Datasets:

Joemgu

/

sumstew

like 9

Summarize: By. Katie Davies. PUBLISHED:. 12:12 EST, 6 March 2013. |. UPDATED:. 12:43 EST, 6 March 2013. A 17-year-old 'clingy and controlling' boyfriend has been charged with murdering his young girlfriend and first love after she planned to move away without him. Minnesota prosecutors yesterday filed second-degree murder charges against Anthony J. Mitchell after his 16-year-old girlfriend, Anna Hurd, was found stabbed to death on a trail near her St Paul home on February 23. It is alleged jealous Mitchell was angry that Anna was due to move from her father's home in Maplewood to live with her mother in Texas. Murdered by her first love? Anthony J Mitchell, 17 has been charged with the murder of his 16-year-old girlfriend Anna Hurd. On camera: Andrew J Mitchell, pictured, was interviewed the day after his girlfriend's murder saying he 'hoped police would catch the guy'. He now faces charges. The charges come after Mitchell was interviewed speaking of his grief at the death of the teenager. Anna Hurd's family have spoken of their sense of betrayal at the allegations against the boy they took into their homes and who comforted them at the 16-year-old's memorial service. Anna's mother, Jennifer Hutchings of Vernon, Texas, told the Star Tribune: 'I thought it was him, but I didn’t want to believe it because Anna loved him, trusted him. We trusted him.' Her father Patrick Hurd told TwinCities.com: 'I'm relieved that they've got a suspect. I'm sad that it's him.' 'It was first-time love, I guess,' he said of their relationship. 'They were young; it. was the first time they ever fell in love. They were inseparable.... I. feel really bad for his mother. I know she loved my daughter like she. loved her own.' The night before her death she had called Hutchings and spoke about plans for her to share a room with her 15-year-old sister Nikki in Texas. 'Nikki was so excited and had everything ready. Anna wanted chicken-fried steak that night,' Hutchings said. 'She said, ‘Mom, I love you.’ she was excited to be coming home.' 'I. knew something happened to her,' she said on realizing her daughter. hadn't texted as planned, later that night. 'I could just feel it in my. heart.' First love: Prosecutors allege Andrew J Mitchell brutally murdered Anna Hurd, pictured together, as he didn't want her to leave him to live in Texas. Comforted: Andrew J Mitchell was comforted by family and friends following the murder of girlfriend Anna Hurd, pictured. He is now accused of stabbing her to death himself. Mitchell sat next to Anna's mother at her memorial service and was comforted by her family as he cried over her murder. He was also interviewed by Fox News leaving a tribute at the spot her body was found. 'I hope they find him,' he told the broadcaster. However, police now allege he was the murderer after all. He was the person who discovered. Anna's body and police claim his story changed several times in the. course of describing the day's events. He returned to his family home on February 22 saying Anna had left for a friend's house. He later went out again in the early hours of February 23 and this time returned to say he had found her dead. His mother called 911 and the recording picked up a voice in the background saying: 'I didn't do it. He had blood on his hands which he claimed was because he had tried to give her CPR. Later Mitchell led police to her body 15 feet from a path in Hillside Park. She had been stabbed multiple times. Anna's. friends say he was a jealous, controlling boyfriend who had tried to. commit suicide when she had previously tried to break up with him. New life: Anna Hurd, pictured, was planning to move in with her mother in Texas. Friends say she was planning to break up with teen boyfriend Andrew Mitchell, who is accused of her murder. One source told police he had injured one of her pet kittens in a previous argument and had allegedly shown off a new knife at a party the night before she was found. Another said Anna was planning to break up with him that night. She was moving to Texas to live with her mother and stepfather after spending a year with her father and grandmother. She was initially going to move there with Mitchell but the plan was cancelled. Hurd's mother then bought a bus ticket just for her daughter. She was due to leave the morning she was found dead. 'This tragic case brings so much pain to the victim’s family as well as the community at large,' said Ramsey County Attorney John Choi. 'Our hearts go out to those who survive her.' 'We see these situations a lot in the domestic abuse contexts where you where someone is wanting to break off the relationship in a substantial way,' he added. Mitchell is accused of second-degree murder and is due to appear at juvenile court tomorrow. He is being held at the Ramsey County Juvenile Detention Center and prosecutors are seeking to have him certified to stand trial as an adult

Summary: Anthony J Mitchell, 17, will appear in court tomorrow charged with the murder of Anna Hurd, 16, in St Paul, Minnesota on February 23. The pair, who had dated for just under a year, were described as 'inseparable' but he was becoming 'controlling and clingy' Following her death he joined her family in mourning and was interviewed weeping over her loss. Police claim he stabbed her to death because he was angry she was moving to live with her mother in Texas and he had been excluded from the trip.

cnn_dailymail

en

Summarize: CROSS-REFERENCE TO RELATED APPLICATION This application claims the benefit of U.S. Provisional Patent Application Ser. No. 61/129,849, filed Jul. 24, 2008. BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to devices for the delivery of pharmaceuticals, and particularly to a bioinjection device for delivering bone morphogenic protein, antibiotics, etc., directly to the site of a bone fracture, degenerative bone tissue or cartilage, etc., during the course of surgery in the form of a bioabsorbable matrix enclosed within a membrane cartridge. 2. Description of the Related Art Bone is a living tissue and plays a structural role in the body. Disease and damage, however, is often difficult to treat in bones, due to their positioning within the soft tissues of the body. Bone consists of repeating Harvesian systems (concentric layers of lamellae deposited around a central canal containing blood vessels and nerves). The central canal is also known as the medullary cavity and is filled with bone marrow. Within the shaft of a long bone, many of these Harvesian systems are bundled together in parallel, forming a type of bone called compact bone, which is optimized to handle compressive and bending forces. In some bones, such as the metacarpals, for example, the bones themselves are hollow and contain little, if any, marrow. Near the ends of the bones, where the stresses become more complex, the Harvesian systems splay out and branch to form a meshwork of cancellous or spongy bone. Compact bone and cancellous bone differ in density, or how tightly the tissue is packed together. Genetic or developmental irregularities, trauma, chronic stress, tumors, and disease can result in pathologies of bones. Some bone diseases that weaken the bones include, but are not limited to, osteoporosis, achondroplasia, bone cancer, fibrodysplasia ossificans progressiva, fibrous dysplasia, legg calve perthes disease, myeloma, osteogenesis imperfecta, osteomyelitis, osteopenia, osteoporosis, Paget's disease, and scoliosis. Weakened bones are more susceptible to fracture, and treatment to prevent bone fractures becomes important. Severe fractures, such as those that are open, multiple, or to the hip or back, are typically treated in a hospital. Surgery may be necessary when a fracture is open, severe, or has resulted in severe injury to the surrounding tissues. Severe fractures may require internal devices, such as screws, rods, or plates, to hold the bone in place or replace lost bone during the healing process. In order to repair severe fractures, bone cement and the like is often applied within the fracture. However, other healing agents, such as antibiotics or bone morphogenic proteins, often need to be applied prior to cementing or performance of other operations on the bone. Due to the awkward positioning of bone fractures within other tissue, it is often quite difficult to properly apply medicaments and the like within the bone, particularly without damaging the tissue surrounding the bone. Thus, a bioinjection solving the aforementioned problems is desired. SUMMARY OF THE INVENTION The bioinjection device is directed towards a device for injecting or implanting a membrane-encased cartridge of pharmaceuticals and/or biologics, bone grafts, radioactive seeds and the like, in a bioabsorbable matrix or carrier directly into the site of a bone fracture, degenerative bone tissue or cartilage, or the like in the course of surgery. The cartridge may contain bone morphogenic protein, antibiotics, bone, bone substitute or the like. The device includes a housing having an upper portion and a lower gripping portion. The lower gripping portion may be rotatable with respect to the upper portion and includes a handle member and a trigger member. The trigger member is pivotally secured to the handle member. Further, the upper portion of the housing has an open interior region formed therein. A shaft is slidably mounted within the open interior region of the upper portion of the housing. The shaft has opposed forward and rear ends and is elongated along a longitudinal axis. Further, the shaft has a channel formed therethrough, also extending along the longitudinal axis from the forward end to the rear end. At least one lever arm is pivotally mounted within the housing, with the at least one lever arm having opposed first and second ends. The first end of the lever arm is attached to the rear end of the shaft, and the second end is attached to the trigger member so that rotation of the trigger member with respect to the handle member drives sliding translation of the shaft with respect to the upper portion of the housing. A needle is slidable within the channel formed through the shaft, the needle having opposed front and rear ends. The front end of the needle terminates in a relatively sharp point. The rear end thereof is attached to the at least one lever arm so that rotation of the trigger member with respect to the handle member drives forward sliding translation of the needle with respect to the upper portion of the housing and the shaft. Preferably, the at least one lever arm includes a pair of lever arms, including a first lever arm driving movement of the shaft and a second lever arm driving movement of the needle. A retaining member has opposed front and rear ends. The front end is open and the rear end is attached to a forward portion of the upper portion of the housing. An opening is formed through the rear end of the retaining member and the forward portion of the upper portion so that the forward end of the shaft and the front end of the needle selectively and slidably project therethrough into an open interior region of the retaining member. The retaining member is preferably releasably attached to the forward portion of the upper portion of the housing. A cartridge is releasably received within the open interior region of the retaining member. The cartridge includes an outer shell membrane and a medicament contained within the outer shell. The forward end of the shaft contacts the membrane so that actuation of the trigger member causes the shaft and the needle to slide forward, with the shaft pushing the cartridge out of the retaining member for deployment thereof into the bone fracture. As the shaft pushes the implant out of the retaining member, the needle pierces the outer shell membrane to release the medicament into the fracture or degenerative tissue. These and other features of the present invention will become readily apparent upon further review of the following specification and drawings. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is an environmental, perspective view of a bioinjection device according to the present invention. FIG. 2 is a side view of the bioinjection device according to the present invention, broken away and partially in section to show details thereof. FIG. 3 is a perspective view of a membranous cartridge for use with a bioinjection device according to the present invention. FIG. 4 is a partial side view in section of the bioinjection device, showing a cartridge extended from the device for injection or implantation. FIG. 5 is a side view of a plurality of removable and fillable heads of a bioinjection device according to the present invention. FIG. 6A is a perspective view of an alternative embodiment of the bioinjection device according to the present invention. FIG. 6B is a perspective view of another alternative embodiment of the bioinjection device according to the present invention. FIG. 7 is an exploded view of a plurality of alternative bone implants for use with the bioinjection device according to the present invention. FIG. 8 is a front view of a human leg broken away to show the bone implants of FIG. 7 inserted within a channel formed within a bone. FIG. 9 is a side view of an alternative embodiment of the head of the bioinjection device according to the present invention. FIG. 10 is a side view of another alternative embodiment of the bioinjection device according to the present invention. Similar reference characters denote corresponding features consistently throughout the attached drawings. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention relates to a bioinjection device 10. As shown in FIG. 1, device 10 is used to place a cartridge 12 into a fracture, degenerative tissue, or the like of a spinal segment S. The cartridge 12 contains a medicament (bone morphologic protein, antibiotics, or the like disposed in a bioabsorbable matrix or carrier) for the healing of the spinal segment S. It should be understood that spinal segment S, having vertebral bodies V, disc D and facet joint F, of FIG. 1 is shown for exemplary purposes only and is not intended to limit the type of bone or fracture that the cartridge 12 and device 10 may be used to treat. As best shown in FIGS. 1 and 2, the device 10 includes a housing 32 having a barrel-shaped upper portion 33 and a lower gripping portion 35. The lower gripping portion 35 may be rotatable with respect to the upper portion 33 and includes a pistol grip handle member 34 and a trigger member 36. The trigger member 36 is pivotally secured to the handle member 34 by a pivot pin 39 or the like. Trigger member 36 preferably has a plurality of finger receiving grooves or recesses 38 formed therein, as shown in FIG. 2, allowing for optimal gripping and actuation by the surgeon. Further, an upper gripping handle 11 may be mounted on an upper surface of housing 32, allowing the surgeon to better grip and secure tool 10 during the surgical operation. As noted above, the lower portion 35, including both handle member 34 and trigger member 36, may be rotatable about pivot 37, allowing the lower gripping portion 35 to be rotated if necessary, depending upon the nature of the particular operation. The lower portion 35 may further be selectively locked in place with respect to the upper portion 33. Further, as shown in FIG. 2, the barrel-shaped upper portion 33 of housing 32 has an open interior region formed therein. As shown in FIG. 2, a shaft 16 is slidably mounted within the open interior region of the upper portion 33 of the housing 32. The shaft has opposed forward and rear ends 21, 22, respectively, and is elongated along a longitudinal axis, as shown. Further, the shaft 16 has a longitudinally extending channel 25 formed therethrough, extending from the forward end 21 to the rear end 22. Shaft 16 is preferably resiliently or spring-biased with respect to housing 32. In the preferred embodiment, a stop 13, such as a disc, is mounted to a central portion of shaft 16, as shown in FIG. 2, with a spring 20 or other resilient element being biased between the stop 13 and the inner wall of forward portion 50 of housing 32. At least one lever arm is pivotally mounted within housing 32 for the actuation of shaft 16. Preferably, the at least one lever arm includes a pair of lever arms with a first lever arm 28 driving movement of the shaft 16, and a second lever arm 26 driving movement of needle 18, as will be described in greater detail below. First lever arm 28 has opposed first and second ends, with the first end of first lever arm 28 being secured to the rear end 22 of shaft 16, and the second end being secured to the trigger member 36 so that rotation of the trigger member 36 with respect to the handle member 34 drives sliding translation of the shaft 16 with respect to the upper portion 33 of the housing 32. Needle 18 is slidably received within the channel 25 formed through the shaft 16, with the needle 18 having opposed front and rear ends 27, 29, respectively (the front end or tip 27 of needle 18 is best shown in FIG. 4 ). The front end 27 of needle 18 is preferably formed as a relatively sharp point. The rear end 29 of needle 18 is secured at 24 to the second lever arm 26 so that rotation of trigger member 36 with respect to the handle member 34 drives forward sliding translation of the needle 18 with respect to the upper portion 33 of the housing 32 and also with respect to the shaft 16 ; i.e., actuation of trigger member 36 causes forward sliding of shaft 16 within the housing 32 and also forward sliding of needle 18 within the shaft 16. A retaining member 14 is further provided, with the retaining member having opposed front and rear ends. As shown, retaining member 14 preferably forms a pair of gripping jaws for releasably holding implant 12. The front end thereof is open and the rear end thereof is secured to mounting member 52, which is fixed to a forward portion 50 of the upper portion 33 of the housing 32. The rear portion of retaining member 14 is preferably releasably attached to the mounting member 52 through use of any suitable releasable fastener. The rear portion may have threads 58 formed thereon, as best shown in FIG. 4, for reception by a threaded recess 53 formed in mounting member 52. Further, an opening 19 is formed through the rear end of the retaining member 14, and a passage 17 is formed through the forward portion 50 of housing 32 so that the forward end 21 of shaft 16 and the front end 27 of the needle 18 selectively and slidably project therethrough into an open interior region of the retaining member 14. Cartridge 12 is releasably received within the open interior region of the retaining member 14. As best shown in FIG. 3, the cartridge 12 includes an outer shell membrane 40 and a medicament 42 contained within the outer shell 40. The medicament 42 may be a bone morphogenic protein, an antibiotic, or any other desired medicament for the healing of the bone, and may be disposed in a bioabsorbable matrix or carrier. The outer shell may be formed from hydroxyapatite calcium phosphate, or any other biodegradable material that will dissolve and/or fuse within the bone. Preferably, the rear end 46 of shell 40 is formed as a relatively thin membrane that can be pierced by tip 27 of needle 18. A further thin membrane 44 may be formed between the outer shell 40 and the medicament 42. In use, the cartridge 12 is positioned within retaining member 14, as shown in FIG. 2, with the forward end 21 of shaft 16 contacting the rear surface 46 of the bone implant 12. Actuation of trigger member 36 causes the shaft 16 and the needle 18 to slide forward. Retaining member 14 is preferably formed from a flexible material, such as rubber, plastic or the like, so that forward movement of shaft 16 pushes the cartridge 12 out of the open front end of the retaining member 14 for deployment thereof into the bone fracture or other damaged or diseased area. As the shaft 16 pushes the cartridge 12 out of the retaining member 14, the tip 27 of needle 18 pierces the thin membrane 46 to release the medicament 42 into the fracture. The surgeon lodges the pierced cartridge 12 within fracture F or the degenerative bone tissue. In FIG. 9, retaining member or head 14 of FIG. 4 has been replaced by an alternative head 214, having a rear portion 216 with threads 258, similar to threaded connection 58 of FIG. 4. A pair of spring-biased jaws 218 are mounted to the rear portion 216, with one or both of the jaws 218 being adapted for releasably gripping a bone dowel 220 or the like for insertion into a facet joint FJ. In the embodiments of FIGS. 2 and 9, the heads 14, 214 and the shaft have relatively small sizes, allowing for placement within the facet joint, as noted above. However, it should be understood that the head and/or shaft may have any suitable size, dependent upon the site for placement of the cartridge. As will be described in detail below, a longer shaft and head may be necessary for injection of cartridges within a larger or longer bone, such as a tibia, and the shaft and head may be appropriately sized dependent upon the intended injection site. FIG. 6A illustrates an alternative embodiment of the bioinjection device. Bioinjection device 100 includes a housing 132 having upper and lower portions 133, 135, similar to that of the embodiment of FIGS. 1-4. Similarly, the lower portion 135 includes a handle member 134 and a trigger member 136, and the upper portion 133 has a handle 111 mounted thereon. Side handles 115 may also be mounted to upper portion 133, as shown, offering the surgeon a variety of gripping surfaces for differing angles of insertion during an operation. In the embodiment of FIG. 6A, an elongated tube 114 is mounted to the front end of barrel-shaped upper portion 133, allowing for the implanting of bone implants where immediate proximity of the surgeon's hands is not possible, such as in the implantation of implants 112 within channel C formed in tibia T of FIG. 8. The elongated tube 114 includes an adjustable portion 126, allowing for angular adjustment of the tube 114 adjacent the front end of the upper portion 133 of housing 132. Adjustable portion may be a rotating and selectively locking disc member, as shown, or may be any other suitable angular adjustment device. A central region 128, preferably being solid and relatively non-flexible, is joined to the flexible portions 126 at one end thereof, and a head 120 is disposed at the other end of tube 114. Head 120 has an open outer end with external threads 124 formed therearound. The retaining jaws 14 of the embodiment of FIGS. 1-5 are replaced in FIG. 6A by a cylindrical retaining member 130 having opposed open ends. Retaining member 130 is formed from a resilient, flexible material, similar to that described above with regard to jaws 14. Internal threads 140 are formed in one end of the retaining member 130 for releasable attachment to the head 120 via engagement with threads 124. It should be understood that retaining member 130 may be releasably secured to head 120 through any suitable releasable fastener. An implant 112 is received within retaining member 130 for selective dispensing thereof. Similar to that described above with regard to the embodiment of FIGS. 1-5, an inner shaft 116, similar to shaft 16, extends through tube 114 and is shown in FIG. 6A slightly projecting from head 120. Shaft 116 preferably has a plunger-type shape, as shown, with a relatively wide outer face for pushing the wider implant 112. A needle 118, similar to needle 18, is housed within shaft 116. The alternative embodiment of FIG. 6B is substantially similar to that shown in FIG. 6A, but shaft 116 terminates in a covering head 117, which covers and surrounds the needle 118 and prevents the needle 118 from becoming caught in the implant 112. In operation, the user actuates trigger 136 to slide the shaft 116 and needle 118 forward so that the shaft 116 pushes the implant 112 out of retaining member 130 and needle 118 pierces the implant 112, as described above. When retaining member 130 is fixed to head 120, the head of plunger 116 will project out from retaining member 130 (when the trigger is compressed) by approximately one or two mm. Implant 112 is preferably formed from materials similar to those described above with reference to implant 12. However, as best shown in FIG. 7, implant 112 preferably includes an upper projecting member 113 and a lower recess 119. As shown in FIG. 7, multiple implants 112 may be stacked through insertion of an upper projecting member 113 into a lower recess 119 of an adjacent implant. As shown in FIG. 5, the removable retaining members 130 may be stored and filled within a tray 54. In order to allow for quick insertion and replacement of cartridges 112, cartridges 112 may be positioned within retaining members 130, as shown. Tray 54 preferably includes a plurality of channels 56 for filling of cartridges 112 within the stored retaining members 130. A syringe 62 or other supply of medicament may be applied to ports 60, which cover and seal channels 56, allowing the medicament to be transferred to the cartridges 112. Communication with, and filling of, cartridges 112 may be accomplished through any suitable fluid transfer mechanism. FIG. 8 illustrates this stacked implantation within a channel C formed within an exemplary tibia T. Such channels C are often formed from the talus to the knee during the implantation of rods and the like in tibial reconstruction. The device 100 of FIG. 6 allows for easy insertion of multiple implants 112 within channel C after removal of such a rod. In the alternative embodiment of FIG. 10, device 200 allows for manual insertion and operation of the implant 112. A gripping handle portion 204 is secured to a lower surface of mount 202. Hollow insertion tube 206 is mounted on a front portion of the upper surface of mount 202, as shown. The rear portion of the upper surface of mount 202 may have a groove, ridge or other means for slidably holding implant 112. A plunger 208 is provided, with plunger 208 having a gripping, rear portion and a front portion terminating in a plunger head 210, with needle 212 being positioned centrally therein. In operation, the user loads an implant 112 onto the rear, upper surface of mount 202, as shown, and pushes implant 112 through tube 206, for insertion, with plunger head 210 pushing implant through tube 206 and needle 212 piercing the rear end of implant 112, as described above. It is to be understood that the present invention is not limited to the embodiments described above, but encompasses any and all embodiments within the scope of the following claims.

Summary: The bioinjection device has a housing including a pistol grip and an elongated barrel. A trigger is pivotally mounted to the housing. A plunger and needle are slidable between a first position in which the plunger and needle are slidably disposed in the barrel and a second position in which the plunger and needle extend from an opening in the end of the barrel. A retaining member is disposed about the opening at the end of the barrel. A spring-biased actuation mechanism connects the trigger with the plunger and needle. A membranous cartridge containing bone morphogenic protein, antibiotics, and/or other medication is loaded into the retaining member. A surgeon can inject the cartridge into a bone fracture or degenerative bone tissue during surgery to deliver the medicament directly to the affected site.

big_patent

en

Summarize: By. Daily Mail Reporter. PUBLISHED:. 17:36 EST, 18 March 2014. |. UPDATED:. 21:46 EST, 18 March 2014. An Illinois woman who became pregnant just six months after she underwent a tubal ligation in 2008 and gave birth to a baby girl with sickle cell disease is now suing her doctor for 'wrongful pregnancy.' While a small percentage of women become pregnant after getting their tubes tied, Cynthia Williams' situation was all the more shocking because she had just a single ovary and she believes the doctor may have cauterized the wrong falopian tube. Williams was further dismayed after she experienced congestive heart failure following the pregnancy she didn't believe could happen and now the 44-year-old mother wants money for the 'extraordinary' medical expenses she says she'll incur as she raises Kennadi, who is now 4. 'I love Kennadi with all my heart...But it¿s been a life change for everybody': Cynthia Williams (right) is suing the doctor she says fouled up her tubal ligation, leading to her pregnancy with Kennadi (left), who is now 4 and living with sickle cell disease. Williams is suing Dr. Byron A. Rosner, MD of Reproductive Health Associates for 'wrongful pregnancy' and wants damages and money for her daughter's many medical expenses. 'I was livid,' Williams recelled to ABCnews.com about the moment her pregnancy test came back positive. 'I just lost it.' Williams had several reasons to be dismayed. She and her husband had decided to stop having babies after three because they both carry the genetic trait for sickle cell and had already had one child with the full blown disease. 'I just wanted to get my tubes tied,' Williams said. And she did just that with Dr. Byron Rosner of. Reproductive Health Associates in Hazel Crest. Except she only technically needed one tube tied. Williams had her right ovary removed at the age of 12 due to a cyst. Despite that, in 2010 Williams gave birth to her daughter Kennadi. Kennadi. had sickle cell disease, but Williams was unable to take care of her. because he suffered congestive heart failure. after the little girl's birth by c-section. Tubal ligation is a permanent procedure used to prevent pregnancy. The fallopian tubes are cauterized, cut and/or tie to prevent the sperm and the egg from meeting. While rare, pregnancy can occur after the procedure. Failure occurs in between 2-10 out of every 1,000 tubal ligations. 'This is. right after I have a baby that I still can’t believe I had,' she told. ABC. 'I couldn’t be with my baby because I was too sick.' Williams spent two weeks in intensive care and missed work for a total of nine months. She. filed suit against Dr. Byron Rosner in 2010. Last month an. appellate court ruled that the state could go forward despite a move to. dismiss by Rosner's attorney's. 'Having. a baby after a sterilization procedure is something that happens,' said. Williams’ attorney, Beverly Spearman. But then Spearman learned that Williams' only had one ovary and started to see the case differently. 'When I found out more about the. whole story, I said, "OK, let’s move forward. Let’s see where this. goes."' According to medical records obtained by ABC, Rosner 'tied,' 'excised' and 'cauterized' Williams' right falopian tube. However, her right ovary had been removed. 'She is the absolute love of my life, but it¿s hard': Cynthia and her husband both have the sickle cell genetic train, not the disease. which means each of their children was born with a 25 percent chance of having sickle cell disease. After one of their other children ( now ages 25, 21 and 17) was born with the painful illness, they decided to stop having children...then little Kennadi came along. The records reportedly indicate that her left tube was intact and 'normal in appearance.' Rosner's. attorney Todd Stalmck told ABC that his client 'complied with the. standard of care' in performing Williams' tubal ligation. But his former patient disagrees and now wants damages for 'personal injury to her, emotional distress, and for lost wages' and medical costs from Rosner. 'It’s. not fair,' Williams said. 'She is the absolute love of my life, but. it’s hard. Sometimes people think I’m her grandmother.' A normal red blood cell (right) and a sickle cell (left) SICKLE CELL DISEASE. Sickle cell disease demands immediate treatment for babies. About 80,000 Americans have sickle cell disease, in which oxygen-carrying hemoglobin clumps inside red blood cells, turning them into a sickle shape that can't squeeze through tiny blood vessels. That causes pain, infections and eventually life-threatening organ damage. SICKLE CELL TRAIT. Sickle cell trait is different. More than 2.5 million Americans have it, meaning they carry one copy of the abnormal hemoglobin gene, not the two needed to cause full disease. Babies from couples who both have the trait, like Cynthia and Kenneth, have a 25 percent chance of having sickle cell disease. Trait carriers only occasionally experience health problems, like blood in the urine, some blood clumping at high altitudes and in athletes — in which intense exercise can cause blood cells to sickle enough to block blood flow to muscles, which rapidly break down. Sickle cell is most common in black Americans — about 10% have the trait — and also in people of Mediterranean, Middle Eastern and Central and South American ancestry. READ THE ILLINOIS COURT'S DECISION TO LET WILLIAMS' CASE PROCEED

Summary: Cynthia Williams, 44, opted for sterilization surgery in 2008 in part because she and her husband both carry the sickle cell trait. They already had one son with sickle cell disease. Williams' pregnancy is even more unbelievable because she only has one ovary after losing the other as a child. Records indicate the doctor may have tied the wrong fallopian tube. Williams suffered congestive heart failure following the birth of of daughter Kennadi, who is now 4.

cnn_dailymail

en

Summarize: A North Carolina police officer who authorities say fatally shot an unarmed man as he sought assistance after he crashed his vehicle early Saturday morning has been charged with voluntary manslaughter in the man's death. Authorities in Charlotte say former Florida Agricultural and Mechanical University football player Jonathan Ferrell appears to have crashed his car down an embankment about 2:30 a.m. and then knocked on the door of a nearby residence shortly after looking for help. The homeowner opened the door thinking it was her husband. When she realized it was 24-year-old Ferrell - a stranger - she closed the door and called 911, according to reports. 'Killer': Authorities say Officer Randall Kerrick shot an unarmed man who may have needed help after an auto accident. When officers arrived, they found Ferrell a short distance from the home, and he matched a description given by the homeowner, police said. The statement said officers approached Ferrell to investigate the original call. Ferrell ran toward the officers and one officer fired a taser, however it failed to discharge, police said. Ferrell continued to run toward police when Officer Randall Kerrick, 27, fired his weapon, hitting Ferrell several times, according to WSOC. Ferrell was pronounced dead at the scene. Authorities said Kerrick fired his weapon with 'excessive' and 'unlawful' force. Victim: 24-year-old Jonathan Ferrell may have been seeking help when he was shot by police. A wrecked vehicle was later discovered in woods nearby. 'We believe that vehicle belonged to the individual who was shot. It's quite possible he was seeking assistance. Based on his accident, it was a pretty serious accident,' Monroe said. Charlotte-Mecklenburg Police Chief Rodney Monroe said the accident was so serious Ferrell would have been forced to climb out of the back window of the vehicle, WSOC reported. He apparently walked to the nearest house and banged on the door. Monroe told a news conference that he didn't think Ferrell was trying to rob the woman. 'I don't believe threats were made,' the chief said. The former Florida A&M University football player had recently moved to the area. Monroe also said he had spoken with Kerrick. Help: Authorities believe Ferrell knocked on this door looking for help. The homeowner called 911. 'He is pretty shook up,' the chief said. 'He's devastated.' Kerrick has been with Charlotte-Mecklenburg police since April 2011. Monroe said at a news conference that Kerrick was in custody. Police say he was charged with voluntary manslaughter after an investigation found that the shooting was excessive. He handed himself in on Saturday. 'The evidence revealed that Mr Ferrell did advance on Officer Kerrick and the investigation showed that the subsequent shooting of Mr Ferrell was excessive,' police said in a statement issued late Saturday. 'Our investigation has shown that Officer Kerrick did not have a lawful right to discharge his weapon during this encounter.' Two other officers at the scene have been placed on paid administrative leave pending the outcome of a probe into the shooting, according to the station. Monroe said his heart went out to the victim's loved ones. 'My hearts goes out to the Ferrell family, quite naturally, as well as the main members of the CMPD family,' he said. 'This is never something easy to deal with, never something easy for us to quite grasp, but we are going to rise form this as we have from other things.' FAMU interim athletic director Michael Smith confirmed that Ferrell played the safety position for the Rattlers in 2009-10

Summary: Jonathan Ferrell appears to have crashed. his car down an embankment about 2:30 a.m. and then knocked on the door. of a nearby residence looking for help shortly after. The homeowner opened the door thinking it. was her husband. When she realized it was 24-year-old Ferrell - a. stranger - she closed the door and called 911. When police arrived, authorities claim Ferrell charged officers before one of them shot him several times.

cnn_dailymail

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Coastal State Climate Change Planning Act of 2008''. SEC. 2. PLANNING FOR CLIMATE CHANGE IN THE COASTAL ZONE. (a) In General.--The Coastal Zone Management Act of 1972 (16 U.S.C. 1451 et seq.) is amended by adding at the end the following: ``climate change adaptation planning ``Sec. 320. (a) In General.--The Secretary shall establish consistent with the national policies set forth in section 303 a coastal climate change adaptation planning and response program to-- ``(1) provide assistance to coastal states to voluntarily develop coastal climate change adaptation plans pursuant to approved management programs approved under section 306, to minimize contributions to climate change and to prepare for and reduce the negative consequences that may result from climate change in the coastal zone; and ``(2) provide financial and technical assistance and training to enable coastal states to implement plans developed pursuant to this section through coastal states' enforceable policies. ``(b) Guidelines.--Within 180 days after the date of enactment of this section, the Secretary, in consultation with the coastal states, shall issue guidelines for the implementation of the grant program established under subsection (c). ``(c) Climate Change Adaptation Planning Grants.-- ``(1) In general.--The Secretary, subject to the availability of appropriations, may make a grant to any coastal state for the purpose of developing climate change adaptation plans pursuant to guidelines issued by the Secretary under subsection (b). ``(2) Plan content.--A plan developed with a grant under this section shall include the following: ``(A) Identification of public facilities and public services, coastal resources of national significance, coastal waters, energy facilities, or other water uses located in the coastal zone that are likely to be impacted by climate change. ``(B) Adaptive management strategies for land use to respond or adapt to changing environmental conditions, including strategies to protect biodiversity and establish habitat buffer zones, migration corridors, and climate refugia. ``(C) Requirements to initiate and maintain long- term monitoring of environmental change to assess coastal zone adaptation and to adjust when necessary adaptive management strategies and new planning guidelines to attain the policies under section 303. ``(3) State hazard mitigation plans.--Plans developed with a grant under this section shall be consistent with State hazard mitigation plans developed under State or Federal law. ``(4) Allocation.--Grants under this section shall be available only to coastal states with management programs approved by the Secretary under section 306 and shall be allocated among such coastal states in a manner consistent with regulations promulgated pursuant to section 306(c). ``(5) Priority.--In the awarding of grants under this subsection the Secretary may give priority to any coastal state that has received grant funding to develop program changes pursuant to paragraphs (1), (2), (3), (5), (6), (7), and (8) of section 309(a). ``(6) Technical assistance.--The Secretary may provide technical assistance to a coastal state consistent with section 310 to ensure the timely development of plans supported by grants awarded under this subsection. ``(7) Federal approval.--In order to be eligible for a grant under subsection (d), a coastal state must have its plan developed under this section approved by the Secretary. ``(d) Coastal Adaptation Project Grants.-- ``(1) In general.--The Secretary, subject to the availability of appropriations, may make grants to any coastal state that has a climate change adaptation plan approved under subsection (c)(7), in order to support projects that implement strategies contained within such plans. ``(2) Program requirements.--The Secretary within 90 days after approval of the first plan approved under subsection (c)(7), shall publish in the Federal Register requirements regarding applications, allocations, eligible activities, and all terms and conditions for grants awarded under this subsection. No less than 30 percent, and no more than 50 percent, of the funds appropriated in any fiscal year for grants under this subsection shall be awarded through a merit- based competitive process. ``(3) Eligible activities.--The Secretary may award grants to coastal states to implement projects in the coastal zone to address stress factors in order to improve coastal climate change adaptation, including the following: ``(A) Activities to address physical disturbances within the coastal zone, especially activities related to public facilities and public services, tourism, sedimentation, and other factors negatively impacting coastal waters, and fisheries-associated habitat destruction or alteration. ``(B) Monitoring, control, or eradication of disease organisms and invasive species. ``(C) Activities to address the loss, degradation or fragmentation of wildlife habitat through projects to establish marine and terrestrial habitat buffers, wildlife refugia or networks thereof, and preservation of migratory wildlife corridors and other transition zones. ``(D) Implementation of projects to reduce, mitigate, or otherwise address likely impacts caused by natural hazards in the coastal zone, including sea level rise, coastal inundation, coastal erosion and subsidence, severe weather events such as cyclonic storms, tsunamis and other seismic threats, and fluctuating Great Lakes water levels. ``(E) Provide technical training and assistance to local coastal policy makers to increase awareness of science, management, and technology information related to climate change and adaptation strategies.''. (b) Authorization of Appropriations.--Section 318(a) of the Coastal Zone Management Act of 1972 (16 U.S.C. 1464) is further amended by adding at the end the following: ``(4) for grants under section 320(c) and (d), such sums as are necessary.''. (c) Intent of Congress.--Nothing in this section shall be construed to require any coastal state to amend or modify its approved management program pursuant to section 306(e) of the Coastal Zone Management Act of 1972 (16 U.S.C. 1455(e)), or to extend the enforceable policies of a coastal state beyond the coastal zone as identified in the coastal state's approved management program.

Title: To amend the Coastal Zone Management Act of 1972 to authorize assistance to coastal states to develop coastal climate change adaptation plans pursuant to approved management programs approved under section 306, to minimize contributions to climate change, and for other purposes Summary: Coastal State Climate Change Planning Act of 2008 - Amends the Coastal Zone Management Act of 1972 to establish a coastal climate change adaptation planning and response program to provide assistance to coastal states to voluntarily develop coastal climate change adaptation plans and to provide financial and technical assistance and training to enable coastal states to implement those plans through coastal states' enforceable policies. Authorizes, subject to the availability of appropriations, grants to coastal states for developing the plans and grants for implementation.

