to account for the slow dynamics commonly found in biological processes. the ms - rmd methodology has already been shown to scale well to hundreds of thousands of atoms and can realistically reach tens of nanosecond simulations with large explicit biomembrane systems. work is already underway to implement these reactive models in protein environments and to use the presented methodology to fine - tune these and other individual amino acid models to behave properly in their specific protein environments.

accurately calculating a weak acid s pka from simulations remains a challenging task. we report a multiscale theoretical approach to calculate the free energy profile for acid ionization, ing in accurate absolute pka values in addition to insights into the underlying mechanism. importantly, our approach minimizes empiricism by mapping electronic structure data (qm / mm forces) into a reactive molecular dynamics model capable of extensive sampling. consequently, the bulk property of interest (the absolute pka) is the natural consequence of the model, not a parameter used to fit it. this approach is applied to create reactive models of aspartic and glutamic acids. we show that these models predict the correct pka values and provide ample statistics to probe the molecular mechanism of dissociation. this analysis shows changes in the solvation structure and zundel - dominated transitions between the protonated acid, contact ion pair, and bulk solvated excess proton.

worldwide, in 2015, it is the second most common newly diagnosed cancer and the fourth most common cause of cancer death in men. in the united states, incidence and mortality of prostate cancer ranked first and second, respectively, in men. over the past few years , incidence of prostate cancer increased steadily, with slowly increased mortality. current treatments for prostate cancer include surgical and medically induced castration and androgen deprivation therapy (adt) using androgen receptor (ar) antagonists. despite these treatments, castrate - resistant prostate cancer (crpc) is defined as disease progression despite adt and may present a spectrum of disease ranging from rising prostate - specific antigen (psa) levels, progression of preexisting disease, or appearance of new metastases. docetaxel, approved by the us food and drug administration (fda) in 2004, is a taxane drug that induces polymerization of microtubules and phosphorylation of bcl-2 protein. three weeks of combined docetaxel and prednisone is currently considered the standard of first - line chemotherapy for men with crpc. the second - line chemotherapy with cabazitaxel has been shown to increased survival time in patients with crpc. however, severe adverse events have been reported for these treatments. with advances in the understanding of disease pathophysiology, new treatments for crpc emerge in the recent years that aim to improve both survival and quality - of - life of patients. these treatments include cancer immunotherapy such as sipuleucel - t, ar - directed therapies such as abiraterone acetate (aa) and enzalutamide (enz), radium-223, and prostvac. phase iii clinical trials have been conducted for sipuleucel - t, aa, and enz and fda has approved their use in patients with crpc. these new treatments hold great potential as the first - line treatments for patients with crpc. finding the optimal regimen is now the major clinical challenge. this meta - analysis aimed to investigate and compare the efficacy and safety of these two treatments and to provide scientific evidence for the management of crpc. aa is a steroidal antiandrogen that exerts its effect through inhibiting cyp17a and it also acts as an antagonist of ar. it has a strong binding affinity for ar and in addition prevents binding of ar to deoxyribonucleic acid and ar to coactivator proteins. the antigen presenting cells (apcs) are harvested from individual patient's peripheral blood and later incubated with recombinant fusion protein antigen, which contains both prostatic acid phosphatase and granulocyte - macrophage colony - stimulating factor. this process activates the apcs, which are critical for priming a cytotoxic t - lymphocyte - mediated immune response. these activated apcs are then reinfused into the individual patient. in 2010, sipuleucel - t became the first immune - therapeutic agent approved by the fda for patients with crpc, based on consistent observed improvement in overall survival. this meta - analysis aimed to further determine the clinical efficacy and safety of these two types of treatments, namely, sipuleucel - t and ar - directed therapies (aa and enz), in the management of crpc. survival and disease progression were assessed by overall survival (os) and time - to - progression (ttp), respectively. we systematically searched seven literature databases (ovid, springer, pubmed, web of science, sciencedirect, medline, and cochrane library) from 1966 to october 2015 for all relevant articles by entering terms including castrate - resistant prostate cancer , sipuleucel - t , enzalutamide , and abiraterone acetate as key words, title, subject heading, and text word. we also searched for potentially missed articles from the reference list of retrieved articles and from previous narrative reviews on this topic. studies were included if they met the following criteria: randomized double - blind place - controlled clinical trials of sipuleucel - t, aa, and enz presenting original data; patients with crpc; english articles published before october 2015. in case of duplicated reports, the article presenting the latest and the most comprehensive data on the largest cohorts was selected. studies were excluded if they were duplicated reports, were of poor quality, were lacking original data, or presented incomplete data; they were review articles, conference abstracts, or commentary. two authors (renliang yi and baoxin chen) conducted literature search and study selection independently. were compared and discrepancies were resolved by a discussion with another author (peng duan). quality of the included articles was assessed using the newcastle - ottawa scale (nos), in which a study is judged on three broad perspectives: the selection of the study groups (adequate definition of the cases, representativeness of the cases, selection of controls, and definition of controls), the comparability of the groups (compatibility of cases and controls), and the ascertainment of the outcome of interest (ascertainment of exposure, ascertainment of cases and controls, and nonresponse rate). were compared and discrepancies were resolved by a discussion with another author (weilin ou). the following outcomes were extracted from each study: os, ttp, reduction of psa level 50%, and adverse events of grade 3. were compared and discrepancies were resolved by a discussion with corresponding author (zhiheng zhou). review manager 5.1 software was used for data synthesis and analysis. the hazard ratio (hr) with 95% confidence interval (ci) heterogeneity analysis was performed using q test with p > 0.1 and i < 50% suggesting homogeneity among studies. for data without significant heterogeneity, fixed - effect models were used for pooled analyses. in case of significant heterogeneity, sensitivity analysis was performed by excluding the study with the highest variance. in the case that no definite cause was found for heterogeneity, random - effect model was used for pooled analyses. the significance of pooled data was further tested and a p < 0.05 was considered statistically significant. when enough studies were included, funnel plot was delineated and the publication bias was evaluated. a total of 302 articles were excluded after reviewing titles and abstracts, and 80 articles were excluded due to duplicated reports. exclusion reasons included review articles and commentary, correspondence, nonrandomized placebo - controlled trials, and lack of complete study outcomes. seven articles were included for the meta - analysis: three articles on sipuleucel - t, two on aa, and two on enz, respectively. all seven studies were randomized, double - blind, placebo - controlled clinical trials. of quality assessment using nos for the seven studies are showed in table 1. regimens used in these studies were as follows: sipuleucel - t: patients were randomly assigned in a 2: 1 ratio to receive either sipuleucel - t or placebo every two weeks, for a total of three infusions; aa: intervention group received combined aa 1000 mg and prednisone 10 mg daily and placebo group received prednisone 10 mg daily plus placebo; enz: intervention group received enz 60 mg daily and placebo group received placebo. all seven studies provided data on survival with follow - up period up to 36 months. analyses of os were performed in 5,936 patients, with 737 patients for sipuleucel - t (intervention group versus placebo group : 488 versus 249 patients) and 5,199 patients for ar - directed therapies (intervention group versus placebo group : 3,015 versus 2,184 patients). showed that, compared with placebo, both sipuleucel - t and ar - directed therapies significantly improved survival of patient with crpc. pooled hr for os was 0.73 for sipuleucel - t (95% ci : 0.610.88 ; z = 3.31 ; p < 0.001) and 0.72 for ar - directed therapies (95% ci : 0.660.78 ; z = 7.94 ; p < 0.00001). tests for heterogeneity showed insignificant , indicating homogeneity among studies (both p > 0.1 and both i < 50%). six studies with a total of 5,936 patients reported ttp , including 737 patients for sipuleucel - t (intervention group versus placebo group : 488 versus 249 patients) and 5,199 patients for ar - directed therapies (intervention group versus placebo group : 3,015 versus 2,184 patients). compared with placebo, sipuleucel - t showed no significant favorable effect on ttp with pooled hr of 0.88 (95% ci : 0.741.06 ; z = 1.35 ; p = 0.18). test for heterogeneity was not significant (p = 0.35, i = 4%). in contrast, ar - directed therapies showed significant improvement in ttp with pooled hr of 0.59 (95% ci : 0.400.88 ; z = 2.59 ; p = 0.009). seven studies with a total of 5,936 patients reported reduction of psa level 50% as study outcome , including 689 patients for sipuleucel - t (intervention group versus placebo group : 458 versus 231 patients) and 4,975 patients for ar - directed therapies (intervention group versus placebo group : 2,928 versus 2,047 patients). pooled rr showed that sipuleucel - t has no significant effect on reducing psa level 50% (rr : 2.51 ; 95% ci : 0.659.73 ; z = 1.33 ; p = 0.18). test for heterogeneity was not significant (p = 0.5 ; i = 0%). in contrast, ar - direct therapies showed significant effect on reducing psa level 50% (rr : 9.82 ; 95% ci : 1.9948.46 ; z = 2.89 ; p = 0.004) (figure 4). to investigate the safety of these treatments, we compared the occurrence of adverse events of grade 3, including fatigue, headache, back pain, arthralgia, constipation, and diarrhea, with that in placebo. pooled rr revealed that, compared with placebo, risk of adverse event was not significantly increased for sipuleucel - t and ar - directed therapies (p > 0.05, table 3 and figure 5). figure 6 shows symmetry funnel plot, indicating that there was no significant evidence of publication bias. researches on novel treatments for crpc have gained increasing interest in the past few years, especially those on sipuleucel - t and ar - directed therapies. this meta - analysis investigated the efficacy and safety of sipuleucel - t and ar - directed therapies, providing valuable information that might be useful clinical evidence on the treatments for crpc. we found that both sipuleucel - t and ar - directed therapies could significantly improve os in patients with crpc, with favorable safety. ar - directed therapies appear to have superior effects in improving ttp and in reduction of psa level. however, there are still debates over the efficacy and optimal regimen of these new treatment methods. it has been known that traditional chemotherapeutic drugs lacked the selectivity on target tumor cells, which may cause different damage to normal cells, or even serious effects on patients. indicated that adverse effects of docetaxel including edema, neurotoxicity, and hair loss limit its application. zhou et al. also showed 2.7% of crpc patients died after docetaxel plus prednisone therapy, 58.56% had neutropenia, and 19.82% had leukopenia. unlike the traditional ones, sipuleucel - t and ar - directed therapies target tumor cells, thus causing little toxic effects on normal cells due to high selectivity. for instance, aa and enz antagonize androgen receptors to inhibit the activity of tumor cells. similarly, sipuleucel - t could elicit immune response targeting against antigen prostatic acid phosphatase (pap) that is highly expressed in most prostate cancer cells. many showed that sipuleucel - t and ar - directed therapies improved the overall survival by exerting different effects on ttp, psa level, and aes. although surgery, radiotherapy, or chemotherapy had stopped for a period of time before the new drugs clinical trials were given, it is still hard to rule out the possibility of the influence by the former treatments. therefore, further clinical validation is needed. beyond that, we paid more attention to the sequela, applicable scopes, and contraindications of these treatments. all trials had strict selection of patients. to be an eligible case for sipuleucel - t trial, histological confirmation on castrate - resistant prostate cancer, serum testosterone level < 50 ng / dl, and a considerable somatic function for expected survival were required. patients accepted for aa trial should had no more than two previous chemotherapies, at least one previous docetaxel therapy, and mild symptoms or no symptoms (radiographic progression in soft tissue or bone with or without psa progression, psa < 50 ng / dl, and ecog performance status of 2 or less). patients from sipuleucel - t trials were scheduled to undergo leukapheresis procedures every 2 week for a total of three times, and on the second day after each leukapheresis procedure, patients were treated by infusion of sipuleucel - t or placebo. patients from aa trials received abiraterone acetate 1000 mg once daily plus prednisone 5 mg twice daily by oral or placebo plus prednisone. and in enz trials patients received enzalutamide 160 mg orally once daily or matched placebo. we found that in aa trials patients with lower score of ecog, age 65 years, and psa level > or < median had the higher hr. on the contrary, in enzalutamide trials, patients with age 65 years, higher score of ecog, and psa level > median had the higher hr. while in sipuleucel - t trials, patients with age < median, psa < or > median, and higher score of ecog had the higher hr. drake 2012 indicated that the subgroup of patients aged less than 65 years did not favor sipuleucel - t. another observation by them was the potential harm from the impact study interventions, because, to some extent, sipuleucel - t broke the immune balance. challenges remain in finding the optimal regimen for sipuleucel - t and ar - directed therapies. combined sipuleucel - t, aa, and prednisone formula has been proposed as a novel treatment diagram in crpc. research has shown that concurrent administration of aa and prednisone did not blunt immunologic effects or alter immune parameters that correlate with sipuleucel - t's clinical benefits. cumulative apc activation, cumulative apc number, total nucleated cell counts, and immune responses to sipuleucel - t were not affected by coadministration of aa and prednisone. such combination of treatments was well tolerated, with no new risk marker emerging. sipuleucel - t is recommended as the first - line treatment for patients with crpc by the national comprehensive cancer network and it is recommended as early use in asymptomatic crpc or patients with mild symptoms. this was possibly a of mutation of ar induced by prednisone, which will subsequently impact the effect of enz on ar. therefore, it appears that there is limited clinical benefit for combination or sequential use of enz and aa.

new treatments, such as sipuleucel - t and androgen receptor- (ar-) directed therapies (enzalutamide ( enz) and abiraterone acetate (aa) ), have emerged and been approved for the management of castration - resistant prostate cancer (crpc). there are still debates over their efficacy and clinical benefits. this meta - analysis aimed to investigate the efficacy and safety of sipuleucel - t and ar - directed therapies in patients with crpc. revman 5.1 was used for pooled analysis and analysis of publication bias. seven studies were included in the meta - analysis, with three studies in sipuleucel - t (totally 737 patients, 488 patients in treatment group, and 249 patients in placebo group) and four in ar - directed therapies (totally 5,199 patients, 3,015 patients in treatment group, and 2,184 patients in placebo group). treatment with sipuleucel - t significantly improved overall survival in patients with crpc and was not associated with increased risk of adverse event of grade 3 (p > 0.05). however, treatment with sipuleucel - t did not improve time - to - progression and reduction of prostate - specific antigen (psa) level 50% was not significantly different from that with placebo. ar - directed therapies significantly improved overall survival in patients with crpc and improved time - to - progression and reduction of psa level 50%. ar - directed therapies did not increase risk of adverse event of grade 3 (p > 0.05).

the national children's food survey (ncfs) 20032004 and the national teens' food survey (ntfs) 20052006 were carried out to establish databases of habitual food and drink consumption in representative samples of irish children aged 512 years and teenagers aged 1317 years. a 7-d weighed food record was used to collect food intake data from 594 children (293 boys, 301 girls), while a 7-d semi - weighed food record was used to collect food intake data from 441 teenagers (224 boys, 217 girls). participants and their parents / guardians were visited by a trained nutritionist four times, including one training visit, during the recording period. participants with the aid of their parents / guardians (younger children requiring more aid up to 100 %) were asked to record detailed information regarding the amount and types of all foods, beverages and supplements consumed over the 7-d period and, where applicable, the cooking method used, the brand name of the food consumed, packaging size and type and details of recipes and any leftover. a hierarchal method for dietary data collection and quantification was used which included weighing, photographic food atlases , manufacturers information and household measurements. analyses of dietary intake data were carried out using wisp (tinuviel software), which contains mccance and widdowson's the composition of foods, 6th edition and the irish food composition database. self - reported health and lifestyle questionnaires were completed by participants or their parents / guardians concurrent with collection of food intake data. this study was conducted according to the guidelines laid down in the declaration of helsinki and all procedures involving human participants were approved by the st. james' hospital and federated dublin voluntary hospitals joint research ethics committee for the ncfs and the university college cork clinical research ethics committee of the cork teaching hospitals for the ntfs. written informed consent was given by the children, teenagers and their parents or guardians. children were selected from twenty - eight primary schools in the republic of ireland from a database obtained from the department of education and science. the database was divided into (a) small / medium / large schools, (b) all boys / all girls / mixed, (c) disadvantage / not disadvantaged and (d) urban / rural. a random sample was selected from each category so that in the final sample the proportions of children attending each of the categories of schools reflected that of the proportions according to the database. the principal at selected schools was given detailed instructions on how to select children for participation in the survey from the school roll. teenagers were recruited in a similar vein from thirty - two secondary schools with a divide of secondary / vocational / comprehension schools in place of the small / medium / large for children. the overall response rate was 66 % for children and 63 % for teenagers. analysis of the demographic features of the samples has shown them to be representative samples of irish children and teenagers with respect to age, sex, social class, socio - economic group and geographic location when compared with census data. ded (kj / g) was calculated including food only and excluding all beverages. this included all solid foods and liquid - like foods such as yoghurts and soups, and excluded all beverages: both energy - containing and non - energy - containing. this method has previously been used by other authors. as water accounts for much of the variability in ded, it was thought that the inclusion of beverages may disproportionately affect estimates in those with high beverage consumption. the intakes of individual nutrients were used as indicators of the nutritional quality of the diet. the intakes of macronutrients were expressed as a percentage of total energy, while micronutrients were adjusted to 10 mj / d. each of the 1945 foods (ncfs) and 1761 foods (ntfs) consumed during the surveys were aggregated into thirty - two food groups to examine the food intake patterns associated with ded. participants who consumed a nutritional supplement at least once over the recording days were defined as supplement users. weight and height measurements were taken by researchers in the participants' own homes. weight was measured in duplicate using a seca 770 digital personal weighing scale (chasmores ltd) to the nearest 01 kg. height was measured to the nearest 01 cm using the leicester portable height measure (chasmores ltd) with the participant's head positioned in the frankfurt plane. minimum energy intake cut - off points, calculated as multiples of bmr, were used to identify under - reporters of energy. accordingly, 32 % of children and 64 % of teenagers were classified as under - reporters. presented below are those for the total population. as no natural cut - offs exist and ded estimates did not vary significantly with age or sex within each study, the populations were split equally into three categories: low- (ncfs < 756, ntfs < 765 kj / g), medium- (ncfs 756875, ntfs 766885 kj / g) and high - ded (ncfs > 875, ntfs > 885 analyses of the differences between low-, medium- and high - ded groups were carried out using a one - way anova with a tukey honestly significant difference ( hsd) or idk post hoc test to test for differences in the means. whitney u, were used when the assumptions of the anova were not met and the variables could not be normalised by transformation to the natural log or square root. the mean weight of food and of food and beverages consumed decreased across tertile of ded (p < 0001), while the mean daily intake of energy did not change significantly (table 1). table 1.daily intake of energy, macronutrients, dietary fibre and weight of food consumed, by tertile of energy density of diets in irish children (n 594) and teenagers (n 441) (mean values and standard deviations)childrenteenagerslowmediumhighlowmediumhighmean dietary energy density (kj / g)677817985663825988tertile cut - offs<756756875>875<765766885>885 n 198198198147147147mean sd mean sd mean sd p*mean sd mean sd mean sd p*weight of food excluding beverages (g / d)845197702158603150000010554028642527312160000weight of all food and beverages (g / d)16784141549371147336400002204791199561718525640000energy (mj)69146915721600958125842485240116protein (% te)14622137181252100001582514724136230000fat (% te)32642345393474300003384935247378460000saturated fat (% te)13625145241472600001312613825149260000monounsaturated fat (% te)105171141711619000010921141912620000polyunsaturated fat (% te)46114812491501155316541659190006unsaturated fat: saturated fat11402311302311502807121280291240261270280485carbohydrate (% te)524495134552250050498524925479490007total sugar (% te)239542364724357058420452025206490739added sugars (% te)1244914445170580000104431264714450000starch (% te)2754826742674801202864528143265440000dietary fibre (g/10 mj)20241176361543800002176318744160330000%te, % total energy. arrows denote the direction of association with increasing dietary energy density. * as determined by anova. daily intake of energy, macronutrients, dietary fibre and weight of food consumed, by tertile of energy density of diets in irish children (n 594) and teenagers (n 441) (mean values and standard deviations) mean values with unlike superscript letters were significantly different between groups. arrows denote the direction of association with increasing dietary energy density. * as determined by anova. the percentage total energy (% te) from fat, saturated fat, monounsaturated fat and added sugars increased (p < 0001) across tertile of ded, while the % te from protein and dietary fibre (g/10 mj) decreased (p < 0001) in both populations. in teenagers alone , it was seen that as the ded increased, the % te from both carbohydrate (p < 001) and starch (p < 0001) decreased, while the % te from poly - unsaturated fats increased (p < 001). the % te from total sugars and the unsaturated fat: saturated fat ratio did not change significantly, in either population, as ded increased (table 1). in children, as ded increased there was a significant decrease in intakes (energy adjusted) of vitamin a, vitamin d, vitamin b12, folate, biotin, thiamin, riboflavin, niacin equivalents, vitamin b6, pantothenic acid, vitamin c, ca, mg, p, k, cu, zn, mn and na (p < 0001) and fe (p < 005) (table 2). table 2.daily vitamin and mineral intakes (per 10 mj energy) from all sources by tertile of energy density of diets in irish children (n 594) and teenagers (n 441) (mean values and standard deviations)childrenteenagerslowmediumhighlowmediumhighmean dietary energy density (kj / g)677817985663825988tertile cut - offs<756756875>875<765766885>885 n 198198198147147147mean sd mean sd mean sd p * mean sd mean sd mean sd p*vitaminsvitamin a (g/10 mj per d)13799131015586656392000013317088884596433830000vitamin d (g/10 mj per d)4343132242800004736262123170000thiamin (mg/10 mj per d)25372107200600003561221320260000riboflavin (mg/10 mj per d)2937260924080000386324142110000niacin equivalents (mg/10 mj per d)43811340488378880000505139443102389920000vitamin b6 (mg/10 mj per d)33382809260900004661311625090000vitamin b12 (g/10 mj per d)694622556220000695592152230000folate (g/10 mj per d)3631563131042828200004021893151042701060000biotin (g/10 mj per d)4345283472730217500005246673121822922580000pantothenic acid (mg/10 mj per d)8549742469230000927371286120000vitamin c (mg/10 mj per d)16641291116371392153500001751593107811657555350000mineralsca (mg/10 mj per d)12883231231314116532200001098298110229310133000011mg (mg/10 mj per d)29843275362553800003115827840250340000p (mg/10 mj per d)15452521472209135723300001538252144921913442200000fe (mg/10 mj per d)13837134411304004817819215821120610000k (mg/10 mj per d)34604543111370281939600003522537319239729124270000cu (mg/10 mj per d)13061204100300001406120310040000zn (mg/10 mj per d)101296248520000118441032391210000mn (mg/10 mj per d)26092307200600003113260822080000na (mg/10 mj per d)30535662997526285651700013150590305355829775550117 mean values with unlike superscript letters were significantly different between groups. as determined by anova, unless otherwise specified. as determined by a kruskal wallis test. daily vitamin and mineral intakes (per 10 mj energy) from all sources by tertile of energy density of diets in irish children (n 594) and teenagers (n 441) (mean values and standard deviations) mean values with unlike superscript letters were significantly different between groups. arrows denote the direction of association with increasing dietary energy density. * as determined by anova, unless otherwise specified. as determined by a kruskal as ded increased there was a significant decrease in intakes (energy adjusted) of vitamin a, folate, biotin, vitamin d, thiamin, riboflavin, niacin equivalents, vitamin b6, vitamin b12, pantothenic acid and vitamin c, mg, p, fe, k, cu, zn and mn decreased as ded increased (p < 0001) and ca decreased (p < 005). there was no significant difference in na intakes across tertile of ded in teenagers (table 2). in both children and teenagers, however, the overall association with the micronutrient density of the diet did not change when the intake from nutritional supplements was excluded. table 3 displays the mean daily intake of food groups (g/10 mj / d). fruit and vegetable intakes were inversely associated with ded in both children and teenagers (p < 0001) as were fruit and vegetable juices intakes (p < 001). table 3.mean daily food group intakes (g/10 mj) by tertile of energy density of diets in irish children (n 594) and teenagers (n 441) (mean values and standard deviations)childrenteenagerslowmediumhighlowmediumhighmean ded (kj / g)677817985663825988tertile cut - offs<756756875>875<765766885>885 n 198198198147147147mean sd mean sd mean sd p*mean sd mean sd mean sd p*fruit and vegetablesfruit15501108992724624850000141617424925692934650000vegetables and vegetable dishes102176861142734633200001114832711524484140000fruit and vegetable juices167318111209140611481500003135617051085140680812430002cereal productswhite bread and rolls8555029294899146601626824877885078554720005wholemeal and brown bread and rolls2524351623089821300003404672093461352740000grains, rice, pasta, pizza and other cereals100480576460271865900001276109610878258377590000breakfast cereals5866134833755439102017228125385693423370000dairy productswhole milk329425193454243733825060797234123692401218224523580588reduced fat milks5341362328113628810820011515132657513339212260326cheeses1071331121321071640126141721311821311870424yoghurts7817616126243163940000396512483971322460000butter and spreadsreduced fat spreads (< 40 %) 2854255316470023327238222540862butter and dairy spreads (> 40 %) 84910087124113000089961031181331460098potatoes and potato dishespotatoes (boiled, baked, mashed)1083794703598506499000011369158726585605150000potato products55172902019020300537220979174871960577chipped, fried and roasted potatoes47540757745366447200006225968005579277010000beveragestea and coffee435232144361298337725710188805963863604902596647960004carbonated beverages1203147716671558234623250000144517922012065322126190000diet carbonated beverages204561272671695530395218759347792859680019squashes, cordials and fruit juice drinks1039148992311471182125501024168944266854017280400meat, fish and eggsfresh meat and meat dishes10237028885696215030000158479414357359985810000burgers, sausages and meat products53539757637458139202674683656084467445020000fish and fish dishes204283109154771330000191299108264761370057eggs and egg dishes1191861141819216201641031841061711031820552confectionery and savoury snackssugars, syrups and preserves81998110795151086781126101167861310542chocolate confectionery19921322520629925400001902072201943232610000non - chocolate confectionery1542072272924429200011151851652511281780392savoury snacks1431418714321218500001171461511662192140000biscuits, cakes and pastries3042284102533802900002572942752882853140494creams, ice creams and chilled desserts44513884153233420166273642623242443260772miscellaneoussoups and sauces49958533140323429600007987784613983773830000nuts, seeds, herbs and spices1237094811350395164614106290578ded, dietary energy density. arrows denote direction of association with increasing ded. * as determined by anova, unless otherwise specified. as determined by a kruskal mean daily food group intakes (g/10 mj) by tertile of energy density of diets in irish children (n 594) and teenagers (n 441) (mean values and standard deviations) ded, dietary energy density. arrows denote direction of association with increasing ded. * as determined by anova, unless otherwise specified. as determined by a kruskal low ded was associated with higher intakes of wholemeal and brown bread, grains, rice, pasta, pizza and other cereals, yoghurts, potatoes, fresh meat and meat dishes, fish, soups and sauces (p < 0001), reduced fat milks, reduced fat spread (p < 005), and lower intakes of butter and dairy spreads, chipped, fried and roasted potatoes, carbonated beverages, chocolate, non - chocolate confectionery, savoury snacks and biscuits and cakes (p < 0001). in teenagers, low ded was associated with higher intakes of wholemeal and brown bread, grains, rice, pasta, pizza and other cereals, breakfast cereals, yoghurts, potatoes, fresh meat and meat dishes, soups and sauces (p < 0001), tea and coffee (p < 001) and lower intakes of chips, carbonated beverages, burgers and sausages, chocolate, savoury snacks (p < 0001), white bread (p < 001) and diet carbonated beverages (p < 005) (table 3). with the removal of under - reporters from the analyses, mean ded was estimated for children as 826 kj / g and for teenagers as 835 kj / g. neither was significantly different from the total population estimates of 826 kj / g for children and 826 kj / g for teenagers. when analyses of associations were repeated excluding those children and teenagers who were classified as under - reporters, variations in the associations of ded with the nutritional quality of the diet were minimal. in these two national, detailed nutrition surveys of irish children and teenagers, ded was inversely associated with multiple individual markers of the nutritional quality of the diet. lower ded is generally considered to be associated with a healthier diet and it has been proposed for use as a possible proxy of dietary quality. this study adds to the evidence for the use of ded as a marker of a better nutritional quality of the diet, examining the data from children and teenagers for whom there is minimal evidence and also using dietary intake data from weighed / semi - weighed 7-d food diaries, whereas previous evidence has been from ffq and 24-h recall dietary data. in irish children and teenagers, low ded was associated with a generally better macronutrient profile: higher (energy - adjusted) intakes of protein and dietary fibre and lower intakes of total fat, saturated fat, monounsaturated fat and added sugars. in irish teenagers (but not children), low ded was also associated with higher intakes of carbohydrates and starch and lower intakes of polyunsaturated fat. similar were reported in swedish children and teenagers, finding that low ded was associated with higher (energy adjusted) intakes of carbohydrates, protein and fibre and lower intakes of total fat, saturated fat and sucrose. studies in adults have also reported low ded to be associated with higher intakes of protein, carbohydrates and dietary fibre and lower intakes of fat and saturated fat. in examining a broad range of vitamins and minerals, this study showed that lower ded was associated with a higher micronutrient density of the diet in children and teenagers. previous studies have found that children and teenagers with low ded had higher intakes of most of the micronutrients examined than those with high ded. in adults, it has been reported that those with a low ded had higher, energy - adjusted intakes of vitamins a, c and b6, folate, fe, ca and k than their high ded counterparts and also that there were higher intakes of folate, vitamin c, carotenoids, vitamin b6, ca and fe in those with lower ded. higher compliance with dietary recommendations for micronutrient intakes has been associated with having a lower ded. in a study of american men and women those with low ded were reported to have a higher prevalence of multivitamin / multimineral supplement use. the association of increased use of nutritional supplements with ded was also examined in the current study and was found to be associated with lower ded in irish children and teenagers. this is not to detract from the association with increased micronutrient intake, as the association of lower ded with increased micronutrient density of the diet was found to be independent of nutritional supplement usage. this better nutritional quality associated with lower ded may be explained by the differences in food intake patterns which were generally closer to healthy eating guidelines. children and teenagers with low ded, compared with those with high ded, consumed more fruit, vegetables, fruit and vegetable juices, wholemeal bread, grains, rice, pasta, pizza and other cereals, breakfast cereals (teenagers only), fresh meat, potatoes (mashed / boiled / baked), yoghurts and (in children only) fish and low - fat dairy products, and less chipped potatoes, carbonated beverages, confectionery and butter (children only) and (in teenagers only) white bread and processed meat. similar to the current analyses were found in swedish children and teenagers; those with lower ded were more likely to consume fruit, vegetables, pasta, rice and potatoes and cereals and less likely to consume sweets and chocolate and sweetened drinks and generally followed the nordic nutrition recommendations better than those with high ded. it had also been reported that adults consuming diets with low ded tend to be closer to dietary recommendations established by the spanish society of community nutrition than those with high ded. in a study of spanish adults, those with low ded showed a trend towards a healthier lifestyle, as characterised by more leisure - time physical activity, lower prevalence of smoking, sedentary lifestyle and alcohol consumption. some exceptions to the association of low ded with better nutritional quality of the diet were noted in this study. firstly, na intakes were slightly higher with lower ded in children but not in teenagers. these intakes, however, are estimated from food consumption data and do not take into account discretionary salt added in cooking or at the table and as such do not reflect total intakes. secondly, lower ded was associated with lower intakes of monounsaturated fat and poly - unsaturated fat (teenagers only). to investigate this further the association of ded with the unsaturated fat: saturated the lack of association shown in this analysis suggests that the lower intakes of unsaturated fats seen with lower ded reflect the association of ded with lower total fat. similarly, lower unsaturated fat intakes were reported in swedish children and teenagers and spanish adults with lower ded with a decrease in the unsaturated fat - to - saturated fat ratio with increasing ded also reported for spanish adults. although some differences in the associations of ded with food intakes were noted between children and teenagers, no differences in the direction of the association of macro- and micronutrients with ded were shown, in keeping with the notion of ded as an indicator of overall dietary quality. ded is a useful marker of the nutritional quality of the diet as it is easy to calculate, is applicable to most data and can be used in the place of multiple individual markers of dietary quality or cumulative scores. one difficulty with its use is the determination of cut - off points: at what level does ded begin to reflect a less healthy diet? this study categorised individuals according to tertile of ded but these are sample specific cut - off points and do not represent healthy and unhealthy ends of the spectrum but rather less and more healthy within the study group. this does not undermine the usefulness of ded as a marker as it can be readily used in a continuous form the cross - sectional nature of the data collection prevents the determination of the direction of associations. the percentages of under - reporters for energy in the study populations were high, particularly in teenagers; however, upon repeating the analyses without their inclusion, the associations with a better nutritional quality of the diet remained significant. no well - accepted method for calculating the ded exists, limiting the findings of this study to the method of food only. the food - only method for calculating ded was used, as water contributes to the weight of the diet but not energy intake; it was thought that the inclusion of beverages may have a disproportionate effect on ded and misclassify high beverage consumers; this also allowed for comparisons with other publications. strengths of these analyses include the detailed level in which dietary intake data were collected, making use of 7-d weighed / semi - weighed diaries collected by trained nutritionists, and the use of a sample which was nationally representative of age, sex, social class, socio - economic group and geographic location. this study shows that in children and teenagers in ireland, low ded was associated with multiple individual indicators of a better nutritional quality of the diet, including higher intakes of dietary fibre and micronutrients and a generally better balance of macronutrients. low ded was also associated with food intake patterns that were generally closer to healthy eating guidelines, as well as with supplement use. taken together , these findings support the that a low ded may be a useful indicator of a better nutritional quality of the diet.

to examine the relationship between dietary energy density (ded) and the nutritional quality of the diet, using data from the irish national children's food survey (ncfs) and the national teens' food survey (ntfs), two cross - sectional studies of food consumption were carried out between 2003 and 2006. data from the ncfs and ntfs were used to examine the intakes of nutrients and foods among those with low- (ncfs < 756, ntfs < 765 kj / g), medium- (ncfs 756875, ntfs 766885 kj / g) and high - energy - dense diets (ncfs > 875, ntfs > 885 kj / g). a 7-d food diary was used to collect food intake data from children (n 594) and teenagers (n 441). ded (kj / g) was calculated including food alone and excluding beverages. participants with lower ded consumed more food (weight) but not more energy. they also consumed less fat and added sugars and more protein, carbohydrates, starch and dietary fibre and had higher intakes of micronutrients. participants with lower ded had food intake patterns that adhered more closely to food - based dietary guidelines. low ded was associated with multiple individual indicators of a better nutritional quality of the diet, including higher intakes of dietary fibre and micronutrients and a generally better balance of macronutrients, as well as being associated with food intake patterns that were closer to healthy eating guidelines. taken together , these findings support the that a low ded may be an indicator of a better nutritional quality of the diet.

for a period of 8 months (september 2012 through april 2013), eighteen adult hemato - oncological patients, scheduled for autologous sct in the maastricht university medical center, were included. the number of venous blood draws and transfusion regime were not influenced by our observational study. two patients were excluded due to missing data (i.e., day of platelet recovery not recorded). venous whole - blood samples were collected in k2-edta vacutainer tubes (bd diagnostics, plymouth, uk). hemato - oncological patients admitted to the ward were routinely sampled daily around 8 am. when samples were drawn more frequently, a previous study showed that the ipf in samples with k2-edta stored at 4c stays within precision limits over 72 h 31. whole - blood, edta anticoagulated, samples were measured on both the sysmex xe-5000 analyzer (sysmex corporation, kobe, japan) and the sysmex xn analyzer. earlier sysmex hematology analyzers (such as the xe-5000) use the ret - channel for the measurement of immature platelets and the optic platelet count (plt - o). the sysmex xn has, in addition, a novel plt - f - channel for measurement of both mature and immature platelets. this plt - f - channel was introduced to specifically gate platelets for a more accurate platelet count (plt) and ipf. on both analyzers, measurement of immature platelets is similar on both analyzers and is based on the principle of hemocytometry. after perforation of platelet cellular membranes by reagents, nucleic acids are stained by fluorescent dyes: polymethine and oxazine (xe-5000) or oxadine (xn ; 31,32). this algorithm contains side fluorescence (reflection of rna content), side scattered light (information on intracellular structure), and forward scattered light (information on cell size). prophylactic transfusion trigger was defined by a platelet concentration of < 10 10/l. in case of clinical complications, surgical intervention or the use of anticoagulants patients in the sct protocol received irradiated platelet products, prepared from the buffy coats of five different abo / d - matched whole - blood donors, resuspended in one unit of plasma to a volume of circa 350 ml and containing at least 250 10 platelets 33,34. some patients received pathogen - inactivated platelets (treated with riboflavin / uvb - pathogen) (mirasol ; terumobct, lakewood, co, usa ; see table2). transfusion reactions were reported according to the standard protocol. to assess biological within - person variation, plt, ipf, and the absolute number of immature platelets (ipa) were measured in eight healthy subjects (four men and four women, age 2333) once a day at the same time on 5 d in duplicate on the sysmex xn and xe analyzers. twofold nested anova was used to estimate, between - person (cvbp), biological (within - person) (cvwp), and analytical (cva) coefficients of variation including 95% confidence intervals 35. rcv was calculated based on the biological and analytical coefficients of variations found in this experiment. rcv is calculated using the formula and reflects the minimal difference required to define a statistically significant increase or decrease compared with the previous in that person. z is the number of standard deviations appropriate to the desired probability 36,37. in this study platelet recovery was defined as the first day that platelet count increased without transfusion and exceeding the rcv. statistical analyses were performed with spss statistics version 20 (ibm corporation, new york, ny, usa). sensitivity, specificity, and positive predictive value (ppv) were calculated as described by emir et al. 38, where sensitivity, specificity, and ppv for our patient population are weighted averages. weights we used are based on the number of patient samples as a control (no recovery within 2 d) or as a case (recovery within 2 d). we analyzed sensitivity and specificity of both ipa and ipf from day 8 after sct until the day of platelet recovery. using these data for a period of 8 months (september 2012 through april 2013), eighteen adult hemato - oncological patients, scheduled for autologous sct in the maastricht university medical center, were included. the number of venous blood draws and transfusion regime were not influenced by our observational study. two patients were excluded due to missing data (i.e., day of platelet recovery not recorded). venous whole - blood samples were collected in k2-edta vacutainer tubes (bd diagnostics, plymouth, uk). hemato - oncological patients admitted to the ward were routinely sampled daily around 8 am. when samples were drawn more frequently, a previous study showed that the ipf in samples with k2-edta stored at 4c stays within precision limits over 72 h 31. whole - blood, edta anticoagulated, samples were measured on both the sysmex xe-5000 analyzer (sysmex corporation, kobe, japan) and the sysmex xn analyzer. earlier sysmex hematology analyzers (such as the xe-5000) use the ret - channel for the measurement of immature platelets and the optic platelet count (plt - o). the sysmex xn has, in addition, a novel plt - f - channel for measurement of both mature and immature platelets. this plt - f - channel was introduced to specifically gate platelets for a more accurate platelet count (plt) and ipf. on both analyzers, measurement of immature platelets is similar on both analyzers and is based on the principle of hemocytometry. after perforation of platelet cellular membranes by reagents, nucleic acids are stained by fluorescent dyes: polymethine and oxazine (xe-5000) or oxadine (xn ; 31,32). this algorithm contains side fluorescence (reflection of rna content), side scattered light (information on intracellular structure), and forward scattered light (information on cell size). prophylactic transfusion trigger was defined by a platelet concentration of < 10 10/l. in case of clinical complications, surgical intervention or the use of anticoagulants patients in the sct protocol received irradiated platelet products, prepared from the buffy coats of five different abo / d - matched whole - blood donors, resuspended in one unit of plasma to a volume of circa 350 ml and containing at least 250 10 platelets 33,34. some patients received pathogen - inactivated platelets (treated with riboflavin / uvb - pathogen) (mirasol ; terumobct, lakewood, co, usa ; see table2). to assess biological within - person variation, plt, ipf, and the absolute number of immature platelets (ipa) were measured in eight healthy subjects (four men and four women, age 2333) once a day at the same time on 5 d in duplicate on the sysmex xn and xe analyzers. twofold nested anova was used to estimate, between - person (cvbp), biological (within - person) (cvwp), and analytical (cva) coefficients of variation including 95% confidence intervals 35. rcv was calculated based on the biological and analytical coefficients of variations found in this experiment. rcv is calculated using the formula and reflects the minimal difference required to define a statistically significant increase or decrease compared with the previous in that person. z is the number of standard deviations appropriate to the desired probability 36,37. in this study platelet recovery was defined as the first day that platelet count increased without transfusion and exceeding the rcv. statistical analyses were performed with spss statistics version 20 (ibm corporation, new york, ny, usa). sensitivity, specificity, and positive predictive value (ppv) were calculated as described by emir et al. 38, where sensitivity, specificity, and ppv for our patient population are weighted averages. weights we used are based on the number of patient samples as a control (no recovery within 2 d) or as a case (recovery within 2 d). we analyzed sensitivity and specificity of both ipa and ipf from day 8 after sct until the day of platelet recovery. using these data figure1 shows the mean concentrations and absolute ranges for plt, ipa, and the ipf of eight healthy individuals measured as described in the methods section. using these data , we calculated analytical, within - person, and between - person coefficients of variation for plt, ipa, and ipf. coefficients of variation and rcv reference change values (rcv), analytical coefficient of variation (cva, 95% confidence interval), within - person coefficient of variation (cvwp, 95% confidence interval), and between - person coefficient of variation (cvbp, 95% confidence interval) for platelet count (plt), immature platelet fraction (ipf), and the absolute number of immature platelets (ipa) based on our biological variation study. mean concentrations (dots) and absolute range (horizontal lines) of platelet count (plt) (panel a), the immature platelet fraction (ipf) (panel b) and the absolute number of immature platelets (ipa) (panel c) measured in healthy individuals (n = 8) on 5 d in duplicate. patient characteristics aitl, angioimmunoblastic t - cell lymphoma; beam, bcnu, cytarabine, etoposide and melphalan; dlbcl, diffuse large b - cell lymphoma; hdm, high - dose melphalan; mm, multiple myeloma; pbsct, peripheral blood stem cell transplantation. platelet recovery (an increase in platelets greater than its rcv and not due to platelet transfusion) was observed after a median of 13 d in patients after autologous sct. before platelet recovery, we observed an increase in ipa exceeding rcv, that is, more than 33.63%, in all patients. this increase in ipa measured on the xn analyzer preceded platelet recovery by a median of 3 d (range 16 d). increase in ipf exceeding rcv, that is, more than 23.44%, was also observed in all patients prior to platelet recovery. this increase in ipf measured on the xn analyzer was seen by a median of 4 d (range 27 d) before platelet recovery. figure2 shows the course of plt, ipa, and ipf in a patient after autologous sct. representative example of the course of platelet count (plt), the absolute number of immature platelets (ipa), and immature platelet fraction (ipf) in a patient from stem cell transplantation (sct) until recovery. panel a shows the course of the plt (black) and the ipa (gray). panel b shows the course of plt (black) and the ipf (gray). stars indicate an increase (in plt, ipa, or ipf) exceeding its reference change value (rcv) not due to platelet transfusion. ipa and ipf, as well as xn and xe data, were analyzed separately. roc curve for ipf from day 8 till the moment of platelet recovery after autologous sct measured with the xn analyzer showed an area under curve (auc) of 0.86. roc curves for the ipa, based on data from the sysmex xe-5000, had lower aucs. aucs of roc curves based on estimated sensitivity and specificity for the ipf and the absolute number of immature platelets (ipa) measured on both the symex xe-5000 and the xn analyzer roc curves and aucs of immature platelet fraction (ipf) measured on the sysmex xe-5000 and xn analyzer after autologous stem cell transplantation (sct). roc curve for ipf after autologous sct measured on the sysmex xn showed the most optimal auc. we determined a cutoff value of 5.3% to predict platelet recovery within 2 d measured on the sysmex xn. figure1 shows the mean concentrations and absolute ranges for plt, ipa, and the ipf of eight healthy individuals measured as described in the methods section. using these data , we calculated analytical, within - person, and between - person coefficients of variation for plt, ipa, and ipf. coefficients of variation and rcv reference change values (rcv), analytical coefficient of variation (cva, 95% confidence interval), within - person coefficient of variation (cvwp, 95% confidence interval), and between - person coefficient of variation (cvbp, 95% confidence interval) for platelet count (plt), immature platelet fraction (ipf), and the absolute number of immature platelets (ipa) based on our biological variation study. mean concentrations (dots) and absolute range (horizontal lines) of platelet count (plt) (panel a), the immature platelet fraction (ipf) (panel b) and the absolute number of immature platelets (ipa) (panel c) measured in healthy individuals (n = 8) on 5 d in duplicate. patient characteristics aitl, angioimmunoblastic t - cell lymphoma; beam, bcnu, cytarabine, etoposide and melphalan; dlbcl, diffuse large b - cell lymphoma; hdm, high - dose melphalan; mm, multiple myeloma; pbsct, peripheral blood stem cell transplantation. platelet recovery (an increase in platelets greater than its rcv and not due to platelet transfusion) was observed after a median of 13 d in patients after autologous sct. before platelet recovery , we observed an increase in ipa exceeding rcv, that is, more than 33.63%, in all patients. this increase in ipa measured on the xn analyzer preceded platelet recovery by a median of 3 d (range 16 d). increase in ipf exceeding rcv, that is, more than 23.44%, was also observed in all patients prior to platelet recovery. this increase in ipf measured on the xn analyzer was seen by a median of 4 d (range 27 d) before platelet recovery. figure2 shows the course of plt, ipa, and ipf in a patient after autologous sct. representative example of the course of platelet count (plt), the absolute number of immature platelets (ipa), and immature platelet fraction (ipf) in a patient from stem cell transplantation (sct) until recovery. panel a shows the course of the plt (black) and the ipa (gray). panel b shows the course of plt (black) and the ipf (gray). stars indicate an increase (in plt, ipa, or ipf) exceeding its reference change value (rcv) not due to platelet transfusion. ipa and ipf, as well as xn and xe data, were analyzed separately. roc curve for ipf from day 8 till the moment of platelet recovery after autologous sct measured with the xn analyzer showed an area under curve (auc) of 0.86. roc curves for the ipa, based on data from the sysmex xe-5000, had lower aucs. aucs of roc curves based on estimated sensitivity and specificity for the ipf and the absolute number of immature platelets (ipa) measured on both the symex xe-5000 and the xn analyzer roc curves and aucs of immature platelet fraction (ipf) measured on the sysmex xe-5000 and xn analyzer after autologous stem cell transplantation (sct). roc curve for ipf after autologous sct measured on the sysmex xn showed the most optimal auc. we determined a cutoff value of 5.3% to predict platelet recovery within 2 d measured on the sysmex xn. in patients awaiting thrombopoietic recovery after sct, a strategy of prophylactic platelet transfusion is considered best practice, despite questions and debates about dose and lowest acceptable platelet counts 21,22,39. platelet transfusions, although generally accepted as safe, may cause various transfusion reactions and are considered a scarce and also costly resource 23. in search of sensitive predictors of thrombopoietic recovery, the feasibility of immature platelets measured by the sysmex xn hematocytometer was studied as a tool to detect early platelet recruitment. an important step toward determination of a cutoff value for immature platelets is to objectively define platelet recovery. we used a validated statistical approach based on biological and analytical variation to objectify platelet recovery based on rcv 36,37. a possible limitation may be that we assumed biological within - subject variation to be the same for healthy subjects as for patients after sct. however, this assumption appears valid because a previous study showed that for the majority of parameters, biological within - subject variation is of the same order in health and disease 40. nevertheless, fraser 41 showed that a ratio of 0.50 of analytical variation to within - subject variation has an effect of only 12% on rcv. while within - subject variation is much larger than analytical variation in our study previous studies used different definitions for platelet recovery, for example, platelet count 30 10/l for three consecutive days, seven consecutive days with a platelet count 20 10/l without platelet transfusions, or a spontaneous increase in plt count without platelet transfusions 1315,18,28. despite the fact that we used rcv to define platelet recovery, the interval between increase in immature platelets and platelet recovery we found appears similar, that is, approximately 2 d 15,16,18,28. to estimate sensitivity, specificity, and ppv, we used the approach proposed by emir et al. this may be a limitation, as it led to a different number of controls per patient: more controls when recovery time is longer, which in turn led to higher specificity. day 8 was chosen because we observed earliest platelet recovery 2 d later (day 10). roc curves based on estimated sensitivity and specificity showed differences in aucs between ipf and ipa and between measurements on the sysmex xe-5000 and the sysmex xn. roc curve of ipf measured on the sysmex xn had a larger auc compared to xe-5000. this reflects that ipf measured by the xn has a better precision than when measured by the xe-5000. we estimated a cutoff value of ipf 5.3% in patients after autologous sct to predict thrombopoietic recovery within 2 d, with a ppv of 0.93. based on the large between - subject variations of 32.9% and 45.9% for ipa and ipf, respectively, found in our biological variation study, it would be reasonable to define a cutoff value indicating the difference between two measurements (or delta). however, roc curves based on both absolute and delta values for ipa and ipf did not have acceptable aucs, and this method was therefore not further investigated (data not shown). in only one other study, a cutoff ipf predicting platelet recovery after autologous sct was estimated 18. in this study, containing 31 patients, an ipf greater than 7.0% on day 8 after sct predicted platelet recovery within 4 d (ppv 79%, sensitivity 76%). because immature platelets were assessed using flow cytometry the cutoff value for ipf of 5.3%, with high ppv and specificity, is based on observational data. theoretically, this cutoff may be used to decide whether or not to give a platelet transfusion. platelet transfusion may be omitted when platelet count is likely to recover within 2 d. this strategy may reduce the number of platelet transfusions and its associated risks and costs. the hemostatic capacity of immature platelets is a point of interest, because current prophylactic strategy is intended to prevent serious bleeding incidents. previous studies suggest that thrombocytopenic patients with high concentrations of immature platelets of up to 4050%, such as itp patients, have a smaller bleeding - tendency compared with thrombocytopenic patients with low concentrations of immature platelets, such as chemotherapy - treated patients 42. clearly, clinical interventional studies are needed to address this issue proving more evidence for the value of high ipf in platelet transfusions strategies. another argument to include a marker of thrombopoiesis in transfusion strategy is the observation that thrombopoiesis may be suppressed by transfused platelets 7,15,27,43. however, while previous studies reported a decrease in ipf after platelet transfusion 7,15, we did not observe an unequivocal effect of platelet transfusions in our population. 44 showed that platelet transfusions lead to a decrease in ipf, but do not alter the ipa, suggesting dilution by an increase in circulating mature platelets. our finding was that immature platelets are sometimes increased and sometimes decreased after platelet transfusion. the dilution effect of platelet transfusion on immature platelets (e.g., increase or decrease) depends on both the immature platelet count before transfusion and the immature platelet content of the platelet concentrate 17,45. in summary, we demonstrated an increase in immature platelets measured on the sysmex xn analyzer preceding platelet recovery. we showed that ipf cutoff of 5.3% is a promising predictor of platelet recovery in patients after autologous sct. however, a small number of patients were included in the final data analysis. due to the observational design of the study interventional clinical trials in a multicenter setting are required to validate the cutoff value presented in this study and to establish its role in ipf - based transfusion policies.

objectivesa period of thrombocytopenia is common after stem cell transplantation (sct). to prevent serious bleeding complications, prophylactic platelet transfusions are administered. previous studies have shown that a rise in immature platelets precedes recovery of platelet count. our aim was to define a cutoff value for immature platelets predicting thrombopoietic recovery within 2 d.methodshematological parameters were measured on the sysmex xn hemocytometer. we calculated reference change values (rcv) for platelets in eight healthy individuals as marker for platelet recovery. to define a cutoff value, we performed roc analysis using data from 16 autologous sct patients.rcv for platelet concentration was 14.1%. platelet recovery was observed 13 (median ; range 931) days after sct. increase in immature platelet fraction (ipf) before platelet recovery was seen in all autologous sct patients. optimal cutoff ipf was found to be 5.3% for platelet recovery within 2 d (specificity 0.98, sensitivity 0.47, positive predictive value 0.93).we identified an optimal cutoff value for ipf 5.3% to predict platelet recovery after autologous sct within 2 d. implementing this cutoff value in transfusion strategy may reduce the number of prophylactic platelet transfusions.