billsum

en

Write a title and summarize: Die Zitruspflanzen (Citrus) sind eine Pflanzengattung aus der Familie der Rautengewächse (Rutaceae). Sie stammen aus dem tropischen und subtropischen Südosten Asiens. Die Vertreter dieser Gattung liefern die Zitrusfrüchte (hauptsächlich Orangen, Mandarinen, Zitronen und Grapefruits), die weit verbreitet in den warmen Gebieten der Erde angebaut werden. Diese Früchte stellen eine Sonderform der Beere dar, die charakteristisch für die Gattung Citrus ist. == Beschreibung Es handelt sich um immergrüne Bäume oder große Sträucher. Sie erreichen Wuchshöhen von etwa 5 bis 25 Metern. Die Blüten sind weiß, die rundlichen Früchte färben sich zur Reife grün, gelb oder orange. === Zweige, Stamm und Wurzeln Die jungen Zweige sind grün und kantig. Sie besitzen einen Grat unterhalb jedes Blattansatzes, der langsam nach unten ausläuft. Es ergibt sich ein dreieckiger Querschnitt, der sich jedoch mit einsetzendem Dickenwachstum verliert. In der Blattachsel sitzen Knospen sowie manchmal jeweils ein Dorn. Dornen werden häufig nur bei jungen Pflanzen oder stark wachsenden Zweigen ausgebildet. Die austreibenden Knospen können sich zu rein vegetativen Sprossen, zu Sprossen mit Blättern und Blüten oder zu solchen ausschließlich mit Blüten entwickeln. Die Zweige beenden ihr Längenwachstum nicht mit einer Endknospe, die letzte Seitenknospe übernimmt diese Funktion (Sympodium). Ältere Äste sind rund, ihre Rinde ist dünn, grau und glatt, das Holz gelblich. Der Stamm ist oft krumm und teilt sich schon kurz über dem Boden in viele unregelmäßig verzweigte Äste. Unter günstigen Bedingungen tritt keine Wachstumspause ein, Jahresringe werden nur in Klimaten mit ungünstigen Jahreszeiten gebildet. Das Dickenwachstum kann während einer Wachstumsperiode in mehreren Schüben verlaufen, so dass Xylem und Phloem mehrmals im Jahr Strukturen bilden, die Jahresringen gleichen. Das Wurzelsystem besteht aus einer Pfahlwurzel sowie seitlichen sekundären Wurzeln. Zwei Typen von Wurzeln lassen sich unterscheiden: dickere Haltewurzeln, die auch ein sekundäres Dickenwachstum aufweisen, sowie dünnere Faserwurzeln, die verzweigte Büschel bilden, sich aber kaum verdicken. Pilze der Gattung Glomus wurden als Mykorrhiza entdeckt. === Blätter Die Laubblätter in der Gattung Citrus werden als Reduzierung von unpaarig gefiederten Blättern verstanden, bei denen nur noch das Endblättchen vorhanden ist. Nur bei nahe verwandten Gattungen sind drei Fiederblättchen ausgebildet. Trenngewebe gibt es zwischen dem Blattstiel und dem Spross sowie weniger stark ausgebildet zwischen dem Blattstiel und dem Blättchen. An den Zweigen sind die Blätter spiralig angeordnet. Nach drei Umdrehungen sitzt das neunte Blatt wieder genau über dem ersten, manchmal auch nach zwei Umdrehungen das sechste Blatt. Bei jedem neuen Austrieb ändert sich die Richtung der Spiralität. Die Blattspreite ist oval bis länglich geformt, die Blattspitze manchmal in einer Träufelspitze auslaufend. Oberseits sind die Blätter dunkelgrün, unterseits heller gelb-grün, auf beiden Seiten glatt. Der Blattrand ist meistens leicht gekerbt. Die Blätter fühlen sich meist dick und ledrig an. Von den Blattadern ist nur die Hauptader in der Mitte des Blatts hervortretend, die Seitenadern verzweigen sich y-förmig, die Seitenäste benachbarter Adern treffen sich (Anastomose) und bilden eine netzartige Aderung. Im Blatt befinden sich Öldrüsen, hauptsächlich am Rand und an der Blattspitze. Im Gegenlicht sind sie als kleine helle Punkte zu erkennen. Der Blattstiel ist oft deutlich geflügelt, bei manchen Arten kann der verbreiterte Blattstiel genauso groß werden wie die eigentliche Blattspreite. === Blütenstände und Blüten Die Blüten sitzen einzeln oder zu wenigen in doldenartigen traubigen Blütenständen zusammen. Blüten oder Blütenstände entwickeln sich aus Knospen in den Blattachseln der Zweige, die Blütenstände können beblättert oder blattlos sein. Je nach Wachstumsrhythmik blühen Zitruspflanzen zu einer bestimmten Zeit im Jahr, dann oft direkt nach einer ungünstigen Jahreszeit, oder auch verteilt über das ganze Jahr. Es kommen zwittrige sowie rein männliche Blüten vor. Die gestielten, radiärsymmetrischen Blüten weisen Durchmesser von 1 bis 5 Zentimeter auf. Die Kelchblätter sind verwachsen und formen einen fünfzipfligen, fleischigen Kelch. Er bleibt bis zur Fruchtreife haften. Die Kronblätter, normalerweise fünf, sind nicht verwachsen. Sie sind dick und ledrig, mit einer wachsartig glatten Oberfläche, weiß gefärbt oder selten rosa auf der Außenseite. Die Kronblätter enthalten Öldrüsen. Staubblätter sind meist viermal so viele wie Kronblätter, also zwanzig vorhanden, es kommen aber auch bis zu vierzig vor. Die weißen Staubfäden können am Grund in mehreren Gruppen verwachsen sein. Die gelben Antheren sind vierlappig. Am Grund der Staubblätter befindet sich eine Nektarscheibe. Diese ringförmige Struktur umschließt das Gynoeceum und sondert einen wässrigen Nektar ab. Die Blüten verströmen oft einen starken Duft und sind dadurch und durch den produzierten Nektar für Insekten attraktiv. Der oberständige Fruchtknoten besteht aus etwa drei bis 14 verwachsenen Fruchtblättern. Jedes Fruchtblatt enthält zwei bis acht oder noch mehr Samenanlagen, die vertikal in zwei Reihen entlang der Mittelachse angeordnet sind. Durch den einzelnen, zylindrischen Griffel führen Griffelkanäle von den Samenanlagen zur Narbe. Diese ist recht groß und rund. === Früchte Aus dem Fruchtknoten bilden sich die kugeligen, ovalen oder etwas birnenförmigen Früchte, entsprechend der Anzahl der Fruchtblätter eingeteilt in Segmente ("Spalten", "Schnitze"). Die Fruchtgröße variiert stark, die kleinsten Früchte haben einen Durchmesser von etwa einem Zentimeter, die größten gezüchteten Sorten bringen Früchte mit dreißig Zentimeter Durchmesser hervor. Das Perikarp (Fruchtwand) bildet drei unterscheidbare Schichten: Das Exokarp, hier Flavedo genannt, bildet die äußerste, farbige Schicht der Frucht, mit einer Cuticula und dicht gepackten Parenchymzellen. Hier befinden sich wieder zahlreiche Öldrüsen. Die Parenchymzellen enthalten Chloroplasten, die für die grüne Farbe unreifer Früchte verantwortlich sind. Im Laufe der Reifung wandeln sich diese zu Chromoplasten, die die Frucht gelb oder orange färben. Das Mesokarp (Albedo) darunter ist weiß und schwammig. Die Albedo degeneriert je nach Art unterschiedlich stark, ebenso die Trennwände (Septen) des Fruchtknotens. Entsprechend lassen sich manche Zitrusfrüchte leicht schälen und in einzelne Segmente teilen. Das Endokarp besteht aus einem dünnen Häutchen, das sich rund um die einzelnen Fruchtblätter erstreckt. Aus dem Endokarp stülpen sich saftgefüllte kleine Säckchen nach innen in die einzelnen Segmente und füllen sie vollständig aus. Diese Saftschläuche wachsen von der Außenseite der Frucht in Richtung Fruchtmitte, die äußeren sind kurz gestielt, nach innen zu werden die Stiele länger. Sie sind von einer Epidermis umhüllt, so dass man die einzelnen Säckchen erkennen kann, aber meist so zusammengewachsen, dass sie nicht separiert werden können. Im Innern dieser Saftschläuche befinden sich große Zellen mit großer Vakuole, aber auch einige kleinere Zellen sowie Öltröpfchen können dort vorkommen. Die Gesamtheit der Saftschläuche wird Pulpa genannt. Diese Strukturen, reich an aromatischem, süßem bis bitterem Saft, sind der Teil der Frucht, der frisch verzehrt wird. Das umgebende zellulosereiche weiße Gewebe ist Ballaststoff für die Verdauung, die ölreiche Schale wird - sofern insektizidfrei - geraspelt, kandiert als Gewürz oder zur Gewinnung des Aromastoffs verwendet. Die zentrale Achse (Columella) der Frucht, die sich vom Ansatz des Blütenstiels auf der einen Seite bis zum Ansatz des Griffels auf der anderen erstreckt, ist mit schwammigem Parenchymgewebe und Leitungsbahnen gefüllt. Die Fruchtblätter sind hier in der Mitte zusammengewachsen; in der Mitte jedes Fruchtblatts, also im Zentrum der Frucht, ist die Ansatzstelle des Griffelkanals zu den Samenanlagen. In der reifen Frucht kann die zentrale Achse mit Gewebe ausgefüllt oder hohl sein. Die Schnittstelle zwischen Blüte und Blütenstiel verholzt bei zunehmender Fruchtreife. Während die Blüte noch ein Trenngewebe zwischen Blütenstiel und Fruchtknoten aufweist, wird dieses verfestigt, wenn sich eine Frucht bildet. Zur Reife bildet sich eine neue Sollbruchstelle. Diese beschriebene Sonderform einer Beere wird gelegentlich Hesperidium genannt, ein Ausdruck, den schon Carl von Linne prägte. Er bezog sich damit auf die "goldenen Äpfel der Hesperiden". Weitere botanische Begriffe für diese Beeren mit ledriger Schale sind Endokarpbeere oder Panzerbeere. === Ernte Die Ernte erfolgt bei Orangen und Grapefruit in der Regel entweder total, d. h. alle Früchte eines Baumes werden gleichzeitig geerntet, oder nach und nach, wie bei Zitronen und Limetten. Die Früchte reifen nicht nach (wie Bananen), da sie stärkearm sind. Reife und volle Schalenausfärbung werden nicht immer gleichzeitig erreicht. Grünschaligkeit bedeutet daher nicht immer Unreife. Für die gewohnte Färbung sind einige kühle Nächte erforderlich. Zu warmes Wetter bewirkt Grünfleckigkeit. === Samen Die Samen sind rundlich bis länglich-zugespitzt und etwa 0,5 bis 1 Zentimeter groß. Ihre strohfarbene äußere Schale (Testa) ist hart und ledrig, oft mit Leisten oder Rippen versehen. Darunter befindet sich eine braun gefärbte, trockene Haut. Im reifen Samen wird der Platz durch die Keimblätter ausgefüllt, Endosperm ist nicht vorhanden. Die Keimblätter speichern die Nährstoffe für den Keimling und sind je nach Art weiß, gelblich oder grün gefärbt. Jeder Samen kann mehrere Embryonen enthalten (Polyembryonie), eine Seltenheit unter den Samenpflanzen. Bis auf einen verkümmern jedoch die meisten Embryonen eines Samens. Die Polyembryonie entsteht dadurch, dass nicht nur aus der befruchteten Eizelle der Samenanlage ein Embryo entsteht, sondern auch aus einzelnen Nucellus-Zellen der Samenanlage. Diese Nucellar-Embryonie ist eine Sonderform der Apomixis. Zur Bildung dieser Embryonen ist jedoch als Auslöser die Befruchtung der Eizelle nötig. Somit entspricht ein Teil der Embryonen, häufig sogar der größere, genetisch der Mutterpflanze, und nur ein Teil besitzt zwei Eltern. Werden die Blüten nicht bestäubt, bilden sich bei einigen Zitruspflanzen trotzdem Früchte (Jungfernfrüchtigkeit). Diese enthalten dann keine Samen, auch nicht solche mit nucellaren Embryos. Einige Sorten bilden selten oder sogar nie Samen, selbst wenn die Blüten bestäubt wurden. Kommerziell genutzte Sorten werden auf solche Früchte ohne Samen selektiert. (Beispiel: Persische Limette, Satsuma Mandarine) Die Keimung erfolgt hypogäisch oder epigäisch. Die ersten beiden echten Blätter stehen gegenständig und sehen meist auch etwas anders aus als die folgenden Blätter. == Kulturgeschichte Genetische, stammesgeschichtliche und biogeografische Analysen der Zitruspflanzen wurden dahingehend interpretiert, dass sie ihren Ursprung vor rund acht Millionen Jahren im Gebiet der südöstlichen Ausläufer des Himalayas hatten, in einer Region, die das heutige östliche Assam, den Norden von Myanmar und den Westen von Yunnan umfasst, und dass sie sich damals - im Miozän - sehr rasch in diverse Arten aufspalteten. Aufgrund der essbaren Früchte wurden Zitruspflanzen früh kultiviert, verbreitet und sind weltweit anzutreffen. === Ursprünge in Ostasien Die Vorläufer der essbaren Zitrusfrüchte werden am Südosthang des Himalaya vermutet, der heutigen Gegend von Nordost-Indien, Myanmar und der chinesischen Provinz Yunnan. Eine sehr alte Erwähnung finden Zitrusfrüchte im Yü Kung, das Tributzahlungen an den chinesischen Herrscher Ta Yu verzeichnet, dieser regierte von 2205 bis 2197 v. Chr. (der Text wird allerdings auf etwa 800 v. Chr. datiert). Legge übersetzt daraus: Mit dem Wort "chu" waren kleine Mandarinen und Kumquats gemeint, mit "yu" Pampelmusen und Yuzu. Erst später, um 200 v. Chr., kommen "kan", größere Mandarinen oder Orangen, hinzu. Erst 300 n. Chr. finden sich dann Hinweise auf die Zitronatzitrone in China. Im Jahre 1178 konnte Han Yen Chih im Chü lu, einer Monographie über Zitrusfrüchte, schon 28 verschiedene kultivierte Sorten detailliert beschreiben. Auch das Veredeln von Zitruspflanzen auf die Dreiblättrige Bitterorange "chih" (Poncirus trifoliata) war bekannt. In Indien findet sich eine Erwähnung von Zitrusfrüchten im Vajasaneyi samhita, Texten, die noch vor 800 v. Chr. geschrieben wurden. Zitrone und Zitronatzitrone werden dort jambila genannt. Bezeichnungen für die Orange tauchen um das Jahr 100 n. Chr. auf. === Einführung nach Europa Die Zitronatzitrone war die erste Zitrusfrucht, die von Menschen in Richtung Westen verbreitet wurde. In der Folge der Züge Alexanders des Großen wurde der Baum, der zu dieser Zeit in Persien kultiviert wurde, in Kleinasien eingeführt. Theophrastus gibt um 310 v. Chr. eine detaillierte Beschreibung der Zitronatzitrone und ihrer Nutzung, weist aber auch darauf hin, dass er die Frucht nicht aus eigener Anschauung kennt. Sie war dann im zweiten Jahrhundert nach Christus im östlichen Mittelmeergebiet allgemein bekannt. Eingeführt wurden sie durch jüdische Migranten, die sich nach der Eroberung Jerusalems im Jahre 70 nach Christus in Spanien, Griechenland und Italien und hier insbesondere in Kalabrien ansiedelten. Vergil nennt die Frucht Medischen Apfel, bei Dioscurides taucht dann die lateinische Bezeichnung Citria auf. Plinius (77 n. Chr.) nennt die Zitronatzitrone malus medica, malus assyria, oder citrus, nach seiner Darstellung war sie den Römern zu dieser Zeit nur als exotischer Import bekannt, eventuell in Italien vorhandene Bäume fruchteten wohl nicht. In De re coquinaria, einer Sammlung spätantiker römischer Rezepte aus dem 3. oder 4. Jahrhundert n. Chr. stammt, wird unter anderem eine Methode zur längeren Aufbewahrung von Zitronen genannt. Beschrieben wird auch ein Saucenrezept, bei dem Zitronatschale mit Minze und Fenchel sowie Brühe gemischt wird. Obwohl die Zitronatzitrone in der Bibel nicht ausdrücklich erwähnt wird (eventuell bezeichnet das Wort hadar sie), spielt sie in der jüdischen Symbolik eine prominente Rolle und erscheint von 66 bis 70 n. Chr. auf jüdischen Münzen. Als nächste Zitrusfrüchte tauchen Zitronen und Bitterorange (Pomeranzen) auf römischen Mosaiken auf, etwa im Mausoleum der Constantia, Tochter Konstantins (etwa 330 n. Chr.). Die genaue Zuordnung der abgebildeten Früchte ist allerdings unsicher. Sicher ist, dass mit den arabischen Eroberungen im 9. Jahrhundert arabische Siedler auch Bitterorangen und Zitronen in den eroberten europäischen Regionen anzubauen begannen. Ibn Hauqal, der auf seinen weiten Reisen auch Sizilien besuchte, beschreibt beispielsweise in seinem 977 niedergeschriebenen Buch vom Bild der Erde auch die umfangreichen Gärten, in denen auf Grund der eingeführten Bewässerungsmethoden Orangen- und Zitronenbäume standen. Die bekannten kultivierten Zitrusfrüchte erreichten eine ähnliche Bandbreite wie in China. Um 1500 waren im Mittelmeerraum Zitronatzitrone, Zitrone, Limette, Pampelmuse und Bitterorange bekannt. Die portugiesischen Entdecker stießen auf dem Weg nach Indien in ostafrikanischen Gärten arabischer Händler auf Zitronen und Pomeranzen. Auch die süße Orange wurde von ihnen nach Europa gebracht. Im 18. Jahrhundert verkauften Zitronenhändler (als Konkurrenten der örtlichen Spezereihändler bzw. Gewürzkrämer) ihre Waren auf süddeutschen Märkten, so etwa die "Tyroler Citronen Männer". Zur Handelsware der sogenannten Zitronenmänner gehörten jedoch nicht nur Zitrusfrüchte wie Zitronen, Limonen und Pomeranzen, sondern auch Zitronat, Granatäpfel, Feigen, Lorbeerblätter, Pistazien, Walnüsse, Mandeln, Parmesankäse, marinierte Fische, Oliven, Rosinen, italienische Wurstwaren, venezianische Seife, italienische Weine, Darmsaiten, genuesische Handschuhe und anderes mehr. Erst 1805 wurde die Mandarine aus China eingeführt. Etwas früher wurde die aus Barbados stammende Grapefruit, eine Kreuzung aus Pampelmuse und Orange, bekannt. Kumquats wurden der Royal Horticultural Society in London 1846 von Robert Fortune vorgestellt. === Namen Die Bezeichnung Zitrus geht auf das lateinische Wort citrus zurück, mit dem unterschiedliche Pflanzen bezeichnet wurden: einmal ein aromatisch duftendes Holz, bei dem es sich wohl um Zedern-Holz sowie Holz der Gliederzypresse handelte, zum anderen die Zitronatzitrone (Citrus medica). Der Name ist also von dem griechischen Wort kedros für Zeder auf die Zitronatzitrone übertragen worden. Die Gemeinsamkeit dieser Pflanzenarten war dabei der Gebrauch als Duftstofflieferant und Mottenabwehrmittel. Erst Ende des 14. Jahrhunderts erfolgte die Übertragung des Wortes auf eine andere, dann wichtiger werdende Zitruspflanze: die Zitrone (Citrus xlimon). Carl von Linne verwendete die Bezeichnung Citrus 1753 dann für die ganze Gattung. Agrumen (ital.: agrumi, Sauerfrüchte) ist eine Sammelbezeichnung für die Früchte der Zitruspflanzen. Viele Bezeichnungen für einzelne Vertreter der Zitruspflanzen sind aus dem Arabischen gekommen, siehe dazu die Artikel zu den jeweiligen Pflanzen. === Symbolik Die unterschiedlichen Zitrusfrüchte haben über das weite Verbreitungsgebiet die verschiedensten Bedeutungen zugeschrieben bekommen. In China ist eine Form der Zitronatzitrone, bei der die Segmente nur an einer Seite zusammengewachsen sind und sich an der anderen fingerförmig ausbreiten, als Buddhas Hand bekannt. Sie kann für Reichtum, als Geste des Greifens und weiter als Symbol für Bestechlichkeit verstanden werden. Die große Anzahl an Samen führt zum Begriff der Fruchtbarkeit, der eng mit dem des Reichtums verknüpft war. Etrog, eine andere Form der Zitronatzitrone, ist bei jüdischen religiösen Ritualen wichtig, etwa beim Laubhüttenfest, zusammen mit Palme, Weide und Myrte. In Europa galten Zitrusfrüchte zuerst als Duftlieferant, Mittel zur Insektenabwehr und Medizin. Als Bestandteil von Rezepten für Pestmedizin tauchte häufig Zitronenschale auf. Oft waren sie in irgendeiner Weise mit dem Tod verknüpft: So trugen zum Tode Verurteilte auf dem Weg zur Hinrichtung eine Zitrone in der Hand, ebenfalls bei Beerdigungen die Trauernden. In der Malerei wird Maria mit einer Zitrusfrucht dargestellt, in der profanen Kunst ist sie Symbol für Verstorbene. Da die Zitrusfrüchte in Mitteleuropa ein teures Importprodukt waren, kam ihnen auch eine Bedeutung als Symbol für Luxus und Reichtum zu. Ein eindrucksvolles Beispiel dafür sind die von Patriziern angelegten barocken Hesperidengärten in Nürnberg. Der international agierende Kaufmann und Botaniker Johann Christoph Volkamer ließ seine Zitruspflanzensammlung Anfang des 18. Jahrhunderts unter dem Titel Nürnbergische Hesperides von mehreren Künstlern in Kupfer stechen und kolorieren. Mit der zunehmenden Verwendung als Nahrungsmittel, weg vom medizinischen Aspekt, werden sie auf bemaltem Geschirr dargestellt. Zusammen mit anderen importierten Früchten stehen sie für die Exotik fremder Länder. == Verwendung Die hauptsächliche Verwendung der Früchte ist die als Nahrungsmittel. Als Obst werden die Früchte roh gegessen, etwa ein Drittel wird zu Saft und anderen Produkten weiterverarbeitet. Als Nahrungsmittel sind Zitrusfrüchte vor allem für den hohen Anteil an Vitamin C und Mineralstoffen bekannt. Der Fruchthandel bezeichnet Mandarinen, Clementinen, Satsumas, viele Tangelos und Tangerinen als Easy Peeler (von engl. easy = einfach und to peel = schälen), da sich bei diesen Zitrusfrüchten die Schale leicht vom Fruchtfleisch lösen lässt. Zitrusfrüchte reifen nach der Ernte nicht nach und zählen damit zu den nichtklimakterischen Früchten. Sie sind zudem kälteempfindlich, unter 2 °C werden sie bitter. Die ideale Lagerung liegt bei 7 °C und hoher Luftfeuchtigkeit. Die in Drüsen der äußeren Schalen gebildeten ätherischen Öle machen sie auch zum Würzen und für Duftmittel interessant. Für die Küche gibt es dafür ein spezielles Haushaltsgerät, den Zestenreißer (teils auch als Zesteur bekannt), der dazu dient, hauchdünne Streifen der äußeren Schale, sogenannte Zesten, abzutrennen. Die äußere Schale wird auch zu Zitronat und Marmelade verarbeitet, in ähnlicher Weise werden Kumquats im Ganzen gegessen. Der Saft von sauren Zitrusfrüchten wird weniger pur verwendet, sondern ebenfalls zum Würzen. Die Blätter der Kaffirlimette werden - ähnlich wie Lorbeerblätter - dem Essen als Gewürz beigegeben. In der arabischen Küche kennt man getrocknete Limetten als Zutat zum Würzen. Die annähernd weißen Innenschalen (das Mesokarp bzw. die Albedo) enthalten große Mengen Pektin und werden daher auch zur industriellen Pektingewinnung genutzt. Ätherisches Öl wird auch aus den Blüten gewonnen und kommt als Neroliöl in den Handel. Die Schale von Zitrusfrüchten wird häufig mit Wachsen (etwa aus Polyethylenwachs, Bienenwachs oder Schellack) behandelt, denen meist Konservierungsstoffe wie Thiabendazol (E 233), Orthophenylphenol (E 231), Natriumorthophenylphenol (E 232), Biphenyl (E 230) und Imazalil zugesetzt werden. 2017 konnte das Niedersächsische Landesamt für Verbraucherschutz und Lebensmittelsicherheit (LAVES) bei fast allen beprobten Zitrusfrüchten Rückstände von Pestiziden nachweisen. Dabei wurde der Grenzwert bei rund 3,4 % der Proben überschritten. Citrusfasern dienen als Zusatzstoff in der Lebensmittelindustrie. == Wirtschaftliche Bedeutung === Erntemengen der wichtigsten Südfrüchte Diese Gattung ist von kommerzieller Bedeutung, da die Pflanzen ihrer Früchte wegen kultiviert werden. Die Welternte betrug 2019 etwa 124 Millionen Tonnen. Die größten Produzenten der jeweiligen Früchte sind in den Tabellen der Hauptartikel zu finden. Die von der Erntemenge her wichtigsten Südfrüchte waren 2019: In Summe brachten es diese vier Gruppen auf insgesamt 124.366.900 t. === Anbaugebiete Zitruspflanzen wachsen in warmen Regionen, beispielsweise rund um das Mittelmeer. Es gibt allerdings auch Pflanzen, die bis zu -12 Grad Celsius vertragen können. Hauptsächlich werden sie im so genannten Zitrusgürtel zwischen dem 20. und 40. Breitengrad nördlich und südlich des Äquators kultiviert. Da die Zitrusfrüchte eine lange Zeit bis zur Reife benötigen, ist ein langer, warmer Sommer erforderlich; das limitiert den Anbau in kühleren Klimaten. In trockenen Gebieten wie dem Mittelmeerraum muss bewässert werden. In den immerfeuchten tropischen Gebieten wachsen Zitruspflanzen zwar gut, allerdings verhindern hier mehrere Faktoren die kommerzielle Nutzung. Die meisten Sorten tendieren in einem Klima ohne trockene oder kalte Periode dazu, kontinuierlich kleine Mengen an Früchten anzusetzen, die nicht rationell geerntet werden können. Die Schale der Früchte wird unter tropischen Bedingungen oft nicht ausgeprägt farbig, auch wird sie häufig von Pilzen befallen. === Probleme und Krankheiten Eine ganze Reihe von Organismen ernährt sich von Zitruspflanzen und wird daher beim kommerziellen Anbau als Schädling wahrgenommen. Da der Anbau oft in Monokultur erfolgt, ergeben sich bei der Bekämpfung - wie bei anderen Kulturpflanzen auch - Probleme mit der raschen Ausbreitung der Schädlinge und dem raschen Anwachsen der Schädlingspopulationen. Mehr als 250 verschiedene Insekten wurden auf Zitruspflanzen nachgewiesen. Einige, die sich auf Zitruspflanzen spezialisiert haben sowie beim Anbau besonders als Schädlinge hervortreten, sind der Zitrus-Blattfloh (Diaphorine citri), Schwarze Fliegen (Aleurocanthus woglumi), Weiße Fliegen (Dialeurodes citri, Aleurolobus citriifolia und weitere), Schildläuse (Aonidiella aurantii, Aonidiella citrina), Schmierläuse (Planococcus citri) und Blattläuse (Toxoptera citricida, Toxoptera aurantii). Die Larven und ausgewachsenen Tiere saugen Pflanzensaft, auf den Honigtau-Ausscheidungen siedeln Pilze. Außerdem werden Viruskrankheiten übertragen. Die Larven des Zitrus-Blattminierers (Phyllocnistis citrella) leben in jungen Blättern. Zitrus-Thrips (Scirtothrips spp., Heliothrips haemorraeodalis) und Zitrus-Milben (Eutetranychus orientalis, Eutetranychus banksi, Tetranychus fijiensis) saugen Pflanzensäfte. Frucht fressende Motten (Ophederes spp., Achaea janata) fressen an unreifen Früchten, die dann faulen und abfallen. Die Raupen etlicher Arten der Gattung Papilio fressen an Zitruspflanzen, wobei manche davon, wie z. B. Papilio demoleus, beträchtliche Fraßschäden verursachen können. Die Falter einer Mottenart (Inderbela quadrinotata) legen ihre Eier auf die Rinde ab. Die Larven fressen unter der Rinde. Pilze wie Phytophthora citrophtora und andere Phytophthora-Arten infizieren die Pflanzen meist über die Wurzel, besonders bei großer Bodennässe. Sporen gelangen durch Regenwasser an verschiedene Pflanzenteile, wo sie sowohl Holz als auch Blätter oder Früchte befallen. Durch Auswahl geeigneter Unterlagen lässt sich die Anfälligkeit der Pflanzen verringern. Fusarium-Pilze greifen ebenso die Wurzeln an, Pellicularia salmonicolor Stamm und Zweige. Auf den Blättern und jungen Zweigen finden sich verschiedene Arten Mehltau (Acrosporium tingitaninum, Colletotrichum gloeosporioides, Botryodiplodia theobromae) und Schorf (Elsinoe fawcettii). Durch Bakterien, die an winzigen Verletzungen in Blätter, Zweige und Früchte eindringen, wird Zitrus-Krebs (Xanthomonas axonopodis cv. citri) ausgelöst. Es bilden sich rundliche, graue Flecken, bei starkem Befall sterben die Blätter und Zweige ab, befallene Früchte sind nicht mehr zu verkaufen. Das "Citrus Greening" wird durch Liberobacter-Bakterien ausgelöst, die von Blattflöhen verbreitet werden und das Phloem der Pflanzen bewohnen. Auch Viren werden an Zitruspflanzen festgestellt, so das Citrus-Tristeza-Virus (CVD), Citrus-Exocortic-Viroid (CEVd), Mosaik- und Ringflecken-Virus. Durch In-vitro-Vermehrung lassen sich virusfreie Pflanzen ziehen. Wenn auf einer Fläche lange Zeit Zitruspflanzen kultiviert werden, wachsen junge Pflanzen nicht mehr gut (Nachbauprobleme). Das lässt sich teilweise auf eine erhöhte Zahl von schädlichen Pilzen im Boden zurückführen, allerdings scheiden zumindest Bitterorangen und vermutlich auch andere Arten Stoffe aus, die das Wachstum anderer Pflanzen hemmen (Allelopathie). Je nachdem, welche Sorte nachgepflanzt werden soll, kann auch diese empfindlich darauf reagieren. === Nährstoffbedarf Für Zitruspflanzen sind die 18 chemischen Elemente als Nährstoffe notwendig, die für das Wachstum von Grünpflanzen allgemein erforderlich sind. Da das Wachstum und die Erntemenge an Zitrusfrüchten bei Nährstoffmangel gravierend beeinträchtigt sein können, werden beispielsweise auf den Zitrusplantagen in Florida häufig Nährstoffanalysen aus eingesammelten Blättern von Zitrusbäumen durchgeführt, um entsprechende Mangelzustände rechtzeitig erkennen und beheben zu können. == Systematik Linne stellte 1753 die Gattung Citrus auf und benannte fünf Vertreter (in Klammern die von Linne benutzten Namen): Zitronatzitrone (Citrus medica), Zitrone (Citrus medica var. limon), Bitterorange (Citrus aurantium), süße Orange (Citrus aurantium var. sinensis) und Pampelmuse (Citrus grandis). === Externe Systematik Innerhalb der Familie der Rautengewächse (Rutaceae) zählt die Gattung Citrus zur Unterfamilie Aurantioideae. Diese wird in die Tribus Clauseneae und Citreae unterteilt, die weitere Unterteilung in Subtriben wird von neueren Untersuchungen nicht gestützt. Die Schwestergruppe von Citrus wird in den Gattungen Atalantia, Limonia und Severinia vermutet. Weitere verwandte Gattungen in der Tribus Citreae sind unter anderen Citropsis, Pleiospermium, Feroniella, Merillia, Murraya und Triphasia. Der letzte gemeinsame Vorfahre der Zitrusgewächse lebte schätzungsweise vor 7 Millionen Jahren. === Interne Systematik Die Abgrenzung einzelner Arten innerhalb der Zitruspflanzen erwies sich lange als problematisch. Kreuzungen sind zwischen allen Arten möglich. Da viele dieser Arten und Sorten schon lange in Kultur sind, wurden sie von Menschen weit über ihr natürliches Vorkommen hinaus verbreitet, verschiedene Arten und Sorten in Gärten nebeneinander gepflanzt und nach wünschenswerten Fruchtqualitäten ausgelesen. Vom Menschen unbeeinflusste Populationen existieren nur noch von Arten, die keine wohlschmeckenden Früchte hervorbringen. Durch die Möglichkeit der Zitruspflanzen, nucellare Embryonen zu bilden, die genetisch mit der Mutterpflanze identisch sind, können Mutationen weitergegeben werden und ansonsten sterile Hybriden können sich vermehren. Die resultierenden Sämlinge können allerdings anders als die Mutterpflanze aussehen, etwa weil junge Zitruspflanzen Dornen tragen und größere Blätter besitzen. Das trug dazu bei, dass Forscher über die Zuordnung einer Pflanze - sei es eine bestimmte Art, eine Kreuzung oder eine von Menschen gezüchtete Sorte - oft im Unklaren waren. Mutationen kommen bei Zitruspflanzen recht häufig vor, ebenso Pflanzen mit doppelten Chromosomensätzen. Die dadurch entstehenden Variationen komplizieren die Situation weiter. ==== Swingle und Tanaka Anfang des 20. Jahrhunderts begann Walter Tennyson Swingle mit seinen Untersuchungen der Systematik der Zitruspflanzen. Auf einer Forschungsreise durch Ostasien lernte er Tyozaburo Tanaka kennen, der mit ihm zusammenarbeitete. Später publizierten die beiden unabhängig voneinander, wobei Swingle sich darauf konzentrierte, möglichst nur natürlich entstandene Taxa zu beschreiben, während Tanaka die ganze Vielfalt der Zitruspflanzen zu erfassen suchte. Das Ergebnis war, dass Swingle 16 Citrus-Arten anerkannte, während Tanaka dasselbe Pflanzenmaterial in 162 Arten einteilte. Nachfolgende Wissenschaftler kritisierten an Tanakas System, dass die meisten der Arten ihren Ursprung als Hybriden und gezüchtete Sorten hätten: Das unterschiedslose Nebeneinander von Kultursorten und natürlichen Arten sei falsch. Auch von Swingles Arbeiten ist nicht mehr viel gültig - die modernen Methoden der Genanalyse haben gezeigt, dass sowohl Art- als auch Gattungsgrenzen anders verlaufen als von ihm postuliert. Allerdings hatte Swingles System einen großen Einfluss auf die Benennung von Zitruspflanzen wegen des Anspruchs, die natürlichen Verhältnisse abzubilden. ==== Gärtnerische Systematik Aufgrund der leichteren Handhabbarkeit hält sich ein an Swingle angelehntes System der Bezeichnungen auch im Gartenbau. Die Gruppierung erfolgt nicht so sehr nach gemeinsamer Abstammung, sondern nach ähnlichen Früchten. Auskunft darüber, ob sich hinter einem botanischen Namen eine Sorte, eine Sortengruppe oder eine natürliche Art verbirgt, darf man von diesem System nicht erwarten. Da die alten Namen im Handel verwendet werden, hier eine Übersicht: ==== Phylogenetische Systematik Die Gattung lässt sich intern in zwei Gruppen einteilen, die sich wahrscheinlich vom südostasiatischen Festland aus Richtung Südosten bis nach Australien ausbreiteten. Die erste Gruppe enthält die Zitronatzitrone (Citrus medica) und Citrus indica sowie die weit südöstlich verbreiteten Gattungen Clymenia, Eremocitrus, Microcitrus und Oxanthera. Die zweite Gruppe, nordöstlicher verbreitet, enthält die restlichen Citrus-Arten, die früher unter dem Namen Fortunella abgetrennten Kumquats (Citrus japonica) sowie Poncirus. Die Vielfalt der kultivierten Zitruspflanzen geht auf nur wenige Arten zurück: namentlich die Zitronatzitrone (Citrus medica), die Mandarine (Citrus reticulata) und die Pampelmuse (Citrus maxima). Auch diese drei sind keineswegs von Naturstandorten bekannt, sondern stellen so wie wir sie kennen vom Menschen ausgelesene Formen dar. Es sind nur wenige weitere Arten aus der Natur bekannt, bei denen außerdem immer in Zweifel steht, ob sie nicht Gartenflüchtlinge sind oder zumindest durch Gen-Austausch mit benachbarten kultivierten Sorten beeinflusst wurden. Nur bei neueren Züchtungen sind die Eltern sicher bekannt, bei den traditionellen Sorten können diese nur durch genetische Studien erschlossen werden. Für folgende Arten wird angenommen, dass sie nicht durch Kreuzung entstanden sind: Die kommerziell genutzten Sorten gehen auf Kreuzungen zurück, deshalb bekommen alle Sorten, die auf die gleichen Eltern zurückgehen, einen gemeinsamen Namen. Sie können weiter in Sorten-Gruppen eingeteilt werden.

Title: Zitruspflanzen Summary: An den Zitruspflanzen wachsen Orangen, Zitronen, Limetten, Mandarinen, Pampelmusen und Grapefruit. Das sind die Zitrusfrüchte. Die Zitruspflanzen bilden eine Gattung innerhalb des Pflanzenreichs. Die Früchte sind eine besondere Form der Beere. Die Zitruspflanzen kommen ursprünglich aus dem Südosten Asiens. Dort in den Tropen oder Subtropen ist es heiss. Sie wachsen als Bäume oder grosse Sträucher und werden höchstens 25 Meter hoch. Ihre Blätter behalten sie das ganze Jahr über. Die einen Zitruspflanzen blühen nur während einer bestimmten Jahreszeit, andere auch verteilt über das ganze Jahr. Die Blüten sind entweder rein männlich oder männlich und weiblich gemischt. Die Bestäubung übernehmen Insekten. Falls eine Blüte nicht bestäubt wird, gibt es trotzdem eine Frucht. Solche Früchte tragen keine Samen in sich. Deshalb sind sie bei vielen Menschen beliebt. Menschen brachten die Zitruspflanzen von Asien in Richtung Westen. Vor etwa 2300 Jahren gab es sie in Persien, etwas später im Römischen Reich. Noch heute wachsen sie in den warmen Gebieten rund um das Mittelmeer. Von dort kennen sie viele Leute aus dem Urlaub. Es gibt sie aber noch in vielen weiteren Gebieten der Erde, wo es warm genug ist. Meistens wachsen Zitruspflanzen nicht allzu weit weg von der Küste. Die Blätter ihrer Bäume sind meist sehr dick. So sind sie besser vor der Hitze geschützt.

klexikon_de

de

Summarize: By. Victoria Woollaston. For three weeks, Samsung has been fending off claims from Apple that it has ripped off various patents - but it’s now hitting back. During the ongoing, high-profile court battle between the two tech giants, the Korean firm claimed Apple's FaceTime feature infringes one of its own patents. The Galaxy smartphone maker is demanding $6 million (£3.6 million) as a result of the alleged infringement and is mounting its own case for damages to counter Apple’s numerous accusations. Samsung claims Apple's FaceTime, pictured, which lets users make video calls over an web connection, infringes a Samsung patent regarding the compression of video before transmission over a mobile network, awarded in 1994. Apple's lawyers claim the technology described in the patent is now obsolete. The $2 billion court case began on. March 31. Apple is accusing rival Samsung of infringing a number of. software patents on the iPhone. It is the latest battle between the two firms dating back to 2010. Apple began by suing Samsung, but the Korean firm counter-sued just. days later. Apple then secured an injunction to restrict sales of. Samsung’s Galaxy Tab 10.1 in Europe. In. July 2012, another court battle led to Apple publicly stating Samsung. didn’t copy its designs, but in August 2012 Apple was awarded $1 billion. in damages. However, the damages paid by Samsung were dropped from $1 billion (£593. million) to around $800 million (£475 million). In June 2013,. the International Trade Commission ruled iPads infringed on Samsung. patents and the products should be banned in the U.S. This ruling was vetoed two months later when ITC blocked older Samsung phones. A retrial began in November last year and Apple won, but Samsung appealed. The trial between the two technology giants is now into its fourth week, and began with Apple seeking $2 billion (£1.1 billion) from Samsung over claims it infringed a number of Apple-filed patents in its range of products. After three weeks of defence, Samsung claimed Apple's FaceTime app - which lets users make video calls via a web connection - infringes a Samsung patent regarding the compression of video before transmission over a mobile network. The court heard the patent was awarded to Samsung in 1994 and the idea was considered ‘revolutionary’ at the time. Apple's lawyers, however, claim the technology described in the patent is now obsolete. The court case began on. March 31. This latest patent war between the two technology giants surrounds a lawsuit brought by Apple over five separate patent infringements, including the ‘slide to unlock’ feature that is prominent on both Apple and Samsung devices. Both companies have listed 10 or more products from the other that infringes a patent, and it is the latest in a series of lawsuits between the two firms involving the alleged copying of technology in modern smartphones. This latest patent war between the two tech giants surrounds a lawsuit brought by Apple over five separate patent infringements, including the'slide to unlock' feature, pictured, that is prominent on both Apple and Samsung devices. Last month, Samsung used slides taken from an Apple planning meeting to defend some of Apple's claims. They were taken from an Apple meeting in April 2013 that plotted the rise in popularity of larger. screens - such as those in Samsung's Galaxy range - compared to a drop in iPhone growth. In. July 2012, another court battle led to Apple publicly stating Samsung. didn’t copy its designs, but in August 2012 Apple was awarded $1 billion. in damages. Last month, Samsung used slides taken from an Apple planning meeting to defend some of Apple's claims, pictured. They were taken from an Apple meeting in April 2013 and plotted the rise in popularity of larger screens - such as those in Samsung's Galaxy range. However, the damages paid by Samsung were dropped from $1 billion (£593. million) to around $800 million (£475 million). In June 2013,. the International Trade Commission ruled iPads infringed on Samsung. patents and the products should be banned in the U.S. This ruling was vetoed two months later when ITC blocked older Samsung phones. A retrial began in November last year and Apple won, but Samsung appealed

Summary: Claims made as the court battle between the tech giants enters fourth week. Apple is seeking $2 billion (£1.1 billion) over alleged patent infringements. Samsung has spent three weeks defending Apple's claims. It has now hit back claiming Apple infringed a patent awarded in 1994. Patent detailed compressing and sending video over a web connection. The Korean firm claims Apple's FaceTime feature infringes this patent. Apple's lawyers claim the tech described in the patent is now obsolete.

cnn_dailymail

en

Summarize: National security adviser H.R. McMaster and lawmakers of both parties on April 16 reacted after a North Korean missile launch failed. (Bastien Inzaurralde/The Washington Post) President Trump’s national security adviser, H.R. McMaster, said Sunday that the United States is exploring “a range of options” to respond to an increasingly provocative North Korea but that the administration would like “to take action short of armed conflict, so we can avoid the worst.” McMaster’s comments came on a weekend during which North Korea staged a huge parade in Pyongyang to showcase its military prowess and later launched a ballistic missile that exploded within seconds. North Korea's show of force fell flat when a ballistic missile launch failed shortly after liftoff on Sunday, April 16. The missile "blew up almost immediately" off the Korean peninsula's east coast, according to U.S. Pacific Command. (Reuters) Appearing on “This Week” on ABC News, McMaster called the failed test part of “a pattern of provocative and destabilizing and threatening behavior on the part of the North Korean regime.” [N. Korea didn’t test a nuclear weapon, but it did try to launch another missile] “The president has made clear that he will not accept the United States and its allies and partners in the region being under threat from this hostile regime with nuclear weapons,” he said, adding that Trump ultimately “will take action that is in the best interest of the American people.” Both McMaster and other Trump administration officials on Sunday stressed that China could play a stepped-up role in denuclearizing the Korean Peninsula. McMaster said the United States is working with allies in the region, as well as China, to “undertake all actions we can, short of a military option, to try to resolve this peacefully.” [Trump breaks silence on North Korea, defends reversal on China] During an appearance on “Fox News Sunday,” deputy national security adviser K.T. McFarland said Trump and President Xi Jinping had spent hours talking about options involving North Korea during the Chinese leader's recent visit to Trump's Mar-a-Lago estate in Palm Beach, Fla. McFarland urged patience to allow Xi to use trade measures and other tools to pressure North Korea. About 80 percent of North Korea's trade is with neighboring China. “It’s like your kids in the back of the car on a long trip saying, ‘When are we going to get there?' ” McFarland said. “Well, in this case, I think we should give the Chinese president some opportunities and some time, as well as pursuing the economic and diplomatic pressures that we have and that our allies have that we can bring to bear on North Korea.” McFarland, speaking from Palm Beach, said she had briefed Trump on North Korea's actions on Saturday night, including what she characterized as a “fizzle” of a missile launch. “It’s not a surprise,” she said. “Even in the last year, President Kim of North Korea has launched over 30 missiles. Most of them have failed. So it didn’t come as a surprise to us. We were expecting something surrounding the birthday of his grandfather.” Saturday was the anniversary of the 1912 birth of Kim Il Sung, North Korea’s founder and the current leader’s grandfather. Asked by host Chris Wallace about speculation that the United States had somehow sabotaged the missile launch, McFarland declined to comment. H.R. McMaster said "Chinese leadership" would be essential to confronting North Korea, particularly since so much of North Korea's economy is dependent on trade with China. AP Photo McMaster: Missile test part of pattern of 'destabilizing' behavior National security adviser H.R. McMaster said a failed early-morning missile test by North Korea "fits into a pattern of provocative and destabilizing and threatening behavior on the part of the North Korean regime." McMaster, appearing Sunday on ABC's "This Week," said the United States is building an international coalition to pressure the North Koreans. Story Continued Below "And I think there’s an international consensus now, including — including the Chinese and the Chinese leadership — that this is a situation that just can’t continue," McMaster said. "And the president has made clear that he will not accept the United States and its allies and partners in the region being under threat from this hostile regime with nuclear weapons." It's unclear whether the United States played any role in the failure of the missile launch, which "This Week" host Martha Raddatz said was a medium-range ballistic missile. Under President Barack Obama's administration, the United States began launching cyberattacks aimed at North Korea's missile program, leading to a high failure rate, The New York Times reported last month. Appearing on "Fox News Sunday," deputy national security adviser K.T. McFarland said she couldn't reveal whether the United States played any role in potentially sabotaging the missile but said the failure "didn't come as any surprise to us" because North Korean launches often misfire or fail. McMaster also said that "Chinese leadership" would be essential to confronting North Korea, particularly since so much of North Korea's economy is dependent on trade with China. "In the coming weeks, months," McMaster told Raddatz, "I think there’s a great opportunity for all of us — all of us who are really [under] the threat now of this unpredictable regime — to take action short of armed conflict, so we can avoid the worst." Authors:

Summary: Citing Pyongyang's failed missile launch as part of "a pattern of provocative and destabilizing and threatening behavior on the part of the North Korean regime," National Security Adviser HR McMaster said Sunday that the United States is developing a "range of options" to counter Kim Jong Un's posturing. "The president has made clear that he will not accept the United States and its allies and partners in the region being under threat from this hostile regime with nuclear weapons," he told ABC News' This Week, per the Washington Post. McMaster said he's also looking to "Chinese leadership" to help put North Korea in check, reports Politico. "I think there's a great opportunity for all of us-all of us who are really [under] the threat now of this unpredictable regime-to take action short of armed conflict, so we can avoid the worst." Deputy National Security Adviser KT McFarland, appearing on Fox News Sunday, refused to confirm any American meddling in the failure of the missile, but said that it "didn't come as any surprise to us," given that the North's missile launches have a high rate of failure.

multi_news

en

Summarize: A mother left unable to walk or talk after suffering a massive stroke has defied the odds to complete a university degree - by blinking. Dawn Faizey Webster was left with locked-in syndrome after the attack in 2003, two weeks after her son Alexander was born. The condition is where a patient is fully-aware and. awake - but cannot move or communicate verbally due to complete paralysis. of nearly all muscles in the body, except for the eyes. Incredibly, the former teacher, then 30, discovered she could still communicate through her eyes and tiny head movements. Dawn Faizey Webster (pictured left aged 27, in 2000, three years before falling ill) suffered a massive stroke in 2003, two weeks after her son Alexander was born. Ms Faizey Webster, now 42, was left with locked-in syndrome after the stroke. She has now defied the odds to complete a degree, thanks to a specialised laptop that translates her eye movements into text. Ms Faizey Webster (left in 2000 at her teacher training graduation from Wolverhamptom University and right on her wedding day), had been suffering high blood pressure during her pregnancy which preceded the stroke. She has now achieved a 2:2 degree in Ancient History and written an autobiography - all thanks to a specialised laptop that translates her eye movements into text. Living at her parents home in Rugeley, Staffordshire, she began her degree in 2008, determined not to be beaten by the condition. And finishing. the Open University qualification has been no mean feat as her fastest writing pace of 50 words per hour has meant each three hour exam. has taken three weeks. Ms Faizey Webster, now 42, worked three-hours a day on the degree, nudging buttons either side of. her head to move the cursor on the screen and blinking to register the. letters. Six years on, she has completed the course with honours and is now. hoping to tackle a Masters in History of Art. Ms Faizey Webster said: 'When I passed my degree, I was so pleased and proud of myself. 'I had achieved my goal that I had for six years been striving for. 'No matter. what obstacles were in my way, such as getting pneumonia twice and other. lesser illnesses, I was determined to reach my goal. 'When I first had my stroke, I realised I would not be able to do anything physical. 'I then decided to use the thing that had not been affected and that was my brain. After the stroke, she disovered she could still communicate through her eyes and tiny head movements - and embarked on a degree in Ancient History. Six years on, and with each three-hour exam taking three weeks, she has graduated with a 2:2. Ms Faizey Webster's parents and full-time carers, Alec and Shirley, say they are delighted with her achievement. 'I felt I needed to prove to myself and to others that I was still me, Dawn.' She added: '[My computer] is my lifeline. Never did I imagine when I got pregnant with Alexander that my life would turn out like this.' Her problems began when she was rushed to hospital at 26 weeks pregnant in and was diagnosed potentially fatal pre-eclampsia - a pregnancy condition associated with high blood pressure. Over the next six days her health deteriorated, until her tiny baby had to be delivered by emergency caesarean weighing just 1lb 8oz. A week later Ms Faizey Webster returned home - still suffering high blood pressure - but was told she would be fine. But another week on, her high blood pressure triggered a stroke. Recalling the day she suffered the attack, she said: 'When I woke up that morning I immediately knew something was terribly wrong. I felt dizzy and faint. 'I had pins and needles in my right side and when I went to speak, my voice was horribly slurred. 'The last thing I remember properly is my mum, Shirley, saying: "Squeeze my hand if you are able", because by that stage I couldn't speak. Ms Faizey Webster (left, 29, and right, aged 24, at a christening) had been a keen traveller before the stroke. The now 42-year-old at Corfe castle in Dorset with her son Alexander. She is now hoping to tackle a Masters in History of Art. She said. she was vaguely aware of a tracheostomy tube going into her neck to help. her breathe and a tube being put into her nose. 'I. could hear traffic going by [and remember] a nurse washed my hair.' But. was was missing, crucially, was her ability to speak. 'My mind screamed that my brain was fine. But as I couldn't speak, no one could hear me shouting that inside my paralysed body, my brain was still alive,' she said. 'Simon [her now ex-husband], my parents and older brother Mark visited daily. Over. the following week, she drifted in and out of consciousness but was. unable to move or talk. Her condition got so bad her eye muscles even. were paralysed. She listened, motionless, while her family discussed her condition and doctors told her husband to prepare for the worst. Locked-in syndrome is a condition in which a patient is fully-aware and awake but cannot move or communicate verbally due to complete paralysis of nearly all muscles in the body, except for the eyes. Total locked-in syndrome is a version of locked-in syndrome where the eyes are paralysed too. It can be caused by a traumatic brain injury, a brain stem stroke or medication overdose. There is no cure for locked-in syndrome, nor is there a standard course of treatment. A therapy called functional neuromuscular stimulation, which uses electrodes to stimulate muscle reflexes, may help activate some paralysed muscles. Several devices to help communication are available. Other treatment is symptomatic and supportive. 'They would talk to me, talk to one another and to the nurses,' recalls Ms Faizey Webster. 'But all I could do was lie there hopelessly watching them, listening for snippets of news about how Alexander was. 'For long hours, I lay staring up at a blank ceiling, living for visiting hours when at least I could hear my family's chatter. 'Inside I cried, but no tears came out. When people saw me, they had no idea I was as wide awake as ever.' No. matter how hard she tried, Ms Faizey Webster was unable to move her fingers to tell. people she was still alive and was left staring at the ceiling as the. weeks passed. A. breakthrough came when she was finally able to blink, and let her. father Alec, who had been at her bedside the entire time, know she was. still inside her broken body. 'My dad asked me if I could hear him - and told me to blink if I could. [When] I blinked, he jumped up in shock.' She. was soon fitted with the laptop that allowed her to communicate, but. her joy was short lived as just months later her husband Simon walked. out. 'When Simon left me it was a crushing blow; I had always believed we married in sickness and in health,' said Ms Faizey Webster. 'I was sure if it had been the other way round - and this had happened to him - I would always have been there for him. 'He. later wrote a letter to me saying he had cried about what we had lost. together. He had found our cottage somehow haunted and changed without. me. 'He saw us both as victims, alone and confused. But I felt betrayed.' Ms Faizey Webster said: 'When I passed my degree, I was so pleased and proud of myself. I had achieved my goal that I had for six years been striving for' Speaking yesterday about his daughter's progess, Ms Faizey Webster's father, who is her full-time carer along with wife Shirley, 75, said they were 'over the moon' with her progress. The 80-year-old said: 'It's amazing she has managed to do this considering her condition. We are so proud of her. She worked so hard to get there. 'Before her stroke she used to love travelling. Egypt was one of her favourite places to visit because of her love of history. 'She lived a very active life. She used to like walking and going to National Trust properties up and down the country. 'It was heartbreaking to see her go through all of this. But she hasn't given up. She has her bad days, as anyone in her situation would, but she is determined to keep going. 'We have to look after her 24/7. We took her and Alexander to Warwick Castle the other day, there wasn't access for her into the Great Hall so when we came back she contacted the castle to say there should be better access for people in wheelchairs. 'She is very proactive about things like that. 'She is graduating in October up in Manchester, it's going to be such a proud moment for us all.'

Summary: Dawn Faizey Webster was left with locked-in syndrome after stroke in 2003. Realised could still communicate through her eyes and tiny head movements. Embarked on degree in Ancient History and after 6 years, has achieved a 2:2. Top 'writing' speed is 50 words an hour, so each 3 hour exam takes 3 weeks. Mother-of-one, 42, is now. hoping to tackle a Masters in History of Art.

cnn_dailymail

en

Summarize: This time, both sides really are doing it. There was only one person who appeared onstage at both the Republican National Convention and the Democratic National Convention, and he used his platform tonight to not-too-subtly snipe at the agenda we've been hearing defended all week, including a mention of those "waiting to be born, welcomed and protected." That would be New York Cardinal Timothy Dolan, who was hastily added to give a benediction at the DNC after he agreed, to some controversy, to do the same at the RNC. Tonight, he was given pride of place immediately after President Obama. "Grant us the courage to defend life," he said, and added, "Renew in all our people a profound respect for religious liberty, the first, most cherished freedom." But lately, when Dolan has said "religious liberty," he's really been talking about your birth control. This is the same man who was successfully courted by Romney in their mutually rabid opposition to the contraceptive coverage mandates in the Affordable Care Act, and who is suing the Obama administration over the policy -- the same man who has called Obama's stance on gay marriage "saddening." (At the RNC, the statement was more muted: "We ask your benediction upon those yet to be born, and on those who are about to see you at the end of this life.) And here was a very coded kick at the platform support for gay marriage: "Show us anew that happiness is found only in respecting the laws of nature and of nature’s God. Empower us with your grace so that we might resist the temptation to replace the moral law with idols of our own making, or to remake those institutions you have given us for the nurturing of life and community." Before the appearances were symmetrical, several Catholics criticized the Tampa appearance as an unnecessarily partisan move, despite the Archdiocese's insistence that the appearance was not an endorsement. “Cardinal Dolan’s appearance in Tampa will damage the church’s ability to be a moral and legitimate voice for voiceless, as those who view the Catholic Church as being a shill for the GOP have just a bit more evidence to prove their case,” wrote Michael O’Loughlin. We heard a lot about a different sort of Catholicism tonight -- from Caroline Kennedy, who said pointedly, "As a Catholic woman, I take reproductive health seriously, and today, it is under attack," to Jill Biden, who cited pro-choice Joe Biden's "strong Catholic faith." Yesterday, we heard from a nun who has been traveling around the country arguing that the Ryan budget "failed a moral test." In order to defuse the implied Romney endorsement, the DNC and the Obama campaign saw fit to welcome in a man who has shown little interest in compromising with them or working with them at all, and whose faithful adherents are hardly persuadable. It was a rare discordant note in a week of remarkably consistent and coherent declarations of principle. (D Dipasupil/WireImage/Getty Images) Cardinal Timothy Dolan, the archbishop of New York and a leading Catholic-American voice opposing abortion and President Obama's health care reform law, inserted what some saw as an anti-abortion remark into his benediction Thursday night at the Democratic National Convention. "Thus do we praise you for the gift of life. Grant us to defend it. Life, without which no other rights are secure. We ask your benediction on those waiting to be born, that they may be welcomed and protected," Dolan said in prayer delivered immediately following President Obama's address accepting his party's nomination. Dolan offered a similar benediction at the Republican National Convention last week in Tampa, Fla. Following his prayer there, he gave an interview saying he was non-partisan and would be glad to offer a benediction at the DNC this week in Charlotte, N.C. Democrats then extended an invitation. In Tampa, he called life an "inalienable gift" and prayed for God's "benediction upon those yet to be born and on those who are about to see you at the end of this life." The Catholic Church has long opposed Democratic Party platform planks that promote keeping abortion legal. More recently, the church assailed the administration over an Affordable Care Act provision that would require religious institutions to provide employees with contraception.

Summary: In case you didn't stay up late enough to see it, President Obama's speech at the DNC last night was followed by a benediction from Cardinal Timothy Dolan, one of the Catholic Church's most vocal abortion foes. He raised a few eyebrows with this bit of prayer, which some are calling a pro-life statement: "Thus do we praise you for the gift of life. Grant us the courage to defend it," Dolan said. "We ask your benediction on those waiting to be born, that they may be welcomed and protected." Dolan drew criticism when he agreed to speak at the RNC, but insisted he wasn't partisan and that he'd gladly pray at the DNC too, ABC News reports. Organizers welcomed him, even though he'd publicly sparred with Obama over birth control-something Irin Carmon of Salon thinks he was referencing last night when he mentioned "religious freedom." Carmon also detected a "very coded kick" against gay marriage; Dolan said that "happiness is only found in respecting the laws of nature," and asked God to help us resist the temptation to "remake institutions you have given us."

multi_news

en

Summarize: Everything was in place for England to. suffer another embarrassment to begin their new era in the cold and wet. of Aberdeen on Friday but they did all they had to do to take one small. step towards recovery from their winter horrors. It. would have been easy for England to push for an abandonment to avoid. any chance of more suffering when rain delayed a fixture that was always. likely to be weather-affected. Yet. one thing they will not lack under Peter Moores is enthusiasm and they. made sure the 6,000 crowd who had waited all day at least got something. of a game, even batting on during heavy rain when play eventually got. under way at 4pm. Job done: James Tredwell took four wickets as England beat Scotland by 39 runs in Aberdeen. ‘It would have been wrong if the game hadn’t taken place,’ said England captain Alastair Cook. ‘It was as wet as I’ve ever fielded in and it probably wasn’t fit to play but both sides got on with it.’ England wore a strip that was virtually orange in their ill-fated World Twenty20 match against Holland and now, seemingly with a nod to their hosts, they took to the Mannofield outfield in near identical blue to Scotland. The chances of their faces becoming red were increased when rain reduced the match to 23 and then 20 overs after Scotland had won what looked an important toss. Yet England, who will meet Scotland in different circumstances at next year’s World Cup, encouragingly passed this test of their mettle. Glum: Peter Moores and Alastair Cook watch on as rain delays the start of the game in Aberdeen. Fresh start: Captain Cook and Ian Bell come out to open the innings for England. England would not usually entrust the. start of a Twenty20 innings to Cook and Ian Bell and the longer-form. openers had to work hard for their runs in the gloom and in the face of. what Cook hailed as ‘outstanding’ Scottish fielding. Bell was added to. England’s squad for their Twenty20 matches against West Indies in March. and the world tournament without playing a game but here he showed that. class usually prevails across all forms of the game. While Cook had. trouble timing his strokes, Bell raced to 50 off 34 balls with two sixes. and it will be interesting to see whether England include him for the. sole short-form match against World Twenty20 champions Sri Lanka for the. match at the Kia Oval on May 20. Bell’s launchpad would have led to a. bigger England score than their eventual 167 for six had their attempts. to accelerate not been punctured by outstanding catches which accounted. for Cook, Jos Buttler and Joe Root. Contribution: The England captain scored 44 before being dismissed by Rob Taylor. Half-century: Ian Bell scored 50 to help England along to 167 from their 20 overs. Somerset’s Josh Davey, one of. six county players in the Scotland side, was the pick of the home. bowlers with three prime wickets but England, so woeful with the bat in. the winter, will be satisfied with this opening gambit. Once Jimmy. Anderson had struck in the first over England’s latest banana skin was. close to being avoided and Scotland fell 40 short of their revised. target of 173 despite some fine hitting from Michael Leask, who has. given up his job in an Aberdeen bank to concentrate of cricket. Another. couple of overs of Leask, who hit 42 off 16 balls, and things could. have been very different but Anderson took a fine catch in the deep to. give James Tredwell one of his four victims. This does not mean England. are back but at least it’s a start. Leap: Taylor catches Jos Buttler on the boundary to dismiss the England batsman for nine. Strike: Jimmy Anderson struck twice early to dismiss Matty Cross and Calum MacLeod (above) Emerging talent: England's Harry Gurney runs in to bowl at Mannofield Park. Scene: The rain during the early part of the day cleared up, allowing the teams to play a 20-over contest. Low five: Tredwell celebrates with Eoin Morgan after picking up one of his four wickets. Through the gate: Scotland's Preston Mommsen is clean bowled in Aberdeen. Watching on: Spectators in attendance for the one-day international in Aberdeen

Summary: England scored 167-7 in their 20 overs of rain-reduced match. Alastair Cook made 44 as fellow opener Ian Bell scored 50. Scotland closed on 133-9 in chase of Duckworth/Lewis adjusted 173 target. James Tredwell took four wickets for England to restrict Scotland. Peter Moores' second reign as England coach began with a victory.

cnn_dailymail

en

Summarize: President Barack Obama said Wednesday that congressional Republicans are pushing a radical plan to trim Medicare and Medicaid, ramping up the rhetoric as he and Congress approach crucial decisions on spending and the nation's debt. President Barack Obama shakes hands with a member of the audience at a town hall meeting to discuss reducing the national debt, Wednesday, April 20, 2011, at Facebook headquarters in Palo Alto, Calif.... (Associated Press) President Barack Obama addresses the crowd during a town hall meeting at Facebook headquarters in Palo Alto, Calif., Wednesday, April 20, 2011. (AP Photo/Marcio Jose Sanchez) (Associated Press) "I think it's fair to say that their vision is radical," Obama told a town hall gathering at the headquarters of Facebook, the huge social network company. "I don't think it's particularly courageous," he said of the GOP plan to convert Medicare to a voucher program and make big cuts to the federal-state Medicaid program for the poor. "Nothing is easier than solving a problem on the backs of people who are poor, or people who are powerless, or don't have lobbyists, or don't have clout," Obama said. Other Democrats have called the GOP plan radical, but the president generally has used less pungent language. Even as he sharply criticized the Republicans' spending proposals Wednesday, he said he believes the two parties can reach an accord on long-range plans to cut deficits by about $4 trillion over the next decade. Obama made the comments in a friendly environment -- one with 19 million friends, in fact. He told Facebook employees and others watching online the nation must invest vigorously in education, clean energy and research that are vital to future jobs and a strong economy. Making the case for his own deficit-cutting plans, Obama said that one way to trim health care costs could involve doctors sharing medical information on Facebook, the hugely successful social network. Obama's 2008 campaign used Facebook and other social networks to reach voters, volunteers and donors, especially among young adults. Such outlets will play even bigger roles in next year's campaigns. The president shared the stage with Facebook's youthful founder, Mark Zuckerberg, whose company noted that 19 million network users have electronically "liked" Obama's White House Facebook site. Obama, beginning a three-day Western tour pitching his budget plans and raising re-election cash, said trimming $4 trillion from the nation's deficits over the next 12 years sounds like a lot but can be done. He will hold another session Thursday in Reno, Nev., with his message that his approach to cutting deficits is more balanced and less painful than a rival House Republican plan. The president has proposed cutting spending, raising taxes and squeezing federal health care programs. The Republican plan rules out tax cuts and would achieve nearly $6 trillion in savings from spending cuts and overhauling Medicare and Medicaid. It was such a special event for Silicon Valley that even CEO Mark Zuckerberg threw out his traditional dress code -- a hoodie -- and turned to a shirt and tie along with his jeans and tennies. The hour... Facebook tones it down: Zuckerberg wears shirt and tie (!) -- and softball questions to boot (VIDEO) Facebook tones it down: Zuckerberg wears shirt and tie (!) -- and softball questions to boot (VIDEO) It was such a special event for Silicon Valley that even CEO Mark Zuckerberg threw out his traditional dress code -- a hoodie -- and turned to a shirt and tie along with his jeans and tennies. The hour long town hall session at Facebook with President Barack Obama was a combo 2012 presidential campaign event, "official" presidential forum, with a mix of social networking and good old fashioned "Ask the President" moments. And there were some fun moments, as when Lt. Gov. Gavin Newsom jokes with Zuckerberg as our own Shaky Hand Productions was on hand to catch the moment: But for all its tech/youth/cutting edge promise, Facebook's event was pretty run of the mill. Frankly, the President was so long winded that just eight questions got aired -- most of them very friendly, pretty predictable and very, very vanilla. We still don't know who chose them -- Facebook says the White House did not -- but it was striking. The place is the beating heart of the cool social tech revolution, and none of the employees or online folks were eager to get a little outside the box with the chance of a lifetime -- and ask really probing, fresh questions. Still, House Minority Leader Nancy Pelosi told us that the event was a landmark for a number of reasons, including its recognition of the "transparency" and democracy that Facebook has brought to politics the world over. Here's her comments to the Shaky Hand: So give us your reviews of the Obama event -- a groundbreaker or not so much? Or as they say on Facebook: Like? Posted By: Carla Marinucci (Email, Twitter)

Summary: Maybe the most suprising part of President Obama's town hall meeting at Facebook headquarters today was that Mark Zuckerberg ditched his hoodie and put on a suit and tie, writes Carla Marinucci at the San Francisco Chronicle. "For all its tech/youth/cutting edge promise, Facebook's event was pretty run of the mill. Frankly, the president was so long winded that just eight questions got aired-most of them very friendly, pretty predictable and very, very vanilla." Obama used the forum to brand the Republican budget plan "radical," reports AP, but nothing much more noteworthy emerged. Still, the meeting "highlighted the increasing interdependence between the president and Silicon Valley," observes Cecelia Kang at the Washington Post. Obama needs Facebook and Silicon Valley to generate high-tech jobs, and Zuckerberg in turn would like to be in the good graces of the White House as his company undergoes ever-more scrutiny and tries to expland globally.

multi_news

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Businesses Supporting Education Act of 2006''. SEC. 2. TAX CREDIT FOR CONTRIBUTIONS TO EDUCATION SCHOLARSHIP ORGANIZATIONS. (a) In General.--Subpart D of part IV of subchapter A of chapter 1 of the Internal Revenue Code of 1986 (relating to business related credits) is amended by adding at the end the following new section: ``SEC. 45N. CONTRIBUTIONS TO EDUCATION SCHOLARSHIP ORGANIZATIONS. ``(a) General Rule.--For purposes of section 38, in the case of a corporation, partnership, or trade or business carried on as a sole proprietorship, the education scholarship credit determined under this section for the taxable year is the aggregate amount of qualified contributions for the taxable year. ``(b) Limitation.-- ``(1) Dollar limitation.--The amount of the credit determined under this section for any taxable year shall not exceed $100,000. ``(2) Application to partnerships and s corporations.--In the case of a partnership, the limitations of paragraph (1) shall apply with respect to the partnership and with respect to each partner. A similar rule shall apply in the case of an S corporation and its shareholders. ``(c) Qualified Contributions.--For purposes of this section-- ``(1) In general.--The term `qualified contribution' means a charitable contribution (as defined by section 170(c)) to an education scholarship organization. ``(2) Education scholarship organization.--The term `education scholarship organization' means any organization which is described in section 170(c)(2) and exempt from tax under section 501(a) and whose exclusive purpose is to provide scholarships for the qualified elementary and secondary education expenses of eligible students. ``(3) Eligible student.--The term `eligible student' means an individual-- ``(A) who is enrolled in an elementary or secondary school (within the meaning of section 530(b)(4)(B)), ``(B) who is a member of a household with a total annual household income which does not exceed 250 percent of the Federal poverty guidelines (as determined by the Secretary of Health and Human Services), and ``(C) with respect to whom the taxpayer is entitled to a deduction for the taxable year under section 151. ``(4) Qualified elementary and secondary education expenses.--The term `qualified elementary and secondary education expenses' has the meaning given such term by section 530(b)(4), except that `child' shall be substituted for `beneficiary' and `a child' shall be substituted for `the designated beneficiary of the trust' in clauses (i) and (iii) of subparagraph (A) thereof. ``(5) Scholarship.--The term `scholarship' does not include any payment to fulfill or fund any obligation or project of any school or school system to provide a free, appropriate public education. ``(d) Denial of Double Benefit.--No deduction shall be allowed under any provision of this chapter for any expense for which a credit is allowed under this section. ``(e) Election.--This section shall apply to a taxpayer for a taxable year only if such taxpayer elects to have this section apply for such taxable year.''. (b) Excise Tax on Failure of Education Scholarship Organizations to Make Distributions.-- (1) In general.--Chapter 42 of such Code (relating to private foundations and certain other tax-exempt organizations) is amended by adding at the end the following new subchapter: ``Subchapter F--Education Scholarship Organizations ``Sec. 4966. Tax on failure to distribute receipts. ``SEC. 4966. TAX ON FAILURE TO DISTRIBUTE RECEIPTS. ``(a) Tax Imposed.--There is hereby imposed a tax on the failure of an education scholarship organization to make required distributions before the distribution deadline. ``(b) Amount of Tax.--The tax imposed by subsection (a) shall be equal to 15 percent of the excess (if any) of-- ``(1) the required distribution amount with respect to a taxable year, over ``(2) the amount of receipts of the education scholarship organization for such taxable year which are distributed before the distribution deadline with respect to such receipts. ``(c) Definitions.--For purposes of this section-- ``(1) Required distribution amount.--The required distribution amount with respect to a taxable year is the amount equal to 90 percent of the total receipts of the education scholarship organization for such taxable year. ``(2) Distributions.--Distributions include amounts which are formally committed but not distributed. ``(3) Distribution deadline.--The distribution deadline with respect to receipts for a taxable year is the first day of the second taxable year following the taxable year in which such receipts are received by the education scholarship organization. ``(d) Reasonable Cause Exception.--The tax imposed by subsection (a) shall not apply with respect to any failure to make required distributions before the distribution deadline which is not willful and is due to reasonable cause.''. (2) Abatement of tax.-- (A) General rule.--Subsection (b) of section 4962 of such Code (defining qualified first tier tax) is amended by striking ``or D'' and inserting ``D, or F''. (B) First tier tax.--Subsection (a) of section 4963 of such Code (defining first tier tax) is amended by inserting ``4966,'' after ``4958,''. (C) Taxable event.--Subsection (c) of section 4963 of such Code (defining taxable event) is amended by inserting ``4966,'' after ``4958,''. (3) Correction period.--Subparagraph (A) of section 4963(e)(2) of such Code (relating to special rules for when taxable event occurs) is amended by inserting ``or 4966'' after ``4942''. (4) Conforming amendment.--The table of subchapters for chapter 42 of such Code is amended by adding at the end the following new item: ``subchapter f. education scholarship organizations''. (c) Credit to Be Part of General Business Credit.--Subsection (b) of section 38 of such Code (relating to general business credit) is amended by striking ``plus'' at the end of paragraph (29), by striking the period at the end of paragraph (30) and inserting ``, plus'', and by adding at the end the following new paragraph: ``(31) the education scholarship credit section 45N(a).''. (d) Clerical Amendment.--The table of sections for subpart D of part IV of subchapter A of chapter 1 of such Code is amended by inserting after the item relating to section 45M the following new item: ``Sec. 45M. Contributions to education scholarship organizations.''. (e) Effective Date.--The amendments made by this section shall apply to taxable years beginning after December 31, 2005.

Title: To amend the Internal Revenue Code of 1986 to allow a business tax credit for contributions to education scholarship organizations Summary: Businesses Supporting Education Act of 2006 - Amends the Internal Revenue Code to allow business entities a tax credit for contributions to a tax-exempt education scholarship organization which provides scholarships to elementary or secondary school students from low or moderate income families. Limits the annual amount of such credit to $100,000. Imposes a penalty tax on education scholarship organizations that fail to make required distributions of scholarship funds.

billsum

en

Summarize: Thousands of reddish-orange tuna crabs are washing ashore on San Diego beaches, a rare event that might be linked to a mysterious warm water "blob" off the West Coast and Mexico. Small patches of the tiny crustaceans have appeared from Point Loma to Newport Beach to Santa Catalina Island since early this year. But the crabs only began stranding in San Diego over the past two weeks. The delicate creatures -- which float freely in the water -- were particularly noticeable on Thursday from Sunset Cliffs to Ocean Beach to Scripps Pier. It's possible that the crabs drifted here from Baja California, where they are commonly found. "We usually see these crabs in large numbers when there is an intrusion of warm water," said Linsey Sala, a museum scientist who manages the pelagic invertebrates collection at UC San Diego's Scripps Institution of Oceanography. Scientists are investigating the nature and cause of the massive pool of warm water that developed last year in the Pacific, from Mexico to Canada. The pool helped push sea surface temperatures in San Diego to unusually high levels for part of the winter and spring. Several different species of gulls were gorging themselves on the large stranding of red tuna crabs that s taking place along the coastline, including Ocean Beach where large numbers of the free swimming crustaceans are coming ashore. — John Gibbins Share Photo   Reddit ✉ Several different species of gulls were gorging themselves on the large stranding of red tuna crabs that s taking place along the coastline, including Ocean Beach where large numbers of the free swimming crustaceans are coming ashore. — John Gibbins Researchers aren't sure whether the pool is associated with the El Niño that appears to be developing in the eastern equatorial Pacific. "The crabs are a warm water indicator, but we don't know whether they are exclusively in the area from the blob, El Niño, or other favorable oceanographic conditions," Sala said. The crustaceans also washed ashore in San Diego in 2002, a year in which Southern California was affected by El Niño. Photographer Jim Grant noticed the crabs at Sunset Cliffs and Ocean Beach on Thursday and was awestruck. "It was like a sea of red on the sand," said Grant. "I thought, 'What the heck, that's not seaweed.' It was awesome." Scripps discourages from eating these crustaceans. Tuna crabs feed on phytoplankton, which sometimes contains toxins. Donna Kalez was out for a leisurely stroll Sunday morning on the Dana Point headlands when she turned a corner and saw the beach below covered in bright red. Thousands of mini crabs – which look like tiny lobsters or crawfish – created a rim of red along the shoreline, scattered and scrambling along the sand at Strands Beach, Salt Creek, San Clemente, south Laguna, Newport Beach and Huntington Beach. “They are all still alive. They are in the surfline and swimming up,” Kalez said. “Once they get this close to shore, they can’t go anywhere, so they just wash in. They aren’t strong enough to swim out.” The tiny crustaceans have been making news in recent weeks after washing up in masses on San Diego County beaches. They’ve been spotted sporadically in Orange County in recent days as far north as Newport Beach and Huntington Beach, but Sunday they washed up here in the thousands. The Pleuroncodes planipes, also known as pelagic red crabs or tuna crabs, showed up in early January and again in February on Balboa Island, fascinating marine scientists and beachgoers, some who tried to save the still-live critters by throwing them back to the sea, though most were dead. Experts said the crabs – which are about 1 to 3 inches long, too small to make for good eating – haven’t been seen in the area for decades. It’s the warm water that has brought them here; they normally live in Baja California. The pelagic crabs are the latest in a year of odd sightings along the coast, with experts crediting warm water that has lingered off Southern California for the past year. In recent weeks, blue, jellyfish-like creatures known as “by-the-wind sailors” have been spotted, and tropical fish like yellowtail and bluefin tuna are showing up earlier than normal this year. The warm patch – extending from the Bering Sea to the waters off Southern California and showing up as a red splotch on temperature-reading water maps – has been named “The Blob” by scientists. O.C. Lifeguards Chief Jason Young said his staff is asking beachgoers to not touch or take them from the marine protected areas of Dana Point and Laguna Beach, and is educating curious people about what the critters are all about. Though a big surf contest was happening at Salt Creek through the weekend, there were no complaints of people getting pinched by the critters, he said. “They have pinchers, but they mostly swim backward,” he said. “They sort of bump you along the way.” Young said he remembers last seeing the crabs around the same time as the last big El Niño in 1997. He said lifeguards in north Orange County said they were seeing some on the sand, but not in the masses as seen in south Laguna. “There’s enough that it looks like a big red blanket along the water line at Thousand Steps Beach and Three Arch Bay,” he said. Rocky Neidhardt, chef at The Shack on San Clemente Pier, said it looked like “millions” of the crabs were in the water, with more along the beaches. “They move like squid in the water and like crabs on shore,” Neidhardt said. Kalez, general manager of Dana Wharf Sportfishing, said her boat captains had been seeing the critters in the ocean for weeks and knew it was only a matter of time before they washed up onshore. “I think it’s kind of cool,” she said. “It’s a phenomenon you won’t see for a long time. It’s sad they’re going to die, but there’s nothing you can do.” For beachgoers, it was an odd sight to see. “Everyone is taking selfies with the red crab,” Kalez said. Contact the writer: [email protected]

Summary: Tiny tuna crabs have been washing up by the thousands on beaches in California's Orange County. The Orange County Register reports that the crustaceans, which look like tiny lobsters or crawfish, created a bright-red rim along the shoreline of Dana Point, San Clemente, Newport Beach, and Huntington Beach yesterday. Experts say the 1- to 3-inch-long crustaceans, which normally live off Mexico's Baja Peninsula, are going farther north because of the warm water that has lingered off Southern California for the past year. In recent weeks, blue jellyfish-like creatures known as "by-the-wind sailors" have also been spotted, and tropical fish such as yellowtail and bluefin tuna are showing up earlier than normal this year. Tuna crabs get their name from the fact that they're a favorite meal for tuna and other large fish. Sea birds, sea otters, and whales also dine on the creatures, but experts at Scripps Institution of Oceanography say people should avoid eating them because the phytoplankton they consume can contain toxins, the San Diego Union-Tribune reports.

multi_news

en

Summarize: Federal Communication Commission Chairman Julius Genachowski pauses as he speaks at the Cable Show in Chicago, June 15, 2011. WASHINGTON Julius Genachowski said on Friday he will step down as chairman of the Federal Communications Commission in the coming weeks after four years on the job, and touted his record of working to expand broadband Internet service to Americans. Genachowski, whose term was due to end in June, told FCC staffers he would be leaving his post "in the coming weeks" but did not give a date. He told Reuters after his announcement that he has no career plans lined up for after his FCC tenure ends. "I'm still focused on the work of the agency," Genachowski said, adding that he expects the FCC, which maintains a Democratic majority, to keep its policy direction after he leaves. Asked to describe his tenure at the FCC in three words, Genachowski answered "unleashing broadband's benefits." His exit from the agency that oversees telecommunications and broadcast policies was widely expected after President Barack Obama's re-election. Obama will nominate a successor to Genachowski, who has headed the FCC since 2009. In a statement, Obama praised Genachowski, the president's classmate at Harvard Law School, for giving the FCC a "clear focus" on encouraging innovation and competitiveness, attracting "jobs of tomorrow" and improving high-speed Internet access and mobile devices sector growth. "I am grateful for his service and friendship, and I wish Julius the best of luck," Obama said. The FCC is also losing its senior Republican commissioner. Robert McDowell said on Wednesday he will depart his post in a few weeks, leaving the five-member panel with two Democrats, one Republican and two vacancies. Among the possible candidates to head the FCC is Tom Wheeler, a venture capitalist and an Obama ally and fundraiser. Wheeler headed the National Cable Television Association and the wireless industry group CTIA. Two other possible contenders are: Lawrence Strickling, head of the National Telecommunications and Information Administration, which advises the president on telecommunications and information policy; and Karen Kornbluh, the U.S. ambassador to the Organization for Economic Cooperation and Development, an international economic body. The next FCC chief faces a list of projects to complete. One major one is Genachowski's plan for a complex incentive auction of spectrum that is meant to free up airwaves for better wireless Internet access. The auction relies on TV stations to give up some of their airwaves to be auctioned off to wireless companies or opened up for shared use. The broadcasters would get a portion of the proceeds and the rest would pay for a public-safety program and go to the U.S. Treasury. Also on the list is the delayed loosening of rules on media ownership. Asked whether he would like to see a vote on those rules before he leaves the FCC, Genachowski said only that the commission will "continue to work on the agenda." Later this year, a federal court will also hold hearings in a case against Genachowski's net neutrality rules for Internet service providers that could have broad implications for the breadth of the FCC's regulatory power. 'AN UNEASY DANCE' In his FCC tenure, Genachowski oversaw an overhaul of the multibillion-dollar Universal Service Fund from a project to spread telephone service in rural America to one focused on broadband access. He also spearheaded the creation of a strategy known as the National Broadband Plan and later pushed Internet providers to step up the speediness of their services. The FCC's priorities under Genachowski reduced the influence of U.S. broadcasters, the relationship with whom has been "an uneasy dance," according to Medley Global Advisors telecommunications policy analyst Jeffrey Silva. Also left disappointed were liberal-leaning organizations including consumer interest groups. Harold Feld of advocacy group Public Knowledge said Genachowski is leaving more tasks for his successor to finish than most of his predecessors. "It's true to some degree of every chairman, but this chairman in particular came in with a lot of expectations," Feld said. "And then, as people say, he wrote a lot of checks that he's now leaving for the next chair to figure out how to cash." Genachowski, who charted a centrist course in his chairmanship, defended his tenure, which also included the FCC's rejection of a landmark 2011 merger bid between U.S. No. 2 wireless carrier AT&T; Inc and fourth-largest provider T-Mobile USA, a unit of Deutsche Telekom. The bid was dropped after the Justice Department sued to block the deal. In pushing against the merger, Genachowski stood up against the prospect of a duopoly in the wireless market by AT&T; and the largest carrier, Verizon, analysts say, as it retained T-Mobile as a competitor and protected the third-biggest player Sprint from being overwhelmed. "This sector has always been and will always be characterized by a robust debate," Genachowski said. "Some people say the commission has gone too far, some people say the commission hasn't gone far enough. What we've been focused on are the right actions to drive the economy and to improve the lives of the American people." Genachowski came to the FCC after advising Obama on telecommunications policy and working at several tech investment firms. He had previously served as chief counsel for former FCC Chairman Reed Hundt. (Editing by Will Dunham) The Internet and social media in Kenya, which played a central role in this year's elections by allowing Kenyans to question candidates, took on a new function Tuesday—spreading messages of peace to avert new bloodshed. Subscriber Content Read Preview Beijing, U.S. Unveil New Korean Sanctions The U.S. and China introduced a new round of sanctions against North Korea at the United Nations that the U.S. said would significantly impede the development of Pyongyang's nuclear and missile programs, in response to its test last month of an atomic bomb.

Summary: The head of the FCC will announce his exit today after four years on the job, insiders tell Reuters. The expected move comes ahead of his term's end in June. President Obama appointed ex-venture capitalist Julius Genachowski in 2009; his term saw the commission halt a proposed T-Mobile-AT&T merger, the Wall Street Journal notes. This week, the FCC's top Republican commissioner, Robert McDowell, also announced his departure. Obama will nominate a new Democratic chairman and Republican commissioner in the coming days, according to FCC rules, Reuters notes.

multi_news

en

Write a title and summarize: Striking individual differences in severity of group A streptococcal (GAS) sepsis have been noted, even among patients infected with the same bacterial strain. We had provided evidence that HLA class II allelic variation contributes significantly to differences in systemic disease severity by modulating host responses to streptococcal superantigens. Inasmuch as the bacteria produce additional virulence factors that participate in the pathogenesis of this complex disease, we sought to identify additional gene networks modulating GAS sepsis. Accordingly, we applied a systems genetics approach using a panel of advanced recombinant inbred mice. By analyzing disease phenotypes in the context of mice genotypes we identified a highly significant quantitative trait locus (QTL) on Chromosome 2 between 22 and 34 Mb that strongly predicts disease severity, accounting for 25%–30% of variance. This QTL harbors several polymorphic genes known to regulate immune responses to bacterial infections. We evaluated candidate genes within this QTL using multiple parameters that included linkage, gene ontology, variation in gene expression, cocitation networks, and biological relevance, and identified interleukin1 alpha and prostaglandin E synthases pathways as key networks involved in modulating GAS sepsis severity. The association of GAS sepsis with multiple pathways underscores the complexity of traits modulating GAS sepsis and provides a powerful approach for analyzing interactive traits affecting outcomes of other infectious diseases. Infectious diseases, like most human diseases, are modulated by complex traits. Susceptibility and clinical outcomes of infections are often a manifestation of interactions between the host' s complex traits and the pathogen' s virulence components. Identification of genes and molecular networks that influence host responses to infectious agents can provide a disease road map that would focus the discovery of effective diagnostics and therapeutics. Group A streptococci (GAS) are classified on the basis of surface M protein antigens into more than 100 serotypes, but recent studies showed a high degree of diversification within a serotype that is driven primarily by horizontal gene transfer [1]–[3]. It is widely believed that such events are responsible for the emergence of highly virulent strains in the 1980' s, including a hypervirulent M1T1 clonal strain, coinciding with the resurgence of severe invasive GAS infections associated with streptococcal toxic shock syndrome (STSS) and necrotizing fasciitis (NF), also known as the “flesh eating” disease [4]. We showed that this hypervirulent M1T1 clinical strain can cause sore throat or mild bacteremia and erysipelas in some patients, while in others it can cause STSS and NF [5]. These findings suggested a strong role for host factors in modulating the outcome of infection by this highly virulent strain. Indeed, we found that allelic variations in host HLA class II haplotypes are associated with markedly different outcomes of GAS sepsis in humans [6], [7]. We confirmed these associations using HLA transgenic mice that were expressing different HLA class II alleles [8]. Inasmuch as STSS pathogenesis is largely mediated by streptococcal superantigens (Strep SAgs), and because HLA class II molecules serve as SAg receptors, such an association was expected. However, GAS is rich in many other virulence factors, and we believe that some of those virulence factors, beside SAgs, may also interact with additional host factors to modulate host responses to GAS infections. To identify additional host factors involved in GAS severity we needed an approach that allowed us to uncover the effect of interactions between complex, polymorphic genetic traits that may modulate sepsis outcomes. Previous animal models for GAS sepsis included various regular conventional inbred mouse strains [9], [10], congenic strains [11], and HLA transgenic mice [8], [12]. These models confirmed that host genetic variability can have a strong effect on infection outcome. Despite their significant utility, these mouse models do not offer the genetic diversity that is characteristic of the human population. In this study, we used a panel of advanced recombinant inbred (ARI) mice as a genetically diverse, segregating reference population that affords a powerful tool for systems genetics approaches. Recombinant inbred (RI) strains have been successfully used to map quantitative trait loci (QTLs) associated with various phenotypes and diseases [13]–[20]. We used the BXD panel of ARI mice derived from C57BL/6J (B6) and DBA/2J (D2) strains and consisting of homozygous, inbred BXD lines, each of which is genetically distinct. Using this genetically diverse BXD panel, we mapped QTLs modulating GAS sepsis severity, and identified candidate genes within these QTLs that were parsed into pathways likely to modulate the severity of this complex infectious disease. Our initial studies [20] demonstrated that there is considerable variability among BXD strains with respect to susceptibility to severe GAS sepsis. To quantify differences among strains in this study, we used three main quantitative traits, namely animal survival, bacteremia, and bacterial dissemination to spleen. We infected mice (n = 5–26 mice per strain), belonging to 32 strains (30 different BXD strains and their parental strains, B6 and D2), intravenously (i. v.) with the same bacterial dose (2±1. 5×107 CFU/mouse). Survival was expressed as normalized corrected relative survival indices (cRSI) calculated for each of the 32 strains as detailed in materials and methods. We observed significant difference in relative susceptibility to GAS sepsis across the BXD panel (P≤0. 0001), Figure 1A. This wide range of susceptibility across the various strains, together with the finding that some of the strains showed phenotypes considerably more exaggerated than the parental strains (B6 and D2), is an illustration of how different combination of polymorphic genes can manifest quite differently according to the overall genetic context. Similarly, we determined bacterial load in blood (log CFU/ml blood), 24 h post-infection and found considerable variation across the strains. In general there was an inverse correlation between mice survival and extent of bacteremia (r = −0. 471, P≤0. 0001, R2 = 22. 2%), Figure 1B. Bacterial dissemination to spleen also varied across the strains, showing a stronger inverse correlation with mice survival (r = −0. 717, P≤0. 0001, R2 = 51. 4%), Figure 1C. Although these inverse correlations between mice survival and bacterial load in blood and spleen made biological sense because it is anticipated that susceptible strains would have higher bacterial load than in resistant strains, there were several exceptions. For example, although strains BXD44, and BXD45 are ranked susceptible based on their survival, they showed low bacterial load in blood and spleen. Similarly, BXD43 and BXD85 strains, which are ranked resistant, had a high bacterial load in their spleen. Another interesting observation was that, in general, susceptible strains survival was better correlated with bacterial load in blood and spleen than resistant strains. Together, these findings confirm that there is more than one mechanism modulating differential susceptibility or resistance to severe GAS sepsis [20]. We used bioinformatics tools available through Gene Network (GN) to link measured phenotypes to strains genotypes. Each of the quantified phenotypes was analyzed in the context of the studied mice genotypes and single nucleotide polymorphism (SNPs) using 3795 SNPs and microsatellite markers for BXD strains. Significant QTLs modulating survival, bacteremia 24 h post-infection, and bacterial dissemination to spleen mapped to mouse Chromosome (Chr) 2. The strongest QTL modulating mouse survival (cRSI) mapped to mouse Chr 2 between 22–34 Mb, with an likelihood ratio statistic (LRS) of 34. 2 (P≤0. 0000001), Figure 2A. A second less significant QTL was also mapped on the same chromosome between 125–150 Mb with an LRS of 12 (P≤0. 001), and a third QTL on Chr X, Figure 2A. The QTLs for bacteremia and bacterial dissemination to spleen overlapped with those for survival, with slight difference in significance. The first QTL modulating bacteremia mapped to Chr 2 between 22–34 Mb with an LRS of 24. 5 (P≤0. 00001), Figure 2B. The second QTL mapped to the same chromosome between 125–150 Mb with an LRS of 17 (P≤0. 0001), Figure 2B. A QTL modulating bacterial dissemination to spleen also mapped to Chr 2 between 125–150 Mb with LRS of 15 (P≤0. 001), Figure 2C. To further investigate and narrow down the mapped region on Chr 2, we resorted to haplotype maps of BXD strains to select additional strains that may be informative in validating, and further confirming mapped QTLs. Our mapped QTLs directed us to select more strains for survival experiments based on differences in their haplotypes within the QTLs. For example, we selected BXD100 with a D haplotype at Chr 2 between 22–34 Mb region, Figure 3A, and found it to be susceptible. Similarly, we tested BXD87 with a B haplotype in the same region and this strain as predicted, exhibited a resistant phenotype. To further narrow down the mapped QTLs, we chose strains with breakage in the mapped interval, i. e. with recombination at Chr 2 region 22–34 Mb for further survival testing (Figure 3A). BXD34 with a B haplotype at Chr 2 between 24–33. 15 Mb region, was resistant, while BXD60 with a B haplotype at Chr 2 between 20–23. 27 Mb region, was susceptible, Figure 1A and 3A. This narrowed down the relevant susceptibility region to Chr 2 between 23. 27–33. 15 Mb. Using more strains with recombination at this narrowed region, we found BXD51,64, and 79 to be quite interesting as they showed intermediate resistance suggesting that genes at this region are candidate modulators of the mapped QTL, Figure 3B. Another interesting strain was BXD94 that we found susceptible to infection, yet has a heterozygous genotyping, suggesting that D allele exhibited dominance, Figure 3B. Similarly, we inspected haplotypes of studied BXD strains at the second QTL between 125–150Mb (Figure 3C), the majority of susceptible strains had D alleles, while resistant strains had B alleles with some exceptions, for example BXD77 is a susceptible strain, yet had B alleles. It was interesting to find that the susceptible strain BXD44 had B alleles at this QTL (Figure 3C), suggesting that observed lower bacterial load in blood compared to other susceptible strains (Figure 1B) might be modulated by B allele in the second QTL. Meanwhile, BXD48, a resistant strain, has a breakage at 135. 9 Mb (Figure 3C) with D alleles suggesting that its relatively higher bacterial load in blood (Figure 1B) might be modulated by the second QTL. Collectively, these findings suggest that both loci modulate different observed phenotypes of GAS sepsis severity. Based on our in silico strain selection and QTL validation by experimental assessment, we evaluated candidate genes within the mapped QTLs, taking into account linkage, gene ontology analyses, cocitation networks, and biological relevance. To categorize genes and transcripts in the mapped QTLs into functional pathways, we performed functional analyses using Ingenuity Pathways Analysis (IPA) (www. ingenuity. com). We parsed our genes into 50 functional networks; the most relevant networks involved those associated with immune response, cell signaling, cellular assembly and organization, and lipid metabolism. From these interrelated pathways, we selected 37 representative genes to study their role in GAS susceptibility QTL by quantitative analysis of their expression levels in selected resistant and susceptible strains (groups) pre- and post-infection (Table S1). We found that 28 out of a representative 37 genes were differentially expressed post-infection (Table S2), of those 14 genes were down regulated in resistant group while up regulated in susceptible group post-infection. Nine genes were down regulated in both groups post-infection, and five were up regulated in both groups post-infection (Table S2). Fourteen of the 28 differentially expressed genes showed significant change post-infection in both resistant and susceptible strains (Table 1 and Figure 4). In general, susceptible strains showed increase in the relative expression levels post-infection (19 genes) of both pro and anti-inflammatory genes, e. g. interleukin1 alpha (Il1 α), and Il1 receptor antagonist (Il1rn) respectively. By contrast, in the resistant BXD strains, most of the tested genes showed a decrease (23 genes) in expression levels post-infection with few exceptions (five genes) e. g. TNF receptor associated factor 1 (Traf1) (Figure 4 and Table S2). Differentially expressed genes were associated with both innate and early adaptive immune response. Among those associated with early immune response, Il1a, Il1rn, prostaglandin E synthase (Ptges), and Ptges2 were up regulated in susceptible strains, whereas their levels decreased in resistant strains. Several of the differentially expressed genes show polymorphisms as SNPs between the parental strains B6 and D2, suggesting that these polymorphic genes modulate differential response to infection (Table S3). The differential expression of IL-1α was confirmed at the protein level (data not shown). We parsed the differentially expressed genes into pathways, using IPA, IL-1 and prostaglandins were key early response molecules modulating susceptibility to severe GAS sepsis in two the mapped networks, which are shown merged in Figure 5. The first network (P<10−27) comprised of genes related to lipid metabolism and innate immunity, e. g. Il1a, Il1rn, Ptges, while second network (P<0. 01) contained genes modulating nucleic acid metabolism, energy production and host responses to injury e. g. Ectonucleoside triphosphate diphosphohydrolase 2 (Entpd2) (Figure 5). It has been established that networks of multiple pathways, rather than a single gene, modulate traits and affect susceptibility and outcomes of virtually all diseases. The ARI strains used in this study afford one of the best unbiased forward genetics approaches to determine how different combinations of polymorphic genes interact to shape disease phenotypes. Using this panel of genetically diverse reference population, we were able to map QTLs modulating specific phenotypes associated with severe GAS sepsis. GAS causes a wide range of diseases depending on multiple factors including site and route of infection, interplay of the pathogen virulence factors with host immune defenses that are affected by the host immune status and difference in the genetic make up of the host [6]. Thus, these bacteria represent a good model to explore the impact of host complex traits on susceptibility to infections. Previous studies have shown that host-pathogen interactions modulate the severity of GAS sepsis [5], [6], [9], [10], and we found that patients with GAS sepsis expressing HLA class II DRB1*15/DQB1*06 (DR15/DQ6) haplotype are protected from severe GAS sepsis, whereas those with HLA class II DRB1*14/DQB1*05 (DR14/DQ5) haplotype are at high risk for developing severe and often fatal forms of the disease [6]. The strong association between disease severity and HLA class II allelic polymorphism is primarily related to the differential ability of HLA class II alleles to present SAgs to T cells, where presentation of Strep SAgs by the protective HLA class II alleles results in a significantly attenuated response as compared to their presentation by the neutral or high-risk alleles [6], [8], [21]. While this association made perfect biological sense based on the known central role of SAgs in the human disease, mice are not susceptible to SAgs due to an inherent lower affinity of mouse MHC class II molecules to GAS SAgs. The role of GAS SAgs can be well investigated in HLA class II transgenic mice as others and we have reported [8], [12], [22], [23]. However, due to the overwhelming response to SAgs in these mice, it is difficult to use them to dissect host response to other GAS virulence factors in the disease process. For this reason, our present ARI mouse model of sepsis is ideal for identifying host genetic variations, besides the MHC class II antigens, that may also contribute to differences in GAS sepsis severity. We invested time and effort to standardize the GAS infection model using a large number of BXD mice (n = 717) and this allowed us to optimize infection dose and identify significant covariates (e. g. age and sex) needed to be accounted for in our final analysis [20]. Although GAS strains can vary considerably with regards to virulence, we showed that the same virulent strain could cause diseases with starkly different severity in humans [5], [6]. The strain used in this study is a hypervirulent derivative of the M1T1 clonal strain that emerged in the 1980' s at the same time that the severe forms of the invasive GAS infections resurged [3], [24]–[26]. Initial studies [20] identified an optimal infection dose of 2±1×107 CFU/mouse, and indicated the need to use mice with an age range of 40–120 days for linear correlation with survival. In addition, these pilot studies determined that sex has insignificant effect in this GAS sepsis model [20] and revealed a stark variation among various BXD strains used with respect to their susceptibility to severe sepsis. However, precise mapping of QTLs required that we study more BXD strains and include more mice per BXD strain to obtain statistical power. With a total of 30 BXD strains and an average of 15 mice per strain, we mapped QTLs on Chr 2 that modulate severity to GAS sepsis, measured by comparing mice survival post-infection, bacterial load in blood, and bacterial dissemination to spleen across the BXD strains. Inasmuch as the BXD strains are heavily genotyped with more than 3600 genomic markers, identifying QTLs is relatively straightforward. The mapped QTLs on Chr 2 harbor a relatively large number of candidate genes associated with various functional networks and signaling pathways including nuclear factor-κB (NF-κB) and p38 mitogen activated protein kinases (MAPK) pathways, proliferation of immune cells, and eicosanoid signaling. Such output is typical of unbiased genome-wide analysis studies, and required further analyses to determine which of these genes are the key modulators of the studied trait. To narrow down the gene list to a handful of genes that can be experimentally validated, we used multiple methods including linkage, gene ontology, and differential gene expression analyses. Our quantitative PCR analysis of 37 representative candidate genes showed that 28 genes were differentially expressed in selected susceptible and resistant strains post-infection. These differentially expressed genes fell into three main categories, genes associated with innate and adaptive immune response, and genes associated with apoptosis. Differentially expressed genes associated with innate immune response were both pro- and anti-inflammatory as well as adaptive immune response genes associated with T and B cell proliferation and differentiation, cell signaling and antigen processing and presentation. Differentially expressed genes associated with innate immune response were either related to pro- or anti-inflammatory responses. Both pro- and anti-inflammatory associated genes were up-regulated in the selected susceptible strains post-infection, and this is in agreement with a recent study by Goldmann, et al. [27] who showed a mixed pro- and anti-inflammatory response belonging to M1 and M2 macrophage phenotypes in response to GAS infection. This increase in both pro- and anti-inflammatory response could be attributed to homeostatic mechanisms where, for example, the increase in Il1 levels in the susceptible strains was accompanied by an increase in its endogenous antagonist Il1rn. This was not the case in the resistant strains that showed decreased levels of expression of pro- and anti-inflammatory related genes both pre- and post-infection. These findings suggest that susceptibly to GAS sepsis is associated with an overzealous innate immune response as observed in susceptible BXD strains only. These results mirror previous findings in humans, where association of exaggerated inflammatory responses, including IL-1, with susceptibility to GAS sepsis was detected [6], [28], [29]. However, unlike what we found in this mouse model, human responses are dominated by high levels of IFN-γ and TNF-ß, presumably because the human disease is driven primarily by SAgs [29], [30]. In general, differentially expressed genes associated with early adaptive immune responses showed a pattern of decrease in expression levels in both susceptible and resistant strains with the exception of anaphase promoting complex subunit 2 (Anapc2) that was slightly increased in susceptible strains post-infection (Figure 5). By contrast, several genes associated with pro- and anti-apoptotic response were differentially expressed in the selected susceptible and resistant strains post-infection (Figure 5). Apoptosis in streptococcal pathogenesis is affected by interacting factors including, context of infection [31], cells undergoing apoptosis [32]–[34], for example, apoptosis aids in the clearing of infection if macrophages are undergoing apoptosis, while it would be harmful to the host if lymphocytes are undergoing apoptosis. Other factors include, whether the bacteria is internalized or extracellular [35] and accordingly the type of apoptosis pathways activated [36]. In our murine GAS sepsis model, we have measured expression levels in whole spleens, which involved the response of various cells including macrophages, T and B lymphocytes, dendritic and endothelial cells etc. Consequently, we expected to observe a mixed response; however, in our ongoing studies, we are examining possible alterations in splenic population profiles post-infection in the various BXD strains to determine which cell types are responsible for the major differences in cytokine levels seen post-infection and to dissect the role of different cell populations in this GAS sepsis model. Another interesting observation was that the relative expression level of genes measured in the selected resistant strains showed a pattern of decrease post-infection, with the exception of five genes, heat shock 70KDa protein 5 (Hspa5), Traf1, Traf2, Notch gene homolog 1 (Notch1), and signal-regulatory protein alpha (Sirpa). It is worthy to note the link between these genes is as they are involved directly and indirectly with activation of early adaptive response. Hspa5 is an Hsp70, which is associated with cytoprotection, anti-apoptosis, and anti-inflammation [37]–[39], and has been associated with immune response to sepsis [40], [41]. Notch1 has been associated with the signaling involved in regulation of lymphocytes development and activation to effector cells [42], natural killer cells development [43]–[45] and recently Notch1 was associated with macrophage activation [46]. We took into consideration in our experimental design that stress might alter the expression of stress related genes especially heat shock proteins and chemokines, therefore, we subjected control mice to the same stress as infected mice by injecting control mice with saline, so that any change in expression levels would be accounted to GAS sepsis. Among the differentially expressed genes, four genes, Il1, Il1rn, Ptges, and Ptges2, showed marked up regulation in susceptible strains, while showed no change or slight decrease in levels in resistant strains post-infection (Figure 5). Expression of Ptges and Ptges2 genes increase is induced by the increased levels of Il1 [47], which is an indirect effect of the activation of IFN-γ (Figure 5). Ptges and Ptges2 are prostaglandins synthases for the lipid inflammatory mediators PGE2, which along with platelet activating factor and leukotriens, mediate vasodilatation in the early response to inflammation [48], [49]. Vasodilatation in turn leads to hypotension, a hallmark of STSS. Although the role of prostaglandins in inflammation and immune response has long been studied, their role in the immune response to infectious diseases has been lately pursued [50]–[55]. Increased production of prostaglandins has been associated with various Gram positive bacterial infections including Streptococcus suis [53], group B streptococcal [55], and GAS skin infections [54]. In conclusion, our holistic approach of studying the genetic basis of differential susceptibility to GAS sepsis revealed loci on Chr 2 that harbor major immune modulators. In the present study, we examined the interactions of pathogen multiple virulence factors with the host immune system in an in vivo model of sepsis using a genetically diverse reference population. This shed light on a network of host genes modulating variation in GAS severity, which includes cytokines, pro- and anti-inflammatory mediators, and genes associated with apoptosis and early adaptive immune response. Our ongoing detailed studies to identify interactive molecular pathways contributing to the complex trait of GAS sepsis will undoubtedly help us dissect the various mechanisms by which the host interacts with the bacteria in vivo, resulting in resistance or increased susceptibility to severe GAS sepsis. We generated the BXD advanced recombinant inbred (ARI) mice at UTHSC by crossing B6 and D2 mice to generate F1 hybrids, which were crossed to generate F2 progeny, each with random patterns of recombination. Random crossing of F2 mice generated F3 and so on, till F11 generation, after which we designated pairs of F11 hybrids as parents of each BXD line, and inbred them by sib mating for >20 generations to achieve homozygosity for each genetically distinct BXD line. This breeding scheme was done to increase recombination events resulting in roughly double the number of recombinations per strain compared to conventional RI strains [56], [57]. The genomes of the B6 and D2 parental strains have been sequenced and a database of their SNPs is available at the Gene Network (GN) web site (www. genenetwork. org/webqtl/snpBrowser. py). Simple sequence length polymorphism (SSLP) markers were typed for all BXD RI strains as previously described [56]. The BXD progeny is genotyped at 13377 SNPs and microsatellite markers [58], a selected subset of 3795 SNPs and microsatellite markers used by GN BXD genotype dataset for mapping traits, can be downloaded at www. genenetwork. org/genotypes/BXD. geno. We recently standardized the model of BXD ARI mice for use in GAS infection studies [20]. In the current study, a total of 696 mice were used, from which 183 flagged mice were excluded based on predetermined criteria as previously detailed in [20]. All procedures involving mouse tissues were approved by the institutional animal care and use committee at the UTHSC. We performed QTL mapping using web-based complex trait analysis available on the GN website and the mapping module which analyzes phenotypes in context of mouse genotypic differences. Interval mapping evaluates potential QTL at regular intervals and estimates the significance at each location using 1000 permutation tests [60]. We performed three sets of analyses using strain means for the following three variables: (1) corrected relative survival index, described above, (2) log bacterial load in blood 24 h post injection, and (3) log bacterial load in spleen at expiration. We investigated the differential expression of target genes in spleen of infected vs. control PBS-injected mice at selected time points, we selected strains based on their susceptibility, BXD61 and 90 representing susceptible strains, and BXD73 and 87, representing resistant strains. We performed 2–3 biological replicates of each set of paired susceptible and resistant (n = 6–8 per strain). Mice were sacrificed 40 h post i. v. injection with 2±1. 5×107 CFU/mouse of clinical isolate GAS 5448 (M1T1) and RNA from individual mice was extracted from spleens. Bacteremia was determined as described above. We isolated RNA using RNA-STAT 60 method and when necessary, we purified RNA samples using RNeasy mini kit clean up columns (Qiagen, Valencia, CA). We pooled RNA samples per strain with A260/280 ratios≥1. 8 for cDNA synthesis with SuperScript III reverse transcriptase kit (Invitrogen, Carlsbad CA) using oligo dT primers. We designed real time PCR assays, hydrolysis probes, and gene specific primers that span long introns to distinguish cDNA from genomic DNA using primer design online software universal probe library (UPL) at www. roche-applied-science. com/sis/rtpcr/upl/index. jsp. We performed quantitative TaqMan PCR on light cycler LC480 (Roche Applied Science, Indianapolis, IN). We used the mouse housekeeping gene, hypoxanthine guanine phosphoribosyl transferase (Hprt1) as an endogenous control to which we normalized gene expression data. Primer sequences are listed in Table S1. Samples were analyzed in triplicates for each of 2–4 biological replicates. We used delta delta Ct (threshold cycle) method for calculating relative expression levels expressed as fold differences between pre- and post-infection values for each gene analyzed. Student t-test was used to assess statistical significance. We generated functional analyses of genes within the QTLs using Ingenuity pathways analysis (IPA) (www. ingenuity. com). Each data set containing gene identifiers was uploaded into the online application, and each gene was overlaid onto a molecular network developed from information contained in the ingenuity pathways database. Networks of genes were then generated based on their connectivity, and we chose the top 50 significant networks. The significance of the association between the data set and the pathways was measured in two ways: (1) the ratio of the number of genes from the data set that map to the pathway divided by the total number of genes that map to the pathway; and (2) by Fischer' s exact test with P<0. 001. Our data sets stored in WebQTL can be found at Gene Network (www. genenetwork. org) under BXD published phenotypes record ID 10836.

Title: An Unbiased Systems Genetics Approach to Mapping Genetic Loci Modulating Susceptibility to Severe Streptococcal Sepsis Summary: Group A streptococci (GAS) cause a wide variety of human diseases ranging from mild pharyngitis to streptococcal toxic shock syndrome and necrotizing faciitis. Our previous studies have shown that host immunogenetic variation can dictate the clinical outcome of GAS sepsis. As in most human disease, GAS sepsis is likely to be affected by complex interactions between more than one polymorphic gene. We addressed this issue in our study where we present an approach that allowed us to identify multi genetic factors that likely contribute to sepsis severity. We mapped susceptibility to severe GAS sepsis to quantitative trait loci on Chromosome 2 using a panel of genetically diverse inbred mice. The mapped regions have high single nucleotide polymorphism (SNP) density that harbor genes known to play an important role in innate immune response to bacteria. Several of those genes are differentially expressed between susceptible and resistant strains of mice. Our overall approach of systematic dissection of genetic and molecular basis of host susceptibility is not unique to GAS infections, but can be applied to other infectious diseases to develop better diagnostics, design effective therapeutics and predict disease severity based on a set of genetic and soluble biomarkers.

lay_plos

en

Summarize: Perhaps most of this Brooklyn story illustrates how medical treatments vary wildly from region to region, state to state, and — at times — even neighborhood to neighborhood. Physical therapists in Brooklyn tend to bill Medicare patients for more treatments than their counterparts elsewhere in country — and even elsewhere in New York City. On average, they billed each patient for 45 separate treatments in 2012, the Times analysis found. Across the river in Manhattan, the average was 37. In Connecticut, it was 24, while in Minnesota, it was a mere 13. Mr. Bakry offers an explanation echoed by other practitioners: the newly released Medicare data paints an incomplete picture of where taxpayer dollars are actually flowing. In an interview, Mr. Bakry said his practice had about two dozen physical therapists and assistants working in four offices in 2012. The care provided by all of those therapists and assistants went under his Medicare billing number because he owned the practice. While Medicare has encouraged providers to bill under their own numbers, the agency acknowledges that data for some providers covers multiple practitioners. Mr. Bakry said he could never himself have provided all the treatments the data appears to suggest. Furthermore, Mr. Bakry, who says he now operates three offices in different locations in Queens, says he has not worked out of the Ocean Avenue office for years — even though the Medicare data attributed his billings to that address. “I don’t know why they keep using that address,” Mr. Bakry said. The release of the 2012 billing records this month set off a firestorm in the medical community. Many applauded the move, saying it shed light on the costs of health care and gave ordinary people a way to compare doctors and treatments. But the American Medical Association and other industry groups fought against the release of the information. (The Obama administration released it after a long legal battle led by The Wall Street Journal.) The A.M.A. and its allies argued that the raw data provided patients with no information on quality of care. The patient smoked cigarettes in the passenger seat of the ambulance every week, chatting with the driver while taxpayers foot the $1,000 bill to drive him four blocks for his dialysis treatment. The routine was part of a $1.5 million scheme to defraud Medicare by Penn Choice Ambulance Inc., according to an indictment against the Philadelphia company. The case helps explain part of why Medicare paid $5 billion to ambulance companies in 2012, more than went to cancer doctors or orthopedic surgeons, according to newly released federal data. The U.S. Department of Health and Human Services has identified ambulance service as one of the biggest areas of overuse and abuse in Medicare -- companies billing millions for trips by patients who can walk, sit, stand or even drive their own cars. “It’s a cash cow,” said Assistant U.S. Attorney Beth Leahy, who prosecuted Penn Choice and five other ambulance fraud cases. “It’s basically like a taxi service except an extremely expensive one that the taxpayers are financing.” Related: Penn Choice received $833,000 from Medicare in 2012, the year before it was indicted, according to the new data for the U.S. government health program for the elderly and disabled. The company went out of business after the indictment. Founder Anna Mudrova pleaded guilty to fraud charges and is facing more than five years in prison, said Thomas Kenny, her lawyer. Federal regulators and investigators have ramped up efforts in the past year to fight ambulance fraud and overuse, with rides to dialysis centers one of the problem areas. HHS estimates Medicare overpaid ambulance providers by $314 million last year, a third of it for medically unnecessary claims to the U.S. government health program for the elderly and disabled. Outsourcing Once dominated by local fire departments, volunteers, or hospitals, ambulances are increasingly being operated by private companies as local governments outsource the service to cut costs, said Sarah Turk, an analyst with research firm IBISWord Inc. About a third of ambulances billing Medicare are for-profit suppliers, according to the Medicare Payment Advisory Commission, or Medpac, which counsels Congress. Cases of fraud seem to be isolated within certain regions, said Leahy. She said most of the companies she has prosecuted were started by Russian or Eastern European immigrants in the Philadelphia area with the intent of being an illegal operation. The American Ambulance Association “condemns Medicare fraud in any form” and supports preventive measures such as preauthorization for dialysis trips, a review for new providers of dialysis transports, and unannounced site reviews, the trade group said in a statement. Easy Entry There have been relatively few barriers for those starting an ambulance company, making the industry susceptible to illegal activity, Kenny said. In the case of Penn Choice, Mudrova, a Russian immigrant with no medical training or advanced degree, was doing administrative work at a doctor’s office when she got a loan from her family to start the ambulance company, according to Kenny. “The threshold to get into the system is basically that you have to have a driver’s license and take a safety course,” Kenny said. “Medicare is letting these ambulances sign up and the threshold is very easy -- you or I could do it tomorrow and we don’t know a thing about ambulances.” HHS is conducting additional screenings of ambulance operators to step up enforcement, including license and database checks, and announced and surprise site visits, said Aaron Albright, a spokesman for the Centers for Medicare and Medicaid Services. Dialysis Trips A large amount of fraudulent ambulance spending is coming from rides to and from dialysis treatment, according to a Medpac report last year. Dialysis patients must get treatment three days a week for years while they await a kidney transplant, making them a predictable, stable source of revenue for fraudsters, Leahy said. While Medicare will pay for a non-emergency ambulance ride for someone so ill they couldn’t get to their medical appointments or treatment any other way, it is not supposed to be used by patients who can walk, sit or ride in a wheelchair. Of the $5 billion Medicare spent on ambulance trips in 2011, $700 million was for rides to dialysis centers, a 20 percent increase since 2007, according to Medpac. Medicare could save more than $400 million a year if the states spending the most on ambulance rides per dialysis patient were brought down to the average levels, it said. No Emergency Those states include West Virginia, Massachusetts, South Carolina, New Jersey and Pennsylvania, where ambulance operators are paid 50 percent more than the average payment per Medicare beneficiary, according to data analyzed by Bloomberg. Authorities have taken action against at least a dozen ambulance operators for alleged Medicare fraud over the past 12 months, according to reports by the federal Office of the Inspector General for HHS. Rural/Metro, the second-largest ambulance provider in the U.S., has paid $8.2 million in settlements with the government since 2012 over its Medicare billing practices. In one case, the company settled U.S. allegations that Medicare paid it for ambulance trips for dialysis patients that weren’t provided or weren’t medically necessary. In December, it reached a second settlement over allegations that it charged Medicare for emergency rides when there was no emergency. Rural/Metro didn’t admit nor deny the allegations in the settlement. Brotherly Love The alleged wrongdoing went on for several years through 2011. In 2012, providers listed under the Rural-Metro or Rural/Metro names were paid more than $60 million by Medicare, according to the recently released data. Company spokesman Tom Milton didn’t return a phone call and e-mail seeking comment. Warburg Pincus LLC, a private-equity investor, bought Rural/Metro Corp. for $677 million in 2011. In the case of Penn Choice, the company billed Medicare for $3.6 million, $1.5 million of which was paid, for transporting patients who federal investigators observed walking and climbing unassisted into the company’s ambulances. Sometimes two people would ride together in the back of the ambulance and Medicare would be billed as if the company had made two separate trips, according to court documents. Penn Choice recruited ambulatory patients outside dialysis centers, telling them they could get Medicare to pay for rides. The company also acquired patients from another ambulance provider, Brotherly Love, which was closed by law enforcement in 2011 for billing Medicare for patients who could have safely been transported by other means and paying them kickbacks, according to Leahy. Brotherly Love sold names and addresses of its passengers to Penn Choice for $2,000 each, she said. Cash Envelopes To keep them coming back, Penn Choice ambulance drivers would hand out envelopes with $100 to $400 in cash every month to the passengers, many of whom were poor and unable to work because of their health condition, the government said. Leahy said she hasn’t prosecuted any of the patients since all have cooperated with the investigation. “They are patients with health issues and a lot are very poor and they are easy prey for these types of schemes,” Leahy said. “It is wrong, there is nothing right about it, but you have to make a decision on a case-by-case basis.” Employees of Penn Choice also transported patients to dialysis in their personal vehicles and billed the trips as ambulance rides. One employee billed Medicare $38,000 for rides for a relative, who was able to travel by car, court records showed. The ambulances were in serious disrepair, unsanitary, and passengers complained that the exhaust was so bad it would make them gag, Leahy said. Revoked Privileges In the Houston and Philadelphia regions, U.S. regulators have gotten so concerned about the potential for fraud they’ve blocked new ambulance companies from enrolling in Medicare and Medicaid. Ambulance suppliers in Philadelphia are being paid $1,300 per user per year, 64 percent more than the average payment in similar areas, according to the Centers for Medicare and Medicaid Services. In the first two months of the moratorium in Houston, CMS has revoked the billing privileges of 15 ambulance suppliers there. “In the community, everyone involved in this knew everyone else and shared patients,” Leahy said. “If one was under investigation and one got wind, the company would shut down and another would pop up.” To contact the reporter on this story: Shannon Pettypiece in New York at [email protected] To contact the editors responsible for this story: Reg Gale at [email protected]; Gary Putka at [email protected] Page 1 of 1 In 2012, FBI agents raided a mental health clinic in the 6600 block of Hornwood that was owned by Westbury Community Hospital. In 2012, FBI agents raided a mental health clinic in the 6600 block of Hornwood that was owned by Westbury Community Hospital. In 2012, FBI agents raided a mental health clinic in the 6600 block of Hornwood that was owned by Westbury Community Hospital. In 2012, FBI agents raided a mental health clinic in the 6600 block of Hornwood that was owned by Westbury Community Hospital. In 2012, FBI agents raided a mental health clinic in the 6600 block of Hornwood that was owned by Westbury Community Hospital. In 2012, FBI agents raided a mental health clinic in the 6600 block of Hornwood that was owned by Westbury Community Hospital. In 2012, FBI agents raided a mental health clinic in the 6600 block of Hornwood that was owned by Westbury Community Hospital. Jeff Parsons, CEO and senior vice president of operations, and Colleen Paxton, administrator at Westbury Community Hospital, were at the clinic Thursday morning during the raid in 2012. Jeff Parsons, CEO and senior vice president of operations, and Colleen Paxton, administrator at Westbury Community Hospital, were at the clinic Thursday morning during the raid in 2012. Ten people, including several from the Houston region, have been charged in an alleged kickback scheme to financially exploit Medicare and Medicaid while providing sometimes unnecessary care to the mentally ill, according to the U.S. Attorney's Office for the Southern District of Texas. The 13-count indictment handed down Friday alleges that two Florida men - Jeffery Parsons, 55, and David Edson, 65, executives of Contiuum Healthcare LLC - billed Medicare and Medicaid for mental health services that were unnecessary or never provided, and directed kickbacks be paid to personal home care owners and patient advocates in exchange for steering clients to three Houston-area clinics. Personal care home owners Aretha Johnson, 61, of Sweeny, and Deborah Davis, 51, of Georgia, were named in the indictment, along with Houstonians Inger Michelle Pace, 51, James Bobino, 44, Mary Browning, 66, and Cheryl Waller, 68. Also indicted were Houston patient advocates Earnestine Johnson, 55, and Ronald Turner, 53. The indictment alleges that Contiuum billed $173 million to Medicare and Medicaid, and were paid $69.4 million, for patients obtained through the scheme. It alleges that Aretha Johnson received the largest kickback sum in the scheme: $2.2 million. None of those indicted, or their attorneys, returned requests for comment Saturday. "Medicare fraud steals from seniors and taxpayers. I keep fighting this drain on Medicare's limited resources," U.S. Rep. Kevin Brady, R-The Woodlands, said in a prepared statement Saturday. "Every dollar lost to this fraud is a dollar not spent providing care for our seniors. The House Ways and Means Committee I sit on will continue to push for real reform that ensures that more dollars are being used to benefit our seniors, not less, and for criminal prosecution of the fraudsters." Areas known for fraud The alleged fraud was detailed by a Houston Chronicle report in 2011 that spurred federal criminal investigations and congressional inquiries. It looked at Medicare payments to private ambulances that transported often able-bodied patients to community mental health clinics from personal care homes, an unlicensed housing option. In 2009, private EMS companies in Houston collected $62 million from Medicare, compared to $7 million in New York City. Often, the patients were delivered to "partial hospitalization programs," whose services are paid for by Medicare but not regulated by Texas, where the mentally ill receive intensive daily therapy. Texas, Louisiana and Florida, which generate about three-quarters of all PHP claims to Medicare, are well-known as high-fraud areas to the federal Centers for Medicare and Medicaid Services. In 2013 alone, federal authorities secured convictions for Medicare kickback schemes in at least four Houston-area cases, according to an April 2014 report from the Department of Health and Human Services Office of the Inspector General. Federal raid in 2012 Sources familiar with the investigation that led to the 13-count indictment told the Chronicle two years ago that they were reviewing whether owners of personal care homes were paid by clinic workers to recruit patients for treatment, regardless of whether the care was needed. In April 2012, Parsons, CEO of Contiuum, looked on as federal agents seized hundreds of patient records from Westbury Community Hospital at 6614 Hornwood. He called the raid "disruptive" for the nearly 140 patients who arrived for multi-hour daily therapy. "At the end of the day, I think we're fine," he said at the time. Edson, a vice president of operations, and Jerry Skinner, the hospital's vice president of integrity and compliance, said employees are questioned about ties to personal care homes or other health care providers and must sign a form saying they do not. "If there were any (ties), we didn't know that, and we have attestations," Edson said at the time. "We're the most compliant group in the entire city," said Skinner, who has not been charged. Able-bodied patients The Chronicle investigation found Westbury Community Hospital, formerly named Contiuum Healthcare, was a frequent stop for private EMS delivering patients from personal care homes. Patients of clinics citywide who were interviewed by the paper often were able-bodied and did not understand why the specialized transport - which was billed to Medicare - was needed. Many remembered the food they ate and the videos they watched at the clinics, but could not recall therapy. All those named in the indictment were charged with conspiring to solicit or receive kickbacks in connection with a federal benefit program, which carries a maximum sentence of five years in prison and a $250,000 fine. Parsons, Edson and Aretha Johnson also were charged with laundering more than $10,000 of proceeds from the kickbacks conspiracy, for which the maximum sentence is 10 years in prison and a $250,000 fine. Pace was ordered into temporary custody pending a hearing set for Monday. All others were released after posting bond. This report contains material from Houston Chronicle archives.