interdisciplinary teamwork is an essential component of holistic care since team members skills, experience, and knowledge are pooled together to produce the best outcomes. each of the members in the intensive care unit (icu) team plays a unique role according to the patients need. physiotherapy has been accepted as an integral component of the management of patients who require intensive care and physiotherapists play a unique role as a part of the icu team. physiotherapists are elemental team representatives of the clinical healthcare team, and they need to understand other practitioners roles and communicate effectively to provide high - quality, coordinated patient care. a nurse on the other hand plays a vital role in critical care unit serves as an important communicator in the icu team. nurses make up a large component of the healthcare sector and are essential in the interprofessional healthcare team in a hospital setting. this perceived dominant role may influence the power relationship between nurses and physiotherapists. in the current demanding healthcare environment, interprofessional team practice is being promoted as a comprehensive means of providing cost - effective healthcare. literature suggests that professional specialization has led to a fragmentation between professions, which is likely to in health care team members being unable to look at problems of patient as a whole team. a small number of studies have highlighted a part of the attitudes and perceptions that may underlie interprofessional relationships and their effect on teamwork and effectiveness of management in critical care. communication is being identified of particular interest because of the complex sociotechnical tendency of the icu environment. interpersonal factors have been reported as the main causes of stress in high - dependency areas whereas poor communication reported as cause of errors. a study exploring interprofessional perceptions of physiotherapists and midwives, using the nominal group technique and follow - up questionnaires, identified the lack of awareness about each other's discipline. another study examined the nurse occupational therapist interface and established that there was little similarity between the work of nurses and therapists, which produced conflicts in patient handling. there stands a scarcity of literature in the indian hospital setting for incorporating interdisciplinary practice in the critical care setting and role perception between health care providers of various professions. further research about collaboration and communication between physiotherapists and nurses in the critical care unit will serve as base to improve the interprofessional relationships. the objective of this study was to examine nurses perceptions of role of physiotherapists in the critical care team at a tertiary care teaching hospital in india. this study was designed to examine nurses perceptions and experiences, rather than to measure specific identified attitudes; semi - structured interview was used as an appropriate method. critical care nurses with the minimum experience of 6 months were recruited for the interview, after obtaining written informed consent. this study was approved by the institution ethics committee of father muller charitable institutions. a purposive this sample size was chosen to allow in - depth exploration and range of perceptions. as the study was exploratory, it did not aim to secure a strictly representative sample. a written informed consent was obtained from each participant before the commencement of the interview. investigators personally contacted the nursing supervisor from each unit to identify the total number of nurses working in that critical care team and also to recognize the ones fulfilling the inclusion criteria. once they were identified, the interviewer individually approached them and fixed up a specific time for interview according to the convenience. the interview questions were developed based on previous literature and from discussions with various experienced icu team members. the interview questions focused on the following general issues: existence of physiotherapist in the icu, the role they played, and various techniques used by the therapists while providing icu care. questions about the interaction and communication between the nurses and therapists within the icu were also asked. in addition, questions related to multidisciplinary practice and its necessity were also included to know their perceptions. although a common interview guide was used for all interviews, the precise manner in which questions were raised varied in response to the direction of each interview. in each case, however, the style of the interview was informal and unstandardized, and a nonjudgmental stance was taken to participants reported perceptions and experience. the interview took place for 1520 min in a silent room where there was no disturbance. themes emerged from the interview transcripts were categorized, and relationships between the ing categories were identified. first, coding on a subsample of transcripts was checked by an investigator who was trained in qualitative research and having similar research interests and relevant knowledge. through this process, thirty - three nurses (32 females and 1 male) were interviewed from the critical care units. these themes, are presented under two main headings: the main issues and the key outcomes identified. principle issues from analysis the issue that emerged most strongly in relation to the physiotherapist's role was that of facilitating ambulation in critical care patients (n = 20). all participants referred to this aspect of physiotherapy, and it was frequently placed within a functional context by reference to a range of functions. ambulation / assisting the patient to walk and limb physiotherapy (n = 23) were the most commonly perceived roles of physiotherapists. the only nonphysical aspect of the physiotherapist's role mentioned was motivating patients (n = 1). this might represent the actual role adopted by physiotherapists in the critical care team but might also reflect the way in which the other aspects of therapy are probably less visible to the health care professionals. a strong theme that emerged from the data was that how nurses perceived efficacy of physiotherapy in managing range of patients. a majority of the respondents admitted to have seen improvement in outcomes (n = 29). physiotherapy was described by several nurses as a field of practice which facilitated quicker weaning, accelerated discharge from critical unit and providing independence to patients in spite of being admitted to critical care, for example, when asked whether they had seen improvement in patients with physiotherapy; nurse reported: yes, many number of times. mostly in case of patients ventilated. the patients actually stood up with the ventilator, and this was very surprising to see.yes, quite a lot of improvement especially after the patient has walked. so, we consider walking as a sign of shift out at times. yes, the patients actually stood up with the ventilator, and this was very surprising to see. yes, quite a lot of improvement especially after the patient has walked. we feel that they look happy and then complaint of less pain. a total number of four nurses reported that they did not notice improvement of following physiotherapy but on the other hand denied of having seen any adverse events posttherapy. when enquired about the importance of interprofessional communication, all the nurses (n = 33) felt the necessity to have strong communication skills. patient's minute details will not be missed out if good communication exists. the nature of the information exchanged between the professionals was highly valued and seen as a significant contribution to good teamwork although it appeared to be of short duration. however, some of the perceived problems in information sharing, which the nurses valued highly included lack of time: for eg. , usually we will not discuss because we will be busy with our work, but sometimes we may discuss something like if anything is to be told from physician side. interprofessional communication related to the patient care was found to be limited although there was strong felt need for interprofessional communications. all the participants felt there was frequent exchange of important information between the two professionals, especially regarding the feeding timings, sedation, and any other adverse events that occurred during the time physiotherapists were not around. in an attempt to explore any underlying conflicts, one of our questions aimed to determine the knowledge of existing disagreements between the professionals. when prompted, a few of the nurses admitted that they had minor conflicts in patient care (n = 12) while a majority of them reported of not having any conflicts. the conflicts if any were resolved by simple face - to - face discussion reported by the respondents. whatever the problem was between the physiotherapist and i was settled within a day as we discussed that issue and it was never repeated again. this theorizes that selfdom or ego is not permitted in critical care as it can have a direct impact on patient's care. certainly, the majority of the subjects admitted that there should be more interaction between nurses and physiotherapists for appropriate congruency in patient care. most of the nurses strongly felt the necessity of forming a multidisciplinary team in the critical care setting (n = 31). this was combined with considerations such as it will save each person's time, management will be completely patient centered, and confusions will be less. these statements suggest that teamwork would thus be an accepted way of providing holistic care since team members skills, experience, and knowledge are pooled together to produce the best outcome. the issue that emerged most strongly in relation to the physiotherapist's role was that of facilitating ambulation in critical care patients (n = 20). all participants referred to this aspect of physiotherapy, and it was frequently placed within a functional context by reference to a range of functions. ambulation / assisting the patient to walk and limb physiotherapy (n = 23) were the most commonly perceived roles of physiotherapists. the only nonphysical aspect of the physiotherapist's role mentioned was motivating patients (n = 1). this might represent the actual role adopted by physiotherapists in the critical care team but might also reflect the way in which the other aspects of therapy are probably less visible to the health care professionals. a strong theme that emerged from the data was that how nurses perceived efficacy of physiotherapy in managing range of patients. a majority of the respondents admitted to have seen improvement in outcomes (n = 29). physiotherapy was described by several nurses as a field of practice which facilitated quicker weaning, accelerated discharge from critical unit and providing independence to patients in spite of being admitted to critical care, for example, when asked whether they had seen improvement in patients with physiotherapy; nurse reported: yes, many number of times. mostly in case of patients ventilated. the patients actually stood up with the ventilator, and this was very surprising to see.yes, quite a lot of improvement especially after the patient has walked. so, we consider walking as a sign of shift out at times. yes, the patients actually stood up with the ventilator, and this was very surprising to see. yes, quite a lot of improvement especially after the patient has walked. a total number of four nurses reported that they did not notice improvement of following physiotherapy but on the other hand denied of having seen any adverse events posttherapy. when enquired about the importance of interprofessional communication, all the nurses (n = 33) felt the necessity to have strong communication skills. patient's minute details will not be missed out if good communication exists. the nature of the information exchanged between the professionals was highly valued and seen as a significant contribution to good teamwork although it appeared to be of short duration. however, some of the perceived problems in information sharing, which the nurses valued highly included lack of time: for eg. usually we will not discuss because we will be busy with our work, but sometimes we may discuss something like if anything is to be told from physician side. interprofessional communication related to the patient care was found to be limited although there was strong felt need for interprofessional communications. all the participants felt there was frequent exchange of important information between the two professionals, especially regarding the feeding timings, sedation, and any other adverse events that occurred during the time physiotherapists were not around. in an attempt to explore any underlying conflicts, one of our questions aimed to determine the knowledge of existing disagreements between the professionals. when prompted, a few of the nurses admitted that they had minor conflicts in patient care (n = 12) while a majority of them reported of not having any conflicts. the conflicts if any were resolved by simple face - to - face discussion reported by the respondents. whatever the problem was between the physiotherapist and i was settled within a day as we discussed that issue and it was never repeated again. this theorizes that selfdom or ego is not permitted in critical care as it can have a direct impact on patient's care. certainly, the majority of the subjects admitted that there should be more interaction between nurses and physiotherapists for appropriate congruency in patient care. most of the nurses strongly felt the necessity of forming a multidisciplinary team in the critical care setting (n = 31). this was combined with considerations such as it will save each person's time, management will be completely patient centered, and confusions will be less. these statements suggest that teamwork would thus be an accepted way of providing holistic care since team members skills, experience, and knowledge are pooled together to produce the best outcome. the issue that emerged most strongly in relation to the physiotherapist's role was that of facilitating ambulation in critical care patients (n = 20). all participants referred to this aspect of physiotherapy, and it was frequently placed within a functional context by reference to a range of functions. ambulation / assisting the patient to walk and limb physiotherapy (n = 23) were the most commonly perceived roles of physiotherapists. the only nonphysical aspect of the physiotherapist's role mentioned was motivating patients (n = 1). this might represent the actual role adopted by physiotherapists in the critical care team but might also reflect the way in which the other aspects of therapy are probably less visible to the health care professionals. a strong theme that emerged from the data was that how nurses perceived efficacy of physiotherapy in managing range of patients. a majority of the respondents admitted to have seen improvement in outcomes (n = 29). physiotherapy was described by several nurses as a field of practice which facilitated quicker weaning, accelerated discharge from critical unit and providing independence to patients in spite of being admitted to critical care, for example, when asked whether they had seen improvement in patients with physiotherapy; nurse reported: yes, many number of times. mostly in case of patients ventilated. the patients actually stood up with the ventilator, and this was very surprising to see.yes, quite a lot of improvement especially after the patient has walked. so, we consider walking as a sign of shift out at times. yes, the patients actually stood up with the ventilator, and this was very surprising to see. yes, quite a lot of improvement especially after the patient has walked. a total number of four nurses reported that they did not notice improvement of following physiotherapy but on the other hand denied of having seen any adverse events posttherapy. when enquired about the importance of interprofessional communication, all the nurses (n = 33) felt the necessity to have strong communication skills. patient's minute details will not be missed out if good communication exists. the nature of the information exchanged between the professionals was highly valued and seen as a significant contribution to good teamwork although it appeared to be of short duration. however, some of the perceived problems in information sharing, which the nurses valued highly included lack of time: for eg., usually we will not discuss because we will be busy with our work, but sometimes we may discuss something like if anything is to be told from physician side. interprofessional communication related to the patient care was found to be limited although there was strong felt need for interprofessional communications. all the participants felt there was frequent exchange of important information between the two professionals, especially regarding the feeding timings, sedation, and any other adverse events that occurred during the time physiotherapists were not around. in an attempt to explore any underlying conflicts, one of our questions aimed to determine the knowledge of existing disagreements between the professionals. when prompted, a few of the nurses admitted that they had minor conflicts in patient care (n = 12) while a majority of them reported of not having any conflicts. the conflicts if any were resolved by simple face - to - face discussion reported by the respondents. whatever the problem was between the physiotherapist and i was settled within a day as we discussed that issue and it was never repeated again. this theorizes that selfdom or ego is not permitted in critical care as it can have a direct impact on patient's care. certainly, the majority of the subjects admitted that there should be more interaction between nurses and physiotherapists for appropriate congruency in patient care. most of the nurses strongly felt the necessity of forming a multidisciplinary team in the critical care setting (n = 31). this was combined with considerations such as it will save each person's time, management will be completely patient centered, and confusions will be less. these statements suggest that teamwork would thus be an accepted way of providing holistic care since team members skills, experience, and knowledge are pooled together to produce the best outcome. the major role of a physiotherapist as perceived by the nurses was facilitating early mobilization. this could be attributed to the fact in the center where this study was carried out practices early mobilization protocol which was designed and tested indigenously. most of the respondents felt that a physiotherapist could help in case of ventilated patients, thereby reducing the chances of ventilated associated infections and improving patients condition and promote quicker recovery. all the nurses commented on the need to have good communication in the critical care unit. a study of this kind advocated that communication would be a significant step in assisting healthcare delivery to clients and their families to become flawless, efficient, and effective. hence, there is need for the same to reflect a core competency between health professionals. a majority of nurses felt lack of time as the major reason for lack of communication in the critical care practice. disagreements are another criterion which requires to be pondered on when there is any discussion on critical care. some of the respondents felt that disagreements are bound to take place in a setting where two professions do not work in congruency. hence the major factor that may influence this is interprofessional learning, and it has shown to have a positive impact on their awareness and understanding of other professional roles, interprofessional issues, and how they valued others roles as well as the support they offer, which in turn helped to reduce barriers and interprofessional conflicts. perhaps understandably, as each profession views the issue from its own perspective, the blame for change or adaptation is liable to be shifted to the other profession. this suggests that if change is to be effective, it should be bilateral, with the blame for change shared across the two professions. one way in which this might occur would be through nurses and physiotherapists working concurrently with the patient, accomplishing the goals of both nursing and therapy in the same activities. for example, a change of the patient's position to side lying may simultaneously provide skin pressure care and improve lung ventilation and sputum clearance. it would appear that physiotherapists should consider spending some time sharing with nurses sufficient skills to provide continuity of care for patients. physiotherapists can not on one hand expect nurses to provide continuity in progression and on the other hand be protective of therapy skills in this area. in any case, physiotherapists should not be unduly worried on this score. brown and greenwood suggest that such flexible cooperation might enhance the core skills of each profession by promoting the working roles of both. nurses also, despite the problems identified, spoke of good or excellent relationships with physiotherapists but admitted that it lacked teamwork because they did not discuss patient goals with each other often, so they did not work together on strategies to achieve those goals. one of the major limitations of this study is the smaller sample size which might not be able derive the perception of entire nurse population. this preliminary exploratory study revealed that nurses working in the critical care team have positive perception about the physiotherapists. participants of this study were aware of the role of physiotherapists in critical care, which will be useful in clinical decision making of the therapist.

: interprofessional relationship plays a major role in effective patient care. specialized units such as critical care require multidisciplinary care where perception about every members role may affect the delivery of patient care. the objective of this study was to find out nurses perceptions of the role of physiotherapists in the critical care team.methods:qualitative study by using semi - structured interview was conducted among the qualified nurses working in the intensive care unit of a tertiary care hospital. the interview consisted of 19 questions divided into 3 sections. interviews were audio recorded and transcribed. in - depth content analysis was carried out to identify major themes in relation to the research question.:analysis identified five major issues which included role and image of a physiotherapist, effectiveness of treatment, communications, teamwork, and interprofessional relations. physiotherapists were perceived to be an important member of the critical team with the role of mobilizing the patients. the respondents admitted that there existed limitations in interprofessional relationship.:nurses perceived the role of physiotherapist in the critical care unit as an integral part and agreed on the need for inclusion of therapist multidisciplinary critical care team.

these are peer - reviewed poster - platform submissions finalized by the scientific program committee. a total of 153 abstracts (14 platforms & 139 posters) were selected from 161 submissions to be considered for presentation during november 4 8, 2011, at the hilton baltimore hotel, to pathologists, cytopathologists, cytotechnologists, residents, fellows, students, and other members of cytopathology - related medical and scientific fields.

cone beam computed tomography (cbct) has found its niche in different fields of dental practice during recent years. nowadays, the use of three - dimensional radiographies is increasing for diagnosis and treatment in dentistry. single - slice ct and multislice ct techniques were first introduced in this regard. the case against these two systems was that they exposed patients to high - radiation doses. thus cbct was introduced to promise low - radiation doses together with adequate image quality, as well as fast image processing and lower costs. consequently, the use of this technique dramatically increased in implant dentistry, maxillofacial surgery , orthodontics, endodontics, and so forth. as different treatment approaches highly depend on the exact estimation of distance between anatomical landmarks and bone thickness, many clinicians tend to use the linear measurement capability of cbct. unfortunately, unwanted measurement errors may lead to catastrophic consequences like treatment failure. since cbct machines are not equipped with cephalostat, the skull might be in eccentric position during scanning procedure. previous studies have investigated accuracy of linear measurements in cbct images using the newtom 3 g, accuitomo, and other cbct machines , concluding that the linear measurement capability of these units is reliable for the structures closely associated with dentomaxillofacial imaging. have evaluated the effect of patient's head position on linear measurement accuracy of newtom 3 g cbct machine. mischkowski et al. evaluated the geometric accuracy of scans obtained with galileous cbct device. they declared the liner measurements between anatomical structures in the present of soft tissue are significantly accurate. although the newly introduced galileous cbct machine is reported to be one of cbct dental devices with the lowest effective dose, its linear measurement accuracy has not been evaluated in different positions. since it is probable that the patient's head deviate from true vertical or horizontal orientation during scanning procedure; which might adversely affect measurement accuracy, the aim of this study was to determine the accuracy of linear measurements in dry human skulls in ideal position and different deviated positions by simulating clinical relevant distances, using galileous cbct machine. this is an experimental study on human skulls which was conducted in isfahan university of medical sciences and approved by ethical committee of isfahan dental school research center. 5 regions were selected on each jaw; anterior, premolar, and molar regions of left and right sides of the jaw. in order to measure buccolingual and mesiodistal distances and height in each region , four points were determined using 1.5 mm rod - shaped gutta - percha (size # 40) opaque markers (table 1): in the way that the first marker was glued to the embrasure of buccal alveolar crest of the studied region, the second marker to embrasure of lingual alveolar crest, perpendicular to the first marker, the third marker to the most apical region of buccal alveolar crest in the same direction with the first marker, and the fourth marker to the adjacent tooth's embrasure of buccal alveolar crest, next to the first marker. the buccolingual, mesiodistal distances and heights of each region were measured two times by the first observer with one - week interval and once by a second observer, using a digital caliper (guanglu, taizhou, china). the images were taken using galileos comfort 3d imaging system (sirona dental systems inc . 5 different radiographs were provided for each skull in different positions : ideal position and positions with 10-to-15-degree rotation, 10-to-15-degree tilt, 10-to-15-degree forward tilt ( flexion), and 10-to-15-degree backward tilt (extension). to reconstruct the temporomandibular joint space, a 1.5 mm - thick baseplate wax was placed between condylar process and temporal fossa. after guiding the jaw into the centric occlusion, the jaws were attached by an adhesive tape. a polyvinyl pipe was placed into the foramen magnum and attached to a camera tripod (zeiss universal tripod ft6302, oberkochen, germany) with capability of lateral and forward - backward tilt and rotational adjustment, via a dial plate. to provide standard radiographs, the skull was held in the image field using the machine's occlusal bite block between teeth (in the way that the occlusal plane was perfectly horizontal ; according to manufacturer 's instructions). to ensure appropriate position of skulls, the system's light localizer, which displays the midsagittal line, then, imaging was performed at 7 ma (42 mas) and 85 kvp, with 14-second scan time and 270 rotation. each scan produced 200 projections in a 15 15 15 cm field of view. a charge - coupled device detector, with 1024 1024 matrix and 0.15 mm voxel size, was used to detect the images. afterwards, the radiographic distances were measured twice by the first observer with two - week interval and once by the second observer. it has to be added that the measured distance was from the end of one marker to the end of another. the physical and radiographic distances, measured in each region, are illustrated in table 1. intraclass correlation coefficient (icc) was used to analyze intraobserver and interobserver reliability of measurements (= 0.05). wilcoxon test was used to compare physical and radiographic values of different measurements (= 0.05); the less the differences between physical and radiographic measurements are, the more accuracy of radiographic measurements will be. one - sample t - test was used to compare the differences with the acceptable 0.5 mm mean absolute error (= 0.05). univariate analysis of variance was used to assess the difference between radiographic and physical measurements, considering the confounding variables. due to severe bone resorption, the distances in the mandibular left premolar and molar regions in one skull and also mandibular right premolar and molar regions in another skull were not separately measured, reducing the whole measurements to 174. according to icc values, interobserver correlations for radiographic measurement and for physical measurements were both 0.996 (p value < 0.001). the mean difference between physical measurements and radiographic measurements in the present study was 0.05 0.45. there was a significant difference between physical measurements and radiographic measurements in ideal, rotation, tilt, and extension positions. accuracy of measurements for height was significantly lower than physical measurements in all positions (p value < 0.05). tukey hsd showed that the accuracy of measurements on skull number 5 was significantly lower than skulls number 2, 3, 4 and 6 (p value = 0.022, 0.001, 0.006, and 0.001, resp .). also, accuracy of measurements in rotation and flexion positions was significantly lower than ideal position (p value = 0.042, 0.043 resp .). there was no significant difference among accuracy of measurements in molar, premolar, and central regions (p value < 0.05). accuracy of measurements in the left sides of skulls was significantly lower than the right side (p value = 0.01). there was no significant difference between upper and lower jaws in terms of accuracy of measurements (p value = 0.115). table 5 compares the absolute mean difference between each radiographic position and 0.5 mm acceptable error. this table shows that the accuracy of measurements in all cases was above 0.5 mm. it is important to determine whether the accuracy of measurements decreases or remains unchanged, when the patient's head position changes. the aim of this study was to determine the accuracy of linear measurements in dry human skulls in different positions of the skull by simulating clinical relevant distances. in the present study, soft tissue was not simulated to prevent its probable confounding effect on accuracy of measurements. main errors in patient's head position (tilt, extension, flexion, and rotation) were evaluated. lateral displacement was not assessed, since this position error less likely occurs. due to the probable effect of teeth situation and the type of jaw, both mandible and maxilla radiographic units should be able to measure height, mesiodistal length, and buccolingual length of implant treatments, all of these distances were included in the present study. the rod - shaped opaque markers would let the observers more easily and accurately measure the distance between the end of one marker and the end of another. to make sure that the measurements were accurate, two observers measured the distances. the intraobserver and inter - observer correlations above 0.95 show that the accuracy was acceptable. the of the study showed that there were some differences in measurement between normal and deviated positions in some cases; however, since the average difference was less than 0.5 mm, they are not considered clinically significant. comparison of the accuracy of radiographic measurements between ideal and deviated positions showed that significant difference exists in rotation and flexion positions, which may suggest that these positions are the most effective deviations for measurement accuracy. hassan et al., in assessment of accuracy of measurements on dry human skulls, found no significant difference between different positions of skulls. this contrast with the present study is probably due to lower number of measurements and longer distances in that study. this contrast might be due to different distances that were measured in these studies, as well as different study designs. the high rates of standard deviation of differences between physical and radiographic measurements in the present study suggest that more than a few factors are affecting the accuracy of measurements. there are a number of reasons that may justify differences in the accuracy of measurements. predominant artifacts in cbct imaging including noise, scatter, extinction artifact, beam hardening, exponential edge gradient effect, aliasing artifacts, and ring artifacts may cause difficulties in detecting the exact situation of objects in a cbct output image which leads to inaccurate measurements. moreover, the anatomical distortions, a function of shape and orientation of the structures, can cause distortions as well. of the present study showed that accuracy of measurements is affected by skull type. this suggests that cbct units can be enhanced by features like a posterior position adjustment, letting the practitioner consider anatomical asymmetries and differences; however, distortion caused by anatomical asymmetry is not always distinguishable from radiographic distortion. on the other hand, although some deviated skulls showed severe distortion in the panorama view of galaxis software in the present study, the distances between markers could still be accurately measured in cross - sectional, tangential, and axial views. this is partly due to the fact that cbct software lets the practitioner choose not only the orientation of reconstructed image layer but also the image plane that cross - sectional, tangential, and axial views are expected to display; however, failure in appropriate setting will lead to difficulties in measuring distances. for instance, to see acceptable cross - sectional image planes, one should previously set the image plane in panorama view. if the practitioner fails to do so, cross - sectional display will not be appropriate for measurements. as an observation of the present study, sometimes the markers that were precisely placed in buccal and lingual embrasures of a tooth could not be displayed at the same time in cross - sectional view of the software, even with changing the image plane in panorama or the orientation of reconstructed image layer, which implies a shortcoming in the unit or the software and should be corrected. the mean difference between physical measurements and radiographic measurements in the present study was 0.05 0.45 mm. ludlow et al. who used the same method for selection of the points, reported 0.29 0.20 mm mean difference. marmulla et al. however, used computer algorithm to localize measurement points with pixel fractionalization. these differences are due in part to the different study designs, measurement techniques, and cbct units used. moreover, leung et al. who measured alveolar bone height reported that the accuracy was 0.6 mm. these contrary can be explained by the fact that determining anatomical landmarks is more difficult than opaque markers. the mean absolute error of galileos cbct machine was estimated to be 0.26 0.18 mm by mischkowski et al.. the difference between this study and the present study is probably due to different investigated areas and distances measured. lund et al. reported that the measurements in cbct were very accurate and the absolute mean difference was even less than voxel size. in fact, lund et al. used an object consisting of plexiglass plates, while the present study was performed on human dry skulls. in the present study for evaluating the effect of different head position all skulls it may be the reason of significant difference of between the left and right side. the manufacturer of galileos cbct machine claims that the accuracy of length measurements is 0.15 mm; however the of the present study showed that this accuracy depends on numerous criteria and is not always in the above range. we suggest that the same study with larger number of skulls be conducted so that more criteria such as aspect of measurement can be included in univariate anova. moreover, it is recommended to simulate soft tissue attenuation in one separate group to assess its probable effect. in , the present study demonstrates that the accuracy of measurements in galileos cbct machine varies when the position of skull deviates from ideal; however the reduction in accuracy could be clinically considered insignificant.

introduction. the aim of this study was to determine the accuracy of linear measurements in dry human skulls in ideal position and different deviated positions of the skull. methods. 6 dry human skulls were included in the study. opaque markers were attached to alveolar bone. buccolingual and mesiodistal distances and heights were measured in 5 different regions of either jaws using a digital caliper. radiographic distances were measured in ideal, rotation, tilt, flexion, and extension positions of the skulls. the physical and radiographic measurements were compared to estimate linear measurement accuracy. . the mean difference between physical measurements and radiographic measurements was 0.05 0.45. there was a significant difference between physical measurements and radiographic measurements in ideal, rotation, tilt, and extension positions (p value < 0.05). . the accuracy of measurements in galileous cbct machine varies when the position of the skull deviates from ideal; however, the differences are not clinically significant.

pure red cell aplasia (prca) is a disorder that was first described in 1922 and that is characterized as a normocytic anemia associated with the absence of erythroblasts in the bone marrow. prca can be induced by various causes.1 however, only a few cases of prca associated with hepatitis a have been reported.2 - 6 in korea, there have been several reports of prca associated with thymoma, lymphoma, sle, hashimoto's disease, parvovirus, and adverse drug reactions. however, no case of prca caused by acute hepatitis a has yet been reported. in this report , we describe a case of prca with acute hepatitis a and review the literature. a 36-year - old male was admitted with a 3-day history of fever, jaundice, and vomiting. his vital signs were as follows: blood pressure, 120/90 mmhg; heart rate, 88 beats / min; respiratory rate, 18/min; and body temperature, 37.1. he had obvious jaundice and icteric sclera. his hemoglobin concentration was 17.1 g / dl, his red cell count was 5.7410/l, his white blood cell count was 5,000/l, and his platelet count was 114,000/l. blood chemistry analyses revealed a total bilirubin level of 3.8 mg / dl; direct bilirubin, 2.39 mg / dl; ast, 7736 iu / l; alt, 3558 iu / l; ldh, 14,407 iu / l; albumin, 3.8 g / dl; prothrombin time, 18.6 s (10.1 - 12.4 s); bun, 50.9 mg / dl; and cr, 5.7 mg / dl. tests for hepatitis b surface antigen, and igm anti - hepatitis b core, and anti - hepatitis c virus antibody were all negative. tests for human immunodeficiency virus antibody and epstein - barr virus vca igm antibody were negative and parvovirus was undetectable by polymerase chain reaction. c3 was 86.6 mg / dl, c4 was 53 mg / dl, igg was 746 mg / dl, iga was 442 mg / dl, and igm was 469 mg / dl. the of a chest x - ray, abdominal ultrasonography, and duodenoscopy were unremarkable. he received hemodialysis treatment owing to acute renal failure three times a week from day 2. on day 4, he was diagnosed with hepatitis a and treated with fluid therapy. on admission, there was no sign of anemia, but his hemoglobin level had gradually decreased. , his hemoglobin level had dropped to 4.8 g / dl and his reticulocyte count had significantly decreased to 0.13%. the bone marrow biopsy showed 50% cellularity and the myeloid: erythroid ratio was 16.1:1. a paucity of erythroid precursors was noted, although granulopoiesis was normal in number and maturation. differential erythroid cell counts of aspirates were as follows: pronormoblast, 1.4%; basophilic normoblast, 2.4%; polychromatic normoblast, 0.0%; and orthochromatic normoblast, 0.0%. as a of these findings , he was diagnosed with pure red cell aplasia associated with acute hepatitis a. he began treatment with intravenous methylprednisolone (1 mg / kg / day) daily at day 29. after the steroid therapy, his hemoglobin level and renal function began to improve steadily. hemodialysis was stopped on day 34, and the hemoglobin level had increased to 8.3 g / dl on discharge. one month after discharge, the prednisolone dose was tapered to 10 mg in the outpatient clinic. on day 48 after discharge, prednisolone treatment was stopped, because the hemoglobin level had improved to 13.9 g / dl and the cr level had decreased to 1.3 mg / dl ( fig. prca in an anemia associated with severe reticulocytopenia and the absence of marrow erythroid precursor cells.1 innate prca is known as blackfan - diamond anemia, and is usually diagnosed among infants less than 1 year of age. in adults, prca usually occurs as an acquired disease, mainly due to thymoma, connective tissue disease, viral infection, lymphoma, and adverse drug reactions.1 in the present case, while the patient was being treated with fluid therapy and hemodialysis for hepatitis a with acute renal failure, his hemoglobin level gradually decreased. no signs of gastrointestinal bleeding were observed and no evidence of thymoma was apparent in the chest x - ray. were negative for human immunodeficiency virus antibody, epstein - barr virus vca igm antibody, viral hepatitis b antibody, viral hepatitis c antibody, anti - nuclear antibody, parvovirus pcr, and rheumatoid arthritis factor. there were no suspicious findings for lymphoma in the peripheral blood smear or bone marrow. bone marrow examination showed marked erythroid hypoplasia with normal granulocytes and megakaryocytes. as a , he was diagnosed with prca caused by acute hepatitis a. globally, cases of acute hepatitis a associated with prca are very rare. in all of the cases reported to date, transient, severe anemia appeared after the acute phase of the hepatitis had passed and disappeared within a short period after blood transfusion or corticosteroid therapy. the clinical course of prca with hepatitis a and the prognosis of the patients were good.2 - 6 the mechanism of prca seen in many cases of viral hepatitis is poorly understood. bone marrow and liver contain components of the reticuloendothelial system and may, therefore, be adversely affected by similar agents. previously known main mechanisms are viral - induced autoimmune response and direct viral infection of bone marrow progenitor cells.1 the autoimmune response can directly cause a cytolytic reaction to bone marrow progenitor cells by t - cells, natural killer cells, or complement binding with antibody and can damage bone marrow stromal cells.1 idiopathic prca can be initially treated with corticosteroids and blood transfusion. generally, the recovery period is about 1 month.7 in a study of 27 prca patients using corticosteroids for 2 to 5 weeks, remission occurred within 4 weeks in 40% of cases, and a cure rate of 37% was reported.8 case studies of prca with acute viral hepatitis are rare; cases of treatment with corticosteroids and blood transfusion have been reported.2 - 6 in corticosteroid - resistant cases, prca can be treated with cyclosporin a or cyclophosphamide. a study of 43 patients treated with cyclosporin a showed an overall response of 65%.9 one study reported that the duration of remission induced by cyclophosphamide seemed to be prolonged compared with that induced by corticosteroid.8 in addition, several studies reported that antithymocyte globulin, alemtuzumab, and rituximab are useful in the treatment of refractory prca.7 in summary, we have reported the first case of prca associated with acute hepatitis a in korea. the patient showed an early response to corticosteroids and successfully achieved remission after 2 months of treatment.

pure red cell aplasia is characterized as a normocytic anemia associated with reticulocytopenia and the absence of erythroblasts in the bone marrow. pure red cell aplasia can be induced by various causes such as thymoma, connective tissue disease, viral infection, lymphoma, and adverse drug reactions. there have been only a few reports of pure red cell aplasia associated with acute viral hepatitis a. in korea, no case of pure red cell aplasia caused by acute hepatitis a has yet been reported. we recently experienced a case of acute viral hepatitis a complicated by pure red cell aplasia. the patient was successfully treated with corticosteroids. here we report this case and review the literature.

age - related macular degeneration (amd) is a complex disorder that is influenced by genetic and environmental factors; heritability is estimated to account for 45% to 71% of cases. several (~20) amd genetic susceptibility genes have been identified with two loci, complement factor h (cfh ( 1q32) and age - related maculopathy susceptibility 2/htra serine peptidase 1 (arms2/htra1) on 10q26 accounting for 50% of amd cases. the cfh locus harbors many independent risk and protective haplotypes while for arms2/htra1 a single major risk haplotype is associated with amd. multiple studies have also demonstrated that haplotype - tagging single - nucleotide polymorphisms (snps) in cfh and arms2, are major determinants of amd endophenotypes and disease progression. specifically, cfh - rs1061170 is associated with drusen and with both early and advanced amd while arms2-rs10490924 is strongly associated with reticular pseudodrusen and rapid progression to late amd. nevertheless, by various estimates, currently known genetic loci account for only 50%75% of overall amd risk. interest in a role for retinal pigment epithelium (rpe) lipofuscin in amd stems from the knowledge that it accumulates with age , is high in central retina, exhibits behaviors toxic to rpe and exhibits a link to drusen formation. advances in non - invasive fundus imaging have facilitated the diagnosis and differentiation of retinal disease. in vivo imaging provides a window within which to view the natural course of retinal disease. of the available imaging modalities, fundus autofluorescence (af) has proven to be especially valuable, in large part because disease - related processes can alter the distribution of the af signal. the natural autofluorescence of the fundus that is excited by sw light (488 nm excitation) (figure 1) exhibits spectral features and an age - relationship that indicates a principle origin from the fluorescent pigments that accumulate in rpe cells as lipofuscin. unlike lipofuscin species that accumulate in other non - dividing cells, the pigments of rpe lipofuscin are produced in the membranes of photoreceptor outer segments from non - enzymatic reactions of vitamin a aldehyde. this fluorescent material is transferred to rpe cells within phagocytosed outer segment disks and becomes deposited in the lysosomal compartment of the cells. in the healthy retina, the age - related increase levels off after age 70 perhaps because of a loss of photoreceptor or rpe cells and/or changes in fluorescence emission due to extensive photooxidation / photodegradation of the bisretinoid compounds (discussed below). rpe lipofuscin consists of a complex mixture of fluorophores that have been identified in by chromatography and mass spectrometry and characterized structurally; all of the known bisretinoid lipofuscin pigments have been detected in human eyes (figure 2). (a2-gpe), a2e and isomers of a2e , dimers of all - trans - retinal having a cyclohexadiene head group (all - trans - retinal dimer) and the associated protonated schiff base conjugate and the uncharged a2-dhp - pe (a2-dihydropyridine - phosphatidylethanolamine). higher molecular weight adducts also form when aldehyde - bearing cleavage products of bisretinoid react with intact bisretinoid molecules. other molecular constituents of rpe lipofuscin are adducts of cep (2-(-carboxyethyl)-pyrrole ), hne (4-hydroxynonenal) and mda (malondialdehyde) that are derived from oxidative fragmentation of lipid. products of lipid oxidation are generally non - fluorescent or blue - emitting fluorophores and in this case could be generated by the photoreactivity of other lipofuscin fluorophores. accumulation of bisretinoids in rpe cells is unlikely to depend on an inhibition of lysosomal enzyme activity, since this fluorescent material is amassed in all healthy eyes beginning at early ages.. they present with a central six - carbon ring from which extend two polyene arms terminating in ionone rings. each of these arms is derived from a molecule of retinaldehyde and constitutes a separate light - absorbing chromophore, one arm absorbing in the ultraviolet range and the other in the visible (figure 2). the numbers of alternating carbon - carbon double and single bonds that form the conjugation systems of the arms determine the wavelength of absorbance; the longer conjugation system in each molecule confers absorbance in the visible range. absorbances in the visible spectrum are significant since these wavelengths reach the retina. since these adducts of retinaldehyde are held together by covalent bonds, bisretinoids do not provide stores of retinoid for the visual cycle, as has been suggested. in clinical settings, sw - fundus af is excited by wavelengths ranging from 488 nm, the excitation employed with a confocal scanning laser ophthalmoscope (cslo), to the 535580 nm range utilized by a modified fundus camera and the 568 nm light used with fluorescence adaptive optics ophthalmoscopy. fundus autofluorescence measured in vivo by spectrophotometry has a broad excitation spectrum that peaks between 490510 nm. the fluorescence emission is also broad and centered at approximately 600 nm. rpe lipofuscin ex vivo exhibits an excitation spectrum that peaks between 450490 nm; the fluorescence emission is maximal at ~600 nm (figure 3). moreover, just as with fundus autofluorescence, the emission spectrum recorded from whole lipofuscin exhibits red - shifts when excited by progressively longer wavelengths (figure 3). thus the spectral characteristics of fundus autofluorescence are consistent with that of rpe lipofuscin and chiefly with an origin from the bisretinoid fluorescent pigments that are known constituents of rpe lipofuscin. the bisretinoids that have been characterized have absorbance maxima varying from 440 nm to 510 nm and they emit with an orange fluorescence that peaks at ~600 nm. the bisretinoid a2e can emit fluorescence at longer wavelength excitations such as 545 nm (figure 3b). while there exists no evidence that bisretinoids of rpe lipofuscin can undergo lysosomal degradation, loss of this material due to photodegradation has been demonstrated. thus studies of rpe lipofuscin and individual bisretinoid lipofuscin fluorophores such as a2-gpe, all - trans - retinal dimer and a2e have revealed that these compounds are photoinducible generators of reactive oxygen species such as singlet oxygen and superoxide anion. singlet oxygen in turn reacts with the conjugated double bond systems comprising the arms of the bisretinoid molecules leading to the fragmentation of the parent molecules and release of aldehyde - bearing cleavage products such as methylgloxal and glyoxal that can react with and inactivate proteins. these small dicarbonyls also provoke the formation of advanced glycation end products (age) that deposit extracellularly. ages incite inflammatory processes and since they are detected in drusen , they reflect a link between rpe bisretinoid lipofuscin and the formation of sub - rpe deposits. photooxidation of a2e and all - trans - retinal dimer has also been shown to incite complement activation. photooxidation is clearly an ongoing process in the eye since photooxidized forms of a2e and all - trans - retinal dimer have been detected in isolated human and mouse rpe. these processes likely contribute to bruch s membrane thickening and photoreceptor cell degeneration in abca4 mutant mice and are a cause of the increased vulnerability of albino abca4 mice to retinal light damage. the propensity for bisretinoids to undergo photooxidative and photodegradative processes may underlie the decline in rpe lipofuscin fluorescence emission (photobleaching) that has been observed in non - human primates during in vivo fluorescence imaging by adaptive optics scanning laser ophthalmoscopy , with cell culture models and in non - cellular assays (figure 4). lipofuscin photobleaching may also explain why after surgical repair of some cases of retinal detachment, hyperautofluorescent lines coursing parallel to retinal blood vessels can be visible in fundus af images (figure 5). the hyperautofluorescent imprint has been interpreted as indicating a change in the position of the vessel relative to the underlying retinal tissue and is visible because of contrasting levels of af brightness. at any given time, the intensity of fundus af is likely the difference between fluorophore synthesis on the one hand, and lipofuscin photoxidation / photodegradation in rpe, on the other. under the shadow of a blood vessel, the formation of bisretinoid from retinaldehyde (with 11-cis being converted to all - trans - retinal) would likely continue unabated but lipofuscin photooxidation and photobleaching would be substantially reduced. as a , a vessel imprint of more intense af would be revealed upon retinal translocation. when rpe lipofuscin is assayed by recording fluorescence in histological sections of human retina, the signal is found to increase from central fovea to perifovea and after peaking at an eccentricity of ~8, it decreases towards the periphery. a similar pattern has been observed with quantitative fundus autofluorescence (qaf) (figure 6); at an eccentricity of 10, qaf is approximately 95% of that measured centrally. reduced foveal fundus autofluorescence is due in large part to absorption of the exciting light by macular pigment and to the higher optical density of melanin in central rpe. by fundus spectrophotometry, qaf and fluorescence photomicroscopy, the highest levels of rpe lipofucin in healthy eyes unexpectedly, this pattern was not replicated in another study relying on fluorescence measurements in flat - mounted human cadaver eyes. based on the spatial distribution of mass peaks detected with matrix - assisted laser desorption - ionization imaging mass spectrometry (maldi - ms) investigators have reported that a2e is detectable in central retina of mice, but not in the central human rpe. instead , the highest a2e levels were restricted to a small patch of rpe found exclusively in the far periphery of temporal retina. this patch was not matched by similar a2e signal in in the periphery of superior, nasal or inferior retina. while a2e is well known to be fluorescent, surprisingly, this patch was almost devoid of fluorescence. since the spectral features of rpe lipofuscin and fundus autofluorescence are best accounted for by the excitation and emission spectra of the bisretinoid constituents, the fluorescence originating in centrally situated rpe cells likely originates from some combination of these di - retinal adducts. interestingly, the maldi - ms findings could indicate that the various species of bisretinoid lipofuscin compounds exhibit spatial heterogeneity. reduced levels of a2e in the macula could also be a consequence of greater lipofuscin photocleavage in central rpe; an explanation such as this could account for the greater susceptibility of the macula to disease. failure to detect a2e centrally, may even be attributable to the limitations of the methodology. maldi - ms is a surface - based technique that depends on the extraction of analyte into a matrix applied to the surface of the tissue. factors that could cause spatial differences in extraction efficiency are regional differences in rpe height and spatial differences in the compartmentalization of lipofuscin. for instance rpe cells are taller and narrower in the human macula with melanin being uppermost and lipofuscin at greater depths in the cells. after age 50 complex organelles containing both melanin and lipofuscin (melanolipofuscin) predominate in the cells with macular rpe containing more melanolipofuscin than rpe at the equator and periphery. thus it is likely that the extraction from central rpe is less efficient because of the depths of lipofuscin in the cells and/or difficulty in accessing lipofuscin from complex melanolipofuscin - organelles. the healthy fundus also exhibits a near - infrared autofluorescence (nir - af) (> 800 nm) when excited at ~787 nm (figure 1). the intensity of the fundus nir - af is at least 60 times less than sw - af. several lines of evidence indicate that rpe and choroidal melanin serve as a source of the nir - af signal. additionally, the high nir - af signal at the fovea corresponds to the elevated optical density of melanin in this area. conversely, nir - af emanating from a full - thickness macular hole is similar in brightness to surrounding retina. the more frequent use of sw - af may be due, in part, to the introduction of the heidelberg spectralis having optical coherence tomography (oct) capability (hra + oct) and to the subsequent decline in the popularity of the hra2 and spectralis hra in retinal clinics. the oct module in the spectralis reduces nir - af signal intensity, thus compromising nir - af image quality as compared to cslos without oct (e.g., hra2 and spectralis hra). nevertheless, nir - af has advantages over sw - af. for instance, during image acquisition, patients are not disturbed by the nir - af light as they are with the sw - af exciting light. in the presence of retinal disease such as amd, patterns and intensities of fundus autofluorescence are notably altered. at locations of rpe and photoreceptor cell demise (atrophy) both the sw - af and nir - af signals become strikingly deficient or absent. these areas of atrophy can take the form of discrete spots, isolated patches or large expanses (geographic atrophy, ga, usa). while ga presents as areas of darkness in both sw and nir - af (figure 7), the lesion size can sometimes appear larger with either the sw - af or nir - af modality (figure 7). nevertheless, the rate of increase in ga area is the same whether measured in sw- or nir - af images. in exudative amd, the developing neovascular lesion can be discerned in sw - af images early on as a focal hyperautofluorescence. later the sw - af signal is reduced within the lesion. in some cases the edge of the neovascular lesion exhibits increased sw - af signal. in the zone of retina immediately adjacent to geographic atrophy, there are often additional af changes. these aberrant signals can present as intermittent foci or continuous bands of altered brightness in both sw - af and nir - af images. in these junctional zones areas of increased sw - af can coincide with increased nir - af; increased sw - af can overlap with reduced nir - af; or nir - af signal can be enhanced while sw - af may appear normal (figure 7). interestingly, a loss of photoreceptor function was found to be associated with both increased and decreased nir - af. since both sw - af and nir - af are considered to originate in rpe cells, it is puzzling that sw - af can be increased at positions where nir - af is reduced or absent. this apparent incongruity has been attributed to abnormal rpe cells that have lost melanin while accumulating excessive levels of lipofuscin due to accelerated rates of outer segment phagocytosis. the lipofuscin forms in photoreceptor cells prior to disc shedding and phagocytosis. as is evident from studies of the rcs rat, the fluorophores of lipofuscin form and accumulate in photoreceptor outer segment debris even in the absence of phagocytosis. other observations indicate that photoreceptor cells are likely to be degenerating in these junctional zones of increased sw - af. in particular, retinal sensitivity, measured by microperimetry, is commonly reduced at positions presenting with increased sw - af as compared to normal sw - af. in addition, oct findings in the zone of enhanced autofluorescence surrounding ga include thinning of the reflective band attributable to rpe / bruch s membrane and disruption of the reflectivity band corresponding to the ellipsoid zone of photoreceptor inner segments thus could it be that at positions of diminished nir - af, rpe cells are atrophied or lost and impaired photoreceptor cells become a source of accelerated lipofuscin formation and thus enhanced sw - af? mechanistically, mishandling of retinaldehyde, the precursor of lipofuscin, is known to lead to elevated bisretinoid formation in photoreceptor cells and compromised photoreceptor cells may not be able to provide the energy needed for reduction of retinaldehyde to the non - reactive alcohol form. similar mechanisms may explain the rapid onset of elevated fundus sw - af that co - localizes with scotomas associated with acute macular neuroretinopathy (amn). the observation that nir - af signals increase in parallel with increases in sw - af at the border of ga may also not be fully understand. hyperautofluorescence foci at the junctional zone of ga, at least in some cases, can be attributed to abnormally superimposed rpe cells. but whether this can account for more extensive bands of high nir - af is not certain. it has been suggested that rpe lipofuscin may contribute to nir - af of the fundus. however, albino rats do not exhibit nir - af despite the presence of lipofuscin and as shown in figure 8, we have not detected an nir - af signal from synthesized samples of a2e that otherwise emit fluorescence when excited at 488 nm. nir - af emission from other bisretinoids is unlikely, given the small structural differences amongst these compounds (figure 2). if melanogenesis is the basis for increased nir - af brightness at the border of ga, as has been suggested , one might expect that increased melanin concentrations would be visible as hyperpigmented spots and bands in color fundus photographs. in considering an optical effect as an explanation for increased nir - af signal it could be that rpe lipofuscin does not fluoresce in the nir range but can modify the nir - af emission from melanin. this could occur if lipofuscin secondary lysosomes intercalate amongst apically situated melanosomes thereby reducing the nir - af quenching associated with secondary self - absorbance of the fluorescence emission. a mechanism such as this might also explain why hyperautofluorescent rings visible in the nir - af fundus images in retinitis pigmentosa exhibit spatial correspondence with high intensity rings observed in sw - af images. interest in a role for rpe lipofuscin in amd stems from its age - related increase , an accumulation that is more pronounced in central retina, a propensity for adverse effects on rpe and photoreceptor cells and links to drusen formation. contributions to amd susceptibility from rpe lipofuscin would exist within the context of genetic risk. since the products of bisretinoid photodegradation can be damaging , it is worth considering whether lipofuscin lost by photooxidation / photodegradation is more significant than the lipofuscin remaining in the cells. at any given time, the lipofuscin in rpe that is recorded by sw - af may consist of only some portion of the fluorescent material that has been accumulated over a life - time. sw - af emitted from rpe bisretinoids is commonly regarded as a way to monitor the health of the rpe, with areas of high af indicating increased lipofuscin levels and areas of low af indicating rpe loss. however, as discussed here there is increasing evidence that interpretations of the sw - af signal are complex. for instance, impaired photoreceptors may generate increased levels of bisretinoid fluorophores thus amplifying sw - af signal. ultimately, an understanding of patterns of fundus af will impact the use of these images to assess therapeutic outcomes. while fundus autofluorescence provides en face spatial information, the spectral features of the fluorescence are not elucidated and the cellular origin of the fluorescence is not identified. recently, this approach has been shown to enable the differentiation of similar phenotypes having disparate genetic origins. the qaf approach may eventually help to ascertain the role of lipofuscin in various retinal disorders including amd. because of more limited gradations of signal and thus greater contrast, diseased versus non - diseased areas of retina are easier to distinguish in nir - af images as compared to sw - af images. indeed, in recessive stargardt disease (stgd1), sw - af changes are often not obvious at fundus locations where abnormalities are detectable in nir - af images. in addition, in many cases the low nir - af signal corresponds spatially to loss of the inner segment ellipsoid zone (ez) in spectral domain (sd) oct images. while the origin of the nir - af signal may not be completely understood, the nir - af signal can provide a good estimate of the size of geographic atrophy and surrounding abnormalities. all of these issues favor the inclusion of nir - af in the management of retinal diseases such as amd.

genes that increase susceptibility to age - related macular degeneration (amd) have been identified; however, since many individuals carrying these risk alleles do not develop disease, other contributors are involved. one additional factor, long implicated in the pathogenesis of amd, is the lipofuscin of retinal pigment epithelium (rpe). the fluorophores that constitute rpe lipofuscin also serve as a source of autofluorescence (af) that can be imaged by confocal laser ophthalmoscopy. the af originating from lipofuscin is excited by the delivery of short wavelength (sw) light. a second autofluorescence is emitted from the melanin of rpe (and choroid) upon near - infrared (nir - af) excitation. sw - af imaging is currently used in the clinical management of retinal disorders and the advantages of nir - af are increasingly recognized. here we visit the damaging properties of rpe lipofuscin that could be significant when expressed on a of genetic susceptibility. to advance interpretations of disease - related patterns of fundus af in amd , we also consider the photochemical and spectrophotometric features of the lipofuscin compounds responsible for generating the fluorescence emission.

head and neck squamous cell carcinoma (hnscc), including oral squamous cell carcinoma (oscc), is the sixth most prevalent type of malignancy worldwide and accounts for approximately 8% to 10% of all cancers in southeast asia. hnscc - related mortality is mainly caused by cervical lymph node metastasis, and occasionally by distant organ metastasis. the epithelial - mesenchymal transition (emt) is a process in which epithelial cells lose their polarity and adopt a mesenchymal phenotype. this process is thought to be a critical step in the induction of tumor metastasis and malignancy. mani et al. demonstrated that induction of emt in cells that have stem cell properties and generates cells with properties similar to breast cancer stem cells. snail, a member of the zinc - finger transcription factor family, is one of the master regulators that promotes emt and mediates invasiveness as well as metastasis in many different types of malignant tumors. the aldehyde dehydrogenase (aldh) family of enzymes is comprised of cytosolic isoenzymes that oxidize intracellular aldehydes and contribute to the oxidation of retinol to retinoic acid in early stem cell differentiation. recently, aldh has been reported to be a unique marker of head and neck cancer stem cells (csc). aldh1 was also found to co - localize with other cscs - related markers, including mmp-9, cd44, and ck14, at the invasive front of the tumor. these hnscc - aldh1 cells displayed the radioresistance and represented a reservoir of cells that have the proliferative potential to generate tumors. these findings suggested that snail expression may regulate the tumorigenesis, radiochemoresistance, and cancer stem cell properties of malignant hnscc tumors. however, the molecular mechanisms involved in mediating metastasis and tumor malignancy of hnscc - csc through the regulation of snail remain unknown. bmi-1 is a member of the polycomb (pcg) family of transcriptional repressors that mediate gene silencing by regulating chromatin structure. bmi-1 is essential for maintaining the ability of neural, hematopoietic, and intestinal stem cells to self - renew. bmi-1 was identified as a proto - oncogene that cooperates with myc to promote the generation of lymphoma. additionally, bmi-1 has been verified as a predictor of prognosis in bladder cancer , prostate cancer, brain cancer , breast cancer , pancreatic cancer, and lung cancer. bmi-1 has been demonstrated to play a role in the tumorigenesis of hnscc. bmi-1 has also been reported to be involved in tumor metastasis. recently, an elegant study by song et al. showed that bmi-1 can directly promote emt and malignancy in nasopharyngeal carcinoma by regulating snail. the goal of this study was to clarify the relationship between bmi-1, snail, and aldh1 in hnscc or hnscc - associated csc and the involved molecular mechanisms. the study was approved by the institutional ethics committee / institutional review board of taipei veterans general hospital. the dissociated cells from the samples of hnscc patients were suspended at 1 10 cells / ml in 37c dmem supplemented with 2% fcs. the identification of aldehyde dehydrogenase 1 (aldh1) positive hnscc cells was carried out using the aldefluor assay (stemcell technologies, durham, nc, usa) and fluorescence - activated cell sorting. cells were suspended in aldefluor assay buffer containing aldh substrate (baaa, 1 mol / l per 1 10 cells) and incubated for 40 min at 37c. as a negative control, for each sample of cells, an aliquot was treated with 50 mmol / l diethylaminobenzaldehyde (deab), a specific aldh inhibitor. the sorting gates were established using the cells stained with pi only as a negative control; the aldefluor - stained cells treated with deab and staining with a secondary antibody alone to test for viability. hnscc - aldh1 cells were cultured in a medium consisting of serum - free dmem / f12 (gibco - brl, gaithersburg, md), n2 supplement (r and d systems inc . , minneapolis), 10 ng / ml bfgf (r and d systems), and 10 ng / ml egf (r and d systems). briefly, total rna (1 g) of each sample was reverse - transcribed using 0.5 g oligo dt and 200 u superscript ii rt (invitrogen). the primer sequences for real - time rt - pcr were listed in table 2. the amplification was carried out in a total volume of 20 l containing 0.5 moll of each primer, 4 mmoll mgcl2, 2 l lightcyclertm - faststart dna master sybr green i (roche molecular systems, alameda, ca), and 2 l of 1: 10 diluted cdna. pcr reactions were prepared in duplicate and performed using the following program: 95c for 10 min, followed by 40 cycles of denaturation at 95c for 10 sec, annealing at 55c for 5 sec, and extension at 72c for 20 sec. standard curves (cycle threshold values versus template concentration) were prepared for each target gene and for the endogenous reference gene (gapdh) for each sample. quantification of unknown samples was performed using lightcycler relative quantification software version 3.3 (roche). the oligonucleotide 5-aaaacctaatactttccagattgatttggat ccaaatcaatctggaaagtattagg-3 targeting human bmi-1 (nm_005180, nt 10611081) was synthesized and cloned into plvrnai to generate the lentiviral expression vector, plvrnai / sh - bmi1. the lentiviral expression vector carrying bmi-1 full - length cdna, plv / bmi-1 was obtained from biosettia inc. pcmvr8.9 and pmd.g, expressing gag - pol and the vesicular stomatitis virus envelope, respectively, were provided by the consortium (academia sinica, taipei, taiwan). the lentiviruses were generated by cotransfecting 5 10 293 ft cells per 10 cm plate with lentiviral vector and packaging plasmids using lipofectamine 2000 (lf2000, invitrogen). subconfluent cells were infected with lentivirus at a multiplicity of infection of 5 in the presence of 8 g / ml polybrene (sigma - aldrich). total rna was extracted from cells using trizol reagent (life technologies, bethesda, md, usa) and the qiagen rnaeasy (qiagen, valencia, ca, usa) column for purification. affymetrix hg u133 plus 2.0 microarrays containing 54,675 probe sets for > 47,000 transcripts and variants, including 38,500 human genes. a typical probeset contains eleven 25-mer oligo nucleotide pairs (a perfect match and a mismatch control). for microarray analysis, sample labeling, hybridization, and staining the average linkage distance was used to assess the similarity between two groups of gene expression profiles as described below. the difference in distance between two groups of sample expression profiles to a third was assessed by comparing the corresponding average linkage distances (the mean of all pairwise distances ( linkages) between members of the two groups concerned ). the error of such a comparison was estimated by combining the standard errors (the standard deviation of pairwise linkages divided by the square root of the number of linkages) of the average linkage distances involved. classical multidimensional scaling (mds) was performed using the standard function of the r program to provide a visual impression of how the various sample groups are related. all procedures involving animals were in accordance with the institutional animal welfare guidelines of taipei veterans general hospital. eight - week - old scid mice and/or nude mice (balb / c strain) were injected with 105 cells orthotopically. in vivo gfp imaging was performed using an illuminating device (lt-9500 illumatool / tls equipped with an excitation source ( 470 nm) and filter plate (515 nm) ). tumor size was measured with calipers and the tumor volume was calculated using the formula (length width2)/2. the integrated optical density of green fluorescence intensity was captured and analyzed using image pro - plus software. the statistical package of social sciences software (spss, inc ., chicago, il) was used for statistical analysis. an independent student's t - test was used to compare the continuous variables between groups. a log - rank test was used to compare the cumulative survival durations in different patient groups. initially, parental, isolated aldh1, and aldh1 cells were isolated from tissue samples of six hnscc patients using the aldefluor assay and the fluorescence - activated cell sorting (facs) analysis (figure 1(a) and table 1 ). it has been reported that cancer stem - like cells can be cultured in suspension to generate floating spheroid - like bodies (sb) under serum - free medium with bfgf and egf. interestingly, aldh1 increased higher tumor spheres - forming capability than that of aldh1 (figure 1(b) ). furthermore, aldh1-derived spheres with regular 10% serum cultivation increased epithelial - attached cells and differentiation marker (ck18)(see figure 1(a) in supplementary material available online at doi: 10.1155/2011/609259).to evaluate the enhancement of tumorigenicity of hnscc - aldh1 cells, soft agar colony formation assays and matrigel / transwell - invasion and were examined. compared with parental and aldh1, aldh1 derived from hnscc patients no.1 and no. 2 showed colony - forming ability and higher invasion activity (figures 1(c) and 1(d) ). to evaluate the in vivo tumor initiating capability of aldh1 and aldh1, we injected 1000, 3000, and 10 cells into the neck of scid mice. the showed that 104 aldh1 did not induce tumor formation but 3,000 aldh1 from the hnscc tissues of six patients in xenotransplanted mice all ed in the generation of visible tumors 6 weeks after injection (table 1).the of xenotransplanted analysis further showed that aldh1 demonstrated higher abilities to induce tumor growth (figure 1(e) ). lastly, serial xenotransplanted analysis suggested that aldh1 had in vivo self - renewal ability (supplementary figure 1(b) ). based on these findings, the aldh1-lineage cells isolated from hnscc patients presented the significant tumor - initiating abilities, especially in aldh1 cells from patients no. 1 and no real - time rt - pcr data demonstrated that the stemness and emt - related genes (especially in bmi-1 and snail) were significantly activated in hnscc aldh1 (table 2 and data not shown). to further investigate the role of bmi-1 in maintaining the biological properties of hnscc - aldh1, we used a loss - of - function approach, in which bmi-1 was knocked down by small hairpin rna (shrna) in hnscc - aldh1 cells. stable knockdown of bmi-1 in hnscc - aldh1 cells was achieved by transduction with lentivirus that expressed shrna targeting bmi-1 (sh - bmi-1). lentivirus that expressed shrna targeted against luciferase (sh - luc .) was used as a control. western blot analysis confirmed that shbmi-1 repressed bmi-1 protein expression in hnscc - aldh1 cells (figure 2(a) ). importantly, silencing bmi-1 expression led to downregulation of snail and aldh1 expression (figure 2(a) ). additionally, our showed that silencing of bmi-1 in hnscc - aldh1 cells inhibited the ability of the cells to form colonies on soft agar (figure 2(b) ) and migrate / invade (figure 2(c) ). to evaluate whether overexpression of bmi-1 could enhance the tumorigenic properties of hnscc - aldh1 cells, we generated stable bmi-1-overexpressing (bmi-1over) hnsccs using lentiviral transduction (figure 2(d) ). total proteins from hnscc - aldh1 overexpressing bmi-1 exhibited elevated expression of snail and aldh1 (figure 2(d) ). in addition, overexpression of bmi-1 significantly increased soft agar colony formation (figure 2(e) ), and migration / invasion of hnscc - aldh cells (figure 2(f) ). taken together, our suggest that bmi-1 modulates the in vitro tumorigenic properties in hnscc - aldh1 or aldh1 cells by regulating snail. to explore molecules governing stemness and tumorigenicity in hnscc - cd44aldh1 cells treated with bmi1-overexpressing lentivirus , we examined their transcriptome profile using gene expression microarray analysis (figure 3(a) ). principle component analysis (pca) further showed that the transcriptome profile of hnscc - aldh1 cells overexpressing bmi-1 demonstrated higher expression levels of embryonic stem cells (escs) transcriptomes (table 3 and figure 3(b) ). multidimensional scaling analysis further demonstrated that hnscc - aldh1 cells and hnscc - aldh1 cells overexpressing bmi-1 are more similar to escs than hnscc - aldh1 cells (* p < .05 ; figure 3(c) ). to validate the microarray analysis , real - time pcr was performed to confirm that the mrna expression levels of the embryonic genes (oct-4, nanog, sox2, klf4, and lin28), emt - related genes (snail and slug), and drug - resistant - related genes (mdr-1 and abcg2) in bmi-1-overexpressing aldh1 cells were significantly higher than those in aldh1 cells (* p < .05 ; table 2 and figure 3(d) ). we next sought to determine if bmi-1 expression could modulate the in vivo tumor initiating activity in immunocompromised nude mice. to monitor the in vivo growth of aldh1, aldh1, and bmi-1-overexpressing aldh1 cells , these cells were transfected using a lentivector combined with the green fluorescent protein gene (gfp) and followed by in vivo gfp imaging system. firstly, the showed that 1 10aldh1 cells did not induce tumor formation in nude mice, but 1000 aldh1 cells generated visible tumors 6 weeks after injection (table 1). in contrast to aldh1 cells, one of three (33.3%) nude mice was detected with the tumor formation after 6-week transplantation of 3000 bmi-1-overexpressing aldh1 cells. furthermore, tumor volumes in hnscc - aldh1 transplanted mice were significantly decreased when mice were treated with sh - bmi-1 (table 1 ; figure 4(a) ). overexpression of bmi-1 enhanced in vivo tumor growth in hnscc - aldh1 (table 1 ; figure 4(a) ). furthermore, we investigated the role of bmi-1 in the radio sensitivity of hnscc - aldh1 and hnscc - aldh1 treated with sh - bmi-1 and bmi-1 overexpressing. an ionizing radiation (ir) dose of 0 to 10 gy was applied to these cells, and hnscc - aldh1 cells showed greater radioresistance than the aldh1 cells (p < .05 ; figure 4(b) ). knockdown of bmi-1 in aldh1 cells in significant inhibition of radioresistance while overexpression of bmi-1 in aldh- cells promotes radioresistant properties (p < .05 ; figure 4(b) ). moreover, to confirm that bmi-1 is crucial for metastasis in vivo, mice were injected with different numbers of aldh1, aldh1/sh - bmi-1, aldh1/bmi-1over or control gfp - expressing aldh1 cells. 5x105 bmi-1-overexpressing aldh1 cells significantly increased local invasion, distant metastasis to the lungs and tumor size compared with control aldh1 cells (figures 5(a) and 5(b) ). in addition, silencing bmi-1 in aldh1 cells effectively reduced the number of lung metastases and tumor size in vivo (figures 5(a) and 5(b) ). taken together , our reveal a crucial role for bmi-1 signaling in the maintenance of in vivo tumorigenicity and metastasis of hnscc - aldh1 and -aldh1 cells. elevated snail protein expression in hnscc is correlated with the development of metastasis and poor survival. elevated expression of aldh1 also correlates with poor prognosis for hnscc patients. to investigate whether there is a positive correlation between bmi-1, snail, and aldh1 in head and neck cancers , we studied the expression of bmi-1, snail, and aldh1 by immunohistochemical (ihc) staining of a panel of specimens array from 93 hnscc patients. the ihc showed that elevated expression of bmi-1, snail, and aldh1 was positively associated with high - grade, poorly differentiated hnscc (figure 6(a) ). our also showed a significant positive correlation between aldh-1, bmi-1 (figure 6(b) ); aldh-1 and snail (figure 6(c) ); bmi-1 and snail (figure 6(d) ) in hnscc tissues. this is consistent with previous studies that reported that hnscc - aldh1 cells have elevated bmi-1 and snail expression. to determine the prognostic significance of bmi-1, snail, and aldh1 coexpression in patients with hnscc patients who were triple positive for bmi-1, snail, and aldh1 were predicted to have the worst survival rate compared with other head and neck cancer patients (figure 6(e); bmi-1/snail / aldh1 versus other groups ). overall, these data indicate that expression of bmi-1, snail, and aldh1 in hnscc patients could be a critical factor in predicting disease progression and clinical outcomes. a recent study demonstrated that bmi-1 mrna and protein overexpressed in a subpopulation of tumor initiating cells in cd44 + hnscc, which possessed self - renewal and tumor formation ability. zhang et al. also reported that there are side populations of oral squamous cell carcinomas that express high levels of abcg2, abcb1, cd44, oct-4, bmi-1, nspc1, and ck19. our previous work showed that hnscc - aldh1 + cells have high levels of bmi-1. the ability to self - renew and radiochemoresistance confirmed that aldh1 + -lineage cells underwent epithelial - mesenchymal transition (emt) and endogenously co - expressed snail. in the current study, our data demonstrated that hnscc - aldh1 cells had high levels of bmi-1, at both the mrna and protein levels (figure 2). using a lentiviral vector expressing shrna targeting bmi-1 , we observed that the level of aldh1 expression and tumorigenic properties of hnscc - aldh1 could be down - regulated by knockdown of bmi-1 (figure 2). importantly, overexpression of bmi-1 could turn hnscc - aldh1 into cancer stem cell - like hnscc - aldh1 cells (figure 3). consistent with these findings, the immunohistochemical survey of 93 hnscc patient tissues showed a positive correlation between expression of bmi-1, snail, or aldh1 and tumor stage (figure 6). kaplan - meier analysis demonstrated that patients expressing bmi-1, snail, and aldh1 were predicted to have the worst survival prognosis of hnscc patients (figure 6(e) ). however, a recent study showed a significant correlation between negative bmi-1 protein expression and the recurrence of tongue cancer. tongue cancer patients, especially female tongue cancer patients, usually do not have these habits. the close relationship between tongue cancer and human papillomavirus has been explored by many researchers. the prognosis of hnscc patients with distant metastases in the lung, liver, and bone is very poor. in this study , we found that bmi-1 can regulate snail and aldh1; change the emt - related genotypes of the aldh1 cells; and modulate distant lung metastases (figure 5). distant metastases have been reported to be associated with bmi-1 expression in breast cancer , melanoma , gastric cancer , and colon cancer. microarray analysis revealed that eleven gene signatures, which were correlated to the bmi-1-driven pathway, were closely related to distant lung metastases. bmi-1 is the target gene of sall4 in human hematopoietic as well as leukemic cells and is down - regulated if sall4 is knocked down by the sirna in the hl-60 leukemia cell line. recently, researchers employed microrna profiling to gain insight into the role of bmi-1 in regulating emt. overexpression of mir-200c decreased bmi-1 expression in breast cancer stem cells (bcscs) and inhibited the formation of mammary ducts as well as tumors by normal mammary stem cells and bcscs. found that mir-15a and mir-16 directly targeted the bmi-1 3 untranslated region and correlated with bmi-1 protein levels in ovarian cancer patients and cell lines. together, our research shows that the bmi-1 signaling pathways play a major role in the maintenance of stemness and the metastatic ability of hnscc - csc by regulating of snail expression. additionally, we demonstrate coexpression of bmi-1, snail, and aldh1 in hnscc patients

recent studies suggest that aldh1 is a putative marker for hnscc - derived cancer stem cells. however, the regulation mechanisms that maintain the stemness and metastatic capability of hnscc - aldh1 + cells remain unclear. initially, hnscc - aldh1 + cells from hnscc patient showed cancer stemness properties, and high expression of bmi1 and snail. functionally, tumorigenic properties of hnscc - aldh1 + cells could be downregulated by knockdown of bmi-1. overexpression of bmi-1 altered in expression property aldh1 cells to that of aldh1 + cells. furthermore, knockdown of bmi-1 enhanced the radiosensitivity of radiation - treated hnscc - aldh1 + cells. moreover, overexpression of bmi-1 in hnscc - aldh1 cells increased tumor volume and number of pulmonary metastatic lesions by xenotransplant assay. importantly, knock - down of bmi1 in hnscc - aldh1 + cells significantly decreased distant metastases in the lungs. clinically, coexpression of bmi-1/snail / aldh1 predicted the worst prognosis in hnscc patients. collectively, our data suggested that bmi-1 plays a key role in regulating snail expression and cancer stemness properties of hnscc - aldh1 + cells.