Summary: How can more than $4 million in Medicare money flow through a small doctor's office in Brooklyn? Seeking answers, the New York Times reports on the world of physical therapy-where demand is on the rise, treatments vary wildly by region, and authorities are cracking down on doctors who cheat the system. The Brooklyn doctor, Wael Bakry, insists he's no cheat, saying he actually runs three offices that give a total of 1,950 patients an average of 94 treatments per year. That's more than triple the national average, but Brooklyn physical therapists tend to bill patients more than counterparts around the country. Why? According to federal authorities, Brooklyn is a hot spot for physical therapists who cheat the system. Factor in aging Baby Boomers who need more medical help, and the comparatively loose guidelines of physical therapy, and it's all too easy: "An area like physical therapy is a bit gray because there's no set guideline on how much a given patient needs," says a professor who suggests variances may be explained by "more entrepreneurial physicians." A US physical therapist bills on average $49,000 to Medicare annually, so Bakry's numbers do stand out-yet he says he's just successful. Meanwhile, Medicare fraud stories are rife around the 'Net-with an ambulance service indicted in a $1.5 million scheme, Bloomberg News reports, and 10 people charged in a $69.4 million scheme in Houston just last week, the Houston Chronicle reports.

multi_news

en

Summarize: There were some bad characters at this Kindergarten play. A children's show in California couldn't go on after some Kindergarten actors’ parents got into a brawl over seating and viewing arrangements. Police responded to the Hans Christensen Middle School in Menifee on Wednesday night, where kids from Ridgemoor Elementary School were putting on a play, to break up the fight — cops issued at least one citation after a parent made a citizen’s arrest. “It’s a sad time to stop a play because the parents can’t get along. It’s discouraging, but sometimes it happens,” a spokesman for the Riverside County Sheriff’s department, Michael Vasquez, told the Daily News. The play was almost over when a “pushing match” started after an unidentified woman stood at the front of the audience and obstructed the view for other parents, as they tried to film the show. The woman wouldn’t get out of the way even after the principal asked her to move, and a brawl broke out. The play was a production by Kindergarten kids at Ridgemoor Elementary School in Menifee. (Google Maps) "She was blocking the middle aisle so other parents couldn't see or video their kids. Parents were asking her nicely to sit or move. She was very rude to everyone. She actually shoved my son, who was holding my infant grandson. We were all disgusted in her actions,” Doreen Johnson told Menifee 24/7, a local news outlet. “I think some people sat down and other people didn’t respect their space, some people started filming,” Vasquez said. When cops arrived to the middle school, the play had been called off and the auditorium was cleared. No names have been released for the citation that was issued. A dispute over “viewing privileges” at a kindergarten play Wednesday in Menifee led to deputies being called to the scene and the cancellation of the play, according to police and school officials. Kindergarten students from Ridgemoor Elementary School were putting on a performance attended by more than 300 people, said Menifee Union School District spokeswoman Betti Cadmus. The event was being held at Hans Christensen Middle School. Just before 7 p.m., a dispute arose among parents “regarding seating and viewing privileges,” said Riverside County sheriff’s Deputy Michael Vasquez. “Some people walked to the front row and began filming,” he said, which prompted a response from other audience members. A verbal altercation turned into pushing and shoving, Vasquez said. At some point, the play was canceled and authorities were called to the school. Vasquez said authorities did not make an arrest, but that deputies did issue a citation for a citizens arrest. He said information would be forwarded to the Riverside County District Attorney’s office for further investigation. Cadmus said letters about the incident were being sent home with Ridgemoor students on Thursday, March 24, and phone notifications were being placed to families of students in both English and Spanish. Screen grab: Ridgemoor Elementary School Guys. We know that school productions can be stressful affairs. There are carpools to coordinate and kids to corral. Great Aunt June’s hearing aid needs adjusting; teenage cousin Ralph has to be bribed to attend. Sonia will demand a juice box five minutes before curtain, then inevitably spill it on her costume two minutes later. But still. It’s probably not a good sign when the local police have to be called to the local school auditorium to break up an all-out brawl. Especially when the brawl involves not the collection of kindergartners standing on stage, but their parents. “Yeah, it’s kind of shocking,” said Michael Vasquez, the bemused sheriff’s deputy tasked with handling media inquiries about what went down at Ridgemoor Elementary School’s kindergarten play on Wednesday. According to Vasquez, the fight broke out over “seating privileges”: Someone walked to the front of the auditorium to film the production. Other audience members registered their discontent. Insults — and eventually fists — began to fly. The local police arrived at the Manifee, Calif., school soon after to find several adults “pushing and shoving” one another, Vasquez said. No one was arrested, but a citation was issued for one person to appear in court at a later date. Then everyone was sent home. Vasquez said that the Riverside County District Attorney’s Office is still investigating the incident. He chuckled: “Sometimes adults act in funny ways.” Uh huh. Menifee Union School District spokeswoman Betti Cadmus told the Riverside, Calif. Press-Enterprise that Ridgemoor students were given letters about the incident to take home on Thursday. The district also made phone calls to families in both Spanish and English. The play does not appear to have been rescheduled. Grown-ups, this is why we can’t have nice things. Story updated at 2:10 p.m. to add confirmation from police that one citizen's arrest was made.... http://www.menifee247.com/2016/03/police-summoned-to-altercation-at-kindergarten-play.html Sheriff's deputies responded to restore order after an altercation during a kindergarten play Wednesday night in Menifee, authorities said.Police questioned several involved after an altercation among adults during a play involving kindergarten students from Ridgemoor Elementary School in Menifee, said Deputy Mike Vasquez. He said no one was taken into custody, but one person was given a citation after another individual made a citizen's arrest.The identity of that individual was not released. The case was forwarded to the district attorney's office. There were no injuries, Vasquez said.The event was held at Hans Christensen Middle School to accommodate the large crowd at what has become a popular event. According to several witnesses, the incident began when a woman sat and stood near the front in the center aisle, blocking others who were trying to watch and video the performance.According to witnesses, the woman refused to move when asked by other parents and principal Kristina Lyman. A physical altercation occurred, involving several people.Savannah Kroll, a Ridgemoor parent who was in attendance, said military personnel who were in the audience to watch a Veterans Tribute planned by the students assisted in restraining the woman."After they took her outside she then attempted to get backstage back into the school, resulting in her being taken out of the school by these men and placed outside in the parking lot," Kroll said in an email to Menifee 24/7."It was a little chaotic while everything was happening inside as the many parents scrambled to take their kids outside and away from potential harm. Once it was determined she was away from the premises and authorities were handling the incident, they pushed forward with the songs. Of all the students that were there at the beginning of the play, maybe 20 to 25 ended up staying through and coming back to the stage to sing a song and do the Veteran Tribute."Leo Cuevas also was in attendance and give this account of what he saw:"Some lady started being loud and disrespectful during the kids' play when they were honoring our Veterans," Cuevas said in a Facebook post for which he later gave permission for publication. "She was so loud they stopped the play and other parents started to tell her to shut up. So she got louder and things just escalated after that."Another person in attendance stated that the woman struck Lyman, but that has not been confirmed."I didn't see her hit the principal, but I saw her sister swing at another parent," Cuevas said. "She was African-American. She was told to move, but not because she was black. When she was told to move, she right away played the racist card and said, 'Just because I'm black.' She was there with her kids and she was so loud and out of control that all three or four of her kids were crying."Kroll agreed with Cuevas' statements that the woman tried to make a racial issue of the request that she move her chair, and that she and at least one other person with her had made racial comments at the very start of the performance."There were racist comments made by the African-American woman in the center aisle regarding the Pledge of Allegiance and how it was a white person's world, and she used the N word multiple times, which just is sad," Kroll said. "Even an African-American man I was seated next to (medically retired from the Navy after 13 years of service) shook his head and said how disappointed he was in her behavior, and actions."Other parents at this point began to get directly involved, asking them to leave the building, or be quiet so they could see their children as profanity and other words were now being used back and forth, but these two continued to argue, involving their family members, who were attempting to calm them down."There was a physical altercation that followed, however I did not see that portion of the argument as there was a large group around the ladies. At that point, I was at the stage with my daughter, helping the teachers there maintain order and keep the children from panicking."Betti Cadmus, public information officer for the Menifee Union School District, said that district officials are working with law enforcement to make sure any offenders in the incident are held accountable."The incident took place close to the end of the performance," Cadmus said. "Several parents got into an altercation. Students were removed from the performance area."It is the primary concern of the Menifee Union School District to provide a school environment that is both safe and educationally rich at all school events. The district will seek resolution of this occurrence, in partnership with law enforcement."Doreen Johnson told Menifee 24/7 she was there watching her grandson perform when the incident began."She was blocking the middle aisle so other parents couldn't see or video their kids," Johnson said about the woman. "Parents were asking her nicely to sit or move. She was very rude to everyone. She actually shoved my son, who was holding my infant grandson. We were all disgusted in her actions."It was sad to hear my kindergarten grandson ask me why are there mean people out there. We went outside to leave and the police were there, questioning everyone that was involved. Then more cars showed up that had something to do with that lady and they all started arguing in the street. They were all embarrassing themselves. I couldn't believe what I saw. I felt so bad for the kids."Cadmus said police and security personnel were at Ridgemoor Elementary this morning as children were dropped off for school."I just picked my daughter up at school at 11:15, and the school had a police officer there both this morning and at pickup, as well as a school liaison who went around informing any parents if they had videos or pictures of the incidents to speak with the front office, as they were fully investigating the incident and had a tech guy in the school," Kroll said."I do applaud Ridgemoor for getting on top of it both last night during the play, and having the nice staff answering what they could today, but I felt so bad for the kindergarten classes and teachers who had worked so hard to put on the 16th play, as well as the children whose families were directly involved last night."A lot of the atmosphere at the school today was that the kids were mostly shook up because they didn't fully understand what had happened. One child (according to the mother) was sad that people didn't like the songs and left! Another never wanted to be in a play again! The parents were just disappointed at the woman's behavior, which disrupted what should have been a very nice event."

Summary: The show must go on-except when the show is a kindergarten play and parents are brawling in the audience. That was the scene at Hans Christensen Middle School in Menifee, Calif., on Wednesday, reports the Riverside Press-Enterprise. Kindergarten students from Ridgemoor Elementary were performing for more than 300 people when an altercation broke out "regarding seating and viewing privileges" during the show around 7pm, says Riverside County Deputy Michael Vasquez. The show had to be canceled as police were forced to intervene. "Yeah, it's kind of shocking," Vasquez tells the Washington Post. The trouble began when a woman stood near the front of the audience and blocked the view of other parents, reports the New York Daily News. She reportedly wouldn't budge, even after a principal asked her to move, which eventually led to pushing and shoving. "She was blocking the middle aisle so other parents couldn't see or video their kids," one attendee tells Menifee 24/7. "She was very rude to everyone." Another says the woman began acting rudely as the kids on stage were honoring military vets. There were no arrests or injuries, though a citation was issued after one individual made a citizen's arrest. The local district attorney's office will investigate.

multi_news

en

Summarize: By. Harriet Arkell. A chocolate labrador who flies around the UK with her owner in his six-seater Cessna light aircraft has been given a crew card after racking up more than 250 flying hours. Three-year-old Callie, who flies with Graham Mountford, 50, is now able to pass through the Crew Only channels at airports after becoming the only dog in the country to be recognised by the Aircraft Owners and Pilots' Association (AOPA). The pet, who takes to the skies every weekend and has flown more than 50,000 miles, has goggles, a special harness to strap her into the cockpit, and is rewarded with a sausage when she lands. Scroll down for video. Callie, who is three, has clocked up more than 250 flying hours with her pilot owner, Graham Mountford, 50. The chocolate labrador wears her own goggles, hat and harness - and gets a sausage every time they land. Chocks away! Callie first got in a plane when she was a 12-week-old puppy - now she is an old hand. Mr Mountford, from Leighton Buzzard, Bedfordshire, has been a private pilot for 13 years and first took Callie, who resembles cartoon flying dog, Muttley, up in the air with him when she was just a three-month-old puppy. She leaps into his Cessna 210 Centurion happily, and has touched won at airports across Britain, including Cornwall, Wales and various far-flung Scottish islands. Mr Mountford said: 'I used to go flying with friends, but when we got Callie three years ago I thought it would be fun to take her up in the plane with me. 'I bought some small ear protectors for her to wear and the first time we just taxied around the airport to make sure she enjoyed it. 'It all went well so we then went on a short flight and she took it all in her stride and seemed very happy.' Now the pair fly most weekends, visiting beaches such as Barra in Scotland, Perranporth in Cornwall and Caernarfon in Wales, where Callie enjoys a run on the sand and a sausage. The labrador, seen here without her Muttley-style goggles, has visited airports right across Great Britain. Needs a pawprint: Callie is the only dog to have an Aircraft Owners' and Pilots' Association crew card. With her goggles and flying hat, Callie looks rather like the cartoon character Muttley, pictured right with Dick Dastardly. VIP access: Now Callie has her card, she can go through special channels at many airports across the UK. Mr Mountford said: 'She usually sits next to me in the front of the plane but if other people come with me she will stretch out on the back seat,' 'I get a lot of comments and smiles when I land at an airport and people realise my co-pilot is a dog.' He added: 'Callie usually wears a fluorescent jacket and as soon as she puts it on, she knows she is going flying. She loves dressing up for the part.' The crew card came about after Mr Mountford visited the AOPA at an exhibition and told them how many flying hours his labrador had. He was told she was eligible for a VIP card, which gives the holder benefits including hotel and hire car discounts, and a card duly arrived in the post soon afterwards. He said: 'I have shown the card, along with mine, at some of the bigger airports and it always causes great amusement. Even the most glum security men break into a smile.' Mr Mountford gave Callie her first taste of flying by simply taxiing around the runway - but she liked it. Man's best friend: Mr Mountford used to go flying with friends, but now he prefers to take Callie in his Cessna. Muttley was the canine sidekick of the hapless baddie, Dick Dastardly, in the Hanna-Barbera Wacky Races and other cartoons. Muttley first appeared in Wacky Races in 1968, but the cartoon's popularity was such that it continued well into the new millennium. Dastardly and Muttley in Their Flying Machines was a series of cartoons in which the duo tried to catch Yankee Doodle Pigeon, a carrier pigeon who carried secret messages to their opponents. With the two villains featuring as aviators in the Vulture Squadron, they wore Aviator caps and goggles and tried, but usually failed, to capture their feathered foe. The cartoon series' original run was from 1969-1970, but it garnered such a fanbase that it was syndicated throughout the 1970s and 1980s, before a box-set was released in 2005

Summary: Private pilot Graham Mountford, 50, first took his dog up at three months. Now three-year-old Callie has more than 250 flying hours under her belt. Sits beside Mr Mountford in cockpit of his six-seat Cessna 210 Centurion. Callie, from Leighton Buzzard, Bedfordshire, has goggles and a harness. As a result, she looks rather like the 1969 flying cartoon dog, Muttley. Her destinations have included some Scottish islands, Cornwall, and Wales. The Aircraft Owners' and Pilots' Association have officially recognised her. Now Callie gets VIP treatment and can walk through Crew Only channels.

cnn_dailymail

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Federal Aviation Administration Extension Act of 2010''. SEC. 2. EXTENSION OF TAXES FUNDING AIRPORT AND AIRWAY TRUST FUND. (a) Fuel Taxes.--Subparagraph (B) of section 4081(d)(2) of the Internal Revenue Code of 1986 is amended by striking ``March 31, 2010'' and inserting ``April 30, 2010''. (b) Ticket Taxes.-- (1) Persons.--Clause (ii) of section 4261(j)(1)(A) of the Internal Revenue Code of 1986 is amended by striking ``March 31, 2010'' and inserting ``April 30, 2010''. (2) Property.--Clause (ii) of section 4271(d)(1)(A) of such Code is amended by striking ``March 31, 2010'' and inserting ``April 30, 2010''. (c) Effective Date.--The amendments made by this section shall take effect on April 1, 2010. SEC. 3. EXTENSION OF AIRPORT AND AIRWAY TRUST FUND EXPENDITURE AUTHORITY. (a) In General.--Paragraph (1) of section 9502(d) of the Internal Revenue Code of 1986 is amended-- (1) by striking ``April 1, 2010'' and inserting ``May 1, 2010''; and (2) by inserting ``or the Federal Aviation Administration Extension Act of 2010'' before the semicolon at the end of subparagraph (A). (b) Conforming Amendment.--Paragraph (2) of section 9502(e) of such Code is amended by striking ``April 1, 2010'' and inserting ``May 1, 2010''. (c) Effective Date.--The amendments made by this section shall take effect on April 1, 2010. SEC. 4. EXTENSION OF AIRPORT IMPROVEMENT PROGRAM. (a) Authorization of Appropriations.-- (1) In general.--Section 48103(7) of title 49, United States Code, is amended to read as follows: ``(7) $2,333,333,333 for the 7-month period beginning on October 1, 2009.''. (2) Obligation of amounts.--Sums made available pursuant to the amendment made by paragraph (1) may be obligated at any time through September 30, 2010, and shall remain available until expended. (3) Program implementation.--For purposes of calculating funding apportionments and meeting other requirements under sections 47114, 47115, 47116, and 47117 of title 49, United States Code, for the 7-month period beginning on October 1, 2009, the Administrator of the Federal Aviation Administration shall-- (A) first calculate funding apportionments on an annualized basis as if the total amount available under section 48103 of such title for fiscal year 2010 were $4,000,000,000; and (B) then reduce by 42 percent-- (i) all funding apportionments calculated under subparagraph (A); and (ii) amounts available pursuant to sections 47117(b) and 47117(f)(2) of such title. (b) Project Grant Authority.--Section 47104(c) of such title is amended by striking ``March 31, 2010,'' and inserting ``April 30, 2010,''. SEC. 5. EXTENSION OF EXPIRING AUTHORITIES. (a) Section 40117(l)(7) of title 49, United States Code, is amended by striking ``April 1, 2010.'' and inserting ``May 1, 2010.''. (b) Section 44302(f)(1) of such title is amended-- (1) by striking ``March 31, 2010,'' and inserting ``April 30, 2010,''; and (2) by striking ``June 30, 2010,'' and inserting ``July 31, 2010,''. (c) Section 44303(b) of such title is amended by striking ``June 30, 2010,'' and inserting ``July 31, 2010,''. (d) Section 47107(s)(3) of such title is amended by striking ``April 1, 2010.'' and inserting ``May 1, 2010.''. (e) Section 47115(j) of such title is amended by striking ``April 1, 2010,'' and inserting ``May 1, 2010,''. (f) Section 47141(f) of such title is amended by striking ``March 31, 2010.'' and inserting ``April 30, 2010.''. (g) Section 49108 of such title is amended by striking ``March 31, 2010,'' and inserting ``April 30, 2010,''. (h) Section 161 of the Vision 100--Century of Aviation Reauthorization Act (49 U.S.C. 47109 note) is amended by striking ``April 1, 2010,'' and inserting ``May 1, 2010,''. (i) Section 186(d) of such Act (117 Stat. 2518) is amended by striking ``April 1, 2010,'' and inserting ``May 1, 2010,''. (j) The amendments made by this section shall take effect on April 1, 2010. SEC. 6. FEDERAL AVIATION ADMINISTRATION OPERATIONS. Section 106(k)(1)(F) of title 49, United States Code, is amended to read as follows: ``(F) $5,454,183,000 for the 7-month period beginning on October 1, 2009.''. SEC. 7. AIR NAVIGATION FACILITIES AND EQUIPMENT. Section 48101(a)(6) of title 49, United States Code, is amended to read as follows: ``(6) $1,712,785,083 for the 7-month period beginning on October 1, 2009.''. SEC. 8. RESEARCH, ENGINEERING, AND DEVELOPMENT. Section 48102(a)(14) of title 49, United States Code, is amended to read as follows: ``(14) $111,125,000 for the 7-month period beginning on October 1, 2009.''.

Title: A bill to amend the Internal Revenue Code of 1986 to extend the funding and expenditure authority of the Airport and Airway Trust Fund, to amend title 49, United States Code, to extend authorizations for the airport improvement program, and for other purposes Summary: Federal Aviation Administration Extension Act of 2010 - Amends the Internal Revenue Code to extend through April 30, 2010: (1) excise taxes on aviation fuels and air transportation of persons and property; and (2) the expenditure authority for the Airport and Airway Trust Fund. Authorizes appropriations for the seven-month period from October 1, 2009, through April 30, 2010, for airport improvement program (AIP) projects, including project grant authority. Sets forth a formula for calculating the apportionment of AIP funding. Extends through April 30, 2010, various airport development projects, including: (1) the pilot program for passenger facility fees at nonhub airports; (2) small airport grants for airports located in the Marshall Islands, Micronesia, and Palau; (3) the temporary increase to 95% in the government share of certain AIP project costs; and (4) the funding of Midway Island airport development. Extends through April 30, 2010, state and local land use compatibility projects under the AIP program. Extends through April 30, 2010, the authority of the Metropolitan Washington Airports Authority to apply for an airport development grant and impose a passenger facility fee. Extends through April 30, 2010, Department of Transportation (DOT) insurance coverage for domestic and foreign-flag air carriers. Allows further extension through July 31, 2010. Extends through July 31, 2010, air carrier liability limits for injuries to passengers resulting from acts of terrorism. Extends through April 30, 2010, certain competitive access assurance requirements for large or medium hub airport sponsors applying for AIP grants. Extends for the seven-month period from October 1, 2009, through April 30, 2010, the authorization of appropriations for: (1) Federal Aviation Administration (FAA) operations; (2) air navigation facilities and equipment; and (3) research, engineering, and development.

billsum

en

Write a title and summarize: SECTION 1. SHORT TITLE; TABLE OF CONTENTS. (a) Short Title.--This Act may be cited as the ``Community Protection and Hazardous Fuels Reduction Act of 1997''. (b) Table of Contents.--The table of contents of this Act is as follows: Sec. 1. Short title; table of contents. Sec. 2. Findings and purpose. Sec. 3. Definitions. TITLE I--MANAGEMENT OF WILDLAND/URBAN INTERFACE AREAS Sec. 101. Identification of wildland/urban interface areas. Sec. 102. Contracting to reduce hazardous fuels and undertake forest management projects in wildland/urban interface areas. Sec. 103. Monitoring requirements. Sec. 104. Reporting requirements. Sec. 105. Termination of authority. TITLE II--FIRE DANGER REDUCTION BY REMOVAL OF GRASSES AND FORBS Sec. 201. Removal of excess levels of grasses and forbs. TITLE III--MISCELLANEOUS PROVISIONS Sec. 301. Regulations. Sec. 302. Authorization of appropriations. SEC. 2. FINDINGS AND PURPOSE. (a) Findings.--The Congress finds the following: (1) Management of Federal lands has been characterized by large cyclical variations in fire suppression policies, timber harvesting levels, and the attention paid to commodity and noncommodity values. (2) Forests on Federal lands are experiencing significant disease epidemics and insect infestations. (3) The combination of inconsistent management and natural effects has resulted in a hazardous fuels buildup on Federal lands that threatens catastrophic wildfire. (4) While the long-term effect of catastrophic wildfire on forests and forest systems is a matter of debate, there should be no question that catastrophic wildfire must be prevented in areas of the Federal lands where wildlands abut, or are located in close proximity to, communities, residences, and other private and public facilities on non-Federal lands. (5) Wildfire resulting from hazardous fuels buildup in such wildland/urban interface areas threatens the destruction of communities, puts human life and property at risk, threatens community water supplies with erosion that follows wildfire, destroys wildlife habitat, and damages ambient air quality. (6) The Secretary of Agriculture and the Secretary of the Interior must assign a high priority and undertake aggressive management to achieve the elimination of hazardous fuel buildup and reduction of the risk of wildfire to the wildland/urban interface areas on Federal lands. Protection of human life and property, including water supplies and ambient air quality, must be given the highest priority. (7) The noncommodity resources, including riparian zones and wildlife habitats, in wildland/urban interface areas on Federal lands which must be protected to provide recreational opportunities, clean water, and other amenities to neighboring communities and the public suffer from a backlog of unfunded forest management projects designed to provide such protection. (8) In a period of fiscal austerity characterized by shrinking budgets and personnel levels, Congress must provide the Secretary of Agriculture and the Secretary of the Interior with innovative tools to accomplish the required reduction in hazardous fuels buildup and undertake other forest management projects in the wildland/urban interface areas on the Federal lands at least cost. (b) Purpose.--The purpose of this Act is to provide new authority and innovative tools to the Secretary of Agriculture and the Secretary of the Interior to safeguard communities, lives, and property by reducing or eliminating the threat of catastrophic wildfire, and to undertake needed forest management projects, in wildland/urban interface areas on Federal lands. SEC. 3. DEFINITIONS. As used in this Act: (1) Federal lands.--The term ``Federal lands'' means-- (A) federally managed lands administered by the Bureau of Land Management under the Secretary of the Interior; and (B) federally managed lands administered by the Secretary of Agriculture. (2) Forest management project.--The term ``forest management project'' means a project, including riparian zone enhancement, habitat improvement, forage removal by livestock grazing or mechanical means, and soil stabilization or other water quality improvement project, designed to protect one or more noncommodity resources on or in close proximity to Federal lands. (3) Land management plan.--The term ``land management plan'' means the following: (A) With respect to Federal lands described in paragraph (1)(A), a land use plan prepared by the Bureau of Land Management pursuant to section 202 of the Federal Land Policy and Management Act of 1976 (43 U.S.C. 1712), or other multiple-use plan currently in effect. (B) With respect to Federal lands described in paragraph (1)(B), a land and resource management plan (or if no final plan is in effect, a draft land and resource management plan) prepared by the Forest Service pursuant to section 6 of the Forest and Rangeland Renewable Resources Planning Act of 1974 (16 U.S.C. 1604). (4) Secretary concerned.--The term ``Secretary concerned'' means-- (A) with respect to the Federal lands described in paragraph (1)(A), the Secretary of the Interior; and (B) with respect to the Federal lands described in paragraph (1)(B), the Secretary of Agriculture. (5) Wildland/urban interface area.--The term ``wildland/ urban interface area'' means an area of Federal land in close proximity to communities and human habitations, such as homes, cabins, and other property. (6) Congressional committees.--The term ``congressional committees'' means the Committee on Resources and the Committee on Agriculture of the House of Representatives and the Committee on Energy and Natural Resources and the Committee on Agriculture, Nutrition, and Forestry of the Senate. (7) Hazardous fuels buildup.--The term ``hazardous fuels buildup'' means an accumulation of forage, woody debris, and predominantly dead and dying timber that has the likelihood of igniting. TITLE I--MANAGEMENT OF WILDLAND/URBAN INTERFACE AREAS SEC. 101. IDENTIFICATION OF WILDLAND/URBAN INTERFACE AREAS. (a) Annual Identification.--On or before September 30 of each year, each District Manager of the Bureau of Land Management and each Forest Supervisor of the Forest Service shall identify those areas on Federal lands within the jurisdiction of the District Manager or Forest Supervisor that the District Manager or Forest Supervisor determines-- (1) meet the definition of wildland/urban interface areas; and (2) have hazardous fuels buildups and other forest management needs that warrant the use of forest management projects as provided in section 102. (b) Treatment of Identification Process.--The identification of wildland/urban interface areas under subsection (a) that have hazardous fuels buildups and other forest management needs that warrant the use of forest management projects as provided in section 102 shall not be considered to be agency action for purposes of paragraph (2)(A) or (2)(E) of section 102 of the National Environmental Policy Act of 1969 (42 U.S.C. 4332). SEC. 102. CONTRACTING TO REDUCE HAZARDOUS FUELS AND UNDERTAKE FOREST MANAGEMENT PROJECTS IN WILDLAND/URBAN INTERFACE AREAS. (a) Contracting Authority.-- (1) In general.--The Secretary concerned is authorized to enter into contracts under this section for the sale of forest products in a wildland/urban interface area identified under section 101 for the purpose of reducing hazardous fuels buildups in the area. (2) Inclusion of forest management projects.--Subject to paragraph (3), the Secretary concerned may require, as a condition of any sale of forest products referred to in paragraph (1), that the purchaser of such products undertake one or more forest management projects in the wildland/urban interface area. (3) Conditions on inclusion.--The Secretary concerned may include a forest management project as a condition in a contract for the sale of forest products referred to in paragraph (1) only when the Secretary determines that-- (A) the forest management project is consistent with the applicable land management plan; and (B) the objectives of the forest management project can be accomplished most cost efficiently and effectively when the project is performed as part of the sale contract. (b) Financing and Supplemental Funding.-- (1) Forest management credits.--The financing of a forest management project required as a condition of a contract for a sale authorized by subsection (a) shall be accomplished through the inclusion in the contract of a provision for amortization of the cost of the forest management project through the issuance of forest management credits to the purchaser. Such forest management credits shall offset the cost of the required forest management project against the purchaser's payment for forest products. (2) Use of appropriated funds.--The Secretary concerned may use appropriated funds to assist the purchaser to undertake a forest management project required as a condition of a contract authorized by subsection (a) if such funds are provided from the resource function or functions that directly benefit from the performance of the project and are available from the annual appropriation for such function or functions during the fiscal year in which the sale is offered. The amount of assistance to be provided for each forest management project shall be included in the prospectus, and published in the advertisement, for the sale. (c) Determination of Forest Management Credits.--Prior to the advertisement of a sale authorized by subsection (a), the Secretary concerned shall determine the amount of forest management credits to be allocated to each forest management project to be required as a condition of the sale contract. A description of the forest management project, and the amount of the forest management credits allocated to the project, shall be included in the prospectus, and published in the advertisement, for the sale. (d) Transfer of Forest Management Credits.--The Secretary concerned may permit a purchaser that holds forest management credits earned by the purchaser as part of a sale authorized by subsection (a), but not used in connection with that sale, to transfer the forest management credits to another sale authorized by subsection (a) if-- (1) the subsequent sale is also purchased by that purchaser; and (2) the sale parcel is located on Federal lands under that Secretary's jurisdiction. (e) Treatment of Forest Management Credits as Moneys Received.-- (1) Bureau of land management lands.--In the case of Federal lands described in section 3(1)(A), all amounts earned by or allowed to any purchaser of a sale authorized by subsection (a) in the form of forest management credits shall be considered to be money received for purposes of title II of the Act of August 28, 1937 (50 Stat. 875; 43 U.S.C. 1181f), the first section of the Act of May 24, 1939 (53 Stat. 753; 43 U.S.C. 1181f-1), or other applicable law concerning the distribution of receipts from the sale of forest products on such lands. (2) Forest system lands.--In the case of Federal lands described in section 3(1)(B), all amounts earned by or allowed to any purchaser of a sale authorized by subsection (a) in the form of forest management credits shall be considered to be money received for purposes of the sixth paragraph under the heading ``FOREST SERVICE'' in the Act of May 23, 1908 (35 Stat. 260; 16 U.S.C. 500) and section 13 of the Act of March 1, 1911 (36 Stat. 963; commonly known as the Weeks Act; 16 U.S.C. 500). (f) Cost Considerations.--Because of the strong concern for the safety of human life and property and the protection of water quality, air quality, and wildlife habitat, a sale authorized by subsection (a) shall not be precluded because the costs of the sale may exceed the revenues derived from the sale, nor shall such sales be considered in any calculations concerning the revenue effects of the forest products sales program for the Federal lands or units of the Federal lands. (g) Other Requirements.--Nothing in this title shall be construed to require or authorize any alteration in the procedures or requirements for sales of forest products otherwise authorized by law, including the applicable provisions of the small business set-aside program. SEC. 103. MONITORING REQUIREMENTS. The Secretary concerned shall monitor the preparation and offering of contracts, and the performance of forest management projects, pursuant to section 102 to determine the effectiveness of such contracts and forest management projects in achieving the purpose of this Act. SEC. 104. REPORTING REQUIREMENTS. (a) Annual Report.--Not later than 90 days after the end of each full fiscal year in which contracts are entered into under section 102, the Secretary concerned shall submit to the congressional committees a report, which shall provide for the Federal lands within the jurisdiction of the Secretary concerned the following: (1) A list of the wildland/urban interface areas identified on or before September 30 of the previous fiscal year pursuant to section 101. (2) A summary of all contracts entered into, and all forest management projects performed, pursuant to section 102 during the preceding fiscal year; (3) A discussion of any delays in excess of three months encountered during the preceding fiscal year, and likely to occur in the fiscal year in which the report is submitted, in preparing and offering the sales, and in performing the forest management projects, pursuant to section 102. (4) The results of the monitoring required by section 103 of the contracts authorized, and the forest management projects performed, pursuant to section 102. (5) Any anticipated problems in the implementation of this title. (b) Four Year Report.--The fourth report prepared by the Secretary concerned under subsection (a) shall contain, in addition to the matters required by subsection (a), the following: (1) An assessment by the Secretary concerned regarding whether the contracting authority provided in section 102 should be reauthorized beyond the period specified in section 105(a). (2) If reauthorization is warranted, such recommendations as the Secretary concerned considers appropriate regarding changes in such authority to better achieve the purpose of this Act. SEC. 105. TERMINATION OF AUTHORITY. (a) Termination Date.--The authority of the Secretary concerned to offer sales of forest products pursuant to section 102, and to require the purchasers of such products to undertake forest management projects as a condition of such sales, shall terminate at the end of the five- fiscal year beginning on the first October 1st occurring after the date of the enactment of this Act. (b) Effect on Existing Sales.--Any contract for a sale of forest products pursuant to section 102 entered into before the end of the period specified in subsection (a), and still in effect at the end of such period, shall remain in effect after the end of such period pursuant to the terms of the contract. (c) Effect on Existing Forest Management Credits.--If any forest management credits from a sale of forest products pursuant to section 102 are not used before the end of the period specified in subsection (a), and no law providing authority to offer sales pursuant to section 102 after such period is enacted by Congress, such credits may be used after such period in any sale of forest products that is authorized by another law, is purchased by the purchaser of the sale in which the credits were earned, and is conducted by the Secretary concerned who had jurisdiction over the sale in which the credits were earned. TITLE II--FIRE DANGER REDUCTION BY REMOVAL OF GRASSES AND FORBS SEC. 201. REMOVAL OF EXCESS LEVELS OF GRASSES AND FORBS. (a) Contracting Authority.--Whenever a county commission or other unit of local government certifies to the Secretary concerned that there is a danger of fire in a wildland/urban interface area as a result of excessive levels of grasses and forbs on Federal lands in the area and requests the removal of the excessive grasses and forbs, the Secretary is authorized and encouraged to enter into contracts with livestock operators or other parties for the removal of the excessive grasses and forbs. (b) Removal Methods.--In the case of a contract under subsection (a) with a livestock operator, the operator shall use grazing to remove the excessive grasses and forbs. In the case of contracts with other persons, mechanical means, such as discing or mechanical mowing, shall be used. (c) Authorization of Appropriations.--There are authorized to be appropriated such sums as are necessary to carry out this section. TITLE III--MISCELLANEOUS PROVISIONS SEC. 301. REGULATIONS. Not later than 180 days after the date of the enactment of this Act, the Secretary concerned shall prescribe such regulations as are necessary and appropriate to implement this Act. SEC. 302. AUTHORIZATION OF APPROPRIATIONS. There are authorized to be appropriated for each of the first five fiscal years beginning after the date of the enactment of this Act such sums as may be necessary to carry out this Act.

Title: Community Protection and Hazardous Fuels Reduction Act of 1997 Summary: TABLE OF CONTENTS: Title I: Management of Wildland-Urban Interface Areas Title II: Fire Danger Reduction By Removal of Grasses and Forbs Title III: Miscellaneous Provisions Community Protection and Hazardous Fuels Reduction Act of 1997 - Title I: Management of Wildland-Urban Interface Areas - Requires the Bureau of Land Management and the Forest Service to identify wildlife-urban interface areas (areas of Federal land in close proximity to communities and human habitations) with hazardous fuels buildups and other forest management needs. (Sec. 102) Authorizes the Secretary of Agriculture or of the Interior to (temporarily) enter into forest product sales contracts in order to reduce hazardous fuels buildups in such areas, which may require the purchaser to undertake forest management projects under specified conditions in return for forest management credits. Title II: Fire Danger Reduction by Removal of Grasses and Forbs - Authorizes the Secretary concerned, upon local certification of fire hazard due to excessive grasses and forbs in such areas, to enter into livestock grazing contracts for such vegetation's removal. Authorizes appropriations. Title III: Miscellaneous Provisions - Requires the Secretary concerned to issue implementing regulations within a specified time. Authorizes program appropriations.

billsum

en

Summarize: Without an agreement from Congress, significant parts of the federal government will begin shutting down Tuesday in the latest partisan showdown on the budget. At the root of the dispute: funding for Obamacare. (Pictured: House Speaker John A. Boehner in Congress on Sept. 28). October 2013: Shutdown showdown Without an agreement from Congress, significant parts of the federal government will begin shutting down Tuesday in the latest partisan showdown on the budget. At the root of the dispute: funding for Obamacare. (Pictured: House Speaker John A. Boehner in Congress on Sept. 28). Melina Mara/The Washington Post Every president is disrupted by unanticipated crises, knocking the U.S. leader off his pins — and his agenda. Here are seven that President Obama has faced since August 2011: Every president is disrupted by unanticipated crises, knocking the U.S. leader off his pins – and his agenda. Here are a half-dozen in President Obama’s past two years. Every president is disrupted by unanticipated crises, knocking the U.S. leader off his pins – and his agenda. Here are a half-dozen in President Obama’s past two years. When the Justice Department began investigating possible leaks of classified information about North Korea in 2009, investigators did more than obtain telephone records of a working journalist suspected of receiving the secret material. They used security badge access records to track the reporter’s comings and goings from the State Department, according to a newly obtained court affidavit. They traced the timing of his calls with a State Department security adviser suspected of sharing the classified report. They obtained a search warrant for the reporter’s personal e-mails. The case of Stephen Jin-Woo Kim, the government adviser, and James Rosen, the chief Washington correspondent for Fox News, bears striking similarities to a sweeping leaks investigation disclosed last week in which federal investigators obtained records over two months of more than 20 telephone lines assigned to the Associated Press. At a time when President Obama’s administration is under renewed scrutiny for an unprecedented number of leak investigations, the Kim case provides a rare glimpse into the inner workings of one such probe. Court documents in the Kim case reveal how deeply investigators explored the private communications of a working journalist — and raise the question of how often journalists have been investigated as closely as Rosen was in 2010. The case also raises new concerns among critics of government secrecy about the possible stifling effect of these investigations on a critical element of press freedom: the exchange of information between reporters and their sources. “Search warrants like these have a severe chilling effect on the free flow of important information to the public,” said First Amendment lawyer Charles Tobin, who has represented the Associated Press, but not in the current case. “That’s a very dangerous road to go down.” Obama last week defended the Justice Department’s handling of the investigation involving the AP, which is focused on who leaked information to the news organization about a foiled plot involving the al-Qaeda affiliate in Yemen. AP executives and First Amendment watchdogs have criticized the Justice Department in part for the broad scope of the phone records it secretly subpoenaed from AP offices in Washington, Hartford, Conn., and New York. “The latest events show an expansion of this law enforcement technique,” said attorney Abbe Lowell, who is defending Kim on federal charges filed in 2010 that he disclosed national defense information. A trial is possible as soon as 2014. “Individual reporters or small time periods have turned into 20 [telephone] lines and months of records with no obvious attempt to be targeted or narrow.” The president said press freedoms must be balanced against the protection of U.S. personnel overseas. According to the office of Ronald Machen Jr., the U.S. attorney for the District, its prosecutors followed federal regulations by first seeking the information through other means before subpoenaing media phone records. Machen’s office is investigating both the Kim and AP cases. The Justice Department said in a statement that in both cases it had abided by “all applicable laws, regulations, and longstanding Department of Justice policies intended to safeguard the First Amendment interests of the press in reporting the news and the public in receiving it.” The Obama administration has pursued more such cases than all previous administrations combined, including one against a former CIA official charged with leaking U.S. intelligence on Iran and another against a former FBI contract linguist who pleaded guilty to leaking to a blogger. The Kim case began in June 2009, when Rosen reported that U.S. intelligence officials were warning that North Korea was likely to respond to United Nations sanctions with more nuclear tests. The CIA had learned the information, Rosen wrote, from sources inside North Korea. The story was published online the same day that a top-secret report was made available to a small circle within the intelligence community — including Kim, who at the time was a State Department arms expert with security clearance. FBI investigators used the security-badge data, phone records and e-mail exchanges to build a case that Kim shared the report with Rosen soon after receiving it, court records show. In the documents, FBI agent Reginald Reyes described in detail how Kim and Rosen moved in and out of the State Department headquarters at 2201 C St. NW a few hours before the story was published on June 11, 2009. “Mr. Kim departed DoS at or around 12:02 p.m. followed shortly thereafter by the reporter at or around 12:03 p.m.,” Reyes wrote. Next, the agent said, “Mr. Kim returned to DoS at or around 12:26 p.m. followed shortly thereafter by the reporter at or around 12:30 p.m.” The activity, Reyes wrote in an affidavit, suggested a “face-to-face” meeting between the two men. “Within a few hours after those nearly simultaneous exits and entries at DoS, the June 2009 article was published on the Internet,” he wrote. The court documents don’t name Rosen, but his identity was confirmed by several officials, and he is the author of the article at the center of the investigation. Rosen and a spokeswoman for Fox News did not return phone and e-mail messages seeking comment. Reyes wrote that there was evidence Rosen had broken the law, “at the very least, either as an aider, abettor and/or co-conspirator.” That fact distinguishes his case from the probe of the AP, in which the news organization is not the likely target. Using italics for emphasis, Reyes explained how Rosen allegedly used a “covert communications plan” and quoted from an e-mail exchange between Rosen and Kim that seems to describe a secret system for passing along information. In the exchange, Rosen used the alias “Leo” to address Kim and called himself “Alex,” an apparent reference to Alexander Butterfield, the man best known for running the secret recording system in the Nixon White House, according to the affidavit. Rosen instructed Kim to send him coded signals on his Google account, according to a quote from his e-mail in the affidavit: “One asterisk means to contact them, or that previously suggested plans for communication are to proceed as agreed; two asterisks means the opposite.” He also wrote, according to the affidavit: “What I am interested in, as you might expect, is breaking news ahead of my competitors” including “what intelligence is picking up.” And: “I’d love to see some internal State Department analyses.” Court documents show abundant evidence gathered from Kim’s office computer and phone records, but investigators said they needed to go a step further to build their case, seizing two days’ worth of Rosen’s personal e-mails — and all of his e-mail exchanges with Kim. Privacy protections limit searching or seizing a reporter’s work, but not when there is evidence that the journalist broke the law against unauthorized leaks. A federal judge signed off on the search warrant — agreeing that there was probable cause that Rosen was a co-conspirator. Machen’s office said in a statement that it is limited in commenting on an open case, but that the government “exhausted all reasonable non-media alternatives for collecting the evidence” before seeking a search warrant. However, it remains an open question whether it’s ever illegal, given the First Amendment’s protection of press freedom, for a reporter to solicit information. No reporter, including Rosen, has been prosecuted for doing so. In the hours before Rosen’s story was published, Kim was one of more than 95 people who saw the intelligence report through a classified database, according to court documents. Kim’s phone records showed that seven calls lasting from 18 seconds to more than 11 minutes were placed between Kim’s desk telephone and Rosen’s cellphone and desk phone at the State Department, according to the court documents. Investigators pulled at least two months of phone records from Kim’s desk and found 36 calls with numbers associated with Rosen. Investigators also scrutinized computer records and found that someone who had logged in with Kim’s user profile viewed the classified report “at or around” the same time two calls were placed from his desk phone to Rosen, according to the documents. Two months later on an August evening, diplomatic security secretly entered Kim’s office and found a copy of Rosen’s article next to his computer. Kim, who worked in a secure facility, was subject to daily office inspections. The Fox News article was also in “plain view” during follow-up visits in late September. Kim initially told the FBI in an interview that month that he had met the reporter in March but had not had contact since. Later, Kim admitted to additional contacts, according to the affidavit. Related: See the court affidavit A Fox News correspondent was accused in a Justice Department affidavit of being a possible criminal "co-conspirator" for his alleged role in publishing sensitive security information -- in a leak case that takes the highly unusual step of claiming a journalist broke the law. According to court documents, the Justice Department obtained a portfolio of information about Fox News' James Rosen's conversations and visits to the State Department. This included a search warrant for his personal emails. The effort follows that by the department to secretly obtain two months of phone records from Associated Press journalists as part of a separate leak probe. The department in this case, though, went a step further -- as an FBI agent claimed there's evidence the Fox News correspondent broke the law, "at the very least, either as an aider, abettor and/or co-conspirator." Michael Clemente, Fox News' executive vice president of news, defended Rosen in a statement issued Monday afternoon. "We are outraged to learn today that James Rosen was named a criminal co-conspirator for simply doing his job as a reporter," Clemente said. "In fact, it is downright chilling. We will unequivocally defend his right to operate as a member of what up until now has always been a free press." The case has also caught the attention of Congress. Sen. Marco Rubio, R-Fla., said in a statement Monday he was "very concerned" about the reports of "possible criminal prosecution for doing what appears to be normal news-gathering protected by the First Amendment." He added: "The sort of reporting by James Rosen detailed in the report is the same sort of reporting that helped Mr. Rosen aggressively pursue questions about the Administration's handling of Benghazi. National security leaks are criminal and put American lives on the line, and federal prosecutors should, of course, vigorously investigate. But we expect that they do so within the bounds of the law, and that the investigations focus on the leakers within the government -- not on media organizations that have First Amendment protections and serve vital function in our democracy." In the case involving Rosen, a government adviser was accused of leaking information after a 2009 story was published online which said North Korea planned to respond to looming U.N. sanctions with another nuclear test. An affidavit entered by FBI agent Reginald Reyes claimed there was "probable cause" to believe Rosen -- identified only as "the reporter" -- had violated a provision of U.S. law barring the unauthorized disclosure of defense information. This is where Reyes labeled Rosen as a possible "co-conspirator" -- an allegation used to gain access to two days' worth of emails. The search warrant for that request was ultimately approved, the records show. Investigators, in pursuing the case, also obtained records of Rosen's visits to the State Department headquarters by tracking security-badge information. As first reported by The Washington Post, a court affidavit said they used the badge records to log his visits as well as the movements of the adviser, Stephen Jim-Woo Kim. The FBI agent said in the affidavit that the visits suggested a "face-to-face" meeting. According to the Post, investigators also obtained two months of phone records from Kim's office. Rosen said Monday that "as a reporter, I always honor the confidentiality of my dealings with all of my sources." He was not contacted by any government or law enforcement representative during the investigation. White House Press Secretary Jay Carney, asked about the case Monday, said he could not comment on the "ongoing investigation." He said President Obama is a "strong defender of the First Amendment," but also is "insistent that we protect our secrets, that we protect classified information." The Department of Justice said in a statement Monday that "leaks of classified information to the press can pose a serious risk of harm to our national security and it is important that we pursue these matters using appropriate law enforcement tools." The U.S. attorney's office for the District of Columbia also said the government, before seeking approval for the search warrant, "exhausted all reasonable non-media alternatives for collecting this evidence." While Kim has already been indicted, the office said no other charges have been brought. "Based on the investigation and all of the facts known to date, no other individuals, including the reporter, have been charged since Mr. Kim was indicted nearly three years ago," the office said. Attorney General Eric Holder said at a House hearing last week that he is not interested in prosecuting the press. "With regard to the potential prosecution of the press for the disclosure of material, that is not something that I've ever been involved in, heard of or would think would be a wise policy," he said on May 15. The seizure of records from the AP offices also spanned two months. AP President Gary Pruitt said on CBS' "Face the Nation" Sunday that the AP records grab was not only unconstitutional but damaging to the operation of the press. "It will hurt," he said. "We're already seeing some impact. Officials are saying they're reluctant to talk."

Summary: Of all the news organizations the government could spy on, it chose to tangle with... Fox News. And this one goes further than the AP. The Justice Department examined Fox News reporter James Rosen's personal emails, phone records, and visits to the State Department, the Washington Post reports. The move was part of an investigation into a possible leak of classified information on North Korea, prompted by an article Rosen wrote in 2009 that investigators believed was based on intel from a top-secret CIA report. (The Post reports investigators believe the report was given to him by State Department security adviser Stephen Jin-Woo Kim.) Unlike the AP case, however, the FBI says Rosen may have broken the law, as an "aider, abettor and/or co-conspirator." Fox is, as you might expect, furious. "We are outraged to learn today that James Rosen was named a criminal co-conspirator for simply doing his job as a reporter," the network's VP of news said in a statement, as reported by Fox News. "In fact, it is downright chilling. We will unequivocally defend his right to operate as a member of what up until now has always been a free press." Also pissed? Marco Rubio, who said the feds should "vigorously investigate" national security leaks, but "we expect... that the investigations focus on the leakers within the government-not on media organizations that have First Amendment protections and serve vital function in our democracy."

multi_news

en

Summarize: The ladies of Longbourn soon waited on those of Netherfield. The visit was returned in due form. Miss Bennet's pleasing manners grew on the good will of Mrs. Hurst and Miss Bingley; and though the mother was found to be intolerable and the younger sisters not worth speaking to, a wish of being better acquainted with _them_, was expressed towards the two eldest. By Jane this attention was received with the greatest pleasure; but Elizabeth still saw superciliousness in their treatment of every body, hardly excepting even her sister, and could not like them; though their kindness to Jane, such as it was, had a value as arising in all probability from the influence of their brother's admiration. It was generally evident whenever they met, that he _did_ admire her; and to _her_ it was equally evident that Jane was yielding to the preference which she had begun to entertain for him from the first, and was in a way to be very much in love; but she considered with pleasure that it was not likely to be discovered by the world in general, since Jane united with great strength of feeling, a composure of temper and a uniform cheerfulness of manner, which would guard her from the suspicions of the impertinent. She mentioned this to her friend Miss Lucas. "It may perhaps be pleasant," replied Charlotte, "to be able to impose on the public in such a case; but it is sometimes a disadvantage to be so very guarded. If a woman conceals her affection with the same skill from the object of it, she may lose the opportunity of fixing him; and it will then be but poor consolation to believe the world equally in the dark. There is so much of gratitude or vanity in almost every attachment, that it is not safe to leave any to itself. We can all _begin_ freely--a slight preference is natural enough; but there are very few of us who have heart enough to be really in love without encouragement. In nine cases out of ten, a woman had better shew _more_ affection than she feels. Bingley likes your sister undoubtedly; but he may never do more than like her, if she does not help him on." "But she does help him on, as much as her nature will allow. If _I_ can perceive her regard for him, he must be a simpleton indeed not to discover it too." "Remember, Eliza, that he does not know Jane's disposition as you do." "But if a woman is partial to a man, and does not endeavour to conceal it, he must find it out." "Perhaps he must, if he sees enough of her. But though Bingley and Jane meet tolerably often, it is never for many hours together; and as they always see each other in large mixed parties, it is impossible that every moment should be employed in conversing together. Jane should therefore make the most of every half hour in which she can command his attention. When she is secure of him, there will be leisure for falling in love as much as she chuses." "Your plan is a good one," replied Elizabeth, "where nothing is in question but the desire of being well married; and if I were determined to get a rich husband, or any husband, I dare say I should adopt it. But these are not Jane's feelings; she is not acting by design. As yet, she cannot even be certain of the degree of her own regard, nor of its reasonableness. She has known him only a fortnight. She danced four dances with him at Meryton; she saw him one morning at his own house, and has since dined in company with him four times. This is not quite enough to make her understand his character." "Not as you represent it. Had she merely _dined_ with him, she might only have discovered whether he had a good appetite; but you must remember that four evenings have been also spent together--and four evenings may do a great deal." "Yes; these four evenings have enabled them to ascertain that they both like Vingt-un better than Commerce; but with respect to any other leading characteristic, I do not imagine that much has been unfolded." "Well," said Charlotte, "I wish Jane success with all my heart; and if she were married to him to-morrow, I should think she had as good a chance of happiness, as if she were to be studying his character for a twelvemonth. Happiness in marriage is entirely a matter of chance. If the dispositions of the parties are ever so well known to each other, or ever so similar before-hand, it does not advance their felicity in the least. They always continue to grow sufficiently unlike afterwards to have their share of vexation; and it is better to know as little as possible of the defects of the person with whom you are to pass your life." "You make me laugh, Charlotte; but it is not sound. You know it is not sound, and that you would never act in this way yourself." Occupied in observing Mr. Bingley's attentions to her sister, Elizabeth was far from suspecting that she was herself becoming an object of some interest in the eyes of his friend. Mr. Darcy had at first scarcely allowed her to be pretty; he had looked at her without admiration at the ball; and when they next met, he looked at her only to criticise. But no sooner had he made it clear to himself and his friends that she had hardly a good feature in her face, than he began to find it was rendered uncommonly intelligent by the beautiful expression of her dark eyes. To this discovery succeeded some others equally mortifying. Though he had detected with a critical eye more than one failure of perfect symmetry in her form, he was forced to acknowledge her figure to be light and pleasing; and in spite of his asserting that her manners were not those of the fashionable world, he was caught by their easy playfulness. Of this she was perfectly unaware;--to her he was only the man who made himself agreeable no where, and who had not thought her handsome enough to dance with. He began to wish to know more of her, and as a step towards conversing with her himself, attended to her conversation with others. His doing so drew her notice. It was at Sir William Lucas's, where a large party were assembled. "What does Mr. Darcy mean," said she to Charlotte, "by listening to my conversation with Colonel Forster?" "That is a question which Mr. Darcy only can answer." "But if he does it any more I shall certainly let him know that I see what he is about. He has a very satirical eye, and if I do not begin by being impertinent myself, I shall soon grow afraid of him." On his approaching them soon afterwards, though without seeming to have any intention of speaking, Miss Lucas defied her friend to mention such a subject to him, which immediately provoking Elizabeth to do it, she turned to him and said, "Did not you think, Mr. Darcy, that I expressed myself uncommonly well just now, when I was teazing Colonel Forster to give us a ball at Meryton?" "With great energy;--but it is a subject which always makes a lady energetic." "You are severe on us." "It will be _her_ turn soon to be teazed," said Miss Lucas. "I am going to open the instrument, Eliza, and you know what follows." "You are a very strange creature by way of a friend!--always wanting me to play and sing before any body and every body!--If my vanity had taken a musical turn, you would have been invaluable, but as it is, I would really rather not sit down before those who must be in the habit of hearing the very best performers." On Miss Lucas's persevering, however, she added, "Very well; if it must be so, it must." And gravely glancing at Mr. Darcy, "There is a fine old saying, which every body here is of course familiar with--'Keep your breath to cool your porridge,'--and I shall keep mine to swell my song." Her performance was pleasing, though by no means capital. After a song or two, and before she could reply to the entreaties of several that she would sing again, she was eagerly succeeded at the instrument by her sister Mary, who having, in consequence of being the only plain one in the family, worked hard for knowledge and accomplishments, was always impatient for display. Mary had neither genius nor taste; and though vanity had given her application, it had given her likewise a pedantic air and conceited manner, which would have injured a higher degree of excellence than she had reached. Elizabeth, easy and unaffected, had been listened to with much more pleasure, though not playing half so well; and Mary, at the end of a long concerto, was glad to purchase praise and gratitude by Scotch and Irish airs, at the request of her younger sisters, who with some of the Lucases and two or three officers joined eagerly in dancing at one end of the room. Mr. Darcy stood near them in silent indignation at such a mode of passing the evening, to the exclusion of all conversation, and was too much engrossed by his own thoughts to perceive that Sir William Lucas was his neighbour, till Sir William thus began. "What a charming amusement for young people this is, Mr. Darcy!--There is nothing like dancing after all.--I consider it as one of the first refinements of polished societies." "Certainly, Sir;--and it has the advantage also of being in vogue amongst the less polished societies of the world.--Every savage can dance." Sir William only smiled. "Your friend performs delightfully;" he continued after a pause, on seeing Bingley join the group;--"and I doubt not that you are an adept in the science yourself, Mr. Darcy." "You saw me dance at Meryton, I believe, Sir." "Yes, indeed, and received no inconsiderable pleasure from the sight. Do you often dance at St. James's?" "Never, sir." "Do you not think it would be a proper compliment to the place?" "It is a compliment which I never pay to any place if I can avoid it." "You have a house in town, I conclude?" Mr. Darcy bowed. "I had once some thoughts of fixing in town myself--for I am fond of superior society; but I did not feel quite certain that the air of London would agree with Lady Lucas." He paused in hopes of an answer; but his companion was not disposed to make any; and Elizabeth at that instant moving towards them, he was struck with the notion of doing a very gallant thing, and called out to her, "My dear Miss Eliza, why are not you dancing?--Mr. Darcy, you must allow me to present this young lady to you as a very desirable partner.--You cannot refuse to dance, I am sure, when so much beauty is before you." And taking her hand, he would have given it to Mr. Darcy, who, though extremely surprised, was not unwilling to receive it, when she instantly drew back, and said with some discomposure to Sir William, "Indeed, Sir, I have not the least intention of dancing.--I entreat you not to suppose that I moved this way in order to beg for a partner." Mr. Darcy with grave propriety requested to be allowed the honour of her hand; but in vain. Elizabeth was determined; nor did Sir William at all shake her purpose by his attempt at persuasion. "You excel so much in the dance, Miss Eliza, that it is cruel to deny me the happiness of seeing you; and though this gentleman dislikes the amusement in general, he can have no objection, I am sure, to oblige us for one half hour." "Mr. Darcy is all politeness," said Elizabeth, smiling. "He is indeed--but considering the inducement, my dear Miss Eliza, we cannot wonder at his complaisance; for who would object to such a partner?" Elizabeth looked archly, and turned away. Her resistance had not injured her with the gentleman, and he was thinking of her with some complacency, when thus accosted by Miss Bingley, "I can guess the subject of your reverie." "I should imagine not." "You are considering how insupportable it would be to pass many evenings in this manner--in such society; and indeed I am quite of your opinion. I was never more annoyed! The insipidity and yet the noise; the nothingness and yet the self-importance of all these people!--What would I give to hear your strictures on them!" "Your conjecture is totally wrong, I assure you. My mind was more agreeably engaged. I have been meditating on the very great pleasure which a pair of fine eyes in the face of a pretty woman can bestow." Miss Bingley immediately fixed her eyes on his face, and desired he would tell her what lady had the credit of inspiring such reflections. Mr. Darcy replied with great intrepidity, "Miss Elizabeth Bennet." "Miss Elizabeth Bennet!" repeated Miss Bingley. "I am all astonishment. How long has she been such a favourite?--and pray when am I to wish you joy?" "That is exactly the question which I expected you to ask. A lady's imagination is very rapid; it jumps from admiration to love, from love to matrimony in a moment. I knew you would be wishing me joy." "Nay, if you are so serious about it, I shall consider the matter as absolutely settled. You will have a charming mother-in-law, indeed, and of course she will be always at Pemberley with you." He listened to her with perfect indifference, while she chose to entertain herself in this manner, and as his composure convinced her that all was safe, her wit flowed long.

Summary: The Bennet sisters get to know Miss Bingley and Mrs. Hurst more, and while Bingley's sisters would like to know Jane and Elizabeth better, they have no use for their mother or their two younger sisters. Elizabeth tells Charlotte that she thinks it is good that Jane does not flaunt her good feelings for Bingley, and Charlotte says that she should show them more if she wishes anything to come of it. While Elizabeth is busy taking note of the relationship between Bingley and her sister, she does not notice the increased interest Darcy has in her. While at first he found her merely tolerable, he now finds her more pleasing, and desires to get to know her more. At a party at Sir William's, the host tries to get the two to dance, and Darcy is willing, but Elizabeth turns him down. Miss Bingley then discovers Darcy's admiration for Elizabeth.

booksum

en

Write a title and summarize: The presence of bottlenecks in the transmission cycle of many RNA viruses leads to a severe reduction of number of virus particles and this occurs multiple times throughout the viral transmission cycle. Viral replication is then necessary for regeneration of a diverse mutant swarm. It is now understood that any perturbation of the mutation frequency either by increasing or decreasing the accumulation of mutations in an RNA virus results in attenuation of the virus. To determine if altering the rate at which a virus accumulates mutations decreases the probability of a successful virus infection due to issues traversing host bottlenecks, a series of mutations in the RNA-dependent RNA polymerase of Venezuelan equine encephalitis virus (VEEV), strain 68U201, were tested for mutation rate changes. All RdRp mutants were attenuated in both the mosquito and vertebrate hosts, while showing no attenuation during in vitro infections. The rescued viruses containing these mutations showed some evidence of change in fidelity, but the phenotype was not sustained following passaging. However, these mutants did exhibit changes in the frequency of specific types of mutations. Using a model of mutation production, these changes were shown to decrease the number of stop codons generated during virus replication. This suggests that the observed mutant attenuation in vivo may be due to an increase in the number of unfit genomes, which may be normally selected against by the accumulation of stop codons. Lastly, the ability of these attenuated viruses to transition through a bottleneck in vivo was measured using marked virus clones. The attenuated viruses showed an overall reduction in the number of marked clones for both the mosquito and vertebrate hosts, as well as a reduced ability to overcome the known bottlenecks in the mosquito. This study demonstrates that any perturbation of the optimal mutation frequency whether through changes in fidelity or by alterations in the mutation frequency of specific nucleotides, has significant deleterious effects on the virus, especially in the presence of host bottlenecks. RNA viruses comprise a diverse group of viruses, which exhibit high genome plasticity due to a high rate of mutation. This results in the generation of a closely related cloud of viral variants known as a ‘quasispecies’ or viral swarm [1]. The generation of this viral swarm is a result of the viral RNA-dependent RNA polymerase (RdRp), which does not possess a proof-reading function. Rather than producing perfect copies of the genome, the RdRp randomly incorporates incorrect nucleotide bases along the genome, generating a cloud of viral genomes that contain one or two mutations in each genome [2]. These variants are believed to collectively contribute to an interactive population that together create the viral phenotype. This population of variants is subject to selection as a whole, rather than selection acting on individual variants. The presence of this diversity is thought to be an advantage for viral transmission and invasion of host tissues [3]. One benefit of adopting a high mutation strategy is that this allows viruses to produce multiple advantageous mutations. The virus is therefore able to infect and replicate in multiple tissue types, each with their own different selective pressures. For arboviruses (arthropod-borne viruses) creating a diverse quasispecies is hypothesized to be of utmost importance, as two diverse species, a vertebrate host and invertebrate vector, must become infected to complete a transmission cycle, and recent work has demonstrated that diversity is important in successful completion of a transmission cycle [4–7]. Bottlenecks are present in all transmission cycles as viruses move from one tissue to another. Studies using marked clones have shown that bottlenecks are more common than were previously thought [5,6, 8], and, at least in some systems, conform to the stochastic nature of bottlenecks so that the virus that traverses the bottleneck is selected at random. What is still unclear is how important bottlenecks are in altering viral diversity, and the robustness of viruses with altered diversity to traverse bottlenecks. Recent studies using wild-type viruses have shown that the virus is able to recover diversity within four days of experiencing the bottleneck, such that the diversity in the next tissue is similar to that in the original tissue [7]. However, successful recovery following the bottleneck is hypothesized to be associated with the successful generation of minority variants. Virologists have come to understand that any perturbation of virus diversity has adverse consequences for the virus population as a whole. Almost all viruses that have been demonstrated to have either higher or lower diversity are attenuated compared to the wild-type in vivo, but replicate similarly to wild-type in vitro [9–14]. These viruses are collectively known as fidelity variants, as they either incorporate a higher or lower number of mutations than the wild-type. High-fidelity variants incorporate lower numbers of mutations, where-as low-fidelity mutants incorporate more mutations than the wild-type virus. Generally, the changes in fidelity are thought to be due to two different, but related mechanisms; the speed of the polymerase or mutations either distal or proximal to the active site that result in altered fidelity of the RdRp [15]. Previous work with Venezuelan equine encephalitis virus (VEEV) in the mosquito vector Culex taeniopus has demonstrated the presence of bottlenecks during normal transmission and infection of the mosquito vector. VEEV is a New World encephalitic alphavirus endemic to parts of Central and South America, and is transmitted between mosquitoes and small rodents. Although often misdiagnosed as dengue fever due to the constant circulation in the same geographic area, VEEV is thought to cause tens of thousands of human infections annually [16]. Importantly, VEEV is considered a potential threat to biosecurity due to its high infectivity via the aerosol route. To determine the how perturbing the mutation spectrum of RNA viruses affects its ability to move through bottlenecks, a series of mutations in the RdRp of the VEEV strain IE 68U201 were created and validated for their changes in fidelity and alterations in mutation frequency. These mutants were then tested to assess their ability to traverse bottlenecks in the vertebrate host, modelled using a wild-type mouse, and the mosquito vector (Cx. taeniopus). Previous work with the vaccine strain of VEEV, TC-83, demonstrated that three mutations in the RdRp collectively contributed to a decrease in virus fidelity, resulting in attenuation in a vertebrate model [11]. To determine the effects of these mutations in a different virus subtype, the mutations identified in TC-83 plus one identified in chikungunya virus (CHIKV) [10] were inserted in the 68U201 backbone and rescued, generating three RdRp mutants (Fig 1A). The first RdRp mutant contained a single nucleotide mutation producing the single G7R amino acid change in the RdRp. The second RdRp mutant, the 3x mutant, contained three amino acid mutations in the RdRp, including G7R, E31G, and S90T. The final RdRp mutant, 4x mutant, contained the following amino acid mutations in the RdRp: G7R, E31G, S90T, and C482Y. To verify that the inserted mutations did not change the replication kinetics of the viruses, growth curves at a multiplicity of infection (MOI) of 10 were conducted for all mutants and the wild-type virus 68U201 (Fig 1B). All mutants replicated to similar titers and there were no statistical differences between mutants and wild-type as determined by one-way ANOVA. Resistance to nucleoside analogues has been one of the tools for determining the presence of a fidelity mutation, as high fidelity viruses are less likely to incorporate mutagens, while low-fidelity viruses should be more susceptible [14,17,18]. Thus, to determine if these mutations confer resistance or increased sensitivity to RNA mutagens, each RdRp mutant was tested for resistance to 5’fluorouracil (5FU) at a range of concentrations (Fig 1C). All three RdRp mutants showed significantly lowered titers compared to wild-type at concentrations of 100 ng/μl 5FU or higher as determined by two-way ANOVA. To determine if these inserted mutations altered virus fidelity, each RdRp mutant along with the wild-type virus were used to infect the vertebrate cell lines, MRC-5 and Vero, and the mosquito cell line U4. 4 at an MOI of 0. 1. At 24 hours post infection, the viruses were harvested and the viral RNA extracted and sequenced using Illumina sequencing to determine the amount of diversity within each virus population (Fig 1D). The G7R mutation significantly increased virus diversity compared to the wild-type strain when tested by two-way ANOVA (p<0. 0001) in all three cell types. The 3x mutation showed a significant reduction in diversity compared to the wild-type strain in U4. 4 cells (p<0. 0001), and a non-significant reduction in Vero and MRC-5 cells. The 4x mutant showed a slight reduction in diversity, but this was only significant in U4. 4. cells (p = 0. 05) and not in either MRC-5 or Vero cells. To determine the stability of the mutations and the phenotype associated with them, the wild-type and RdRp mutant viruses were passaged five times using Vero cells. Following the fifth passage, the growth kinetics and sensitivity to 5FU assays were repeated with passage 5 virus (S1 Fig). There was no significant difference in viral titer between any RdRp mutant and the wild-type virus at any time point of the growth curve or any concentration of 5FU. To verify the mechanism of attenuation of the RdRp mutants, stocks of the electroporated viruses were titered to determine the number of viable viral particles, as well as the number of RNA genomes produced as determined by real-time RT-PCR (i. e. to determine the specific infectivity (SI) of the viruses). All four viruses produced equivalent amounts of genome copies to the wild-type, which shows that the rate of genome replication was not altered as a result of the mutations (Fig 1E). However, the titer of the RdRp mutants was significantly decreased as compared to the wild-type virus. Thus, the SI of the mutants is reduced compared to the wild-type. The wild-type had a SI of 6x10-4, whereas the G7R mutant has a SI of 9x10-6, and the 3x and 4x mutants have a SI of 1x 10−7 and 7x10-7, respectively. To test if the apparent changes in entropy were the result of particular mutational biases, the propensity for specific base changes was determined for the MRC-5, Vero and U. 4. 4 cells individually (S2 Fig) and combined (Fig 2). There were significant differences associated with specific base changes as determined by two-way ANOVA and each change from the wild-type 68U201 is shown in Fig 2 for both individual cell types and when all cell types were combined. The G7R mutation resulted in a significant increase in the number of G-A, G-C, C-A, A-C, A-T and T-C mutations, while decreasing the number of T-G mutations. The 3x RdRp mutant produced a significantly higher proportion of T-A mutations and significant decreases of G-T mutations. However, the addition of the two extra mutations, E31G and S90T, reduced the effect of the C-G and the A-C changes so that no significant change in base changes was observed compared to that observed in the G7R mutation. The addition of the C482Y mutation in the 4x mutant resulted in an increase in the number of A-G mutations and a decrease in the number of A-C mutations, albeit at a lower significance than associated with the other RdRp mutants. As these RdRp mutants caused changes in mutation frequency that resulted in attenuation, it was hypothesized that these changes altered the number of viruses with viable genomes, i. e. increased the number of stop codons resulting in more unfit viral particles. To determine if these mutational changes resulted in an increase in truncated genomes, a model was set up to determine if these alterations would result in more or less lethal mutations. The specific base frequency changes shown in Table 1 were used to generate mutations randomly along the coding portion of each genome at a rate of 1 mutation in every 10,000 nucleotides added. One hundred billion genomes were generated, and then each in silico nascent genome was translated to determine the number of additional stop codons generated compared to the wild-type 68U201. Although it was expected that the number of stop codons would increase, the model indicates that the alteration in base changes actually leads to a reduced number of stop codons compared to the wild-type 68U201 virus (p<0. 0001, by one-way ANOVA) (Fig 2C) (S1 Table). Translation of the data used to generate the frequencies showed the same reduction in the number of stop codons in the RdRp mutants (S2E Fig). RdRp mutant and wild-type viruses were inoculated into mice to determine the effects of the RdRp mutations on virulence. There was a reduction in mortality and increase in time to death for the RdRp mutants compared to the wild-type 68U201 in adult mice (Fig 3A). All of the RdRp mutants showed a significant reduction in mortality as measured by the Log-Rank test. This was also reflected in weight, with the wild-type virus (68U201) showing increased weight loss compared to the mutated viruses (Fig 3B). Interestingly, some animals survived even after 30% weight loss when infected with the G7R mutant. These animals did show evidence of neurological disease following a gain in weight, but animals were still gaining weight when the experiment was terminated. This is highly unusual for VEEV [19], and suggests that these animals were able to clear the virus from the brain and recover from the severe disease. Therefore, viremia titers were examined for each animal to determine the severity of the viremia compared to the wild-type 68U201. For all the RdRp mutants there was a significant drop in the amount of virus in the blood compared to the wild-type 68U201 strain with p<0. 0001 by one-way ANOVA (Fig 3C). When the RdRp mutants were used to infect cohorts of Cx. taeniopus mosquitoes, there was a significant reduction in the number of disseminated infections compared to the wild-type 68U201 strain (Fig 4). The percent of mosquitoes with infections in the legs/wings and salivary glands was significantly reduced for all three RdRp mutants compared to the wildtype virus. To test how altered mutation frequencies affected the ability of the virus to traverse a bottleneck, a series of silent mutations were inserted into the G7R, 3x and 4x RdRp mutants, generating 8 neutral marked viruses of each RdRp mutant. These marked viruses were previously described in Forrester et al. 2012 [6], and used to determine the number of bottlenecks in the mosquito Cx. taeniopus. Mice were intravenously infected with an equal amount of each marked virus so that they exhibited an artificial viremia of approximately 105 PFU/ml or 106 PFU/ml, and mosquitoes were allowed to feed on the mice for 45 minutes. Mice were bled both before and after the feed to verify the final titer of the blood fed to mosquitoes. Mosquitoes were then sampled on day 1 (midguts and bodies), and days 4,8, and 12 (bodies, legs/wings and saliva). The number of marked viruses present in each sample was determined using a real-time assay that allowed each marked virus to be identified. When exposed to 6. 5 x 105 PFU/ml of the G7R marked viruses, none of the mosquitoes had virus dissemination outside of the midgut/body (Fig 5A). These mosquitos had a mean of 3 marked viruses in the midgut and 1. 667 in the bodies. However, when the mosquitoes were exposed to 7. 6 x106 PFU/ml of the G7R marked virus mixture, there were 3. 6 marked viruses on average that initiated infection in the midguts, and 2. 281 in the bodies (Fig 5D). The legs/wings showed an average of 1 marked virus per tissue. Only one mosquito was positive for virus in the saliva, and this sample also had only one marked virus. For the 3x mutant, none of the mosquitoes showed dissemination outside the midgut/bodies when the mosquitoes were exposed to 9. 6 x 105 PFU/ml of the marked viruses. Fewer than 2 marked viruses initiated all infections, and this was reflected in an average of 1. 250 marked viruses in the midguts and 1. 175 in the bodies (Fig 5B). When the mosquitoes were exposed to 1. 06 x 106 PFU/ml of marked viruses, a similar number were found with an average of 1. 33 in the midguts, 1. 155 in the bodies, and 1 in the legs/wings. However, no virus was found in the saliva of any of the mosquitoes (Fig 5E). While there is little or no difference in the titers seen between the two experiments, the 3x mutant showed consistent results and a more severe bottleneck than the wild-type virus (S5 Fig) There was again a significant reduction in the number of marked viruses when the mosquitoes were exposed to 4. 8x104 PFU/ml of the 4x marked clones. Less than 2 clones initiated all infections, with an average of 1 marked virus in the midgut and 1. 507 marked viruses in the bodies (Fig 5C). However, when exposed to 2. 03 x106 PFU/ml of virus, there was a limited amount of dissemination with a maximum of 3 marked clones per tissue (Fig 5F). Dissemination was observed in only two mosquitoes from this group; one mosquito showed dissemination to the legs/wings and one showed dissemination to the saliva. Interestingly, the legs/wings of the mosquito with saliva positive for virus did not show any evidence of infection. The results from this experiment were compared to the previous results in the wild-type and while there was a significant reduction in the number of marked clones in the bodies (S5 Fig), given the small number of mosquitoes that showed disseminated infection, it was not possible to determine statistical significance in the legs/wings and saliva compared to that previously seen. To determine if the titer was responsible for the number of clones, we calculated the titer using standard curves generated similar to those described in Forrester et al. (2012) [6]. These results can be found in S5A–S5F Fig). The samples could be divided into those with titers over 105 pfu/ml and those under 105 pfu/ml. However, there was no correlation between the number of marked viruses and the titer (S5G Fig) indicating that the number of marked viruses was not influenced by the titer of the infection. To investigate if the RdRp mutants were also attenuated in the vertebrate host, the marked viruses were injected into 6-week old CD-1 outbred mice and organs were collected daily for 7 days. The lymph nodes (LN), blood and brain were chosen for sampling because the LN is the primary site of replication, the blood is the means for transmission and the brain indicates the severity of the pathogenesis. Compared to the wild-type infection, there was a significant reduction in the number of marked viruses in the LN and the brain for all three RdRp mutants (Table 2 and Fig 6), whereas the number of marked viruses in the blood showed no significant change from the wild-type. In particular the 3x RdRp mutant showed a large reduction in the number of infected mice, with mice only being infected through day 4, though this could be due to random sampling of the animals and the nature of the terminal sampling carried out. There was no apparent bias in which clone was selected, and in the wild-type mice all 8 marked viruses were present in all organs. To confirm that this was not because of the presence of circulating blood in all the organs, a second infection was carried out where the mice were perfused to remove circulating virus in the blood, and all 8 clones were identified in the majority of tissues (S6 Fig). Viral diversity is an important factor affecting RNA virulence and transmission. Generation of viral diversity allows the virus to effectively move between cells and cell types in vivo. It also increases the potential for the virus to continue its transmission cycle. Virus diversity is thought to be even more important for arboviruses, which infect a two-host system, as the virus must infect both a vertebrate host and a mosquito vector. It is well known that the virus undergoes numerous bottlenecks, or reductions in viral numbers, when going from host to host [6,20]. This results in a small founding population that initiates infection within the new host. Bottlenecks imposed during transmission decrease the diversity of the viral population, therefore altering the course of infection by inhibiting the pathogen’s ability to adapt to the new host. The smaller the founding population, the slower adaption occurs [21]. A more diverse population covers more sequence space, meaning that the population is more likely to include virus variants required for efficient adaptation. Viruses that are able to produce more diversity with each replication event should be able to replenish diversity in the founding population quickly. Conversely, viruses that are hindered in their ability to generate diversity are hypothesized to be more sensitive to bottlenecks due to the inability to generate a diverse population from the founding population. Previous work with fidelity mutants has demonstrated that they are attenuated in vivo [3,13,15,22]. Low fidelity variants have also been linked to higher rates of recombination, causing more degenerate particles, which in turn stimulate type I interferon in the vertebrate host and RNA interference in the arthropod vector [23–27]. Specifically for VEEV, a recent study identified three mutations that decreased the fidelity of the VEEV vaccine strain TC-83 [11]. To test these mutants in a wild-type and unattenuated system, the same mutations were inserted into an enzootic strain of VEEV, 68U201. The hypothesis that these were fidelity mutants was tested, and the initial result suggested that the RdRp mutants encompassed both high and low fidelity tendencies. However, this result was not maintained upon serial passage, even though no reversion was observed in passage 5, in addition we did not see any other mutations that could act as pseudo-revertants. This suggested that other factors might be responsible for the attenuation of these mutant viruses. As the phenotype of fidelity was not stable through 5 passages, other reasons for the attenuation were investigated. The data showed that there were changes in the mutation spectrum for each RdRp mutant, and given the recent work showing attenuation of Coxsackie B3 virus and Influenza A virus in vivo with 1-to-stop mutants [28], it was hypothesized that these altered individual mutation frequencies would result in an increased number of stop codons. Using an in silico approach, a computer model was used to determine if there was a change from the wild-type in the number of stop codons. All RdRp mutants showed a reduction in the number of predicted stop codons. Given that nascent genomes with additional stop codons are likely targeted for destruction, the absence of stop codons as a result of specific mutations likely results in a larger number of less-fit genomes (still containing critical 5’ and 3’ ends). Thus, replication in the G7R, 3x and 4x mutants results in more genomes that contain mutations that result in lower fitness, that if a stop codon had been inserted would otherwise be purified out during translation or packaging. From our data, it appears that attenuation of these viruses is a result of changing the frequency of specific mutations as a result of incorporating the specific RdRp mutants. Further evidence for this can be found in the reduced SI compared to the wild-type for the RdRp mutants, suggesting that there is an increase in the number of less fit genomes produced. Given the large discrepancy in the SI it is unlikely that these stop codons are the only mechanism leading to attenuation, but it is more likely a combination of factors. However, this work does raise interesting possibilities about the evolutionary pressures for specific mutation frequencies in viruses. This intriguing hypothesis will need to be evaluated experimentally both in vivo and in vitro. When Cx. taeniopus mosquitoes were infected with the RdRp mutants as well as the wild-type virus, there was no significant decrease in the percentage of mosquitoes positive for virus in the body between the wild-type and mutant virus infections. However, there was a significant decrease in the legs/wings, and saliva. This indicates that changes in mutation frequency decrease dissemination within the mosquito vector. Only at the higher dose was virus detected in the legs/wings or saliva, and mosquitoes exposed to a higher dose also contained more clones than mosquitoes receiving a lower dose. When combined, these results support the hypothesis that any alteration in the generation of viral diversity results in an impaired ability to overcome bottlenecks imposed during dissemination through the mosquito compared to the wild-type virus. Although, it must be stated that some samples from the legs/wings and bodies may have been below the limit of detection, 101 PFU, for real-time analysis. This attenuation was recapitulated in vivo as mice infected with mutant viruses demonstrated increased time to death and increased survival rates compared to the wild-type virus 68U201. Interestingly, some mice infected with the attenuated mutants lost as much as 30% of their body weight but were able to recover. A possible explanation for this is that host immune systems are able to respond more effectively to these attenuated viruses once infection has been established, something not seen in the wild-type infection. This is not the first time this has been observed, as evidence for an improved immune response has been reported for low fidelity variants. The presence of lower fidelity resulted in an increased generation of degenerate virus particles that stimulate RIG-I, MDA5 and dendritic cell maturation [23–27,29], resulting in a more effective immune response. When marked viruses with altered fidelity RdRps were injected subcutaneously into CD-1 mice there was a significant decrease in the number of clones isolated from the LN and the brain, but no change was observed in the blood. This suggests that the attenuation is likely due to the inability of the virus to spread between different cell or tissue types within the vertebrate host. Differences in infection between the different RdRp mutants were also observed. Notably, no 3x mutants were isolated after 4 days post infection, suggesting this attenuation contributed towards an inability to traverse the blood-brain-barrier. The lack of virus detected in the lymph node after day 4 for the G7R and 4x mutants, also suggests that these altered fidelity viruses are cleared from the organ, unlike the wild-type virus. RdRp mutants were only able to be isolated from the brain at later time points compared, to the wild-type. This delay in reaching the brain is evidence of the mutant virus population’s attenuation, which could potentially give the host immune response enough time to combat the infection. This would also account for the increased survival seen in these animals. The delayed spread of the RdRp mutants to the brain could also be due to its reduced ability to go through bottlenecks encountered during dissemination. This work has demonstrated that the RdRp mutants described here have a reduced ability to traverse bottlenecks during infection of vertebrate hosts and mosquito vectors. There was a tentative association showing that the G7R RdRp mutant, which is a putative low fidelity phenotype, was less sensitive to bottlenecks compared to the 3x and 4x RdRp mutants, which showed putative high fidelity phenotype. However, all mutants were more sensitive to bottlenecks than the wild-type counterpart. This study has demonstrated that there are significant costs to altering the finely tuned balance of viral diversity, which has usually been conceived as a random accumulation of mutations [1,15,30]. Any perturbation of this either by increasing or decreasing fidelity, or altering the RdRp propensity for specific mutations may result in attenuation of the virus. Of great interest, the mutations that were inserted into the RdRp theoretically result in a reduction in the number of stop codons produced in the protein sequences due to altering the frequency of specific mutations. This suggests that VEEV and potentially other RNA viruses use the generation of stop codons as a mechanism for reducing the number of unfit genomes present in the mutant swarm, and have therefore evolved to optimize their genome to account for specific base mutation frequencies. If a higher percentage of mutations are more likely to generate a stop codon, they are less likely to encode signals and use resources to be either translated or packaged. This leads to the hypothesis that the presence of stop codons may be a method by which the virus reduces the number of less fit genomes produced. Regardless of whether these viruses are attenuated by changes in fidelity of the polymerase or as a result of reduced stop codon production, it is clear that any disruption of the mutation spectrum results in attenuation of the virus. This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocols (0209068 and 1309038) were approved by the Institutional Animal Care and Use Committee of the University of Texas Medical Branch. African green monkey kidney (Vero), Baby Hamster Kidney (BHK), and human lung fibroblast (MRC-5) cells were obtained from the American Type Culture Collection (Bethesda, MD) and maintained in Dulbecco’s minimal essential medium (DMEM) supplemented with 10% fetal bovine serum (FBS), and gentamycin (100 U/ml) in a 37°C, 5% CO2 incubator. U4. 4, cells were maintained in Mitsuhashi and Maramorosch media supplemented with 20% FBS, 2% Sodium Bicarbonate (7. 5%) and gentamycin (100 U/ml) in a 30°C CO2 incubator. Viruses were rescued from the enzootic subtype IE VEEV strain 68U201 as described previously and without further passage [31]. The wild type virus (genomic sequence in GenBank accession no. U34999) was isolated from one of the endemic foci in Guatemala in 1968 from a sentinel hamster. The isolated virus was passaged once in infant mice and twice in BHK cells before being cloned. Four mutations identified to cause altered fidelity in the VEEV vaccine strain TC-83 were cloned into the 68U201 backbone (Fig 1A; [11]. Mutations were inserted using joining PCR and the sequence of each RdRp mutant was verified prior to rescue of the virus. Following rescue of the RdRp mutants, 8 marked clones described in Forrester et al. 2012 were cloned into each of the RdRp mutant backbones. All clones were rescued in BHK cells as previously described [32] and titers were determined by standard plaque assay on Vero cells [33]. To determine changes in fidelity, viruses were passaged once in Vero, MRC-5, and U4. 4 cells. Cells were trypsinised (Vero and MRC-5) or scraped (U4. 4) from the flask surface and then counted and resuspended in media. Viruses were then added to the cell suspension at a multiplicity of infection (MOI) of 0. 1. Following one hour of incubation, with regular mixing, the cells were pelleted and resuspended in phosphate buffered saline (PBS) (Gibco, Carlsbad, CA). This was repeated three times and the final resuspension of the cells occurred in media. The cells were then plated out onto 24-well plates, with 1ml of cell suspension per well. Virus was harvested at 24 hours post infection and titered by standard plaque assay. To ensure that the inserted mutations did not interfere with viral replication, standard replication curves were conducted. Cells were infected at a MOI of 10 and 0. 01 in Vero cells in 24-well plates and incubated for one hour before being washed twice with PBS and overlaid with 2 ml of DMEM supplemented with 2% FBS and gentamycin (100U/ml). Virus was harvested by removing the entirety of the medium. Harvested virus was supplemented with FBS to a final concentration of 20%, and clarified by centrifugation at 3000rpm for 5 min. The supernatant was then removed and stored at -80°C. Viral titers were determined by standard plaque assays (Fig 1B). Rescued viruses were passaged 5 times on Vero cells to ensure genetic stability. Viruses were harvested 2 days post-infection and diluted for a MOI of 0. 01 before infection of Vero cells in the subsequent passage. Following passage 5, viral suspensions from passage 1 and 5 were placed into TRIzol (Invitrogen, Carlsbad, CA) and RNA extracted using the ZR Viral RNA Kit (Zymo Research, Irvine, CA) as per the manufacturer’s protocol. cDNA was produced using the Superscript III First Round Synthesis kit (Invitrogen, Carlsbad, CA) following the manufacturer' s instructions. cDNA was amplified for sequencing using the Phusion enzyme (NEB, Madison, WI) in a 50ml volume following the manufacturer' s instructions using primer sets that covered the entire genome. Products were sequenced on the ABI 3700 sequencer (ABI, 3500) to confirm the sequence of the passaged virus. RNA extractions were also sent for RNA sequencing (see below). Rescued viruses from passage 1 and 5 were tested for susceptibility to 5’ fluorouracil in triplicate. Cells were pretreated with 0,10,25,50,100,200, or 300 μg/ml of 5’ fluorouracil for 2 hours. The cells were then infected with 0. 01 MOI of the RdRp mutants or wildtype 68U201. Medium containing the pretreatment amount of 5’ fluorouracil was added to the infected cells 1 hour post-infection. Virus was harvested 24 hours post-infection and titrated in duplicate using standard plaque assays. Rescued viruses were used to test for specific infectivity of the virus. Standard plaque assays were carried out in triplicated as described above. RNA was also extracted using a QIAamp Viral RNA Mini kit according to the manufacturer’s protocol. Real-time RT-PCR was performed using primers against the nsP1 using primers (F 5’-TCACAGATAATGACCATGCTAACGC-3’, R 5’- TGTCTAGGATCGTATCGGATGGTTC-3’), and against the nsP3 using primers (F 5’- CTATTCCGCTTCTGTCCACTGGA-3’, R 5’- TTGTGTCCAATGCCGTTAACAGATG-3’). Real-time RT-PCR was carried out using iTaq Universal SYBR Green Mix (Bio-Rad) and iScript Reverse Transcriptase (Bio-Rad), with single steps of 10 min at 50°C and 3 min at 95°C, followed by cycling at 15 s at 95°C, and 30 s at 57°C for 45 cycles, and a melt curve from 55–95°C (+0. 5°C/cycle). CD-1 mice (Charles Rivers, Wilmington, MA) were infected subcutaneously with 3 log10 PFU of virus. For survival studies, mice were bled on days 1,2 and 3 to determine the level of viremia. The resulting blood samples were diluted 1: 10 in DMEM supplemented with 10% FBS and stored at -80°C. Mice were weighed daily and monitored until they exhibited signs of paralysis, at which point they were sacrificed (Fig 2). Mouse infections were also carried out using the set of marked clones. To determine the number of potential bottlenecks in a wild-type infection, mice were sampled daily (n = 3) following subcutaneous injection with 3 log10 PFU of virus. Each mouse was perfused using PBS and the brain, heart, lung, liver, spleen, kidney and lymph node were harvested. In a second round of experiments, mice were infected with the RdRp mutants that contained the marked clones, and were again sampled daily (n = 3). Each mouse was subjected to cardiac puncture to collect serum, and the brain and brachial lymph nodes were also harvested. All samples were tested for viral presence and titer by cytopathic effect (CPE) assay and standard plaque assay on Vero cells. Mice used for oral mosquito exposure were injected via the tail vein with a mixture of all 8 clones in equal concentrations to generate an artificial viremia of known content. The mice were anaesthetized with ketamine/xylazine and then bled approximately 5 minutes post injection to estimate viremia titers before being presented to mosquitoes. Mosquitoes were allowed to feed on the mice for up to 45 minutes. Following a terminal blood draw, mice were sacrificed without gaining consciousness. Mouse manipulations were approved by the UTMB Institutional Animal Care and Use Committee. Cohorts of C. taeniopus mosquitoes (colony originating from Chiapas, Mexico) were sugar-starved for at least 16 hours, then allowed to feed for one hour on mice injected via the tail vein to generate viremia of predictable content, as described above. After one hour, engorged mosquitoes were incubated at 27°C and provided 10% sucrose ad libitum. At selected time points mosquitoes were chilled, their legs and wings removed, and then individuals were allowed to salivate for 45 minutes into a capillary tube containing FBS. The midguts were then dissected, and the remaining carcass was held separately. Midguts were cut in half and the residual blood was washed out using PBS. All mosquito tissues were placed into DMEM supplemented with 10% FBS, pen/strep and Fungizone (Sigma-Aldrich, St Louis, MO). All mosquito and vertebrate tissues were resuspended in DMEM supplemented with 10% FBS and gentamycin (for mosquito tissues Fungizone (Sigma-Aldrich) ) was also added) and homogenized at 26 hz for 5 minutes, then subjected to centrifugation at 38206 x g for 10 minutes. Saliva samples were subjected to centrifugation at 6636 x g for 10 minutes prior to processing. All samples were tested for the presence of virus by CPE assay. Positive samples were stored at -80°C for subsequent analysis. For mosquito saliva samples, supernatants positive for CPE were used in a real-time RT-PCR assay, as the inconsistency in the amount of virus expectorated from the mosquito [34] would have resulted in some samples being below the limit of detection and thus the passaged supernatant was utilized [6]. Virus suspensions were placed into TRIzol (Invitrogen, Carlsbad, CA) and RNA extracted using the ZR Viral RNA Kit (Zymo Research, Irvine, CA) as per the manufacturer’s protocol. Real time RT-PCR was carried out using the ABI 7900HT Fast Real-Time PCR system (ABI, Carlsbad, CA). Each reaction was performed using the TaqMan RNA-to-CT 1-Step kit (ABI) as per the manufacturer’s instructions in a 10 μl reaction. The primers and probes were identical to those used in previously published work [6]. Each probe had a corresponding primer set that was designed to anneal flanking the polymorphic region of each variant. Every sample, run in duplicate, was tested for each variant. Positive and negative controls were run on each plate and all 8 clones were included as controls to ensure no cross-detection of the other clones by an individual probe. Additionally, serial dilutions with titers from 105−101 pfu/ml of the individual clones were used to create standard curves. Viral RNA (0. 05–1. 7 mg) was fragmented by incubation at 94°C for 8 minutes in 19. 5 μl of fragmentation buffer (Illumina, San Diego, CA). First and second strand synthesis, adapter ligation, and amplification of the library were performed using the Illumina TruSeq RNA Samplec Preparation kit as per the manufacturer’s protocol. Cluster formation of the library DNA templates was performed using the TruSeq PE Cluster Kit v3 (Illumina) and the Illumina cBot workstation as per the manufacturer’s protocol. Paired-end 50 base sequencing by synthesis was performed using TruSeq SBS kit v3 (Illumina) on an Illumina HiSeq 1500 as per the manufacturer’s protocol. All reads were assembled using a pipeline previously described [7] and were assembled using the Venezuelan equine encephalitis virus strain 68U201 (GenBank accession #: U34999. 1; [35]) as a reference sequence. Diversity was calculated using Shannon entropy [36] and a cut off of 1% was used for the analysis. Statistical analyses were carried out using GraphPad Prism and details are found in the text. In order to quantify the extent to which point mutations create new stop codons, we simulated in silico the replication of (either 1m or 1bn) RNA strands for each variant, counting the number of individual strands produced that include new codons with either TAG, TAA, or TGA. For each variant, raw RNA data was obtained from the sequence of the infectious clone used to produce the virus. The algorithm begins at position 46 and reads each codon sequentially up to position 7538, skipping the opal stop at 5696. Reading continues at position 7546 and continues to 11338, this corresponds to the open reading frame for VEEV strain 68U201. Each base within each codon has a likelihood of mutation of 0. 0001; if mutation occurs, the base changes randomly, according to the distribution given in Table 1. If a stop codon is produced at any point, this is recorded and the replicate counted as non-viable. The simulation code was written in C++ and is available for download at https: //github. com/StanDeSiecle/Ihaventdonethisyet. To determine the frequency of mutations leading to stop codons in the data generated from next generation sequencing of p1 viruses, each codon in the 68U201 genome was read sequentially. Using the substitution data from the p1 NGS data, we generated alternative codons if a substitution of any base was found to have occurred at any locus within that codon. We then recorded whether that substitution resulted in a stop codon. The proportion of stop codons to other mutations was then calculated for each virus and replicate.