neuroleptic malignant syndrome (nms) is a rare but life - threatening complication to antipsychotic agents. it was initially reported in 1960s and since then many cases have been recognized worldwide. nms is associated with a significant mortality rate and requires early recognition and prompt treatment. early diagnosis of nms can be a clinical challenge to family physicians who treat patients with both medical and psychiatric conditions. with increasing the use of antipsychotic agents in primary and secondary care setting, nms can be missed if not suspected in patients on antipsychotics presenting in general practice with hyperthermia and muscle rigidity. we report a case of nms diagnosed in a patient with poorly controlled diabetes in the urban health center at vellore, tamil nadu, india. a 34-year - old male with history of type 2 diabetes mellitus on oral hypoglycemic agents was hospitalized twice with symptoms of ketosis. poor drug compliance, poor motivation regarding diabetes care, and psychomotor agitation were noted during hospitalization. one week after starting on antipsychotics, he presented with extrapyramidal symptoms of dystonia, parkinsonian gait, fine tremors, high spiking fever, altered sensorium, and muscle rigidity. blood counts, urine microscopy, and renal function were normal except for low sodium. creatine phosphokinase (cpk) was ordered in view of muscle rigidity that was very high. a diagnosis of nms was made according to diagnostic and statistical manual of mental disorders (dsm - iv) criteria. laboratory abnormalities in our patient risperidone was stopped immediately, and he was treated with lorazepam, trihexyphenidyl, paracetamol, and intravenous fluids in consultation with psychiatrist. within 48 h of hospitalization, family was informed of the diagnosis and the need for close monitoring of his glycemic control. nms is a rare condition as reported in the two studies done in neurology and psychiatric units of teaching hospitals in india with an incidence of 1.401.41/1000 cases treated with antipsychotics. among the risk factors, some studies report older age as high - risk due to the associated medical morbidities, nutritional deficiencies, dehydration and electrolyte abnormalities, male gender, and genetic predisposition. other studies report more cases in the age group of 2050 years associated with high antipsychotic dosage as seen in our patient. the antidopaminergic activity of antipsychotic drugs is associated with the symptoms of muscle rigidity, hyperthermia, autonomic dysfunction, and mental status change. these symptoms are recognized as diagnostic according to the american psychiatric associations dsm - iv. the signs and symptoms develop during a 2472 h period following the administration of antipsychotic drug; however, it can develop later as seen in our patient. newer antipsychotic agents such as risperidone block serotonin receptors more than dopamine receptors; however, nms has been reported with their use as in our case study. anti - emetics such as metoclopramide and droperidol have been linked to nms by their dopaminergic blocking activity. laboratory abnormalities may include leukocytosis, electrolyte disturbances, and elevated cpk secondary to muscle damage. diagnostic tests for fever may include urine analysis, chest radiography, and lumbar puncture. imaging studies of brain are not diagnostic of nms, however, may rule out other causes of altered mental status. possible complications include dehydration from poor oral intake, renal failure secondary to rhabdomyolysis, and coagulation abnormalities. mortality in nms has decreased from 76% to between 10% and 20%, however, complete recovery is noted in most patients. mortality is caused by complications such as respiratory failure, cardiovascular collapse, renal failure, arrhythmias, and thromboembolism. patients who are hemodynamically unstable are to be transferred to higher centers for intensive monitoring. mild cases can be managed at the secondary care setting in consultation with a psychiatrist. supportive therapy involves discontinuation of antipsychotic agents, correction of electrolyte imbalances, nutritional deficiencies and monitoring of airway, breathing, and circulation. our patient was managed at the urban health center by the team of family physicians. specific dopaminergic agents such as bromocriptine, dantrolene, and electroconvulsive therapy as an option are considered for more severe cases by psychiatrists. symptoms may last for a month in patients who were on depot preparations. restarting antipsychotics in patients with history of nms if needed is done on consultation with psychiatrist. depot preparations are generally not recommended, however, a 2 weeks interval is to be considered between recovery and restarting antipsychotic agents. early detection and management of side effects caused by neuroleptic agents are of particular consideration to family physicians who attend to the early symptoms. decreasing risk factors that aggravate rigidity include avoiding dehydration, minimal use of restraints and intramuscular injections, adequate nutrition, screening for history of nms in the patient, or other family members.

neuroleptic malignant syndrome (nms) is a life - threatening emergency that is often seen as a complication of antipsychotic agents. it is characterized by a tetrad of motor, behavioral, autonomic, and laboratory abnormalities. we report a case of a 34-year - old man with a history of newly diagnosed type 2 diabetes mellitus, mental retardation, and behavioral abnormalities who developed nms after starting on antipsychotic agents. he presented with high temperature, muscle rigidity, tachycardia, and elevated blood pressure. after a week of hospital treatment in the general ward of a secondary care unit, he was discharged in a hemodynamically and mentally stable state.

chronic myelogenous leukemia (cml) is a chronic myelo - proliferative disorder with an initially chronic course lasting for 35 years. cml was one of the first diseases in which a specific chromosomal abnormality was identified, a t(9;22)(q34;q11) or philadelphia (ph) chromosome. avascular necrosis of the femoral head (avnfh) occurs as a complicated traumatic or nontraumatic disorder. most cases of avnfh are nontraumatic and occur secondary to excessive corticosteroid use and alcohol abuse.1 other causes include coagulopathies, hemoglobinopathies (eg, sickle cell disease), chronic liver disease, gout, idiopathic hyperlipidemia, metabolic bone disorders, pregnancy, radiation, chemotherapy, smoking, systemic lupus erythematosus, and vasculitis syndromes. intravascular coagulation appears to be the central event associated with nontraumatic avnfh.2 coagulation may occur secondary to extravascular compression (eg, marrow fat enlargement), vessel wall injury (eg, chemotherapy, radiation), or a thromboembolic event (eg, fat emboli). in addition, ischemic insult to the femoral head may in subchondral bone infarction. in this situation, weakened and unrepaired necrotic bony trabeculae fail under a compressive load, leading to subchondral collapse (eg, crescent sign), and ultimately, articular collapse.3 traumatic causes of femoral head avascular necrosis (avn) include femoral neck fractures, hip dislocation, and slipped capital femoral epiphysis.4 avnfh can be presenting manifestation for a patient with cml. we did literature review and came with number of cases reporting avnfh as an initial presentation of cml, illustrated in table 1. avnfh has been reported as an initial presentation in few cases with cml by many authors (table 1). a 34-year - old sudanese female with the diagnosis of cml was started on imatinib as a first - line therapy, but she failed the first - line therapy as per european leukemianet guidelines 2010. she was referred to the hematology service at the national center for cancer care & research (ncccr) for further evaluation. her clinical examination was unremarkable, and her work - up was repeated, including a complete blood count, cytogenetics, and bcr / abl by pcr plain radiograph before treatment was available and she was reported as normal. her work - up revealed a chronic phase of cml in failing first - line therapy. she was started on dasatinib 100 mg po once daily as a second - line therapy with which she achieved chr, ccyr, and mmr at 18 months. after 18 months on therapy with dasatinib, she presented with severe pain in her left groin with limping. her peripheral smear reported as normal, and her disease revaluated at the molecular level and showed major molecular response. radiological evaluation, including pelvic radiography (see fig . 1a and b) and magnetic resonance imaging (mri) showed grade 34 avnfh (see fig . this is because of the limited number of reports and absence of prospective studies evaluating this issue in this situation . in addition, whether the disease itself and/or the treatment encourage the development of avnfh is not known . post - contrast material - enhanced mri with its inherent high spatial resolution capabilities is considered an excellent diagnostic tool for detecting and staging of femoral head avn . it is considered the preferred method for diagnosis of occult avn, since it is more sensitive than bone scan or plain films . owing to the high incidence of bilateral avn, mri may pick up avn in opposite asymptomatic hip . an avn lesion is typically a well - demarcated epiphyseal area of altered and variable signal intensity ( figs . 1 and 2). in its early stages, t2-weighted images and stir short tau - inversion recovery can help in detection of necrotic tissue in some unusual avn lesions that mostly showed ill - delimited edema - like marrow changes.11,12 mri has 90100% sensitivity for symptomatic disease. in some cases, contrast - enhanced mris may increase diagnostic confidence by showing homogeneous hypervascularization in bone marrow edema lesions and by depicting hypovascular marrow areas in avn lesions. also the mri can discriminate between the avn and transient marrow edema.11,13 sequential and follow - up mri is considered valuable in the assessment of equivocal femoral head lesions, especially in its early stages where the findings are usually trivial.12,13 treatment historically has passed through two eras. the era of interferon: there is a limited data that interferon alfa 2a can cause avnfh. there are no reports in the literature about avnfh with other therapeutic uses of interferon alfa. therefore, the occurrence of avnfh in patients with cml on interferon treatment may be the of an interaction between cml and interferon alfa therapy. interferon alfa can inhibit angiogenesis, which may cause avn, and the stress of weight bearing may make the femoral head, particularly, vulnerable.14 the second era for cml treatment started with using tyrosine kinase inhibitor (tki) table 3. few cases of avnfh have been reported at disease presentation (cml) as well as with the use of first - generation tkis imatinib (glivec). though the mechanism by which dasatinib can cause avn is not clear, it can be postulated because of micro - circulatory obstruction of the femoral head. the above mentioned review of literature states that six patients with cml presented with avnfh as the initial presentation prior to any therapy, five in the era of interferon and two in the era with tkis, and one with imatinib and the other with dasatinib treatment. there are two issues to be considered: either the condition is rare or there is underreporting of this side effect. observational studies with proper reporting are required to accurately measure the incidence of this complication, which could significantly affect patients safety and quality of life.

chronic myeloid leukemia (cml) is a myeloproliferative neoplasm characterized by the presence of the philadelphia (ph) chromosome ing from the reciprocal translocation t(9;22)(q34;q11). the molecular consequence of this translocation is the generation of the bcr abl fusion gene, which encodes a constitutively active protein tyrosine kinase. the oncogenic protein tyrosine kinase, which is located in the cytoplasm, is responsible for the leukemia phenotype through the constitutive activation of multiple signaling pathways involved in the cell cycle and in adhesion and apoptosis. avascular necrosis of the femoral head (avnfh) is not a specific disease. it occurs as a complication or secondary to various causes. these conditions probably lead to impaired blood supply to the femoral head. the diagnosis of avnfh is based on clinical findings and is supported by specific radiological manifestations. we reported a case of a 34-year - old sudanese female with cml who developed avnfh after receiving dasatinib as a second - line therapy. though the mechanism by which dasatinib can cause avascular necrosis (avn) is not clear, it can be postulated because of microcirculatory obstruction of the femoral head. to the best of our knowledge and after extensive literature search , this is the first reported case of avnfh induced by dasatinib in a patient with cml.

colorectal cancer (crc) is one of the most common forms of cancer in western society. every year 9,500 patients in the netherlands are diagnosed with the disease and almost half of them die from it (dutch cancer registry, 2002). it is estimated that in around 20% of the patients with a colorectal tumour genetic factors play a role in the aetiology. about 15% of the patients with crc are thought to have hereditary non - polyposis colorectal cancer (hnpcc, lynch syndrome); a dominant hereditary disease, which is caused by a defect in one of the dna - mismatch repair (mmr) genes. the most important clinical characteristics of crc associated with hnpcc, are the relatively young age at which patients are diagnosed with the disease (average < 45 years old) and the proximal localisation of the tumour in the colon. besides an increased risk of developing a tumour in the colon, there is an increased risk of developing a tumour elsewhere in the body, especially in the endometrium (lifetime risk : 50%), the small intestines, the ovaries, the brain, the urinary tract, the biliary tract and the development of a keratoacanthoma or a carcinoma of the sebaceous glands of the skin. the identification of patients with hereditary colorectal carcinoma is of great importance for the patient, because the treatment and follow - up of the tumour differ from those with non - hereditary colorectal carcinoma. furthermore, the identification of these patients is important, because it offers efficient manners for the prevention of colorectal carcinoma and other forms of cancer for the patient himself as well as his family. it has been shown that a colonoscopy every three years can lead to a decline in mortality of at least 65%. the genetic defect in hnpcc another method to select families for mutation analysis of the mmr genes is analysis of errors in repetitive dna - sequences, i.e., micro satellite instability (msi). msi is found in around 15% of the non - selected crc and in more than 95% of the colorectal tumours associated with hnpcc. in 1996 these so - called bethesda - guidelines describe practically all situations, where there is a suspicion of hnpcc. table 1guidelines for the performance of msi - analysis of colorectal tumour revised bethesda - guidelinesa person with colorectal carcinoma diagnosed at age 50a person with colorectal carcinoma and msi - associated pathology<60 yearsa person with colorectal carcinoma and a hnpcc associated tumoura person with colorectal carcinoma and a first degree relative with a colorectal or hnpcc associated tumour; at least one of the tumours is diagnosed before the age of 50three relatives diagnosed with colorectal carcinoma or a hnpcc associated tumour, diagnosed at any age; one patient needs to be a first degree relative of the other twothe presence of tumor - infiltrating lymphocytes, so called, " crohn's like lymfocyte reaction ", mucinous or signet ring cell carcinoma differentiation or medullary growth patterncarcinoma of the endometrial tissue, stomach, small intestines, pancreatic gland, biliary tract, urinary tract, ovaries, brain, keratoacanthoma and carcinoma of the sebaceous glands guidelines for the performance of msi - analysis of colorectal tumour the presence of tumor - infiltrating lymphocytes, so called, " crohn's like lymfocyte reaction ", mucinous or signet ring cell carcinoma differentiation or medullary growth pattern carcinoma of the endometrial tissue, stomach, small intestines, pancreatic gland, biliary tract, urinary tract, ovaries, brain, keratoacanthoma and carcinoma of the sebaceous glands before the discovery of the mmr - genes, the most common approach in the diagnostic work - up for hnpcc was to use the amsterdam criteria. these criteria are met if there are, within one family, three individuals with a colorectal (or another hnpcc - associated kind of) tumour, of whom one person is a first degree family member of the other two and at least one carcinoma is diagnosed before the age of fifty. to evaluate the amsterdam criteria in patients with crc, a complete history on cancer in the patient s family has to be obtained. until now it is not known whether an adequate family history is taken of all patients with a colorectal carcinoma. we also do not know to what extent medical specialists use the above mentioned clinical bethesda guidelines and if the tumours of all the patients who match the criteria are tested for msi. the objective of the present study was to answer these questions using data of the cancer registry of the comprehensive cancer centre west (cccw) in leiden, the netherlands. we selected patients who were diagnosed with a primary and invasive colorectal tumour in the period 19992001 from the cancer registry (cr) of the comprehensive cancer centre west (cccw) in the netherlands. the patients had to satisfy one of the following two bethesda guidelines: the patient had to have more than one tumour, i.e., one colorectal carcinoma and a second one (colorectal cancer or another hnpcc - associated kind of tumour), or the patient had to be fifty years or younger at diagnosis. the selected patients were considered to have an indication for the performance of msi - analysis and/or referral to the clinical genetic centre (cgc). patients with a carcinoma in situ or a carcinod of the appendix were not included in the analysis. between 1999 and 2001, 434 patients who complied with the above mentioned criteria were diagnosed with crc in one of the twelve hospitals in the cccw - region. seven hospitals gave permission for the collection of information concerning family history, msi - analysis and referral to the cgc. the family history was considered complete if the medical records reported on cancer in the family, and if so, information about the age at the time of the diagnosis, the type of cancer and the occurrence of cancer within first - degree and second - degree family members. 120 patients had multiple tumours, 109 patients were fifty years or younger at the time of diagnosis, and 15 patients had both characteristics. for comparisons between patients with multiple tumours and patients who were young at diagnosis, those with both characteristics were allocated to the multivariate logistic regression analysis was used to study whether the presence of a complete family history or referral to a cgc could be explained by age, sex, inclusion criterion (multiple tumours or young age at diagnosis), hospital or type of medical specialist. the study group consisted of 244 persons, who complied with one of the bethesda guidelines and therefore were considered to be referred for msi - analysis and/or genetic counselling. the male: female ratio was 49:51 and did not differ between the groups selected on the basis of multiple tumours or age 50 years at diagnosis. a complete family history was recorded in the medical records of 38 (16%) of the 244 patients. for 136 patients (55%) limited information on the family history was available, and for 70 (29%) patients no information on the family history of the 38 patients with a complete family history, 20 (53%) were referred to the cgc. this percentage was higher than that of patients with an incomplete family history (13%) and that of patients without any information on family history (4%) (p < 0.0001, table 2). msi - analysis was performed more often in the patients with a complete family history: 34% of patients with a complete family history compared to 6% of patients with an incomplete family history and 1% of patients without any family history (p < 0.0001) (table 2). presence of a complete family history and the performance of msi - analysis were not associated with age, sex, inclusion criterion (multiple tumours or young age at diagnosis), hospital or type of medical specialist (multivariate logistic regression analysis ; data not shown). table 2diagnostic work - up for hnpcc in 244 patients with colorectal cancer, by completeness of the family history as reported in the medical recordsdiagnostic workupfamily history complete (n = 38)family history incomplete (n = 136)family history absent (n = 70)referred to cgc20 (53%)17 (13%)3 (4%)msi - analysis performed13 (34%)8 (6%)1 (1%) of msi - analysis3 msi, 10 stable7 stable, 1 unknown1 stablediagnosis of hnpcc6 (16%)3 (2%)1 (1%) diagnostic work - up for hnpcc in 244 patients with colorectal cancer, by completeness of the family history as reported in the medical records we used the bethesda - guidelines to select a group of patients with a suspicion of hnpcc. these patients were diagnosed with colorectal cancer between 1999 and 2001, a period during which msi - analysis and the bethesda guidelines were already available. therefore we expected that for these patients, physicians would have examined and reported their patients family history and that msi - analysis would have been performed. in our study group, however, the family history of the patients diagnosed with colorectal carcinoma was not sufficiently examined and reported in the medical records. for this reason, we believe the bethesda - guidelines were not sufficiently applied by the physicians. as a consequence, msi - analysis was performed on a small proportion of the tumours. more patients with a complete family history in their medical records were referred by their physicians to the cgc than patients without such a family history. we expect that in a low - risk population, i.e., patients with colorectal cancer who do not meet the bethesda guidelines, these would be even more dramatic. on the one hand we collected our data using medical records from various medical specialties, while the treating physician will not have this overview in practice. on the other hand, it is possible that when a physician examined a family history and none of the family members was diagnosed with cancer, he did not report it in the medical records. in this case, the family history was considered as absent, although it in fact was examined. nevertheless we expect that if msi - analysis was performed or the patient was referred to the cgc, this would have certainly been reported. we found that the attention for hnpcc in the diagnostic workup for crc differed widely. for the seven participating hospitals, the proportion of patients with a reported family history on cancer ranged from 38% to 91%. for these reasons, we can not generalise our for the whole cccw - region. nevertheless, we conclude that the family history appears to be neglected in the majority of patients with colorectal cancer in our study period, and that msi - analysis was only performed in a small proportion of the patients that meet the guidelines for this analysis. possibly, the attention for identification of patients with hnpcc has increased in more recent years. our findings underscore the importance of implementation of family history and bethesda guidelines in the physician education.

in the diagnostic work - up of hereditary non - polyposis colorectal cancer (hnpcc, lynch syndrome), high - risk patients can be identified using information from the family history on cancer (amsterdam criteria and bethesda guidelines). to investigate to what extent the medical specialists apply these criteria to patients with colorectal carcinoma and a suspicion of hnpcc, we collected information on diagnostic work - up of 224 patients of seven hospitals in the region of the comprehensive cancer centre west in leiden, the netherlands. these patients were diagnosed with colorectal cancer between 1999 and 2001 and satisfied at least one of the bethesda guidelines. a complete family history was recorded for 38 of the 244 patients (16%). patients with a complete family history were more likely to be referred to the clinical genetic centre than those with an incomplete or absent family history (53% vs. 13% and 4%, respectively ; p < 0.0001), and more likely to be analyzed for microsatellite instability (msi), which is a characteristic of hnpcc (34% vs. 6% and 1%, respectively ; p < 0.0001). we conclude that the family history is neglected in the majority of patients with colorectal cancer and msi - analysis is only performed in a small proportion of the patients that meet the guidelines for this analysis.

great progress has been made in neonatal care over the last few decades, reflected by improving survival rates and clinical outcomes of preterm infants. despite these advances, 45 years after its first description, bronchopulmonary dysplasia (bpd) remains a major complication of premature birth, causing ongoing morbidity and mortality: it is the most common neonatal chronic lung disease, affecting around 25% to 35% of vlbw neonates (very low birth weight, < 1500 g), and is associated with increased risk for rehospitalization , cognitive delay, and neurosensory deficits. initially described by northway et al. in 1967, the old bpd mainly affected modestly premature newborns suffering from respiratory distress and therefore mechanically ventilated with high levels of supplemental oxygen. with the introduction of surfactant treatment, prenatal maternal use of glucocorticoids, improved nutrition, and ventilator strategies the clinical course and pathology of bpd have changed considerably. unlike the original description, today's new bpd is mainly regarded as a disruption of distal lung growth. thus, influenced by both genetic susceptibility and environmental factors on the immature lung, the pathophysiology is characterized by inflammation, abnormal microvascularization, and impaired alveolarization. alveolar formation of the primitive saccules is a complex process of epithelial morphogenesis, capillary growth, and coordinated extracellular matrix (ecm) remodelling. at this, fibroblast growth factor (fgf) signalling and matrix metalloproteinase (mmp) activity play eminent roles. some mmps are upregulated in inflammatory environment and yet are involved in pulmonary host defense. there is evidence for some mmp isoforms being important determinants for alveolarization, especially mmp-2, -9, and -16: mmp-2 deficient mice showed fewer and larger alveoli with thinner interstitial tissue. hadchouel et al. demonstrated an increase of mmp-16 activity during the alveolar stage and moreover found two snps within the mmp-16 gene being associated with lower tracheal mmp-2 and -16 activity and to protect from bpd. prospecting further potential biomarkers for bpd, also mmp-9 shows some promise; for example, harijith et al. highlighted a mmp-9-dependent lung injury pathway in an ifn-mediated animal model of bpd. mice with a partial mmp-9 deficiency showed a reversal of ifn-induced lung injury during hyperoxia. mmps, particularly mmp-2 and -9, activate fibroblast growth factors (fgfs) by cleavage in the ecm, especially during angiogenesis. in turn activated fgfs upregulate mmp expression. fgfs are secreted glycoproteins involved in interactions between epithelium and mesenchyme regulating cell migration and proliferation in embryonic development, especially in fetal pulmogenesis. their signalling depends on membrane - located receptors (fgfrs) with a tyrosine kinase domain, encoded by four different genes (fgfr 14). they are all translated in developing lungs and are suggested to play major roles in modifying distal lung patterns during alveolarization; for example, fgfr-3-fgfr-4 double - knockout mice show no alveolarization. it has been assumed that heritable determinants contribute significantly to both bpd and rds. on this account, we were interested in identifying genetic risk factors in a caucasian population of premature newborn with bpd and rds. we genotyped 27 polymorphisms within fourteen candidate genes for bpd: mmp-1, -2, -9, -12, and -16, fgf receptors 2 and 4, fgf-2, -3, -4, -7, and -18, signal - regulatory protein (sirpa), and thyroid transcription factor-1 (ttf-1). we also included sirpa because of the known effect on surfactant proteins and inhibition of macrophages, as well as ttf-1 due to its effect on lung differentiation. we recruited preterm neonates (28 weeks of gestation) born between january 1996 and september 2010 at the centre for pediatrics and adolescent medicine, university hospital freiburg, germany. twins and siblings were excluded from the study as were children with chromosomal aberrations, congenital heart defects, or other major congenital malformations. dna was collected by buccal swabs or by routine blood sampling, between 2 weeks up to 2 years of age. this included gestational week, number of days with supplemental oxygen, need of mechanical ventilation and positive airway pressure, and need of surfactant therapy. as described previously, the subdivision of our bpd study population was based on the analysis by lavoie et al. about the heritability of bpd according to the consensus defined by the national institute of health: the bpd population included all infants with moderate and severe bpd, that is, supplemental oxygen for at least 28 days plus need of oxygen and/or positive pressure at 36 weeks of gestation, whereas the control population consisted of all preterm neonates with no or mild bpd. recruiting neonates for the rds population was targeted on severe cases of respiratory distress by including only newborns depending on surfactant within the first 24 hours after birth (see supplementary material available online at http://dx.doi.org/10.1155/2013/932356). at our neonatal intensive care unit (nicu) the following approach has been applied regarding the treatment with surfactant: avoiding of intubation independent of the gestational week. therefore, even very premature infants are only intubated if they show failure of ventilation and/or need of supplemental oxygen above 40%. once they required intubation during the immediate postnatal period, they receive surfactant within 2 hours. we included a minority of polymorphisms that already had been tested for other pathologies (rs1799750 in mmp1 and rs2276109 and rs652438 in mmp12). for pcr reactions, genomic dna was initially denatured at 94c for 5 minutes and underwent 3540 cycles of denaturation (94c for 30 seconds), annealing (1 minute, corresponding temperatures displayed in table 2), extension reaction (72c for 1 minute), and a final extension step at 72c for 8 minutes. in table 2 some primers contain intended single nucleotide mismatches (mutagenic primers) to create sites for restriction enzymes. accuracy of the rflp was confirmed by sequencing via dideoxy chain termination method, respectively, three controls (homozygous wildtype, heterozygous, and homozygous mutation) for each polymorphism using the big dye terminator cycle sequencing kit on an abi 310 sequencer (applied biosystems). genotyping data of our case - control populations were analysed by using armitage's trend test (att) for possible association with bpd and rds as specified previously. moreover att was used to calculate hardy weinberg equilibrium (hwe) for each polymorphism. the collection of blood / buccal swabs and the experimental procedures were approved by the ethical committee of the university of freiburg. parents were given written and verbal information about the study and a statement of informed consent was signed by the parents of all enrolled children. the of the 27 studied polymorphisms (table 1) for association with bronchopulmonary dysplasia and neonatal respiratory distress are specified in table 3 (bpd) and table 4 (rds). among the 11 genotyped polymorphisms in different mmp genes (see table 1) there was no bpd - associated polymorphism (table 3) but two polymorphisms associated (p < 0.05) with rds (rs20544 in mmp-9 : p = 0.033 ; rs652438 in mmp-12 : p = 0.047, see table 4). both snps show no significant deviation from hardy - weinberg equilibrium, neither in the control nor in the case population. analysis of rs20544 (c / t) identifies the t allele as protective against respiratory distress. for the genotyping of the amino acid substitution rs652438 (a / g, asn357ser) the complete absence of the g / g homozygous genotype in the respiratory distress case population must be taken in account. the other mmp - snps showed no association, inclusively rs2664352 in mmp16, that had been associated with protection from bpd. the fgfr-4 snp rs1966265, located in the exon region and causing an amino acid substitution of isoleucine (ile) for valine (val) is associated with both bpd (p = 0.023) and rds (p = 0.003). here the a / a genotype (ile) could be identified as protective allele variant against our studied lung diseases. the association from significant differences in allele frequencies: in both bpd and rds analysis the g allele is more frequent in the disease populations (see tables 3 and 4). the other snps in the fgfr genes showed no association with neither bpd nor respiratory distress. whereas no association could be detected between the eight fgf - snps and bpd, rs10796856 in fgf-3 and rs4316697 in fgf-7 showed associations with rds. correspondent p values are p = 0.036 (rs10796856) and p = 0.044 (rs4316697), and no deviations from hardy - weinberg equilibrium were detected (see table 4). the four snps in sirpa and ttf-1 showed no association with neither bpd nor rds. analysis of ttf-1 rs999460 unfolds deviation from hardy - weinberg equilibrium in both case and one control populations in our caucasian population (see tables 3 and 4). the aim of this study has been to identify genetic risk factors in an ethnically homogenous caucasian population. genetic contribution to bpd is suggested on the basis of twin studies demonstrating that at least half of the susceptibility is hereditary. additionally, lavoie et al. could differentiate in their study that mild bpd (according to the national institute of child health and human development consensus definition) had been mainly attributable to shared environmental factors whereas moderate or severe bpd had been attributable to genetic influence. following these findings, we defined our control population as neonates with no bpd or mild bpd, whereas our bpd population included neonates with moderate or severe bpd. furthermore, we recruited only preterm neonates 28 weeks of gestational age for the bpd population to avoid false associations based on the fact that bpd hardly develops in newborn older than 30 weeks of gestational age. in contrast to bpd, the of twin studies on rds susceptibility showed mostly contradictory . a twin study by levit et al. with 332 twin pairs of a heterogeneous population has been the first one to include and assess the influence of several independent covariates, revealing that 50% of the variance to rds susceptibility is hereditary. given these lines of evidence for genetic contribution, we have chosen the candidate - gene approach for our association study based on the hypothesis that genes fundamental in lung organogenesis and alveolar remodelling, that is, mmp and fgf, determine susceptibility to bpd and rds. known genetic risk factors for rds are mostly allelic polymorphisms of the genes encoding surfactant proteins sp - a1, sp - a2, and sp - b. anyhow, other determinants than components of the surfactant system might also affect the liability to rds. genes encoding for growth factors or enzymes that account for alveolarization through proper secondary septation and extracellular remodeling might affect the gas - exchange and therefore aggravate respiratory distress at birth. supposed genetic risk factors for bpd are mostly genes encoding components of innate immunity and antigen - presentation, cytokines, antioxidant defences, and angiogenic growth factors such as: mannose - binding lectin (mbl2), tumor necrosis factor - alpha (tnf-) , human leucocyte antigen (hla)-a, -b, and -c alleles, glutathione - s - transferase - p1, and vascular endothelial growth factor (vegf). some years ago, two mmp-16 gene polymorphisms were demonstrated to protect from bpd and moreover to be associated with lower tracheal mmp-2 and -16 levels. matrix metalloproteinases are a family of zinc - dependent endopeptidases, and they degrade extracellular components and play a crucial role in lung development, especially during alveolarization. particularly mmp-2 and -9 (so - called gelatinases a and b) seem to be relevant in extracellular remodeling and even pulmonary host defense. they degrade type iv collagen, fibronectin, elastin, and denatured collagen (gelatin). mmp-2 deficient mice show an abnormal saccular development with larger and simplified alveoles. in line with this finding , newborns developing bpd showed low mmp-2 tracheal levels at birth. recently, mmp-9 could be identified as a pathogenic key mediator in a murine model of bpd. on the other hand, increased tracheal levels of mmp-9 early after birth have been associated with resolving rds, suggesting that increase in mmp-9-activity is a physiologic repair response. demonstrated that increased mmp-9 activity in neonatal lungs early after birth correlated with resolving respiratory distress syndrome, demonstrating a likely role of mmp-9 in pulmonary host defense. in our study we identified an snp (rs20544) in the mmp-9 gene to be associated (p = 0.033) with rds, but not bpd. respiratory distress syndrome has been defined as need of surfactant (see supplementary material). on one hand, ethnically homogenous populations like our caucasian population are favourable to detect possible pathogenetic determinants, but one must bear in mind that the size of our rds population is limited and the total numbers of neonates studied for each polymorphism vary slightly according to the recruiting time point. furthermore, association studies on rds are prone to confounding factors. other pulmonary conditions such as a transient tachypnea provoked by wet lung syndrome or pulmonary infection might mimic respiratory distress syndrome caused by surfactant deficiency and thereby hamper the of our study. in our study, we included mmp-16 polymorphisms that had been associated with bpd in a french population (rs2664352). in our population rs2664352 up to now, the role of fgf3 has been mainly studied in cancer diseases, that is, lung cancer, but its exact role in pulmogenesis remains elusive. there is evidence for fgf-3 upregulation to be associated with alveolar type 2 cell hyperplasia and downregulation to be associated with an excessive recruitment of free alveolar macrophages which might lead to symptoms of respiratory distress. furthermore it has been shown that fgf-3 stimulates the secretion of mmp-2 and -9 propeptides in vitro. fgfr-4 polymorphism rs1966265 showed association with both respiratory distress (p = 0.003) and bronchopulmonary dysplasia (p = 0.023). the a / a genotype (encoding for isoleucin instead of valine) has been protective in our association study. the exact - test showed no deviation from hardy weinberg equilibrium for this snp in both case and control populations, suggesting that the association does not from population admixture or genotyping errors. fgfr-1 to fgfr-4 are expressed in the lung and fgfr-3 and -4 signalling, in particular, appears to be fundamental in alveolar formation. weinstein et al. demonstrated that mice deficient in both fgfr-3 and -4 show a completely blocked alveolarization and fail to show any formation of secondary septae, whereas solely fgfr-4(/) animals exhibit no significant abnormalities, revealing a cooperative effect of fgfr-3 and -4 in lung development. hyperoxia - exposed (fio2 0.85) mice show a bpd - like lung pattern of enlarged airspaces and furthermore a reduced expression of fgfr-3 and -4, suggesting a pathogenic role in arrested lung development. replicated these in fgfr-3 and -4 deficient mice and demonstrated in addition that fgfr-3/-4 signaling contributes to excessive elastin production and its alveolar accumulation, which is another typical feature of bpd. but these abnormalities have not been due to fibroblast defects but due to increased expression of paracrine factors of alveolar type 2 cell (at2). if a reduction in fgfr-3 and -4 expression affects distal lung development, a functionally significant polymorphism within the correspondent gene possibly alters the susceptibility to alveolar disease such as bpd and rds. showed that there is a peak of fgfr-4 expression at the day of birth, when respiratory distress syndrome occurs. false - positive can only be excluded by replications in other study populations. in , we describe five snps in mmp-9, mmp-12, fgfr-4, fgf-3, and fgf-7 that are associated (p < 0.05) in our caucasian population with respiratory distress syndrome of the newborn, defined as surfactant application within the first 24 hours after birth. among these polymorphisms one polymorphism in fgfr-4 (rs1966265) is additionally associated with bronchopulmonary dysplasia, demonstrating its possible role in the pathogenesis of newborn lung diseases on grounds of pulmonal immaturity.

. bronchopulmonary dysplasia (bpd) is the most common chronic lung disease of premature birth, characterized by impaired alveolar development and inflammation. pathomechanisms contributing to bpd are poorly understood. however, it is assumed that genetic factors predispose to bpd and other pulmonary diseases of preterm neonates, such as neonatal respiratory distress syndrome (rds). for association studies, genes upregulated during alveolarization are major candidates for genetic analysis, for example, matrix metalloproteinases (mmps) and fibroblast growth factors (fgfs) and their receptors (fgfr). objective. determining genetic risk variants in a caucasian population of premature neonates with bpd and rds. methods. we genotyped 27 polymorphisms within 14 candidate genes via restriction fragment length polymorphism (rflp): mmp-1, -2, -9, and -12, -16, fgf receptors 2 and 4, fgf-2, -3, -4, -7, and -18, signal - regulatory protein (sirpa) and thyroid transcription factor-1 (ttf-1). . five single nucleotide polymorphisms (snps) in mmp-9, mmp-12, fgfr-4, fgf-3, and fgf-7 are associated (p < 0.05) with rds, defined as surfactant application within the first 24 hours after birth. one of them, in fgfr-4 (rs1966265), is associated with both rds (p = 0.003) and bpd (p = 0.023). . rs1966265 in fgf receptor 4 is a possible genetic key variant in alveolar diseases of preterm newborns.

raised intracranial pressure (icp) is usually associated with increased morbidity, mortality, and poor neurological outcomes. the etiology could be varied viz stroke, liver failure, meningitis, meningoencephalitis, metabolic encephalopathy and postresuscitation syndrome. it is associated with complications such as infection, bleeding and being expensive. regular assessment and comparison by computed tomography (ct)/magnetic resonance imaging (mri) in these critically ill - patients the optic nerve, as a part of the central nervous system, is surrounded by a subarachnoid space and experiences the same pressure change as the intracranial compartment. the intraorbital part of the sheath, and particularly its retrobulbar segment, can distend when icp is elevated. the use of bedside ocular ultrasonography (usg) in measuring optic nerve sheath diameter (onsd) can be a useful method for detecting raised icp. it has the advantage of being a noninvasive, portable, easily performed at bedside in minimum time. it can be repeated for re - evaluation without risk of radiation. keeping this in view , we conducted the bedside study of a noninvasive measurement of onsd as predictor for detecting raised icp. we conducted a prospective observational study on 101 adult individuals after institutional review board's permission over a period between may 2013 and august 2013. they were divided into two groups a and b. group a were, 41 healthy controls of which 20 were female and 21 male. a total of 60 patients were admitted during this period with symptoms of fever, headache, vomiting and altered sensorium with possibility of elevated icp, were included in group b. they were 17 female and 43 male. all these patients were examined in the supine position using a 10 mhz phased linear array probe on the closed eyelids. the structures of the eye were visualized to align the optic nerve directly opposite the probe, with the onsd width perpendicular to the vertical axis of the scanning plane. a single onsd was measured 3.00 mm behind the globe in both the eyes. the onsd measurements were obtained averaging three readings from each eye to create a binocular onsd measurement. occular sonography: high frequency 10 mhz linear array probe placed on the gel on the closed eyelid the optic nerve sheath diameter (onsd) measurement: optic nerve appears homogeneous with low internal reflectivity compared with the high reflectivity of the nerve sheath. onsd measured 3 mm behind the globe using an electronic caliper with an angle perpendicular to the eye ball the individuals in the control group were between 18 and 40 years. in these controls a mean binocular onsd was 4.6 mm and 4.8 mm in females and males respectively. the measurements above 4.6 mm and 4.8 mm in females and males were considered to have increased icp. imaging of the head ct / mri was done as per requirement in group b patients only. the finding of ct / mri was reported by the on - site radiologist, and they were correlated with bedside onsd measurement. the patient's imaging was considered to be positive for raised icp if the radiologist's impression described findings, suggestive of elevated icp such as significant cerebral edema, midline shift, mass effect, effacement of sulci, collapse of ventricles, compression of cisterns and onsd > 5.0 mm on t2 mri. the waiver of the individual consent was requested as the intervention was completely harmless, nonchargeable to the patient and no patient identification was used. patients with a history of optic neuritis, arachnoid cyst of the optic nerve, high myopic, optic nerve trauma, and anterior orbital or cavernous sinus mass are excluded from the study. the variables used were age, sex, diagnosis, heart rate, blood pressure, respiratory rate, oxygen saturation, temperature, glasgow coma scale (gcs), onsd, signs of raised icp on imaging, serum osmolarity, serum creatinine, mannitol, and management. statistically assessed the observed differences among various onsd groups in the distribution of categorical variables, the pearson or fisher exact test of association was used. statistics to test baseline differences between the study group and controls was performed with the mann - whitney u - test. statistically assessed the observed differences among various onsd groups in the distribution of categorical variables, the pearson or fisher exact test of association was used. statistics to test baseline differences between the study group and controls was performed with the mann - whitney u - test. statistically assessed the observed differences among various onsd groups in the distribution of categorical variables, the pearson or fisher exact test of association was used. statistics to test baseline differences between the study group and controls was performed with the mann - whitney u - test. a were 41 (females = 20 and males = 21) as a control. in group the mean onsd of control and study group for female was 4.627 0.09 mm and 5.103 0.62 mm and for male was 4.8 0.10 mm and 5.081 0.58 mm respectively. the mean age of the control and study group was 27.44 3.31 and 56.15 18.86 years respectively. demographic profile of the study patient out of 60 patients that were admitted, 35 cases showed raised icp on imaging and their onsd 5.43 0.53 mm. the other 25 patients did not show a raised icp on imaging and onsd was 4.61 0.19 mm. it showed a significant difference between the two sets of patients with a p < 0.001. however, 10 out of their 25 showed a rise in onsd for a female 4.735 mm > 4.6 mm and male 4.907 mm > 4.8 mm which required reduction of icp. the mean gcs for raised icp and normal icp on imaging was 10.5 0.12 and 12.04 2.11 respectively. the mean temperature 99.31 0.75f and 98.89 0.55f respectively for raised icp and normal icp. it showed statistically significant as p value for gcs and temperature was 0.04 (< 0.05) and 0.02 (< 0.05) respectively. other variables were also analyzed and did not show any statistically significant difference as shown in table 2. association of icp with clinical profile receiver operator characteristic (roc) curve (area under the curve) for mean onsd 4.716 mm is 98.6% (95% ci : 96.5 - 100%) with sensitivity of 77.8% and specificity of 100%. for female roc curve (auc) for onsd > 4.6 mm is 100% (95% ci : 100%), with sensitivity of 84.6% and specificity of 100% whereas for male roc curve (auc) for onsd > 4.8 mm is 97.4% (95% ci : 93.5 - 100%) with sensitivity of 75.0% and specificity of 100% as shown in figures 3 and 4. receiving operating characteristic curve for detecting raised intracranial pressure by ultrasonography optic nerve sheath diameter for female receiving operating characteristic curve for detecting raised intracranial pressure by ultrasonography optic nerve sheath diameter for male all these patients received treatment with mannitol, antiepileptics, antiplatelet, antibiotics, and antiviral depending on cerebrospinal fluid (csf) analysis. the trend of onsd in patients with raised icp was recorded from day 1 to day 4. in the female population onsd on day 1 was 5.405 0.5729 mm and by day 4 it decreased to 4.868 0.4417 mm. similarly in male onsd on day1 was 5.442 0.5233 mm and by day 4 it decreased to 5.065 0.3730 mm. in 10 cases that did not show raised icp on imaging but had increased onsd on day 1 for female 4.735 0.064 mm and male 4.907 0.054 mm. reduction of icp was noted on 2 day as onsd decreased to 4.630 0.071 mm in female and to 4.823 0.038 mm in male. trend of onsd with treatment trend of onsd with treatment about 35 patients had raised icp on imaging and onsd of 5.430 0.5311 mm, 21 cases diagnosed as infective (meningitis, meningoencephalities), 12 cases were cerebrovascular accident (stroke, intracranial hemorrhage), and 2 cases were metabolic encephalopathy. whereas out of 25 cases that did not show raised icp radiologically 2 cases were infective (meningitis, meningoencephalities), 18 cases were cerebrovascular accident (stroke, intracranial hemorrhage) and 5 cases were metabolic encephalopathy. but 10 cases did not show raised icp radiologically but had mean onsd for two female as 4.735 mm and eight male as 4.907 mm. they were 8 cerebrovascular accident, 1 metabolic encephalopathy, and 1 infective. in the study group out of 60 patients, 28 patients had high onsd and signs of raised icp on imaging received mannitol as definitive treatment. however, three patients who showed only high onsd and did not show raised icp on imaging also received mannitol and they showed a decrease in onsd after supportive therapy. totally 26 patients required intubation and controlled mechanical ventilation with sedation. in the study group, 21 patients had high onsd and signs of raised icp on imaging, but the other five patients had high onsd, but did not show signs of raised icp on imaging. total 5 cases expired, 2 with icp increased, 3 without icp and it did not find any statistical significant. raised icp is, usually, associated with conditions such as stroke, liver failure, meningitis, meningoencephalitis, metabolic encephalopathy, and postresuscitation syndrome. the cranium and the vertebral canal along with the relatively inelastic dura form a rigid container, such that the increase in any of its contents, that is, brain, blood, or csf, will tend to increase the icp. the monro - kelliy doctrine relationship states that small increases in brain volume do not lead to immediate increase in icp due to the ability of the csf to be displaced into the spinal canal, as well as the slight ability to stretch the falx cerebri between the hemispheres and the tentorium between the hemispheres and the cerebellum. however, once the icp reaches around 20 - 25 mmhg, any small increase in brain volume can lead to marked elevations in icp due to failure of intracranial compliance. in stage 1 , there is a minimal increase in icp. in stage 2, there is a drastic increase in icp as change in volume is > 100 - 200 ml. stage 3 is characterized by a sustained increased icp, with dramatic changes in icp with small changes in volume. as the icp approaches the mean arterial pressure, it becomes more and more difficult to squeeze blood into the intracranial space, leading to widespread reduction in cerebral flow and perfusion, eventually leading to ischemia and brain infarction. because of hypoxia and hyper apnea, patients present with decreased level of consciousness (loc), cheyne - stokes respiration, hyperventilation, sluggish or dilated pupils and widened pulse pressure. generally when there is a rise in icp, common symptoms and signs include headache, vomiting without nausea, and altered loc. the headache is worse on coughing / sneezing / bending, and progressively worsens over time. the optic nerve sheath (ons) is anatomically continuous with the dura mater and has a trabeculated arachnoid space through which csf slowly percolates. on ultrasound examination , optic nerve appears homogeneous with low internal reflectivity compared with the high reflectivity of the nerve sheath; this was utilized by ossoinig when he performed the first ultrasound measurement of the optic nerve using an a - scan technique, and subsequently described standardized a - scanning. using these echography techniques several groups have investigated the relation between the onsd as measured by a - scan and the icp cennamo et al. each demonstrated a positive linear relation between these two variables in neurosurgical patients and in particular, an immediate change in onsd with change in icp. a position 3 mm behind the globe was chosen because the ultrasound contrast is greatest, the are more reproducible, and anatomically the anterior nerve is most distensible. hansen et al. presented data using a transorbital b - scan approach for the measurement of onsd, this approach allowed them to select a distance behind the globe to consistently measure the nerve, something difficult to attain with a - scan techniques. helmke and hansen demonstrated in cadaver studies that the onsd increased by up to 60% at a distance of 3 mm behind the globe compared with only 35% at 10 mm thus confirming liu and kahn's observations. furthermore, they went on to show that the optimal experimental scanning position was longitudinal (axial) where the least interobserver variability was found although there was no significant difference in measurement by lateral, axial, or transverse projection. in our study, the average onsd in the control group aged between 18 and 40 years was 4.6 mm and 4.8 mm in female and male respectively. it has been proved by dubourg et al. in a systematic review and meta - analysis of a ultrasonographic of onsd of detection of raised icp, a onsd in a adult < 5 mm, pediatrics (1 - 15 years) they also concluded that onsd > 5.00 - 5.70 mm had a raised icp > 20 mm with diagnostic odds ratio of 51, sensitivity of 90% (95% ci : 80 - 95%) and specificity 85% (95% ci : 73 - 93%). in a study conducted by dubost et al. to detect the incidence of raised icp in preeclampatic patients, concluded that onsd was 5.4 mm in preeclampatic patients when compared to healthy pregnant women which was 4.5 mm. similar study conducted by rajajee et al. who concluded that bedside measurement of onsd is an accurate noninvasive method to identify icp > 20 mmhg in a heterogeneous group of patients with acute brain injury with onsd > 4.8 mm has greatest accuracy. in 60 admitted patients, 35 cases had raised icp on radiological findings, the onsd for female was 5.405 mm and male was 5.442 mm. about 10 (40%) individuals did not have raised icp on imaging, but their onsd was found to be more than the control for female 4.735 0.064 mm and male 4.907 0.054 mm. we found for mean onsd of 4.716 mm, sensitivity for detecting raised icp was 77.8% (95% ci : 83 - 100%) and specificity 100%. in female sensitivity for raised icp is 84.6% and specificity 100%. in male sensitivity for raised icp was 75.0% and specificity was 100%. beare et al. evaluated ons ultrasound as a noninvasive method of detecting raised icp in african children. they concluded that sensitivity and specificity of detecting raised icp on ct for onsd 4.2 mm was 100% and 86% respectively. conducted a prospective blinded observational study on adult head injury patients in an emergency department. it has been proved by dubourg et al. in a systemic review and meta - analysis of a ultrasonographic measurement of ons diameter of detection of raised icp, that onsd > 5.00 mm had a raised icp > 20 mm, pooled sensitivity 90% (95% ci : 80 - 95%), specificity 85% (95% ci : 73 - 93%). the patients with raised icp are 51 times more likely to have a positive onsd. it was also noted that papilledema was not found in the acute situation as it takes hours to days to develop. acute rise in icp can be difficult to diagnose because the symptoms are nonspecific, and direct measurement of icp has the attendant risks of intracranial hemorrhage and infection. in our analysis, 35 patients who had raised icp on ct / mri only temperature and gcs had a significant difference. about 35 cases had raised icp on imaging and high onsd on the 1 day of admission and after starting the appropriate treatment onsd was measured subsequently on days 2, 3 and 4. we found a significant reduction of onsd for female and male after 72 h of treatment. about 25 cases did not have increased icp on imaging. however 10 cases out of 25 had onsd higher than the cutoff value for female 4.735 0.064 mm and male 4.907 0.054 mm. after supportive treatment, their onsd on day 2 for female and male was almost returned to normal value. the early detection of raised icp can be very difficult when invasive devices are not available. clinical signs of raised icp such as headache, vomiting and drowsiness are not specific and often difficult to interpret. in sedated patients, clinical signs of raised icp bedside measurement of onsd is a useful test to identify raised icp, being noninvasive, can be repeated multiple times, devoid of ionizing radiation and can be applied in a broad range of settings.