Title: Viral RNA-dependent RNA polymerase mutants display an altered mutation spectrum resulting in attenuation in both mosquito and vertebrate hosts Summary: RNA viruses replicate with a high mutation rate, giving them the ability to generate mutations that might be beneficial under different selection pressures. Any perturbation of the accumulation of mutations has been shown to result in severe attenuation of the virus. However, the mechanism of this attenuation is still unclear. Mosquito-borne viruses, which are mostly RNA viruses, undergo repeated bottleneck events during the transmission cycle of the virus. Using a model system of Venezuelan equine encephalitis virus (VEEV) we investigated the effect of perturbing the rate of mutations in both a mosquito and vertebrate host. We show that any perturbation of the mutation frequency, either by increasing or decreasing the overall mutation frequency as well as altering the specific frequency of mutations results in attenuation. Our results also suggest that RNA viruses may use stop codon accumulation as a means of purifying out less-fit genomes by targeting them for destruction. These changes in the genome result in viruses unable to overcome the bottlenecks in the mosquito vector and to a lesser extent in the vertebrate host. Overall, our study shows that any change in the accumulation of mutations from wild-type increases the likelihood of an unsuccessful transmission cycle.

lay_plos

en

Summarize: Oklahoma governor: "It's just heaps of debris" Forget your password? Best tips for staying secure on the web Forget your password? Best tips for staying secure on the... Implant gives deaf child gift of sound: How does it work? Implant gives deaf child gift of sound: How does it... (CBS News) Oklahoma Gov. Mary Fallin spent Monday evening visiting with search crews at Plaza Towers Elementary School in Moore, Okla., and speaking with President Obama and FEMA to coordinate emergency response to the deadly tornado that leveled neighborhoods, and destroyed schools and a major hospital. "There are so many different areas of the city that are destroyed... it jut wiped out miles of homes and businesses," Fallin told "CBS This Morning" on Tuesday. She said Monday's storm is even worse than the historic May 3, 1999 twister. Search and rescue efforts continued on Tuesday morning, amid inclement weather and threats of gas leaks from the wrecked buildings. "If you walk through the neighborhoods, if you go through of some of these business areas... and certainly when you see the schools, it's just heaps of debris.... It would be incredible if anybody survived in any of those structures," Fallin said. Fallin spoke with Mr. Obama Monday night, who along with FEMA, quickly approved emergency funding to aid in search and rescue efforts. "I very much appreciate his phone call. He offered any type of assistance," she said. "We appreciate the president, the administration, FEMA approving our emergency declaration so quickly last night. "This is going to be a huge recovery effort," Fallin added, "It's going to take a long time to get the power, the lights, the debris cleared up... roads open." Fallin reiterated the stakes of the recovery effort in the months to come, describing a "tremendous about of structural damage." "There were five schools hit by the tornado, a major hospital, businesses. It's just a huge, wide path of destruction," she said. The governor also offered words of support and hope for Oklahoma residents and said in the near future, the greatest concern is recovering people and maintaining secure perimeters around damaged sites. "We have what we call the Oklahoma standard, being able to work through terrible disasters like this... and to come out stronger on the other side," she said. Sen. Tom Coburn (R-Okla.) will seek cuts elsewhere in the budget to offset federal disaster relief funds after a tornado struck Moore, Okla., on Monday, killing dozens. “He’ll ask his colleagues to help Oklahoma by setting priorities and sacrificing less vital areas of the budget,” Coburn spokesman John Hart wrote in an e-mail to POLITICO. Text Size - + reset Obama remarks on Oklahoma tornado Coburn, a prominent fiscal hawk, has long demanded budget offsets to pay for disaster relief after tragic events, including the bombing of the Murrah Federal Building in Oklahoma City in 1995. (PHOTOS: Oklahoma tornado) Liberal blogs were bashing Coburn’s stance on Tuesday, claiming he was placing cash before compassion. “Coburn is taking his own constituents hostage as budget-cutting human shields,” AMERICABlog’s John Aravosis wrote, adding: “We wouldn’t need to be holding a bake sale every time Mother Nature hiccuped … if the Republicans would stop spending a trillion on this war and another trillion on that tax cut.” “Yes, they are still pulling victims from the debris and Tom Coburn’s mind is on making sure other poor souls get harmed too,” the blogger Attaturk wrote on FireDogLake. “But he’ll get credit for consistency, without mentioning the consistency is for being horrible.” Coburn’s office released a statement from him on Tuesday that didn’t directly address the offset issue. “Oklahomans have always inspired the nation with their courage, compassion and resilience in the face of unspeakable tragedy and loss,” he said. “That has already been the case in the few hours since these terrible tornadoes destroyed major parts of our communities, and will be the case as neighbors care for those who have lost everything, including children and family members. “I spoke with Department of Homeland Secretary Janet Napolitano last night about FEMA’s response. We still don’t know the scope of devastation and won’t for some time. But, as the ranking member of Senate committee that oversees FEMA, I can assure Oklahomans that any and all available aid will be delivered without delay.” Rep. Joe Crowley (D-N.Y.), who was one of the leading crusaders during fights earlier this year about aid to Sandy victims said now is not the time to be worrying about spending offsets for aid to the Oklahoma tornado victims. “We will wait and see what the assessment is of the damage,” Crowley told reporters Tuesday morning. In the aftermath of Sandy, Crowley argued that disasters haven’t required offsets in the past and shouldn’t bog down aid for hurricane victims. Asked about Coburn saying there should be offsets, Crowley said he hopes another fight won’t slow down the delivery of assistance and said that the focus right now should be on helping those who are still in peril. “We’ll deal with these other issues when it’s appropriate,” he said. Rep. Elijah Cummings, a Democrat, told POLITICO he thought Congress could forgive the Sandy position if Coburn and Sen. James Inhofe (R-Okla.) were to accept Oklahoma aid without offsets. “I hope they would change their minds this time and I’m sure the Congress would understand that,” Cummings (D-Md.) said. “But I hope if they change their minds this time then in the future, and sadly there will be future circumstances, that they will help those communities when they’re in need.” Ginger Gibson and Katie Glueck contributed. The chairman of the House Appropriations Committee said Tuesday there’s $11 billion left in the nation’s disaster relief account, and if additional aid is needed, corresponding budget cuts would be inappropriate. Rep. Hal Rogers (R-Ky.) told a small group of reporters that if FEMA needs more money, it should not be matched by spending cuts. Text Size - + reset (PHOTOS: Oklahoma tornado) “I really don’t think disasters of this type should be offset,” Rogers said. “We have an obligation to help those people. We’ll worry about our budgetary items back here, but the aid has to be there.” (Also on POLITICO: Coburn wants offsets for Okla. aid) House Speaker John Boehner was asked repeatedly if a disaster aid package would need to be offset — as his party has requested in the past — and he would only say that Congress will work with the Obama administration to provide the help that’s needed. Oklahoma Sen. Jim Inhofe, who wanted to slash Hurricane Sandy recovery funding, said on Tuesday that aid for his state would look different in the wake of a devastating tornado. “Let’s look at that, that was totally different,” Inhofe (R-Okla.) said on MSNBC on Tuesday when asked about his Sandy position. “They were getting things — for instance that was supposed to be in New Jersey, they had things in the Virgin Islands, they were fixing roads there, they were putting roofs on houses in Washington, D.C., everyone was getting in and exploiting the tragedy taking place.” Text Size - + reset (PHOTOS: Oklahoma tornado) His comments came a day after a massive and deadly tornado struck his state. Inhofe pledged that relief for Oklahoma wouldn’t look like the Sandy funding, which he said last year resembled a “slush fund.” “That won’t happen in Oklahoma,” he continued on Tuesday. Rep. Elijah Cummings (D-Md.) told POLITICO that Congress would “understand” if Inhofe and Sen. Tom Coburn (R-Okla.) accepted Oklahoma relief without seeking offsets despite previous positions. Coburn, however, has indicated he will pursue offsets. “I hope they would change their minds this time and I’m sure the Congress would understand that,” Cummings said. “But I hope if they change their minds this time, then in the future, and sadly there will be future circumstances, that they will help those communities when they’re in need.” Sen. Tom Coburn (R-Okla.) will insist that any federal aid to deal with the tornado in his home state must be offset by budget cuts. (J. Scott Applewhite/AP) "He will ask his colleagues to sacrifice lower priority areas of the budget to help Oklahoma," spokesman John Hart said. Should other Republicans join Coburn, it could set up a fight similar to the January tug-of-war over Hurricane Sandy funding. That aid package was delayed by GOP opposition and ultimately passed with mostly Democratic support. In a statement, Coburn said that "as the ranking member of Senate committee that oversees FEMA, I can assure Oklahomans that any and all available aid will be delivered without delay." He later told CNN that it was "insensitive to even talk about" budgeting for relief funding now. "It just shows the crassness of Washington versus the sensitivity that we need to have," he said. We don't yet know what a congressional relief package for Oklahoma would look like, if one is even necessary. As of Tuesday morning, FEMA has $11.6 billion in its Disaster Relief Fund. Coburn was against the Sandy relief package, as well as 2011 legislation to replenish the Federal Emergency Management Agency's disaster fund. His office has noted that the 1995 aid for victims of the Oklahoma City bombing was balanced by cuts to unspent appropriations. However, he did ask for expedited FEMA aid in 2007, when an ice storm hit his state. President Obama declared a major federal disaster late Monday and ordered federal aid to deal with the Moore, Okla. tornado, which devastated an area a mile wide and 20 miles long. Coburn is also headed back to Oklahoma to asses the damage. House Republican leaders declined to address whether they would demand spending cut offsets. "We will work with the administration to make sure that they have the resources they need," Speaker John A. Boehner (R-Ohio.) told reporters Tuesday morning. "We will help them rebuild," Majority Leader Eric Cantor (R-Va.) said. The offsetting cuts issue first reached controversy in 2011, when an earthquake centered in Cantor's district roiled the East Coast. At the time Cantor sided with conservatives suggesting the emergency aid should be financed by other cuts to the federal budget. When it came to the Sandy aid package, Cantor took the lead in supporting the legislation. Boehner was joined at the weekly leadership press conference by members of the Oklahoma delegation. Sen. James Inhofe (R-Okla.) also voted against Sandy aid. Two of Oklahoma's five members in the House of Representatives, all Republicans, voted against it. Rep. James Lankford voted for a smaller federal flood relief package but against the bigger package. Rep. Tom Cole (R-Okla.) said on MSNBC Tuesday morning that one reason he supported the Sandy relief was Oklahoma's history of bad tornadoes. "Frankly, one of the reasons that we try to be sympathetic to people in other parts of the country" is that "we're always one tornado away from being Joplin," he said, referencing the catastrophic 2011 tornado in Missouri. "I didn't think it was going to be quite this soon." Ed O'Keefe contributed to this report.

Summary: Tom Coburn represents Oklahoma, so you might expect him to call for tornado relief to flow to his state no matter the cost-but you'd be wrong. Instead, the Republican senator is demanding that all aid to his state be offset by cuts elsewhere in the budget, a spokesman tells Politico and the Washington Post. "He will ask his colleagues to sacrifice lower priority areas of the budget to help Oklahoma," the spokesman said. Coburn and fellow Oklahoma Sen. James Inhofe were among those who voted against Hurricane Sandy relief, the Post notes, as were many of the state's Republican House reps. Inhofe today said that Oklahoma relief would look "totally different" than Sandy relief, alleging that the Sandy effort had been full of pork. "They were putting roofs on houses in Washington DC, everyone was getting in and exploiting the tragedy," he said. "That won't happen in Oklahoma." But President Obama said today that Oklahoma could count on getting whatever resources it needed. "The people of Moore should know that their country will remain on the ground there for them, beside them, as long as it takes," he said in remarks at the White House today. Oklahoma Gov. Mary Fallin confirmed that Obama had promised to "get rid of red tape for federal resources," according to MSNBC. She also told CBS News today that the storm had wreaked even more havoc than the historic May 3, 1999, tornado. "It just wiped out miles of homes and businesses.... It's just heaps of debris." When asked if Republicans would call for offsets, John Boehner would only say that Congress would work with Obama to get help to the state.

multi_news

en

Summarize: 3-year-old left in car for hours dies; mother's friend could face charges PHOENIX -- Police are investigating the death of a 3-year-old boy who was apparently left in a car outside a church for three hours Saturday afternoon. Officers were called to the Abundant Life Church at 1914 E. Roeser Road at about 2 p.m. Saturday in regard to an injured child. According to police, the toddler, Hayden Nelson, and his mother spent the night with a 27-year-old friend. Both adults were scheduled to attend choir practice at the church, but Hayden's mother had to be there earlier than her friend. That friend arrived at the church with Hayden and two other children at about 11 a.m. "Indications are the suspect was a bit late and she and the other children exited the car," Officers James Holmes wrote in an email to media outlets. "The suspect went immediately into the church for practice." When the practice ended at about 2 p.m., Hayden's mother realized her child was nowhere to be found. "Everyone began searching the church for the victim and the suspect went to the parking lot; it was then that she found the child still inside the vehicle and in medical distress," according to Holmes. The outside temperature was between 95 and 97 degrees, which means the temperature inside the car was much higher. "It's obvious that the 27-year-old forgot that the child was in the car," Holmes said Monday morning. "She was in a hurry. She had something that she had to do, and she didn't take a minute to make sure." Hayden was rushed to a local hospital, but doctors could not save him. "You cannot imagine what this young lady is going through right now, what this family is going through...," Holmes said. Police released the woman, whose name has not been released. The Maricopa County Attorney's Office will determine if she will face charges in connection with Hayden's death. As of Friday, 27 children have died of heatstroke after being left in hot cars this year, according to KidsandCars.org, a national nonprofit group dedicated to keeping kids safe in and around cars. Hayden is No. 28, but the first in Arizona this year. According to Amber Rollins of KidsandCars.org, a total of 32 children have died in hot cars in Arizona, making the state fourth in the country for child hot car deaths. Two of those deaths happened last year. Editor's note: Police originally reported that Hayden Nelson was 3 months old. The department later advised media outlets that he was 3 years old. CLOSE Pastor Kelvin Hines of Abundant Life World Ministries in Phoenix, offers sympathies after a 3-year-old died in a hot car over the weekend. A 3-year-old child died Sunday after being left inside a car for several hours, officials said Monday. Phoenix Police and Fire departments personnel were called to Abundant Life Church on Saturday afternoon after the child was discovered to have been left in a car for three hours. (Photo: Photo by: 12 News) Phoenix police say prosecutors will weigh any potential charges in the death of a 3-year-old boy brought on by heatstroke from being left in a car at a church parking lot. Courtney Arnold, a family friend, reportedly left 3-year-old Hayden Nelson in a hot car Saturday afternoon outside Abundant Life Church in Phoenix, where she and the child's mother, Tiffani Nelson, were attending choir practice, according to a police statement released Monday. Police said Nelson stayed at Arnold's house overnight with Hayden and his 8-year-old sister. Because Hayden's mother needed to arrive early to choir practice, Arnold agreed to bring the children, including her own 5-year-old daughter, at a later time. Arnold, whom police identified as a 27-year-old woman, was reportedly running late when she pulled up to the church with the children in tow. All but Hayden exited the car, where heat built up for the next three hours as temperatures outside reached 96 degrees. Members of the church helped Nelson look for Hayden after choir practice. He wasn't breathing when they found him, police said. RELATED: 3-year-old boy dies after being left in car in Phoenix On Monday, the parking lot to the medium-sized church was empty except for one car belonging to the church's pastor. People who saw news vans while driving along Roeser Road near 20th Street hollered out, asking what had happened. One man stopped to say he was there on Saturday when the incident occurred. "It's just a really sad situation," Ernest McCray said. McCray isn't a member of the Abundant Life's congregation, but said he knows the pastor and dropped in on Saturday when he saw police vehicles outside the church. The pastor informed him of what was going on. By then, Hayden had been taken to a hospital in critical condition, where he would die on Sunday. "I didn't think she intended at any moment to harm the child," McCray said about Arnold. McCray said there could have been plenty of reasons why it took so long for someone to realize the child had been left in the car, adding that he doesn't blame Nelson and imagines her grief is overwhelming. "This is going to stay with her for the rest of her young life," he said. On Monday afternoon, community and civil-rights advocate the Rev. Jarrett Maupin and criminal defense attorney Benjamin Taylor met with Nelson and Arnold. Taylor represented a Phoenix mother who knowingly left her two small children in a car in Scottsdale while she interviewed for a job in Scottsdale earlier this year. Shanesha Taylor was charged with child abuse, but a judge said those charges will be dropped if she successfully completes a diversion program. Maupin said Monday that he was contacted by members of the church who were concerned for Nelson and Arnold. "I don't have any reason to doubt that this was an accident," Maupin said. Read or Share this story: http://azc.cc/1vKZc22 Stats Data Source: KidsAndCars.org Database - These data vastly underestimate the true magnitude of non-traffic fatal incidents involving children. This chart represents the incidents KidsAndCars.org has documented involving children < 15 years of age. Location specific data available upon request. 2014 Nontraffic Fatalities (as of 6/18/15): Heatstroke: 32 Backovers: 71 Frontovers: 63 Vehicle set in motion: 5 Underage Driver: 16 Drowning: 3 Power Window Strangulation: 2 Fall from Vehicle: 1 Other: 1 Total: 194 Not-in-Traffic Surveillance Reports : The National Highway Traffic Safety Administration (NHTSA) is not required to collect data about nontraffic incidents as per the provision we helped adopt as part of the 2005 Federal Transportation bill (SAFETEA-LU). NHTSA refers to this new database as the “Not-in-Traffic-Surveillance” system or NiTS. Below are the reports they have published. Child Fatality and Injury Statistics in Nontraffic Crashes 2008 to 2011- April, 2014 Fatality and Injury Statistics in Nontraffic Crashes 2008 to 2011 - April, 2014 Not-in-Traffic Surveillance 2007 – Children - June, 2009 Not-in-Traffic Surveillance 2007 – Highlights – January, 2009 Updated Charts Coming Soon!

Summary: America has seen its 28th death of a child left in a hot car this year, according to the Kids and Cars nonprofit, with the latest death occurring on Saturday in Phoenix. In that case, 3-year-old Hayden Nelson was allegedly left in a car outside Abundant Life Church for several hours by a family friend. Police explain the timeline, via the Arizona Republic: The child, mother Tiffani Nelson, and an 8-year-old sister spent the night at Courtney Arnold's home. Arnold and Nelson both had choir practice to attend; because Nelson had to get there early, Arnold, 27, agreed to bring her own daughter, along with Nelson's kids, later. AZFamily.com reports that Arnold arrived around 11am. In an emailed statement, police say "indications are the suspect was a bit late and she and the other children exited the car. The suspect went immediately into the church for practice." Hayden was somehow left behind and spent three hours in the vehicle before his mother and churchmembers began searching for him. Outside temps at the time were as high as 96 degrees. The boy had stopped breathing, and died Sunday in the hospital. Prosecutors are still considering whether to bring charges against Arnold, though Officer James Holmes paints it as a tragic accident: "It's obvious that the 27-year-old forgot that the child was in the car. She was in a hurry. She had something that she had to do, and she didn't take a minute to make sure."

multi_news

en

Summarize: The internet blew up this afternoon over one weird ranting climate change tweet by one weird game show host. Here was the offending(?) statement: I now believe global warming alarmists are unpatriotic racists knowingly misleading for their own ends. Good night. — Pat Sajak (@patsajak) May 20, 2014 And while it prompted some clever responses......turns out, this is Pat Sajak's whole shtick. As the episode went viral, Sajak added this explanation to the mix. Sometimes it's fun to poke a stick in a hornets' nest just to hear the buzzing. — Pat Sajak (@patsajak) May 20, 2014 O rly, Pat? Well, while it's difficult to tell whether Sajak's efforts to seem edgy on Twitter are sincere or not, we do know that this isn't new. But like the climate, Sajak has been heating up. Lately, he seems to have really gotten into blasting short missives about climate change and general tidbits of annoyance at liberal things to his roughly 50,000 followers. Here's a recent sampler: Prods at climate change: Very hot weather: "We're all going to die!" Very cold weather: "There's a difference between climate & weather, moron!" — Pat Sajak (@patsajak) May 11, 2014 Traveled from Caribbean to East Coast today. Climate did change. That settles it; I'm a believer. — Pat Sajak (@patsajak) January 2, 2014 I miss the pre-climate change days when it didn't get too hot or cold, or too wet or dry, or too stormy or calm or... — Pat Sajak (@patsajak) January 7, 2014 In East with more snow. Miss pre-climate change days growing up in Chicago. Always 65-70 with occasional gentle rain. — Pat Sajak (@patsajak) March 25, 2014 General smarm directed at liberal sacred cows: Skeet shooting in Hillsdale, MI. (Don't worry...they were free range skeet.) pic.twitter.com/YHUPc1k0nA — Pat Sajak (@patsajak) May 9, 2014 My interest in Al Gore's pronouncements could fit into a gnat's navel & still leave room for a Liberal's sense of humor. — Pat Sajak (@patsajak) May 7, 2014 Hired Wendy Davis PR firm to redo my bio. Turns out I was orphaned. Then reform school, migrant worker. Very inspiring. — Pat Sajak (@patsajak) January 21, 2014 Critiques of the liberal media or whatever: Reportedly, msnbc streamlining apology process by creating computer template for on-air staff. — Pat Sajak (@patsajak) January 13, 2014 NY Times: All the news that fits, we print. — Pat Sajak (@patsajak) December 31, 2013 Well, whad'ya know? Turns out Putin is also a community organizer. — Pat Sajak (@patsajak) March 5, 2014 Happy birthday tomorrow, George Washington. Your father thought if he liked his cherry tree, he could keep it. Period. — Pat Sajak (@patsajak) February 21, 2014 Met a nice woman who said she'd check my tax return for free. Says she's an expert. Name is Lerner, I think. — Pat Sajak (@patsajak) April 11, 2014 And one paranoid 4/20 tweet: George Orwell was right, other than missing by 30 years. — Pat Sajak (@patsajak) April 20, 2014 In addition to this slight libertarian bent, Republicans and Congress in general seem spared from Sajak's Twitter ire. Maybe he assumes this is his audience. But also, who cares? Ultimately, this is a totally unremarkable revealing of a public figure's private side. But, I suppose, if we're collectively going to isolate and react to one Sajak tweet, we might as well glance at his whole dumb digital oeuvre and realize that it, like much of Twitter, isn't terribly interesting. Add a location to your Tweets When you tweet with a location, Twitter stores that location. You can switch location on/off before each Tweet and always have the option to delete your location history. Learn more Image via Flickr user Smata2 Even If you don't normally read the tweets of gameshow ding-dongs like I do, you might already know that Wheel of Fortune's Pat Sajak shot his mouth off about climate change on Monday morning. He tweeted "I now believe global warming alarmists are unpatriotic racists knowingly misleading for their own ends. Good night," triggering a humdrum category 2 Twitter shitstorm. It wasn't really anything to batten down the hatches for, but it got pretty windy for a while. I now believe global warming alarmists are unpatriotic racists knowingly misleading for their own ends. Good night. — Pat Sajak (@patsajak) May 20, 2014 Here's a sampling of the hilarity:What got mentioned relatively little was his recent hobby of being a marginally successful internet troll, seemingly grasping for controversy every time he has some downtime and access to his phone. A few publications looked into it though. And lo it was revealed to the world that Pat Sajak has been tweeting right-wing dad jokes and Andy Rooney-esque observations for years. Even though I told him it was settled folklore, my young nephew remains a Tooth Fairy denier. (Those kids today!) — Pat Sajak (@patsajak) May 19, 2014 My interest in Al Gore's pronouncements could fit into a gnat's navel & still leave room for a Liberal's sense of humor. — Pat Sajak (@patsajak) May 7, 2014 I suggest grabbing bunches of those plastic produce bags and taking them to checkout stand. — Pat Sajak (@patsajak) May 5, 2014 Prediction: Next big 'cause du jour' will be Plants Rights. No joke! (Can see posters now: Ficus have feelings, too!) — Pat Sajak (@patsajak) April 30, 2014 So given the pattern, it was only a matter of time before this happened. His age is getting blamed, but that's a red herring. If we just had to be ageist about it, and if the "global warming alarmists" tweet had been an isolated incident, dementia might be a plausible culprit. One might even think the whole trend toward conservatism could be the product of an aging mind. But some of Sajak's tweets actually come off as pretty sharp and even kind of plugged in to the culture: To boost career, planning to post, delete & apologize for offensive tweet later. Blaming hackers or prescription drugs. — Pat Sajak (@patsajak) March 17, 2014 Two years ago he got some media traction by admitting that he'd been shitfaced while on TV for much of his career. It was, I thought at the time, a tiny chink in the armor of a bland, uncontroversial minor celebrity. I still barely blinked. Over the years, a few people might have also directed me to his history of donating money to republican causes. That was another piece of news that I doubt rattled me. Most showbiz types are liberals, but given Pat Sajak's audience, who can blame him for being conservative? Wheel of Fortune is perfect for people who want everything to stay the same forever. Still, there's letting the public have the occasional peek at your sincerely held conservative beliefs, like Tom Selleck or James Earl Jones, and then there's what Sajak is doing: letting his conservative freak flag fly. And granted, there are plenty of figures out there like Stephen Baldwin or Charlton Heston who basically get "republican" tattooed on their foreheads. But you lose half of America when you do that. Unlike being a politically active Democrat, being an active Republican in showbiz is a factoid that ends up in your obituary. Don't get me wrong, I'm not advocating for some kind of privilege check among America's celebrity leftists. I really could not care less that being a Democrat in Hollywood is normal and being a Republican is weird. I'm just fascinated by what Pat Sajak is voluntarily giving up. He could have been one of those friendly TV faces everyone likes. People like Al Roker or Steve Carrel might have political beliefs you can uncover if you Google hard enough, but they're so damn likable. They seem preternaturally impossible to hate. At one time, I would have put Pat Sajak in that category. It's not that I'd choose to be the kind of figure everyone likes at the cost of being someone who can express my opinions freely. It's just that in my line of work, I'm told several times a day to kill myself by some internet rando or another. Every once in a while it sounds nice to be liked by everyone. That's just not for me, and I guess it's not for Pat either. Follow Mike Pearl on Twitter

Summary: Pat Sajak isn't apologizing for the controversial tweet in which he called climate change believers "unpatriotic racists," but he is backtracking-a little. "As most of you know, original Tweet was intended to parody the name-calling directed at climate skeptics. Hyperbole," the Wheel of Fortune host tweeted yesterday. He had earlier noted on Twitter, "Sometimes it's fun to poke a stick in a hornets' nest just to hear the buzzing." But, as multiple outlets have pointed out, it's clear Sajak has few warm feelings for climate change activists. Some of his previous tweets on the topic: "Help...climate changing...must send money to lots of places...a lot of money...hurry...time is short...not kidding..." "My interest in Al Gore's pronouncements could fit into a gnat's navel & still leave room for a Liberal's sense of humor." "Traveled from Caribbean to East Coast today. Climate did change. That settles it; I'm a believer." "I miss the pre-climate change days when it didn't get too hot or cold, or too wet or dry, or too stormy or calm or..." "Very hot weather: 'We're all going to die!' Very cold weather: 'There's a difference between climate & weather, moron!'" "In East with more snow. Miss pre-climate change days growing up in Chicago. Always 65-70 with occasional gentle rain."

multi_news

en

Summarize: Lo Stato Sociale partecipa per la seconda volta al Festival di Sanremo 2021 con la canzone "Combat pop", in gara nella sezione Campioni.. Il brano presentato dalla band a Sanremo 2021 è una canzone che trasuda energia, unita a un testo le cui parole esigono di riflettere sulla direzione che il nostro Paese ha intrapreso dal punto di vista musicale. Il singolo è tratta dal nuovo album della band bolognese "Attentano alla musica italiana". Lo Stato Sociale, dunque, torna sul palco dell'Ariston a tre anni anni di distanza dalla prima partecipazione nel 2018, durante la quale la band ha piacevolmente sorpreso con "Una vita in vacanza", aggiudicandosi il secondo posto. Ecco il testo, le parole e il significato di Combat Pop, la canzone de Lo Stato Sociale a Sanremo 2021. di A. Cazzola – F. Draicchio – J. A. Ettorre – L. Guenzi A. Guidetti – E. Roberto – M. Romagnoli Ed. Garrincha Edizioni Musicali/BKM Production Sony Music Publishing (Italy) – Bologna – Salerno – Milano Questo è combat pop! O era combat rock? Erano i Clash lo so, Ma che stile! Metti il vestito buono, Sorrisi e strette di mano, Che non è niente male Questo funerale. Credevi fosse amore E invece era un coglione, Sbaglia anche il migliore, ma con stile! Questo è combat pop, Mica rock’n’roll. Nella vita si può Anche dire di no, Alle canzoni d’amore, Alle lezioni di stile, Alle hit del mese, Alle buone maniere… Ma… ma che senso ha? Volere sempre troppo, Pagare tutto il doppio E godere la metà? Ma che senso ha Vestirsi da rockstar, Fare canzoni pop Per vendere pubblicità? Che bravo cantautore Con tutto questo dolore… No bella ‘sta canzone eh, Ma che sfiga! Il tatuaggio sul collo Ce l’ha anche mio nonno E le elezioni di maggio Le vince il solito gonzo! Questo è combat pop, Mica rock’n’roll. Nella vita si può Anche dire di no, Alle canzoni d’amore, Alle lezioni di stile, Alle hit del mese, Alle buone maniere… Ma… ma che senso ha? Volere sempre troppo, Pagare tutto il doppio E godere la metà? Ma che senso ha Vestirsi da rockstar, Fare canzoni pop Per vendere pubblicità? Non c’è più il punk Per dire quanto sei fuori O il rock per litigare Con i tuoi genitori, La canzone impegnata, Sì ma niente di serio, Ormai solo Amadeus Ha un profilo di coppia. A canzoni non si fanno rivoluzioni Ma nemmeno un venerdì di protesta, La moda passa, lo stile resta Fidati, l’ha detto una stilista. Ma… ma che senso ha? Volere sempre troppo, Pagare tutto il doppio E godere la metà? Ma che senso ha Vestirsi da rockstar, Fare canzoni pop Per vendere pubblicità? Sono ritornati e lo hanno fatto nella loro maniera. A tre anni dal sorprendente secondo posto al Festival di Sanremo con il brano "Una vita in vacanza", una hit in grado di travalicare l'avventura sanremese, collezionando più di 23 milioni di ascolti, Lo Stato Sociale ritorna con la solita carica in "Combat pop". Il brano fotografa il momento attuale del mercato discografico italiano, in tutte le sue rotture, in tutte le sue immagini deformate. Il gruppo chiede al pubblico che ascolta quali sono i motivi per cui ci siamo ritrovati in questa situazione, ferma, alcune volte trainata dalla pubblicità, da tutto ciò che non è musica. "Combat pop" denuncia un sistema con arguzia e simpatia, che può essere anche estratto dal contesto musicale, e può descrivere la situazione italiana in generale.

Summary: Lo Stato Sociale torna per la seconda volta a Sanremo, in gara tra i Big di questa 71esima edizione con il brano "Combat Pop". La canzone è un'ironica denuncia della situazione attuale del mercato discografico. La band bolognese torna dopo il successo registrato nell'edizione del 2018 della kermesse sanremese, durante la quale si aggiudicarono il secondo posto con "Una vita in Vacanza", un brano che ha fatto registrare 23 milioni di ascolti. Ecco il testo, le parole e il significato di Combat pop de Lo stato Sociale, in gara a Sanremo 2021.

fanpage

it

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``HHS Women Scientist Employment Opportunity Act''. SEC. 2. WOMEN'S SCIENTIFIC EMPLOYMENT. The Public Health Service Act (42 U.S.C. 201 et seq.) is amended by adding at the end the following title: ``TITLE XXVIII--WOMEN'S SCIENTIFIC EMPLOYMENT WITH DEPARTMENT OF HEALTH AND HUMAN SERVICES ``SEC. 2801. WOMEN'S SCIENTIFIC EMPLOYMENT. ``(a) In General.-- ``(1) In general.--For each agency specified in paragraph (2), the Secretary, in collaboration with the head of the agency, shall-- ``(A) establish policies for the agency on matters relating to the employment by the agency of women as scientists, and periodically review and as appropriate revise such policies; and ``(B) monitor the extent of compliance with such policies and take appropriate action in cases in which the Secretary determines that the policies have been violated. ``(2) Specified agencies.--The agencies referred to in paragraph (1) are the National Institutes of Health, the Centers for Disease Control and Prevention, the Food and Drug Administration, and such other agencies or offices of the Department of Health and Human Services as the Secretary determines to be appropriate. ``(b) Certain Functions.-- ``(1) In general.--In carrying out subsection (a) with respect to a specified agency, the Secretary shall provide for the following: ``(A) Determining the concerns of women scientists employed at the agency. ``(B) Developing a policy defining the standard tenure process for employment at the agency. ``(C) Determining the reason for departure from the agency by interviewing women and men scientists as they leave. ``(D) Distributing yearly to all employees of the agency copies of the policy of the agency on flexible family leave. ``(E) Monitoring the number of women, including minority women, included on the committees, panels, and other working groups (and in meetings) of the agency. ``(F) Making efforts to recruit minority women, based on the small numbers of tenured minority women scientists. ``(G) Developing additional goals related to women and minority women scientists at the agency. ``(2) Agency-specific provisions.--With respect to the National Institutes of Health, in carrying out subsection (a), the Secretary shall (in addition to activities under paragraph (1)) provide for the implementation of the recommendations of the group known as the Task Force on the Status of NIH Intramural Women Scientists. ``(c) Inclusion of Women on Intramural and Extramural Conferences and Other Groups.-- ``(1) In general.--The Secretary shall establish a policy at each specified agency of requiring inclusion of women scientists in greater numbers on or in conferences, workshops, meetings, international congresses, and other groups funded or sponsored by the agency. Such policy shall provide for the inclusion of not less than one woman scientist in each such group, except as provided in paragraph (2). This paragraph applies whether such groups are held for employees of the agency headquarters, for employees of field offices, or both. ``(2) Exclusion; written explanation.--The policy established in paragraph (1) may provide that no woman scientist will be included in a group for purposes of such paragraph if the Secretary provides a waiver of the requirement. The Secretary may grant such a waiver only if-- ``(A) the individual with the chief responsibility for the group involved submits to the Secretary a written request for the waiver and the request provides an explanation of the reasons underlying the need for the waiver; and ``(B) the Secretary makes a determination that extraordinary circumstances justify providing the waiver. ``(d) Study on Pay Equity.-- ``(1) In general.--For each specified agency, the Secretary shall provide for a study to identify any pay differences among men and women scientists employed by the agency, both tenured and untenured. The study shall include recommendations on measures to adjust any disparities or inequities, and shall identify a program to communicate information on salary ranges to all employees. ``(2) Report.--Not later than 240 days after the date of the enactment of the HHS Women Scientist Employment Opportunity Act, the Secretary shall complete the study required in paragraph (1) and submit to the Committee on Commerce of the House of Representatives, and to the Committee on Labor and Human Resources of the Senate, a report describing the findings made as a result of the study. ``(e) Definitions.--For purposes of this section, the term `specified agency' means an agency specified in subsection (a)(2). ``(f) Authorization of Appropriations.--For the purpose of carrying out this section, there are authorized to be appropriated such sums as may be necessary for each of the fiscal years 2000 through 2002.''.

Title: HHS Women Scientist Employment Opportunity Act Summary: HHS Women Scientist Employment Opportunity Act - Directs the Secretary of Health and Human Services to: (1) establish policies for the Department of Health and Human Services on matters relating to the employment of women scientists; and (2) monitor compliance and take appropriate action if policies have been violated. Mandates implementation of the recommendations of the Task Force on the Status of NIH (National Institutes of Health) Intramural Women Scientists. Provides for a study and report on pay equity. Authorizes appropriations.

billsum

en

Summarize: FIELD OF THE INVENTION The invention relates to methods and apparatus for genera; surgery, especially ocular surgery and in particular for cataract surgery. The invention further relates to a device used in such surgery for pupil dilation, for lens capsule dilation and/or for connecting or stabilizing an intraocular lens. The invention also relates to apparatus for cinch locking the device during surgery or as a tether to secure the device when it remains in the eye. BACKGROUND AND PRIOR ART Methods for retracting tissues to improve visualization or prevent trauma to tissues impinging on a surgical site have been used for centuries. Optical instruments, such as speculums or retraction devices require a surgical opening to be made for their insertion thereby adding to the number of wounds required to accomplish proper exposure. Heretofore these devices have been placed through small or large incisions in order to bring retracting or hooking surface to bear against the tissue to be retracted. For cataract surgery a large pupil of 6 mm or more is required. When pupils do not dilate well due to the presence of adhesions, inability of the iris musculature to respond to pharmacologic mydriasis, or for other reasons, a mechanical method of enlarging the pupil is necessary. Stretching the iris has been the most common methodology in the last thirty years. Speculums were employed in the past for retracting the iris during intracapsular cataract surgery whereby removal of the entire lens utilizing an incision of 8-10 mm or larger was required. The Rosenbaum Drews iris retractor was one such example. The surgeon must hold the retractor with one hand while an assistant lifted the cornea and the surgeon removed the lens with a cryoprobe or other such lens removal device with the dominant hand. Models for left and right handed surgeons were designed. With the onset of modern small incision surgery 1.5-6 mm incisions have been employed. The size limitations of a small incision and the presence of a small pupil required that the iris be cut and moved out of the way, stretched using (Kuglen) hooks, (Beehler) pupil stretchers or that a small (peripheral) or large section of the iris be removed (sector iridectomy) to facilitate cataract removal. Recently the presence of a condition whereby the iris prolapses through the small incision has been described. This condition has been given the name “intraocular floppy iris syndrome” or IFIS. Enlarging the incision or introducing instruments into the eye requires that the pupil remain dilated and the iris be kept away from the incision. Intraocular hooks for retracting the iris or lens capsule developed by Makool are introduced through individual small incisions. Four or five of these incisions and hooks are required to adequately retract the iris. With multiple incisions and multiple hooks to retract the iris, insertion and removal may be problematic. The hooks may rotate into the iris stroma damaging the iris and causing bleeding thereby making surgery more difficult. Insertion and removal of the hooks is technically difficult and many surgeons avoid them for this reason. The introduction of pupillary rings developed by Milverton “Perfect Pupil™”, Malyugin “Malyugin ring” is another method for retracting the iris through the incision which is made for cataract removal. An expanding ring is inserted through the small cataract incision. The expense of the device, and the necessity for learning a new methodology with specially developed insertion and removal tools has limited their use. SUMMARY OF THE INVENTION An object of the invention is to provide a speculum or retractor and associated methods for its utilization which avoids the need for hooks or other bulky instruments and their associated incisions as explained above in respect of the prior art. A particular object of the invention is to provide a speculum or retractor which can be introduced into the eye without need for an incision or any closure stitch. The terms speculum, retractor and speculum retractor are used interchangeably and refer to the same element. A further object of the invention is to provide such a speculum or retractor which is made of a deformable material that has shape retentive memory so that it can be installed in a collapsed, deformed state through a needle track into a position adjacent to the iris where it expands to its original state to accomplish various purposes in the eye surgery. In accordance with the invention, the speculum is secured to a suture connected to a needle. The needle is inserted through the cornea into the anterior chamber of the eye and exits from a corneal site several millimeters from the entry site. This results in the speculum remaining in the anterior chamber with suture ends external to the eye. The needle diameter is larger than the deformed speculum allowing easy passage of the flexible speculum through the needle track. The speculum can then be manipulated in the anterior chamber through an original cataract incision or a small paracentesis to engage the iris. The suture is pulled up to a desired position of the speculum resulting in dilation of the iris and the pupil being secured. Several of the sutures with speculums are placed to produce the desired degree of dilation of the iris. The speculum retractors may also be used to engage the capsular bag, if required, for zonular weakness or absence, or to stabilize a subluxed posterior chamber intraocular lens. The speculum retractors may also be used to support a customized intraocular lens in the absence of capsular or iris support. The speculum of the invention has use in general laparoscopic and other forms of surgery of various sizes in which retraction is important for visualization of surgical wounds. DESCRIPTION OF THE FIGURES OF THE DRAWING FIG. 1 is a perspective view of one embodiment of a speculum or retractor according to the invention. FIG. 2 shows another embodiment of the speculum or retractor according to the invention. FIG. 3 diagrammatically illustrates the retractor of FIG. 1 assembled with a needle and a suture for passing through the cornea. FIGS. 3A-3D diagrammatically illustrate progressively the deformation of the retractor for its entry and passage through the needle track. FIG. 4 is a front elevation view which schematically illustrates the placement of the retractor in the anterior chamber of the eye. FIG. 5A diagrammatically illustrates the placement of the speculum into the anterior chamber. FIG. 5B shows the placement of the speculum into the peri-pupillary space. FIG. 5C shows the final position of the speculum. FIG. 6 diagrammatically illustrates a pupil dilated by four retractors. FIGS. 7A-7E diagrammatically illustrate the retractors for tissue retraction. FIG. 8 is a rear elevation view that diagrammatically illustrates the retractor as a docking member for an intraocular lens. FIG. 9 diagrammatically illustrates a single suture cinch lock for a retractor in operative position dilating an iris. FIG. 10A is a top perspective view of a single cinch lock disc. FIG. 10B is a side view of a single cinch lock disc. FIG. 10C is a side perspective view of a single suture cinch lock disc. FIG. 10D is a top perspective view of a double suture cinch lock disc. FIG. 10E is a side view of a double suture cinch lock disc. FIG. 10F is a side perspective view of a double suture cinch lock disc. FIG. 10G is a diagrammatic view of the suture retractor in the pupil in place and retracting the iris and secured by the cinch lock disc. FIG. 11 is similar to FIG. 10G but showing double locking and cinching of the suture. FIG. 12 is similar to FIG. 11 and shows a modification in the double locking and cinching of the suture. FIGS. 13A-13L diagrammatically illustrate variations of the suture cinch lock disc. FIGS. 14A-14C diagrammatically illustrate further variations of the suture cinch disc. FIGS. 15A-15C further illustrate suture cinch lock discs. FIGS. 16A-16C diagrammatically illustrate cinch lock discs. FIGS. 17A and 17B further diagrammatically illustrate the suture cinch lock disc. FIGS. 18-20 illustrate an intraocular lens adapted for engagement with the retractor for being secured therewith. FIG. 21 diagrammatically illustrates a tether secured to a retractor to hold an intraocular lens. DETAILED DESCRIPTION Referring to the drawing and particularly to FIGS. 1-6, therein there is seen a portion of an eye of a patient adapted to undergo cataract surgery. In the course of the surgery, an optical instrument in the form of a treatment device will be used and described in greater detail subsequently and which will include and be referred to hereafter, in equivalent terms, as a speculum, retractor or speculum retractor. The speculum or retractor is made as a deformable body of shape retentive memory material that is capable of being deformed to a stretched, collapsed position and able to return to its original shape when relaxed and no longer deformed. The body can be a natural biometric material, such as titanium, stainless steel or the like or synthetic materials, such as polypropylene or Nylon provided that it is inert to the human body. FIG. 1 diagrammatically illustrates a treatment device comprising a needle 1 of curved shape with a pointed end 2 for piercing body tissue. Connected to the needle, for example, by swaging, or a link coupling, is a flexible suture 3 of conventional suturing material, such as polypropylene or titanium thread. The thread is connected at 4 to one end of the speculum or retractor 5 by swaging or a link connection or the like. At the opposite end 6 of the retractor 5, it is connected to a further length of suture 7. In order for the speculum to be brought to an operative position in the eye, the needle pierces the cornea 8 (only a portion of which is shown) of the eye and transports the suture 3 and the speculum 5 therewith into the anterior chamber 9 of the eye adjacent to the pupillary aperture or pupil 10 in the iris 11 of the eye. In the course of the travel of the needle 1 through the cornea 8, the needle forms a needle track 12 in the cornea, through which the suture 3 and the deformed, collapsed speculum (to be described in more detail subsequently) pass. The needle 1 is of sufficiently small diameter that the needle track 12 self-closes and a closure stitch is unnecessary. FIG. 1 shows the retractor 5 in its initial undeformed state. As shown, the retractor is formed as a continuous length of wire material to constitute a wire-form body and includes two loop members 5 A, 5 B connected by a connecting portion 5 C. The loop members 5 A and 5 B are partial loops that are adapted for engaging the iris or for engaging a lens, or lens capsule as will be explained later. One lower end of loop member 5 A, representing one end 4 of retractor 5, is connected to suture 3. An opposite end 6 of retractor 5 is connected to the suture 7. The loop members are formed as predominantly open semi-circular shape. The loops can have other shapes other than semi-circular as long as it has an opening for insertion of the iris and a curved bearing surface for contacting the iris and applying lifting pressure thereagainst. For example, the loop member can be oval or rectangular with a rounded top or any combination thereof. FIG. 2 shows another embodiment of the retractor in which only a single loop member 5 A is provided. As in the previous embodiment, the retractor 5 is connected at its ends to both sutures 3 and 7. The connection of the suture 3 to the lower end of the loop member is made through a reverse bend at the lower end of the loop member. The retractor is deformed as shown in FIGS. 3A-3C by applying tension thereto by pulling on the needle 1 in one direction and by pulling on the suture 7 in the opposite direction to stretch and deform the retractor. The needle is pulled through the cornea 9 by a conventional needle holder (not shown) to form the needle track 12. The suture 3, the deformed retractor and suture 7 follow in succession. The sequence of the deformation of retractor 5 is shown in FIGS. 3A-3C. It is seen in particular in FIG. 3C that the retractor is substantially in flattened state when fully deformed to enable its passage through the needle track 12. When the retractor has been introduced into the anterior chamber 9 and the needle has exited from the cornea at an exit site several millimeters from the needle entry site, the needle 1 can be separated from the suture 3 so that both ends of the sutures extend outside the cornea. Dimensions A normal corneal diameter is between 11 and 13.5 mm, normal pupil diameter is between 2 and 4 mm and the needle length is between 9 and 15 mm. The retractor in its normal undeformed state has a length of 2-3 mm, a height of 0.5-1 mm and a width of 0.5-1 mm. In its deformed flattened state the retractor has a length of 7-8 mm. The retractor has a wire diameter of 0.1-0.2 mm although it need not be circular but can be slightly oval or flattened. The retractor has sufficient strength and rigidity to apply force to the iris to dilate the pupil as will be shown later. FIG. 4 is a front view showing the iris 11, pupil 10 and the retractor 5 installed in the anterior chamber 9. The sutures 3 and 7 extend outside the cornea. As previously explained, after the needle 1 has entered the anterior chamber, the needle exits from the anterior chamber at an exit site several millimeters from the entry site. Thus the retractor has been introduced into the anterior chamber and the sutures 3 and 7 extend out of the cornea. FIG. 4 shows a modified embodiment of the retractor 5 ′ on enlarged scale in front of iris 11 with pupil 10. The retractor has been shown with its loops turned 90 degrees for purposes of illustration. The retractor has loops 5 A′ and 5 B′ connected by connecting portion 5 C′. The retractor can be manipulated to be adjacent to the pupil whereafter the retractor can be displaced into the pupil by means of a hook 13 ( FIG. 5B ) the hook is inserted into the anterior chamber 9 through a paracentesis (not shown) not requiring a closure stitch. The hook 13 is a conventional means used for various displacement purposes in the eye during surgery. FIG. 5A shows the retractor in front of and spaced from the pupil and anterior to lens 14, in a position in which the openings in the loops 5 A′ and 5 B′ face the edge of the iris with the legs of the loops in a position to straddle the iris so that when the retractor is pulled up, as will be explained later, the loops can engage around the inner peripheral edge of the iris surrounding the pupil. FIG. 9 more clearly shows the engagement of the loops of the retractor with the iris. In order to retract or stretch the iris and expand the pupil, the ends of the sutures are pulled up to apply pressure by the loops 5 A′ and 5 B′ against the inner surface of the iris as shown in FIG. 9. FIG. 5B shows a hook 13 engaging the retractor and FIG. 5C shows the hook having pushed the retractor into the pupil. FIG. 6 diagrammatically shows four substantially equally spaced retractors 5. The retractors 5 are turned 90 degrees for purposes of illustration. The retractors 5 are engaging iris 11 to dilate the pupil when the retractors are in place in the pupil and their sutures are pulled up. FIG. 7 shows a speculum retractor 20 showing loops 21, the retractor being connected at its ends to sutures 3 and 7. FIGS. 7A-7D illustrate the use of the retractor for tissue retraction. In FIG. 7A the needle is shown penetrating and exiting a tissue. The retractor has not yet been used. In FIG. 7B the retractor is shown in position with the sutures in place. In FIG. 7C the retractors were in position prior to retracting the wound on either side of the vertical incision. In FIG. 7D the wound is retracted on either side by the sutures. FIG. 7E shows the retractor in place in cross sectional view. FIG. 8 shows an intraocular lens (IOL) where haptics 23 are extensions that allow docking with modified speculum retractors which are anchored in the cornea or sclera allowing fixation of the implant without suturing the implant directly. The loops of the retractor are shown turned 90 degrees for purposes of illustration, but it is to be understood when installed the legs of the loops will straddle the leg of the haptic. FIG. 9 shows the iris retractor 5 in place in a dilated pupil 10 engaging the peripheral iris 11. The sutures 6 A and 6 B pass through the cornea at 8 A and 8 B respectively. The suture 6 A is shown with the needle 1 A engaging the indentation of a suture cinch lock disc 15 A 1 at 16 and passing through a slit 17 that extends from the indentation to a hole 15. The movement of the suture from the indentation 16 to the hole 15 passes across a path Q with the needle moving from 1 A′ to 1 A. The suture 6 B and needle 1 B have not engaged into the hole 15 in this view. FIGS. 10A-10G illustrate a single and double lock suture cinch disc 15 A 1. FIG. 10A is a top perspective view of a single suture cinch lock disc 15 A 1 having a single indent 16, a single slit 17 and a single hole 15. FIG. 10B is a side view of a single suture cinch lock disc 15 A 1 with a single indent 16, single slit 17 and single hole 15. FIG. 10C is a side perspective view of a single suture cinch lock disc 15 A 1 with a single indent 16, single slit 17 and single hole 15. FIG. 10D is a top perspective view of a double suture cinch lock disc 15 A 2 with two indents 16, 18, two slits 17, 19 and two holes 15 and 20. FIG. 10E is al side view of a double suture cinch lock disc 15 A 2 with two indents 16, 18, two slits 17, 19 and two holes 15 and 20. FIG. 10F is a side perspective view of a double suture cinch lock disc 15 A 2 with two indents 16, 18, two slits 17, 19 and two holes 15 and 20. FIG. 10G is a diagrammatic illustration of the suture retractor 5 in the pupil 7 in place and retracting the iris 7 A. The sutures 6 A and 6 B are connected to the retractor and pass through the cornea at 8 A and 8 B respectively. The needle 1 A is shown already having been placed through the hole 15 of suture cinch lock disc 15 A 2. The suture 6 B and needle 1 B move into the indent at 16 through arc R into the slit 17 and into the hole 15 across path Q with the suture needle arriving at position 1 B′. FIG. 11 is a diagrammatic illustration similar to FIG. 10G showing the suture retractor 5 in the pupil 7 in place and retracting the iris 7 A. The sutures 6 A and 6 B are connected to the retractor and pass through the cornea at 8 A and 8 B respectively. The needle 1 A is shown already having been placed through the hole 15 of suture cinch lock disc 15 A 2. The suture 6 A and needle 1 A move into the indent at 18 through arc 21 and needle at 1 A′, into the slit 19 and into the hole 20 across path 22 with the suture needle arriving at position 1 A″ with the suture 6 A engaged in hole 20 effectively double locking and cinching the suture. The suture 6 B has not been engaged in 15 A in FIG. 11. FIG. 12 is a diagrammatic view similar to FIG. 11 with the suture retractor 5 in the pupil 7 in place and retracting the iris 7 A. The sutures 6 A and 6 B are connected to the retractor and pass through the cornea at 8 A and 8 B respectively. The needle 1 A is shown already having been placed through the hole 15 of suture cinch lock disc 15 A 2. The suture 6 A and needle 1 A are shown in the final position of FIG. 11. Suture 6 B and needle 1 B move into the indent at 16 through arc H and needle at 1 B′, into the slit 17 and into the hole 15 across path I with the suture needle arriving at position 1 B″. The suture 6 B is then moved across path J to engage the indent at 18, the slit at 19 and hole at 20 with needle and suture path K and needle moving from 1 B′″ to 1 B″″ with the suture 6 B engaged in hole 20 effectively double locking and cinching the suture. The sutures 6 A and 6 B are both now double locked. FIG. 13A is a top perspective view of a triple suture cinch lock disc 15 A 3 with three indents 16, 18, 24, three slits 23 and three holes 15, 21 and 22. FIG. 13B is a side view of the triple suture cinch lock disc 15 A 3 with three indents 16, 18, 24, three slits 23 and three holes 15, 21 and 22. FIG. 13C is a side perspective view of the triple suture cinch lock disc 15 A 3 with three indents 16, 18, 24, three slits 23, and three holes 15, 21 and 22. FIG. 13D is a top view of a quadruple clover leaf shaped suture cinch lock disc 15 A 4 with four indents 16, four slits 23, and four holes 15, 20, 21 and 22. FIG. 13E is a top perspective view of the quadruple clover leaf shaped suture cinch lock disc 15 A 4 with four indents 16, four slits 23, and four holes 15, 20, 21 and 22. FIG. 13F is a side perspective view of the quadruple clover leaf shaped suture cinch lock disc 15 A 4 with four indents 16, four slits 23, and four holes 15, 20, 21 and 22. FIG. 13G is a top view of an S shaped double suture cinch lock disc 15 A 5 with four indents 16, four slits 23, and four holes 15, 20, 21 and 22. FIG. 13H is a top perspective view of the S shaped double suture cinch lock disc 15 A 5 with four indents 16, four slits 23, and four holes 15, 20, 21 and 22. FIG. 13I is a side perspective view of the S shaped double suture cinch lock disc 15 A 5 with four indents 16, four slits 23, and four holes 15, 20, 21 and 22. FIG. 13J is a top view of a double oval shaped double suture cinch lock disc 15 A 6 with four indents 16, four slits 23, and four holes 15, 20, 21 and 22. FIG. 13K is a top perspective view of the double oval shaped double suture cinch lock disc 15 A 6 with four indents 16, four slits 23, and four holes 15, 20, 21 and 22. FIG. 13L is a side view of the double oval shaped double suture cinch lock disc 15 A 6 with four indents 16, four slits 23, and four holes 15, 20, 21 and 22. FIGS. 14A-14C illustrate a suture cinch lock disc 15 A 7 with an extension hook like loop 30 which may be attached to a suture loop or clamp to fasten the end distal to the surgical site. The extension may be rigid acting as a hook or flexible allowing the extension to stretch exerting significant traction when fixed under tension. FIG. 14A is a top view of a disc 15 A 7 with three slits 23, and three holes at 15, 21 and 22. FIG. 14B is a side perspective view with three slits 23, and three holes at 15, 21 and 22. FIG. 14C is a side view with three slits 23, and three holes at 15, 21 and 22. FIGS. 15A-15C illustrates a suture cinch lock disc 15 A 8 with an extension hook like loop 31 with a central opening 25 which may be attached to a suture loop, peg or clamp to fasten the end distal to the surgical site. The extension may be rigid acting as a hook or flexible allowing the extension to stretch exerting significant traction when fixed under tension. FIG. 15A is a two dimensional top view with three slits 23 and three holes at 15, 21 and 22. FIG. 15B is a side perspective view with three slits 23, and three holes at 15, 21 and 22. FIG. 15C is a side view with three slits 23, and three holes at 15, 21 and 22. FIGS. 16A-16C illustrate an adherent means 26 on the back surface of a sure cinch lock disc 15 A 92. The disc may have a multiplicity of configurations and holes of various sizes to allow for multiple sutures, cords or ropes. FIG. 16A is a top view showing three slits 23, and three holes at 15, 21 and 22. FIG. 16B is a side perspective view showing three slits 23, and three holes at 15, 21 and 22. FIG. 16C is a side view showing three slits 23, and three holes at 15, 21 and 22. FIGS. 17A and 17B diagrammatically illustrates the suture cinch lock disc in position. FIG. 17A diagrammatically illustrates, similar to FIG. 11, in which the suture retractor 5 is in the pupil 7 in place and retracting the iris 7 A. The sutures 6 A and 6 B are connected to the retractor and pass through the cornea at 8 A and 8 B respectively. The needles 1 A and 1 B are shown already having been placed through the holes 15, 20 of suture cinch lock disc 15 A 2. FIG. 17B shows three suture cinch lock discs 15 A in position with the retractors 5 retracting the iris 7 A and dilating the pupil 7. The inset shows the details of the retractor 5 and the suture cinch lock disc 15 A in place. FIG. 18 is a front perspective view of the intraocular lens (IOL) 35 similar to FIG. 8. The haptics 23 are seen on the back surface of the IOL and are engaged by the loops 5 A and 5 B of the retractors 5. The sutures 3 and 7 are secured to the sclera (not shown) of the eye. The retractors 5 serve as tethers for the IOL. FIG. 19 is a rear view showing the IOL installed in the iris in which the retractors 5, serving as tethers, engage the haptics 23, the ends of sutures 3 and 7 are knotted together at knots 36. The retractors serving as tethers maintain the IOL in place without sulcus or capsule fixation. FIG. 20 is a rear perspective view of the IOL showing the engagement of the retractors 8 with the haptics 23. The sutures 3 and 7 are to be secured to the sclera as previously noted. FIG. 21 is an enlarged diagrammatic view of the eye showing the optic nerve 37, the pars plana region of the retina 38 and the IOL installed in the iris. Also visible are the haptics 23 and the retractors 5. The sutures 3 and 7 are knotted at 36.