and aims: the aim was to evaluate efficacy of optic nerve sheath diameter (onsd) by ultrasound as a noninvasive method for detecting raised intracranial pressure (icp) in intensive care unit, to compare with computed tomography / magnetic resonance imaging (mri) findings of raised icp and to prognosticate onsd value with treatment.materials and methods: we conducted a prospective, observational study on 101 adults by including 41 healthy individuals in group a as control and 60 patients in group b admitted with fever, headache, vomiting, and altered sensorium. we examined them in supine position using 10 mhz linear array probe on closed eyelid. onsd was measured 3 mm behind the globe in each eye. a mean binocular onsd > 4.6 mm in female and 4.8 mm in male was considered abnormal. midline shift, edema, effacement or onsd > 5.0 mm on t2 mri suggestive of elevated icp was used to evaluate onsd accuracy.:group a mean onsd was 4.6 mm in females and 4.8 mm in males. group b mean onsd for 17 females was 5.103 0.6221 mm (p = 0.002) and for 43 males 5.081 0.5799 mm (p = 0.032). radiological sign of raised icp was confirmed in 35 patients (females = 11 and males = 24) with high onsd value. sensitivity of detecting raised icp by onsd was 84.6% in females and 75% in males while specificity was 100% in both genders. out of 25 patients without radiological signs of raised icp 10 patients showed high onsd (females = 4.735 mm and males = 4.907 mm). onsd was well prognosticated with treatment modalities.:bedside ocular ultrasonography for measuring onsd can be used an early test for diagnosing raised icp as it is a noninvasive, cost effective bedside test, which can be repeated for re - evaluation.

reports of organogold complexes undergoing redox processes are typically limited to slow oxidative additions and reductive eliminations. however, organogold complexes are not necessarily unreactive; we recently showed that diaryl au(iii) complexes undergo remarkably fast aryl aryl reductive elimination at temperatures as low as 50 c. these recent findings from our group, as well those established by vicente, hashmi, and lloyd - jones, suggest that the barrier for challenging reductive eliminations might be substantially diminished at au(iii). cf3 bond reductive elimination is typically a slow process requiring elevated temperatures and long reaction times, due to ground state stabilization afforded by exceptionally strong bonding between transition metals and cf3 ligands. for instance, (dppbz)pd(2-me - c6h4)(cf3) (dppbz = 1,2-bis(diphenylphosphino)benzene ) is stable at 130 c for 3 days, while (dppp)pd(ph)(cf3) (dppp = 1,3-diphenylphosphinopropane) and (dppe)pd(ph)(cf3) (dppe = 1,2-diphenylphosphinoethane) yield only 10% phcf3 after 3 days at 145 c. reductive eliminations at temperatures between 50 and 80 c can be achieved at pd(ii) by employing bulky ligands, such as xantphos and brettphos. notably, while aryl - cf3 reductive eliminations from pd(iv) often require similarly high temperatures, sanford has shown that they can occur at temperatures as low as 23 c over 1 h. despite advances in catalytic trifluoromethylation, caryl cf3 reductive elimination still remains a challenging step. given the importance of trifluoromethylated arenes in pharmaceuticals and agrochemicals, we were prompted to investigate potentially low - barrier caryl cf3 bond reductive elimination at au(iii). to access complexes of the type r3pau(aryl)(cf3)i , we were drawn to puddephatt s report of the oxidative addition of cf3i to me3paume to afford cis / trans mixtures of me3paume2(cf3) and me3paui. in one case, me3pau(me)(cf3)i was obtained exclusively, but its preparation could not be reproduced by the authors. because reaction times varied from 5 min to 1 day, and rates dramatically slowed in the presence of galvinoxyl, the authors concluded that a free - radical chain mechanism was operative, with cf3 as the propagating species. prior investigations by our group revealed that oxidation of ph3pau(4-f - c6h4) rapidly generates 4,4-difluorobiphenyl through a mechanism involving aryl group transfer. however, the use of the bulkier pcy3 prevents transfer of the arene ligand, instead ing in clean, rapid oxidation of cy3pau(4-f - c6h4) (1a) to the isolable au(iii) complex cis-(cy3p)au(4-f - c6h4)cl2 (eq 1).1 therefore, we began our investigations of au(i) oxidation by cf3i using 1a, with the fluorinated arene ligand also providing a convenient f nmr handle. treatment of 1a in cd2cl2 with cf3i (25 equiv) afforded the product of formal cf3i oxidative addition 3a in 1 h in good yield (eq 2 and table 1). both the cf3 and pcy3 ligands (doublet at = 24.5 and quartet at = 25.6 in the f and p nmr spectra, respectively) provide diagnostic nmr signals (table 2). the substantial coupling (jp f = 63 hz) between fluorine and phosphorus are characteristic of a trans relationship between the cf3 and phosphine ligands. x - ray analysis of crystals of 3a confirmed this stereochemical relationship around the square planar au(iii) (figure 1a); other than the homoleptic anion , complex 3a contains a rare example of a crystallographically characterized au(iii)cf3 bond. complex 3a is not only stable to air and water but can be purified by column chromatography as well.2 (a f) thermal ellipsoid representations of 3a3d, 12a, and 12b at the 50% probability level. atoms are color - coded: gray (carbon), yellow (fluorine), gold (gold), purple (iodine), orange (phosphorus). the reaction of 1a and cf3i represents a rare oxidation of au(i) to au(iii) that directly installs potentially reactive au(iii)carbon bonds. during our attempts to monitor the oxidative addition by f nmr , we found that no reaction occurred when the reaction mixture was placed inside the dark nmr spectrometer. however, when the reaction mixture was exposed to ambient fluorescent light for 5 min, the formation of 3a was detected (20%). given the reliance of numerous methods on cf3i as a trifluoromethyl source, we investigated its photochemical reactivity. actinometry experiments were carried out to determine the overall quantum yield, using the norrish ii fragmentation of valerophenone as a standard. the oxidative addition of cf3i to 1a was complete after 20 s of irradiation by a hg vapor lamp (2 mm aq . k2cro4 optical filter ; transmittance max = 313 nm), while the fragmentation of valerophenone (= 1) took place over 24 h under identical conditions. this rate difference, in addition to the ability of ambient light to bring the reaction to full conversion over variable reaction times (between 15 min and 1 h), supports a radical chain reaction as the mechanism of au(i) oxidation by cf3i. the reaction of excess cf3i and 1a is also fast in thf, but the conversion is never greater than 65% (52% yield of 3a), even when irradiated by a hg vapor lamp for 1 h (vida infra). notably, an excess of fluoroform (hcf3) is generated in thf, regardless of the light source (only dcf3 is formed when thf - d8 is used). gc - ms analysis of reaction mixtures reveals several products of thf oxidation, likely formed by h abstraction by cf3. several control experiments, using hcf3 production relative to a standard as a probe to detect cf3 generation, support the involvement of au(i) during the initiation of the chain reaction. the uv absorption of cf3i is centered at 270 nm but tails beyond 350 nm. when irradiated at 313 nm, cf3i undergoes fast, reversible c however, in the absence of 1a, only negligible amounts of hcf3 are observed when thf solutions of cf3i are irradiated for 30 min, indicating that carbon / iodine radical recombination is substantially faster than h abstraction from thf. similarly insignificant quantities of hcf3 are observed when 20 equiv (relative to cf3i) of the h donors 1,4-cyclohexadiene, 9,10-dihydroanthracene, or triphenylmethane are added (figure 2a). additionally, cy3pau(2-(ch2ch = ch2)c6h4 ) , containing a pendent olefin to either capture a putative au(ii) intermediate and/or cf3, is fully consumed upon irradiation in the presence of excess cf3i (figure 2b). this oxidation affords multiple au(iii) products of indiscriminate cf3 addition to the terminal olefin and gold atom (and hcf3 when thf is used as solvent) (see si). because 2-allylbromobenzene does not react with cf3i when irradiated under similar conditions (no hcf3 is observed after 5 min, and less than 2% after 30 min) , we conclude that the au(i) aryl complex is necessary for chain initiation. these are also consistent with an initiation mechanism involving , which generates iodide and cf3 following c i bond homolysis. control experiments to assess involvement of au(i) in the initiation of the radical chain mechanism. (a) irradiation of cf3i solutions containing h donors to detect cf3h in the absence of gold. (b) radical trapping using an olefin with and without a pendant gold center. we envisioned two possible initiation mechanisms for generating cf3 as a propagating species from in a chain reaction: initial photoexcitation of 6 followed by electron transfer to cf3i, or initial photoexcitation of cf3i followed by electron transfer from 6 (scheme 1). au(i) aryl complexes are well - known chromophores, and their photophysical properties have been investigated previously. while 1a absorbs weakly above 310 nm (the cutoff for many laboratory fluorescent lamps), excitation at 320 nm (= 37 m cm) in a weak, broad luminescence from 340 to 460 nm, classified as fluorescence based on the lifetime of excited species 1a * (< 10 ns, quantum yield of fluorescence = 0.03). despite the short lifetime of 1a *, cf3i effectively quenches its fluorescence (stern volmer quenching constant ksv = 30 m, figure 3). although this energy transfer could conceivably generate cf3 and initiate a chain reaction (mechanism 1, scheme 1), when cf3i is removed from fluorimetry samples under vacuum, fluorescence is restored to the same intensity prior to introduction of the gas, indicating that consumption of au(i) has not occurred. volmer plots of fluorescence quenching of 1a by different concentrations of cf3i (blue boxes) and au(iii) complex 3a (blue triangles) in ch2cl2. concentrations of au(iii) are in mol / l and cf3i concentrations are in mmol / l. surprisingly, fluorescence quenching by the au(iii) complex 3a is more than 2 orders of magnitude more effective (ksv = 4270 m) than quenching by cf3i (figure 3). if propagating species terminate frequently, some critical concentration of au(iii) product exists that may impede productive energy transfer from an excited species, halting reinitiation of the chain reaction. in light of puddephatt s report, au(i) alkyl complexes, such as me3paume, clearly react with cf3i. however, there is no mention of the dependence of light on this process, although if the reaction is photoinitiated, mechanism 1 would seem especially unlikely given the absence of a chromophoric aryl ligand in puddephatt s examples. to test this hypothesis, we irradiated cy3paume in the presence of cf3i (scheme 2). while 9 does not absorb above 300 nm (see si), the reaction is quantitative in cd2cl2 when irradiated with ambient light, and does not proceed in the dark. the oxidized product is unobservable, eliminating ch3i to generate cy3paucf3 at room temperature. in thf, the reaction generates excess hcf in thf3, presumably also from solvent h abstraction by cf3. if initiation mechanism 2 is operative, then cf3 could be generated by irradiating cf3i solutions containing electron donors other than au(i), such as phosphines (scheme 3). indeed, irradiation of pme3 or pcy3 in the presence of cf3i in formation of i (10a, jp consistent with quenching of * by au(iii), the oxidation of pcy3 in thf stalls at roughly 45% conversion (by p nmr) in the presence of 25 mol % au(iii) complex 3a. pph3 does not react with cf3i (eq 3), presumably due to its lower oxidation potential relative to pme3 and pcy3. when pcy3 and pph3 are irradiated together with cf3i, only pcy3 is consumed, suggesting that pph3 neither initiates the chain nor reacts with cf3 during propagation. contrary to our initial hypothesis that bulky phosphine ligands prevent aryl group transfer upon au(i) oxidation, we found that ph3pau(4-f - c6h4) (11a) undergoes quantitative photoinitiated reaction with cf3i in cd2cl2 to generate 12a (eq 4). since pph3 is unreactive toward cf3i, oxidation of 11a can not be initiated by small amounts of dissociated pph3 (we can not disprove the analogous mechanism for pcy3-supported complex 1a .) complex 12a was characterized by x - ray crystallography and shown to be isostructural to 3a (figure 1b).3 on the basis of these , we propose that while photoexcited * undergoes rapid c i bond homolysis and recombination, it also oxidizes au(i) aryl and alkyl complexes by accepting electrons into a low - lying somo to generate radical anion (mechanism 2, scheme 1). homolysis of the c i bond of generates iodide and cf3, which oxidizes (r3p)aur to au(ii) intermediate 7. iodine atom abstraction of cf3i by 7 affords au(iii) complex 8 and regenerates cf3. in thf, oxidation of 6 by cf3 is competitive with solvent h abstraction to make hcf3 and terminate the radical chain. at sufficiently high concentrations, the au(iii) product quenches * before it can reinitiate the radical chain reaction promisingly, the photoinitiated oxidative addition of cf3i is general for electronically diverse complexes of the type cy3pau(aryl) (tables 1 and 2). the ing au(iii) products (see figure 1 for their crystallographic analyses) can be purified by chromatography on silica. complex 1b (aryl = 3,5-f2-c6h3), which is more electron - deficient than 1a (aryl = 4-f - c6h4), reacts smoothly with cf3i to afford 3b. while complexes with more electron - rich ligands such as 1c (aryl = c6h5) and 1d (aryl = 4-me - c6h4) also react with cf3i to afford 3c and 3d, respectively, the most electron - rich complex 1e (aryl = 4-meo - c6h4) decomposes to au nano particles and several cf3-containing au(iii) complexes in solution and solid state (no products of caryl au(iii) product 3e is detectable, however, and its decomposition can be slowed substantially by addition of mecn upon concentration of the reaction, allowing its solution - state characterization. the mechanism of decomposition has not yet been identified, although we speculate that the electron - rich arene may encourage pcy3 dissociation at room temperature and subsequent aryl group transfer. the complex 1f (aryl = 2-me - c6h4) does not react with cf3i at all, suggesting that cf3i oxidative addition is sensitive to the sterics of the aryl ligand and that relaxation of * is faster than oxidation of the metal center to initiate the radical chain. unsurprisingly, no hcf3 is observed when 1f is irradiated in thf for 20 min. cf3 reductive eliminations from au(iii). to our surprise, 12a undergoes quantitative caryl i reductive elimination in toluene - d8 at 110 c to afford 4-fluoroiodobenzene and ph3paucf3 over 20 min (scheme 4). this process is highly sensitive to free phosphine, stalling completely in the presence of pph3 (0.1 or 1.0 equiv) at 110 c for 12 h. treatment of 12a with pph3-d15 at room temperature in immediate formation of 12a - d15, presumably via an associative process. more electron - rich aryl ligands, such as 4-methylphenyl (12b), do not significantly affect the relative rates of caryl i and caryl cf3 reductive elimination (scheme 4). at 110 c, complex 12b undergoes mostly caryl i reductive elimination within 10 min to afford 4-methyliodobenzene. both caryl i and caryl cf3 reductive eliminations are also completely inhibited in the presence of pph3 (0.1 or 1.0 equiv), while pph3-d15 reacts immediately at room temperature to afford 12b - d15, also via associative ligand exchange. these observations are consistent with a mechanism involving highly reversible pph3 dissociation from 12a and 12b, followed by slow caryl , the behaviors of 12a and 12b are similar to au(iii)alkyl complexes studied by kochi, which not only reductively eliminate calkyl calkyl bonds between 70 and 100 c via a dissociative mechanism but also undergo associative ligand exchange at ambient temperature with excess phosphine. unsurprisingly, analogous pcy3-stabilized complexes 3a and 3d are stable at 110 c for at least 12 h, presumably due to the greater -donating ability of pcy3 relative to pph3. phosphine exchange with excess p(n - bu)3, pbn3, or pcy3 does not occur even at these temperatures, precluding not only the lower - barrier associative exchange mechanism observed with the pph3-supported systems (attributed to the larger cone angle of pcy3 relative to pph3), but also pcy3 dissociation to form a three - coordinate complex. because caryl i reductive elimination is significantly faster than caryl cf3 reductive elimination, a cycle for gold - catalyzed trifluoromethylation must necessarily involve iodide abstraction from the au(iii) product of cf3i oxidative addition. despite the apparent kinetic stabilities of the au(iii) complexes 3a3e, 12a, and 12b, they all undergo quantitative caryl cf3 reductive elimination in less than 1 min upon treatment with agsbf6at room temperature. to consider the effects of the phosphine ligand on the silver - mediated caryl cf3 reductive elimination of au(iii), we used variable - temperature nmr to follow the reductive elimination from 3a and 12a in the presence of agsbf6. pcy3-substituted complex 3a undergoes very fast (quantitative conversion in less than 1 min) caryl cf3 reductive elimination at 10 c, while the analogous pph3-stabilized 12a reacts similarly fast at room temperature (eq 5). at lower temperatures, several bridging species (most likely dimers) are observed by f nmr upon halide abstraction in both cases. if caryl cf3 bond reductive elimination can only occur from a monomeric three - coordinate intermediate, then 12a might be expected to undergo slower reductive elimination due to slower dimer dissociation and/or a dimer monomer equilibrium that more favors the dimer, based on the smaller cone angle and weaker -donation of pph3 relative to pcy3.5 these reported herein support the oxidative addition of cf3i to au(i) via a photoinitiated chain reaction. the reactions are fast at room temperature for both au(i) aryl and alkyl complexes. aryl - cf3 reductive elimination is typically a high - barrier process but occurs in seconds at room temperature from a au(iii) cation. the au(i)aryl species may be regenerated via one of the numerous transmetalation strategies available involving carbon nucleophiles. for instance, excess (4-f - c6h4)snme3 (10 equiv) undergoes fast, quantitative transmetalation with sbf6 at room temperature to afford 1a, thereby closing a hypothetical catalytic cycle based on the three elementary steps shown in scheme 5. silver - free halide abstraction from au(iii) complexes could conceivably enable a practical and mild cycle for gold - catalyzed trifluoromethylation of aryl nucleophiles, although deleterious reactions between starting material and metalloradical intermediates and cf3 must be mitigated, as well as competitive aryl aryl homocoupling. while we initially set out to probe caryl cf3 reductive elimination at au(iii), we also explored the oxidative addition of cf3i to au(i), a process with potential implications beyond gold chemistry. the possibility of photoinitiated oxidation of transition metals or main group elements by cf3i should not be discounted in methods employing this reagent as a trifluoromethyl source, particularly since ambient fluorescent laboratory lighting is sufficient to initiate a chain in the presence of a suitable reductant. the presented also suggest that substrate photoexcitation may provide a low - barrier avenue to kinetically challenging oxidative additions by au(i), providing access to potentially reactive au(iii) complexes.

herein we report the mechanism of oxidative addition of cf3i to au(i), and remarkably fast caryl cf3 bond reductive elimination from au(iii) cations. cf3i undergoes a fast, formal oxidative addition to r3paur (r = cy, r = 3,5-f2-c6h4, 4-f - c6h4, c6h5, 4-me - c6h4, 4-meo - c6h4, me ; r = ph, r = 4-f - c6h4, 4-me - c6h4). when r = aryl, complexes of the type r3pau(aryl)(cf3)i can be isolated and characterized. mechanistic studies suggest that near - ultraviolet light (max = 313 nm) photoinitiates a radical chain reaction by exciting cf3i. complexes supported by pph3 undergo reversible phosphine dissociation at 110 c to generate a three - coordinate intermediate that undergoes slow reductive elimination. these processes are quantitative and heavily favor caryl i reductive elimination over caryl cf3 reductive elimination. silver - mediated halide abstraction from all complexes of the type r3pau(aryl)(cf3)i in quantitative formation of ar cf3 in less than 1 min at temperatures as low as 10 c.

despite technical advancement of various imaging modalities, it is still impossible to differentiate benign and malignant pancreatic lesions by the images only. for tissue acquisition to differentiate pancreatic lesions, endoscopic ultrasound - guided fine needle aspiration (eus - fna) is the procedure of choice with high accuracy and low complication rate. pooled sensitivity and specificity of eus - fna in the diagnosis of etiology of solid pancreatic mass was 86.8% and 95.8%, respectively, in a meta - analysis.1 although eus - fna shows high diagnostic accuracy in patients with suspected pancreatic carcinoma, the rate of acquiring indeterminate cytologic findings is still up to 10.9%.2 endosonographer face difficulties when cytology of eus - fna is inconclusive while malignancy is highly suspicious in clinical presentation. although eus is minimally invasive, very safe and accurate technique for tissue diagnosis, sometimes endosonographers get nondiagnostic eus - fna . after obtaining specimen by eus - fna , cytopathologist reads the sample and classifies them into inadequate, benign / reactive, atypical, suspicious, and/or malignant. problems of eus - fna are inconclusive and diagnostic errors including false positive and false negative. the reasons for those problems stem from the various situations such as failed puncture, successful puncture but obtained inadequate sample material, or successful puncture, obtained adequate sample material but cytology was negative for malignancy. there are several options. in the first place, clinical observation and follow - up with serial imaging one study showed that about 30% of patients with negative or nondiagnostic eus - fna were finally able to be diagnosed as pancreatic cancer later.3 in that situation, visible predictors of malignancy on the eus were vascular invasion or lymphadenopathy.3 when pancreatic cancer is clinically suspected, careful short - term follow - up with eus or other imaging modalities is very risky. next, surgical exploration with blind pancreatic resection or chemoradiation therapy without definitive tissue diagnosis may be an option. when endosonographers get negative or nondiagnostic eus - fna while pancreatic cancer is highly suspicious clinically, the most beneficial next step for the patient should be sought. alternative diagnostic tools would be chosen to get tissue for diagnosis, such as bile duct brushing with endoscopic retrograde cholangiopancreatography (ercp) or computed tomography (ct)-guided biopsy. however, ercp with brushing is associated with postprocedural complications such as pancreatitis and ct - guided biopsy bears the risk of intraperitoneal spread. one study compared alternative methods which can be utilized for tissue sampling when pancreatic cancer is suspicious.4 ercp with brushing showed low sensitivity and surgical biopsy showed very high complication rate. ct or abdominal ultrasound - guided percutaneous approach showed high rate of failure compared with eus - fna. considering that all of these options have some concerns and/or risks, retrial of eus - fna can also be a reasonable option. if we can change one of the components of eus - fna, we can anticipate different of repeated eus - fna. factors that can influence the of eus - fna related with lesion are location, characteristics and size. as to location, pancreatic head and uncinate are even more difficult area.5 though we can not change the location of the lesion, sometimes we can approach pancreatic head through the stomach, rather than the duodenum to get a better . characteristics of the lesion are also an important factor. if there is pancreatitis, or extensive necrosis of the mass, it is difficult to get a good from eus - fna.6 we may try to target different area of the lesion to get a better . accuracy of eus - fna increases as the size of the pancreatic mass increases.7 however, one interesting study suggests that repeated eus - fna can improve diagnostic yield even in small pancreatic masses.8 they evaluated the role of repeated eus - fna for small pancreatic mass with previous indeterminate and negative cytology. from january 2004 to october 2006, 47 eus - fna was done for pancreatic mass of less than 3 cm in size. initial eus - fna were 17 malignancies, 21 benign, and nine indeterminate. repeated eus - fna for these nine indeterminate cases ed in six malignancies, one benign, and two indeterminate. again, eus - fna was done for these two indeterminate cases and one malignancy was proved. as a consequence, initial diagnostic accuracy of eus - fna 83% was increased up to 96% by repeated eus - fna. regarding equipment, ultrasound processor with better resolution can give us better view of targeting the lesion, but there is no study comparing the efficiency of ultrasound processor for eus - fna. there is suggestion that newly developed forward viewing echoendoscope may be helpful to puncture difficult lesions such as uncinate process or head of the pancreas.9 there will be articles about eus - fna needles in this issue of clinical endoscopy. eus - fna is a technically demanding procedure with a steep learning curve.10 this means that the of eus - fna may be very operator - dependent. according to guidelines for credentialing and granting privileges for eus by american society for gastrointestinal endoscopy, minimum of 150 supervised cases is recommended for competency of eus. to perform eus - fna, at least 25 supervised eus - fna is recommended.11 but a study showed that the rate of positive yield of eus - fna is increasing after 20, 30, 40 eus - fna procedures.12 after looking at the learning curve of 300 consecutive eus - fna procedures, a study suggested that even after 45 eus - fnas during fellowship, more procedures are needed to gain proficiency and efficiency with eus - fna. these studies teach us that the yield of eus - fna depends on the experience of endosonographer.13 a well - trained cytopathologist is an essential element of successful eus - fna procedure and presence of on - site pathologist in the endoscopy suite and rapid on - site cytopathological examination are very helpful to get adequate specimen. on the other hand , an interesting study revealed that cytopathologists' expertise could impact the diagnostic accuracy of eus - fna . in that study, local cytopathologists mailed the eus - fna slides of difficult cases to expert cytopathologists. diagnostic sensitivity and accuracy were 72% and 75% for local cytopathologists, respectively, and 89% and 88% for expert cystopathologists, respectively.14 when eus was repeated for a similar clinical indication at a tertiary - referral center, a significant clinical impact was observed in 63% of the patients.15 repeated eus at the same center with various indications, also ed in change of further management plan in 72% of the patients.16 from those , we might expect that repeated eus - fna by expert at another center or by the same endosonographer with different setting can give successful as the cases of colonoscopy or ercp maybe successfully performed on the previously failed procedure. a study reported overall accuracy of second eus - fna as 84%.6 twenty four repeat eus - fna were done in the study center and second eus - fna proved malignancy in 46% of the cases. eight out of 10 atypical / suspicious cases with initial eus - fna confirmed malignancy. surprisingly, two out of 10 benign initial eus - fna cases changed diagnosis to malignancy and two malignancy cases were confirmed as benign. another researcher performed repeat eus - fna 3 weeks later, when initial eus - fna was indeterminate for solid pancreatic lesion. the proved that 78% (7/9) of the patients with indeterminate cytology had malignancy.8 when eus - fna was performed in 62 cases of repeated eus, 82% of patients (47/62) among them had inconclusive cytology with previous eus - fna, 73% cases (45/62) were prevented from undergoing further diagnostic work - up.16 there is a retrospective study that evaluated repeated eus - fna performed in 15 cases including eight pancreatic mass and seven unknown intra - abdominal lymphadenopathy. second eus - fna proved malignancy in 60% of the cases and overall accuracy of second eus - fna was 92.9%.17 mean while, there is a study of low diagnostic yield of repeat eus - fna. twenty eight repeat eus - fna were done when pancreatic cancer was suspected but prior eus - fna were non - diagnostic. repeating eus - fna is a reasonable choice. repeated eus - fna may impose substantial clinical impact with low risk. in clinical practice, repeated eus - fna is useful when the initial eus - fna of a suspected tumor is nondiagnostic. repeat eus - fna should be considered especially if predictors of malignancy, such as vascular invasion or lymphadenopathy, are visible on the eus.

for tissue diagnosis of suspected pancreatic cancer, endoscopic ultrasound - guided fine needle aspiration (eus - fna) is the procedure of choice with high safety and accuracy profiles. however, about 10% of cytologic findings of eus - fna are inconclusive. in that situation, careful observation, surgical exploration, or alternative diagnostic tools such as bile duct brushing with endoscopic retrograde cholangiopancreatography or computed tomography - guided biopsy can be considered. however, some concerns and/or risks of these options render repeat eus - fna a reasonable choice. repeated eus - fna may impose substantial clinical impact with low risk.

this study examined the changes in cellular glucose uptake induced by 2,3,7,8 tetrachlorodibenzo - p - dioxin (tcdd) as measured by quantification of intracellular radioactivity in the nih 3t3 l1 preadipocyte cell line after a 30-minute incubation with the non - metabolizable radioactive analogue of glucose, 3-o - methyl - d- glucose. treatment of differentiated nih 3t3 l1 cells with tcdd produced a time- and dose - dependent decrease in the cellular uptake of glucose. treatment of cells for 3 hr with 10(-8) m tcdd significantly reduced glucose uptake to about 10% of control values (p < /= 0.05). furthermore, cytochalasin b, a specific inhibitor of facilitative glucose transporter proteins totally abolished the portion of glucose transport activity that is sensitive to tcdd. the role of the ah receptor in tcdd - mediated reduction in glucose uptake was investigated. pretreatment of 3t3 l1 cells with the ah receptor blocker 4,7-phenanthroline antagonized the effect of tcdd on glucose uptake. structure - activity relationship studies with tcdd and two polychlorinated biphenyl (pcb) congeners revealed a rank order for their potency in the inhibition of glucose transport as follows: tcdd < < 3,3',4,4' tetrachlorobiphenyl < 2,2',5,5' tetrachlorobiphenyl (tcb). such a rank order correlates both with previously determined biological activity of tcdd and the more active 3,3',4,4'- and less active 2,2',5,5'-tcb and with affinity for binding to the ah receptor. the thyroid hormone t4, like tcdd, reduced glucose uptake and blocked the action of tcdd to further reduce glucose uptake. experimental evidence is consistent with a proposed mechanism for tcdd to reduce the titer of functional glucose transporter proteins through its interaction with the ah receptor.imagesp454-afigure 1.figure 2.

a technique known as the colony overlay procedure for peptidases (copp assay) was previously developed as the first test to enumerate total vibrionaceae in shellfish, seawater, and well water. this assay has been recommended for use in monitoring molluscan shellfish and for potentially regulating their harvest based on the levels of total vibrionaceae. this total vibrionaceae approach is similar in concept to traditional sanitary surveys of shellfish harvesting areas, which are based on the total number of fecal coliforms or e. coli present in either the shellfish or their surrounding waters. in the original copp assay, a substrate, l - lysyl-7-amino-4-trifluoromethylcoumarin (l - lys - afc), is bound to a cellulose acetate membrane and the membrane is overlaid for 10 minutes onto an overnight culture grown on nonselective agar media. a lysyl aminopeptidase that is present in all vibrionaceae family members tested to date cleaves the substrate to produce fluorescent foci on the membrane when viewed under longwave uv. in the present study, we extended this overlay concept to produce similar assays for total and fecal e. coli. these assays are based on the presence of -glucuronidase (gud) activity, which is found in most non - o157:h7 e. coli and in cleavage of the substrate 4-methyl--d - glucuronide (mug) into the fluorescent 4-methylumbelliferone. mug - based fluorescence assays for e. coli have been previously developed for food and water. mug - based assays of foods and particularly molluscan shellfish often involve the most probable number (mpn) procedure, which is labor intensive, relatively costly, and requires up to three days for to be obtained. consequently, simpler, more rapid, less expensive, and more direct enumerative procedures are needed to monitor for total and fecal e. coli, particularly in perishable foods, like shellfish. in this study , we report on simple membrane overlay methods to separately enumerate total e. coli (capable of growing at 37c), fecal e. coli (capable of growing at 44.5c), and total vibrionaceae (capable of growing at 37c), and a fourth multiplex method to enumerate total e. coli and total vibrionaceae simultaneously. these methods are applicable for use in monitoring the presence of these organisms in shellfish and other foods, water, and environmental samples. stock cultures consisted of 37 strains of non - o157:h7 e. coli, as described in table 1, and 22 enterobacteriaceae within the genera citrobacter, klebsiella, pseudomonas, salmonella, shigella, serratia, and yersinia (table 2). human pathogenic vibrios consisted of v. cholerae o1 and v. vulnificus (vv1003), as previously described, and v. parahaemolyticus o3:k6, a pandemic strain obtained from e. fidelma boyd at the university of delaware, newark, delaware. eastern oysters (crassostrea virginica) were obtained from a commercial source in rhode island and from a tidal river at the university of delaware marine laboratory in lewes, delaware. the oysters were naturally contaminated with low levels of e. coli and moderate levels of vibrionaceae. they were collected principally during the warm, summer months when vibrionaceae were present in the water column. seawater was also obtained from the university of delaware marine laboratory during the summer. the mpn procedure using mug in the ec broth tubes was performed on dilutions of pure cultures and on seawater and oyster homogenates according to the protocol published in the u.s. the mug membrane overlay procedure was developed and its specificity was determined using e. coli serotypes and other enterobacteriaceae as listed in tables 1 and 2. the bacteria were grown in tryptic soy broth (becton, dickinson and co., sparks, maryland) supplemented with an additional 0.5% nacl (1% total nacl) and were streaked onto 100 mm plates of tryptic soy agar (becton, dickinson and co.) containing a total of 1% nacl (tsa - n) using a flamed and cooled metal triangle. plates were incubated overnight (~18 hours) at 37c. after culture incubation, cellulose chromatography papers (whatman international, maidstone, uk) or whatman no. 1, 4, or 54 cellulose filter paper discs (referred to as cellulose membranes) were cut to the desired size (of the petri dish or colonies to be overlaid) and soaked in 20 mm tris buffer, ph 8.0 containing 50 mg / l mug for about 10 seconds. excess buffer was allowed to drip from the membranes for 5 seconds, and the membranes were overlaid onto colonies growing on the surface of the tsa - n plates. unused substrate was retained at 4c for future use and has a shelf life of several weeks. membranes were removed with forceps and placed in empty petri dishes and examined for fluorescent foci using either a hand - held uv lamp at a wavelength of 364 nm or a uv light box at the same wavelength. alternatively, membranes could be viewed with the hand - held uv lamp while still overlaying the colonies. the copp assay was performed with cellulose acetate membranes as previously described or with cellulose chromatography paper (whatman international). in essence, a substrate l - lysyl-7-amino-4-trifluoromethylcoumarin (l - lys - afc ; cat . afc-008, mp biomedicals, salon, oh) was dissolved in dimethylsulfoxide (dmso) to 20 mm (2140 l of dmso to 25 mg of l - lys - afc) and the stock was stored at 20c until needed. a 250 m substrate working solution was prepared by combining 25 l of thawed substrate and 2 ml of 20 mm tris, ph 9.0. substrate stock solution may be refrozen and thawed multiple times without appreciable deterioration of the substrate. a cellulose acetate membrane or a plain cellulose membrane (chromatography paper) was cut to the desired size and placed in the working solution for 1015 seconds. the membrane was lifted with forceps, allowed to drip excess fluid for 5 seconds, and overlaid onto overnight bacterial colonies grown at 37c on tsa - n plates. each membrane was removed from the plate, placed in a clean petri dish, immediately viewed under longwave (364 nm) uv, and fluorescent foci were counted. alternatively, the foci could be visualized with a hand held uv lamp while the membrane was still covering the colonies. the appearance of bright white or pale blue fluorescence on cellulose acetate membranes or green fluorescence on cellulose chromatography paper signifies the presence of a lysyl aminopeptidase, which cleaves the substrate. positive controls consisted of v. cholerae, v. parahaemolyticus, and v. vulnificus and were propagated at 37c. the overlay of enterobacteriaceae was also performed at 37c for 10 minutes to determine if any of the species contained a lysyl aminopeptidase activity similar to that found in the vibrionaceae. a method to simultaneously detect total vibrionaceae and total e. coli was evaluated using cellulose chromatography paper that was soaked in 20 mm tris, ph 8.0 containing 250 m l - lys - afc and 50 mg / l mug. oysters were either 1: 10 homogenates or dilutions of the homogenates that were prepared in 0.1% peptone buffer. plates were prepared using 100 l of each homogenate or dilutions of the homogenates, which were spread over tsa - n plates with a flamed and cooled metal triangle. after overnight incubation at 37c, membranes containing both substrates were overlaid onto the culture plate. vibrionaceae were enumerated in situ after 10 minutes followed by the enumeration of mug - positive (gud - positive) colonies after an additional 20 minutes (30 minutes total). it was anticipated that total e. coli could be easily distinguished from total vibrionaceae based on the color of the fluorescent foci. forty - three principally food - borne outbreak strains of e. coli o157:h7 were screened for gud activity by both the mpn - mug assay and by the mug overlay of colonies that were grown on tsa - n and incubated at 37c for 2 hours followed by 44.5c overnight. plates were overlaid for 30 minutes and the membranes were viewed on a uv light box. oysters and seawater were screened by the membrane overlay assay for total e. coli and total vibrionaceae and by multiplex assays for both by spread plating 100 l of a 1: 10 or 1: 100 oyster homogenate, prepared in 0.1% peptone buffer, or 100 l of undiluted seawater onto tsa - n plates. the plates were allowed to incubate at either 37c for total e. coli and total vibrionaceae overlays or at 37c for 2 hours followed by 44.5c overnight for e. coli overlays using cellulose membranes containing mug and copp separately and combined. samples were occasionally plated in duplicate and one plate incubated at 37c for the multiplex assay of total vibrionaceae and total e. coli while the other plate was incubated at 37c for 2 hours and then at 44.5c overnight for fecal e. coli enumeration. initial tests showed that overnight colonies of e. coli growing on tsa - n plates could be overlaid with cellulose membranes (chromatography paper or whatman no . 1, 4, or 54 filter paper discs) soaked in mug to produce strong blue fluorescent foci on the membranes, corresponding with the site of contact between the colony and the membrane. comparable were obtained regardless of which type of membrane was used. consequently, we selected the chromatography paper to perform mug overlays throughout this study. an evaluation of substrate concentrations showed that strong fluorescence intensity was achieved when membranes were saturated in 50 mg / l mug. membranes were incubated for 1560 minutes, and then viewed for fluorescent foci in situ with a hand - held uv lamp, or the membrane could be removed to a petri dish and viewed with the hand - held uv lamp or placed on a uv light box for viewing. optimal were obtained after a 3060-minute overlay and 30 minutes was selected for the remainder of the study. in contrast, colonies to be screened for total vibrionaceae by the copp assay were saturated in 250 m of l - lys - afc and overlaid for only 10 minutes to preclude weak enzyme activity, which is present in some enterobacteriaceae and other non - vibrionaceae, from producing false positive fluorescent foci. figures 1(a)1(d) show mug and copp fluorescence on cellulose membranes after overlaying colonies of three serotypes of non - o157: h7 e. coli (top row in each panel) and three vibrionaceae (bottom row in each panel). edges of the foci are not distinct and sharp, but somewhat fuzzy because enzyme activity is via diffusion of the enzymes within the membranes. examples of representative mug fluorescence on the membranes are shown for total e. coli that had been incubated at 37c overnight and overlaid for 30 minutes with mug - containing membranes (figure 1(a) ), and for fecal e. coli grown at 37c for 2 hours, incubated overnight at 44.5c, and overlaid for 30 minutes with a mug membrane (figure 1(b) ). these same vibrios are strongly copp positive after overnight incubation at 37c and overlay for 10 minutes with l - lys - afc, producing green fluorescence on cellulose membranes, as depicted in figure 1(c). very weak copp fluorescence is occasionally observed in the e. coli (arrow, figure 1(c) ), and such foci should not be counted as vibrionaceae because of the weak signal. this fluorescence may be minimized by enumerating the foci immediately after the 10-minute overlay. of the multiplex assay on cultures incubated at 37c overnight, followed by a 30-minute overlay with mug and l - lys - afc (combined) are shown in figure 1(d) with blue fluorescence from the e. coli on the top row and green fluorescence from the vibrios on the bottom row. the arrow in figure 1(d) indicates the blockage of uv light from an opaque colony of v. parahaemolyticus which inadvertently transferred to the membrane and blocked the passage of the uv light from the light box through the membrane. such transfer of opaque colonies to the membranes occasionally occurs and appears to be a function of the stickiness of the colony. in such cases, foci may be readily observed by holding a hand - held uv lamp on the opposite side of the membrane (the side without the opaque material). the mug overlay and the mpn - mug assays were compared for 37 strains of e. coli (non - o157:h7). twenty - four (65%) of the 37 strains were positive by the mug overlay and 23 (62%) were positive by the mpn - mug assay; however, four colonies that were mug - negative by overlay were positive or weakly positive by the mpn - mug method, specifically strains o14:nm, o42:h2, o103:h2, and o111:nm (table 1). likewise, five isolates that were mug - negative according to the mpn - mug method were positive by the overlay method, specifically one each of the o4:nm and o26:h11 strains, and o78:h11, o91:h, and o91:h14 (table 1). mpn - mug often gave weak fluorescence signal (listed as in table 1). repeat assays of these isolates showed variability in the perceived fluorescence intensities for those cultured in mpn - mug media. no variability was seen on the overlays, which consistently produced bright blue foci. copp overlays of these cultures were performed for 10 minutes with readings taken immediately after overlay, and weakly positive were obtained for four of the isolates (table 1). differentiation of the shigella spp. was possible using individual mug and copp assays where one sh. boydii was both mug and copp positive, sh. flexneri was both mug and copp negative, sh. dysenteriae was mug negative and copp positive, and sh. sonnei was mug positive and copp negative with cultures propagated at 37c (table 2). shigella boydii, sh. dysenteriae, and y. enterocolitica were copp positive indicating an enzyme analogous to the lysyl aminopeptidase that was found in vibrionaceae family members. this is the first time we detected strong copp positive colonies associated with bacteria that were unrelated to the vibrionaceae. forty - three e. coli o157:h7 strains were tested in triplicate and were mug negative by both the overlay and mpn - mug assays (data not shown). it is well known that o157:h7 strains lack gud activity and are therefore mug negative with few exceptions. membranes simultaneously soaked in mug and l - lys - afc were used in a multiplex format to detect total e. coli and total vibrionaceae on plates that were grown overnight at 37c (figures 1(e) and 1(f) ). in the multiplex assay of oyster homogenates, green and dark blue foci are obtained for vibrionaceae and total e. coli, respectively, when incubated at 37c (figures 1(e) and 1(f) ). for accurate enumeration, fluorescent foci must be counted in stages. membranes were incubated for 10 minutes on the plates and viewed with a hand - held uv. green fluorescent foci, representing the vibrionaceae colonies, were counted immediately, to avoid low levels of enzymes in some non - vibrionaceae from leading to false positive . the plate was then incubated for an additional 20 minutes or longer at 37c for blue fluorescence development, which is indicative of colonies of total e. coli. for illustration purposes only , membranes shown in figures 1(e) and 1(f) were illuminated on a uv light box and photographed after a 30-minute overlay, which was sufficient to give bright blue fluorescence from the gud - positive colonies but was longer than recommended for accurate vibrionaceae enumeration. simultaneous detection is only practical if countable levels of total e. coli and total vibrionaceae are present on the same dilution plate, although figures 1(e) and 1(f) demonstrate the ease with which total e. coli colonies may be identified, even on crowded plates. multiplex assays are not appropriate for cultures incubated at 44.5c, since many vibrionaceae may not grow at elevated temperatures. one exception was our v. cholerae o1 which produced typical copp fluorescence when grown at 44.5c. if total vibrionaceae and total and fecal e. coli enumeration are desired for a sample, duplicate plating allows one plate to be incubated at 37c for total vibrionaceae and total e. coli while the other plate is incubated at 37c for 2 hours and then at 44.5c overnight for fecal e. coli enumeration. the 2 hours incubation at 37c constitutes a resuscitation step, as oysters may contain stressed bacteria which need to be resuscitated. higher e. coli counts were obtained in our assays when the resuscitation step was employed. from a safety standpoint, the mug assay offers additional protection against pathogens, by detecting some strains of salmonella and shigella which were mug positive and could grow at 44.5c, specifically, s. montevideo, sh. seawater produced bacterial colonies that gave a fluorescence signal comparable to that found in oyster homogenates for total and fecal e. coli and total vibrionaceae; however, the levels of bacteria were generally 10- to 100-fold less than in filter - feeding molluscan shellfish, which bioconcentrate bacteria from the seawater within their edible tissues. by definition, fecal coliforms, including fecal e. coli, are gram - negative bacteria which ferment lactose with the production of acid and gas at 44.545.5c. such organisms are indicative of human gut bacteria and can be used as indicators for the possible presence of human fecal pathogens in foods and water. the mpn procedure capitalizes on the use of lactose - containing media, the collection of gas, and growth at 44.545.5c, so that positive isolates meet the classical definition for fecal coliforms. mpn - mug procedures use mug as an indicator for the presence of e. coli, since e. coli are the primary producers of gud at these elevated temperatures; therefore, positive mpn in the presence of mug are considered confirmatory for the presence of e. coli. current mpn assays for total and fecal coliforms, or e. coli, are tedious, costly, and time consuming. the incorporation of mug into ec broth for the mpn detection of e. coli has hastened the analysis over previous mpn methods but is still complex and produces false positives which can compromise . according to the u.s. food and drug administration's bacteriological analytical manual, the mpn - mug assay requires the use of new borosilicate glass tubes as well as new gas collection (durham) tubes and the tubes must be prescreened for fluorescence, as some tubes exhibit autofluorescence. in our hands, autofluorescence was a problem and may have contributed to the weakly positive mpn - mug for e. coli o14:nm, o42:h2, o103:h2, and o111:nm, which were consistently negative by the mug overlay procedure (table 1). in the united states, oysters and their growing waters are monitored for fecal coliforms or e. coli using a 5-tube mpn approach, which means that 1530 or more new tubes may be required for a single analysis, depending on the number of dilutions required and the number of presumptive positive tubes that need to be transferred from lauryl sulfate tryptose broth to ec broth, thus making this procedure costly and impractical for routine use. since one of the major obstacles in monitoring for environmental contamination and food safety is the lack of practical and cost effective assays, our goal was to produce simple, more rapid, and inexpensive procedures to enhance monitoring efforts. this paper provides new tools to monitor for total and fecal e. coli and total vibrionaceae levels. in this study , we developed a simple plate cultivation and mug - membrane overlay technique to detect bacteria that are likely fecal e. coli based on gud production and their ability to grow at 44.5c. for our overlay procedure for total e. coli, we recognize that occasional pathogens other than e. coli may be gud positive, like some salmonella and shigella strains (table 2), or some streptococci; however, the detection of other occasional pathogens simply enhances the benefits of using this test as a potential regulatory tool. endogenous levels of gud, which are high in some fish and shellfish , are not a problem in our plate - based membrane overlays, since the overnight incubation of the plates at either 37c or 44.5c degrades endogenous, tissue - specific enzymes well before the plate is overlaid with the membrane containing the fluorogenic substrate. consequently, in the many assays we performed on oysters, we saw no fluorescence, even though oyster tissues are known to contain gud. in addition to the complexities of performing traditional mpn - based assays, analyses for vibrionaceae in seawater and shellfish are usually complex and are generally limited to picking a few isolates from a plate for complex biochemical or molecular biological testing for specific pathogenic strains. monitoring of shellfish or seawater for pathogenic vibrios has failed to stop outbreaks of v. parahaemolyticus, while routine monitoring programs for v. vulnificus are nonexistent in spite of the fact that v. vulnificus in oysters causes occasional illness and death. acceptable baseline or threshold levels of vibrionaceae and total or fecal e. coli should be determined for implementation into regulations for harvesting or distribution of shellfish. threshold levels currently exist for coliforms in harvesting area waters and shellfish meats but are based on mpn approaches. no methods have been established to date for regulation of shellfish harvesting or distribution based on total vibrionaceae levels or e. coli levels using simple overlay methods. in screening 37 strains of non - o157:h7 e. coli that were associated with major foodborne outbreaks of illness, 24 (65%) were positive by the mug overlay and 23 (62%) were positive by the mpn - mug assay. in contrast, other studies showed the recovery of gud in 95.5%, 96.5%, and 91% of the isolates examined. potential reasons for these differences in gud distribution among the isolates were suggested by chang et al., but there have been no conclusive studies explaining such variability. in addition to a subset of non - o157:h7 isolates that were mug negative, 43 isolates of e. coli o157:h7 that were derived from a wide variety of food - borne outbreaks were mug negative. the failure to detect o157:h7 strains is a limitation of both mpn - mug and the mug overlay methods. this finding does not lessen the importance of the mug membrane overlay procedure, since o157:h7 strains constitute a minority of the e. coli in environmental isolates and other mug - based cultural assays, like the u.s. food and drug administration - recommended mpn - mug assay for e. coli, also fail to detect the o157:h7 serotype. escherichia coli o157:h7 strains do not contain enzymatically active gud, although these strains contain the gusa (uida) gene, which encodes gud and two regulatory regions. there does not appear to be regulatory repression to restrict gud formation, since antibody against gud detects the enzyme; however, the gud is in an inactive form lacking hydrolytic activity. the cause for this inactive protein is the presence of a guanosine - guanosine insertion causing a frameshift ing in the introduction of a premature termination codon in the gusa gene in all strains of e. coli o157:h7 tested, but not in other serotypes. this mutation accounts for the presence of an incomplete protein lacking gud activity; therefore, mug - based assays are not appropriate for the detection of o157:h7 isolates. advantages of the overlays are that they are far simpler, less expensive, and directly quantitative, unlike mpns which give statistical probabilities of counts. culturing bacteria on nonselective tsa - n also has an advantage over selective media, like mcconkey agar with or without mug, since selective media are often inhibitory to environmentally stressed bacteria. with multiplex overlays, we have consolidated assays to simplify monitoring in order to drive down costs for screening and to promote more frequent testing for total e. coli and vibrionaceae. both the mug overlay and the copp assays are relatively fast, with derived within 24 hours. mpn assays require up to 3 days for completion (2448 hours incubation in lst broth followed by 24 hours in ec broth) and additional time if e. coli confirmation via biochemical testing is desired. together, the mug and copp overlay methods provide new options for quantifying total and fecal e. coli and vibrionaceae in seawater, shellfish, and other food and environmental matrices. unlike the original copp assay, which used cellulose acetate membranes that could be prepared in advance, dried for storage, and soaked in buffer before overlay , the cellulose membranes used for copp and mug assays in this paper can not be prepared in advance or dried. this is because copp substrate covalently bonds to cellulose acetate membranes, but not to plain cellulose membranes, and mug does not bind to either membrane. although we used cellulose acetate and plain cellulose membranes to screen stock cultures for lysyl aminopeptidase activity, we used cellulose membranes exclusively for multiplex assay for total coliforms and total vibrionaceae. this was because copp assays on cellulose acetate membranes produced a bright light blue fluorescence while mug produced a stronger blue fluorescence; thus, differentiation of the two colors was difficult at times. it became clear that the green and blue fluorescence obtained on the plain cellulose membranes was easier to discriminate between than blue and light blue fluorescence on the cellulose acetate membranes. multiplex overlays for the simultaneous detection of both total e. coli and total vibrionaceae may be performed when both groups of bacteria are in relatively the same proportion; that is, both can be enumerated from the same dilution plate. methods to monitor molluscan shellfish harvesting and distribution, much like methods for other foods, water, or environmental samples, are often outdated and out of touch with today's needs. it is necessary to shift analytical and regulatory paradigms to simpler, more practical, and cost effective measures to monitor relative levels of contamination. given the development of simple membrane overlay assays, we propose the establishment of membrane overlay - based monitoring for total and fecal e. coli and total vibrionaceae. for routine monitoring purposes, it may be time to shift from a search for specific vibrio pathogens to the enumeration of total vibrionaceae. environmental factors responsible for increases in human pathogenic vibrios within shellfish or their growing waters will likely cause an increase in the levels of many other vibrionaceae family members, including pathogenic strains; therefore, the copp assay could prove useful in regulating shellfish harvesting based on total vibrionaceae counts. european standards for shellfish harvesting, where coliform levels are currently used to regulate shellfish harvesting and distribution. in an aquaculture setting, the simple copp assay may serve as an index of fish health and disease, where spikes in vibrionaceae levels over what is normal and customary would suggest a need for more refined assays for specific pathogens and for corrective actions to be implemented within the aquaculture or hatchery setting. membrane overlays are simple and practical for routine monitoring and could enhance food safety by allowing increased numbers of samples to be tested at a reduced cost or by providing a simple alternative to procedures that are too rigorous for routine use.

three assays were developed to enumerate total and fecal escherichia coli and total vibrionaceae in shellfish, seawater, and other foods and environmental samples. assays involve membrane overlays of overnight colonies on nonselective agar plates to detect -glucuronidase and lysyl aminopeptidase activities for e. coli and vibrionaceae, respectively. cellulose membranes containing the substrates 4-methylumbeferyl--d - glucuronide (mug) produced a bright blue fluorescence when overlaid onto e. coli, while l - lysyl-7-amino-4-trifluoromethylcoumarin produced green fluorescent foci when overlaid onto vibrionaceae family members. a multiplex assay was also developed for simultaneously enumerating total e. coli and total vibrionaceae in oysters and seawater. overall, 65% of overlaid e. coli (non - o157:h7) were mug - positive, compared with 62% as determined by the most - probable - number - mug assay. the overlays are rapid, simple, and cost effective for quantification purposes. this research provides practical alternatives for monitoring bacterial indicators and potential pathogens in complex samples, including molluscan shellfish.

a 73-year old female patient 150 cm tall and weighing 50 kg visited our hospital presenting with the complaints of lower back pain and radiating pain to right lower extremity. at first, mild lower back pain had occurred from time to time, but severe pain with a visual analogue score (vas) of 8 or higher started to occur three months prior to her visit. the patient did not have any particular medical history except osteoporosis diagnosed in her late fifties. she felt pain as if her body was collapsing or sinking, accompanied by pulling pain at the hip and groin. the pain became more severe when standing up and moving, and relieved when lying down at rest. the physical examination showed tenderness at the first lumbar (l1) spinous process region. the plain radiograph showed severe osteoporosis over the vertebral bodies, a severe compression fracture of the l1 vertebral body in which the anterior compression rate was 70% or higher, and an intravertebral vacuum cleft in the vertebral body (fig . 1). magnetic resonance imaging showed a low signal area of l1 in the t1 weighted image and a high signal in the t2 weighted image (fig . 2). despite conservative treatment for more than four weeks including continuous epidural pain control, the patient's pain did not decrease and she was rejecting surgical procedures such as a spinal fusion. although the case was not a general indication of percutaneous vertebroplasty and kyphoplasty due to the severe collapse of the vertebral body, we decided to do transpedicular kyphoplasty using this method to block the cement outflow by slowly injecting highly viscous bone cement. before the procedure, we had the patient take the prone position, supporting her abdomen with a pillow, in order to reduce abdominal lordosis. to check the patient's state during the procedure , we monitored the blood pressure, heart rate, and oxygen saturation, with supplement of oxygen through a nasal cannula. for the sake of sedation and analgesia during the procedure, when needed, we injected fentanyl intravenously with a total of 100 g. using the c - arm image , we verified the pedicle of l1 and determined a working cannula implantation position and angle. local infiltration anesthesia was performed with 1% lidocaine on the expected cannula implantation pathway. under fluoroscopic c - arm guidance, we implanted the cannula into the fractured vertebral body through the vertebral pedicle. at the moment when the left cannula was inserted into the vertebral body, air flowed into the vertebral body with a popping sound, and the level of the vertebral body recovered spontaneously (fig . the cannula was also inserted into the right side, and balloons were inflated with a pressure of 50 - 100 psi to recover the level of vertebral body . then, 4.5 ml of bone cement was slowly injected through each side of cannulas through the l1 vertebral body ( fig . 4). while injecting the bone cement, cement leakage out of the vertebral body after the procedure, the vas of the patient was 2, indicating that the preoperative pain almost disappeared. currently, the patient during follow - up visits has not received any particular treatments except for the medication for osteoporosis. kummell's disease is a delayed disorder characterized by avascular necrosis and the collapse of a vertebral body. the avascular necrosis accumulates gas or liquid inside the vertebral body, which is characteristically found as an intravertebral vacuum cleft on the computed tomography or plain radiograph. in an intravertebral vacuum cleft, a space formed by the necrotic bones, fusion of the fractured bones is difficult, and pseudoarthrosis, which could be moved by the patient's posture or respiration, forms previous reports in the literature have mainly advocated conservative treatments such as bed rest and the wearing of aids as the treatment for kummell's disease. however, the effect of the conservative treatment is often limited because vertebral body necrosis continuously progresses and natural healing hardly occurs in this disease. in the case where there is neurological damage, however, spinal fusion through general anesthesia is also quite limited because most of the patients are old accompanied by severe osteoporosis. bone cement injected during these treatments appropriately agglutinates fractures and resolves the instability due to the pseudoarthrosis by filling the vacuum cleft. in particular, kyphoplasty is considered as the more safe and effective procedure than percutaneous vertebroplasty in treating kummell's disease because it can recover the vertebral body and reduce the cement outflow toward the space outside the vertebral body. although it is known that there is no absolute contraindication for these procedures as a treatment for vertebral compression fractures; however, a severely collapsed vertebral body such as vertebra planar is generally considered as a contraindication for these procedures due to the difficulties in the procedure and the risk of cement outflow. in this case, we performed kyphoplasty without any other alternatives, although the patient had a severe osteonecrotic vertebral compression fracture in which the vertebral compression rate was higher than 70% and difficulties including the difficulties of the procedure itself as well as the risk of cement outflow were anticipated. unexpectedly, we experienced during the procedure spontaneous recovery of the vertebral body level as air suddenly flowed into the vacuum cleft of the vertebral body. this was rare even for us, and no similar cases were found in the literature. the possibility of an air embolism concerned us since air suddenly flowed into the vacuum cleft of the vertebral body; however, no complications including an air embolism occurred due to the flow of air into the vertebral body during the recovery process for the vertebral body. we assumed that the spontaneous recovery of the vertebral body level took place as the vacuum cleft was filled with air immediately after the cannula was inserted because negative pressure existed in the vacuum cleft where the intravertebral pseudoarthrosis had formed. although there was the risk of bone cement outflow since the vertebral body could be damaged due to the sudden recovery, the kyphoplasty was successfully performed by slowly and meticulously injecting the bone cement, which had a consistency that was more viscous than the normal bone cement. the patient achieved drastic analgesia and recovery of mobility after the procedure. in , a kyphoplasty is worthy of considering as a good treatment modality that may provide analgesia and recovery of mobility without any complications for patients with kummell's disease accompanied by severe vertebral body compression fracture. in some cases where a vacuum cleft in which negative pressure exists has been formed, spontaneous recovery of vertebral body level could occur.

kummell's disease is a spinal disorder characterized by delayed post - traumatic collapse of a vertebral body with avascular necrosis. although definitive treatment for kummell's disease has not been established, it has been reported that percutaneous vertebroplasty or kyphoplasty has shown good . however, these procedures are not recommended for severely collapsed vertebral bodies because of the risk of cement leakage or technical difficulties. authors report a rare case of spontaneous reduction in vertebral height by the insertion of a working cannula into the vertebral body in kummell's disease.

inflammation of the mammary gland (mastitis) caused by invading pathogens is common among lactating dairy cows and leads to considerable economic loss through reduced milk yield, impaired milk quality, and increased veterinary costs. globally, mastitis is one of the most costly bovine diseases for the dairy industry, estimated to cost approximately $ 1.8 billion annually in the united states. the differences in these types of mastitis are based on the invading pathogen(s) and resolution of the infection. clinical mastitis is stronger and more acute than the subclinical mastitis, and it is caused mainly by gram - negative bacteria such as escherichia coli. the subclinical mastitis elicits milder inflammation and persists over the life span of infected cows. gram - positive bacteria, like staphylococcus aureus, are involved with the subclinical mastitis infection. endotoxin (lipopolysaccharide, lps) and lipoteichoic acid (lta) are considered as the main virulence factor of e. coli and s. aureus, respectively. moreover, proinflammatory cytokine tumor necrosis factor- (tnf-) elicits both local and systemic inflammatory reactions and triggers the inflammatory cascade acute phase response in inflammation and participated in the acute phase of coliform mastitis. to suppress proliferation of invading pathogenic mastitis - causing bacteria, modern dairy practice employs several strategies, including teat disinfection, antibiotic therapy, and culling of persistently infected cows. despite the great effectiveness of antibiotics, their use is coming under increasing public scrutiny due to the possible development of resistant pathogens (like methicillin - resistant s. aureus, mrsa) and food safety concerns (like antibiotic residues in milk). considering the risks associated with antibiotic therapies for bovine mastitis, development of alternative treatment strategies for management of clinical and subclinical mastitis propolis is a resinous substance collected by honeybees (apis mellifera l.) from various polyphenol - rich plants. it has been used widely in folk medicine since ancient times and has attracted much attention in recent years for its various biological properties. in our recent studies, we determined that propolis had potent anti - inflammatory effects in macrophages and boosted cellular antioxidant defence systems. previous literature has shown that propolis could inhibit the growth of several different bacterial strains known to cause mastitis, as well as some antibiotic - resistant s. aureus strains. nevertheless, little is known about the effects of propolis on mastitis responses in bovine mammary epithelial cells (bmecs). in the present study , we studied the impact of the effect propolis when bovine mammary epithelial cells were challenged with heat - killed mastitis - causing bacterial cells, as well as selected agents also associated with tissue response to mastitis. lps (escherichia coli 0111:b4), lta (from staphylococcus aureus), caffeic acid, caffeic acid phenethyl ester (cape), chrysin, ferulic acid, galangin, kaempferol, pinocembrin, and quercetin were purchased from sigma (st . louis, mo, usa). high performance liquid chromatography- (hplc-) grade methanol was obtained from merck (darmstadt, germany). recombinant human tnf- was purchased from peprotech (rocky hill, nj, usa). culture plates were obtained from coring life science (lowell, ca, usa .). the pi / rnase staining buffer kit, fitc - conjugated annexin v, and binding buffer were obtained from bd biosciences (san diego, ca, usa). other chemicals were of analytical grade and purchased from sangon biotechnology (shanghai, china). chinese propolis (cp) was obtained from colonies of honeybees, a. mellifera l., in shandong province in the summer of 2010, and the main plant origin was poplar (populus spp .). briefly, raw propolis (100 g) was extracted by 95% (v / v) ethanol (1 l) and sonicated at 40c for 3 h. the supernatant was collected and filtered to remove the residues. the raw propolis was extracted for three times. then the supernatants were collected and evaporated in a rotary evaporator under a reduced pressure at 50c to evaporate the ethanol. dried ppe were stored at 20c until further use. for the in vitro studies , cp was redissolved directly in ethanol to a concentration of 20 mg / ml and sterilized using a 0.22 m syringe filter (pall, port washington, ny, usa). the final concentration of ethanol in the cell culture was less than 0.5% (v / v). bovine mec line mac - t cells were generously provided by professor fengqi zhao (university of vermont, burlington, usa) which were cultured in high - glucose dulbecco's modified eagle's medium (dmem, hyclone, fremont, ca, usa) supplemented with 100 u / ml of penicillin, 100 g / ml streptomycin, and 10% (v / v) heat - inactivated fetal bovine serum (fbs, gibco, carlsbad, ca, usa) at 37c and 5% co2 in a humidified incubator. we challenged these cells with heat - inactivated bacteria particles of the mastitis - causing pathogens e. coli strain 1303 and s. aureus newbould 305. details regarding the culture of e. coli or s. aureus pathogens and usages of these heat - inactivated bacteria particles to challenge bmecs were described previously. e. coli and s. aureus strains were grown (37c) in lysogeny broth (lb) medium to the logarithmic phase of culture growth. heat inactivation was performed in an 80c water bath for 1 h to kill all live cells and verified through control plating. subsequently, cells were spun down, washed twice with pbs, and later then resuspended with dmem at a density of 5 10 cells / ml. aliquots were stored frozen at 20c until used. cell viability assay was performed using the cck-8 kit (dojido, kumamoto, japan) according to the manufacture's instruction. briefly, 10 10/ml mac - t cells were seeded into 96-well culture plates. after 24 h incubation, cells in each well with specific treatment were incubated with 10 l of cck-8 at 37c for 2 h before measuring the od at 450 nm with a microplate reader (spectramax m5, molecular devices, sunnvale, ca, usa). cells were stained with annexin v - fitc and pi and then evaluated for apoptosis by flow cytometry according to the manufacturer's protocol (bd biosciences, san diego, ca, usa). briefly, 10 cells were washed twice with pbs and stained with 5 l of annexin v and 5 l of pi (50 g / ml) in washing buffer from the kits for 15 min at room temperature in the dark. apoptotic cells were counted in the lower right quadrant corresponding to early apoptotic cells (annexin v - positive) and those in the upper right quadrant corresponded to late apoptotic cells (annexin v- and pi - positive). total rna was extracted with the rna pure kit (aidlab biotechnologies co., ltd ., reverse transcription was done using the primescript rt reagent kit ( takara, dalian, china) with 1 g total rna. quantitative real - time pcr was carried out with sybr premix ex taq (takara) following the manufacturer's instructions with 1: 10 diluted cdna template and using a standard two - step reaction. primers for target genes that covered introns were designed with the primer5 software (premier biosoft international, palo alto, ca) and listed in table 1. after overnight incubation, 30 ng of firefly luciferase reporter plasmid pgl4.2-nf-b - luc and pgl4.37-luc2p / are / hygro vector (promega, madison, wi, usa) were transfected to drive transcription of nf-b and are, respectively, by using lipofectamine 2000 (invitrogen, carlsbad, ca, usa). sea pansy luciferase reporter plasmid (prl - tk, 5 ng) was transfected to normalize the transfection efficiency. the pcdna3.1 empty vector was used to compensate the total expression plasmids to 500 ng / well. luciferase activities were measured 24 h after specific treatments by using the dual - glo luciferase assay system (promega). data are expressed as the means sd from at least three independently performed experiments. one - way analysis of variance (anova) followed by student - newman - keuls (snk) multiple - comparison test was used to determine statistical significance for multiple comparisons, and student's t - test was used for comparisons of two groups. we analyzed the major polyphenolic compounds in chinese propolis using our previously developed hplc method. the major polyphenolic components were chrysin, pinocembrin, pinobanksin, galangin, and cape. as shown in figure 1(a), not all of these stimuli caused cell viability decreases in mac - t cells. only lps and heat - killed e. coli and s. aureus, but not tnf- and lta stimulation, lead to significant cell viability losses (15% to 52%, p = 0.0009, 0.0041, and 0.001 for lps, e. coli, and s. aureus, resp .). heat - killed bacterial strains caused more serious cell viability losses than lps. to test the effects of cp on protecting against the cell viability decreases caused by mastitis pathogens, various concentrations of cp also shown in figure 1(a), tested concentrations of cp (5, 10, and 15 g / ml) pretreatment were safe to mac - t cells. cp pretreatment (10 and 15 g / ml) significantly mitigated cell viability loss by lps (p < 0.05) and heat - killed e. coli (p < 0.05). s. aureus - induced cell viability losses can be inhibited by 15 g / ml cp pretreatment (p < 0.05). cell apoptosis analysis by flow cytometry showed that 10 particles / ml heat - killed mastitis strains caused a substantially increased percentage of apoptotic cells, but none of the other stimuli, tnf-, lps, or lta, cause any changes on apoptotic cell numbers (figure 1(b) ). nevertheless, pretreatment with 15 g / ml cp in mac - t cells showed a significantly lower number of apoptotic cells (p < 0.05) compared to heat - killed e. coli- and s. aureus - treated cells, which was consistent with the above obtained from cck-8 cell viability assay. as shown in figure 2, all of these mastitis pathogens, except for lta, lead to significant increases of il-6 and il-8 (p < 0.05). lta and heat - killed s. aureus stimulation also failed to induce expression of tnf- compared with uninfected cells (p > 0.05). on the contrary, heat - killed e. cp - pretreated mac - t cells have much slighter changes of il-6 and tnf- mrna compared to their corresponding stimuli controls. surprisingly, cp lead to ~8-fold changes of il-8, significantly higher than tnf-, lps, and heat - killed e. coli stimuli (p < 0.05). as shown in figure 3(c), only gclm expression was affected by several mastitis pathogens (tnf- and two heat - killed mastitis strain particles). we noticed that cp treatment in mac - t cells leads to substantial increases in ho-1, txnrd-1, and gclm expressions (p < 0.05). ho-1 expressions were further elevated in cp - pretreated mac - t cells undergoing mastitis challenges (figure 3(a) ). upregulated txnrd-1 was unchanged in cp - treated mac - t cells (figure 3(b), p < 0.05 ), regardless of these different mastitis pathogens. furthermore, cp treatment itself can not induce expression of gclm but it substantially increased in mastitis pathogen challenged cells along with cp. these indicated that cp could elicit the antioxidant defense system in the bmecs cells undergoing mastitis challenges. as shown in figure 4, the increased expressions of proinflammatory cytokines il-6 (figure 4(a) ) and tnf- (figure 4(c) ) were suppressed by cp in a time- and dose - dependent manner. as for another important chemokine, il-8, its expression was significantly driven by tnf- and immediately peaked at 3 h after tnf stimulus (figure 4(b) ). cp treatment strongly promoted il-8 expression, which reached its peak after 9 h tnf stimulus. we also found that tnf- had very limited effects on antioxidant gene expressions, ho-1, txrnd, and gclm (figures 4(d)4(f) ). to determine the effects of cp as well as its purified compounds on nf-b and are transcriptional activity, luciferase reporter assays were applied in hek-293 t cells. as shown in figure 5, nf-b activity was significantly decreased by approximately 70% (p < 0.001). the luciferase activity derived from the are promoter was consistently increased by approximately 4.7-fold after treating with 20 g / ml cp (figure 5(b), p < 0.001 ). moreover, significant decreases in nf-b activity were found in cells treated with cape (5 m, 45%, p < 0.001), quercetin (50 m, 73%, p < 0.001) caffeic acid (50 m, 12%, p < 0.05), and ferulic acid (50 m, 11%, p < 0.05) (figure 5(a) ). in parallel, the luciferase activity derived from the are promoter was consistently increased after treatment with cape (5 m, 2.5-fold, p < 0.001), quercetin (50 m, 5.1-fold, p < 0.01), kaempferol (50 m, 3.6-fold, p < 0.001), and pinocembrin (50 m, 2.9-fold, p < 0.01). regardless of increased pressures of cutting down the antibiotic usage in the husbandry in the european union and us, mastitis treatment is continued after the initial usage of antibiotics, mainly for chronically occurring subclinical mastitis. the increasing scientific data on the benefit of natural products encourages us to explore novel nonantibiotic agents for mastitis therapies. in this study , the potential utilization of chinese propolis as an anti - inflammatory reagent and immune modulator against bovine mastitis was examined in bmecs. previous studies have demonstrated that propolis has great antimicrobial properties against bacterial fungi, protozoan, and even yeast pathogens. despite chemical variations of propolis from different geographic origins / plant sources, the antibacterial activity by propolis always exists. in accordance with published literature, chinese propolis extracts on gram - positive s. aureus cells appear to be bactericidal but show only limited activity against gram - negative e. coli bacteria. based on the literature, we applied 10 particles / ml of the heat - inactivated bacteria to the bmecs, which is approximately 30 particles challenged per host cell. this approach represented a reliable robust stimulus model considering that 10 to 10 cfu of bacteria particles per ml as peak values in the milk were produced from cows after mastitis infection. also, we confirmed that propolis' bactericidal effects are potent in controlling mastitis - causing s. aureus strains, which are most frequent but more difficult to eradicate by conventional antibiotic therapies. it has been known that acute coliform mastitis is caused by endotoxin - producing acute coliform bacteria (specifically, e.g., e. coli, enterobacter, and klebsiella spp .) and is characterized by a rapid and intense increase in the somatic cell count (scc), while subclinical mastitis caused by s. aureus is characterized by a more moderate and delayed scc increase that leads to chronic and, in some circumstances, life - long infection. mammary tissue damages induced by mastitis pathogens also have been shown to be linked with increased scc and mainly induced by either apoptotic or necrotic mammary cells. we explored and compared the effects of major different various mastitis pathogens on bmecs cell viability and cell apoptotic features. we found that tnf- and lta stimulation did not cause any significant losses on the cell viability or cell apoptosis to bmecs, coinciding with other in vitro studies using bovine mammary cells. meanwhile, previous findings on proapoptotic effects by heat - killed e. coli and s. aureus were inhibited by cp pretreatment, suggesting that cp has modulating effects on the cellular apoptosis cascade, such as blocking the activation of caspases. we noticed that the e. coli cell wall component lps only decreased cell viability but did not induce cell apoptosis, suggesting that the influences of bacterial cell wall components on bmecs may be different from those mastitis bacteria strains. moreover, as the internalization process of bacteria pathogens to the cells differs among bacteria strains, the different signal transduction mechanisms requiring the interaction between cp and cell wall components as well as the host cells are in need to be further clarified. bovine mastitis is initiated by the entry of bacteria through the teat canal. shortly after entry of the invading pathogen , the resident leukocytes together with epithelial cells initiate the inflammatory response necessary to eliminate the invading bacteria. different mediators of inflammation, especially some inflammatory cytokines, which are expressed during this stage will participate in the innate immune defense to respond to the earliest stages of infection after mastitis pathogen / stimulus exposure. il-6 and tnf- are the two most predominant proinflammatory cytokines during the acute phase responses of mastitis. in heat - inactivated e. coli challenged bmecs, significant increases of il-6 and tnf- gene expression were observed (figure 2), a finding consistent with a previous study using a different mastitis strain of e. coli. compared to lps and tnf-, heat - inactivated e. coli elicited stronger inductive effects on these inflammatory cytokines expressions, suggesting that some other virulence factors from e. coli (like lipoproteins or flagellum) may be involved in the innate immune defense of the bovine epithelium cells. in contrast to e. coli challenged models, lower levels of inflammatory response were found after s. aureus compared with e. coli, which has been found by previous studies. in these studies no increases in the concentrations of tnf-, il-1, and il-8 in milk were found after intramammary challenge by s. aureus. in our experiments , we did not notice any significant changes on these inflammatory cytokine genes following s. aureus or lta stimulation. previous reports have suggested that s. aureus mastitis is characterized by a more moderate and delayed inflammatory responses and limited cytokine responses. expanded time - course studies of cp effects by s. aureus and lta stimulation need to be conducted. propolis has been used historically as a folk medicine since ancient ages times and has since been safely used as a substitute medicine or supplement to improve human health in modern days. although the effective components in propolis vary significantly according to the mother plant that the honeybees collect it from, the bioactivities of propolis are always present. our previous studies have confirmed the anti - inflammatory effects of chinese propolis (poplar type) by protecting murine macrophages from lps challenges and controlling proinflammatory cytokine releases in lps - induced mice endotoxemia. similar to our previously published , the proinflammatory cytokine expressions (il-6 and tnf-) were inhibited by cp treatment following coliform mastitis pathogen challenges (heat - inactivated e. coli as well as endotoxin). besides, through our comprehensive tnf- stimulation model, we found that cp effectively inhibits the expression of these two genes in a time- and dose - dependent manner. through our previous studies using lps challenged murine macrophages models, the inhibition on nf-b activation by cp may be the source of its anti - inflammatory effects. we knew that polyphenolic compounds are among the most prominent components of propolis because they are considered responsible for most of its properties. in parallel with previous studies, cape, quercetin, and caffeic it should be noted that in this study, the expression of il-8 (also known as cxcl8) increased in cp - treated cells in several different stimulus models. various animal models of inflammation have demonstrated il-8 as a principal chemotactic factor directing neutrophil recruitment to activation at the inflammatory focus. expression of il-8 is known to be controlled by multiple transcriptional factors (activator protein, ap, -1, and nf-b and nf-b repressing factor, nrf) and involved with some coactivator cbp/300 complexes. it also has been shown that the pivotal importance of c / ebp to activate il-8 expression in mecs is independent of nf-b activation. therefore, in this study, as we have found that the nf-b transcriptional activity was inhibited by cp and its bioactive compounds, we assumed that other transcriptional factors, like c / ebp, which are possibly activated by cp, may contribute to the enhancement of il-8 expression in mastitis pathogens challenged mec. it is well - known that multiple antioxidant genes may be induced by diverse plant - derived natural products. these antioxidant genes, such as ho-1, txnrd1, gclm, sod, and nqo-1, encode several detoxifying (phase ii) enzymes and endogenous antioxidants to provide protections against external stresses, including oxidative stress and inflammation. in particular, nrf2 has been shown to be involved in the inductions of phase ii detoxifying enzymes and antioxidants by natural polyphenols in bmecs suffered from oxidative stress. ho-1 is well - known to be a major antioxidant enzyme that plays an important role in the antioxidant defense against inflammatory stresses in different cell types, such as macrophages, keratinocytes, and epithelial cells. thioredoxin reductase (trxr), which catalyzes the reduction of the active site disulfide of thioredoxin (trx), is an nadph - dependent homodimeric oxidoreductase. as trxr is an antioxidant enzyme that can scavenge ros, cp - induced trxr1 expression may indicate the activation of cellular defense systems against tnf and other mastitis pathogen challenges. our recent study found that endogenous antioxidant defenses systems could be activated by chinese propolis in murine macrophages. in parallel with this study, these increased antioxidant gene expressions are in keeping with cp's inductive effects of nrf2-are transcription activity. furthermore, several specific active polyphenolic compounds from propolis have been shown to activate nrf2-are signaling, including cape, kaempferol, quercetin, and pinocembrin. our studies have demonstrated that chinese propolis has strong protective effects against various mastitis pathogen insults to bmecs. apart from cp's bactericidal effects, it clearly prevented cell viability losses / apoptosis induced by lps and heat - inactivated mastitis strains (e. coli and s. aureus) in bmecs. these effects were partly achieved by modulating expression of inflammatory cytokine genes and boosting antioxidant defense genes. the possible mechanisms for cp against bovine mastitis may be attributed to its abundant polyphenolic components (mainly cape and quercetin), which strongly inhibited nf-b transcription activity and increased the transcriptional activity of the nrf2-are pathway. field studies are needed to confirm that propolis may be developed as nonantibiotic therapy strategy for the control of cow mastitis.

chinese propolis (cp), an important hive product, can alleviate inflammatory responses. however, little is known regarding the potential of propolis treatment for mastitis control. to investigate the anti - inflammatory effects of cp on bovine mammary epithelial cells (mac - t) , we used a range of pathogens to induce cellular inflammatory damage. cell viability was determined and expressions of inflammatory / antioxidant genes were measured. using a cell - based reporter assay system, we evaluated cp and its primary constituents on the nf-b and nrf2-are transcription activation. mac - t cells treated with bacterial endotoxin (lipopolysaccharide, lps), heat - inactivated escherichia coli, and staphylococcus aureus exhibited significant decreases in cell viability while tnf- and lipoteichoic acid (lta) did not. pretreatment with cp prevented losses in cell viability associated with the addition of killed bacteria or bacterial endotoxins. there were also corresponding decreases in expressions of proinflammatory il-6 and tnf- mrna. compared with the mastitis challenged cells, enhanced expressions of antioxidant genes ho-1, txnrd-1, and gclm were observed in cp - treated cells. cp and its polyphenolic active components (primarily caffeic acid phenethyl ester and quercetin) had strong inhibitive effects against nf-b activation and increased the transcriptional activity of nrf2-are. these findings suggest that propolis may be valuable in the control of bovine mastitis.

exercise tolerance generally decreases in patients on hemodialysis (hd) who have diminished musculoskeletal muscle strength and muscle atrophy, reduced muscle blood flow distribution, a decline in cardiopulmonary function, and severely reduced activities of daily living. previous studies have found that a low level of physical activity (pa) affects physical function, and it has psychological effects that influence the prognosis for survival1,2,3,4. recently, exercise intervention and high levels of pa have been recommended for patients on hd. studies have found that these are effective for improving exercise tolerance (i.e., an increased maximum oxygen uptake and anaerobic threshold), pulmonary function (i.e., a lower ventilatory volume at a given submaximal load intensity), cardiac function (i.e., a lower heart rate at a given submaximal load intensity), coronary risk factors (e.g., a lower systolic blood pressure, higher high - density lipoprotein cholesterol level, and lower neutral fat level), and survival prognosis and for preventing the progression of coronary artery stenotic lesions1, 5,6,7,8,9,10,11. although a high level of physical exercise exerts a wide range of beneficial effects, it has so far been difficult to improve the low level of pa in patients on hd. patients with low levels of pa tend to be elderly women who possess factors that are strongly correlated with diabetes and atherosclerosis9. particularly, helping such patients maintain a high level of pa is an issue given their level of physical function, and it requires an approach that takes activity patterns, psychological factors, and environmental adjustments into account. in recent years, many elderly patients above 60 years old have started to undergo dialysis treatment above 60 years old, or they have been undergoing dialysis treatment, in addition to those who for a long time (since a young age). as the number of elderly patients on hd increases, it is important to maintain appropriate pa to protect against decreases in physical function and activities of daily living function caused by disuse in daily life. however, in japan, rehabilitation is not targeted at patients on dialysis during medical treatment. many patients on dialysis do not readily participate in exercise classes at fitness clubs or communities because of dialysis treatment; consequently, they miss the opportunity to exercise or receive instruction. as there is a lack of a good exercise environment for elderly patients on hd, a large amount of motivation is required to engage such patients in pa. moreover, elderly patients on hd tend to have low participation in social activity, and they mostly stay indoors, which further reduces their physical levels of pa. in elderly patients on hd, the amount and intensity of pa are important. many previous studies, however, have focused solely on the amount of pa in terms of the number of steps taken by patients on hd per day, and few have addressed the level of everyday activities that patients on hd are engaged in or their attitudes toward exercise and their state of psychological preparedness. assessing the activity patterns of patients on hd with a focus on their pa levels and determining their attitudes toward exercise may enable the establishment of support methods that are best suited to raising their levels of activity. the current study aimed to identify the characteristics of elderly patients on hd and their attitudes toward exercise and to ascertain their everyday activity levels by using a pa monitor. the protocol for the research project conformed to the provisions of the declaration of helsinki (as revised in tokyo in 2004). a researcher described the research purposes, methods, risks, and benefits to the participants. then consent was obtained for the research study, and a questionnaire to collect personal information was administered to the subjects. subjects were recruited from amongst outpatients who visited two institutions in japan: a hospital and clinic that specialize in hd treatment. the inclusion criteria were age 60 years, 4 h of hd 3 times / wk renal disease, and hd for > 12 wk. to measure pa , subjects wore an accelerometer (kenz lifecorder ex 4s version ; measurement interval) to evaluate the amount of pa they performed for 1 wk, and their number of steps and level of exercise were calculated. they were obligated to wear the device at all times other than in the bath. the imported values for exercise level obtained from the accelerometer included periods in which no activity was recorded, and these periods treated as periods of inactivity. the levels of activity were as follows: pa intensity < 1, sedentary behavior (sb); 13, light - intensity activity (lpa); 45, moderate - intensity activity (mpa); and 69, vigorous - intensity activity (vpa). the survey on attitudes toward exercise covered the subjects psychological state with respect to exercise based on the transtheoretical model10 (a five - stage model comprising precontemplation, no interest at all ; contemplation, interested but not yet taking action ; preparation, engaging in exercise on an irregular basis ; practice, having engaged in continued regular exercise for < 6 months ; and maintenance, having engaged in regular exercise for at least 6 months and acquired the habit of exercising). items related to their exercise habits (whether they engaged in habitual exercise and the type, frequency, and period for which it was continued) and motivation for exercise (assessed on a four - point scale of agree, somewhat agree, somewhat disagree, and strongly disagree) and items concerning awareness of the need for and the effects of exercise, negative attitudes toward exercise, previous experience of exercise, and wish for instruction about exercise by medical staff (yes / no answers) were evaluated. regarding the analytical methods, accelerometer data were used to calculate the mean time per day spent at each level of pa (inactivity, sb, lpa, mpa, and vpa). the number of steps and time spent at each level of exercise were also calculated separately for each subject on hd and non - hd days. two - way factorial analysis of variance (anova) was performed with hd / non - hd days and activity levels as independent variables and activity time as the dependent variable. the frequencies and percentages of the responses to survey on psychological state were calculated. the subjects were three men (age, 68.7 2.3 years ; height, 163.7 1.2 cm ; weight, 58.8 5.0 kg ; and dialysis history : 4.6 2.1 years) and seven women (age, 65.3 6.6 year ; height, 152.7 3.7 cm ; weight, 52.4 11.6 kg ; and dialysis history, 2.1 1.3 years). the data of 8 subjects for whom no data were missing were used to calculate the pa levels as the main outcome of this study. in 2 cases with immeasurable levels , the accelerometer did not respond to the level of movement during walking even though the subjects were capable of walking independently. the number of steps was 2,805.1 1,742.0 on hd days and 4,717.0 2,991.6 on non - hd days (p = 0.069, effect size ( es) = 0.64 ), and the difference was not significant (table 1table 1.physical activity intensity levels on the dialysis and non - dialysis daysdialysis daynon - dialysis daymeanmediansdmeanmediansdsteps ( steps)2,805.12,428.31,742.04,717.04,604.72,991.6inactivity (min)792.5720.4315.8610.4599.4253.7sb (min)557.8639.5282.3619.4811.5268.8lpa (min)20.920.910.332.934.019.7mpa (min)7.72.210.511.45.114.7vpa (min)0.70.21.51.20.21.3sb: sedentary behavior; lpa: light - intensity physical activity; mpa: moderate - intensity physical activity; vpa: vigorous - intensity physical activity ). the mean number of steps was lower for hd elderly japanese patients than for non - hd elderly japanese patients (men, 7,303 steps, and women, 6,705 steps). sb: sedentary behavior; lpa: light - intensity physical activity; mpa: moderate - intensity physical activity; vpa: vigorous - intensity physical activity to verify whether there was a significant difference between exercise levels on hd and non - hd days, two - way factorial anova was performed with hd / non - hd days and activity levels as independent variables, and activity time as the dependent variable (tables 1 and 2). this showed a significant interaction (f = 6.0, p < 0.001, n = 0.46). a test of the simple main effect for each level showed that it was not significant for hd / non - hd days (f = 0.72, p = 0.79, n = 0.01). the simple main effect was significant for the activity level (f = 68.9, p < 0.01, n = 0.79), and a multiple comparison test showed significant correlations between inactivity and lpa, mpa, and vpa and between sb and lpa, mpa, and vpa. however, there was no significant correlation between inactivity and sb, or between lpa, mpa, and vpa. the survey on attitudes toward exercise showed that 5 subjects (50.0%) were in the precontemplation stage, 3 (30.0%) were in the contemplation stage, and 2 (20.0%) were in the practice stage and in the habit of engaging in regular exercise (table 2table 2. concerning psychological staten=10%ttm stageprecontemplation550.0contemplation330.0practice220.0ex habityes220.0no880.0habitual ex typegroup ex1walking1habitual ex frequency / wover 3 days110.02 days110.0none880.0habitual ex durationover 1 year110.016 months110.0less than 1 month880.0motivation for exagree550.0somewhat disagree550.0awareness of the need for exagree550.0somewhat agree550.0negative attitude toward exagree110.0somewhat agree660.0somewhat disagree220.0disagree110.0effect of exagree550.0somewhat550.0previous experience of exyes770.0no330.0ttm : transtheoretical model ; ex : exercise). motivation to exercise and awareness of the need to exercise was high in 5 subjects (50.0%) and low in 5 (50.0%). seven subjects (70.0%) disliked exercise and thought of it as too much trouble. the purpose of this study was to ascertain the characteristics of the pa levels and attitudes toward pa of elderly patients on hd. we found that their mean number of steps per day was lower than the reference value for non - hd elderly individuals. additionally, although there was no significant difference in the numbers of steps or activity levels on hd and non - hd days, the time spent in inactivity was long on both days, and most activity was sb. over 80.0% of the subjects were not in the habit of exercising, and although 70.0% had previous experience with exercising, their awareness of the need to exercise was now low (50.0%); additionally, they tended to harbor negative feelings about exercising (70.0%). the decline in physical function seen in patients on hd was due to the effect of chronic renal failure and the fact that they were leading sedentary lifestyles, with low levels and intensities of exercise, which is also an important factor. in a previous study of pa, 795 (35.1%) of among 2,264 patients on hd in the united states, a follow - up investigation of those patients 1 year later found that heart disease and peripheral complications were more frequent among those who had not engaged in exercise or pa, and the risk of death after 1 year was 1.62 times higher than that of those who did engage in exercise or pa. a 10 year follow - up study of patients who engaged in regular aquatic exercise and those who were inactive also found that mortality was higher for patients on hd13. in terms of patterns of pa , there were no great differences in the average values on hd and non - hd days, but the absence of a difference in the number of steps may have been due to the wide standard deviation. in a previous study of pa on hd and non - hd days, majchrzak et al.12, 14, 15 showed that patients on hd had particularly low activity levels on hd days. they found that factors contributing to the decrease in pa on hd days included hd - induced fatigue and postural hypotension14, 16. patients on hd also spend about > 10 h / wk in treatment - associated rest, hemostasis after hd, and post - hd fatigue with a low blood pressure. focusing on the activity intensity patterns in this study , subjects spent the longest amount of time inactive, and even when they were active, the time spent in sb, which involved sitting or a similar activity, was extremely long on both hd and non - hd days. johansen et al.17 used accelerometry to measure activity levels in patients on hd over a 1-wk period and showed that patients on hd had significantly lower levels of activity than those of healthy individuals who were leading a sedentary lifestyle. guidelines in many countries, japan included, recommend that elderly people take at least 6,000 steps a day and engage in around 15 min of moderate pa, but patients on hd do not achieve this even on non - hd days. the length of these periods of inactivity and bed rest minimizes the effect of gravity, meaning that gravity - resisting muscles are not subjected to gravity for continued periods, ing in inactivity. thus, they develop disuse muscle atrophy, which reduces muscle strength, generating a vicious cycle whereby declining physical function factors and pa exert a negative effect on each other15, 16, 18, 19. patients on hd are therefore recommended to be proactive in raising their levels of pa and incorporating exercise therapy. however, the question of the extent to which the pa of patients on hd can be increased is an important one. as shown by subjects in this study , patients on hd may have a low awareness of exercise, and even if they do regard it as necessary, they may not engage in it due to negative attitudes. a wide range of intervention methods are now being used to encourage pa by patients on hd, including intervention on non - hd days and before and during hd, as well as the use of home exercises. many patients on hd also have complications and may be worried about heart failure or hypertension immediately before hd and postural hypertension immediately after hd. thus, it is necessary to encourage pa that is best suited to each individual. counseling and efforts on the part of staff involved in hd to encourage patients on hd to increase their levels of regular physical exercise are also required5. the present findings also suggested that patients on hd are looking for support from medical staff. according to bennett et al.6, 20, specialist staff and encouragement and commitment on the part of medical staff are factors that contribute to a successful continuous program. for medical staff, possessing the appropriate knowledge is also a factor that helps increase the level of physical exercise in patients on hd. improving the level of physical exercise has been shown to have a beneficial effect on mental health and physical function16, 21, and intervention through appropriate pa may provide the impetus for patients on hd to generate a virtuous circle. this study only included a small number of subjects, and thus we did not attempt to elucidate a causal relationship between pa and body strength characteristics. patients on hd with low levels of pa, however, reportedly also have poor physical function, exercise tolerance, and survival prognosis22. in addition, this study focused on intensity rather than the number of steps. as may be understood from the of this study, it is significantly difficult for patients to exercise on their own in the absence of exercise instructors due to their low motivation for exercise. in recent years, from the perspective of health - related behavioral science23, however, emphasis has been placed on eliminating negative factors, such as reducing sitting time daily and changing patterns of inactive time (i.e., sitting behavior), rather than on positive factors for improving pa by promoting exercises, as was the case in this study. therefore, appropriate pa guidance is required, especially at medical institutions without stationed specialists to help with exercise. in the 2 cases with immeasurable pa levels in this study , the accelerometer did not respond to the levels of movement during walking even though the patients could walk independently. determining indexes of the amount of physical exertion for patients on dialysis is important. furthermore, a comprehensive care program that includes guidance on improving pa and the psychosocial aspects of exercise is needed.

the aim of this study was to ascertain the optimum strategy for implementing a physical activity intervention in patients on hemodialysis by investigating the physical characteristics of elderly patients on hemodialysis, and their attitude to physical activity and level of daily activity. the subject were 10 elderly patients on hemodialysis. they wore a physical activity monitor for 1 week. data obtained were analyzed for hemodialysis and non- hemodialysis days, and two - way analysis of variance was used to compare the number of steps and activity levels. a questionnaire was administered to investigate the stage of psychological preparedness for exercise and attitudes toward / awareness of exercise. there was no significant difference in the number of steps or exercise levels on hemodialysis and non- hemodialysis days. however, on both types of days, subjects spent long periods not engaged in any activity. most of their activity was either inactivity or sedentary behavior. patients on hemodialysis with low physical activity levels are considered to have poor physical function and exercise tolerance. to maintain and improve the physical function of patients on hemodialysis , it will be necessary to reduce their time spent in inactive, and comprehensive care that covers psychosocial aspects should be provided to promote the proactive improvement of physical activity and their attitudes to exercise.

endoscopic evaluation of the gastrointestinal tract offers both diagnostic and therapeutic options and has become the preferred procedure for the evaluation of gastrointestinal disorders. presented here are an illustrative example and a review of the world literature, with a focus on diagnostic and management options. a healthy, 75-year - old woman underwent screening colonoscopy at an outside facility and developed left upper quadrant abdominal pain over the ensuing days. cyst, and observational management was elected. over the next several months, the patient underwent serial ct scan examinations of her abdomen, which demonstrated a slowly but progressively enlarging splenic cyst. approximately 4 months after the inciting colonoscopy, the patient was referred to our facility for management. a 10x7-cm thin - walled splenic fluid collection was seen on ct (figure 1), abutting the abdominal wall and displacing the spleen medially. a fluid / fluid level could be seen within the collection, consistent with hematocrit effect (blood cells separating from plasma and settling over time). the collection was percutaneously drained with an 8 french multi - holed catheter for 400cc of brown fluid, consistent with old blood. postprocedure ct confirmed complete collapse of the collection (figure 2) and the catheter was removed. six days after the collection was drained, the patient presented with a return of her abdominal pain and was found on follow - up ct to have a recurrent 6x4-cm subcapsular splenic collection with a small hematocrit level, presumably from ongoing small hemorrhages. with the rapid reformation of the collection therefore, the patient was immunized with pneumococcal and hib vaccines and taken for elective splenectomy 2 days later. though laparoscopic splenectomy was considered, open resection was chosen given the patient's age and likelihood of significant inflammatory changes. at laparotomy, she was noted to have a very mobile splenic flexure with an underdeveloped splenocolic ligament. inflammatory adhesions were found in the area of the spleen, and an 8x5-cm white cyst, slightly larger than the spleen itself, was found posterolateral to the spleen (figures 3 and 4). postoperatively, the patient did remarkably well and was discharged home 3 days later. presenting computed tomographic scan of patient with large undrained hemorrhagic splenic cyst abutting the left lateral abdominal wall. though barium enema has long been the gold standard for identification of colonic lesions, colonoscopy affords the ability to not only identify a lesion, but to provide tissue for pathologic examination and is often the definitive procedure for polyps. hence, colonoscopy is considered the accepted screening examination in all people over 50 years of age, and younger if a familial history of colon cancer is present. though overall very safe the 2 most common complications are hemorrhage following polypectomy (range, 1.8% to 2.5%) and perforation (range, 0.34% to 2.14%). the injury was first reported in 1974, with 2 patients sustaining hemorrhage, one of which ed in splenectomy. since the first report, an additional 36 cases have been reported in the world literature, including the current case. the average age of the patients is 64.9 years (range, 33 to 90), reflecting the age for which colonoscopy is routinely indicated, with a preponderance of females (66.7%). difficult intubation of the colon may impart direct injury to the spleen during passage through the splenic flexure. dense adhesions between the colon and spleen from previous surgery or disease may in tearing of the splenic capsule as the colonoscope is passed through the colon. telmos and others later added technical maneuvers to the list of risk factors, including slide - by, the alpha maneuver, straightening of the sigmoid loop, and externally applied abdominal pressure. in the available literature, only 6 patients were reported to have had some difficulty with intubation of the colon, while 21 specifically mentioned a lack of difficulty. reports from the remaining 10 cases made no mention of ease or difficulty of the procedure. twelve of the 37 reported patients had undergone previous surgery or had a disease process that may have enabled adhesion formation (crohn 's disease and pancreatitis). eighteen had no predisposition to adhesion formation, and 8 reports lacked any information regarding risk factors. interestingly, of the 12 patients with possible adhesions, 10 had no intubation difficulties. most patients with colonoscopic splenic injury present relatively soon after injury with signs or symptoms suggestive of a problem. the range in the reported literature extends from within 2 hours to as long as 10 days. fourteen of the 32 patients with available information presented with symptoms within 12 hours of colonoscopy. the remaining 18 patients presented over the following days. the vast majority of patients with information available presented with symptoms of pain (28/32). approximately half of these same patients also presented with evidence of hemorrhage or shock, or both (18/32). with the exception of 1 patient successfully managed nonoperatively, the only reports that did not include pain as a presenting symptom were also those in which the patients died, suggesting the patients were too moribund to complain of pain. the diagnosis and management of these colonoscopy - related splenic injuries has to some degree reflected the available technology and is similar to the management of traumatic splenic injuries. although most injuries were diagnosed, or at least confirmed, at laparotomy in the era before 1987, 21 of the 24 cases since 1989 have been diagnosed with noninvasive methods, such as computed tomography or ultrasonography. before the report of federle in 1983 , diagnosis of splenic injury sustained in trauma was indirect and was prompted by a positive diagnostic peritoneal lavage (dpl) leading to laparotomy. with the proven utility of ct in blunt abdominal trauma, only hemodynamically unstable patients now undergo dpl, and even that has been largely replaced by the focused abdominal sonography for trauma (fast) examination. the recognition over 100 years ago of the spleen's role in immunoprotection against encapsulated organisms, such as streptococcus pneumoniae, haemophilus influenzae, and neisseria meningitidis was largely ignored until the 1950s when a swing in the management of splenic injuries began the era of splenic salvage. besides splenorrhaphy, splenic salvage maneuvers now include nonoperative management of splenic injuries and splenic artery embolization of pseudoaneurysms. in the trauma literature, nonoperative management of lower grade injuries ( grades i though none of the injuries induced at colonoscopy were graded in the available reports, these are presumably not the pulverized high - grade injuries seen in trauma, and probably fall into the grade i thru iii category. however, overall only 27.8% of patients with a splenic injury by colonoscopy have retained their spleens. before 1988 , that rate has dropped to 61.5%, still higher than that predicted from the trauma literature. finally, our patient presented with a condition not previously reported in the colonoscopy literature. the formation of a secondary cyst is rare and is characterized by the lack of a cellular lining as seen in a primary cyst. successful percutaneous drainage under ultrasound guidance has been reported for splenic cysts secondary to blunt abdominal trauma, but not for those related to colonoscopy. our attempt at percutaneous drainage was similarly intended to prevent splenectomy, but unfortunately was unsuccessful. with only limited experience, this technique, however, should remain in the armamentarium for the treatment of these injuries. in the history of splenic injury by colonoscopy, the experience of the first decade was laparotomy and splenectomy in all patients. though ct scanning has proven successful in diagnosing the injury, relatively few patients have escaped the experience with an intact spleen. nonoperative management and splenic artery embolization have been used with significant success in the trauma setting, but used only sparingly with colonoscopic injuries. though our attempt at percutaneous control of the secondary cyst formed as a of a colonoscopic splenic injury was unsuccessful, we believe this could nevertheless represent an alternative to splenectomy in future patients.

injury to the spleen during routine colonoscopy is an extremely rare injury. diagnosis and management of the injury has evolved with technological advances and experience gained in the management of splenic injuries sustained in trauma. of the 37 reported cases of colonoscopic splenic injury, 12 had a history of prior surgery or a disease process suggesting the presence of adhesions. only 6 had noted difficulty during the procedure, and 31 patients experienced pain, shock, or hemoglobin drop as the indication of splenic injury. since 1989, 21/24 (87.5%) patients have been diagnosed initially using computed tomography or ultrasonography. overall, only 27.8% have retained their spleens. none have experienced as long a delay as our patient, nor have any had an attempt at percutaneous control of the injury. this report presents an unusual case of a rare complication of colonoscopy and the unsuccessful use of one nonoperative technique, and reviews the experience reported in the world literature, including current day management options.

in a classic little book, what is life? the great theoretical physicist erwin schrdinger considered one of biology's central questions: how can a living organism be accounted for by physics and chemistry? (schrdinger, 1944). in attempting to answer this question, schrdinger rightly focused on the centrality of the gene, and thus on the necessity of understanding the nature of mutations given that they are essential for identifying and investigating the nature of genes. because the chemical nature of the gene was unknown the paper by avery et al. demonstrating that dna was the genetic substance was published while what is life? was still in press schrdinger drew on max delbrck's atomic physics - based model of genetic mutation and the structure of the gene (timofeeff - ressovsky et al ., 1935) suggesting that the gene is a linear one - dimensional crystal. i.e., one whose elements do not repeat in a periodic way as in common crystals. although schrdinger's little book was not universally well received, especially by biologists, even a critic like linus pauling was willing to conclude that schrdinger's formulation of the theory of wave mechanics in 1925, for which he received the nobel prize in 1933, was basically responsible for modern biology because it developed largely on the basis of the new understanding of chemistry that quantum mechanics made possible (pauling, 1987 ; cited in dronamraju, 1999). quantum mechanics was certainly also at the core of schrdinger's speculations on the nature of the gene. molecular biologists, many of whom had been trained as physical scientists, especially crystallographers and physical chemists (such as max delbrck, linus pauling, francis crick, and matthew meselson, to name just a few). this was the dawn of the great molecular biology revolution that led to a vast increase in our understanding of genes and genomes and established the fundamental nature of the gene as a nucleic acid molecule comprised of a string of distinct nucleotide bases whose sequence normally specifies a gene product which can effect or influence the expression of phenotype during growth and development. interestingly, a complementary way of thinking about the nature of the gene that came to be associated with the term epigenetics also had its origins in the 1930s and 1940s. the epigenetic perspective pointed toward a more complicated reality for the nature of genes that was largely sidelined for several decades by the molecular biology revolution for good reason, because it was molecular biology that would have to develop the tools and approaches to eventually understand the molecular basis of the epigenetic perspective. thus, the two perspectives existed in parallel, with little cross - talk, simply because molecular biology had to develop and mature to the point that it could consider and address the epigenetic perspective. as first noted by brink, the epigenetic perspective was presaged by none other than morgan, when he noted the possibility that the genes also are building up more and more, or changing in some way as development proceeds, in response to that part of the protoplasm in which they come to lie. this view of the gene as dynamically changing in development without losing its fundamental properties (morgan, 1934) has been undergoing a renaissance in recent years, as it has become increasingly clear that the dna - focused understanding of the gene that had revolutionized genetics and biology is actually incomplete without its complement, the chromatin-centered perspective of epigenetics. the chromatin - centered perspective on the gene was first elaborated 50 years ago by r. alexander brink. in a classic paper, brink inferred that eukaryotic chromosomes not only have a genetic function, but also possess what he termed a he proposed that a genetic locus was thus comprised of two types of chromatin, which he termed orthochromatin and parachromatin. brink defined orthochromatin as the substance at a locus that remains qualitatively constant in all nuclei of an individual and is presumably comprised of the dna at a given locus. parachromatin, on the other hand, brink proposed to be comprised of alternative states of chromatin that can be altered by factors arising in development or in response to the environment, and that these states can adopt a succession of mitotically transmissible states, together reflecting the progressive history of a cellular lineage. brink explicitly noted that the concepts of euchromatin and heterochromatin are fundamentally different than the concepts of orthochromatin and parachromatin, especially in that the locations of the former pair are mutually exclusive, whereas the latter pair are co - located intimately at the same genetic locus. brink based his hypothesis of a paragenetic function for chromosomes on observations that he and two other maize geneticists, barbara mcclintock and edward coe, made in the 1950s, which demonstrated the existence of two types of genetic variations, classical mutations and what he termed paramutations. paramutations, in the broadest use of the term (brink, 1960), are directed, for instance by particular paramutations are also typically reversible and changeable, often exhibiting a series of quantitatively or qualitatively varying states. brink argued that although paramutations violate mendel's laws, their occurrence implies the existence of processes by which genes change in development and supports morgan's contention that the genes might change in development without losing their fundamental (i.e., genetic) properties. brink's definition of parachromatin allowed great latitude in the nature, composition, and dynamic behaviors of parachromatin. in modern terms , we would include not only histone proteins and their various modification states, but also the many, diverse chromatin proteins and complexes that remodel chromatin into new states that may be comprised of conformational alterations, covalent modifications, and/or changes in molecular composition. explicitly included in such chromatin states would be not only proteins, but also rna molecules of various types, including but not limited to sirnas produced by rna interference - related chromatin complexes. thus, the modern view of chromatin at a given locus is one of a highly dynamic entity that fits well with brink's concept of parachromatin. even though brink had no understanding of the molecular nature of chromatin, his hypothesis was flexible enough to fully encompass our modern understanding of chromatin. brink's concept of parachromatin offered a broad general perspective on the nature, behaviors, and functions of genes in eukaryotes. but it was impossible in 1960 for brink to specify any molecular details or mechanisms that comprise parachromatin. only 1 year later, jacob and monod offered a simple, straightforward molecular biological model of the control of gene expression in prokaryotes that revolutionized thinking about how genes were expressed and regulated and that seemed to have the potential to account for the gene regulation in complex eukaryotes as well. parachromatin was largely forgotten for decades, as molecular biologists and geneticists explored the jacob monod model of gene regulation in great detail, first in prokaryotes and then in eukaryotes. eventually, however, it came to be recognized that simple models based on transcription factors binding to specific dna sequences were insufficient on their own to explain the control of gene regulation in complex eukaryotes. molecular tools and approaches were developed that could begin to open a window on the higher order complexities of eukaryotic gene regulation. chromatin was gradually accepted, first as a mediator or modulator of transcription complex formation, and then as an active, dynamic participant in the entire transcription process. when the concept of the histone code or the histone language was developed around 2000, molecular biology was finally beginning to catch up to brink's concept of parachromatin. of course, we are still very far from being able to say that we fully understand the molecular basis of parachromatin, but i have little doubt that we have begun to open the door to a vast realm of possibilities waiting to be explored and to be defined molecularly and mechanistically. the chromatin - centered perspective on the gene was first elaborated 50 years ago by r. alexander brink. in a classic paper, brink inferred that eukaryotic chromosomes not only have a genetic function, but also possess what he termed a he proposed that a genetic locus was thus comprised of two types of chromatin, which he termed orthochromatin and parachromatin. brink defined orthochromatin as the substance at a locus that remains qualitatively constant in all nuclei of an individual and is presumably comprised of the dna at a given locus. parachromatin, on the other hand, brink proposed to be comprised of alternative states of chromatin that can be altered by factors arising in development or in response to the environment, and that these states can adopt a succession of mitotically transmissible states, together reflecting the progressive history of a cellular lineage. brink explicitly noted that the concepts of euchromatin and heterochromatin are fundamentally different than the concepts of orthochromatin and parachromatin, especially in that the locations of the former pair are mutually exclusive, whereas the latter pair are co - located intimately at the same genetic locus. brink based his hypothesis of a paragenetic function for chromosomes on observations that he and two other maize geneticists, barbara mcclintock and edward coe, made in the 1950s, which demonstrated the existence of two types of genetic variations, classical mutations and what he termed paramutations. paramutations, in the broadest use of the term (brink, 1960), are directed, for instance by particular paramutations are also typically reversible and changeable, often exhibiting a series of quantitatively or qualitatively varying states. brink argued that although paramutations violate mendel's laws, their occurrence implies the existence of processes by which genes change in development and supports morgan's contention that the genes might change in development without losing their fundamental (i.e., genetic) properties. brink's definition of parachromatin allowed great latitude in the nature, composition, and dynamic behaviors of parachromatin. in modern terms , we would include not only histone proteins and their various modification states, but also the many, diverse chromatin proteins and complexes that remodel chromatin into new states that may be comprised of conformational alterations, covalent modifications, and/or changes in molecular composition. explicitly included in such chromatin states would be not only proteins, but also rna molecules of various types, including but not limited to sirnas produced by rna interference - related chromatin complexes. thus, the modern view of chromatin at a given locus is one of a highly dynamic entity that fits well with brink's concept of parachromatin. even though brink had no understanding of the molecular nature of chromatin, his hypothesis was flexible enough to fully encompass our modern understanding of chromatin. brink's concept of parachromatin offered a broad general perspective on the nature, behaviors, and functions of genes in eukaryotes. but it was impossible in 1960 for brink to specify any molecular details or mechanisms that comprise parachromatin. only 1 year later, jacob and monod offered a simple, straightforward molecular biological model of the control of gene expression in prokaryotes that revolutionized thinking about how genes were expressed and regulated and that seemed to have the potential to account for the gene regulation in complex eukaryotes as well. parachromatin was largely forgotten for decades, as molecular biologists and geneticists explored the jacob monod model of gene regulation in great detail, first in prokaryotes and then in eukaryotes. eventually, however, it came to be recognized that simple models based on transcription factors binding to specific dna sequences were insufficient on their own to explain the control of gene regulation in complex eukaryotes. molecular tools and approaches were developed that could begin to open a window on the higher order complexities of eukaryotic gene regulation. chromatin was gradually accepted, first as a mediator or modulator of transcription complex formation, and then as an active, dynamic participant in the entire transcription process. when the concept of the histone code or the histone language was developed around 2000, molecular biology was finally beginning to catch up to brink's concept of parachromatin. of course, we are still very far from being able to say that we fully understand the molecular basis of parachromatin, but i have little doubt that we have begun to open the door to a vast realm of possibilities waiting to be explored and to be defined molecularly and mechanistically. the evolution from mendelian genetics toward what we might call molecular epigenetics via molecular biology's description of the gene as a nucleic acid molecule has an intriguing and perhaps instructive parallel in the evolution of physics from newtonian mechanics toward quantum mechanics via the planetary model of the atom in which electrons orbit the nucleus. the original concept of the atom, the fundamental entity of newtonian mechanics, had held that the atom was an indivisible particle. this concept was transformed twice first into the planetary model and then by quantum mechanics which redefined the atom as a field of probabilities of subatomic particles existing in four dimensions (three spatial dimensions and time). similarly, the original concept of the gene, the fundamental entity of mendelian genetics, was that it was also particulate and indivisible, a concept that has also been transformed twice first through the prism of genetics and molecular biology into the concept of a gene as a nucleotide sequence, divisible by recombination, and now again by molecular biology, looking through the prism of epigenetics, into what might be referred to as a field of possibilities of alternative chromatin states centered on a particular nucleic acid sequence, i.e., parachromatin, to use brink's terminology. as mentioned previously, alternative parachromatin states are assumed to be based on diverse chromatin proteins, rnas, and complexes that can exist in various conformational and covalent modification states that are adopted during growth and development and can differ among loci. in quantum mechanics, subatomic particles may be viewed in two very different ways, i.e., as both waves and particles; likewise, paramutations may be viewed both as gene expression states and as mitotically, and in some cases, meiotically heritable states. classical genetics and then molecular biology established the macro - framework of genetics in the same way that newtonian mechanics and then the planetary model of the atom established the macro - framework of physics. quantum mechanics ultimately led to the idea of wave - particle duality and the description of positions of subatomic particles as a field of probabilities that determine the chemical properties of a given atom. similarly, brink introduced the idea of a genetic paragenetic duality of genetic loci in which a genetic entity (dna) and a paragenetic entity (chromatin), both present at each genetic locus, are complementary and interdependent partners which we might describe as a field of possibilities that determine the expression states of a given locus. in drawing this parallel, i am not trying to suggest that the classical, molecular biological view of genetics is neither correct nor useful, any more than newtonian mechanics or the planetary model of the atom is neither correct nor useful. rather, i am simply suggesting that each represents early, incomplete descriptions of reality that required important modification and enrichment before we could fully understand the nature of the genetical and physical worlds, respectively. however, we ought not try to take the analogy too far because at some level of detail it most likely will break down. in the twentieth century, physics evolved beyond a deterministic view of the universe postulating that the future of the universe in theory could be extrapolated from the laws of physics if only one could obtain complete knowledge of the positions, directions, and velocities of movement of all particles in the universe. quantum mechanics, especially in heisenberg's uncertainty principle raised fundamental questions that challenged the possibility of precise knowledge of the future: for instance, the number of times per second that atoms in a lump of uranium will undergo radioactive decay is known with precision; however, why and when any particular atom will decay is unpredictable by modern physics. similarly, although geneticists can measure mutation frequency in a particular system under specific conditions, the timing of a particular nucleotide substitution (or any other mutational event) is unpredictable. thus, from an evolutionary genetic perspective, biology is no more deterministic than is physics, as tautz has analyzed in terms of population genetic theory. tautz argued that the selective fitness of an advantageous mutation in a population and time comprise a canonically conjugated pair of variables analogous to such pairs of physical variables, such as the location and momentum of a particle, or the energy of a particle and the time at which it was measured. he showed that uncertainty is largest at low allelic frequency and when the selective advantage is small. the specific trajectory of such an allele in a population of finite size is well known in population genetics to be unpredictable, and only probabilities for different trajectories can be determined. with the advent of genomics, it is theoretically possible to know with absolute certainty the sequence of a region of chromosome carrying a gene and even the sequence of an entire chromosome. however, as stadler noted, it is not trivial to precisely locate a gene, i.e., it can not be shown to be delimited from neighboring genes by definite boundaries. this follows from stadler's definition of the gene: operationally, the gene can be defined only as the smallest segment of the gene - string that can be shown to be consistently associated with the occurrence of a specific genetic effect. in modern terms, knowing the complete sequence of a chromosome does not allow us to precisely determine all of the many interdependent elements of a gene, including all those elements in cis that are necessary for the normal operation of a given gene that is associated with a specific genetic effect (jorgensen, 2010). in addition, the expression and selective value of a gene in nature may often be dependent on the environment encountered by the organism, perhaps making it impossible to precisely identify the boundaries of a gene. distinct from quantum mechanics, it is also important to recognize the relevance to biology of complexity theory, which has identified another type of uncertainty in physics, ing from sensitive dependence on initial conditions such that relatively simple newtonian systems may exhibit unpredictable chaotic behaviors due to the impracticality of knowing initial conditions precisely enough. similarly, it should be evident that knowing all alternative epigenetic states of a given gene in all environments may be unachievable in any practical sense. this is essentially no different than what is postulated in complexity theory, namely, that it is impractical to know with enough precision the locations and movements of all particles of a system in order to predict future behavior with any certainty, at least in certain systems and under certain conditions. perhaps then , the most we can hope to achieve is to determine or estimate the field of possibilities that comprise the orthochromatin and parachromatin components of each gene. the marriage of epigenetics and molecular biology promises to deepen and revolutionize our understanding of the fundamental nature of the gene, allowing us to see deeply into its field of possibilities. it is going to be very interesting to learn what degree of knowledge of the field of possibilities that comprise a gene we will be able to obtain. though i will be happy to be proved wrong, my strong suspicion is that while we will be able to learn a lot about a given gene, we can never know what we do not know about it, i.e., its complete field of possibilities will be not be determinable simply because it will be impossible to anticipate for every gene every circumstance that an organism may encounter. finally, given the rapidly increasing interest in the phenomenon of transgenerational (meiotic) inheritance of epigenetic and paragenetic states and their possible evolutionary consequences, it is also interesting to consider that epigenetics may also revolutionize our understanding of biological evolution (perhaps similar to how understanding of atomic particles continues to revolutionize our understanding of the evolution of the universe). many biologists, especially plant biologists, have long postulated that information may sometimes flow backward from the environment to the gene via epigenetic impositions on the genome (altering states of brink 's parachromatin) and have suggested the possibility for the generation of novel genetic variations which, in the words of barbara mcclintock, might this seemingly radical suggestion (which was not lamarckian, but rather a modified darwinian mechanism) led to a great deal of criticism and misunderstanding of mcclintock unfair criticism, as i have argued previously; rather than repeat that discussion here, i would refer the interested reader to jorgensen. the author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

the perspective presented here is that modern genetics is at a similar stage of development as were early formulations of quantum mechanics theory in the 1920s and that in 2010 we are at the dawn of a new revolution in genetics that promises to enrich and deepen our understanding of the gene and the genome. the interrelationships and interdependence of two views of the gene the molecular biological view and the epigenetic view are explored, and it is argued that the classical molecular biological view is incomplete without incorporation of the epigenetic perspective and that in a sense the molecular biological view has been evolving to include the epigenetic view. intriguingly, this evolution of the molecular view toward the broader and more inclusive epigenetic view of the gene has an intriguing, if not precise, parallel in the evolution of concepts of atomic physics from newtonian mechanics to quantum mechanics that are interesting to consider.