Summary: A method and apparatus for performing eye surgery. A deformable body having shape memory retentive properties is formed with one or more open loops. The body is longitudinally stretched so that it can follow a needle through a small caliber needle track formed in the cornea, into the anterior chamber in front of the iris. There, the body has relaxed and reverted to its original shape. The needle is of such size that the needle track self-closes and no closure stitch is needed. Two sutures are connected to opposite ends of the body and one of the sutures connects the body to the needle. After the body is in the pupil of the iris, the loop openings face the wall of the iris and then the sutures are pulled to displace the body and press it against the wall of the iris to dilate the pupil.

big_patent

en

Write a title and summarize: La Milicia Bolivariana está formada por civiles partidarios del gobierno socialista que han sido armados y entrenados. Con ese mensaje publicado este martes en su cuenta de Twitter, el mandatario venezolano Nicolás Maduro confirmó la decisión de su gobierno de enviar 1.000 milicianos al estado Apure (suroeste del país), donde desde el pasado 21 de marzo se han producido enfrentamientos entre disidentes de la exguerrilla de las FARC y militares venezolanos. La Milicia Bolivariana es un cuerpo formado por civiles, ideológicamente alineados con el gobierno socialista de Venezuela que han sido entrenados y armados para actuar como un componente adicional de la FANB. Desde su creación, bajo el gobierno de Hugo Chávez, ha estado rodeada de polémica. El fallecido mandatario quiso incorporarla como parte de la Fuerza Armada Bolivariana en su propuesta de reforma constitucional que fue rechazada por los electores de 2007. En febrero de 2020, finalmente se produjo esa incorporación a través de una reforma de la Ley de la FANB aprobada por la cuestionada Asamblea Nacional Constituyente (controlada por el chavismo) y que, según sus críticos, estaba actuando en usurpación de los poderes del parlamento venezolano (controlado entonces por la oposición). Final de Quizás también te interese "La guerra de todo el pueblo" Detrás de la creación de esta milicia estaba la idea de Chávez de impulsar la unión "cívico-militar", de preparar al país para una posible "guerra asimétrica" en contra de Estados Unidos, inspirado en un concepto de la doctrina militar cubana conocido como la "Guerra de todo el pueblo", que prevé que ante un eventual ataque del "imperialismo", las fuerzas armadas sean reforzadas por la milicia y "el pueblo en armas". Maduro dijo el martes que ante lo que ocurre en Apure debe haber una "guerra de todo el pueblo" y que esa experiencia sirve como "enseñanza para defender el territorio ante grupos armados por el Comando Sur" de Estados Unidos y el gobierno de Colombia, a quienes vincula con esos ataques. Más de 6.000 personas se han desplazado desde Venezuela hasta Colombia, huyendo de los choques armados en Apure. Unos 6.000 residentes de Apure han tenido que cruzar la frontera hacia Colombia huyendo de estos choques armados, en los que han fallecido 8 militares venezolanos, según las autoridades de ese país. El comandante de la Milicia Bolivariana, mayor general Manuel Bernal Martínez, dijo que los 1.000 milicianos que enviarán a Apure son voluntarios y que actuarán como una "fuerza miliciana humanitaria de protección a las comunidades" de la región. En Cuba, la "guerra de todo el pueblo" está contemplada en la Ley de Defensa Nacional, aprobada en 1994, como parte de la doctrina militar de ese país. Según esa legislación, la guerra de todo el pueblo, como concepción estratégica defensiva del país, "resume la experiencia histórica acumulada por la nación; se basa en el despliegue del sistema defensivo territorial como sustento de su poderío militar, y en el empleo más variado de todas las fuerzas y recursos de la sociedad y el Estado". Sin embargo, los orígenes de esta doctrina se vinculan al pensamiento de Fidel Castro, quien desde los primeros años de la revolución cubana se mostró partidario de incorporar de forma masiva a la población civil en la defensa del país. Así, ya en 1959, el fallecido mandatario cubano señalaba: "Cuando cada fábrica sea una fortaleza, cuando cada sindicato sea un baluarte de la Revolución, cuando cada esquina, cada calle, cada barrio, cada loma, cada camino, cada árbol tenga un hombre que lo defienda; cuando cada uno de los sitios donde trabajan los 3.000 delegados de este Congreso sean fortalezas de la Revolución y los obreros tengan disciplina y los obreros estén unidos y los obreros tengan entrenamiento y los obreros sepan combatir; y cuando al lado de esa fuerza tremenda e invencible esté la fuerza de los campesinos en cada cooperativa, en cada pedazo de tierra —cuyos títulos les ha entregado la Revolución—, en cada montaña, en cada río, en cada valle, en cada piedra, ¿quién podrá vencer esta Revolución?". Ahora puedes recibir notificaciones de BBC News Mundo. Descarga la nueva versión de nuestra app y actívalas para no perderte nuestro mejor contenido.

Title: Tensión en Apure y Arauca: la "guerra de todo el pueblo", la doctrina militar con la que Maduro justificó el envío de 1.000 milicianos a la frontera con Colombia Summary: "Les ratifico la orden a la FANB (Fuerza Armada Nacional Bolivariana) y a la Milicia Bolivariana en el estado Apure, de aplicar la doctrina: Guerra de todo el Pueblo contra grupos irregulares y terroristas colombianos. Unión Cívico-Militar-Policial en defensa de la soberanía venezolana. ¡Cero Tolerancia!".

xlsum_es

es

Summarize: Fadi Fawaz, the partner of legendary pop icon George Michael, deleted his Twitter account shortly after apparently taking to the social media platform to state that the ‘Faith’ singer had killed himself. Michael was found deceased on Christmas Day and there has been much speculation at the cause of death. It was initially reported that the 53-year-old died from heart failure. However, a post-mortem came back with inconclusive results and further tests will now be conducted to find what led to Michael dying. On Sunday morning, Fawaz’s account sent out the following series of tweets indicating that Michael had been suicidal for a long time and had attempted to take his life previously. The account would be deleted quickly after these tweets were sent. The Daily Mirror was able to speak with Fawaz, who stated that his account was hacked. Fawaz later told the Mirror: “I am shocked with what’s going on with the Twitter thing. My Twitter account has been hacked and closed. “It’s a bit scary to be honest. I did not send those tweets. I woke up at 11.30am to the news. I am not going to worry about these things.” In a statement, the family of Michael said it didn’t want to comment on any speculation on his death. “In the week since his tragic death there has been much comment and speculation concerning George and the circumstances surrounding his death. There will inevitably be more in the future. The family remain devastated by his passing​ and have no wish to comment in relation to any such speculation, whether current or in the future.�? Per the Sun, Fawaz and Michael had been together since 2009, following Michael’s split from his longtime partner Kenny Goss. It was also stated that Fawaz helped Michael get through some issues with drugs, including the singer’s sting in rehab. [image via screengrab] – Follow Justin Baragona on Twitter: @justinbaragona Have a tip we should know? [email protected] Get celebs updates directly to your inbox Subscribe See our privacy notice Thank you for subscribing! Could not subscribe, try again later Invalid Email George Michael killed himself on Christmas Day after numerous suicide attempts, tweets from his boyfriend's Twitter account have claimed. A series of tweets appearing on Fadi Fawaz's account this morning claimed the singer killed himself after a number of attempts at his life. The tweets said: "Not sure who that nasty close friend of George (sic) but i was in a relationship with George Michael till i found him dead in bed. "The only thing George wanted is to die. He tried numbers of times to kill himself many times and finally he managed. "We loved each other very much and were together almost 24 hours a day." (Image: Twitter/@Fadifawaz) The tweets were soon deleted and the account closed. Fawaz later told the Mirror: "I am shocked with what's going on with the Twitter thing. My Twitter account has been hacked and closed. "It's a bit scary to be honest. I did not send those tweets. I woke up at 11.30am to the news. I am not going to worry about these things." The cause of the singer's death has not yet been confirmed, with the initial post mortem proving inconclusive. Fawaz last week used his Twitter account to reveal that he found George dead in bed. He also posted a tribute to the singer. A tweet posted on Fawaz's account last night said: "I hate you 2016 from the bottom of my heart". (Image: Twitter/@Fadifawaz) Another tweet said: "I would like to get the record straight. I’m 40-year-old and I’m fine art photographer." On Boxing Day, a tweet on the account read: "Its a Xmas I will never forget finding your partner dead peacefully in bed first thing in the morning..I will never stop missing you." It was reported today that George was in ­despair when he died because the voice that made him a ­superstar had been ruined. The pop legend lost 20 per cent of his lung capacity after contracting pneumonia in 2011 and was devastated to find it had reduced his ability to sing. (Image: Splash News) He was torn apart by the setback to his plans for a comeback in 2017. News of his state of mind emerged after an inconclusive post mortem raised the possibility that he did not die of natural causes as initially thought. (Image: Rex) A source close to George, who died aged 53 on Christmas Day, said: “Losing voice capacity for a man like him was like losing his inner self or his soul. “Things got so dark and difficult after it hit him. It tipped him over a psychological edge. George would never be the same man again – and more importantly, never be the same singer. “He needed drugs and alcohol and anything he could get hold of to cope with such a severe loss.” Friends revealed that the singer who shot to fame with Wham! suffered lasting effects from the life-threatening pneumonia, which left him unconscious for 15 days. Doctors had to perform a tracheotomy to keep his airways open. He recovered but found it difficult to walk uphill, swim and do the thing he loved most – sing. It is understood he was left with only three quarters of his lungs functioning and could only limp through performances with the help of steroids and other medication. He could barely finish a concert, never mind a whole tour. Video Loading Video Unavailable Click to play Tap to play The video will start in 8 Cancel Play now “It was the third big loss in his life,” said the insider. “He lost his partner Anselmo Feleppa to HIV, his mother Lesley and then the voice he once had. “To lose your three most cherished things by your early 50s is very hard and was a big load to carry. “George was an old soul who died young because he found it very hard to manage the albatrosses in his life.” (Image: Photoshot) But he was determined to get back to making music and was set to release a new album next year, produced by Naughty Boy. UK songwriter, musician and producer Naughty Boy, 31, said last month: “I can’t wait. I don’t know what to ­expect. He’s mysterious.” The source confirmed: “Yes, he was going to do another album. He was planning to regain some breath control by regular swimming with a therapist and walking, to strengthen his lungs and get the weight down. “But George knew that in reality his lungs would never regain their same capacity. Sooner or later he would be the star who used to sing for hours and do tours. Could he ever do this again? Could he be like Madonna, or Elton, or Mick Jagger – all older than him but but still bouncing around? That’s the kind of thing he was filled up with. He was a haunted man.” George left three full ­albums of unreleased music in his private collection. Now they may never see the light of day. The perfectionist performer had shelved the nearly-finished albums and those in charge of his estate will not go against his wishes. George was found dead in bed at his home in Goring-on-Thames, Oxfordshire, by his partner Fadi Fawaz, 40. Further tests are planned to determine how he died. Police said the star’s death was still being treated as unexplained but not suspicious.

Summary: On Sunday morning, a series of tweets posted to the Twitter account of George Michael's partner, Fadi Fawaz, indicated Michael took his own life. "The only thing George wanted is to DIE... he tired [sic] numbers of time to kill himself many times... and finally he managed," read some of the tweets captured in screenshots by Mashable. Fawaz's Twitter account was deleted soon thereafter. But Fawaz tells the Daily Mirror he didn't write the tweets: "I am shocked with what's going on with the Twitter thing. My Twitter account has been hacked and closed." There is no official word yet on the cause of death for the 53-year-old singer.

multi_news

en

Summarize: FIELD OF THE INVENTION [0001] The present invention generally relates to a lacrosse head. The present invention more particularly relates to a lacrosse head to be used by a goalie in a game of box lacrosse. BACKGROUND OF THE INVENTION [0002] Box lacrosse is played indoors on an enclosed rink, often on an ice rink where the ice has been removed. The playing area is referred to as the box. Conversely, field lacrosse is played outdoors on an unenclosed playing field. [0003] Box lacrosse goaltenders typically hold their sticks much differently than field lacrosse goaltenders. Field lacrosse goaltenders tend to hold their sticks elevated such that the head is positioned upward. On the other hand, box lacrosse goaltenders tend to hold their sticks such that the head is positioned downward between the goaltenders&#39; legs. The scoop portion of the head often rests on the ground. [0004] Currently box lacrosse goaltenders use either a lacrosse stick that was designed to be used by a field lacrosse goaltender or a manually constructed box lacrosse goaltender stick. There are disadvantages of using both types of lacrosse sticks by a goaltender in the game of box lacrosse. [0005] There are disadvantages of a box lacrosse goaltender using a stick that was designed to be used by a field lacrosse goaltender. One disadvantage is that the field lacrosse goaltender sticks have a small head that does not sufficiently fill the space between the goaltenders legs. Another disadvantage is that the shape of the scoop is curved such that it does not allow the stick to rest flat on the ground to more effectively prevent the ball from entering the goal. [0006] There are also disadvantages of a box lacrosse goaltender using a manually constructed box lacrosse goaltender stick. These types of sticks tend to have the correct proportion for filling the space between the goaltender&#39;s legs however, they are known to be very heavy and not well balanced. These disadvantages are the due to the fact that they are made by hand from wood. A stick that is heavy and not well balanced results is less effective manipulation of the ball. [0007] Therefore, there is a need for a lacrosse head for use by a goaltender playing the sport of box lacrosse that is has the proper proportions for filling the space between the goaltender&#39;s legs, is light-weight and well-balanced. SUMMARY OF THE INVENTION [0008] The present invention overcomes the disadvantages of known box lacrosse goalie heads by providing a box lacrosse goalie head that is larger than known field lacrosse goaltender stick heads. Further, the present invention is lighter weight and more balanced than known manually constructed box lacrosse goal heads. [0009] In accordance with the advantages of the present invention, a box lacrosse goaltender head is disclosed that includes a generally triangular-shaped frame having a ball stop portion, a scoop portion opposite from the ball stop portion and a pair of sidewalls each having a first linear portion and a second linear portion extending between the ball stop portion and the scoop portion. The scoop portion has a substantially flat exterior surface and generally curvilinear interior surface. Each sidewall second linear portion is positioned on an angle relative to the first linear portion. The first and second sidewalls are mirror images of each other. [0010] Other advantages and features of the present invention will become apparent when viewed in light of the detailed description of the invention and taken in conjunction with the attached drawings and claims. BRIEF DESCRIPTION OF THE DRAWINGS [0011] The present invention will be described, by way of example, with reference to the following drawings. [0012] FIG. 1 illustrates a front view of a box lacrosse goalie stick in accordance with an embodiment of the present invention; [0013] FIG. 2 illustrates a front view of a box lacrosse goalie head in accordance with an embodiment of the present invention; and [0014] FIG. 3 illustrates a side view of a box lacrosse goalie head in accordance with an embodiment of the present invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT [0015] Referring to FIG. 1, a box lacrosse goaltender stick is disclosed in the present invention, shown generally at 20. The stick 20 includes a head frame 22 to which a handle 24 and a pocket 26 are attached. [0016] The frame 22 has a generally triangular shape including a ball stop portion 28, a scoop portion 30 opposite from the ball stop portion 28 and two sidewalls 32, 34, each having a first linear portion 36, 40 and a second linear portion 38, 42. Both sidewalls 32, 34 extend between the ball stop portion 28 and the scoop portion 30. [0017] The scoop portion 30 of the frame 22 includes a flat linear exterior surface 44 and a curvilinear interior surface 46. The flat linear exterior surface 44 has a first corner 48 and a second corner 50. The distance 52 between the first corner 48 and the second corner 50 measures in the range of 14.0 inches to 16.0 inches. In the embodiment illustrated, the first and second corners 48, 50 are curved or rounded. However it should be noted that they could have a more pointed geometry. The flat linear exterior surface 44 allows the goaltender to rest the lacrosse stick 20 on the ground periodically during the game. This provides a more stable surface to rest the stick on and more area coverage to effectively stop the ball as it is thrown or shot at the goal. [0018] Both sidewalls 32, 34 have a first end 54, 58 and a second end 56, 60. The first end 54 of the first sidewall 32 coincides with the first corner 48 where the flat linear exterior surface 44 of the scoop 30 and the first linear portion 36 intersect. The first end 58 of the second sidewall 34 coincides with the second corner 50 where the substantially flat linear exterior surface 44 of the scoop 30 and the first linear portion 40 intersect. The second end 56, 60 of each sidewall 32, 34 intersects opposing ends of the ball stop portion of the frame 28. The location of the first end 54, 58 and the second ends 56, 60 need not be a specific boundary, but preferably are a general location as is understood by a person of ordinary skill in the art. [0019] The first sidewall 32 includes a first linear portion 36 and a second linear portion 38. The first linear portion 36 extends between the first end 54 and an intermediate point 62. The second linear portion 38 extends between the intermediate point 62 and the second end 56. The second linear portion 38 is positioned on an angle alpha (α) relative to the first linear portion 36. [0020] Similarly, the second sidewall 34 has a first linear portion 40 and a second linear portion 42. The first linear portion 40 extends between the first end 58 and an intermediate point 66. The second linear portion 42 extends between the intermediate point 66 and the second end 60. The second linear portion 42 is positioned on an angle beta (β) relative to the first linear portion 40. The first and second sidewalls 32, 34 are mirror images of each other. In the embodiment illustrated, the first linear portion 36 of the first sidewall 32 and the first linear portion 40 of the second sidewall 34 are both longer than the second linear portions 38, 42 of the first and second sidewalls 32, 34. [0021] Referring to FIG. 3, the frame 22 is generally flat having a thickness 86 in the range of 0.5 inches to 2.5 inches. Further the frame 22 includes a throat portion 70 that extends down from the ball stop portion 28 for attachment to the handle 24. The top 72 of the throat portion coincides with the ball stop portion 28 of the frame 22. The bottom 74 of the throat portion 70 includes the attachment region 76 for attachment of the frame 22 to the handle 24. The distance 78 from the flat linear exterior surface 44 of the scoop to the bottom 74 of the throat portion 70 measures in the range from 25.0 to 27.0 inches. The distance 80 from the flat linear exterior surface 44 of the scoop to the top 72 of the throat portion measures in the range from 23.0 inches to 25.0 inches. [0022] When assembled, the lacrosse head includes a pocket 26 that is attached to a lacrosse head frame 22 via pocket securing apertures 82 that are located in the scoop 30, the ball stop portion 28, and the sidewalls 32, 34. In one embodiment, the pocket 26 includes lace-like, pocket cords 84 that are placed through the apertures 82 in the frame 22 and secured in place, often by being tied into a knot. The lacrosse pocket 26 is flexible and includes enough material to give the pocket depth beyond the frame to cradle a lacrosse ball. It will also be understood that other types of netting or pockets, such as mesh, may also be utilized. [0023] The assembled box lacrosse stick 20 is light-weight, weighing in the range of 2.0 to 2.5 pounds. The frame 22 could be made from molded plastic, but is not limited to that particular material. This is much improved over known box lacrosse goal sticks that are made from wood and weigh in the range of 3.0 to 3.5 pounds. [0024] While the present invention has been described in what is presently considered to be its most practical and preferred embodiment or implementation, it is to be understood that the invention is not to be limited to the disclosed embodiment. On the contrary, the present invention is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims, which scope is to be accorded the broadest interpretation so as to encompass all such modifications and equivalent structures as is permitted under the law.

Summary: The present invention provides a box lacrosse goalie stick including a generally triangular shaped frame having a scoop portion with a flat exterior surface measuring in the range from 14.5 inches to 16.5 inches. The lacrosse stick of the present invention includes a head that is larger than field lacrosse goalie sticks. Further, the lacrosse stick of the present invention is lighter weight and more balanced than a box lacrosse goalie stick that is hand made from wood.

big_patent

en

Write a title and summarize: SOX2 is a master regulator of both pluripotent embryonic stem cells (ESCs) and multipotent neural progenitor cells (NPCs); however, we currently lack a detailed understanding of how SOX2 controls these distinct stem cell populations. Here we show by genome-wide analysis that, while SOX2 bound to a distinct set of gene promoters in ESCs and NPCs, the majority of regions coincided with unique distal enhancer elements, important cis-acting regulators of tissue-specific gene expression programs. Notably, SOX2 bound the same consensus DNA motif in both cell types, suggesting that additional factors contribute to target specificity. We found that, similar to its association with OCT4 (Pou5f1) in ESCs, the related POU family member BRN2 (Pou3f2) co-occupied a large set of putative distal enhancers with SOX2 in NPCs. Forced expression of BRN2 in ESCs led to functional recruitment of SOX2 to a subset of NPC-specific targets and to precocious differentiation toward a neural-like state. Further analysis of the bound sequences revealed differences in the distances of SOX and POU peaks in the two cell types and identified motifs for additional transcription factors. Together, these data suggest that SOX2 controls a larger network of genes than previously anticipated through binding of distal enhancers and that transitions in POU partner factors may control tissue-specific transcriptional programs. Our findings have important implications for understanding lineage specification and somatic cell reprogramming, where SOX2, OCT4, and BRN2 have been shown to be key factors. Transcription factors bind DNA in a sequence-specific manner and regulate gene expression patterns in response to developmental cues. Thus, transcription factors often direct a hierarchy of events controlling cellular identity [1], [2]. The HMG box containing transcription factor SOX2 is essential for the development of the epiblast in the early mammalian embryo [3] and for the maintenance of embryonic stem cells (ESCs) in vitro [4]. SOX2 is also necessary for the function and maintenance of neural progenitor cells (NPCs) in the nervous system [5], [6]. Further, SOX2 functions in other adult stem cell and progenitor populations in the gastrointestinal and respiratory tract, as well as in the developing lens, inner ear, taste buds, and testes [7]–[12]. Thus, SOX2 is a critical regulator of distinct stem cell states, but how it can serve this multifunctional role is not fully understood. In ESCs, SOX2 is a component of the core transcriptional regulatory circuitry that controls pluripotency. Together with OCT4 (Pou5f1) and NANOG, SOX2 binds to the proximal promoters of large cohort of genes with known roles in pluripotency (including Oct4, Sox2, and Nanog) as well as those that function later in development [13]–[16]. These data suggest that SOX2 regulates ESC state by actively promoting pluripotency and by marking the regulatory regions of developmental genes for future activation. Consistent with this, SOX2 can act as a pioneer factor at a subset of genes in ESCs, and can be sequentially replaced by other SOX family members during differentiation, leading to activation of genes [17], [18]. SOX2 is also a critical factor in somatic cell reprogramming, whereby adult cells are converted into a pluripotent ESC-like state by the exogenous expression of a small set of transcription factors [19]–[21], with SOX2 being at the top of a gene expression hierarchy during the late phase of reprogramming [22]. In the central nervous system (CNS), Sox2 is required for proper NPC function during embryonic development and for maintenance of NPCs postnatally [23]–[25]. Specifically, loss of Sox2 in the developing CNS leads to multiple brain defects, including precocious progenitor differentiation and a reduced proliferating cell population in the brain, resulting in perinatal lethality [5], [6], [26], [27]. In contrast, forced expression of Sox2 blocks terminal differentiation of NPCs [26]–[29]. While a critical role for Sox2 in distinct stem cell populations has been firmly established both in vivo and in vitro, the molecular mechanisms by which SOX2 regulates cell type-specific gene expression programs are not clear. Analysis of genome-wide binding profiles indicates that SOX2 occupies the promoters of thousands of genes [17], [30], however, a direct comparison of SOX2 targets in ESCs and NPCs has not been reported. Emerging evidence indicates that transcription factors drive tissue specific gene expression programs through interactions with distal enhancer elements [31]–[33]. Recent studies have shown that histone modification patterns, specifically monomethylation of lysine 4 of histone H3 (H3K4me1) and acetylation of lysine 27 on histone H3 (H3K27ac), mark distal enhancers [34]–[37]. Using this set of histone marks, we previously identified thousands of enhancer elements in ESCs and NPCs [34]. Thus far, the binding of SOX2 at enhancers has only been clearly demonstrated at a few genes in both ESCs and NPCs. For example, SOX2 occupies the proximal and distal enhancers upstream of the Oct4 promoter in ESCs whereas binding at an intronic enhancer (Nes30) in the Nestin gene was observed in NPCs [14], [38]–[40]. Thus, knowledge of SOX2-bound enhancers in these two cell types will contribute significant new insights into understanding control of cell state. SOX family members weakly bind DNA and cannot robustly activate transcription alone, suggesting roles for additional partner factors in target selection [41]. Consistent with this, cooperation between SOX and POU transcription factor families has been highly conserved across metazoans where these factors are important regulators of developmental programs [42]. For example, SOX2 cooperates with the Class V POU family member OCT4 in ESCs to maintain pluripotency [13]–[16], however transcription factors that function with SOX2 genome-wide in NPCs are largely unknown. Thus, the identification of factors that bind to genomic sites with SOX2 will also be key to understanding how this master regulator can control distinct phenotypic outcomes. Here, we defined the genome-wide binding patterns of SOX2 in ESCs and NPCs and show that SOX2 occupied a largely distinct set of genomic regions within promoters and distal enhancer elements in the two cell types. Similar to its cooperation with OCT4 (Pou5f1) in ESCs, we identified the Class III POU transcription factor BRN2 (Pou3f2) as a candidate SOX2 partner factor that co-bound a large fraction of distal enhancers with SOX2 in NPCs. Consistent with a functional role, forced expression of BRN2 in differentiating ESCs led to recruitment of SOX2 to a subset of NPC distal enhancers. This recruitment was associated with changes in chromatin structure, activation of neighboring genes, and ultimately precocious differentiation toward a neural-like state. Further analysis of bound sequences showed differences in the arrangement of a SOX-POU binding in ESCs and NPCs and revealed enrichment for additional transcription factor motifs. Together, these data reveal new insights into how SOX2 can function in a context-dependent manner to specify distinct stem cell states. Our work also has important implications for understanding development as well as the process of somatic cell reprogramming. SOX2 is a master regulator of pluripotent ESCs and multipotent NPCs, yet how the same transcription factor can specify distinct stem cell states remains an open question. We reasoned that detailed analysis of genomic binding patterns in the two cell types might reveal how SOX2 can regulate diverse gene expression programs. To this end, we differentiated ESCs toward NPCs using established protocols [43], and interrogated SOX2 binding sites by chromatin immunoprecipitation followed by massively parallel sequencing (ChIP-Seq). Analysis of SOX2 binding in genetically identical ESC and NPC lines identified 13,717 and 16,685 enriched regions, respectively (Table S1). Our results were highly consistent with prior work in ESCs [16], however we observed a lower correlation compared to published data sets in neural progenitor cells (Figure S1A and Discussion). We found that >95% of bound regions are unique to each cell type (only 1,274 of the total regions are common to both datasets) (Figure 1A and Figure S1A, S1B). Thus, we identified a union set of 29,128 enriched regions at high confidence and found that SOX2 occupied a largely non-overlapping set of genomic sites in ESCs and NPCs. SOX2 is thought to bind to regulatory regions of genes with roles in stem cell maintenance and neural differentiation [13]–[16], however, a direct comparison of genome-wide binding in ESCs and NPCs has not been reported. Thus, we first mapped binding sites within 1 kb of a transcription start site (TSS) and found that SOX2 occupied 893 and 3,821 sites within promoters in ESCs and NPCs, respectively (Table S2). While ∼one-third (36%) of bound TSSs in ESCs were common to NPCs, SOX2 largely occupied distinct sites within promoters in the two cell types (Figure S1C). For example, SOX2 occupied the Nanog promoter only in ESCs, while the Egr2 (Krox20) promoter was bound only in NPCs, and a site within the Hdac9 promoter was occupied in both cell types (Figure 1B). Nanog and Egr2 are critical regulators of the ESC state and neural development, respectively, and Hdac9 is a broadly expressed chromatin regulator with a known role in brain development [44]–[48]. Furthermore, we also found examples where SOX2 occupied different sites in ESCs and NPCs but within the promoters of the same gene, such as the Rlim promoter, which encodes a regulator of both X-inactivation and later neural patterning [49], [50] (Figure 1B). Consistent with this, while roughly one-third of TSS-associated regions overlapped in ESCs and NPCs, 58% of the genes bound by SOX2 in ESCs were also NPC targets (Figure 1B, Figure S1C and S1D). These data suggest that SOX2 can utilize different binding sites to regulate genes in a context-dependent manner. On a global level, SOX2 bound to a set of genes that code for chromatin and transcriptional regulators in both ESCs and NPCs in accordance with previous data [13]–[16] (Figure 1C, 1D and Table S3). While many of these targets were common to both cell types, a large group of chromatin and transcriptional regulators (490) were occupied uniquely in NPCs. Moreover, SOX2 bound more promoter regions in NPCs compared to ESCs and also occupied genes with diverse functions such as RNA splicing, regulation of the ubiquitin cycle, and translation (Figure 1D). While RNA splicing is a general cellular function, alternative splicing is known to play a key role in brain development [51]. For example, in NPCs, SOX2 occupied the promoters of the alternative splicing factors PTB and nPTB, which constitute a molecular switch regulating neuronal commitment [52]. We also found that SOX2 occupied genes displayed higher expression compared to all genes (Figure 1E, 1F and Table S4) suggesting that SOX2 has a positive regulatory role at promoters in each cell type. While SOX2 occupied proximal promoter regions in the two cell types, the vast majority of bound sites (>93% and >77% in ESCs and NPCs, respectively) mapped greater than 1 kb from annotated TSSs (Figure 2A). Distal enhancers are important non-coding DNA elements that control tissue specific gene expression patterns at variable distances from the promoters they regulate through binding of transcriptional and chromatin regulators [31]–[33]. We previously identified thousands of putative enhancers in ESCs and NPCs by genome-wide analysis of H3K4me1 and H3K27Ac occupancy, two histone marks known to mark distal enhancer elements [34]. SOX2 bound ∼17% (4,947) and ∼24% (6,842) of these putative enhancers in ESCs and NPCs, respectively (Figure 2B and Table S2). Currently, distal enhancers are presumed to regulate the nearest gene [34], [37], and after assigning each enhancer to the nearest upstream or downstream gene, we found that the SOX2-bound enhancers corresponded to 3,372 and 3,990 genes in ESCs and NPCs, respectively (Table S2). While these sites were largely distinct in the two cell types (Figure S2A), ∼44% of genes associated with SOX2 enhancers in ESCs also had a bound enhancer assigned to the same gene in NPCs (Figure S2B) and included many factors with specific roles in neural specification. Notably, analysis of bound enhancers revealed thousands of additional genes that may be regulated by SOX2 in both cell types which would not have been identified by analysis of only TSSs (Figure S2C, S2D). These data are consistent with the idea that, while enhancer utilization is highly cell type-specific, individual genes can be regulated by different enhancers [31], [53]. The pattern of H3K4me1 and H3K27Ac occupancy can distinguish a given enhancer as active (H3K4me1+/−; H3K27Ac+) or poised (H3K4me1+; H3K27Ac−), states which correlate with high expression of a neighboring gene or the potential of that gene to be expressed later during development, respectively [34], [37], [54], [55]. Thus, globally genes nearest active enhancers are expressed at a higher level than those linked to poised elements. By comparison of SOX2-bound regions with the set of active and poised enhancers in our previous study [34], we found that SOX2 occupied 2,100 and 4,037 poised enhancers and 2,847 and 2,805 active enhancers in ESCs and NPCs, respectively (Table S2). Consistent with the idea that enhancers regulate transcriptional output, expression of genes closest to SOX2-bound active enhancers is significantly higher than genes associated with SOX2-bound poised enhancers (Figure 2C). To gain deeper biological insights, we used the GREAT algorithm to perform Gene Ontology (GO) analysis to determine the function of genes associated with SOX2-bound enhancers. SOX2-bound poised enhancers in ESCs were nearest genes that function in commitment to the neural lineage and morphogenesis and included Jag1, Neurog3, and Nkx2-2, whereas those associated with poised enhancers in NPCs included genes with roles in terminal differentiation into neurons and glia such as Atoh1, Lhx8, Id2 and Id4 (Figure 2D, Tables S5 and S6). Notably, SOX2 bound to active enhancers nearest genes with functions in stem cell development in both cell types. Enriched categories in ESCs also revealed genes that function in early development and axis specification whereas genes linked to active enhancers in NPCs have roles in WNT signaling and neurogenesis (Figure 2E). For example, SOX2 occupied a known enhancer in the 5′ region of the Nanog locus in ESCs [56] and bound to intronic enhancers in Notch1 in NPCs [57], [58], known regulators of pluripotency and neurogenesis, respectively (Figure 2F). Thus, we identified thousands of stage-specific enhancers including many previously known enhancers in both cell types. Despite the low overlap of SOX2-bound enhancer regions in ESCs and NPCs, genes linked to SOX2-bound poised enhancers in ESCs had functions in neural development, similar to genes linked to SOX2-bound enhancers in NPCs. Thus, we hypothesized that SOX2 might be regulating a subset of targets in both cell types by occupying distinct enhancer elements. Indeed, direct comparison of these genes revealed that ∼50% of genes (821 of 1,654) associated with SOX2-bound poised enhancers in ESCs also had a bound enhancer associated with that gene in NPCs (Figure S2E), despite the regions of SOX2 binding being largely cell-type specific. Importantly, genes where enhancers remained poised showed no significant difference in expression whereas those genes that gained active enhancers were expressed at higher levels (Figure S2F). These data are consistent with the idea that, while enhancer utilization is highly cell type-specific, individual genes can be regulated by different enhancers [31], [53]. Along those lines, using the GREAT algorithm to query the MGI gene expression database, we determined that 2,253 of the 4,037 SOX2-bound poised enhancers in NPCs were linked to genes expressed in the postnatal mouse nervous system (binomial p-value = 1. 91e-35) (Table S6). Together, our data support the idea that poised enhancers can predict future developmental potential and suggest that SOX2 regulates a larger network of genes than previously anticipated by binding to distal enhancer elements. SOX2 binds DNA weakly and it is insufficient to strongly activate transcription without cooperation with additional factors [59]. Consistent with this idea, we identified the canonical SOX2 motif, 5′-CTTTGTT-3′ [60]–[63] as highly enriched in ESCs and NPCs despite the difference in binding patterns (Figure 3A). Thus, we sought to identify additional factors that may function with SOX2 in ESCs and NPCs. SOX2 partners with the Class V POU-domain containing transcription factor OCT4 in ESCs to regulate a large cohort of genes important for pluripotency [13]–[16] however, partner factors in NPCs have not been clearly defined. Interactions between SOX and POU factors are conserved in all metazoans and play key roles in embryonic development [42], thus, we hypothesized that SOX2 may also function with POU factors in NPCs. To test this, we interrogated a 100 bp window surrounding peaks of SOX2 enrichment in NPCs and determined enrichment for all known vertebrate transcription factor-binding motifs in the TRANSFAC database. Notably, we identified several enriched motifs, including two highly similar motifs recognized by the Class III POU factor BRN2 (Pou3f2) (Figure 3B and Table S7). BRN2 was of particular interest for several reasons. First, our transcriptome analysis showed that Brn2 is highly expressed in NPCs, but not in ESCs (Table S7). Moreover, Brn2 and Sox2 are both expressed in neurogenic regions of the brain and SOX2 and BRN2 are known to co-occupy a small number of loci in this tissue [38], [64], [65]. Like Sox2, Brn2 loss-of-function causes pleiotropic defects and NPC impairment [66]–[69]. Furthermore, Sox2, Brn2, and the forkhead transcription factor Foxg1 are sufficient to reprogram fibroblasts toward a multipotent NPC-like state [70]. These data suggest that transitions in POU partner factors of SOX2 may control cell identity in distinct stem cell populations. Although neurogenesis and maintenance of cell identity in the brain require BRN2, its target genes in NPCs were not known. To address this, we performed ChIP-Seq and identified 6,574 BRN2 occupied regions in NPCs (Table S1). Similar to SOX2-bound regions, more BRN2-bound regions mapped to previously identified distal enhancers [34] than to promoter regions (Figure S3A). Motif analysis revealed enrichment for a canonical Octamer (OCT) motif (5′-ATGCATAT -3′) [71], [72] within BRN2 bound sites validating the high quality of our data set (Figure S3B). We next examined the overlap between SOX2 and the two POU factors (BRN2 and our previously published OCT4-ESC dataset [16], Table S1) in ESCs and NPCs. Regions occupied by OCT4 and BRN2 showed little overlap (Figure S3C), indicating that these factors occupied cell-type-specific targets. Our data confirmed that SOX2 and OCT4 co-occupied many genomic sites in ESCs [13]–[16] (Figure 3C and Figure S3D-S3G). For example, SOX2 and OCT4 co-bound the promoter of Fbxo15 and to two putative enhancers of Pax6 that have been previously identified based on evolutionary sequence conservation and histone modification patterns [73] (Figure 3D). Notably, whereas BRN2 was absent from most SOX2-bound promoters in NPCs (Figure 3E), BRN2 occupied a subset of distal enhancers and bound many of these sites with SOX2, including known SOX2-BRN2 targets such as enhancers of Sox2 and Nestin [38], [65] (Figure S3H-S3K). For example, SOX2 and BRN2 co-occupied putative 3′ enhancer regions of Olig1 [74], and a known regulatory region 3′ of the Ascl1 (Mash1) locus [75] (Figure 3F). Together, these data suggest that SOX2 functions with BRN2 at a subset of distal enhancers to regulate target genes in NPCs. Whereas SOX2-OCT4 bound enhancers associated with genes that have roles in pluripotency and lineage commitment, SOX2-BRN2 enhancers neighbored genes that function in NPC identity. Overall, SOX2 and BRN2 occupied 756 poised and 895 active enhancers in NPCs (Figure 3G). SOX2-BRN2 bound active enhancers correlated with genes that were expressed at higher levels than those associated with poised enhancers (Figure 3H). Further analysis revealed genes linked to active enhancers included transcription factors that play roles in neural development such as Notch1, Rfx4 and Sox2 itself (Figure 3I and Table S8). Interestingly, genes linked to the co-bound poised enhancers in NPCs included regulators of later stages of neuronal developmental such as the pro-neural transcription factor Atoh1 [76], [77] and Dab1, a critical regulator of neuroblast migration [78] (Figure 3J and Table S8). Notably, ∼24% of genes associated with SOX2-OCT4 poised enhancers in ESCs overlapped with genes associated with SOX2-BRN2 bound enhancers in NPCs that included known regulators of neural development such as Atoh1 and Ncam1, despite differences in the bound regions. Thus, SOX2-POU partnerships may control neural development by differentially targeting specific subsets of enhancers in pluripotent ESCs and multipotent NPCs, in order to establish the development potential of this tissue from very early stages of embryogenesis. The significant overlap between BRN2 and SOX2 in NPCs predicts that BRN2 is also an important driver of neural commitment. To test this idea, we generated ESC lines that harbored a drug-inducible Brn2 transgene (TetO-Brn2) and assayed the potential of these cells to differentiate toward the neural lineage (Figure S4A–S4C). Upon Brn2 induction, ESCs showed distinct morphological changes from round cells that grew in colonies to polarized, Nestin-positive cells at day 1 of differentiation compared to control cells (Figure 4A and Figure S4D). Consistent with these changes, neural lineage genes such as Nestin and Sox1 showed higher expression in ESCs upon Brn2 expression (Figure 4B). Notably, Brn2 induction led to changes in gene expression and cell fate in the absence of additional growth factors whereas control cells did not show significant differences under these conditions. Thus, forced expression of Brn2 can promote differentiation of ESCs toward a neural-like fate. Our data suggested that POU factor expression may be a key determinant of cell-type-specific SOX2 target selection, so we hypothesized that ectopic BRN2 might be sufficient to recruit endogenous SOX2 to genomic regions de novo. To test this, we collected TetO-Brn2 cells two days after induction (Figure S4D) and performed ChIP-Seq. We identified 12,362 and 8,401 regions occupied by SOX2 and BRN2 in these cells, respectively (Table S1). Similar to SOX2 and BRN2 in NPCs, these factors occupied more distal sites than promoters (Figure S4E). Strikingly, ∼18% (1,034 regions) occupied by BRN2 in the induced ESCs were also bound by BRN2 in NPCs, indicating that ectopic BRN2 retained some of its NPC target specificity. These regions were distal to loci encoding neurodevelopmental regulators such as Ephrin Receptors (Epha3, Epha4, Epha5, Epha7) and transcription factors such as Id2 and Id4 (Table S9). Importantly, we defined 1,533 regions co-occupied by BRN2 and SOX2 in these cells. Comparison of these regions to SOX2 and OCT4 targets in ESCs and SOX2 in control cells at day 2 (Table S1) revealed 701 (46%) of these sites were bound uniquely by SOX2-BRN2 in the induced cells. These data suggested that BRN2 was necessary for SOX2 binding at these sites (Figure 4C and Figure S4F, S4G). Analysis of enriched GO categories showed that genes closest to these novel targets had roles in the development and function of the nervous system (Figure 4D and Table S9). Notably, 21% of these novel sites (144 regions) were also bound by SOX2 and/or BRN2 in NPCs, including enhancers linked to genes with demonstrated roles in neural development such as Lrrn1 and Abpa2 (X11l) [79]–[81] (Figure 4E). Expression analysis by qRT-PCR of a subset of these TetO-Brn2/NPC, SOX2-BRN2 genes, including Lrrn1, Abpa2, Kirrel3, Cops2, Id4, and Lemd1, revealed that some were significantly induced in TetO-Brn2 cells compared to controls (Figure 4F). Thus, ectopic BRN2 was sufficient to recruit SOX2 to NPC-specific sites and to induce the expression of nearby genes, indicating that POU-factor partners are sufficient to functionally recruit SOX2 to a subset of cell-type-specific target loci. Given that SOX2-BRN2 binding in NPCs correlated with cell-type-specific distal enhancers, we hypothesize that SOX2-BRN2 might play a role in regulating the state of these elements. Thus, we next examined the distribution of the enhancer chromatin marks, H3K4me1 and H3K27Ac, in TetO-Brn2 and control cells at day 2 in order to determine whether the ectopic binding of these factors could alter local chromatin structure (Table S1). We found that 777 of the 1,533 co-bound sites (∼51%) were coincident with H3K4me1 and/or H3K27Ac regions in TetO-Brn2 cells and 488 of these regions (∼32%) displayed similar patterns in both induced and control cells (Figure 4G). Interestingly, 165 of the co-occupied regions (∼11%) gained H3K27Ac upon Brn2 induction, and were closest to genes involved in neural development such as Atoh1, NeuroD1, and Tcf7l (Tcf3). This included 125 regions (∼8%) that were unmarked (i. e. lacked H3K4me1 or H3K27Ac) in control cells (Figure 4H) and 40 regions (∼3%) that transitioned from a poised state to active (Figure 4I). Thus, ectopic BRN2-SOX2 binding was sufficient to activate both poised and unmarked enhancers, supporting a role for these factors in controlling global gene expression networks by regulating the activity of cis-regulatory elements. Collectively, these data support a role for distinct POU factors in SOX2 binding site selection and gene regulation, and suggests a model by which BRN2 functions with SOX2 to mediate developmental transitions in the neural lineage. Given that most SOX and POU family members bind highly similar motifs, we hypothesized that distinct motif configurations may explain, in part, the diverse binding patterns in ESCs and NPCs. For example, SOX2 and OCT4 bind DNA in distinct conformations depending on the arrangement of binding sites 82–86 and these configurations have consequences on factor binding and transcriptional outcome [38], [82], [86], [87]. We found that SOX2 frequently occupied sites within 25-bp of OCT4 (∼25%), and that relatively few sites were greater than 100–200 bp from OCT4 (∼8%) (Figure 5A). In contrast, while a significant fraction of regions showed SOX2 and BRN2 bound within 25-bp in NPCs (∼12%), a larger fraction (∼33%) occurred at distances of 100–200 bp. For example, an intragenic region of the Wwc1 locus was bound by SOX2 and BRN2 in NPCs and peaks of enrichment were 100 bp apart (Figure 5B), while in ESCs neither SOX2 nor OCT4 recognized this element. These data indicate that while SOX2 and POU factors occupied similar motifs in ESCs and NPCs, these factors bound to different arrangements of these motifs in a cell type-specific manner. Many known SOX2-OCT4 target sites comprise a composite SOX-Octamer (OCT) motif, consisting of a 5′-SOX motif followed by a 3′ OCT site [15], [88], [89]. Therefore, we further analyzed the configuration of the SOX2 and OCT motifs by directly inspecting the sequence within the co-occupied regions. SOX-OCT composite motifs can exist in several configurations that were previously termed “canonical”, “order”, “diverging”, and “converging” [86] (Figure 5C). Interestingly, these configurations were shown to determine which combinations of SOX and POU factors could co-occupy a given site. Surprisingly, we observed that the canonical orientation with a 1 bp overlap between the native TRANSFAC motifs was the most highly represented configuration in both SOX2-OCT4 co-bound regions in ESCs (∼23% of motif pairs) and SOX2 and BRN2 co-bound regions in NPCs (∼21% of motif pairs) (Figure 5C). For example, at a locus on chromosome 2 distal to Chd6, SOX2-OCT4 occupied a canonical motif with a 1 bp overlap in ESCs, and SOX2-BRN2 occupied the same site in NPCs (Figure 5D). Thus, SOX2-OCT4 and SOX2-BRN2 prefer the same composite SOX-OCT motif at genomic targets in ESCs and NPCs. Combinatorial interactions among transcription factors are important for driving specific transcriptional responses [90]–[93]. In ESCs, SOX2 and OCT4 are known to co-occupy genomic sites with a cohort of other transcription factors, including NANOG, SALL4, and TCF7L1 [13]–[16], [94]–[96]. Thus, we sought to identify additional transcription factors that may interact with SOX2 and BRN2 in NPCs. To this end, we analyzed SOX2-BRN2 bound regions for enrichment of known transcription factor motifs (Table S10). To discover factors that may function specifically with SOX2 and BRN2 in NPCs, we contrasted these motifs with those that were enriched in SOX2-OCT4 co-bound regions. Notably, the enriched motifs in SOX2-BRN2 regions corresponded to transcription factors that were highly expressed in NPCs relative to ESCs (Monte Carlo analysis, p-value = 0. 03, Materials and Methods) (Figure 6A). For example, NF-I motifs were highly enriched in SOX2-BRN2 regions in NPCs and family members such as NF-Ia, NF-Ib, and NF-Ix were expressed at significantly higher level in NPCs than ESCs (Table S10). NF-I factors have known roles in central nervous system formation and in NPC function [97]. Motifs associated with the RFX family were also enriched in SOX2-BRN2 regions (Table S10). RFX family members play essential roles in early nervous system patterning [98], [99]. While Rfx3, Rfx4, and Rfx7 were expressed at significantly higher levels in NPCs, Rfx2 expression was higher in ESCs (Table S10). Interestingly, a recent proteomic study identified RFX3 and NF-IB as putative SOX2 interaction partners in NPCs [30]. Thus, our analysis has identified additional transcription factors that may regulate specialized gene networks with SOX2 and POU factors in ESCs and NPCs. We identified 439 SOX2-BRN2-NF-I-motif and 251 SOX2-BRN2-RFX-motif regions in NPCs (see Materials and Methods). Further analysis showed that SOX2-BRN2 regions containing NF-I or RFX motifs were largely exclusive (only 34 common regions) suggesting that SOX2-BRN2 sites could be further classified by interactions with specific sets of transcription factors. Consistent with this observation, SOX2-BRN2 regions containing an NF-I motif were linked to genes with functions in nervous system development and cell growth, including Sox2 and NF-Ib themselves as well as Olig1 and Integrin genes (Figure 6B). In contrast, SOX2-BRN2-RFX-motif regions were linked to a largely distinct set of regulators of neural development including regulators of neuronal apoptosis such as Ntrk2 (TrkB) [100], Ntrk3 (TrkC) [101], and Cdk5r1 (p35) [102], [103], an important process regulating the development of the CNS (Figure 6C). Interestingly, conditional ablation of Sox2 in NPCs is associated with increased apoptosis in the developing brain [6]. Thus, RFX and NF-I family members represent additional candidate partner factors in NPCs that may further contribute to specific regulation at SOX2-BRN2 target genes. Collectively, our work reveals a detailed picture of how SOX2 coordinates gene expression programs during lineage commitment and provides novel insights into the key principles that underpin regulation of diverse stem cell states. The HMG-box transcription factor SOX2 has critical roles in the function of multiple stem cell types including pluripotent embryonic stem cells (ESCs) and multipotent neural progenitor cells (NPCs). How this master regulator can control diverse transcriptional programs has remained an important and unresolved question in the field. While SOX2 occupied many promoters in both cell types, the major class of genomic elements occupied by SOX2 in ESCs and NPCs were distal enhancers (Figure 1 and Figure 2). While our data displayed high concordance among replicates and with published data sets in ESCs, SOX2 binding in NPCs was less correlated with prior data [17], [30] (Figure S1). This is likely due to the different protocols used to derive and culture NPCs. NPCs with similar developmental potential but distinct molecular profiles exist throughout development [24], and these populations respond differently to external signaling cues present in culture media [104]–[106]. Thus, it is perhaps not surprising that SOX2 binding is more variable in NPCs relative to ESCs. We derived NPCs directly from genetically identical ESCs allowing us to directly analyze SOX2 binding as these cells transition between states. Several criteria support the high quality of our data. First, we identified many known SOX2 binding sites including promoters and enhancers in both ESCs and NPCs. Second, while many binding sites were distinct, we identified a canonical SOX2 motif as highly enriched in both cell types. Third, SOX2 overlapped significantly with POU partner factors in ESCs and NPCs consistent with the expectation that these transcription factor families function together to regulate developmental progression. In addition, we identified a SOX-OCT composite motif as enriched in these co-bound sites. SOX2 occupied largely exclusive sites in ESCs and NPCs, despite using the same DNA motif to recognize these genomic targets. Moreover, SOX2 occupied distinct regions in the same promoter and distinct enhancers associated with the same gene. These data indicated that additional factors dictated SOX2 binding site specificity. While SOX2 co-occupied many binding sites with OCT4 in ESCs, partner factors in NPCs have not been well defined. We found the recognition motif for the Class III POU factor BRN2 was enriched in SOX2 bound regions in NPCs. The evolutionary conservation of the SOX-POU interaction, the co-expression of Sox2 and Brn2 in neurogenic regions of the brain, and the neurodevelopmental defects associated with Brn2 loss-of-function suggested that SOX2 and BRN2 together regulate a subset of genes important for neural fate. Consistent with this, we defined a large group of enhancer elements co-bound by SOX2 and BRN2 in NPCs. We identified known functional enhancers bound by SOX2 and BRN2 in NPCs, such as the Nes30 enhancer of the Nestin locus [38], [40] and the 3′ enhancer of the Sox2 locus, SRR2 [5], and extended this list to include hundreds of additional neural-specific enhancers. Consistent with a positive role in regulating neural cell state, forced expression of Brn2 led to up-regulation of neural markers and to differentiation toward the neural lineage. Our work is in agreement with several studies that have implicated Brn2 as an early marker of neural commitment [40], [107], [108]. Notably, ectopic BRN2 was sufficient to recruit SOX2 to hundreds of novel sites in differentiating ESCs that corresponded to a subset of enhancers also bound in NPCs. The recruitment of SOX2 by BRN2 to specific loci was sufficient to induce expression of nearby genes and to alter chromatin state in some cases. These data are in agreement with the notion that SOX proteins require partner factors to tightly bind to genomic targets and modulate transcriptional outcomes [59]. Interestingly, ectopic expression of OCT4 alone in NPCs was sufficient to reprogram cells into induced pluripotent stem cells, presumably by partnering with endogenous SOX2 [109], consistent with the idea that POU factors can recruit SOX2 to specific targets. Furthermore, ectopic expression of Sox2, Brn2, and the forkhead factor Foxg1 can transdifferentiate fibroblasts to NPC-like cells [70]. Taken together, these data may facilitate efforts to define the minimal set of genes needed to promote the transition from undifferentiated cells to the neural lineage. Thus, our results implicate BRN2 as a SOX2 partner factor and suggest that together these factors are important for neural specification and NPC function. While the motifs occupied by these factors were highly similar, the arrangement of SOX and OCT motifs in SOX2-POU target sites displayed differences in ESCs and NPCs. Regulation of SOX-POU target genes appears to depend not only on the presence of a SOX and an OCT motif in close proximity to each other, but also on other DNA sequence determinants, including the spacing and orientation of these motifs with respect to each other [82], [84], [87], [110]–[113]. However, these observations related to only a few genes and had not been extended genome-wide. While we found that SOX2-OCT4 and SOX2-BRN2 preferred similar composite motifs when they were bound in close proximity to each other, examination of co-bound regions found that peaks of SOX2 and BRN2 in NPCs were often spaced farther apart than peaks of SOX2 and OCT4 in ESCs. Thus, allosteric interactions between transactivation domains of SOX and POU factors may be key in stabilizing ternary complexes and in setting the stage for additional interactions that determine binding specificity and transcriptional output at target genes [84]–[87], [114], [115]. Combinatorial interactions among transcription factors allow cells to respond to environmental and developmental cues in a tissue-specific manner. A classical example involves the regulation of interferon-β expression through cooperative binding of transcription factors and chromatin proteins to an enhancer, collectively known as the interferon-β enhancesome [116]. In ESCs, SOX2 and OCT4 are known to physically interact with other transcription factors at many loci, including enhancers [14], [94], [117]–[120], suggesting that SOX2-POU factors may also nucleate specific enhancesomes. We identified a set of candidate factors that may interact with SOX2-BRN2 that included RFX and NF-I family members. NF-I factors are expressed in NPCs in vivo and their loss in development leads to defects in central nervous system formation and specifically NPC dysfunction [97], [121]–[124]. RFX family members also play essential roles in proper brain development [99], [125]. For example, RFX4 regulates Sonic Hedgehog (SHH) signaling in the developing nervous system and loss of function resulted in pleiotropic brain defects linked to SHH signaling [99], [125]. Defects associated with conditional ablation of Sox2 in the brain were also shown to be partially mediated by aberrant SHH signaling [6]. Additional studies revealed that SOX2 co-localized with the ATP-dependent histone remodeler CHD7 in NPCs [30]. Thus, interactions with chromatin modifiers or other epigenetic regulators may also be critical for binding site selection and establishment of NPC-specific gene expression programs in response to particular signals. Recent data showed that SOX2 functions as a pioneer factor in ESCs by marking a subset of genes for activation by other SOX family members, namely SOX4 in the B-cell lineage, SOX3 in NPCs and SOX11 in immature neurons [17], [18]. Interestingly, the POU factor Brn5, like Sox11, is expressed in differentiated cell types in the CNS and thought to play a role in regulating cell state [126]–[130], thus elucidation of BRN5 targets in these cells may reveal another layer of SOX-POU regulation of neurogenesis. Taken together, these data suggest that transitions in SOX-POU partners regulate the earliest stages of development through terminal differentiation. Ultimately, characterization of combinatorial interactions among transcription factors and chromatin regulators at distal enhancers will be central to understanding the complex mechanisms that control cell state throughout development. ChIP-Seq and Affymetrix microarray data are deposited on GEO database under the accession numbers GSE38850 and GSE35496. C57/BL6-129JAE (V6. 5) mouse embryonic stem cells were cultured in as described [34]. Neural progenitors were derived via in vitro differentiation from V6. 5 ESCs as described [43] and cultured on 15 µg/ml polyornithine and 1 µg/ml laminin in N3 medium, supplemented with 5 ng/ml bFGF, 20 ng/ml EGF, and 1 µg/ml laminin. In the presence of growth factors the vast majority of these cells can be labeled homogenously with antibodies against NESTIN, SOX2, and PAX6. Upon growth factor withdrawal, the cells differentiate into TUJ1-positive neurons. ChIP in NPCs was performed as described previously [131]. Briefly, approximately 5×108 cells were cross-linked and chromatin fractions were sheared by sonication. ChIP-enriched and input DNA were purified and genomic libraries were prepared using the ChIP-Seq Sample Prep Kit (Illumina 1003473) according to the manufacturers protocol (Illumina 11257047) for selecting library fragments between 200 and 350 bp. Samples were run using the GA2X genome sequencer (SCS v2. 6, pipeline 1. 5). For ChIP in ESCs, and in TetO-Brn2 cells and control cells were cross-linked and harvested as above. Approximately 5×107 formaldhyde-crosslinked cells were lysed and as above on an IP-Star (Diagenode). Chromatin was sonicated on the Bioruptor (Diagenode) to an average size of 0. 2–1 kb. ChIP was performed on chromatin from approximately 5 million cells with 3 µg of antibody (above) using the IP-Star Automated System (Diagenode) and 2. 5% of chromatin was used for each whole cell extract (WCE). Following reversal of crosslinks, sample and WCE DNA was purified. ChIP and WCE DNA was dissolved in water and barcoded genomic libraries were prepared using the TruSeq DNA Sample Prep Kit (Illumina) and multiplexed on the HiSeq 2000 (Illumina). Antibodies used in ChIP experiments are as follows: SOX2 (R and D Systems AF2018 goat polyclonal); BRN2 (Santa Cruz Biotechnology sc-6029 goat polyclonal); H3 (rabbit polyclonal Abcam ab1791) H3K4me1 (rabbit polyclonal Abcam ab8895); H3K27Ac (rabbit polyclonal Abcam ab4729). Images acquired from the Illumina/Solexa sequencer were processed using the bundled Solexa image extraction pipeline. Sequences were aligned using Bowtie (http: //bowtie-bio. sourceforge. net/index. shtml) using murine genome NCBI Build 36 (UCSC mm8) as the reference genome with default settings for mismatch tolerance and non-unique mapping events. Mapped reads were analyzed as described [16]. Briefly, sequence reads were extended 200 bp for transcription factors and 400 bp for histone modifications and allocated in 25 bp bins. Statistically significant enriched bins were identified using a Poissonian background model, with a p-value threshold of 10−8 to minimize false positives. We then used an empirical background model (whole cell extracts (WCE) for transcription factors or pan-histone histone H3 ChIP-Seq (H3) for chromatin marks) that requires bins to be enriched relative to background to eliminate non-random enrichment. Replicate datasets were combined and analyzed in one batch. Previously published datasets for enhancer associated histone marks were analyzed as described [34], [132]. SOX2, BRN2, and OCT4 enriched regions within 1 kb of a TSS were assigned to the associated gene, while bound enhancers were identified as regions that overlap H4K4me1 and/or H3K27Ac regions that are >1 kb from a TSS [34] and were assigned to the nearest gene using the GREAT algorithm for gene ontology studies and using the Galaxy web tool for all other analyses. ChIP–seq plots for individual genes were generated using the UCSC Genome Browser (http: //genome. ucsc. edu/cgi-bin/hgGateway).. wig files were generated from ChIP-Seq reads and density was normalized to reads-per-million. Published datasets were used to correlate SOX2 bound regions to histone modification patterns for enhancer analysis [34], [132]. We used a 1-bp minimum cutoff for the overlap between regions to define common genomic targets, as described throughout the manuscript to define co-bound SOX2-POU sites and sites occupied by SOX2 or POU factors across cell types. Correlation of ChIP-Seq datasets in figure S1 was performed using a similarity metric based on a correlation coefficient [133]. This analysis generates a correlation coefficient between zero and one reflecting the similarity of genomic regions occupied in two datasets. RNA was isolated using Trizol reagent (Invitrogen) according to the manufacturer' s protocol and DNAse treated using the DNA-Free RNA kit (Zymo Research R1028). Samples were then prepared for Affymetrix GeneChip Expression Array analysis. 5 µg total RNA was used to prepare biotinylated cRNA according to the manufacturer' s protocol (Affymetrix One Cycle cDNA Synthesis Kit). Samples were prepared for hybridization, hybridized to arrays, and washed according the Affymetrix hybridization manual using the Affymetrix GeneChip Hybridization, Wash and Stain Kit. GeneChip arrays (Mouse 430) were hybridized in a GeneChip Hybridization Oven at 45°C for 16 hours at 60 RPM. Arrays were scanned on a GeneChip Scanner 3000 and images were extracted and analyzed using GeneChip Operating Software v1. 4. To define expression levels of genes linked to bound promoters and enhancers, and to define fold change of expression levels of transcription factors linked to enriched TRANSFAC motifs between ESCs and NPCs, biological replicates were analyzed using the Affymetrix GCOS program and the mean intensity for each probe across three arrays was calculated. Maximum probe mean values for each gene were taken as gene expression levels. Box and Violin plots were constructed depicting median values as the center line, and bottom and top of the box representing the 25th and 75th percentiles, respectively. Whiskers depict+1. 5*IQR (interquartile range) for top, −1. 5*IQR for the bottom. To define differentially expressed genes, array data was RMA normalized using updated annotation from the BrainCDF the site and remapped from Ensembl Gene ID to Gene Name using Biomart table. For finding differentially expressed (DE) genes, the biological replicates were subjected to moderated welch test (MWT). Genes were called differentially expressed if the MWT FDR<0. 05 and the fold change of the mean of the replicates was more than 1. 5 fold up or down. Gene ontology analysis was performed using GOSTAT (http: //gostat. wehi. edu. au/cgi-bin/goStat. pl) for genes linked to SOX2 bound promoters or the GREAT algorithm [134] (http: //great. stanford. edu/) for regions associated with SOX2 bound enhancers. GOSTAT was performed using the mgi (mouse) GO annotation database for promoter-associated regions. Since GREAT analysis requires inputs in the mm9 genome build, lift-over of mm8 called regions was performed using the Galaxy web tool prior to input into GREAT (main. g2. bx. psu. edu/). In general, terminal “GO Biological Process” terms were presented in figures to maximize the specificity of the information presented. In some cases terminal terms contained few genes and were thus misleading, so more informative parent terms encompassing less specific but more relevant descriptions of biological processes are presented. MEME (meme. sdsc. edu/) [135] was used to find DNA sequences enriched in SOX2-, OCT4-, and BRN2-bound regions in ESCs and NPCs. Plus/minus 75 base pairs surrounding a subset of the highest peaks of enrichment for each factor (minimum peak height 100 for SOX2,148 for OCT4, or 225 for BRN2) were input into MEME and motif logos were generated from obtained position weight matrices. Brn2 inducible ESCs were generated using the “flp-in” system described previously [136]. Briefly, a single copy of a tetracycline inducible mouse Brn2 cDNA were flipped into the Col1a1 locus of KH2 ESCs harboring an M2-rtTA gene in the Rosa26 locus. Inducible Brn2 and control (KH2) ESCs were passaged off feeders and cultured in ESC medium with 2 µg/ml Dox. Twenty-four hours after passage, cells were culture in N2B27 (without Vitamin A) media without LIF or serum for the duration of the experiment [137]. Gene expression for differentiation markers was assayed by quantitative Real-Time PCR at 24-hour intervals. For immunostaining, cells were fixed with 4% paraformaldehyde in PBS and stained with anti-Nestin (Developmental Hybridoma Bank) and DAPI. Trizol-isolated RNA from three biologically independent samples was purified, DNAse treated (DNA free RNA Kit, Zymo Research) and reverse transcribed using a First Strand Synthesis Kit (Invtirogen). cDNA was analyzed in triplicate for each biological sample by quantitative PCR using an ABI Prism 7000 (Applied Biosystems) with Platinum SYBR green qPCR SuperMix-UDG with ROX (Invitrogen). All primers used in this study are listed in Table S11. Data were extracted from the linear range, and the standard curve method was used to obtain relative expression values. Technical replicates were averaged and then biological replicates were averaged. Statistical significance was determined using Graphpad Prism to perform an ANOVA with Bonferroni Correction for multiple testing. Regions of SOX2-BRN2 co-occupancy in TetO-Brn2 cells were defined as above. To define regions of differential chromatin state between TetO-Brn2 and control cells, we first compared H3K4me1 enrichment in these cells to define regions common to both cell types or unique to one or the other. Common regions were merged and treated as one enhancer if detected in both cell types. A similar analysis was performed for H3K27Ac enrichment. SOX2-BRN2 regions were then compared to regions of H3K4me1 and H3K27Ac in order to define SOX2-BRN2 binding events that resulted in changes in chromatin state between TetO-Brn2 cells and controls. 100 base pair windows around the max peak of SOX2-bound regions (in ESCs and NPCs) regions were analyzed for the presence of overrepresented DNA binding motifs. Similarly, 150 base pair windows around the midpoints between the max peaks of SOX2 and OCT4 or BRN2 (in ESCs or NPCs, respectively) in co-bound regions were analyzed for the presence of overrepresented DNA binding motifs. We used a hypothesis-based approach to identify known protein-DNA recognition elements enriched in each dataset. The set of hypotheses are derived from all vertebrate position-specific scoring matrices (PSSMs) from TRANSFAC [138] filtered for sufficient information content (IC>8 total bits). As many of these motifs are redundant, we clustered them based on pairwise distance by KL-divergence of the PSSMs using Affinity Propagation. The TAMO programming environment [139] was used to store the PSSMs and score sequences. We used two approaches to identify overrepresented motifs. All motifs discussed in the paper were found by both methods except for M00145 in SOX2 bound sites in NPCs which was only found by the first approach described below. In the first approach, we determined whether motifs were overrepresented in a foreground set of all bound regions (SOX2-bound or SOX2-POU co-bound, depending on the analysis) compared to a background set of randomly generated sequences which matched the GC content of the foreground using the Mann-Whitney-Wilcoxon (MWW) ranked sum test. For each independent motif test, sequences were ranked by the maximum motif score in each sequence (across all k-mers in the sequence for a motif of width k). This ranked list was used to compute the U statistic for the foreground set from which we computed a p-value and applied a Benjamini-Hochberg multiple hypothesis correction. Because many motifs in the databases are very similar to each other, we present the motif within each cluster with the most significant p-value. In the second approach, we determined whether motifs were overrepresented in a foreground set of 1,000 randomly selected bound regions compared to a background set of randomly generated sequences matching the GC content of the foreground using THEME [140]. A β value of 0. 7 and 5-fold cross-validation (CV) were used as THEME parameters. Statistical significance of the CV-error was calculated using randomization of 25 trials and multiple hypothesis corrected using the Benjamini-Hochberg procedure. As in the MWW tables, we present the motif within each cluster with the most significant p-value. Distances between SOX2 bound sites and cofactor bound sites in ESCs and NPCs were calculated as follows. Overlapping regions of SOX2 and POU factors were defined as regions with at least 1-bp of overlap. Peaks from these overlapping regions were then used to define distances between the bound factors. In particular, we calculated distances between SOX2-BRN2 site pairs (NPCs), and SOX2-OCT4 site pairs (ESCs). Site pairs were defined by matching each SOX2 bound site to the closest cofactor bound site within 200 bases. Distance was calculated as the cofactor chromosomal coordinate subtracted from the SOX2 chromosomal coordinate. Spacing between SOX and OCT sites was determined using a motif-based approach to determine specific spatial arrangement of the motifs in SOX2-OCT4 (ESCs) and SOX2-BRN2 (NPCs) co-bound regions. Max motif scores were calculated as described above and normalized as in Equation 1. Motif matches to SOX were defined as normalized scores greater than 0. 85 to a general SOX TRANSFAC matrix, M01308. Similarly, OCT family motif matches were defined as normalized scores greater than 0. 85 to a general OCT TRANSFAC matrix, M00342. For each sequence i and motif j, a motif score sij: was calculated. Spacing was defined as the number of base positions between the OCT4 and SOX2 motif matches relative to the SOX2 motif match. OCT-SOX motif pairs were associated with the previously defined “canonical”, “order”, “diverging”, and “converging” orientations [86]. The Mann-Whitney Z-score test result was used to rank all vertebrate TRANSFAC motifs in order of enrichment for SOX2 and OCT4 bound regions in ESCs, and SOX2 and BRN2 bound regions in NPCs. The change in rank (ΔRank) from ESC SOX2-OCT4 bound regions to SOX2-BRN2 bound regions was determined for each motif. Motifs were filtered to include only motifs with a rank less than or equal to 200 in the two ranked lists. Gene expression fold change was determined for each transcription factor associated with at least one TRANSFAC motif. After assigning a pseudocount of 1 to the normalized Affymetrix gene expression values for each transcription factor at the ESC and NPC stages, the log (base 2) of the fold change was calculated. Motifs were mapped to associated transcription factors according to the vertebrate all profile accessible on ExPlain 3. 0 containing 656 motifs. The TF with the fold change that best agreed with the ΔRank of the associated motif was chosen as the ‘representative’ factor for the motif (for instance, if ΔRank was negative, the associated transcription factor that had the most negative log-transformed fold change was chosen.) Scaled motif ΔRank values and the associated log-transformed gene expression fold change values were sorted in order of log-transformed gene expression fold change, and viewed in a heatmap (Spotfire, TIBCO). Only motifs that had associated transcription factor expression values were considered. A spearman correlation coefficient was calculated between the ΔRank values of the motifs and the expression-fold change of their associated transcription factors. This required each motif to be associated with a single transcription factor. In the case where multiple transcription factors are known to bind a single motif, the TF was selected as described in the previous section. The significance of the spearman correlation coefficient was assessed by a Monte-Carlo algorithm. The input to the Monte-Carlo algorithm was a table in which each row of the first column was a motif and each row of the second column was the set of transcription factors known to bind the motif. The column containing the motifs was randomly permuted 100,000 times (thereby randomizing the associations of transcription factors to motifs), and the process of selecting a single transcription factor to be associated with each motif was repeated. After associating each motif with a single random transcription factor, the spearman correlation between the ΔRank of the motifs and the log-fold-change in expression of the transcription factors was computed. The fraction of randomized tables that produced a higher spearman correlation than the original table was reported as the p-value. Only motifs for which the rank in either the SOX2-OCT4 list or the SOX2-BRN2 list was in the top 200 were used. The motifs also had to have at least one associated transcription factor for which gene expression data was available. Genomic intervals corresponding to enriched transcription factor binding motifs in SOX2-BRN2 bound regions were determined. The single nearest gene to a given region was determined using the GREAT algorithm. Genes associated with a motif having a motif similarity score of equal to or greater than 0. 85 (439 NF-I motif regions and 251 RFX motif regions) were used to generate a non-redundant target gene list. This gene list was then used as the input for Ingenuity Pathway Analysis. Ingenuity recognized 431 NF-I associated genes and 249 RFX associated genes. Overlap of genomic regions containing motif sequences was performed using Galaxy.