the world health organization states that ~347 million people, roughly 9.5% of the adult population, were suffering from diabetes in 2008. the incidence of diabetes is rapidly increasing with estimates suggesting that this number will almost double by 2030. diabetes mellitus is a major cause of chronic kidney disease (ckd) worldwide and is associated with enhanced morbidity and mortality, in particular accelerated cardiovascular disease. diabetic nephropathy (dn) is now the most common cause of end - stage renal failure in the western world. clinical associations that frequently precede overt dn are hypertension and poor glycaemic control, although a subset of patients develop nephropathy despite the proper glycemic control and normal blood pressure. once nephropathy is established, blood pressure often rises further, but glycaemic control can paradoxically improve as a of reduced renal insulin clearance. it is postulated that the interplay between metabolic and hemodynamic pathways plays an important role in the development and progression of dn (figure 1). increased systemic and intraglomerular pressure activation of the renin - angiotensin - aldosterone system (raas) has been recognized as a key component of dn progression. additionally, chronic hyperglycemia promotes the generation of advanced glycation end - products (ages). it is widely accepted that ages mediate their effects both directly and indirectly through receptor - dependent mechanisms. the receptor for age (rage) acts as a signal transduction receptor, and the rage - age interaction activates multiple intracellular signalling pathways which increase the production of growth factors, inflammatory cytokines, and oxidative stress (figure 1). in recent times, a novel class of non - coding rna, microrna (mirna ; mir), has been found to be expressed in all tissues and plays important roles in tissue homeostasis and disease progression. whilst the role of mirna in the pathogenesis of dn has been extensively reviewed by others in relation to growth factors and fibrosis in dn, the focus of this review is on the role of mirna in the renin - angiotensin system and the age / rage signalling pathway, and their downstream the mediators such as oxidative stress and the immune response in the context of diabetic nephropathy. mirnas are a group of small (~22 nucleotide) single - stranded non - coding rnas ubiquitously expressed in plants and animals where they act posttranscriptionally to modulate the expression of target genes. they were first discovered in 1993 when lin-14 protein expression was found to be regulated by the mature product of the lin-4 gene in caenorhabditis elegans (c. elegans). the mechanism was found to rely upon sequence specificity in the 3-untranslated region (utr) of lin-14 to which lin-4 bound. whilst this occurred with only partial complementarity, the binding occurred with sufficient affinity to in inhibition of protein translation. at the time this was considered a peculiarity in the worm. it was not until 2000 when another such regulator, let-7, was discovered in c. elegans, and soon after came the realisation that this form of regulation was conserved across many species, representing a general mechanism for regulating the expression of several genes. mirnas are found in intergenic sequences or on the antisense strand of genes and may possess their own promoter and regulatory sequences. other mirnas (almost 50% in the case of human mirna) are found within gene sequences and are together regulated with their host gene. approximately half are found in polycistronic units from which the mature mirnas are processed. the primary transcript (pri - mirna) is processed by a number of proteins including ribonuclease iii, drosha, and the rna binding protein, digeorge syndrome critical region gene 8 (dgcr-8) protein, into a short hairpin rna molecule termed the precursor mirna (pre - mirna) which is subsequently exported from the nucleus by exportin-5. once in the cytosol , further processing is mediated by another ribonuclease iii, dicer, and this is followed by the incorporation of the mature strand of the duplex mirna into the rna - induced silencing complex (risc) which includes the argonaute family of proteins. the mirna - risc complex stabilises the mirna against nuclease attack and mirna direct the complex to target rna transcripts via sequence complimentarity between the mirna seed sequence (28 nucleotides) and the mirna recognition element (mre) in the target transcript. mirnas modulate protein synthesis by binding to the 3 utr of mrnas via incomplete base pairing to the complementary seed sequence in the utr, leading to translational repression. mres are predominately located in the 3 utrs of mammalian mrna, however; there is evidence indicating that mirna can also mediate translational repression via binding 5 utrs or coding sequences. in plants and lower vertebrates where complete complimentarity exists between an mirna seed sequence and the target mrna, degradation of the target mrna in contrast, mirnas exercise finer control on protein expression in mammalian cells where they repress protein translation , allowing for more comprehensive regulation of protein expression as any single mirna can target many mrnas, and any mrna can be the target of several mirnas. this potential of mirnas to regulate many genes adds significant complexity to the interpretation of many studies where the focus is on single genes. it is therefore critical to computationally detect the combination of mirnas that target specific mrna molecules. such analyses often demand complex algorithms that need to be defined by high stringency levels to generate computational data that could then be assessed and validated in the wet lab. added to this is the recent discovery of circulating mirnas in microparticles and the potential of these mirnas to be delivered to sites distal to their generation. renin production is the key regulatory step that initiates an enzymatic cascade that leads to angiotensin generation and the control of blood pressure in addition to fluid and electrolyte homeostasis. renin is synthesized and released by renal juxtaglomerular (jg) cells, which are located at the entrance to the glomerulus. in early embryonic development, renin producing cells are broadly distributed along intrarenal arteries in the glomerular mesangium and in a few developing tubules. with maturation lineage studies demonstrate that this progressive restriction is achieved by differentiation of renin cells into vascular smooth muscle cells (vsmcs), mesangial cells, and a subset of tubular cells. were the first to address the role of mirna in the maintenance of jg cells by generating mice with a conditional deletion of dicer (dicer cko mice) specifically and exclusively in renin - expressing cells, ing in selective ablation of mirna generation only in renin cells and their descendants. deletion of dicer ed in severe reduction in the number of jg cells accompanied by decreased expression of the renin ren1 and ren2 genes, decreased plasma renin concentration (prc), decreased bp, abnormal renal function, and striking nephrovascular abnormalities including striped corticomedullary fibrosis. this study clearly showed a critical role of mirna in the orchestration of renal function and the importance of mirna homeostasis for specific organ functions. marques and colleagues conducted for the first time transcriptome - wide study of differential expression of mrnas and mirna in kidneys of hypertensive subjects (15 untreated hypertensive and 7 normotensive white males) by microarray technology. they confirmed differences of expression for nuclear receptor subfamily 4 group a member 1 (nr4a1), nr4a2, nr4a3, period circadian protein homolog 1 (per1), and salt - inducible kinase 1 (sik1) mrnas and for the mirnas hsa - mir-638 and hsa - let-7c by real - time quantitative pcr expression in the medulla. functional experiments confirmed the predicted binding of hsa - let-7c to the 3 untranslated region of nr4a2 mrna. in the renal cortex they confirmed differences in expression of apoptosis - inducing factor, mitochondrion - associated, 1 (aifm1), alpha-1-microglobulin / bikunin precursor (ambp), apolipoprotein e (apoe), cluster of differentiation 36 (cd36), ephrin - b1 (efnb1), nadh dehydrogenase (ubiquinone) complex i, assembly factor 1 (ndufaf1), peroxiredoxin 5 (prdx5), ren, renin binding protein (renbp), solute carrier family 13 (sodium / sulfate symporters), member 1 (slc13a1), syntaxin 4 (stx4), and troponin t type 2 (cardiac) (tnnt2) mrnas, and the mirnas hsa - mir-21, hsa - mir-126, hsa - mir-181a, hsa - mir-196a, hsa - mir-451, hsa - mir-638, and hsa - mir-663. functional experiments demonstrated that hsa - mir-663 can bind to the ren and apoe 3 untranslated regions regulating ren and apoe mrna levels, whereas hsa - mir-181a regulated ren and aifm1 mrna. a major discovery was evidence for ren mrna regulation via binding of mirnas hsa - mir-181a and hsa - mir-663 to its 3 utr as the observed downregulation of these 2 mirnas in hypertension could explain the elevation in intrarenal renin mrna. due to small sampling size , these findings need to be bolstered by the acquisition of suitable samples from larger cohorts of untreated hypertensive subjects in other settings. chronic kidney disease (ckd) is a known cardiovascular risk factor, and most patients with ckd die of cardiovascular disease (cvd) before reaching the need for dialysis. chen and colleagues measured vascular mirnas in blood from 90 patients with ckd and found an association between decreased circulating levels and progressive loss of egfr by multivariate analyses. expression of vascular mirnas was decreased in the thoracic aorta of ckd rats compared to normal rats, with concordant changes in target genes of runx2, at1r, and myocardin with no alteration in drosha or dicer, indicating that the low levels of expression are not due to altered intracellular processing. furthermore, the expression of mir-155 was negatively correlated with calcification of the aorta, a process known to be preceded by vascular dedifferentiation in these animals. overexpression of mir-155 in vsmc from ckd rats inhibited at1r expression and decreased cellular proliferation, confirming a causative role of low mir155 in vsmc transformation to a more synthetic, proliferative phenotype. however, whether downregulation of these mirnas is the cause or consequence of the widespread vascular phenotype abnormalities in patients with ckd remains to be determined. jeppesen and colleagues have shown that angii regulates five mirnas (mir-29b, -129 - 3p, -132, -132 - 5p, and -212) during in vitro stimulation of primary cardiac fibroblasts and of hek293n cells overexpressing the at1r. furthermore, eskildsen and colleagues undertook a detailed analysis of potential mirnas involved in angii - mediated hypertension in rats and hypertensive patients, using mirna microarray and qpcr analysis. mir-132 and mir-212 are highly increased in the heart, aortic wall, and kidneys of rats with hypertension (159 12 mm hg) and cardiac hypertrophy following chronic angii infusion. in addition, activation of the endothelin receptor, another gq coupled receptor, also increased mir-132 and mir-212. a significant downregulation of mir-132 as well as a robust attenuation of mir-212 in human arteries from the arb - treated patients was also observed, whereas treatment with -blockers had no effect. in , mir-132 and mir-212 are upregulated in angii - induced hypertension in organs associated with blood pressure control, possibly via the gq - dependent pathway. table 1 contains mirnas that are known to be regulated by the renin - angiotensin system in the kidney and other tissues and associated with kidney disease, hypertension, and cardiovascular disease. chronic hyperglycemia promotes the generation of advanced glycation end products (ages) as a of sequential biochemical reactions involving nonenzymatic glycation of protein and lipids known as the maillard reaction. as a consequence of age formation ages can induce expression of the mcp-1 in podocytes through activation of the age receptor (rage) and generation of intracellular reactive oxygen species (ros). the induction of oxidative stress in upregulation of nuclear factor (nf)-b and various nf-b - mediated proinflammatory genes, eventually leading to glomerular and tubulointerstitial injury. therefore, age / rage and oxidative stress signalling are important in the progression of dn and targeting this axis by modulating the mirnas that are involved is a potential new therapy. there are very few studies examining the role of mirna in age / rage signalling related to kidney disease. most studies have focussed on the role of rage in the immune system or cancer because rage is a member of the immunoglobulin superfamily of cell surface molecules. when dicer was selectively inactivated in mouse podocytes, multiple abnormalities were observed in glomeruli of mutant mice, including foot process effacement, irregular and split areas of the glomerular basement membrane, podocyte apoptosis and depletion, mesangial expansion, capillary dilation, and glomerulosclerosis. gene profiling by microarray analyses revealed upregulation of 190 genes in glomeruli isolated from mutant mice at the onset of proteinuria compared with control littermates. target sequences for 16 mirnas were significantly enriched in the 3-untranslated regions of the 190 upregulated genes. further, supporting the validity of the in silico analysis, 6 of the 8 top - candidate mirnas were identified in mirna libraries generated from podocyte cultures; these included mir-28, mir-34a, and four members of the mir-30 family, mir-30c-1, mir-30b, mir-30d, and mir-30c-2. among the 15 upregulated target genes of the mir-30 mirna family, rage, vimentin, heat - shock protein 20, and immediate early response 3 were known to be expressed in injured podocytes in experimental models and human kidney disease. rage and immediate early response 3 are known to mediate podocyte apoptosis, whereas vimentin and heat - shock protein 20 are involved in cytoskeletal structure. the findings demonstrate the important roles of the mir-30 family in podocyte homeostasis and podocytopathies. s100b, a rage ligand, significantly increased cox-2 mrna accumulation in thp-1 monocytes at 2 h via mrna stability. s100b decreased occupancy of the dna / rna - binding protein, heterogeneous nuclear ribonuclear protein k (hnrnpk), at the cox-2 promoter but simultaneously increased its binding to the cox-2 3-utr. additionally, s100b significantly downregulated the expression mir-16 which acts to destabilize cox-2 mrna by binding to its 3-utr. these demonstrate that diabetic stimuli can efficiently stabilize inflammatory genes via opposing actions of key rna - binding proteins and mirna. ages delay spontaneous apoptosis of monocytes and contribute to the development of inflammatory responses. in genome - wide mirna expression analysis significant upregulation of mir-214 was consistently observed in thp-1 and human monocytes treated with various ages. a striking increase in mir-214 overexpression of pre - mir-214 led to impaired pten expression and delayed apoptosis of thp-1 cells, whereas knockdown of mir-214 levels largely abolished age - induced cell survival. these findings define a role for mir-214-targeting of pten in age - induced monocyte survival. high - mobility group box 1 protein (hmgb1) is a late inflammatory cytokine that signals danger to the immune system through the rage and toll - like receptor. mir-221 and mir-222 are involved in cell proliferation through the inhibition of the cell cycle regulator, p27kip1, in smooth muscle cells and endothelial cells (ecs). hmgb1 increases the expression of mir-221 and mir-222 in primary cultures of excised papillary lesions and in an established papillary cancer cell line and overexpression of mir-222 and mir-221 caused by hmgb1 increases growth and motility in papillary thyroid cancer cells. recently, it was reported that mir-21 and mir-221, which are tissue inhibitors of metalloproteinases (timp)3-targeting mirna, were significantly upregulated in kidneys from diabetic mice compared to control littermates and in a mesangial cell line grown in high glucose conditions. mesangial expansion is one of the main characters in dn and is mainly due to accumulation of extracellular matrix (ecm). ecm turnover is regulated by timps activities. in diabetic conditions, timp3 expression in kidney mir-221/mir-222 cluster which has been examined in several cardiovascular disorders affects the angiogenic activity of stem cell factor (scf) by targeting the receptor c - kit. high glucose levels elevate mir-221 and this correlates with decreased expression of c - kit and reduced ec migration. mir-221/222 targets no synthase and transcription factor ets-1 which are both major contributors to the atherosclerotic process. taken together, these indicate that hmgb1/rage and mir-221/222 axis may be activated in the kidney and vasculature ing in ecm accumulation and atherosclerosis in dn patients. table 2 lists the mirnas that are known to be modulated by the age / rage in kidney, monocytes, vsmcs, and ecs and associated with kidney disease and vascular dysfunction. reactive oxygen species (ros) is a collective term that includes a number of reactive and partially reduced oxygen (o2) metabolites. some of them are free radicals, such as superoxide anion (o2) and hydroxyl radicals (oh) that are extremely reactive molecular species with an unpaired electron in their outer orbital. a number of studies have demonstrated that both type 1 and type 2 diabetes are associated with overproduction of oxygen - derived free radicals. increased ros production and reduced levels of antioxidants culminate with an in increased level of oxidative stress leading to oxidative damage to cellular components. among the many enzymatic systems implicated in ros generation in vascular tissues, enzymes of the mitochondrial respiratory chain (complexes i and iii), xanthine oxidase, uncoupled nitric oxide synthase, and nicotinamide adenine dinucleotide phosphate reduced form (nadph) oxidase (nox) appear to be particularly important. increased nox - mediated superoxide production has been reported in experimental models of diabetes and occurs in parallel with upregulation of nox1 and nox4. nox - mediated generation of superoxide is an important mediator of matrix accumulation, renal fibrosis, and podocyte injury in dn. mir-377 is upregulated in spontaneous and stz - induced mouse models of dn and in mesangial cells exposed to high glucose and tgf-1. furthermore, genes potentially relevant to the pathogenesis of dn were confirmed experimentally, including the cytoskeletal regulator p21-activated kinase 1 (pak1) and superoxide dismutases (sod1/sod2) that catalyse ros, which accumulates in response to hyperglycemia. it has previously been shown that upregulation of the mir-23a~27a~24 - 2 cluster induces caspase - dependent and caspase - independent cell death in human embryonic kidney cells via c - jun n - terminal kinase (jnk) with increases in ros and the release of proapoptotic factors such as cytochrome c (cyt c) in addition to apoptosis - inducing factor (aif) from the intermembrane space of mitochondria to the cytosol. in order to better understand the molecular mechanism responsible for mir-23a~27a~24 - 2 cluster - induced cell death, gene expression profiling was performed in control and mir-23a~27a~24 - 2 cluster overexpressing hek293 t cells. this revealed mir-23a~27a~24 - 2 cluster - induced apoptosis was associated with endoplasmic reticulum (er) stress and the unfolded protein response (upr) pathways in hek293 t cells. overexpression of the mir-23a~27a~24 - 2 cluster ed in er stress and altered mitochondrial membrane permeability and this was further established by increased intracellular and mitochondrial calcium levels in hek293 t cells. there have been reports that mir-23b levels were increased in the kidneys of tgf-1 transgenic mice and rats following subtotal nephrectomy, which was found to be localized to podocytes and tubular epithelium by in situ hybridization. mir-23b was also upregulated by tgf-1 in cultured renal epithelial cells. in vitro gain and loss - of - function studies pointed to several mir-23b targets, including tgf- receptor type ii, smad3, and tgf-1 itself, suggesting a negative feedback loop - regulating tgf-1 signaling. modulation of mir-23b in cultured podocytes altered expression of wt1, nephrin, and podocin and also influenced motility of cultured tubular cells. studies have found that in the aged organs, including the kidney, expression of antioxidant enzymes such as sod, catalase, gpx, and peroxiredoxins is downregulated thus leading to reduced antioxidant capacity. from bioinformatic analysis of the mirna expression profile of young and old rat kidneys, mitochondrial sod2 and thioredoxin reductase 2 (txnrd2) are potential targets of mir-335 and mir-34a, respectively, as aging mesangial cells exhibited significant upregulation of mir-335 and mir-34a and marked downregulation of sod2 and txnrd2. further studies confirmed sod2 and txnrd2 as target genes of mir-335 and mir-34a which coincided with ros generation. within the mitochondria, uncoupling protein 2 (ucp2) has recently been reported as a negative regulator of ros generation. its ablation leads to marked increase of oxidative stress in several cell types. in the stroke - prone spontaneously hypertensive rat (shrsp) kidneys, severe renal damage along with increased rate of inflammation and oxidative stress ucp2 gene and protein levels were downregulated paralleled by differential expression of kidney mir-24 and -34a, which were identified to target the ucp2 gene. the silencing of the ucp2 gene in renal mesangial cells led to increased rate of ros generation, increased inflammation and apoptosis, reduced cell vitality, and increased necrosis, suggesting that ucp2 is critical in preventing oxidative stress damage in renal mesangial cells. specific mirnas, including mir-205 and the mir-200 family (mir-200a c, mir-141, and mir-429), were shown to mediate epithelial - to - mesenchymal transition (emt) in response to tgf-1 in madin - darby canine kidney cells. downregulation of these mirnas relieves their cooperative repression of the mesenchymal transcription factors zeb1 and sip1 that, in turn, are free to inhibit e - cadherin expression promoting epithelial dedifferentiation. assessed changes in mirna expression in the cultured renal tubular cell line hk-2 under hypoxia - reoxygenation - induced oxidative stress or er stress using mirna microarray assay and real - time rt - pcr. among altered mirna expression, mir-205 was markedly decreased in both stress conditions. functional analysis revealed that decreased mir-205 led to an increase in cell susceptibility to oxidative and er stresses and that this increase was associated with the induction of intracellular ros and suppression of antioxidant enzymes. furthermore, mir-205 bound to the 3-utr of the prolyl hydroxylase 1 (phd1/egln2) gene and suppressed the transcription level of egln2, which modulates both intracellular ros level and er stress state. mirna profiling of huvec treated for 8 and 24 hrs with 200 m hydrogen peroxide (h2o2) showed that mir-200c and the cotranscribed mir-141 increased more than eightfold. mir-200c overexpression in huvec recapitulates many aspects of the oxidative stress - induced phenotype, since it induces cell growth arrest, apoptosis, and cellular senescence. all these effects are mediated, at least in part, by the inhibition of the target zeb1 by the mir-200 family. mir-200 family induction following h2o2 exposure has been confirmed in different cell lines such as human and mouse immortalized fibroblasts, colon carcinoma (ct26), mammary gland epithelial cells (nmumg) and human cell lines, melanoma cells (mda - mb-435s), kidney cells (293 t), breast adenocarcinoma (mda - mb-436 and bt-549), and ovarian adenocarcinoma (skov3). notably, in all these cell lines, all mir-200 family members were upregulated. in a recent study, an analysis of mirnas upregulated in diabetic mouse heart compared to control was performed revealing that mir-200c and mir-141 were among the most upregulated. the authors show that mir-141 targets the inner mitochondrial membrane phosphate transporter, solute carrier family 25 member 3 (slc25a3), which provides inorganic phosphate to the mitochondrial matrix and is essential for atp production, suggesting an important role of mir-200 family in mitochondrial responses involved in cardiac diseases associated with diabetes and obesity. on the contrary to the role for mir-200 family in oxidative stress, the mir-200 family also plays an important role in emt, which is considered to mediate production of renal fibroblasts, in part by targeting zeb1/2, the transcriptional repressors of e - cad. on the other hand , another group has demonstrated that tgf- activated akt in glomerular mesangial cells by inducing mir-200b and mir-200c, both of which target fog2, an inhibitor of phosphatidylinositol 3-kinase activation, suggesting the role of mir-200 family on glomerular mesangial hypertrophy in the progression of dn. some of the differences may relate to variances in experimental models and/or conditions; however, one often overlooked explanation is that some effects of mirna and inhibitors are likely to be indirect in nature. recent evidence demonstrates regulation of gene expression via deadenylation, by altering message stability, and by effects on transcription. bioinformatics utilising pathway analysis will be needed to better understand the crosstalk between factors that drive many downstream processes and how those processes ultimately impact the expression of individual genes. mirna profiling of rat vsmcs treated with 200 m h2o2 for 6 hours revealed an upregulation of mir-21. this study showed that mir-21 participates in h2o2-mediated gene regulation via its target programmed cell death 4 (pdcd4) and transcription factor ap-1 pathway activity. elevated mir-21 is thought to contribute to atherosclerosis by directly targeting ppar, leading to an increased inflammatory response in ecs. inhibition of mir-21 causes activation of ap-1 as well as upregulation of proinflammatory factors such as vcam-1 and mcp-1. mir-21 can also act as an inhibitor of angiogenesis by reducing ec proliferation, migration, and tube formation in culture via inhibition of rhob. mir-21 can also increase nitric oxide (no) in huvecs exposed to shear stress via increased phosphorylation of nitric oxide synthase (nos) and decreased apoptosis. this activity is balanced by the ability of mir-21 to repress sod-2 which is important in antioxidant defence. furthermore, mir-21 is elevated in angiogenic precursor cells by asymmetrical dimethylarginine (adma) which is a powerful nos inhibitor, ultimately ing in elevated intracellular reactive oxygen (ros) species. knockdown of mir-21 decreased mesangial expansion, collagen i / iv, and fn1 expression and reduced macrophage infiltration and tnf and mcp-1 expression. the gene expression changes were replicated in vitro in both ptc and mesangial cells (mcs) with mir-21 overexpression enhancing fibrogenesis via a mechanism which in part involved the direct targeting of smad7. interestingly, mir-21 targets pten and also leads to decreased mesangial expansion in db / db mice. mir-21 has also been implicated in regulation of tgf- signalling in a number of animal models of tubulointerstitial fibrosis and associated renal dysfunction. in one such model, smad7 overexpression in the rat unilateral ureteral obstruction model has restored mir-21 expression to normal levels with congruent improvements in renal pathology. in line with a profibrotic role for mir-21, upregulation of this mirna furthermore, regulation of pdcd4 by mir-21 enhances podocyte apoptosis and loss in conjunction with increased tubular epithelial cells survival against growth arrest signals. mir-210 appears to function as master regulator of the hypoxic response as it was found to be upregulated by hypoxia in virtually all the cell types tested to date. recent data demonstrate that hif1 can block both mitochondrial respiration via the electron transport chain (etc) through transcriptional activation of mir-210 in some cell types. upregulation of mir-210 along with vegf and vegfr2 expression was confirmed in renal ischemia / reperfusion (i / r) injury of male balb / c mice. furthermore, overexpression of mir-210 in huvec-12 cells enhanced vegf and vegfr2 expression and promoted angiogenesis in matrigel in vitro. these suggest that mir-210 may be involved in targeting the vegf signaling pathway to regulate angiogenesis after renal i / r injury. table 3 summarises the mirnas that are regulated by oxidative stress in the kidney and other tissues and associated with kidney disease and vascular dysfunction ing from excessive ros production. considerable progress has been made in identifying a number of important roles for mirna in various biological processes and in disease. there is much excitement at the prospect that some mirnas appear to be important to the regulation of several related processes in diabetes and its complications, including the modulation of the raas and oxidative stress pathways. the number of mirnas relevant to these conditions is constantly increasing (tables 13). it is encouraging that in some cases restoring the expression of a dysregulated mirna can attenuate or even reverse disease. our initial understanding of gene regulation has continued to change from simple concepts in terms of protein factors sitting on dna to complex epigenetics involving chromatin dynamics and multiple histone and dna modifications. even this complexity has been superseded by the ability of mirna to modulate the expression of multiple targets posttranscriptionally. whilst the biology around mirna continues to generate new and interesting findings , the challenge of the future is to translate some of the exciting experimental findings to the potential therapeutic interventions.

micrornas (mirna) are a novel class of small, noncoding rna molecules that have gained the attention of many researchers in recent years due to their ability to posttranscriptionally regulate the expression of families of genes simultaneously. their role in normal physiology and pathobiology is intriguing and their regulation in normal and disease states is fascinating. that the cells can return to a state of homeostasis when these small molecules are perturbed is truly remarkable given the multiple cellular targets of each mirna and that many mrnas are targeted by multiple mirnas. several reviews have covered aspects of mirna function in biology and disease. here, we review the role of mirna in regulating the renin - angiotensin system, age / rage signalling, and under conditions of oxidative stress in the context of diabetic nephropathy.

these are two distantly related groups of eukaryotes that have similar lifestyles. both feed by osmotrophy. the cells secret enzymes that decompose organic matter and the metabolites are imported into the cell. fungi are more closely related to animals than to oomycetes, whereas diatoms, a group of photosynthetic algae, are a sister group to oomycetes. , the oomycete and fungi genomes are not among the genomes for which traditional phylogenomic studies have indicated a significant role of gene transfer in eukaryotes. nevertheless, targeted evolutionary studies have suggested that gene transfer contributed to the similarities between the groups. they could identify dozens of gene transfers between the groups using a wide range of genomes from both groups together with clustering and phylogenetic methods. interestingly, all transfers except one were reported to have occurred in the direction from fungi to oomycetes. many of the transferred genes encode secreted decomposing enzymes and were specifically acquired by plant - tissue colonizing oomycetes. these show that oomycete most likely are more recent plant pathogens than fungi and that transfer of genetic material from a distantly related eukaryotic group have played an important role in evolution of their pathogenic lifestyle. these fascinating would not have been obtained with a traditional phylogenomic approach in which genes with strong sequence similarities to other eukaryotes would have been assumed to be present in the common eukaryotic ancestor. studies of gene transfer are indeed able to shed light on the diversification process of eukaryotes. choanoflagellates are a group of free - living microbial eukaryotes which are the closest relatives to animals. sun and coworkers used a directed phylogenomic approach to search for genes of algal origin in the genome of monosiga brevicollis, a phagotrophic unicellular choanoflagellate. using realistic filtering criteria they were able to identify 103 genes with strong support for algal origin, mostly from haptophytes, diatoms and green algae. this could be the of repeated transfer of genes from food; choanoflagellates feed on bacteria and other eukaryotes. alternatively, or rather in addition , the genes could have been introduced from a past algal endosymbiont in the lineage leading to monosiga. interestingly, a quarter of the identified genes appeared to first have been transferred from bacteria to a eukaryotic alga, and then secondarily to choanoflagellates. however, such a bacterial origin would not have been detected using a typical phylogenomic approach since the strongest sequence similarity would be to algal gene of bacterial origin. functions in amino acid and carbohydrate metabolism dominated among the gene transfer candidates, indicating that these choanoflagellates have adapted by acquisition of algal genes that expand their metabolic repertoire. the two examples outline above test well - defined hypotheses about gene transfers by using directed phylogenomic methods in combination with careful filtering and interpretation of the . they are very powerful to characterize the role of gene transfers between distantly related eukaryotic groups in the adaptation of eukaryotes. however, one disadvantage is that the approach relies on existing knowledge of the biology of the organisms; if only transfers between two organismal groups are addressed important contributions from other groups may be missed in such phylogenomic approaches. in addition, these kinds of studies can only estimate minimal number of transfers between the groups analyzed; the number of false negatives may be large. to circumvent these problems i applied an alternative approach to study these issues. i first identified patchily distributed proteins because these are expected to be enriched with gene transfer events (fig . 1), instead of screening for unexpected sequence similarities then i performed phylogenetic analyses for each identified gene family to evaluate whether the patchy distribution was a consequence of gene transfer, or differential loss in the eukaryotic domain. the soil - dwelling cellular slime mold d. discoideum was selected in the case study for two reasons: an active research community have produced a high quality annotation of the genome sequence (http://dictybase.org/), and only 18 potential gene transfers were reported in the original publication. i identified 49 protein families in the dictyostelium genome which were shared with at least one prokaryotic species, but only a limited number of other eukaryotes and prokaryotes (fig . 1). the evolutionary history of these patchily distributed families were analyzed further. for seven of the families the remaining 42 families contained sequences from one or more eukaryotic species outside the dictyostelium genus. the closest relative with a completely sequenced genome, the human parasite e. histolytica, was represented in only two families. in contrast, the amoeboflagellate naegleria gruberi had a representative in 25 of the families. dictyostelium and naegleria are having somewhat overlapping lifestyles, they are both free - living heterotrophs that can be found in soil and they both undergo cell differentiation under certain conditions. however, they are distantly related eukaryotes classified within two different supergroups: amoebozoa and excavata. there exist at least two alternative plausible explanations for this striking gene - sharing pattern. these genes were present in the common ancestor of the dictyostelium and naegleria and distributed in eukaryotes strictly by vertical inheritance. in lineages that have different lifestyles (i.e., parasites) alternatively, the genes have been distributed via gene transfer in more recent evolutionary timescales providing selective advantage to the recipient lineages. the vast majority of the phylogenetic trees showed strong indications of lateral gene transfer between prokaryotes and eukaryotes and within eukaryotes.figure 1b shows an example of an individual gene tree. the exact details of the transfer events could in many cases not be traced, because the density of organismal sampling was too low. nevertheless, there are no strong indications that any of the proteins have evolved solely via vertical inheritance and gene loss; gene transfer has likely affected all patchily distributed genes families identified in the analysis to some extent. only a single protein among the 49 identified as patchily distributed was among the 18 gene transfer candidates in the original d. discoideum genome publication, and very few were among the 184 lateral gene transfer candidates reported from n. gruberi. this may be surprising, but is logical if the details of the methods applied are considered. dictyostelium genes with significant similarity to a bacterial - specific pfam domain and only present in dictyostelium among eukaryotes were considered as gene transfer candidates. this conservative approach is unlikely to pick up false positives, but will be very prone to false negatives. genes acquired via gene transfer in two or more different eukaryotes are excluded, as are any genes without sufficient sampling among prokaryotes to be included in pfam. similarly, the n. gruberi gene set was screened with similarity searches, and genes with significant similarity only to prokaryotes were considered as gene transfer candidates. again, gene families with repeated transfers are missed in the screen and eukaryote - to - eukaryote transfers are not even considered. the true number of gene families in these microbial eukaryotes are likely much larger than has been reported. the spread of patchily distributed genes are part of this adaptation process, and there is no reason to assume that microbial eukaryotes do not take part of this flux of genetic material (fig . 1). for example, if a gene provide the ability to utilize a carbon compound present in the environment it is likely to spread to different microbes in the environment previously lacking this ability (provided that there are mechanisms in action). the assumption that a gene has a vertical eukaryotic history is violated as soon as two eukaryotic lineages inhabit a similar environment and acquire their copy of a particular gene family independently during the adaptation process. the traditional phylogenomic approaches will fail to identify members of such protein families as gene transfer candidates because they assume that vertical inheritance is the norm for all protein families with gene transfer events as very rare exceptions. however, this is probably only the case for universal core genes, and certainly not for patchily distributed proteins (fig . 1). traditional phylogenomic approaches probably only have scratched the surface of the gene transfer events and thereby drastically underestimated the impact of the process on eukaryotic genome evolution.

phylogenomic approaches have shown that eukaryotes acquire genes via gene transfer. however , there are two fundamental problems for most of these analyses; only transfers from prokaryotes are analyzed and the screening procedures applied assume that gene transfer is rare for eukaryotes. directed studies of the impact of gene transfer on diverse eukaryotic lineages produce a much more complex picture. many gene families are affected by multiple transfer events from prokaryotes to eukaryotes, and transfers between eukaryotic lineages are routinely detected. this suggests that the assumptions applied in traditional phylogenomic approaches are too nave and in many false negatives. this issue was recently addressed by identifying and analyzing the evolutionary history of 49 patchily distributed proteins shared between dictyostelium and bacteria. the vast majority of these gene families showed strong indications of gene transfers, both between and within the three domains of life. however, only one of these was previously reported as a gene transfer candidate using a traditional phylogenomic approach. this clearly illustrates that more realistic assumptions are urgently needed in genome - wide studies of eukaryotic gene transfer.

pc12risi0044 ), we conducted a retrospective review of all patients with ps treated in our hospital from march 2006 to february 2013. surgery was performed on 12 patients from among 239 patients who were diagnosed with ps using our inclusion / exclusion criteria (table 1). of these surgery was indicated when pain (buttock pain or mainly sciatica) was not relieved by conservative measures, including education for habitual position or physical activity change, medication, physical therapy, local steroid injections on the piriformis muscle, or extracorporeal shock wave therapy (eswt) for at least 3 months. twelve patients underwent surgery for ps and the average age of the patients (4 males and 8 females) who underwent surgery was 61 years (range, 45 to 71 years). the average duration of the symptoms before surgery was 22.1 months (range, 4 to 72 months), and the mean follow - up period was 22.7 months (range, 12 to 43 months). of the 12 patients who had piriformis muscle resection with / without neurolysis, 8 had underlying pathologies including spinal stenosis; 5 had been managed by spinal block and 3 had undergone lumbar spinal surgery, but their symptoms had not been relieved. three patients had a long - time, occupation - related, habitual sitting position, and 1 patient had a history of sacral fracture. we evaluated buttock pain with / without sciatica using a visual analog scale (vas ; 0, no pain ; 10, maximum pain) and recorded the responses preoperatively, and at 3 days and 12 months postoperatively. kruskal - wallis and mann - whitney u - tests were used for post hoc analysis to compare changes in vas for pain over time. the gluteus maximus was divided in the direction of its fibers by blunt dissection, and the fascia lata was incised in continuity where it overlaid the trochanter; we then removed the trochanteric bursa. the piriformis muscle was inserted into the posterior aspect of the greater trochanter as tendinous nature and was located above the obturator internus tendon (fig . the sciatic nerve was explored and found to pass anteriorly to the piriformis muscle in all cases . additionally, we divided the tight piriformis tendon at the insertion site at its tendinous portion . the proximal portion of the muscle was retracted when the leg was internally rotated after its division . neurolysis around the sciatic nerve into the sciatic notch was performed in two cases of a severely adherent sciatic nerve . severely dilated and engorged epineurial vessels were found in two cases with intractable sciatica ( fig . after surgery, patient activity with the assistance of a cane was encouraged to relieve pain from the gluteal muscle repair . the diagnostic procedure involved a detailed physical examination, including a palpation test for tenderness over the origin ( sacroiliac joint) or insertion of the short external rotators behind the trochanter (fig . the clinical examination also included several provocation tests for pain and weakness on resisted abduction and external rotation of the thigh in a sitting position ( pace test), pain on forced passive internal rotation of the extended thigh (freiberg 's test), and buttock and leg pain during passive straight leg raising (lasgue 's sign). in addition to electromyography, various imaging studies including ct, mri, and ultrasonography were performed, and a steroid injection into the piriformis muscle was carried out for diagnostic treatment. to exclude sciatica caused by spinal problems, repeated patients who had greater than 50% relief of symptoms of sciatica after caudal block were excluded from having a diagnosis of ps. asymmetry of the piriformis muscle on ct or mri was considered a positive finding of ps. an electromyographic finding of radiculopathy was attributed to spinal root compression, not to ps (fig . the gluteus maximus was divided in the direction of its fibers by blunt dissection, and the fascia lata was incised in continuity where it overlaid the trochanter ; we then removed the trochanteric bursa . the piriformis muscle was inserted into the posterior aspect of the greater trochanter as tendinous nature and was located above the obturator internus tendon ( fig . the sciatic nerve was explored and found to pass anteriorly to the piriformis muscle in all cases . additionally, we divided the tight piriformis tendon at the insertion site at its tendinous portion . the proximal portion of the muscle was retracted when the leg was internally rotated after its division . neurolysis around the sciatic nerve into the sciatic notch was performed in two cases of a severely adherent sciatic nerve . severely dilated and engorged epineurial vessels were found in two cases with intractable sciatica ( fig . after surgery, patient activity with the assistance of a cane was encouraged to relieve pain from the gluteal muscle repair . the diagnostic procedure involved a detailed physical examination, including a palpation test for tenderness over the origin ( sacroiliac joint) or insertion of the short external rotators behind the trochanter (fig . the clinical examination also included several provocation tests for pain and weakness on resisted abduction and external rotation of the thigh in a sitting position ( pace test), pain on forced passive internal rotation of the extended thigh (freiberg 's test), and buttock and leg pain during passive straight leg raising (lasgue 's sign). in addition to electromyography, various imaging studies including ct, mri, and ultrasonography were performed, and a steroid injection into the piriformis muscle was carried out for diagnostic treatment. to exclude sciatica caused by spinal problems, repeated patients who had greater than 50% relief of symptoms of sciatica after caudal block were excluded from having a diagnosis of ps. asymmetry of the piriformis muscle on ct or mri was considered a positive finding of ps. an electromyographic finding of radiculopathy was attributed to spinal root compression, not to ps (fig . for the diagnosis of ps, physical examinations, including several provocative tests, radiographic studies, such as plain x - ray, ct or mri, emg, or an injection were performed . when a diagnosis of ps was suspected, various conservative treatments were initially performed in all patients and generally provided good ( table 2). of the 239 patients, 12 patients who were refractory to conservative treatment underwent surgical treatment.table 3 summarizes the clinical features and the of surgical treatment. on physical examination, tenderness in the gluteal area, particularly on the iliac side of the sacroiliac joint, was detected in 10 patients (83%). pain provocative tests such as the freiberg's and pace tests were positive in 7 patients (58%). electrodiagnostic testing showed no specific findings (delayed h - reflex at the flexion adduction internal rotation position) suggesting ps as opposed to other pathologies, such as lumbosacral radiculopathy, sciatic nerve palsy, or posterior cutaneous neuropathy of the thigh. asymmetry of the piriformis muscle or hyperintensity around the sciatic nerve on ct and mri was detected in only 5 patients (42%) (fig . three patients had occupations that involved sitting for a long duration, such as sewing or driving . of the 12 patients undergoing surgical resection of the piriformis muscle, neurolysis was performed in 2 patients due to a severely adherent or scarred sciatic nerve . engorged epineurial vessels around the sciatic nerve shrank spontaneously after resection of the piriformis muscle . the average length of the skin incision was 9.5 cm, and the average amount of postoperative bleeding was 24.5 ml . there were no postoperative complications including hematoma, infection, delayed wound healing, scar formation, and myositis ossificans . the average duration of hospitalization was 5.3 days ( range, 3 to 9 days). compared with preoperatively (mean vas score, 9) , the vas scores significantly decreased both immediately after surgery (mean vas score, 4) and at the 12-month follow - up (mean vas score, 3.1) (table 4). persistent buttock pain after surgery was present in 3 patients. among them, 1 patient had symptom relief after 12 months. the diagnosis of ps is mostly elusive and remains controversial due to the lack of consistent objective diagnostic criteria. the differential diagnoses should include herniation of the nucleus pulposus (hnp), myofascial pain, sacroiliitis, trochanteric bursitis, or any other sciatic nerve - impinging conditions. in this study , the diagnosis of ps could be established with the patient's history, a careful physical examination, and a local injection of the piriformis muscle when no other etiological findings were identified on emg or imaging studies, including ct and mri (fig . because lumbosacral hnp or spinal stenosis commonly occurs at the l4 - 5 or l5-s1 intervertebral space, it is important to determine whether the pain originates from the root or peripheral nerve.10) in patients with ps, symptoms of neurological claudication are rare, while pain aggravation by a position change or prolonged sitting is frequently observed in them. specific sensory changes in dermatomes or muscle weakness can help to exclude ps. based on our cases, we suggest that the three cardinal symptoms of ps are buttock pain, radiating pain to the posterior thigh above the knee, and pain aggravated by position changes or prolonged sitting. the piriformis muscle can be firm and hard to palpation from the greater sciatic notch to the posterior aspect of the greater trochanter. in physical examination, tenderness of the piriformis muscle (83%) is the most consistent finding. although emg is often normal in patients with ps, continuous compression may in abnormal spontaneous activity of the muscles innervated by the sciatic nerve, including a delay in the h - reflex with the affected leg in a flexed, adducted, and internally rotated position.11 ) in our study, electrodiagnostic testing was not helpful for the diagnosis of ps but useful in ruling out other causes with similar symptoms, such as lumbosacral radiculopathy. diagnostic imaging modalities, including ct, mri, and mrn, have been used in many studies to diagnose ps.12131415 ) however, these studies are limited to cases showing atypical anatomy, including asymmetry of the piriformis muscle or hyperintensity of the sciatic nerve; these conditions accounted for only 5 of the 12 surgical patients (42%) in our study. sayson et al.16 ) and barton17 ) found that preoperative mri failed to identify atypical anatomy that was found intraoperatively. mrn is a relatively new technique that was developed specifically to enhance the imaging of nerves. filler et al.1 ) used mrn to prospectively investigate 87 patients with sciatica - like pain in whom either standard testing had failed to yield a diagnosis or who had failed lumbar disc surgery; 67% of this group was diagnosed with ps. however, tiel18 ) pointed out methodological and technical problems of mrn. some reports have suggested diagnostic criteria for ps.1920 ) recently, michel et al.21 ) proposed to use a clinical scoring system: ps can be considered probable with a score of 8 or more out of 12 points. however, it includes negative findings for spinal disease, such as no lower back pain, painless axial spinal palpation, negative lasgue's maneuver, or absence of perineal irritation (4 points). a scoring system including negative findings for spinal problems can in overdiagnosis of ps. in addition, the scoring system involves obscure physical tests that provoke buttock pain or sciatica by stretching or resisted contraction, and it does not include some diagnostic tests, such as local steroid injection, which is a widely used tool for establishing the diagnosis. they are comprised of 5 items: buttock pain with / without sciatica during prolonged sitting; tenderness of the piriformis muscle; positive provocative tests; positive findings on ct or mri; and pain relief with a local injection. additionally, caudal or epidural block was tried at least once before surgery in our study. we suggest to exclude a diagnosis of ps with any of the following findings: symptoms of neurologic claudication; positive lasgue's or straight leg raise test; sensory changes on nerve root innervation; radiculopathy on emg; or an effective caudal or epidural block. the sciatic nerve compression by the piriformis muscle or surrounding fibrous bands is different from the nerve root compression of spinal origin. absent clinical findings due to nerve root compression is important in the diagnosis of ps. initial nonoperative treatment of ps includes medications (nonsteroidal anti - inflammatory drugs, muscle relaxants, and other medications effective in neuropathic pain, such as pregabalin or gabapentin), physiotherapy, eswt, injections of local anesthetics and corticosteroids, and the more recently investigated option of botulinum neurotoxin injections.8 ) in our study, eswt was applied in patients with buttock pain more than twice with an interval of 1 week until pain subsides significantly. eswt was undertaken with 2,000 pulses each time at 1 week interval totaling 4,000 to 6,000 pulses. our clinical demonstrated that the most effective modality in treatment of ps for reducing buttock pain was eswt. we had satisfactory clinical after release of the piriformis muscle and neurolysis of sciatic nerve in patients with refractory sciatica that fail to respond successfully to conservative treatments. intraoperatively, identification of the piriformis muscle among short external rotator muscles and posterior retraction after complete resection of the muscle are important. careful dissection of fibrous tissues around the sciatic nerve is also essential to avoid damaging the nerve proper or the dilated vaso nervorum. deep gluteal syndrome (dgs) is a disease entity that is characterized by pain or dysesthesia in the buttock area, hip, or posterior thigh and/or radicular pain due to a nondiscogenic sciatic nerve entrapment in the subgluteal space.22 ) its main pathology is fibrous bands around the sciatic nerve formed by various pathological conditions, such as piriformis syndrome, obturator internus / gemellus syndrome, or ischiofemoral impingement. the causes of dgs include traumatic, iatrogenic, inflammatory / infectious, vascular, and gynecological processes, and tumors / pseudotumors. therefore, the treatment of dgs is decompression of the sciatic nerve via open or endoscopic surgery. it is not clear whether resection of the piriformis muscle has additional benefits over decompression of the sciatic nerve in ps. however, the recurrence of sciatic nerve adhesions can be avoided when the muscle is resected.1 ) endoscopic surgery for adhesiolysis of the sciatic nerve has several advantages over open methods, including less invasiveness and less postoperative pain.23 ) however, endoscopic sciatic nerve release is technically demanding and has limited efficacy for release of a severely adherent sciatic nerve. considering that no prospective, randomized trial has evaluated surgical treatment outcomes of ps, the important finding of our study was the significant decrease in symptoms after surgery. to achieve good , the indications for surgery (no response to physical therapy and at least one injection) should be determined upon proper diagnosis (based exclusively on clinical and spine evaluations). surgery is an important treatment option for unresolved ps because of its low morbidity and simplicity. to overcome the limitations of our work, a prospective study with a greater number of cases and a longer follow - up period should be performed to establish the gold standard methods for the diagnosis and treatment of ps; furthermore, several modalities for diagnosis of ps should be developed. in , the diagnosis of ps is obscure and elusive, but a systematic approach is helpful. if a diagnosis is determined correctly, surgical treatment can be a good option in patients with refractory pain, particularly sciatica, despite application of appropriate conservative treatment modalities.

piriformis syndrome (ps) is an uncommon disease characterized by symptoms ing from compression / irritation of the sciatic nerve by the piriformis muscle. uncertainty and controversy remain regarding the proper diagnosis and most effective form of treatment for ps. this study analyzes the diagnostic methods and efficacy of conservative and surgical treatments for ps.methodsfrom march 2006 to february 2013, we retrospectively reviewed 239 patients who were diagnosed with ps and screened them for eligibility according to our inclusion / exclusion criteria. all patients underwent various conservative treatments initially including activity modification, medications, physical therapy, local steroid injections into the piriformis muscle, and extracorporeal shock wave therapy for at least 3 months. we resected the piriformis muscle with / without neurolysis of the sciatic nerve in 12 patients who had intractable sciatica despite conservative treatment at least for 3 months. the average age of the patients (4 males and 8 females) was 61 years (range, 45 to 71 years). the average duration of symptoms before surgery was 22.1 months (range, 4 to 72 months), and the mean follow - up period was 22.7 months (range, 12 to 43 months). we evaluated the degree of pain and recorded the responses using a visual analog scale (vas) preoperatively and 3 days and 12 months postoperatively.buttock pain was more improved than sciatica with various conservative treatments. compared with preoperatively , the vas score was significantly decreased after the operation. overall, satisfactory were obtained in 10 patients (83%) after surgery.ps is thought to be an exclusively clinical diagnosis, and if the diagnosis is performed correctly, surgery can be a good treatment option in patients with refractory sciatica despite appropriate conservative treatments.

the epitaxial growth of monocrystalline semiconductors on metal nanostructures is interesting from both fundamental and applied perspectives. the realization of nanostructures with excellent interfaces and material properties that also have controlled optical resonances can be very challenging. here we report the synthesis and characterization of metal semiconductor core shell nanowires. we demonstrate a solution - phase route to obtain stable core shell metal cu2o nanowires with outstanding control over the ing structure, in which the noble metal nanowire is used as the nucleation site for epitaxial growth of quasi - monocrystalline cu2o shells at room temperature in aqueous solution. we use x - ray and electron diffraction, high - resolution transmission electron microscopy, energy dispersive x - ray spectroscopy, photoluminescence spectroscopy, and absorption spectroscopy, as well as density functional theory calculations, to characterize the core shell nanowires and verify their structure. metal semiconductor core shell nanowires offer several potential advantages over thin film and traditional nanowire architectures as building blocks for photovoltaics, including efficient carrier collection in radial nanowire junctions and strong optical resonances that can be tuned to maximize absorption.

recent evidences support using paclitaxel drug - coated balloon (dcb) catheters as a therapeutic method for de novo coronary lesions, in - stent restenosis (isr), small coronary vessels, and coronary bifurcation lesions. dcb was designed to achieve comparable efficacy in neointimal proliferation through local drug delivery without requiring foreign body implantation or prolonged dual antiplatelet therapy (dapt). the advantages of dcb include homogeneous and high concentration's drug delivery to the entire vessel wall, absence of stent layer, and absence of the polymer that could lead to chronic inflammation. dcb is a promising device to overcome some limitations of des in percutaneous coronary intervention (pci), such as isr, late and very late stent thrombosis, and risk of bleeding caused by prolonged dapt. although dcb has shown remarkable angiographic and clinical effects in coronary artery interventional therapy, it has some limitations in the treatment of de novo coronary lesions. elastic recoil and flow - limiting dissections may be the main reasons for therapy failure. as the lack of mechanical scaffolding provided by stent struts, the use of dcb may not be ideal for complex coronary lesions. therefore, a strategy combining dcb and bare metal stent (bms) is a potential solution to overcome these limitations. the more rapid endothelialization and shorter dapt duration of bms than des should be beneficial in certain scenarios. however, studies examining the efficiency of dcb + bms compared with stents alone for de novo lesions have yielded inconsistent , and whether this strategy provides additional benefits remains unclear. hence, we conducted a comprehensive meta - analysis of randomized controlled trials (rcts) to assess and compare the clinical efficacy and safety of dcb + bms with those of stents alone for de novo coronary lesions. we comprehensively searched related papers in electronic databases (pubmed, web of science, and the cochrane central register of controlled trials) before september 2016 to identify potential rcts. paclitaxel - eluting balloon, drug - eluting balloon, and drug - coated balloon. ethical approval was not required due to that this is a systematic review and meta - analysis. all included studies were approved by the notified ethics committees and institutional review boards. and this study was performed in accordance with preferred reporting items for systematic reviews and meta - analyses (prisma) statement. studies met the following inclusion criteria were included in the meta - analysis: rcts of de novo coronary artery lesions intervention, dcb + bms as a treatment arm, and eligible angiographic and clinical outcome data obtained during follow - up. data abstraction was performed independently by 2 investigators (lu and zhu), and discrepancies were resolved by consensus. the following features of each eligible study were extracted using a standardized form: study and patient characteristics, intervention procedures, and angiographic and clinical outcomes. the cochrane collaboration tool was used to methodologically assess the risk of bias to evaluate the quality of included trials. the following methodological domains were considered: random sequence generation, allocation concealment, blinding, drop - out rates (incomplete outcome data), addressing incomplete outcome data, selective reporting, and other potential sources of bias. after assessment, the included study were labeled as low risk (l), high risk (h), or the primary endpoints were in - segment late lumen loss (lll) and major adverse cardiac events (maces). the secondary endpoints were in - segment binary restenosis (br), in - segment minimum lumen diameter (mld), and target lesion revascularization (tlr), myocardial infarction (mi), and death. maces were defined as a composite of death, mi, and tlr. the most similar endpoint was used if data for mentioned endpoint were unavailable. we conducted the meta - analysis by using the cochrane program review manager (v.5.0 ; oxford, england) and stata software (version 12.0 ; statcorp, college station, tx). according to the inverse variance fixed - effect model, categorical variables were calculated as the pooled risk ratio (rr) and 95% confidence intervals (cis). continuous variables were presented as estimated mean difference (md) with a 95% ci. if i > 50% (substantial and important heterogeneity), a random effect model was used for quantitative data synthesis, whereas a fixed model was adopted. begger funnel plots and egger tests were used to assess publication bias, with p < 0.05 as the threshold for statistical significance. we comprehensively searched related papers in electronic databases (pubmed, web of science, and the cochrane central register of controlled trials) before september 2016 to identify potential rcts. paclitaxel - eluting balloon, drug - eluting balloon, and drug - coated balloon. ethical approval was not required due to that this is a systematic review and meta - analysis. all included studies were approved by the notified ethics committees and institutional review boards. and this study was performed in accordance with preferred reporting items for systematic reviews and meta - analyses (prisma) statement. studies met the following inclusion criteria were included in the meta - analysis: rcts of de novo coronary artery lesions intervention, dcb + bms as a treatment arm, and eligible angiographic and clinical outcome data obtained during follow - up. data abstraction was performed independently by 2 investigators (lu and zhu), and discrepancies were resolved by consensus. the following features of each eligible study were extracted using a standardized form: study and patient characteristics, intervention procedures, and angiographic and clinical outcomes. the cochrane collaboration tool was used to methodologically assess the risk of bias to evaluate the quality of included trials. the following methodological domains were considered: random sequence generation, allocation concealment, blinding, drop - out rates (incomplete outcome data), addressing incomplete outcome data, selective reporting, and other potential sources of bias. after assessment, the included study were labeled as low risk (l), high risk (h), or unclear risk (u). the primary endpoints were in - segment late lumen loss (lll) and major adverse cardiac events (maces). the secondary endpoints were in - segment binary restenosis (br), in - segment minimum lumen diameter (mld), and target lesion revascularization (tlr), myocardial infarction (mi), and death. maces were defined as a composite of death, mi, and tlr. the most similar endpoint was used if data for mentioned endpoint were unavailable. we conducted the meta - analysis by using the cochrane program review manager (v.5.0 ; oxford, england) and stata software (version 12.0 ; statcorp, college station, tx). according to the inverse variance fixed - effect model , categorical variables were calculated as the pooled risk ratio (rr) and 95% confidence intervals (cis). continuous variables were presented as estimated mean difference (md) with a 95% ci. if i > 50% (substantial and important heterogeneity), a random effect model was used for quantitative data synthesis, whereas a fixed model was adopted. begger funnel plots and egger tests were used to assess publication bias, with p < 0.05 as the threshold for statistical significance. we initially screened a total of 7668 potential studies through a number of searches. after eliminating duplicates, 505 articles were examined. of these, 11 rcts with a total of 2196 patients met the inclusion criteria were included in our meta - analysis. figure 1 presents a flowchart of the overall search strategy. among these 11 studies, four studies were 3-arm trials comparing the subgroups dcb + bms, bms alone, and des alone; therefore, these studies were considered as 2 separate trials. we finally selected 9 studies comparing dcb + bms with des alone and 6 comparing dcb + bms with bms alone. the clinical and angiographic primary endpoints were provided in all trials, with follow - up durations of 6 to 24 months. furthermore, dcb + bms was used in 714 patients, whereas control treatments, namely bms alone and des alone, were used in 190 and 715 patients, respectively. the key demographic and angiographic characteristics of included the studies are summarized in tables 1 and 2, respectively. flow diagram for identification processes. general characteristics of studies included in this meta - analysis. lesions and devices characteristics of included studies. lll: this was reported in 9 of the 11 studies within follow - up periods of 6 to 9 months. nine studies were included in the dcb + bms versus des subgroup analysis, whereas 5 studies were included in the dcb + bms versus bms subgroup analysis. compared with the des alone subgroup, the dcb + bms subgroup exhibited a significant increase in lll (md, 0.19 ; 95% ci, 0.060.32 ; p = 0.0042). however, the dcb + bms subgroup showed nonsignificantly lower lll than did the bms alone subgroup (md, 0.14 ; 95% ci, 0.330.04 ; p = 0.24 ; fig . effectiveness of dcb + bms strategy versus des alone or maces : these were observed in 10 of the 11 studies within a follow - up period of 6 to 24 months . the fixed effect model was used . subgroup analysis indicated that compared with des alone, dcb + bms significantly increased maces ( rr, 1.88 ; 95% ci, 1.442.45 ; p < 0.0001). the subgroup analysis showed that the dcb + bms strategy was advantageous over the bms treatment in reducing maces incidence, with borderline significant (rr, 0.67 ; 95% ci, 0.450.99 ; p = 0.05 ; fig . seven and 3 studies with follow - up periods of 6 to 9 months were included in the dcb + bms versus des alone and dcb + bms versus bms alone subgroup analyses, respectively . subgroup analysis showed the dcb + bms strategy was inferior to des alone strategy in reducing br incidence ( rr, 2.15 ; 95% ci, 1.074.31, p = 0.03). the dcb + bms versus bms subgroup analysis showed that dcb + bms was beneficial, but the difference between both strategies was nonsignificant (rr, 0.74 ; 95% ci, 0.341.60, p = 0.44, respectively ; fig . effectiveness of dcb + bms strategy versus des alone or secondary angiographic endpoints : ( a) in - segment binary restenosis rate; and (b) in - segment minimum lumen diameter. six and 3 studies with follow - up periods of 6 to 9 months were included in the dcb + bms versus des alone and dcb + bms versus bms alone subgroup analyses, respectively. compared with des alone, dcb + bms had a significant lower mld (md, 0.25 ; 95% ci, 0.41 to 0.10 ; p = 0.001). a significant effect favoring dcb + bms was detected in the dcb + bms versus bms alone subgroup analysis (md, 0.18 ; 95% ci, 0.030.33 ; p = 0.02 ; fig . all 3 endpoints were reported in 9 of the 11 studies within follow - up periods of 6 to 24 months . because of the low degree of heterogeneity, we used the fixed effect model for the quantitative analysis . tlr : the analysis indicated a significantly higher risk of tlr in the dcb + bms subgroup than in the des alone subgroup ( rr, 1.94 ; 95% ci, 1.272.98 ; p = 0.002), and the incidence rate of tlr did not differ significantly between the dcb + bms subgroup and bms alone subgroup (rr, 0.71 ; 95% ci, 0.471.09 ; p = 0.012 ; fig . mi : the analysis showed no significant difference in mi incidence between the dcb + bms and des alone subgroups ( rr, 0.88 ; 95% ci, 0.322.42 ; p = 0.81). similarly, the incidence rate of mi was comparable following dcb + bms and bms alone implantation (rr, 0.51 ; 95% ci, 0.161.67 ; p = 0.27 ; fig . death : the analysis revealed that death did not differ significantly in the dcb + bms and des subgroups ( rr, 5.91 ; 95% ci, 0.7248.39 ; p = 0.10); similar were observed in the dcb + bms versus bms subgroup analysis (rr, 0.20 ; 95% ci, 0.021.70 ; p = 0.14). effectiveness of dcb + bms strategy versus des alone or secondary clinical endpoints: (a) target lesion revascularization, (b) mi, and (c) death. according to the of heterogeneity analysis, we conducted sensitivity analysis between the dcb + bms and control groups (dcb + bms vs des and dcb + bms vs bms subgroups) at all observed endpoints. we sequentially eliminated one study at a time and observed that no study strongly influenced the overall . egger test showed no evidence of significant publication bias in this meta - analysis (p > 0.05). in addition, the funnel plot was symmetrical, suggesting no publication bias (fig . seven and 5 of the included studies showed a low risk of bias in random sequence generation and allocation concealment, respectively . five studies showed a low risk of bias in the blinding of participants, and 5 had a high risk of bias in the blinding of the outcome assessment . all studies have a low risk of bias regarding incomplete outcome data and selective outcome reporting . we initially screened a total of 7668 potential studies through a number of searches . after eliminating duplicates, 505 articles were examined . of these, 11 rcts with a total of 2196 patients met the inclusion criteria were included in our meta - analysis . figure 1 presents a flowchart of the overall search strategy . among these 11 studies, four studies were 3-arm trials comparing the subgroups dcb + bms, bms alone, and des alone ; therefore, these studies were considered as 2 separate trials . we finally selected 9 studies comparing dcb + bms with des alone and 6 comparing dcb + bms with bms alone . the clinical and angiographic primary endpoints were provided in all trials, with follow - up durations of 6 to 24 months . furthermore, dcb + bms was used in 714 patients, whereas control treatments, namely bms alone and des alone, were used in 190 and 715 patients, respectively . the key demographic and angiographic characteristics of included the studies are summarized in tables 1 and 2, respectively . flow diagram for identification processes . general characteristics of studies included in this meta - analysis . lesions and devices characteristics of included studies . lll : this was reported in 9 of the 11 studies within follow - up periods of 6 to 9 months . nine studies were included in the dcb + bms versus des subgroup analysis, whereas 5 studies were included in the dcb + bms versus bms subgroup analysis . compared with the des alone subgroup, the dcb + bms subgroup exhibited a significant increase in lll ( md, 0.19 ; 95% ci, 0.060.32 ; p = 0.0042). however, the dcb + bms subgroup showed nonsignificantly lower lll than did the bms alone subgroup (md, 0.14 ; 95% ci, 0.330.04 ; p = 0.24 ; fig . effectiveness of dcb + bms strategy versus des alone or maces : these were observed in 10 of the 11 studies within a follow - up period of 6 to 24 months . the fixed effect model was used . subgroup analysis indicated that compared with des alone, dcb + bms significantly increased maces ( rr, 1.88 ; 95% ci, 1.442.45 ; p < 0.0001). the subgroup analysis showed that the dcb + bms strategy was advantageous over the bms treatment in reducing maces incidence, with borderline significant (rr, 0.67 ; 95% ci, 0.450.99 ; p = 0.05 ; fig . in - segment br rate . seven and 3 studies with follow - up periods of 6 to 9 months were included in the dcb + bms versus des alone and dcb + bms versus bms alone subgroup analyses, respectively . subgroup analysis showed the dcb + bms strategy was inferior to des alone strategy in reducing br incidence ( rr, 2.15 ; 95% ci, 1.074.31, p = 0.03). the dcb + bms versus bms subgroup analysis showed that dcb + bms was beneficial, but the difference between both strategies was nonsignificant (rr, 0.74 ; 95% ci, 0.341.60, p = 0.44, respectively ; fig . effectiveness of dcb + bms strategy versus des alone or secondary angiographic endpoints : ( a) in - segment binary restenosis rate; and (b) in - segment minimum lumen diameter. in - segment mld. six and 3 studies with follow - up periods of 6 to 9 months were included in the dcb + bms versus des alone and dcb + bms versus bms alone subgroup analyses, respectively. compared with des alone, dcb + bms had a significant lower mld (md, 0.25 ; 95% ci, 0.41 to 0.10 ; p = 0.001). a significant effect favoring dcb + bms was detected in the dcb + bms versus bms alone subgroup analysis (md, 0.18 ; 95% ci, 0.030.33 ; p = 0.02 ; fig . all 3 endpoints were reported in 9 of the 11 studies within follow - up periods of 6 to 24 months . because of the low degree of heterogeneity, we used the fixed effect model for the quantitative analysis . tlr : the analysis indicated a significantly higher risk of tlr in the dcb + bms subgroup than in the des alone subgroup ( rr, 1.94 ; 95% ci, 1.272.98 ; p = 0.002), and the incidence rate of tlr did not differ significantly between the dcb + bms subgroup and bms alone subgroup (rr, 0.71 ; 95% ci, 0.471.09 ; p = 0.012 ; fig . mi : the analysis showed no significant difference in mi incidence between the dcb + bms and des alone subgroups ( rr, 0.88 ; 95% ci, 0.322.42 ; p = 0.81). similarly, the incidence rate of mi was comparable following dcb + bms and bms alone implantation (rr, 0.51 ; 95% ci, 0.161.67 ; p = 0.27 ; fig . death : the analysis revealed that death did not differ significantly in the dcb + bms and des subgroups ( rr, 5.91 ; 95% ci, 0.7248.39 ; p = 0.10); similar were observed in the dcb + bms versus bms subgroup analysis (rr, 0.20 ; 95% ci, 0.021.70 ; p = 0.14). effectiveness of dcb + bms strategy versus des alone or secondary clinical endpoints: (a) target lesion revascularization, (b) mi, and (c) death. according to the of heterogeneity analysis, we conducted sensitivity analysis between the dcb + bms and control groups (dcb + bms vs des and dcb + bms vs bms subgroups) at all observed endpoints. we sequentially eliminated one study at a time and observed that no study strongly influenced the overall . egger test showed no evidence of significant publication bias in this meta - analysis (p > 0.05). in addition, the funnel plot was symmetrical, suggesting no publication bias (fig . 5). funnel plot for publication bias. (a) primary angiographic endpoint: in - segment late lumen loss. (b) seven and 5 of the included studies showed a low risk of bias in random sequence generation and allocation concealment, respectively. five studies showed a low risk of bias in the blinding of participants, and 5 had a high risk of bias in the blinding of the outcome assessment. all studies have a low risk of bias regarding incomplete outcome data and selective outcome reporting. our present meta - analysis included the largest number of rcts to date showed that although the dcb + bms strategy performed more favorably than did the bms alone strategy, it was not superior to des alone strategy in the treatment of de novo coronary lesions. its dramatic ability to inhibit neointimal hyperplasia through sustained elution of cytostatic drugs turns into a significantly reduced repeat revascularization rate in clinical trials. nevertheless, cases of treatment failure, mainly because of isr and stent thrombosis (st), have attracted more attention considering the sizeable number of patients with des implantation. various factors are required to satisfactorily resolve, such as slow drug release, polymer - induced inflammation, endothelial dysfunction, and coronary vasoconstriction disturbance. therefore, paclitaxel dcb may be an emerging therapeutic alternative that has the advantages of operative simplicity and homogeneous antiproliferative agent release along the entire device. to avoid the disadvantages of des, researchers have tried to combine dcb and bms to achieve benefits by dcb provided local release antiproliferative agents and bms prevented acute postangioplasty recoil. although bello study showed that, compared with pes in small vessels (reference diameter 2.8 mm), dcb yielded significantly lower in - stent (in - balloon) late loss and similar rates of restenosis and revascularization. however, there have been few well - designed head to head studies comparing the dcb and des strategies for lesions with lumen diameters of more than 2.5 mm. all studies included in the present meta - analysis had applied the dcb + bms therapeutic strategy for de novo coronary lesions (lumen diameter > 2.5 mm). nevertheless, the pooled of our research showed that the clinical efficacy and safety of the dcb + bms strategy were not equivalent to those of the des alone strategy for de novo coronary lesions. regarding the maces rate, replacing des implantation with dcb + bms was not beneficial in simple de novo coronary lesion intervention. first, the lack of sufficient uncoated balloon predilation in some included study may have contributed to the . predilation before dcb use could improve drug uptake by the vessel wall because of the creation of microdissections, thus facilitating drug transport through the intima and media, particularly for calcified lesions. the valentines ii trial adopted regular balloon predilatation of the target lesion followed dior ii dcb reported low in - segment lll and tlr rates. meanwhile, 1 rct, which adopted regular balloon predilatation, compared the efficacy of bms and dcb combination versus bms alone in patients with non - st elevation acute coronary syndrome also reported significantly lower lll but the absence of a favorable effect on patient clinical outcomes. second, we speculated geographical miss caused by unfavorable geometric proportions as a potential influencing factor because the reference point for stent or balloon placement was missing. one clinical trial reported that patients treated with dcb predilatation with an additional bms implantation had a very high proportion of geographical miss, which was identified as an independent significant predictor of restenosis. if stent deployment precedes dcb dilatation, the contact surface between the balloon and vessel wall is reduced by approximately 15% owing to the surface of the stent struts. the octopus trial, which used optical coherence tomography, reported that dcb + bms was associated with more pronounced neointimal proliferation than des. the ivus study used intravascular ultrasound also showed more pronounced neointimal hyperplasia in the dcb + bms group, leading to more revascularization than that in the des group. possible influencing factors are the interaction of the mounted stent with drug release from dcb, stent and balloon lengths, drug concentrations, and stent system. our meta - analysis included 2 strategies for dcb application: pre- and post - bms implantation. theoretically, dcb used before bms implantation could increase the risk of geographical mismatch, because the stent may be implanted partly outside the dcb - treated segment. by contrast, dcb used after bms implantation might affect the drug delivery to the vessel because of interposition of the stent struts. an optical coherence tomography (oct) study investigated the effects of the sequence of dcb and bms (i.e., dcb first and bms first) and stated that the bms - first sequence translated into more favorable apposition than did the dcb - first sequence, as evidenced by the significantly low proportion of incomplete stent apposition (isa) struts and nonsignificantly low isa areas and volumes in the former. however, the indicor trial and another oct study used dcb from different manufacturers suggested that, the sequence of dcb application does not affect lll, maces, and in - stent neointimal hyperplasia. similar clinical and angiographic were reported by the in - pact coro trial. finally, a possible explanation for these findings is that the currently used dcb, particularly first - generation dcbs, failed to warrant sufficient bioavailability of paclitaxel at the lesion site. bondesson et al reported the differential treatment outcomes of various dcbs, and this variation may be even larger than that caused by des because drug delivery to the vessel wall is crucial during balloon inflation. regarding lll, the pharmacokinetics of paclitaxel with first - generation dcbs may have been insufficient to provide comparable benefits. a recent experimental study showed much higher drug concentrations into the vessel wall by using the dior - ii dcb than dior - i, combined with a shorter inflation time. hence, using a second - generation dcb with a bms, higher tissue drug delivery dose, might lead to better angiographic and clinical outcomes for de novo lesions. second, because the studies had a relatively short follow - up durations, definitive will necessitate clinical follow - up for several additional years. finally, most included studies were conducted in western countries, hence, data from non - western countries were inadequate to precisely assess the clinical efficacy and safety of the dcb + bms strategy for de novo lesions. thus, further large, multicenter, well - designed randomized trials recruiting patients from more countries are required to provide additional insights. the present meta - analysis does not favor the dcb + bms strategy as an alternative therapeutic method to des implantation for de novo coronary artery lesions in pci. additional well - designed large rcts with long follow - up periods are required to resolve this concern.

abstract: studies examining the efficiency of drug - coated balloon (dcb) + bare metal stent (bms) compared with stents alone for de novo lesions have reported inconsistent . the present comprehensive meta - analysis of randomized controlled trials (rcts) assessed and compared the clinical efficacy and safety of dcb + bms with those of stents alone for de novo coronary artery disease.methods:we formally searched electronic databases before september 2016 to identify potential studies. all rcts were eligible for inclusion if they compared dcb + bms with a control treatment (drug - eluting stent alone or bms alone) in patients with de novo coronary artery disease.:eleven rcts with a total of 2196 patients met the inclusion criteria were included in our meta - analysis. subgroup analysis indicated dcb plus bms was associated with poorer outcomes when compared with des alone in primary endpoint {( in - segment late lumen loss : mean difference , 0.19 ; 95% confidence interval , 0.060.32 ; p = 0.0042) and (major adverse cardiovascular events : risk ratio , 1.88 ; 95% ci, 1.442.45 ; p < 0.0001)}. however, dcb + bms had nonsignificantly lower lll than bms alone (in - segment lll : md, 0.14 ; 95% ci, 0.330.04 ; p = 0.24), and was more advantageous in reducing mace incidence, with borderline significance (maces : rr, 0.67 ; 95% ci, 0.450.99 ; p = 0.05).: in summary, the present do not favor the dcb + bms strategy as an alternative therapeutic method to des implantation for de novo coronary artery lesions in percutaneous coronary intervention (pci). additional well - designed large rcts with long - follow - up periods are required to clarify the inconsistent .

minimally invasive surgical techniques have revolutionized the treatment of many of the problems seen by the general surgeon. although the impact has been greatest in the treatment of cholelithiasis, many of the same advantages achieved with laparoscopic cholecystectomy can be realized with advanced laparoscopic procedures. since the first initial reports of laparoscopic right hemicolectomy in february 1990 and sigmoid resection in october 1990, laparoscopic - assisted colectomy (lac) has been found to have numerous advantages when compared to open colectomy. among these advantages are less blood loss, fewer wound complications, more rapid return of intestinal function, less pain, shorter hospitalization and quicker return to work. but lac has not been widely accepted as the surgical treatment of choice for patients requiring colon resection. first, the procedure is technically much more difficult and, second, although some have reported good , lac has not yet been proven to yield equal or better for the treatment of colon cancer when compared with open colectomy. indeed, much concern has been raised about the possibility of increased recurrence rates, port site metastasis, and the possibility that lac will not prove to be an adequate resection for cure of cancer. even though lac for benign disease has yielded good , only a small percentage of surgeons offer lac for the treatment of benign disease when discussing options with their patients. overall, the biggest impediment to the widespread adoption of lac for benign disease remains the difficulty of the procedure. in our experience , colon mobilization and division of the mesentery have been the most difficult parts of the procedure for the surgeon to learn. the anastomosis is usually completed extracorporeally or with the transanal circular stapler, much as would be done during open surgery. the development of the ultrasonically activated shears (laparosonic coagulating shears , ethicon endo - surgery / ultracision, smithfield, ri) has provided an alternative technology for mobilization of the colon and division of the mesentery. to evaluate the efficacy, safety, and efficiency of this new energy source, we retrospectively reviewed a portion of our series of lac cases. from october 1990, to may 1997, 118 laparoscopic colon resections were completed for a variety of indications. thirty - three of these patients had a colectomy other than a right hemicolectomy or a sigmoid resection and were eliminated from the study. the charts of the remaining 85 patients who underwent either laparoscopic - assisted right hemicolectomy or laparoscopic - assisted sigmoidectomy were reviewed retrospectively by the authors. patients who underwent curative resection for carcinoma of the colon were entered in an institutional review board (irb) approved prospective study. the operative notes were reviewed to determine the method in which the colon was mobilized and the mesentery divided. from this review, two groups were identified: one in which this dissection was done without the lcs (no lcs group), and one in which this dissection was done with the lcs (lcs group). the age, sex, indication for surgery, operative times, estimated blood loss (ebl), and length of stay (los) were documented for each group. all surgical procedures were performed in a similar fashion by the senior author or by the laparoscopic surgery fellow under the direct supervision of the senior author. in all patients the colon was mobilized and the mesentery was divided with a totally laparoscopic technique. in cases completed without the lcs, hemostasis was obtained with a combination of clips, endoscopie linear cutting staplers, and monopolar cautery delivered with scissors. the technique using the lcs varied according to whether there was benign or malignant disease. in most cases of benign disease, other methods for hemostasis were usually not necessary unless the benign disease was so extensive that it required a wide dissection of the mesentery. for cases of malignancy, a high ligation of the vascular pedicle (ileocolic artery for right colectomy and inferior mesenteric or superior sigmoid artery for sigmoid resection) was accomplished with an endoscopie linear cutting stapler. a plastic wound protector was routinely placed in the mini - laparotomy incision during specimen extraction. the anastomosis after right hemicolectomy was completed extracorporeally via the minilaparotomy, and the anastomosis after sigmoid resection was created intracorporeally using the circular stapler passed transanally. all surgical procedures were performed in a similar fashion by the senior author or by the laparoscopic surgery fellow under the direct supervision of the senior author. in all patients the colon was mobilized and the mesentery was divided with a totally laparoscopic technique. in cases completed without the lcs, hemostasis was obtained with a combination of clips, endoscopie linear cutting staplers, and monopolar cautery delivered with scissors. the technique using the lcs varied according to whether there was benign or malignant disease. in most cases of benign disease, other methods for hemostasis were usually not necessary unless the benign disease was so extensive that it required a wide dissection of the mesentery. for cases of malignancy, a high ligation of the vascular pedicle (ileocolic artery for right colectomy and inferior mesenteric or superior sigmoid artery for sigmoid resection) was accomplished with an endoscopie linear cutting stapler. a plastic wound protector was routinely placed in the mini - laparotomy incision during specimen extraction. the anastomosis after right hemicolectomy was completed extracorporeally via the minilaparotomy, and the anastomosis after sigmoid resection was created intracorporeally using the circular stapler passed transanally. of the 85 patients, 36 had their procedures completed without the lcs and were in the no lcs group, while 49 had use of the lcs and were in the lcs group. the female: male ratio was 2:1 in the no lcs group and 1.6:1 in the lcs group. the average age was 67.9 years (range 28 - 101) in the no lcs group and 62.6 years (range 25 - 91) in the lcs group. right hemicolectomy was indicated for carcinoma 74% of the time in both groups (table 1). large adenomas, arteriovenous malformations, and, in one case, lymphoma were the other indications. sigmoid colectomy was indicated for diverticulitis in 58% of the no lcs group and 79% of the lcs group (table 2). the other indications for sigmoid colectomy in the no lcs group were sigmoid stricture and sigmoid volvulus. hence, the majority of the sigmoid resections were completed for diverticulitis, and the majority of the right hemicolectomies were for carcinoma. fifteen of 36 patients (42%) in the no lcs group and 22 of 49 patients (45%) in the lcs group had previous abdominal or pelvic surgery. average operating room time was less when the lcs was used (170 min . vs. 187 min . average blood loss was nearly the same whether the lcs was used or not ( 95 ml vs. 98 ml, p=0.7620) (table 3). the los was less for the lcs group (4.3 days vs. 6.9 days, p=0.0018), and this did reach statistical significance. , three patients overall had postoperative bleeding from a stapled anastomosis, for an incidence of 3.5%. another patient after sigmoidectomy had an unsuccessful colonoscopic attempt to control the bleeding and required transanal suture of the staple line after 3 units of blood were transfused. a third patient bled from a stapled ileocolic anastomosis after heparin therapy was started to treat a postoperative pulmonary embolus. however, when heparin was again started, the patient rebled, and, therefore, a vena caval filter was placed. of note was that none of these patients who bled, bled from the area of dissection with the lcs, even when heparin therapy caused anastomotic bleeding. hence, there were no early or late bleeding complications in the areas of dissection with the lcs. additionally, there were no other early or late complications which could be related to the use of the shears. of the 85 patients, 36 had their procedures completed without the lcs and were in the no lcs group, while 49 had use of the lcs and were in the lcs group. the female: male ratio was 2:1 in the no lcs group and 1.6:1 in the lcs group. the average age was 67.9 years (range 28 - 101) in the no lcs group and 62.6 years (range 25 - 91) in the lcs group. right hemicolectomy was indicated for carcinoma 74% of the time in both groups (table 1). large adenomas, arteriovenous malformations, and, in one case, lymphoma were the other indications. sigmoid colectomy was indicated for diverticulitis in 58% of the no lcs group and 79% of the lcs group (table 2). the other indications for sigmoid colectomy in the no lcs group were sigmoid stricture and sigmoid volvulus. hence, the majority of the sigmoid resections were completed for diverticulitis, and the majority of the right hemicolectomies were for carcinoma. fifteen of 36 patients (42%) in the no lcs group and 22 of 49 patients (45%) in the lcs group had previous abdominal or pelvic surgery. average operating room time was less when the lcs was used (170 min . vs. 187 min ., p=0.1989) but did not reach statistical significance. average blood loss was nearly the same whether the lcs was used or not (95 ml vs. 98 ml, p=0.7620) (table 3). the los was less for the lcs group (4.3 days vs. 6.9 days, p=0.0018), and this did reach statistical significance. , three patients overall had postoperative bleeding from a stapled anastomosis, for an incidence of 3.5%. another patient after sigmoidectomy had an unsuccessful colonoscopic attempt to control the bleeding and required transanal suture of the staple line after 3 units of blood were transfused. a third patient bled from a stapled ileocolic anastomosis after heparin therapy was started to treat a postoperative pulmonary embolus. however, when heparin was again started, the patient rebled, and, therefore, a vena caval filter was placed. of note was that none of these patients who bled, bled from the area of dissection with the lcs, even when heparin therapy caused anastomotic bleeding. hence, there were no early or late bleeding complications in the areas of dissection with the lcs. additionally, there were no other early or late complications which could be related to the use of the shears. this report is a single - institution, single - surgeon's experience with lac, and dates from the first reported cases of lac. although many new instruments and technologies have been introduced since then, the fundamental surgical techniques and principles described then have not changed. the most difficult steps in lac are intracorporeal mobilization of the colon and division of the mesentery. the learning curve for these techniques is much longer than for the techniques required for laparoscopic cholecystectomy, and this has slowed the widespread use of lac for patients needing colon resection. this study was done to assess the use of a new technology, the ultrasonically activated shears, for mobilization of the colon and division of the mesentery. the jaws of the shears consist of an active blade and an opposing passive (not ultrasonically activated), movable tissue pad. this allows the surgeon to grasp tissue and vessels within the jaws of the shears, and coapt the endothelium of any vessels in the tissue. the ultrasonic energy is then transmitted to this tissue and can seal blood vessels and divide what has been grasped. the shears have been shown to facilitate completion of other advanced laparoscopic procedures such as division of the short gastric arteries during nissen fundoplication and division of the infundibulopelvic ligament during laparoscopic - assisted vaginal hysterectomy. depending on the power setting of the generator, the active blade will move 50 - 100 microns with each oscillation. touching the active blade to tissue transfers mechanical energy from the blade to the tissue. this mechanical energy breaks hydrogen bonds in the protein of the tissue, ing in a sticky coagulum which seals blood vessels. this will allow blood vessels up to 3 mm to be sealed with the shears, without the need for any other method to achieve hemostasis. relatively little heat is generated compared to other energy sources, since most of the energy delivered is mechanical energy. the relatively low level of heat generated increases the safety with which the instrument can be used adjacent to other viscera, such as the small intestine or great vessels. the largest or named arteries in the mesentery may need to be controlled by other means, such as clips, ligatures, or the endoscopie linear cutting stapler. we found that when the ultrasonically activated shears were utilized, the need for scissors, pre - tied loops, clips, and linear cutting staplers was markedly reduced. in situations in which blood vessels were less than 3 mm (as in colon resections for benign disease when high vascular pedicle division was not necessary) these were no longer needed, and the entire dissection could be completed with the shears. when we compared lac done with and without the shears, the overall operative times and blood loss were similar. although the operative times with the shears were a little bit shorter, this could have been due to an increase in our skills as we progressed along our learning curve. however, as our skills improved, and partly due to the availability of the shears , we attempted and completed many more difficult procedures than we would have tried without the shears, as documented by the 20% higher incidence of diverticulitis in the lcs group. these more difficult cases inevitably would have taken more time than most of the cases we tried initially if we had not had the shears. therefore, the shorter length of time in the group in which the shears were used, although not great, is probably significant since we were often doing more difficult cases with the shears. it is our opinion that use of the shears greatly facilitated successful completion of these more complex cases. the literature documents a decreased length of stay following lac. in the present study, although the los for the group in whom we used the shears was less, this difference is probably due to changes in our postoperative management as we became more comfortable and familiar with the recovery of patients after lac. since the patients treated without the shears were all treated early in our experience (before the shears were available), the decrease in length of stay was probably related to our experience. with experience we learned that early advancement of the diet and earlier discharge are possible because the patient has less pain and a shorter ileus following lac. we do not see a reason why the use of the ultrasonically activated shears would reduce pain and shorten ileus, nor do we see a reason why the use of the lcs would explain the shorter length of stay. the ultrasonically activated shears are a safe and effective device for mobilizing the colon and dividing the mesentery during lac. for the experienced laparoscopic surgeon, use of the shears can reduce the time required for routine cases of lac and for the inexperienced laparoscopic surgeon, there is no substitute for appropriate training, but the shears have the potential to shorten the learning curve for the inexperienced surgeon by facilitating the two most difficult technical parts of lac.

and objectives: mobilization of the colon and dissection of the mesentery are difficult laparoscopic techniques. traditional methods have been used for this dissection, but often with great difficulty. the ultrasonically activated shears, when introduced in 1993, had the possibility to make this dissection less technically difficult. this is a retrospective review of the use of these shears for these techniques during laparoscopic - assisted colectomy.materials and methods: eighty - five patients underwent a laparoscopic - assisted right hemicolectomy or sigmoid resection. colon mobilization and mesenteric dissection were completed intracorporeally. complications, operative time, estimated blood loss, and length of stay were compared for resections completed with and without the ultrasonically activated shears.:thirty-six patients had laparoscopic - assisted colectomy without the shears, and 49 patients had the procedure with the shears. there were no complications due to the ultrasonic energy. use of the shears ed in shorter operative times (170 min . vs. 187 min . , p=0.1989), similar median blood loss (98 ml vs. 95 ml, p=0.7620), and shorter lengths of stay (4.3 days vs. 6.9 days, p=0.0018).: the ultrasonically activated shears are safe and effective for colon mobilization and mesenteric division. the use of the shears may in shorter operative times and shorter lengths of stay.

neurons arise from a small set of progenitor cells that divide in a spatially and temporally controlled manner to generate the six - layered structure of a fully functional adult cortex (caviness et al ., 2009 ; gtz and huttner, 2005 ; pierani and wassef, 2009 ; rowitch and kriegstein, 2010). how different fates are established in the daughter cells of these progenitors is poorly understood. during early phases of mouse brain development (e9.0), the cortex consists of neuroepithelial progenitors (neps), which extend from the ventricular (apical) to the pial (basal) surface of the neural tube and divide symmetrically to amplify the progenitor pool. at the onset of neurogenesis (around e11.0) , neps turn into so - called radial glial cells (rgcs) and adopt molecular and morphological characteristics of glial cells. rgcs are characterized by an apical fiber extending toward the ventricle and a basal fiber extending toward the pial surface (caviness et al . , 2009 ; gtz and huttner, 2005 ; kriegstein and alvarez - buylla, 2009). rgcs occupy the most apical area of the cortex, called the ventricular zone (vz). their nuclei undergo a characteristic interkinetic nuclear migration where mitosis and s phase occur in the apical and basal areas of the vz, respectively. rgcs give rise to all the cortical neurons through two kinds of asymmetric divisions (anthony et al . , they divide into one rgc and another cell that migrates into the more basally located cortical plate ( cp) where it differentiates into a neuron. ipcs (also called basal progenitors or nonsurface - dividing cells) lose their connection to the apical surface and reside in the cortical area between the vz and intermediate zone (iz) where they form the so - called subventricular zone (svz). ipcs undergo one to two rounds of symmetric division, generating either one or two pairs of neurons (haubensak et al . 2004), which can then populate all six layers of the cortex (kowalczyk et al ., 2009 ; sessa et al ., 2008). as the gene expression profiles of rgcs generating neurons are characteristically different from the ones generating ipcs (pinto et al ., 2008), the two modes of division seem to occur in distinct subpopulations of rgcs. whether or not the orientation of rgc divisions is relevant for neurogenesis has been a matter of intense debate. early reports have demonstrated that vertical spindle orientation correlates with an asymmetric outcome in terms of daughter cell fates (chenn and mcconnell, 1995 ; zhong and chia, 2008), leading to models in which the unequal segregation of the apical and basal plasma membranes directs cell fate (zhong and chia, 2008). consistent with this, mitotic spindles with vertical orientations are only found during the neurogenic phases of brain development (haydar et al ., 2003), while during the early expansion phase, keeping precise horizontal spindle orientation is crucial to maintain the neural progenitor pool (fish et al . , 2006 ; yingling et al ., 2008). the frequency of vertical divisions during the neurogenic phase, however, is too low to account for all divisions with asymmetric outcome (chenn and mcconnell, 1995 ; haydar et al ., 2003 ; this could be explained by the small size of the apical membrane domain of rgcs, such that even barely oblique mitotic spindles would give rise to cleavage planes that fail to bisect this domain ing in its asymmetric segregation ( kosodo et al ., 2004). it has been demonstrated that increasing the rate of vertical divisions can affect progenitor cell number and location (konno et al ., 2008 ; shitamukai et al ., 2011). functional evidence to demonstrate that either vertical or oblique spindle orientation is required for neurogenesis, however, remains to be established. the molecular machinery for spindle orientation during neurogenesis is best understood in drosophila (siller and doe, 2009). in drosophila neuroblasts, orientation of the mitotic spindle along the apical - basal axis is important for the asymmetric segregation of the cell fate determinants numb (hirata et al ., 1995 ; knoblich et al ., 1995 ; rhyu et al ., 1994 ; spana and doe, 1995), prospero (hirata et al ., 1995 ; knoblich et al ., 1995 ; spana and doe, 1995), and brat (bello et al ., 2006 ; betschinger et al ., 2006 ; lee et al . , 2006) into the basal daughter cell (bowman et al ., 2006 ; 2006), where these proteins prevent self - renewal and induce differentiation. in neuroblasts, the mitotic spindle is oriented by two protein complexes that assemble on its apical cell cortex. one complex consists of the pdz domain proteins par-3, par-6, and the atypical protein kinase c (apkc) while the other contains the goloco domain protein pins, the heterotrimeric g protein subunit gi, and the microtubule - binding protein mushroom body defect (mud). , 2000; yu et al., 2000 ) and par-3 (schober et al ., 1999 ; wodarz et al ., 1999) via multiple armadillo repeats within its so - called asymmetry domain (knoblich et al . in insc mutants, mitotic spindles in neuroblasts are randomly oriented, leading to missegregation of cell fate determinants, and thus, cell fate defects in the developing nervous system . when insc is ectopically expressed in epithelial cells, pins and mud are recruited from the basolateral to the apical cortex, and the mitotic spindle reorients from a horizontal into an apical - basal direction . therefore, unlike all other components, insc is not only required but also sufficient for spindle orientation along the apical - basal axis . while the components of the drosophila spindle orientation machinery are conserved in mammals, they have been studied mainly with regard to their roles in epithelial cell polarity ( goldstein and macara, 2007), and most of them have additional functions in cell polarity or microtubule dynamics (woodard et al ., 2010). mammalian par-3, par-6, and apkc are important for spindle orientation, and like their drosophila counterparts they are also required for epithelial apical - basal polarity. pins has two mammalian homologs, ags-3 and lgn (sanada and tsai, 2005 ; yu et al ., 2003). ags-3 does not appear to be expressed in the brain at significant levels, and ags3 knockout mice show no brain phenotype (blumer et al ., 2008). by contrast, lgn mediates planar spindle orientation in the developing brain (konno et al ., 2008 ; morin et al ., 2007), consistent with its role in mitotic spindle orientation during epithelial morphogenesis (zheng et al ., 2010), but is also required for microtubule aster formation and spindle morphology (du et al ., 2001), and regulates mitotic spindle orientation during epithelial morphogenesis similarly, the mammalian mud homolog numa has been shown to play a conserved role in the spindle orientation complex (du and macara, 2004) but has additional functions in organizing a bipolar mitotic spindle (silk et al ., 2009 ; sun and schatten, 2006). overexpression and rnai studies have shown that the protein is involved in orienting the mitotic spindle in the rat retina (zigman et al ., 2005), and a similar function has been postulated in the mouse skin (lechler and fuchs, 2005). moreover, in situ hybridization experiments showed that mouse inscuteable (minsc) is expressed in the developing neocortex at the time when the first neurons start to appear (zigman et al ., 2005). to test the role of minsc in cortical development, we measure spindle orientation in 3d and show that the fraction of oblique divisions increases or decreases upon minsc overexpression or deletion, respectively. we show that loss of minsc leads to defects in neurogenesis and depletion of bps, while minsc overexpression has the opposite effect. our data are consistent with a model in which oblique divisions preferentially give rise to bps and, therefore, suggest a mechanism regulating the balance between direct and indirect neurogenesis during mouse brain development. minsc is expressed throughout the developing cortex during mid - neurogenesis (figures 1a, 1b, and 1k) (zigman et al ., 2005). in the vz, the protein is enriched at the spindle midzone in about 90% of the anaphase cells (yellow arrow in figure 1c, and graph in figure 1e). in 100% of the cp neurons, however, the protein is localized to the neuron cell body cytoplasm and concentrates on one side of the nucleus (yellow arrow in figure 1d). to test whether minsc can functionally replace the drosophila protein , we generated transgenic flies expressing c - terminally myc - tagged minsc (minsc::myc). when expressed in neuroblasts, minsc::myc localizes into an apical crescent (figures 1f and 1 g). like drosophila insc (kraut et al ., 1996), minsc::myc can induce a reorientation of the mitotic spindle into an apical - basal orientation when ectopically expressed in epithelial cells (figures 1h and 1i). thus, minsc is a functional homolog of drosophila insc. to analyze the function of minsc in mouse cortical development, we generated conditional loss - of - function and overexpression alleles (called minsc and r26, respectively) (figure 1j ; see figures s1a and s1b and supplemental experimental procedures available online for details). upon cre recombination, the r26 line lost -gal expression and showed strong and ubiquitous expression of minsc - gfp (r26) (figure 1p). for brain - specific recombination we used nescre8, which expresses cre in the forebrain of e8.5 embryos (petersen et al ., 2002). when combined with minsc , this line in near - complete removal of minsc from the cortex at e14.5 (figures 1k and 1l). we call the recombined allele minsc. residual minsc staining on the apical surface of the cortex (white arrow) is presumably due to truncated protein persistence or mosaic expression of cre (figure 1l). in addition we detected some nonspecific antibody staining around blood vessels (yellow arrow) that is not due to the secondary antibody (figures s1f and 1 g). when combined with the r26 allele, nescre8 caused loss of -gal expression (compare figure 1 m with 1n), and strong expression of the gfp fusion protein (figures 1o and 1p) in the entire cortex at e14.5. expression of the gfp fusion protein can also be detected as a 90 kda band in immunoblots from e13.5 heads (figure 1q). this band is found in addition to the 60 kda band from the endogenous protein in nescre/;r26 but not in nescre/ or r26 mice (figure 1q). thus, we have generated functional tools for gain- and loss - of - function analysis of minsc. previous rnai experiments have suggested that the function of minsc in controlling the orientation of neural precursor divisions is conserved from drosophila to mice (zigman et al ., 2005). we therefore asked whether minsc controls the orientation of mitotic spindles in rgcs and, if so, whether the loss- and gain - of - function alleles influence spindle orientation and lineage specification in the developing brain. various conflicting reports exist on the wild - type orientation of mitotic spindles in rgcs (chenn and mcconnell, 1995 ; haydar et al ., 2003 ; konno et al ., 2008). in these reports, spindle orientations were measured relative to a line representing the ventricular surface. as this methodology neglects spindle orientations in z direction (out of the focal plane) and is therefore imprecise due to the curved apical surface of the ventricle, we used 3d image reconstruction and computational analysis to obtain more precise measurements. e11.5 and e13.5 embryos were stained for tubulin (tub), tubulin (tub), and phosphorylated histone h3 (ph3) to mark centrosomes, mitotic spindles, and mitotic chromatin, respectively. embryonic brains were paraffin embedded, and individual anaphase rgcs were reconstructed in 3d from confocal stacks of coronal brain sections (figures 2a2c ; figures s2a s2c ; asterisks in figures 2a and 2b point at centrosomes). using the imaris 3d visualization software, we then defined the position of the two centrosomes and placed five points at different positions along the apical surface of the 3d - rendered cell. these points were used to determine the best - fitting plane by orthogonal distance regression and to calculate the angle between a vector connecting the two dots marking the centrosomes, and the normal vector of the plane, marking the apical surface. the angle of the spindle orientation was calculated as 90 minus the angle (figure 2d). using this procedure, we determined the division angle of radial glia cells from nescre/ (ctrl), nescre/;minsc (cko), and nescre/;r26 (cki) mice at both e11.5 and e13.5. at e11.5, rgcs divide in a planar orientation with mitotic spindles oriented in parallel to the ventricular surface (angles less than 30), consistent with previous observations (haydar et al ., 2003 ; konno et al . division angles in cko and cki mice are not significantly different from controls ( figure 2e ; table s1). although we can not exclude that cre recombination is not efficient in early stages, this suggests that minsc is not functional at early stages of neurogenesis. at e13.5 , however, 63% of the mitotic spindles in control embryos are at angles between 0 and 30, while 33% are between 30 and 60. consistent with previous reports, we found that vertically oriented mitotic spindles (between 60 and 90) are rare (haydar et al ., 2003) and are not seen in more than 3% of all mitotic cells (figure 2f, and blue bar in figure 2 g). in cko mice, however, the vast majority of mitotic spindles (95%) were between 0 and 30, oblique divisions (30 < 0 < 60) were strongly reduced (5%), and vertical spindles were never seen (figure 2f, red bar in figure 2 g ; table s1). upon overexpression of minsc in cki mice, however, the fraction of oblique and vertical divisions was significantly increased (63%) (figure 2f, green bar in figure 2 g ; table s1). thus, like in drosophila, minsc is required and sufficient for orienting mitotic spindles along the apical - basal axis. importantly, the minsc spindle orientation phenotype is different from the one observed in lgn knockout mice and lgn knockdown in chicken spinal cord (konno et al ., 2008 ; morin et al ., 2007), where spindle orientation is randomized, and the number of horizontal spindles is actually decreased. we also tested the subcellular localization of minsc::gfp in r26/ rgcs at e14.5 (figure 2h). when nuclei are close to the ventricular surface in preparation for mitosis, the protein concentrates in the apical stalk as well as on the basal side of the rgc body (yellow arrow in figures 2h and 2i, and yellow bar in figure 2 m). in about 80% of mitotic cells, minsc concentrates in an apical crescent (orange arrow in figures 2h and 2j, and green bar in figure 2 m) that enlarges in prometaphase while the basal staining disappears (green arrow in figures 2h and 2k). in anaphase, finally, minsc becomes symmetric again and is distributed on both sides of about 90% of anaphase rgcs and in the spindle midzone (blue arrow in figures 2h and 2l, and blue bar in figure 2 m). taken together, these data demonstrate that minsc is an important regulator of spindle orientation in the developing mouse brain. both nescre/; minsc and nescre/;r26 mice survive to adulthood, although nescre/;r26 animals frequently show epileptic crisis. despite their viability, however, both mutants show clearly visible and reproducible defects in cortical organization (figure 3). nissl staining of brains from 2-month - old animals shows that cortical thickness is reduced in nescre/;minsc mice and increased in nescre/;r26 mice (figures 3a3d). very similar brain defects are observed in minsc mice (figure 3b), indicating that the time of onset of nescre8 expression is not relevant for the strength of the phenotype. the different layers of the developing cortex can be recognized by their unique cell density and morphology in nissl stains. analysis of the various minsc alleles reveals that layer organization is not dramatically affected in nescre/;minsc mice (figure 3c) while in nescre/;r26 mice, layer iv is barely recognizable and seems to be fused with layer v (figure 3d). in addition, gfap staining indicates an alteration of the white matter layer thickness (figure s3). to further characterize these adult brain phenotypes, we used layer - specific markers. we used foxp2 as a marker for layer vi, foxp1 as a marker for layers iii and v, satb2 as a marker for layers ii iv (britanova et al . 2003), and cux1 as marker for layers iii iv (nieto et al ., 2004). the number of satb2-positive cells is reduced in the nescre/;minsc mice (figures 3e and 3i), while in the nescre/;r26 mice, their number is increased (figure 3 m). similar were obtained using cux1 antibody as marker of the upper layers (figures 3h, 3l, and 3p). the nuclear marker foxp1 is present in two stripes corresponding to layers iii and v (figure 3f). cell density is strongly reduced in nescre/;minsc mice (figure 3j) while the number of cells in these layers is significantly increased in nescre/;r26 mice (figure 3n). finally, layer vi of the adult cortex, which is the first to be formed during embryogenesis, is also affected in both mutant conditions, as shown by immunostaining with the foxp2 antibody (figures 3 g, 3k, and 3o). a quantitative analysis of the cells positive for the various layer - specific markers (figure 3q) confirms this phenotypic analysis. these data demonstrate that minsc levels are important for neurogenesis and suggest that vertical orientation of the mitotic spindle is relevant for cortical development. to determine the developmental origin of those cortical phenotypes, we analyzed cortical development in minsc knockout and overexpression mice (figure 4). e11.5 brain sections from control, conditional knockout, germline - transmitted knockout, and conditional knockin show no difference in the expression of nestin, tbr1 (neurons), or tbr2 (intermediate progenitors) (figure s4), indicating that minsc has no obvious role in early neurogenesis. we then stained coronal sections of e14.5 control and mutant brains with cresyl violet (figures 4a4j). no major structural abnormalities were detected at this stage, but nescre/;minsc brains were smaller than controls (figures 4a and 4b). the lateral ventricles were enlarged, and overall cortical thickness as well as the protrusion of the lateral ganglionic eminence into the ventricles were reduced (figures 4a, 4b, 4e, and 4f). nescre/;r26 brains, on the other hand, exhibited increased cortical thickness (figure 4a, 4c, 4e, and 4 g). these alterations in cortical thickness were observed in both central and lateral regions (refer to the scheme in figure 4k). quantification of those phenotypes showed that cortical thickness was reduced by around 20% both medially and laterally in nescre/;minsc mice, while it was increased by about 20% in the medial region and by around 40% in the central and lateral regions in nescre/;r26 mice (figure 4l). a more detailed examination of these phenotypes revealed that the alterations in cortical thickness are largely due to changes in the iz and the cp while the vz is almost unaffected (figures 4h4j). in nescre/;minsc mice the thickness of the iz and cp were reduced by about 25% and 40% (figure 4 m) while in nescre/;r26 mice, both layers were thicker, up to more than three times (figure 4 m). to test whether these alterations were due to changes in cellular composition, we stained e14.5 nescre/, nescre/;minsc, and nescre/;r26 embryos for nestin, bplp, and tuj1, which label neural progenitors and neurons, respectively (menezes and luskin, 1994 ; yachnis et al ., 1993). while nestin staining of nescre/;minsc mice does not reveal any obvious abnormalities, rgcs in nescre/;r26 brains showed an alteration in the radial organization of the rgc fibers (menezes and luskin, 1994) (figures 4n4p ; figure s5). tuj1 staining revealed that neurons in the iz and cp of nescre/;minsc brains are reduced while in nescre/;r26 brains the area occupied by those neurons is enlarged, consistent with the observed increase in cortical thickness (figures 4q4s). in nescre/;minsc brains, however, tuj1 neurons in the vz were rarely found (arrow and inset in figure 4r), while in nescre/;r26 brains they seemed to be more abundant (arrow and inset in figure 4s). together, these data indicate that changes in spindle orientation do affect neurogenesis in the developing cortex, with consequent alteration of its thickness, although the number of rgcs is not strongly affected (figure 5r). to characterize the initial defects in minsc - deleted or -overexpressing mice, we used markers for cp neurons. cp neurons are the first recognizable layer of the developing neocortex, and are identified by the expression of map2 and the transcription factor tbr1 (fujimori et al ., 2002 ; hevner et al ., the number of tbr1 cells is reduced by almost half in nescre/;minsc brains while in nescre/;r26 mice the number of these cells is significantly increased ( figures 5a5c and 5p). staining for map2 shows similar alterations in cp neurons in the two genotypes (figures 5h5j). to test whether the decrease in neurogenesis occurs at the expense of cortical progenitor cells, we used the nuclear rgc marker pax6 (figures 5d5f and 5l5n) (gtz et al ., 1998). although the high density of pax6 nuclei in the vz makes it impossible to obtain precise quantitative measurements, we did not find any striking changes in the number of sox2 + vz progenitors in nescre/;minsc or in nescre/;r26 mice (figure 5r). however, vertical spindle reorientation in nescre/;r26 mice leads to the frequent generation of pax6 progenitors that are located outside the vz, in the iz, or the cp (figures 5f and 5n). the number and frequency of those cells were increased even more when cre recombination was induced in the germline of r26/ mothers using morecre. in e14.5 embryos from those mothers (named r26/), clusters of pax6 cells were frequently seen in the iz, and pax6 cells were present even in the cp where they replaced differentiating neurons forming gaps in the map2 layer of cells (figures 5 g and 5k, arrows, and figure 5o). quantitative analysis revealed that pax6 cells were six times more abundant in the iz and three times more abundant in the cp of r26/ mice when compared to nescre/;r26 (figure 5q). these observations are consistent with previous in utero electroporation experiments (konno et al ., 2008), although the previous that endogenous minsc does not orient mitotic spindles in the mouse cortex (fish et al ., 2008 ; konno et al ., 2008) changes in cortical thickness and neuronal differentiation observed in minsc mutant and minsc - overexpressing brains could be due to alterations in the position of mitotic cells and/or in rgc proliferation. in order to distinguish between these possibilities, we first stained e14.5 sagittal brain sections with anti - ph3 to look at proliferative cells in both vz and svz. in control animals, 80% of the mitotic figures seen in the cortex at e14.5 are located at the apical side of the vz while 20% of mitotic figures corresponds to the more basally located intermediate progenitors (figures 6a, 6d, 6h, and 6i). in nescre/;minsc mice, however, the number of basally located mitotic cells is strongly reduced at e14.5 (figures 6b, 6e, 6h, and 6i). in nescre/;r26 mice, on the other hand, the number of basal mitotic cells is increased (figures 6c, 6f6i). thus, changes in spindle orientation affect the number of basal mitotic cells, without significantly altering the number of apical mitotic cells (figure 6h). alterations in the number of neurons and intermediate progenitors that are produced during neurogenesis could be due to premature cell cycle exit of vz progenitors. to test this, we injected pregnant females with brdu to label s phase cells, sacrificed the animals 24 hr hour later, and performed double immunostaining for brdu and the proliferation marker ki67. in this experiment, the fraction of ki67brdu cells within the total brdu - positive population can be used as an indicator of cell cycle exit of progenitors. we found no significant differences in nescre/;minsc, in nescre/;r26, or in r26/ mice (figure 6j), indicating that minsc has no strong effect on average cell cycle length both in apical and bps. the altered proliferation pattern could be due to a difference in position or fate of the dividing cells. in wild - type animals, proliferation basal to the vz is due to ipcs, which can be specifically marked by staining for tbr2 (figure 6k) (englund et al ., 2005). in nescre/; minsc mice, the number of tbr2cells is reduced (figure 6l) while this number is increased in nescre/;r26 brains (figure 6 m). this effect can be enhanced by germline recombination of the r26 allele in r26/ mice (figure 6n). interestingly, the extra bps are no longer confined to the svz but frequently found in the more basal parts of the cortex. thus, modifying spindle orientation changes the frequency with which rgcs give rise to intermediate progenitors. as proliferation and cell cycle exit rates of rgcs do not change in the mutant conditions, we can exclude that this is a consequence of alterations in rgc proliferation. therefore, we postulate that spindle orientation influences the fate that rgc daughters assume after division. to obtain more direct evidence for the proposed lineage changes, we used in utero electroporation (figures 7a7r). for this we electroporated a construct expressing rfp into brains of e14.5 control, knockout, and embryos from r26 males crossed to nescre/; r26 females. we used nescre/; r26 embryos in order to avoid the observed massive ectopic location of apical and bps. long - term time - lapse experiments during mid - late neurogenesis show that apical progenitors undergo only one division in 24 hr (noctor et al ., 2004). in order to look at the fate of the daughter cells after one division of apical progenitors, embryos were collected 1 day after electroporation. rfp cells are found in the vz and iz of brains from control, knockout, and knockin embryos (figures 7b, 7e, 7h, 7k, 7n, and 7q). while the electroporated rfp cells have migrated beyond the basal border of the pax6 expression zone in control and knockout animals, the rfp cells are located right at the edge of this expression zone in the minsc - overexpressing animals (compare figures 7c and 7i with figure 7f). to determine the identity of those cells, we used the bp marker tbr2. in control and mutant brains, tbr2 is expressed in a subset of the rfp - electroporated cells. in control animals, tbr2 is expressed in 23% of the rfp - electroporated cells while this fraction is reduced to about 10% in nescre/; minsc embryos. in minsc - overexpressing animals, in contrast, the bp marker is expressed in over 50% of the electroporated cells (determined as the number of tbr2, rfp cells divided by the total number of rfp cells, figure 7 t). as the percentage of pax6/rfp progenitor cells among all electroporated (rfp) cells does not change (figure 7s), these indicate that a reorientation of the mitotic spindle along the apical - basal axis causes rgcs to preferentially generate intermediate progenitors after division. taken together, our data reveal that spindle orientation along the apical - basal axis is mediated by minsc and is important for promoting neurogenesis. apical - basal divisions are more likely to give rise to intermediate progenitors, and this effect may be responsible for the increased rates of neurogenesis observed upon minsc overexpression. to address the role of nonplanar spindle orientation in cortical development, we have generated a conditional deletion of minsc. unlike drosophila pins, par-3, par-6, and apkc, insc has a single, clearly defined mammalian homolog (katoh, 2003 ; lechler and fuchs, 2005 ; zigman et al ., 2005). in drosophila embryos, insc is exclusively expressed in asymmetrically dividing cells, and no functions other than asymmetric cell division have been reported. mutating centrosomal proteins like asp (aspm in mice) (fish et al ., 2006, 2008) or cnn (cdk5rap2 in mice) (barrera et al ., 2010) might affect signaling pathways by disrupting primary cilia and will influence centrosome asymmetry, which was proposed to be important in cortical neurogenesis (wang et al ., 2009). mutating dynein - binding proteins like lis1 causes defects in spindle morphology and cell migration (yingling et al ., 2008). therefore, our minsc knockout and minsc - overexpression mice are particularly specific tools to analyze spindle orientation. the spindle orientation defects we observe in minsc - deficient mice are different from the one previously reported for lgn, the mouse homolog of the insc - binding partner pins. in lgn knockouts, the orientation of the mitotic spindle is randomized while lack of minsc causes almost all mitotic spindles to assume a planar orientation. this is in agreement with the functions reported for the two genes in flies and explains why the two genes have different effects on cortical neurogenesis (konno et al ., 2008 ; our suggest that intermediate progenitors are more likely to arise from oblique or horizontal divisions ( in which the spindle is oriented oblique or vertical, respectively). first, increasing or decreasing minsc expression elevates or reduces the number of neurons, respectively. at the same time, both the total number of apical progenitors and the number of mitotic cells in the vz remain constant. second, minsc levels affect the number of tbr2-positive intermediate progenitors and the number of cells dividing outside the vz. and finally, apical progenitors labeled by electroporation of rfp - expressing plasmids are more likely to give rise to tbr2-positive intermediate progenitors when minsc levels are increased. we propose a model in which minsc influences spindle orientation and thereby regulates the balance between direct and indirect neurogenesis (figure 8). whether or not minsc is required for generating all or most bps is not clear. it is remarkable that the terminal forebrain phenotype of minsc mice is similar to the one observed for tbr2, in which intermediate progenitors are essentially absent (arnold et al . 2008): in both cases, thickness of the cp is reduced by about 40%. while the outer layers are more affected in tbr2 mice, this could be explained if intermediate progenitors initially form through a spindle orientation - dependent mechanism, but later neurogenesis can also proceed through a partially redundant, minsc - independent mechanism. how could asymmetry be established during progenitor divisions? quite likely, minsc - independent direct neurogenesis and minsc - dependent indirect neurogenesis might use different mechanisms. both the narrow apical plasma membrane domain and the basal process that connects progenitors to the pial surface should be inherited by only one daughter cell during oblique or vertical division. as bps do not maintain their connection to the apical surface (gtz and huttner, 2005 ; miyata et al . , 2004) but do contain a basal process, the asymmetric inheritance of those structures could contribute to intermediate progenitor formation. for example, intermediate progenitors could simply move out of the vz after s phase because they are not attached to the apical surface. alternatively, apically localized proteins could perform a more direct signaling role. it has been proposed that the asymmetric inheritance of par3 can activate notch signaling in one daughter cell of an apical progenitor (bultje et al ., 2009). as levels of notch signaling are lower in intermediate progenitors and decreasing levels of notch signaling promotes the formation of intermediate progenitors (mizutani et al . , one could imagine that the loss of par3 during an oblique division establishes bp fate in one of the two daughter cells . alternatively, the basal process could carry certain signaling molecules, whose asymmetric inheritance alters daughter cell fate ( schwamborn et al ., 2009). how could minsc act on a molecular level? in drosophila, the expression of insc recruits pins to the apical cortex and acts as a molecular switch for spindle orientation. in the mouse cortex , however, progenitor cells seem to express equal levels of minsc regardless of division orientation. it has been demonstrated that horizontal spindle orientation in epithelial cells depends on apkc - mediated phosphorylation of lgn (hao et al ., , minsc could simply inhibit this pathway by binding to the apkc / par-3/par6 complex and thereby promote nonplanar orientation of the mitotic spindle . in this model, the role of minsc would not be to instruct apical - basal orientation in a binary manner but to introduce imprecision and cause a degree of stochasticity in the orientation of progenitor divisions . this would explain why minsc expression levels do not decide on the orientation of individual progenitor divisions, but overall changes of minsc expression have a strong influence on the fraction of cells that divide in a nonplanar fashion . it has been proposed that changes in spindle orientation have influenced cortical evolution ( bond et al ., 2002 ; fish et al ., 2008 ; zhang, 2003). the gene aspm, which is required for correct orientation of early proliferative neuroepithelial divisions (fish et al ., 2008), has evolved adaptively in primates suggesting a functional alteration during primate evolution. aspm is localized at spindle poles and is particularly important for correct planar orientation of symmetric progenitor divisions (fish et al ., 2008). it has been proposed that adaptations in aspm function have increased the fidelity and number of early symmetric divisions, thereby increasing progenitor pools, neuron number, and brain size (ponting and jackson, 2005). given that minsc regulates spindle orientation, it could have a similar role in primate evolution. in fact, intermediate progenitors play an important role in cortical evolution: in primates these cells can generate many more than two neurons, thus amplifying the total number of neurons arising from one ventricular progenitor. human and ferret brains contain a population of outer subventricular zone (osvz) progenitors that have been attributed a key role in amplifying neuron numbers (fietz et al . live - imaging experiments have suggested that spindle orientation is crucial for establishing this cell population ( shitamukai et al ., 2011 ; wang et al ., 2011). given that minsc is a key regulator of intermediate progenitor formation, it could regulate osvz progenitor formation as well. in this case, characterization of evolutionary changes in the minsc locus and a functional analysis in the human brain might yield important information on how this unique cell population has arisen in evolution. primary antibodies used were: rabbit anti - minsc (1:100 ; zigman et al .); mouse anti--gal (promega); chicken anti - gfp (1:500 ; abcam); rabbit anti - satb2 (1:500 ; abcam); rabbit anti - foxp1 (1:500 ; abcam); rabbit anti - foxp2 (1:500 ; abcam); mouse anti - tuj1 (1:500 ; sigma - aldrich); rabbit anti - nestin (1:500 ; becton dickinson); rabbit anti - pax6 (1:300 ; covance); rabbit anti - tbr1 (1:500 ; abcam); mouse anti - map2 (1:500 ; chemicon); rabbit anti - tbr2 (1:500 ; abcam); rabbit anti - ph3 (1:500 ; upstate); and mouse anti - ph3 (1:500 ; cell signaling). secondary antibodies were conjugates of alexa fluor 488, alexa fluor 568, and alexa fluor 647 (1:500 ; invitrogen). fifteen micron coronal sections of e11.5 and e14.5 embryonic brains paraffin embedded were stained with mouse anti-tub (1:1000 ; sigma - aldrich), mouse anti-tub (1:1000 ; sigma - aldrich), and rabbit anti - ph3 (upstate), using the staining protocol described in the supplemental experimental procedures. z stacks with an interval of 0.5 m were taken using a zeiss axiovert 200 m confocal microscope. after 3d reconstruction of the confocal stacks of a dividing cell with the imaris software, five points were placed arbitrarily at different positions of the 3d - rendered plane ventricular surface, and two points were placed at the positions of the two centrosomes. the coordinates of the five points were used to determine the best - fitting plane by orthogonal distance regression. the angle between the vector connecting the two points marking the centrosomes and the normal vector of the regression plane was calculated, and 90 minus the angle was used as the division angle. all calculations were done using the r programming environment. in order to have an estimate of the upper limit of error for the division angle calculation, each of the five points was in turn left out for determining the best - fitting plane. thereby, five planes determined by just four points were received, and the angles for these were determined as well as the standard deviation (sd) of the angles.

summaryneurons in the mammalian neocortex arise from asymmetric divisions of progenitors residing in the ventricular zone. while in most progenitor divisions, the mitotic spindle is parallel to the ventricular surface, some progenitors reorient the spindle and divide in oblique orientations. here, we use conditional deletion and overexpression of mouse inscuteable (minsc) to analyze the relevance of spindle reorientation in cortical progenitors. mutating minsc almost abolishes oblique and vertical mitotic spindles, while minsc overexpression has the opposite effect. our data suggest that oblique divisions are essential for generating the correct numbers of neurons in all cortical layers. using clonal analysis , we demonstrate that spindle orientation affects the rate of indirect neurogenesis, a process where progenitors give rise to basal progenitors, which in turn divide symmetrically into two differentiating neurons. our indicate that the orientation of progenitor cell divisions is important for correct lineage specification in the developing mammalian brain.

cells comprising a tissue migrate as part of a collective. how collective processes are coordinated over large multi - cellular assemblies has remained unclear, however, because mechanical stresses exerted at cell - cell junctions have not been accessible experimentally. we report here maps of these stresses within and between cells comprising a monolayer. within the cell sheet there arise unanticipated fluctuations of mechanical stress that are severe, emerge spontaneously, and ripple across the monolayer. this stress landscape becomes increasingly rugged, sluggish, and cooperative with increasing system density. within that landscape, local cellular migrations follow local orientations of maximal principal stress. migrations of both endothelial and epithelial monolayers conform to this behavior, as do breast cancer cell lines before but not after the epithelial - mesenchymal transition. collective migration in these diverse systems is seen to be governed by a simple but unifying physiological principle: neighboring cells join forces to transmit appreciable normal stress across the cell - cell junction, but migrate along orientations of minimal intercellular shear stress.

there is growing recognition that bipolar affective disorder is associated with neurocognitive deficits and allied neuroanatomic and neurophysiologic anomalies. while mood states and psychotropic medication usage influence cognition and brain physiology, observations that many of these neurocognitive and structural and functional neuroanatomic abnormalities predate symptom onset or persist during symptom remission raise the possibility that some changes in brain structure and function are central to the pathophysiology of bipolar affective disorder. furthermore, accumulating evidence suggests that neurocognitive and neuroimaging factors are associated with clinical outcome, psychosocial functioning, and vocational disability in bipolar disorder. the goal of this review is to synthesize these recent findings to assess their clinical relevance and highlight areas in need of additional research. almost two thirds of bipolar patients have some level of inter - episode functional impairment , and about half are unemployed or have reduced occupational functioning. thus, although many individuals with bipolar disorder respond well to treatments designed to reduce affective and psychotic symptoms, the ability to achieve functional recovery the capacity to study, work, engage in recreation, live independently, and engage in romantic relationships may be significantly hindered. therefore, recovery from mood episodes and/or residual symptoms does not necessarily translate into functional recovery. indeed, many patients with bipolar illness do not regain premorbid levels of psychosocial functioning. studies of the lifetime course of bipolar disorder consistently find that during periods of symptomatic recovery, bipolar individuals often continue to experience residual mood symptoms that likely contribute to increased levels of disability and decreased psychosocial functioning. clinical factors in particular disease chronicity, severity, and subsyndromal depressive symptoms are associated with poor functional outcome. in addition, as reviewed in detail below, there is growing evidence for a relationship between neurocognitive function, underlying neuroanatomic abnormalities, and functional outcome across a range of severe neuropsychiatric disorders, including bipolar illness. a better understanding of the relationship between neurocognitive and neuroimaging measures and clinical outcome has the potential to improve current treatment options and provide targets for new treatment strategies. although there is clear evidence that patients with bipolar disorder exhibit widespread neurocognitive dysfunction during acute episodes of mania and depression, the discovery that these deficits endure during symptom remission raises the possibility that cognitive impairment may represent a trait rather than a state variable. euthymic bipolar patients exhibit limitations in several cognitive domains, particularly in measures of executive function, declarative memory, and sustained attention. although euthymic patients often present with residual affective symptoms that may adversely affect performance on cognitive tests, even those who have been euthymic for months prior to assessment have marked neuropsychological impairments. indeed, several recent meta - analyses of neuropsychological performance in euthymic bipolar disorder have documented impairment across a wide variety of cognitive domains. in the most recent of these meta - analyses, kurtz and gerraty found that nonsymptomatic bipolar patients performed 0.40.9 sd below healthy individuals on measures of attention (e.g, continuous performance test ; cohen s d = 0.69), processing speed (e.g, digit symbol substitution ; d = 0.66), working memory (e.g, digit span backward ; d = 0.65), declarative memory (e.g, rey or california verbal learning test ; d = 0.81), nonverbal declarative memory (e.g, visual reproduction subtest from the wechsler memory scale ; d = 0.91), and executive functioning (e.g, trail making test b ; d = 0.72). observations of neuropsychological deficits in nonsymptomatic bipolar patients suggest that these impairments may be related to the pathophysiology of the illness and, as described subsequently, are also reasonable predictors of psychosocial functioning and disability. evidence that clinically unaffected relatives of patients with bipolar disorder have subtle neurocognitive impairments suggests that such deficits may reflect genetic liability for the illness. a recent meta - analysis reported small but statistically significant differences (e.g, d < 0.5) for unaffected first - degree relatives compared with healthy individuals in the domains of executive functioning and verbal memory. another recent meta - analysis of 17 published studies included 443 first - degree relatives of bipolar patients and reported cognitive impairments in the range of small to medium effect sizes in the domains of attention (0.080.51), verbal learning (0.270.33), and executive functioning (0.220.36). glahn and colleagues recently reported that three cognitive tests (digit symbol coding, object delayed response task, and immediate facial memory) are genetically correlated with liability for bipolar disorder, suggesting that the same genetic factors that increase the risk of bipolar disorder influence performance on these tests. although many of the neurocognitive impairments found in individuals with bipolar disorder are present during euthymia, it is quite likely that clinical course influences test performance in bipolar disorder. indeed, age at onset, total number of mood episodes, number of manic episodes, number of depressive episodes, and number and duration of hospitalizations are all factors associated with the degree of neurocognitive impairment among individuals with bipolar disorder. furthermore, the use of psychotropic medication could impact neurocognitive functioning in bipolar patients. a recent meta - analysis examining the effects of lithium on cognitive performance in bipolar disorder in 12 studies involving 276 lithium - treated and 263 lithium - free patients found a small but significant impairment in lithium - treated patients in immediate verbal learning and memory (effect size, 0.24) and creativity (effect size, 0.33). in contrast, no significant impairments were found for delayed verbal memory, visual memory, attention, executive functioning, processing speed, or psychomotor performance. some antidepressant medications have been shown to yield adverse cognitive effects, particularly those with anticholinergic properties. however, other studies have failed to find significant effects of such medications on cognition. although few studies have examined neurocognitive performance in unmedicated bipolar patients, goswami and colleagues found no significant differences in neurocognitive test performance between 22 drug - free euthymic bipolar patients and 22 medicated euthymic patients. together, these data suggest that although clinical course and medication usage may influence cognitive performance in bipolar disorder, these effects seem to explain only a fraction of the observed impairments. growing evidence indicates that the neurocognitive impairments contribute to poorer psychosocial functioning and increased functional disability in bipolar disorder. for example, executive dysfunction at initial assessment has been linked to lower levels of functional recovery in this population both cross - sectionally and longitudinally. bonnin and colleagues recently found that subthreshold depressive symptoms and working memory function (digits backward) were specific predictors of occupational functioning 4 years later. similarly, bipolar patients with declarative memory deficits are less likely to return to premorbid psychosocial or occupational functioning. schizophrenia research has recently begun to distinguish between functional capacity (i.e, an estimate of one s ability to perform tasks relevant to everyday functioning) and actual performance (i.e, what one actually does in everyday settings). this distinction is important, as performance can be influenced by functional capacity as well as environmental, motivational, and other factors. bowie and colleagues recently performed a series of confirmatory path analyses to determine how neurocognitive deficit influences real world functioning and disability in bipolar disorder. a total of 130 community - dwelling individuals with bipolar disorder were assessed with neuropsychological tests, symptom measures, and performance - based social and adaptive functional competence measures in three domains of real world functioning (community and household activities, work skills, and interpersonal relationships). in all models, the relationship between neurocognition and outcome these findings imply that functional disability may persist in patients with bipolar disorder even after symptomatic recovery due to neurocognitive and skill deficits. conversely, even if a patient acquires certain neurocognitive skills but continues to experience mild mood symptomatology, changes in real world behavior might lag or not manifest at all. in summary , significant evidence suggests that many individuals with bipolar disorder have at least some degree of neurocognitive deficit. although these deficits may be influenced by clinical course / severity or psychotropic medication usage, they also seem to be associated with the genetic liability for the illness, suggesting that neurocognitive deficits are an important aspect of the presentation of bipolar disorder. finally, neurocognitive impairments impact real world functioning of patients with bipolar disorder. the most consistently documented neuroanatomic abnormalities in adult patients with bipolar disorder are lateral ventricle enlargement (+ 17%) and increased rates of deep white matter hyperintensities (odds ratio, 2.49). reduced area or volume of the corpus callosum is also a robust finding across studies. additional evidence for white matter involvement in bipolar disorder comes from studies finding alterations in white matter tract organization and regional white matter volume reductions. in addition, some recent evidence indicates that white matter abnormalities may be stable, trait - based abnormalities that reflect genetic liability to the illness. kieseppa and colleagues found decreased left hemisphere white matter volume in bipolar probands and their nonbipolar co - twins. similarly, mcdonald and colleagues found that the genetic risk of bipolar disorder was associated with white matter reduction in the left frontal and temporoparietal regions, suggesting that left frontotemporal disconnectivity may be a genetically controlled neuroanatomic abnormality associated with bipolar illness. finally, in a large dutch twin sample, van der schot and colleagues found that reduction in overall white matter volume was related to the genetic risk of bipolar disorder, whereas significant environmental correlations were observed for cortical gray matter. in general, findings of gray matter alterations in bipolar disorder are more variable across studies, which is likely at least partially attributable to the now well - documented effects of lithium on gray matter volume. although a recent meta - analysis revealed an effect size of 1.17 for reduced volume of the left anterior cingulate in bipolar patients relative to controls, this finding was not significant across studies due to the high between - study heterogeneity. kempton and colleagues, using voxel - based morphometry in patients with bipolar i disorder, their relatives with major depression, healthy relatives, and controls, found group differences in the left insula, cerebellum, and substantia nigra; increased left insula volume in particular was associated with genetic preposition to bipolar disorder independent of clinical phenotype. in contrast, increased left substantia nigra volume was specific to those with the clinical phenotype of bipolar i disorder. changes uniquely associated with the absence of a clinical diagnosis in bipolar relatives were observed in the left cerebellum, suggesting that there may be dissociable genetic and phenotypic influences on brain structure in bipolar disorder. given the substantial body of literature on neuroanatomic changes in bipolar disorder , surprisingly few studies have examined their relationship to outcome. in patients with schizophrenia and those at risk of the illness, this relationship has been examined in several studies. for example, accelerated ventricular enlargement in the 3 years following illness onset was associated with poor outcome in first - episode schizophrenia, whereas a progressive decrement in frontal lobe white matter was associated with greater negative symptom severity. more recently karlsgodt and colleagues found that the structural integrity of medial temporal white matter tracts was predictive of functional outcome in adolescents at high risk of developing psychosis. given the accumulating evidence that disrupted white matter integrity may be central to the pathophysiology of bipolar disorder, white matter abnormalities represent a promising candidate for a neuroanatomic predictor of outcome. two prior studies examined white matter hyperintensities as indicators of treatment resistance and poor outcome in bipolar disorder. moore and colleagues categorized patients with bipolar disorder as good or poor outcome based on treatment response and level of functioning, finding that poor outcome group members had significantly more deep and more severe subcortical punctate white matter hyperintensities relative to those in the good outcome group and healthy controls. regenold and colleagues found that an index of treatment resistance correlated significantly with deep white matter hyperintensity volume, as well as measures of abnormal brain glucose metabolism (sorbitol and fructose) in bipolar patients but not in other patients (i.e, those with schizophrenia and neurologic controls). in summary, there is strong evidence to date implicating neurocognitive factors in bipolar patients as key determinants of functional outcome. given that these cognitive abnormalities likely are reflective of underlying abnormalities in brain structure and function, we propose that microstructural white matter alterations may contribute to poor outcome. similar to the literature relating abnormalities of brain structure to poor outcome in schizophrenia, recent functional mri studies also have begun to document such a relationship. in particular, fusar - poli and colleagues found that in youth with prodromal signs of psychosis, clinical and functional improvement over follow - up was associated with a longitudinal increase in activation in the anterior cingulate and right parahippocampal gyrus during performance on an n - back task. similarly, in individuals at high clinical risk of psychosis, sabb and colleagues found that baseline neural activity in the left inferior frontal gyrus during performance on a language processing task was predictive of severity of positive formal thought disorder and poor social outcome at follow - up. to date, no such studies have been conducted in patients with bipolar disorder. however , emerging literature suggests that the neurophysiology of bipolar disorder involves frontal hypoactivation with concomitant disinhibition (i.e, relative hyperactivation) of limbic structures. the subgenual prefrontal cortex modulates the affective output of limbic and paralimbic structures and cognitive output from the prefrontal cortex. recent evidence from functional mri studies using affective processing paradigms (ie, reacting to stimuli with positive or negative emotional valence) suggests that patients with bipolar disorder may disproportionately engage limbic structures during emotionally valent tasks, regardless of mood state , although the direction of effects has not been consistent across studies. taken together, these studies suggest that corticolimbic dysregulation may underlie the emotional dysregulation and cognitive impairments associated with bipolar disorder. moreover, exaggerated medial prefrontal cortical and subcortical (putamen and amygdala) responses to emotional signals have been observed in bipolar i patients and their nonbipolar relatives, suggesting that such responses may represent heritable neurobiological abnormalities underlying bipolar disorder. given that similar cognitive impairments and associated psychosocial and functional disabilities are seen in patients with bipolar disorder and those with schizophrenia, the adaptation of treatment strategies that have proven beneficial for schizophrenia patients may also be efficacious for bipolar patients. in particular, cognitive remediation has been associated with significant, although modest, improvements in cognitive performance and psychosocial functioning in schizophrenia patients. the development of treatments that target cognitive impairments and functional status is an important area of future investigation in bipolar disorder. two small studies have found that rehabilitative interventions such as cognitive remediation and supported employment may be effective in improving vocational outcomes for bipolar patients, but this will require replication in larger investigations. although bipolar disorder historically has been viewed as a disease involving only episodic dysfunction, increasing evidence indicates that this is not the case for a substantial proportion of patients. collectively, the data reviewed above provide compelling evidence that cognitive impairments are present across multiple domains particularly in the areas of attention, processing speed, and memory in most bipolar patients. these difficulties are observable at or soon after illness onset, and persist throughout the course of illness. given that clinically unaffected relatives of patients with bipolar disorder have similar but milder neurocognitive impairments, such deficits may reflect genetic liability for the illness. although investigation of the neural correlates of functional disability in bipolar disorder is only in its nascent stages, given strong commonalities with schizophrenia, it is anticipated that similar relationships between structural and functional neuroanatomic abnormalities and outcome in bipolar patients will be identified. the rich literature in schizophrenia and in individuals at risk of the illness could serve to inform areas of future research needed in bipolar disorder. as recommended by harvey and colleagues, approaches used in schizophrenia research in particular , longitudinal assessment of cognition, neurophysiology, and psychosocial function across variations in clinical state, and separate assessment of functional capacity and real world functioning will be highly informative when applied to the study of patients with bipolar illness. a clear need exists for objective methods of assessing real world functional abilities, as subjective self - assessments are likely to be influenced by current symptoms or other illness features. thus far, few studies have investigated specific aspects of functional status in bipolar patients and their associations with neuroanatomic, clinical, and treatment - related factors. such investigations are critical for understanding the array of determinants of disability in bipolar illness.

historically, bipolar disorder has been conceptualized as a disease involving episodic rather than chronic dysfunction. however, increasing evidence indicates that bipolar disorder is associated with substantial inter - episode psychosocial and vocational impairment. here we review the contributions of neurocognitive deficits and structural and functional neuroanatomic alterations to the observed functional impairments. in particular, compelling evidence now suggests that neurocognitive impairments, particularly in the areas of attention, processing speed, and memory, are associated with functional outcome. although investigation of the neural correlates of functional disability in bipolar disorder is only in its nascent stages, preliminary evidence suggests that white matter abnormalities may be predictive of poor outcome. a better understanding of the relationship between neurocognitive and neuroimaging assays and functional outcome has the potential to improve current treatment options and provide targets for new treatment strategies in bipolar disorder.

according to current models, cell death most often proceeds via either of two relatively independent subroutines, apoptosis, and necrosis. for a long time, apoptotic and necrotic instances of cell death have exclusively been identified based on morphological criteria. in addition, while apoptosis was believed to constitute the sole regulated (i.e., genetically encoded, and hence susceptible to pharmacological modulation) modality of cell death, necrosis was viewed as a purely accidental process. recently, a functional classification of cell death mechanisms, based on measurable biochemical features, has been proposed, and the concept of regulated necrosis has gained large consensus. in this scenario, the true relevance of additional processes that were previously catalogued as bona fide cell death subroutines is being reevaluated. in particular, while macroautophagy (hereafter referred to as autophagy) turned out to constitute a prominent homeostatic and cytoprotective mechanism , autophagic cell death (a lethal subroutine that is mediated, rather than merely accompanied, by autophagy) has been shown to occur in a limited number of, mostly developmental, scenarios. along similar lines, mitotic catastrophe, a signaling cascade elicited in mitosis - incompetent cells that was initially viewed as a particular case of apoptosis, has recently been proposed to constitute an oncosuppressive mechanism with multiple functional outcomes, including cell senescence as well as apoptotic and necrotic cell death. apoptotic stimuli can be propagated via two distinct, but not entirely disjointed, molecular cascades: extrinsic apoptosis, transducing lethal signals that originate in the extracellular microenvironment, and intrinsic (also known as mitochondrial) apoptosis, responding to perturbations of intracellular homeostasis. extrinsic apoptosis can be initiated either by the ligand - induced activation of plasma membrane death receptors (e.g., fas / cd95, tumor necrosis factor receptor 1 ( tnfr1) ) or by so - called dependence receptors (e.g., deleted in colorectal carcinoma ( dcc) ), when the concentration of their ligands falls below a specific threshold. death receptors promote the activation of caspases (a class of cysteine proteases that play a central role in multiple instances of apoptosis) via the formation of a multiprotein complex that includes among other components receptor - interacting protein kinase 1 (ripk1), fas - associated protein with death domain (fadd), cellular inhibitor of apoptosis proteins (ciaps), and multiple isoforms of cellular flice - inhibitory protein (c - flip). such a death - inducing signaling complex (disc) allows for the proximity - induced autoactivation of caspase-8, in turn catalyzing the proteolytic maturation of caspase-3, the central effector of most cases of apoptosis. the mechanisms whereby dependence receptors are connected to the execution of apoptosis have only recently begun to emerge and appear to involve caspase-9, a caspase that was long believed to exclusively regulate mitochondrial apoptosis. intrinsic apoptosis can be triggered by a plethora of perturbations in intracellular homeostasis, including among others independent of the initiating stimulus, the signaling cascades that mediate intrinsic apoptosis as well as the prosurvival signals that are generated alongside (to facilitate the reestablishment of homeostasis) are opposed to each other at the level of mitochondria. if lethal signals prevail, the majority of mitochondria become permeabilized, an event that de facto seals the cell fate. indeed, upon mitochondrial outer membrane permeabilization (momp), (i) the mitochondrial transmembrane potential (m), that is, the electrochemical gradient driving atp synthesis as well as many other mitochondrial functions, is rapidly dissipated; and (ii) cytotoxic proteins that are normally secluded within the mitochondrial intermembrane space (e.g., cytochrome c ; apoptosis - inducing factor ( aif), endonuclease g (endog) ) are released into the cytosol, where they promote the activation of caspases as well as of caspase - independent cell death executioner mechanisms. the former relies on the cytochrome c - elicited, datp-, and apoptotic peptidase activating factor 1 (apaf1)-dependent assembly of the so - called apoptosome, a molecular platform for the activation of the caspase-9 caspase-3 cascade. the latter involves the caspase - independent endonuclease activity of aif and endog as well as the bioenergetic and redox crisis that ensues m dissipation. of note, extrinsic and intrinsic apoptosis are not entirely disjointed. indeed, while in some cell types (e.g., lymphocytes) the caspase-8 caspase-3 cascade is sufficient to mediate death receptor - dependent apoptosis, in others (e.g., hepatocytes), this process requires the caspase-8-mediated cleavage of the bh3-only protein bid, generating a mitochondrion - permeabilizing fragment (see below). given its position at the frontier between cell life and death, it is not surprising that momp constitutes a highly regulated phenomenon. so far, two models have been put forward to explain momp in molecular terms. on one hand, momp has been suggested to originate at the mitochondrial outer membrane (om), thanks to the pore - forming activity of multidomain proapoptotic members of the bcl-2 protein family, namely, bax and bak. on the other hand, it has been proposed that in response to specific triggers momp would stem from the so - called mitochondrial permeability transition (mpt), an abrupt increase in the permeability to small solutes of the mitochondrial inner membrane (i m). in this latter scenario, a critical role has been ascribed to the permeability transition pore complex (ptpc), a large molecular entity assembled at the junctions between the om and the i m by several proteins, including (though presumably not limited to) voltage - dependent anion channels (vdacs), adenine nucleotide translocase (ants), and cyclophilin d (cypd). importantly, antiapoptotic multidomain members of the bcl-2 protein family, including bcl-2 itself, bcl - xl, and mcl-1, not only counteract the pore - forming activity of bax and bak by engaging in direct inhibitory interactions, but also (i) intercept upstream proapoptotic signals such as those mediated by bh3 only proteins like bad, bid, bim, and bbcr3 (best known as p53-upregulated modulator of apoptosis ( puma) ) , (ii) bind to, hence regulating, several components of the ptpc, including vdac1 and ant , and (iii) prevent the generation of proapoptotic cytosolic ca waves, either by interacting with inositol 1,4,5-trisphosphate (ip3)-gated ca channels on the endoplasmic reticulum (er) or by limiting the capacity of er ca stores. in addition, both pro- and antiapoptotic bcl-2-like proteins have recently been shown to modulate multiple processes that are not directly connected to the execution of cell death, including among others bioenergetic metabolism, mitochondrial functions, mitosis, and autophagy. here , we discuss the multifaceted role of bcl - xl, a prototypic antiapoptotic member of the bcl-2 family, at the hub between cell death and metabolism. in humans, bcl - xl is encoded by bcl2l1, a bcl2-related gene mapping to chromosome 20q11.21. bcl2l1 was shown from the beginning to code for two distinct protein products, owing to the alternative splicing of bcl2l1 mrna: a cytoprotective factor of 233 residues (bcl - xl) and a smaller polypeptide (170 residues) that exerts bcl - xl - antagonizing functions (bcl - xs). similar to bcl-2, bcl - xl contains four distinct bcl-2 homology (bh) domains (bh1bh4) as well as a transmembrane region, through which it localizes at least in part to several membranous compartments, including the om, the er, and the nuclear envelope the same does not apply to bcl - xs, which lacks both the bh1 and bh2 domains. of note, in most physiological settings the bcl - xl - coding mrna is expressed to higher levels than its bcl - xs - coding counterpart. conversely, bcl - xs often predominates in situations of developmental and pharmacological cell death. importantly, a caspase - generated cleavage product of bcl - xl (lacking an n - terminal fragment) has recently been shown to mediate neuronal cell death in rodent models of ischemic brain injury, suggesting that chemical inhibitors of bcl-2-like proteins might also be employed (at least in selected circumstances) as cytoprotective agents. bcl-2 and bcl - xl were soon recognized as critical antiapoptotic factors, although this function was initially attributed to their ability to mediate antioxidant effects. this notion has quickly been abandoned in favor of the so - called rheostat model, proposing that bcl-2 and bcl - xl would physically sequester their proapoptotic counterparts bax and bak in inhibitory interactions. in the following decade, along with the discovery of several other members of the bcl-2 protein family, this model has been progressively refined to include the concepts of activating and derepressing bh3-only proteins. according to current viewpoints, the former would promote momp by engaging in direct activatory liaisons with bax and bak, while the latter would do so by competitively displacing bax and bak from inhibitory interactions with bcl-2, bcl - xl, and mcl-1. of note, the core concept of the rheostat model as first theorized by stanley korsmeyer in 1993, that is, that cell death is governed by the balance between pro- and antiapoptotic bcl-2 family members, has remained remarkably unmodified since its original formulation. nevertheless, during the last two decades, antiapoptotic bcl-2 family members, including bcl - xl, have been shown to exert cytoprotective functions via a myriad of mechanisms that do not necessarily rely on their capacity to block the pore - forming activity of bax and bak although at least in some instances they do involve a bax-/bak - antagonizing effect. similar to bcl-2, bcl - xl prevents the generation of proapoptotic cytosolic ca waves by reducing capacity of er ca stores, an effect that is antagonized by bax and bak. moreover, bcl - xl has been shown to critically regulate the opening status of vdac1, and hence of the ptpc, thus influencing mpt - dependent apoptotic cell death. of note, while some authors proposed that the mpt would stem from an unselectively open conformation of the ptpc, others concluded that the mpt would originate from the closed state of the pore. irrespective of this controversy, which has not yet been fully resolved, recent data have confirmed a critical role for the interaction between vdac1 and bcl - xl in the antiapoptotic properties of the latter. interestingly, many other bcl-2 family members such as bax, bak, bid, and bcl-2 appear to interact with (and hence modulate the activity of) ptpc components (i.e., vdac1, vdac2, and ant) , suggesting that the crosstalk between these two systems might constitute a particularly important point of functional regulation. however, the actual relevance of the ptpc for the cellular demise in physiological settings remains matter of debate. indeed, mice lacking one or more of the most critical ptpc components (including all vdac and ant isoforms known thus far) , with the single exception of ppif animals (lacking cypd) , fail to exhibit remarkable cell death defects in response to ischemic, traumatic, and pharmacological challenges. hence, it seems that at least in physiological settings the complex crosstalk between bcl-2 family members and the ptpc mainly modulates cell - death unrelated cellular functions and impacts on the cellular demise only via indirect circuitries (see below). one of the most central regulators of apoptosis as triggered by perturbations of intracellular homeostasis such as dna damaging conditions, imbalances in redox homeostasis and oncogenic stress is p53. besides operating as a stress - responsive transcription factor that regulates the synthesis of both pro- and antiapoptotic proteins, including a large panel of bcl-2 family members (i.e., bax, bak, bad, bid, puma, bcl-2, and bcl - xl), p53 can also exert apoptotic functions in a transcription - independent fashion. in particular, p53 has been shown to operate similar to bh3-only proteins, that is, to promote momp either by engaging in activatory (though labile) interactions with bax or by displacing bax and bak from inhibitory liaisons with bcl-2 and bcl - xl. in this setting, the mitochondrial pools of bcl-2 and bcl - xl constitute the main target for the derepressor activity of p53. in addition, a cytoplasmic pool of bcl - xl appears to work as a puma - sensitive inhibitor of p53, de facto operating at the interface between p53 transcriptional and transcription - independent functions. thus, bcl - xl exerts cytoprotective effects not only as it antagonizes its proapoptotic counterparts but also as it counteracts the activity of p53. in addition, bcl - xl has recently been reported to interact with the mitochondrial phosphatase phosphoglycerate mutase family member 5 (pgam5), a central effector of regulated necrosis. hence, although niture et al. did not address this question in a direct fashion, bcl - xl may soon be discovered to regulate necrotic instances of cell death. the hypothesis that bcl-2 family members, notably bax, bad, bcl-2, and bcl - xl, would influence bioenergetic and intermediate metabolism began to gain consensus along with the discoveries that (i) these proteins interact with components of the ptpcs that, in physiological circumstances, regulate various facets of mitochondrial functions (e.g., ant, vdac, and glucokinase) , (ii) these proteins modulate ca homeostasis at the er , and (iii) p53 not only operates as a potent proapoptotic factor in response to stress but also exerts an homeostatic control over metabolism. in particular, bcl - xl (i) reportedly preserves the physiological conformation of vdac, hence promoting the exchange of metabolites, including adp, across the om; (ii) functionally antagonizes bad, which has been found to exert prominent metabolic functions by regulating a mitochondrial multiprotein complex that involves (among other enzymes) glucokinase, protein kinase a, and protein phosphatase 1; (iii) has been shown to lower the concentrations of ca ions within the er, hence quenching the bioenergetic burst that normally from the opening of ip3-gated ca channels; and (iv) binds to cytoplasmic p53 in steady - state conditions, thus at least theoretically modulating its functions related to bioenergetic and redox metabolism. bcl - xl has also been demonstrated to regulate distinct facets of intermediate metabolism in a direct fashion. in neurons , a pool of bcl - xl localized to the i m appears to physically interact with the subunit of the f1fo atp synthase, hence increasing its enzymatic efficiency, stabilizing the m and consequently maximizing mitochondrial atp generation. similar functions have been attributed to a truncated variant of mcl-1 that localizes to the mitochondrial matrix. in addition, the transfection - enforced overexpression of bcl-2 has been associated with increased oxygen consumption and higher rates of mitochondrial respiration. taken together, these observations suggest a conserved role for bcl-2 proteins in the regulation of atp synthesis. of note , antiapoptotic members of the bcl-2 family have been suggested to exert prooxidant functions, at least under selected circumstances. such a (slight) prooxidant state, presumably reflecting the ability of bcl-2 and bcl - xl to stimulate mitochondrial respiration , appears to be linked to the interaction of bcl-2-like proteins with small gtpases of the rac family and to exert cytoprotective effects by contributing to the maintenance of baseline energetic homeostasis. recent data have indicated that bcl - xl operates (in a bax- and bak - independent manner) to limit the intracellular levels of acetyl - coa. acetyl - coa is not only a critical intermediate of the krebs cycle, but also required for protein acetylation, including n--acetylation, that is, the posttranslational modification that consists in the addition of an acetyl moiety (provided by acetyl - coa) to the n - terminus of nascent polypeptides. hence, high expression levels of bcl - xl exert cytoprotective effects along with the establishment of a state characterized by decreased levels of virtually all the metabolites involved in the krebs cycle (but not of glycolytic substrates) as well as by reduced extents of n--acetylation. although yi and colleagues ascribed such an antiapoptotic state (which could be reversed by the exogenous supply of citrate and acetate) only to the inhibition of n--acetylation, reduced levels of reactive oxygen species (ros), which constitute a normal byproduct of mitochondrial respiration, may equally well underpin (at least part of) the cytoprotective effects that originate from bcl - xl metabolic functions. in support to this notion, (i) the overactivation of several metabolic circuitries (including glycogenolysis and glutaminolysis) and the overgeneration of ros have been linked to both apoptotic and necrotic cell death; and (ii) a predominantly glycolytic metabolism, as observed in cancer cells even in the presence of normal oxygen levels (i.e., the so - called warburg effect), reportedly exerts cytoprotective effects as it increases the amounts of reduced glutathione (a potent antioxidant). of note, the pyruvate kinase m2, a glycolytic enzyme variant that is known to sustain the warburg effect, has been shown to stimulate the expression of bcl - xl at the transcriptional level. although the cytoprotective transcription factor nf-b may play a role in this setting, the precise molecular mechanisms underlying this phenomenon remain to be identified. in addition, protein acetylation has recently been involved in the regulation of autophagy (see below) , suggesting that bcl - xl might exert a broad control over multiple cellular functions. autophagy is a catabolic pathway driving the lysosomal degradation of cellular constituents such as portions of the cytoplasm, protein aggregates, and dysfunctional / supernumerary organelles. under physiological conditions , autophagy plays a prominent role in the maintenance of intracellular homeostasis. in addition, the autophagic flux is dramatically upregulated in response to a large panel of stress conditions, including (but not limited to) glucose and amino acid deprivation, hypoxia, intracellular pathogens, and cytotoxic xenobiotics. although in some, mostly developmental, scenarios an autophagic program de facto mediates cell death , stress - elicited autophagy near to invariably exerts prominent cytoprotective functions. in line with this notion, both pharmacological and genetic maneuvers that block autophagy most often exacerbate, rather than limit, cell death as triggered by several distinct stimuli. the stress - elicited upregulation of autophagy is a tightly regulated phenomenon, involving distinct molecular sensors and signal transduction cascades that impinge at various levels on the autophagic machinery. a detailed description of the proteins and factors that are involved in the regulation and execution of autophagy largely exceeds the scope of this paper and can be found elsewhere. nevertheless, it is important to note that in most (but not all) settings autophagy critically relies on a class iii phosphoinositide-3-kinase (pi3k) enzymatic activity. in human cells, this function is mediated by phosphatidylinositol 3-kinase, catalytic subunit type 3 (pik3c3, best known as hvps34), which operates under the control of a multiprotein complex involving among other interactors the haploinsufficient oncosuppressor beclin 1. importantly, by virtue of a bona fide bh3 domain, beclin 1 can physically interact with antiapoptotic members of the bcl-2 protein family, including bcl-2 itself and bcl - xl. by interacting with beclin 1, bcl-2 and bcl - xl de facto prevent the stress - induced activation of autophagy. in line with this notion, both bh3-only proteins (e.g., bad) and chemical inhibitors of bcl-2-like proteins (e.g., abt-737) have been shown to activate autophagy as they displace beclin 1 from inhibitory liaisons with bcl-2 and bcl - xl. interestingly, some bh3-only proteins like bnip3 have been shown to be critical for the execution of specific autophagic programs, such as the selective removal of damaged mitochondria (mitophagy) , while their relevance in cell death regulation seems rather limited. the binding of beclin 1 to antiapoptotic bcl-2 family members can also be resolved by the phosphorylation of either binding partner. conversely, it seems that bcl-2 and bcl - xl do not affect the steady - state levels of the autophagic flux in a direct fashion. of note, tian et al. have recently suggested that bcl-2/bcl - xl - targeting compounds might activate a beclin 1- and pik3c3-independent autophagic program leading to cell death. however, the authors failed to provide robust data to mechanistically explain their findings. besides a direct autophagy - modulatory function stemming from its interactions with beclin 1 and other bcl-2-like proteins , bcl - xl is expected to regulate autophagy via less direct metabolic circuitries, notably as it (i) controls the efficiency of mitochondrial atp production , (ii) influences the exchange of critical bioenergetic metabolites (e.g., atp and adp) by ptpc components , (iii) reduces the intracellular levels of acetyl - coa, and (iv) interacts with the cytoplasmic pool of p53. hence, the expression levels of bcl - xl might also influence the autophagic flux in steady - state, as opposed to adaptive, conditions. this aspect of the crosstalk between bcl - xl and autophagy warrants further investigation. the implication of bcl-2 family members, including bcl - xl, in cell death - unrelated processes is not limited to the aspects of cell biology discussed above. for instance, it has recently been shown that bcl - xl is phosphorylated at multiple serine residues (including s49 and s62) in a cell cycle - dependent fashion. the mitotic kinase polo - like kinase 3 (plk3) appears to be responsible for the cell cycle - dependent phosphorylation of bcl - xl at s49 (starting at the s phase and abruptly falling at the onset of mitosis), whereas plk1 and mitogen - activated protein kinase 9 (mapk9) have been suggested to catalyze bcl - xl phosphorylation at s62 in response to dna - damaging agents, hence stabilizing a cell cycle arrest at the g2 checkpoint. hence, similar to bcl-2 , bcl - xl plays a role in both physiological cell cycle progression and dna damage - induced cell cycle checkpoints. a few years ago, rather unspecific inhibitors of bcl-2-like proteins such as abt-737 and abt-263 have generated an intense wave of enthusiasm and quickly entered clinical trials as part of antineoplastic regimens for the treatment of mostly hematological malignancies. one of the most prominent on - target side effects of abt-737 and abt-263 turned out to be a dose - limiting thrombocytopenia , linked to the fact that bcl - xl is critical for the survival of platelets. more recently, bcl - xl has also been involved in the adhesive function of platelets. hence, abt-737 and abt-263 appear to impair aggregation not only as they trigger the demise of a consistent fraction of circulating platelets but also as they exert consistent thrombocytopathic effects among residual platelets. the implication of the bcl-2 protein family in mitochondrial dynamics as well as the actual relevance of mitochondrial fission / fusion events in apoptosis have been and still are the subject of a vivid debate. while a detailed discussion of this topic largely exceeds the scope of this paper, it is worth noting that bcl- xl has recently been shown to interact with (and stimulate the gtpase activity of) dynamin - related protein 1 (drp1), a central component of the mitochondrial fission machinery. in doing so , bcl - xl appears to alter the mitochondrial function of neurons in a manner that stimulates the formation of synapses. as drp1 also participates in the execution of regulated necrosis, mitochondrial dynamics may constitute yet another point of control of cell death - related and -unrelated processes by bcl - xl. bcl-2 and bcl - xl have been reported to negatively regulate the nlrp1 inflammasome, a supramolecular platform that is required for the full - blown activation of caspase-1and hence the production of interleukin (il)-1 and il-18in response to proinflammatory stimuli. in particular, the flexible loop domain of both bcl-2 and bcl - xl (which is located between the 1st and 2nd helices of the proteins) appears to engage in physical interactions with nlrp1, thereby blocking the capacity of the latter to bind atp and oligomerize. besides playing a critical role in innate immunity, inflammasomes are crucial for the translation of immunogenic cell death (a functionally peculiar form of apoptosis) into a robust adaptive immune response. it is therefore tempting to speculate, yet remains to be formally proved, that the interaction between antiapoptotic bcl-2 family members and inflammasomes may constitute a promising therapeutic target for enhancing the immunogenicity of (cancer) cell death. following an initial wave of interest on the role of bcl-2-like proteins in the regulation of apoptosis, several laboratories have refocused their attention on distinct aspects of the biology of pro- and antiapoptotic members of the bcl-2 family. during the last decade, this intense investigational effort has led to the identification of several processes that are modulated by bcl-2 family proteins independent of (or at least not directly impacting on) their cell death - regulatory functions. as discussed in this paper, bcl - xl has been shown to exert a consistent degree of control on various aspects of bioenergetic metabolism, including mitochondrial atp production, ca fluxes, autophagy, and protein acetylation, as well as on several other cellular and organismal processes such as mitosis, platelet aggregation, and synaptic efficiency (table 1). hence, similar to other bcl-2 family members , bcl - xl appears to operate at critical hubs to coordinately control multiple cellular functions including the three - step switch between homeostatic metabolisms, adaptive responses to stress, and cell death. in this scenario, it is tempting to speculate, yet remains to be formally demonstrated, that bcl-2-like proteins may have originated as regulators of non - apoptotic functions and only later in evolution may have acquired the capacity of control cell death. similar to what happened (and is still happening) for p53 the number of cellular functions that are regulated by bcl-2 family members, including bcl - xl, will grow further.

the bcl-2 homolog bcl - xl, one of the two protein products of bcl2l1, has originally been characterized for its prominent prosurvival functions. similar to bcl-2, bcl - xl binds to its multidomain proapoptotic counterparts bax and bak, hence preventing the formation of lethal pores in the mitochondrial outer membrane, as well as to multiple bh3-only proteins, thus interrupting apical proapoptotic signals. in addition, bcl - xl has been suggested to exert cytoprotective functions by sequestering a cytosolic pool of the pro - apoptotic transcription factor p53 and by binding to the voltage - dependent anion channel 1 (vdac1), thereby inhibiting the so - called mitochondrial permeability transition (mpt). thus, bcl - xl appears to play a prominent role in the regulation of multiple distinct types of cell death, including apoptosis and regulated necrosis. more recently, great attention has been given to the cell death - unrelated functions of bcl-2-like proteins. in particular, bcl - xl has been shown to modulate a number of pathophysiological processes, including but not limited to mitochondrial atp synthesis, protein acetylation, autophagy and mitosis. in this short review article , we will discuss the functions of bcl - xl at the interface between cell death and metabolism.

deliberate self - harm (dsh) is one of the commonest cause of death in the world with a higher rate noted in the low- and middle - income countries. soman et al. from south india reported that dsh was responsible for 6.6% of all deaths. the average age was 42 years for males and 34 years for females and half of all suicides occurred in the age group of 1544 years. reported that women had frequent dsh attempts and the mean age was 24.5 years. dsh attempts are one of the commonest reasons for emergency department (ed) admissions. self - poisoning was the most common method used for dsh in a study done across eight low- and middle - income countries. suicide attempts were common among those from low socioeconomic status, and the common modes were self - poisoning with organophosphorus compounds and overdosage of tablets. the suicide rate was high among the elderly according to a study done in south india, and the common modes were hanging and organo - phosphorous poisoning. insecticide poisoning and self - immolation were associated with high mortality rate in india while in a south american country hanging and jumping from heights had a bad outcome. a wide variety of poisons like insecticides, pesticides, plant poisons, rodenticides is freely available across the country. there is a wide variation in the method of dsh used across different states of india and varies with the socioeconomic status. this study was done to describe the profile of dsh attempts and outcome of patients presenting to the adult ed of our tertiary care hospital in south india. this is a retrospective study, of patients, presenting with dsh to the adult ed of christian medical college, vellore, which is a 45-bed department in south india with an average of 200 admissions daily. all patients more than 15 years old presenting with a history of alleged dsh from january 01, 2011 to december 31, 2013, were included in the study. a retrospective chart review was performed on all the above said patients using the hospital's electronic medical database. the following were extracted: demographics, age, sex, date of admission, type of dsh used, discharge status, and duration of admission. the categorical variables were expressed in proportion and chi - square test or fisher exact test was used to compare dichotomous variables. for all tests, this study was approved by the institutional review board, and patient confidentiality was maintained using unique identifiers and by password protected data entry software with restricted users. eighty - seven percent of those were medical / surgical emergencies, and 13% were trauma related cases. the prevalence of patients presenting with dsh was 1.08% (1228/1,13,243). there was a slight female predominance (51.8%) which was consistent over the study period of 3 years. almost half of the patients (48.1%) were in the age group between 20 and 29 years of age. elderly population (60 years) constituted 3.5% of the study population. the month - wise distribution of dsh cases over a 3-year period is shown in figure 2. the time of dsh admissions were as follows, 37.1% (456/1228) were at nights (21000500 h, the following day), 29% (356/1228) were at afternoons (12001700 h), 18.9% (232/1228) at evenings (17002100 h), and 15% (184/1228) during morning hours (05001700 h). patient flow in emergency department with classification of dsh baseline characteristics mode of deliberate self - harm among men and women consumption of pesticide chemicals (agricultural chemicals) (46%) was the most common mode of dsh followed by tablet overdosing (29.8%). consumption of plant poisons (7.8%), near hanging (5.3%), corrosive chemical ingestion (4.7%), and ingestion of rodenticides (4.2%) were the other common modalities of dsh. two wild plants of our locality which were consumed for dsh were oleander (52/96) and oduvanthalai (42/96). the other plants that were used for dsh were henna and eucalyptus with one case each of the leaves being consumed. rare modes of dsh (2%) were hydrocarbon ingestion, hair dye ingestion, self - infliction with sharp objects, ingestion crushed glass pieces, burns, and ingestion of copper oxychloride. the method of dsh more preferred by women were plant poisons (66.3% vs. 33.7%, p = 0.006), corrosives (63.8% vs. 36.2%, p = 0.047) and tablet overdose (64.9% vs. 34.1%, p = 0.001) while agricultural chemicals were more likely to be consumed by men (59.5% vs. 40.5%, p = 0.001) for dsh. the preferred mode of dsh by the males and females is shown in figure 3. mode of deliberate self - harm month wise distribution of the number of patients with dsh for 3 years the outcome was studied by the condition at discharge from hospital and the number of days in hospital. majority (97.9%) of the patients were discharged alive from the hospital while 19 (1.5%) died in the hospital. the discharge status of 7 patients was mentioned as either left against medical advice or discharged at request. the length of hospital stay was 2 days among 634 (51.6%) patients, between 3 and 6 days among 374 (30.5%), between 7 and 13 days among 151 (12.3%) and 2 weeks or more in 69 (5.6%) patients, respectively. the objective of this study was to describe the demographic features, mode of dsh and outcome of patients presenting with dsh to a tertiary care hospital in south india. nearly, 1% of our admission in the ed is related to dsh. in our study, the male: female ratio was 0.93 with a slight female predominance (51.8%), while a study done in a low socioeconomic country reported a male to female suicide ratio of 1.7. a study conducted in a middle - income country showed that women had frequent dsh attempts than men. a similar study revealed the average age was 42 years for males and 34 years for females with half of all suicides occurring in the age group of 1544 years. the average age commonly resorting to dsh was 24.5 years as reported by nojomi et al. in our study , dsh was common among the young with 82.7% patients being < 40 years of age. almost half of the patients (48.1%) were in the age group between 20 and 29 years of age. patients 60 years constituted 3.5% of the dsh attempts reported, and dsh was not uncommon among the elderly. dsh attempts usually present to the ed and self - poisonings were the common mode of dsh according to a study done in eight low- and middle - income countries. in this study on an average, at least, one dsh presented to ed every day. self - poisoning was the most common method of dsh, and agricultural chemicals (46%) were commonly used to commit dsh. other studies from india also reported insecticide poisoning and tablet overdosage as the frequent modes of dsh. the other modes of dsh reported were near hanging, self - immolation, jumping from heights, self - infliction, inhalation of automobile gases, etc. the less frequently reported modes of dsh in this study were consumption of plant poisons (7.8%), near hanging (5.3%), corrosive chemical ingestion (4.7%), and ingestion of rat killer poisons (4.2%). multiple modes of dsh were observed in 3 patients, one patient presented with near hanging after consuming insecticide poison, the second patient consumed a combination of kerosene, insecticide and paint and the third patient consumed zinc phosphide along with paracetamol tablets. since the hospital in which the study was done has a separate triage and resuscitation policy for burns, exact numbers could not be presented. study on suicides in the same geographical area reported a total mortality rate of 82.2/100000 population. as the age group affected was from 15 to 40 years the total years of life lost was also high (26.9 years). however, in this study, of the total 1228 patients with attempted dsh 1202 (97.9%) patients were discharged alive from the hospital, while 19 (1.5%) died in the hospital. this reflects that though suicide attempts posed a high risk for death, hospitalization and aggressive treatment can positively affect the outcome. on further analysis, it was found that of the adult dsh attempts 51.6% were discharged from hospital by 2 days. the length of hospital stay was between 3 and 6 days for 30.5% of patients, between 7 and 13 days for 12.3% and 2 weeks or more 5.6% of the study population. psychiatric illness such as depression and personality disorders were found in majority of first attempters of dsh. alcohol abuse, ethnicity, low income, marital discord, loss of job, and change in weather conditions were also associated with dsh. all patients with dsh attempt should receive a psychiatric evaluation and follow - up should be arranged with a general practitioner or a psychiatrist. preventive health activities such as psychiatric screening and follow - up, socioeconomic upliftment, counseling regarding difficult times in life such as loss of job, marital discord, and alcohol abuse will in decreased dsh attempts. banning and restricting the use of fatal agricultural chemicals will reduce the morbidity and mortality associated with dsh in low socioeconomic countries. hazard classification of agricultural chemicals should also include their dsh potential and warnings issued accordingly. since still a large number of dsh attempts are with agricultural chemicals, political will, and legal changes regarding the sale of poisonous chemicals can indirectly lead to a decrease in mortality and morbidity associated with dsh attempts. the retrospective nature of this study did not provide information into the risk factors and co - morbid conditions associated with dsh. the retrospective nature of this study did not provide information into the risk factors and co - morbid conditions associated with dsh.

: deliberate self - harm (dsh) is a major under - recognized epidemic in the low- and middle - income countries. this is a large retrospective study form the emergency department (ed) of tertiary care center of south india to describe the clinicodemographic features of dsh cases.materials and methods: this is a retrospective study conducted at ed of christian medical college, vellore, india from january 01, 2011 to december 31, 2013. all cases of dsh were included in the study. the demographic details, mode of dsh and clinical outcome were extracted from the electronic medical record. descriptive statistics are presented. chi - square test was used to compare categorical variables. for all tests, a two - sided p 0.05 was considered statistically significant.:total of 1228 patients were admitted to ed for dsh during the study period. male and female occurred in equal ratio. more than half of the cases occurred among age group below 30 years. consumption of pesticides (agricultural chemicals) was the single most common mode of dsh (46%), especially among men, followed by medication overdose (29.8%). consumption of plant poison and tablet overdose was higher among women. overall mortality due to dsh was low (1.5%) in our study.:dsh is under - recognized major public health problem in low - middle income countries like india. most cases occur among young and productive age group and in equal frequencies among men and women. timely and the appropriate institution of treatment can decrease the morbidity and mortality due to dsh remarkably.

dense, vision - obscuring calcification on the posterior aspect of silicone intraocular lenses (iols) is often not amenable to neodymium: yttrium - aluminum - garnet capsulotomy, and, in prior reports, has required iol exchange. we report the successful removal of dense calcium deposition on the posterior surface of a three - piece silicone lens using pars plana vitrectomy (ppv). a light pipe was used to retroilluminate the iol, and a dense fibrous tissue setting with a low cut - rate and high aspiration rate was able to clear the visual axis of the dystrophic calcification without damaging the iol optic. small - gauge ppv may be utilized to remove dense dystrophic calcium deposits on the lens surface in lieu of iol exchange. dystrophic calcification of the silicone intraocular lenses (iols) is a rare complication that can diminish visual acuity and contrast sensitivity. dystrophic calcification has been reported with the use of silicone iols after vitreous hemorrhage or in patients with asteroid hyalosis, and it has been primarily treated with lens explantation, as neodymium: yttrium - aluminum - garnet (nd : yag) laser treatment often can not remove dense deposits.1,2 the first report was published in 2004 by wackernagel et al describing the composition of deposits on an explanted silicone lens 4 years after implantation.3 recently, mamalis et al reported the presence of calcium and phosphate in 16 explanted opacified silicone lenses from various manufacturers; 86.4% of those lenses were in patients with confirmed asteroid hyalosis. concurrently, the authors analyzed 111 calcified hydrophilic acrylic lenses; none were associated with a history of asteroid hyalosis.4 previous treatments of lens opacification have relied on the lens explantation alone with or without subsequent reimplantation of a new lens.14 this requires a large incision and risks refractive change. herein, we describe a novel approach to treating patients with vision - obscuring dense calcification of silicone lenses without explantation of the iol. a 78-year - old woman underwent bilateral phacoemulsification and three - piece clariflex silicone iol insertion (abbott medical optics inc, santa ana, ca, usa). she had no significant past medical history and a past ocular history of asteroid hyalosis, greater in the right eye, and wet macular degeneration in the left eye with a central scar. also, 9 years later, she described decreased vision in her right eye. visual acuity was 20/100 in the right eye and count - fingers in the left eye. examination revealed dystrophic calcification on the posterior surface of the right intraocular lens (figure 1). at that time, a nd: yag capsulotomy was unable to clear the calcification. to access the dystrophic calcification, a pars plana approach was taken using a stellaris pc 23-gauge vitrectomy system (bausch and lomb incorporated, bridgewater, nj, usa). after performing a core and anterior vitrectomy, a dense fibrous tissue setting was used with a high aspiration rate of 600 and a variable cut rate less than 1,500 cuts / minute to slowly remove the calcified material from the posterior aspect of the iol, along with the posterior capsule. after clearing the central optic, her visual acuity was 20/25 without correction on postoperative day one, and the central optic was clear of dystrophic material (figure 2). at 1 year , no material had reaccumulated on the central optic, and her vision remained stable at 20/25 (figure 3). calcification of the posterior surface of silicone iols in patients with asteroid hyalosis is a rare but well - described late complication after cataract surgery.2 prior reports in the treatment of this dystrophic calcification have required iol explantation or exchange. a case series studying 22 iol exchanges identified complications in 36.4% of procedures, including corneal decompensation, loss of capsular support, vitreous prolapse, and an uncertain refractive outcome.57 in comparison, the united kingdom national ophthalmology database study of vitreoretinal surgery found only 7.8% of pars plana vitrectomies (ppv) had an intraoperative complication, the most common of which were iatrogenic retinal breaks (3.2%).8 the use of a high - speed, small - gauge vitrectomy system to clear calcification with lasting via a posterior approach allows use of the existing iol with a more rapid surgical and visual recovery compared to iol exchange. patients maintain the same intraocular optics achieved immediately after cataract surgery and the chance of refractive alteration associated with iol exchange is minimized. in theory, removing the asteroid bodies during vitrectomy decreases the risk of future calcium deposition on the silicone iol optic. in the interest of saving a patient from the risks and refractive uncertainty of an iol exchange, small - gauge ppv may be utilized to remove dense dystrophic calcium deposits from the lens surface.

purposedense, vision - obscuring calcification on the posterior aspect of silicone intraocular lenses (iols) is often not amenable to neodymium: yttrium - aluminum - garnet capsulotomy, and, in prior reports, has required iol exchange. we report the successful removal of dense calcium deposition on the posterior surface of a three - piece silicone lens using pars plana vitrectomy (ppv).materials and methodsa 23-gauge ppv was performed using the stellaris vitrectomy system. a light pipe was used to retroilluminate the iol, and a dense fibrous tissue setting with a low cut - rate and high aspiration rate was able to clear the visual axis of the dystrophic calcification without damaging the iol optic.visual acuity improved from 20/100 to 20/25.mall - gauge ppv may be utilized to remove dense dystrophic calcium deposits on the lens surface in lieu of iol exchange.