Title: SOX2 Co-Occupies Distal Enhancer Elements with Distinct POU Factors in ESCs and NPCs to Specify Cell State Summary: In mammals, a few thousand transcription factors regulate the differential expression of more than 20,000 genes to specify ∼200 functionally distinct cell types during development. How this is accomplished has been a major focus of biology. Transcription factors bind non-coding DNA regulatory elements, including proximal promoters and distal enhancers, to control gene expression. Emerging evidence indicates that transcription factor binding at distal enhancers plays an important role in the establishment of tissue-specific gene expression programs during development. Further, combinatorial binding among groups of transcription factors can further increase the diversity and specificity of regulatory modules. Here, we report the genome-wide binding profile of the HMG-box containing transcription factor SOX2 in mouse embryonic stem cells (ESCs) and neural progenitor cells (NPCs), and we show that SOX2 occupied a distinct set of binding sites with POU homeodomain family members, OCT4 in ESCs and BRN2 in NPCs. Thus, transitions in SOX2-POU partners may control tissue-specific gene networks. Ultimately, a global analysis detailing the combinatorial binding of transcription factors across all tissues is critical to understand cell fate specification in the context of the complex mammalian genome.

lay_plos

en

Summarize: By. Mike Dickson. PUBLISHED:. 04:07 EST, 21 June 2013. |. UPDATED:. 11:41 EST, 21 June 2013. Benjamin Becker v Andy Murray (2) Novak Djokovic (1) v Florian Mayer. Rafael Nadal (5) v Steve Darcis. Victor Hanescu v Roger Federer (3) Lleyton Hewitt v Stanislas Wawrinka (11) Marin Cilic (10) v Marcos Baghdatis. James Ward v Yen-Hsun Lu. Kyle Edmund v Jerzy Janowicz (24) Click HERE for the full draw. And print it out for your wall HERE. Andy Murray has been drawn in the same half as both Roger Federer and Rafael Nadal at Wimbledon, although he will only have to beat one of them en route to the final. No 2 seed Murray faces a potential quarter-final against Jo-Wilfried Tsonga, who he beat at Queen's Club last week, before a potential last-four clash against either Federer or Nadal, who are scheduled to meet in a mouth-watering last-eight tie. Nadal’s number five seeding proved. particularly bad news for defending champion Federer, who might be. hoping that his compatriot Stanislas Wawrinka could take him out in a. possible fourth round before they even meet. Theirs is a rough quarter. of the draw. The lumping in together of Nadal,. Federer and Murray also means that there will be a blockbuster first day. at Wimbledon on Monday with all three of them in action. Test: Andy Murray, pictured wearing his new adidas kit, has been drawn in the same half as Roger Federer and Rafael Nadal at Wimbledon. Repeat: Murray will play Benjamin Becker in the first round, who he beat at Queen's Club last week. Old foes: No 5 seed Nadal faces the prospect of a mouth-watering quarter-final against Federer. Murray’s first week looks relatively. benign until the gradient gets tougher after the middle weekend,. although it is hardly a straightforward start either. In the first round. he is up against 31 year-old Benjamin Becker, a decent grass court. player, having beaten him at Queen’s last week. He could then meet British wildcard. James Ward, or Taipei’s Yen-Hsun Lu, the world number 74, who beat the. 26 year-old Scot at the Beijing Olympics and is happy on faster surfaces. with a Wimbledon win against Andy Roddick on his CV. The first two seeds Murray is. scheduled to meet are Spanish veteran Tommy Robredo and Serb Janko. Tipsarevic, although what could materialise is a third round against. excellent grass courter Nicola Mahut, of Wimbledon marathon fame. Murray’s quarter final opponent is. slated to be one of Jo Wilfried Tsonga or Marin Cilic, the two players. he beat over finals weekend at the Aegon Championships. But with Novak. Djokovic getting the better end of things with David Ferrer the other. top-four seed in his half, all eyes will be on the potential classic. match-up of Nadal versus Federer. Opener: Reigning champion Federer will begin his title defence against Victor Hanescu on Monday. Familiar: Murray could face Jo-Wilfried Tsonga in the quarter-finals, who he beat at Queen's last week. Kind: Novak Djokovic has been drawn in the opposite half to Murray, Nadal and Federer. Kyle Edmund, one of only three. British men in the main draw, will have a tough baptism against the. hugely talented 6ft 8ins Pole Jerzy Janowicz, already ranked 22 in the. world, whose temperament can be an Achilles heel. World No 1 Novak Djokovic will play Florian Mayer in the first round before a potential quarter-final against Tomas Berdych. The. Serb has been handed the easier draw with Murray, Federer and Nadal all. on the opposite side. Djokovic could meet either David Ferrer or Juan. Martin Del Potro in the semis. French. Open champion Nadal will begin his tournament against Steve Darcis. while defending champion Federer opens Centre Court proceedings on. Monday against Victor Hanescu. Baby-faced: Murray is consoled by Nalbandian in 2005. Andy Murray will make his eighth appearance at Wimbledon looking to end Britain's long wait for a home men's singles champion. Here, Sportsmail assesses the US Open winner's performances on his previous visits to SW19. 2005: Murray made his senior Wimbledon debut at the age of 18. There was great excitement surrounding the teenager following his win in the US Open juniors in 2004 and he justified the hype by reaching the third round. Murray's first match was a comfortable win over George Bastl and he followed that up by eliminating 14th seed Radek Stepanek. Next up was former finalist David Nalbandian and the young Scot looked set for a famous win when he took a two-set lead before cramp took its toll. 2006: Murray. was now the leading British player and again he did not disappoint. Victories over Nicolas Massu and Julien Benneteau set up a blockbuster. clash with top-five player and former finalist Andy Roddick. Murray had. beaten the American en route to winning his first ATP Tour title in San. Jose earlier in the season and he repeated the feat with a brilliant. straight-sets win. The Scot could not maintain that standard, though,. and lost to Marcos Baghdatis in the fourth round. 2008: After. missing the 2007 championships with a wrist injury, Murray was looking. to make up for lost time. He reached the fourth round with relative ease. to set up a clash with Richard Gasquet that turned out to be one of. Wimbledon's classic encounters as the Scot hit back from two sets and a. break down to reach the quarter-finals for the first time. Hopes were. high as he prepared to face eventual champion Rafael Nadal but it proved. to be a one-sided affair in the Spaniard's favour. 2009: With Nadal unable to defend his title because of injury, Murray was the highest seed in his half of the draw. He almost came unstuck in the fourth round against an inspired Stanislas Wawrinka in the first match to be played entirely under the new Centre Court roof before prevailing in a deciding set. Murray reached the semi-finals for the first time and was favourite to see off Roddick but he paid for a cautious approach and was beaten in four sets. 2010: The British number one came into Wimbledon in indifferent form but by the end of the first week it was clear he would be a contender once again. A victory over Gilles Simon in front of the Queen was a highlight and he was not really tested until a quarter-final clash with big-hitting Frenchman Jo-Wilfried Tsonga. Victory earned the world number four another shot at Nadal but, despite doing most things right, it was not even enough for him to win a set. 2011: Nadal again in the semi-finals, and more despair loomed for Murray. This time he led, and had Nadal in trouble. But a loose forehand early in the second set was the beginning of Murray's demise. Nadal seized on the sign of weakness to win in four sets. Even though Murray felt he was playing better tennis than he had in 2010, it was scant consolation as he said: 'It's tough. But I'm giving it my best shot each time. I'm trying my hardest. That's all you can do. I'm disappointed.' 2012: This time Murray reached the final, and had all of Britain abuzz as he attempted to become the first home champion since Fred Perry in 1936. His opponent, Roger Federer, had other ideas though. Despite making a great start, Murray lost 4-6 7-5 6-3 6-4 as Federer landed his seventh Wimbledon title. Revenge of sorts came in the London 2012 Olympic final, back at Wimbledon, as Murray thrashed Federer

Summary: Murray to play Benjamin Becker in first round on Monday. British No 1 faces potential semi-final against Roger Federer or Rafael Nadal. Olympic champion set for quarter-final against Jo-Wilfried Tsonga. 2012 Queen's champion and 2013 finalist Cilic also in Murray's section. Murray faces potential all British second round match against James Ward. Ward drawn against Yen-Hsun Lu and Kyle Edmund faces Jerzy Janowicz.

cnn_dailymail

en

Summarize: FILE - In this Jan. 16, 2018, file photo, Kentucky Gov. Matt Bevin speaks to a joint session of the General Assembly at the Capitol, in Frankfort, Ky. Bevin apologized Sunday, April 15, for saying that... (Associated Press) FILE - In this Jan. 16, 2018, file photo, Kentucky Gov. Matt Bevin speaks to a joint session of the General Assembly at the Capitol, in Frankfort, Ky. Bevin apologized Sunday, April 15, for saying that children were sexually abused because they were left home alone while teachers rallied to ask lawmakers... (Associated Press) FILE - In this Jan. 16, 2018, file photo, Kentucky Gov. Matt Bevin speaks to a joint session of the General Assembly at the Capitol, in Frankfort, Ky. Bevin apologized Sunday, April 15, for saying that children were sexually abused because they were left home alone while teachers rallied to ask lawmakers... (Associated Press) FILE - In this Jan. 16, 2018, file photo, Kentucky Gov. Matt Bevin speaks to a joint session of the General Assembly at the Capitol, in Frankfort, Ky. Bevin apologized Sunday, April 15, for saying that... (Associated Press) FRANKFORT, Ky. (AP) — Kentucky Gov. Matt Bevin apologized Sunday for saying that children were sexually abused because they were left home alone while teachers rallied to ask lawmakers to override his vetoes. The Republican issued his apology in a nearly four-minute video posted online, saying "it is not my intent to hurt anybody in this process, but to help us all move forward together." On Friday, Bevin's explosive comments were part of his statement criticizing teachers for leaving work to protest at the Capitol. More than 30 school districts closed Friday. Bevin's comments came shortly after Republican lawmakers voted to override his vetoes of an operating budget that included increased spending for public education with the help of an accompanying tax increase. The GOP-led Kentucky House later approved a pair of resolutions condemning Bevin's comments. Bevin apologized several times in Sunday's video and said many people misunderstood and "did not fully appreciate" his earlier statement. "It's my responsibility to represent you, not only when I'm speaking to you, but when I'm speaking on your behalf in ways that are clear, that are understood, that don't hurt people and don't confuse people," he said. "And so the extent that I do that well, great. And to the times when I don't do it well, that's on me. I'm sorry for those of you, every single one of you, that has been hurt by things that I've said." Robin Cooper, an occupational therapist in Fayette County, the state's second-largest public school district, was among the thousands of educators protesting at the Capitol in recent weeks. Cooper voted for Bevin in 2015 and vowed Saturday not to do it again. And after watching the video Sunday, she said, "Seriously? That's not much of an apology. "I think he's gotten so much heat that he had to say something," Cooper said. "But it still wasn't an apology. It was still him defending his words. Everyone heard his words. I don't know how we can misunderstand his intent. So that just kind of makes me angry." House Minority Floor Leader Rocky Adkins, D-Sandy Hook, said in a statement that while Bevin claims there was a misunderstanding, "the people of Kentucky heard loud and clear what he said and today's video shows he still does not comprehend why so many were understandably upset. "The teachers and public employees he has insulted over the past year deserve much more than this." Telephone messages left with spokesmen Kentucky House Republicans and the Kentucky Education Association weren't immediately returned Sunday. Teachers from across Kentucky gather inside the state Capitol to rally for increased funding for education, Friday, April 13, 2018, in Frankfort, Ky. The unrest comes amid teacher protests in Oklahoma... (Associated Press) Teachers from across Kentucky gather inside the state Capitol to rally for increased funding for education, Friday, April 13, 2018, in Frankfort, Ky. The unrest comes amid teacher protests in Oklahoma and Arizona over low funding and teacher pay. The demonstrations were inspired by West Virginia teachers,... (Associated Press) FRANKFORT, Ky. (AP) — The Latest on protests by Kentucky teachers (all times local): 7:20 p.m. The Kentucky House has condemned Republican Gov. Matt Bevin's comments that children were sexually abused while teachers rallied at the state Capitol. The extraordinary rebuke came on the final day of the legislative session Saturday. The Republican-led House approved a pair of resolutions Saturday rebuking Bevin. One resolution was filed by Democrats. The other was offered by Republican Rep. John "Bam" Carney. More than 30 school districts across Kentucky closed Friday so teachers could rally at the state Capitol and ask lawmakers to override Bevin's vetoes of the state budget that included increased classroom spending. Lawmakers overrode Bevin's vetoes and the new spending became law. Asked about the protests, Bevin said he guaranteed a child who had been left home alone was sexually assaulted because the schools were closed. He also said children likely ingested poison or were introduced to illegal drugs for the first time if they were out of school while teachers rallied in Frankfort. ___ 4:05 p.m. A teacher rebellion in Kentucky is testing the Republican party's grip on the state. The legislature's rush to make changes to the state's troubled pension system coupled with Gov. Matt Bevin's comments targeting teachers have led to a wave of protests and prompted at least 40 current and former teachers to run for public office this year, most of them Democrats. The surge of activism is enough to cast doubts on whether Republicans can keep control of the state House of Representatives in the fall and whether Bevin, an ally of the Trump administration, could survive a re-election campaign in 2019. Republican Senate President Robert Stivers said he saw no political turmoil and predicted Republicans would still control state government next year.

Summary: Kentucky Gov. Matt Bevin apologized Sunday for saying that children were sexually abused because they were left home alone while teachers rallied to ask lawmakers to override his vetoes, the AP reports. He added that "some were introduced to drugs for the first time because they were vulnerable and left alone." The Republican issued his apology in a nearly four-minute video posted online, saying "it is not my intent to hurt anybody in this process, but to help us all move forward together." On Friday, Bevin's explosive comments were part of his statement criticizing teachers for leaving work to protest at the Capitol. More than 30 school districts closed Friday. Bevin's comments came shortly after Republican lawmakers voted to override his vetoes of an operating budget that included increased spending for public education with the help of an accompanying tax increase. The apology came after major blowback following the remarks, even from within Bevin's own party. "There are no words for this other than, I am appalled!" President of the Kentucky Education Association Stephanie Winkler responded on Twitter. Republican state Sen. Max Wise called Bevin's words "disgusting" and "reprehensible," and the AP reported that rebukes came from both sides of the aisle in Kentucky's GOP-led House. An online petition also circulated to demand Bevin apologize and state Democratic Rep. Attica Scott is calling for him to resign, the Courier-Journal reports. Kentucky teachers went on strike, as did Oklahoma educators, after West Virginia teachers struck and won 5% raises last month.

multi_news

en

Summarize: BACKGROUND OF THE INVENTION The invention relates to an arrangement for the electrothermal treatment of the human or animal body, in particular for the electrocoagulation or electrotomy. The use of high-frequency alternating currents in the frequency range of 300 kHz to 2 MHZ for tissue coagulation and tissue separation has long been known in the field of surgery, resulting in the treated tissue being coagulated or vaporized, which is referred to as electrocoagulation or electrotomy. A distinction must be made here between the monopolar and the bipolar HF thermotherapy. For the monopolar thermotherapy, an electrode—also referred to as the neutral electrode—is configured as a large-surface patient lead and is installed near the place of incision on the patient. The shape of the actual working electrode—referred to as the active electrode—is adapted to the respective application. Thus, large-surface sphere, disk or needle electrodes are used for the tissue coagulation, whereas thin lancet or loop-type electrodes are used for tissue separation. In the bipolar HF thermotherapy, on the other hand, both electrodes are arranged in close proximity to the place of incision, so that the effect of the alternating current is limited to the area immediately surrounding the place of incision, thereby resulting in a high degree of safety for the patient and the user since accidents caused by capacitive leakage currents or burning at the neutral electrode can no longer occur. Another advantage of the bipolar HF thermotherapy consists in the considerably lower load resistance of the tissue between the two electrodes, which permits a reduction in the necessary generator output while maintaining the thermal effect. Based on the position of the electrodes, the HF thermotherapy can furthermore be divided into the surface coagulation on the one hand and the depth coagulation on the other hand. The bipolar technique uses two parallel-arranged tactile electrodes for the surface coagulation, which are placed onto the tissue surface. As a result of this, the tissue underneath is heated, owing to the flow of current, and is thus coagulated. The use of needle, lancet, or loop-type electrodes for the monopolar electrotomy is known in the field of depth coagulation. Electric arcs must be generated for this on the active electrode in order to vaporize the tissue, positioned in front of the active electrode, thereby realizing a tissue cut. This is relatively simple with the monopolar technique because only a specific field strength is required to trigger a spark discharge at the active electrode. The bipolar technique makes higher demands on the design of the electrode configuration since the physical processes in this case cannot be controlled as easily. That is why only a few bipolar electrode arrangements for the depth coagulation are known, e.g. the bipolar needle electrode, which is suitable, among other things, for the myoma therapy. This known bipolar electrode arrangement consists of two parallel-arranged needle electrodes that are stuck into the tissue, by means of which the tissue between the electrodes is heated as a result of the current flow and is thus coagulated. However, the known bipolar electrode arrangements for the depth coagulation have the disadvantage that placement of the electrodes through two puncture sites is relatively involved. Furthermore, the predetermination of the field distribution by the user is relatively imprecise because the position of the two electrodes relative to each other generally cannot be specified exactly. The DE 43 22 955 A1 furthermore discloses the use of laser radiation for the coagulation of body tissue, which laser radiation can be transmitted into the therapy region via a cylindrical optical waveguide, wherein the known optical waveguide additionally permits the transmission of ultrasound energy, so that the two therapy methods of ultrasound tissue separation and the laser coagulation can be combined. A waveguide is also disclosed in the DE 44 32 666 A1, which makes it possible to transmit high-frequency energy in addition to ultrasound waves and laser radiation, so that the initially mentioned methods of high frequency surgery can be used at the same time as the laser surgery and the ultrasound surgery. For this, the known waveguide has a cylindrical design and additionally comprises two layers of an electrically conductive material for the high-frequency transmission, which layers are also cylindrical and are electrically insulated against each other. Thus, the known waveguide permits the transmission of high-frequency energy from a high-frequency generator, arranged extracorporeal, into the therapy region, but it does not permit the release of the high-frequency energy to the body tissue. SUMMARY OF THE INVENTION It is thus the object of the invention to create an arrangement for the electrothermal treatment of the human or animal body, which permits an interstitial tissue coagulation by means of a bipolar electrode arrangement and which avoids the aforementioned disadvantages of the known types of arrangements. The invention includes the technical teaching that a bipolar electrode arrangement is used for the thermotherapy, the two electrodes of which are arranged one after another on an elongated catheter to make it possible to insert the two electrodes jointly into the body through a single puncture site, wherein the two electrodes are connected to the catheter or form a component of the catheter. Herewith and in the following, the term catheter is understood to have a general meaning. It is not limited to the preferably used hollow-cylindrical arrangements, described in detail in the following, but can also be realized with large arrangements of nearly optional cross sections. Critical to the function according to the invention is only that the two electrodes are inserted jointly into the patient&#39;s body, through one puncture site. The catheter according to the invention for the first time allows placing the electrodes into deep tissue layers and obtaining a partial tissue coagulation there. The electrodes in the arrangement according to the invention are connected to a current source that supplies the electrical energy necessary for heating up the tissue. The term current source here is not limited to narrowly defined sources having a constant current, but includes also the preferably used alternating current generators, especially high-frequency generators. One advantageous variant of the invention provides that the axial distance between the two electrodes can be adjusted, so that the field distribution can be varied. If the insulator length in axial direction between the two electrodes is shorter, for example, than twice the electrode diameter, spherical coagulation necroses can be obtained advantageously, whereas the shape of the coagulation necroses for longer insulator lengths is more oval. The preferred embodiment of this variant therefore provides that the proximal electrode has a hollow design, at least at its distal end, such that it can accommodate the distal electrode on its inside. The external cross section of the distal electrode is smaller than the internal cross section of the proximal electrode to allow an axial displacement of the distal electrode inside the proximal electrode. It is important in this case for the two electrodes to be electrically insulated against each other in a suitable manner, since the two electrodes can overlap in axial direction. An electrical insulation is provided for this on the inside of the proximal electrode or on the outside of the distal electrode. For example, this insulation can consist of a dielectric coating or an insulating material sleeve, preferably composed of PTFE or polyimide—as in the initially listed reference DE 44 32 666 A1—wherein the cross section for the insulating-material sleeve is preferably adapted to the cross section of the distal or proximal electrode, such that the insulating-material sleeve can be press-fitted to the proximal or distal electrode and is thus fixed on the electrode. Thus, the two electrodes are coaxially arranged and can be displaced against each other in axial direction, so that the field distribution can be changed, wherein a section of the distal electrode in longitudinal direction is held inside the proximal electrode. In this variant of the invention, as for the other variants of the invention, the two electrodes have a cylindrical cross section, wherein the internal diameter of the proximal electrode for this variant must be larger than the external diameter of the distal electrode, so that the distal electrode can be displaced in axial direction. However, the invention is not limited to cylindrical electrode designs, but can be realized with other electrode cross sections as well. Concerning the function of this variant of the invention, it is only critical that the internal cross section of the proximal electrode is adapted to the external cross section of the proximal electrode in such a way that the distal electrode can be displaced in axial direction inside the proximal electrode in order to change the axial distance between the two electrodes. In another variant of the invention, the adjustment of the axial distance between the two electrodes is made possible with an elongated carrier element of electrically insulating material, which is arranged such that it can be displaced inside the proximal electrode and contains the distal electrode on the side in its distal region. The proximal electrode is therefore designed to be hollow, at least at its distal end, to be able to hold the carrier element. The internal cross section of the proximal electrode in this case is adapted to the external cross section of the carrier element, such that the carrier element can be displaced in axial direction in order to be able to adjust the axial distance between the distal end of the proximal electrode and the distal electrode, arranged on the carrier element. In this variant of the invention, the distal electrode is attached to the side of the electrically insulating carrier element and can consist, for example, of a ring-shaped, metallic coating or a metallic sleeve, which is pushed axially onto the carrier element during the assembly and is press-fitted to this carrier element. In accordance with another variant of the invention, the spacing between the two electrodes is specified, to achieve a simple design for the catheter and to ensure a predetermined field distribution. For this, the catheter also has an elongated carrier element of electrically insulating material, with the electrodes fixedly attached to the side in axial direction and at a distance to each other. On the one hand, the carrier element here is used for a mechanical fastening of the electrodes, in order to achieve a predetermined field distribution as a result of the constant distance between the electrodes. On the other hand, the carrier element must insulate the two electrodes electrically against each other and is therefore composed of an electrically insulating material. In the preferred embodiment of this variant, the carrier element has a cylindrical cross section, wherein the two electrodes have a hollow-cylindrical design and are arranged so as to be circumferential with respect to the longitudinal axis of the carrier element. In this case, the electrodes can be deposited, for example, on the carrier element surface as a metallic coating, or they can respectively form a metallic sleeve that is fitted onto the carrier element and is press fitted to it. In another embodiment of this variant, the electrodes are not fixed axially as a result of being arranged on a carrier element, but through respectively one connecting element between the electrodes, which connects the fronts of the electrodes. In addition to the axial fixation of the electrodes, the connecting element must also insulate the two electrodes against each other and thus consists of an electrically insulating material. The electrodes and the connecting pieces in this case are preferably cylindrical and have the same cross section, so that the outside contour of the catheter is continuous, without projecting edges, at the transitions between the electrodes and the connecting elements. This is very important for the insertion of the catheter into the body of the patient, to avoid unnecessary injuries. A modified variant of the invention provides for more than two electrodes, which are arranged at a distance to each other in axial direction of the catheter. As described in the above, the electrodes can be attached to the side of an elongated carrier element or, as previously explained, can respectively be separated from each other with the aid of a connecting element of electrically insulating material. The preferred embodiment of this variant provides that the individual electrode pairs, arranged such that they are distributed axially along the longitudinal axis of the catheter, can be actuated separately and have separate feed lines for this, which are preferably extended out of the body through a hollow conduit inside the catheter and can be connected to an adequate control device that permits an individual adjustment of, for example, current, voltage and/or frequency. As a result of the superimposition of the fields generated by the individual electrode pairs, it is possible in this way to specify the field distribution freely within far-ranging limits, e.g. to destroy as little healthy tissue as possible during an electrocoagulation. In one advantageous modification of this variant, the extracorporeal control device has several storage elements, in which the electrical parameters such a current, voltage and frequency for various field distributions are stored, so that the user must only select the desired field distribution, whereupon the control device then reads out the electrical parameters necessary for reaching this field distribution from the respective storage element and respectively actuates the individual electrode pairs. Other advantageous modifications of the invention are shown in further detail in the following with the aid of the figures and together with the description of the preferred embodiment of the invention. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 illustrates preferred embodiment of the invention, depicting an arrangement for electrothermal treatment with a catheter for inserting the electrodes into the body and a manipulator for guiding the catheter; FIGS. 2 a and 2 b illustrate the catheter for the arrangement in FIG. 1, with a core electrode inserted and pulled out; FIGS. 3 a and 3 b illustrate various catheters with fixed electrodes for obtaining a specified field distribution; FIG. 4 illustrates a catheter with five electrodes, making it possible to have special field distribution forms; FIG. 5 illustrates a flexible catheter for use in the minimally invasive surgery; FIGS. 6 a, 6 b, and 6 c illustrate various catheters making it possible to feed rinsing liquid; and FIG. 7 illustrates another catheter with adjustable electrode spacing. DESCRIPTION OF THE PREFERRED EMBODIMENTS As a preferred embodiment of the invention, FIG. 1 shows an arrangement 1 for the electrothermal treatment of the human and animal body, consisting essentially of a catheter 2 with a core electrode 3 and a covering electrode 4, as well as a manipulator or handle 5 for guiding the catheter 2, wherein the catheter 2 is shown in further detail in the FIGS. 2 a and 2 b. The catheter 2 permits an adjustment of the axial distance between the two electrodes 3, 4, so that the field distribution in the therapy region can be specified. For this, the catheter 2 has the cylinder-shaped, stainless steel core electrode 3 with a diameter of 800 μm. Except for its distal end, the surface area of said electrode is covered with a 50 μm thick coating of polyimide 6 as electrical insulation. This coated core electrode 3 is positioned such that it can be displaced coaxially in the hollow cylindrical covering electrode 4, also made of stainless steel, and has an internal diameter of 900 μm. The external diameter of the covering electrode 4 is 1500 μm for a length of 10 cm. It thus a large length-to-diameter ratio, about 67. With the aid of a displacement mechanism, integrated into the manipulator 5, the internal core electrode 3 can be pulled back before the catheter 2 punctures the tissue, so that the core electrode 3 and the covering electrode 4 together form a symmetrically ground puncturing spike, as shown in FIG. 2 a. After inserting the catheter 2 into the tissue, the core electrode 3 can be extended in axial direction and thus forms a dipole configuration with the insulating polyimide layer 6 and the covering electrode 4, as shown in FIG. 2 b. The axial displacement of the core electrode 3 furthermore allows an adjustment of the axial distance between the two electrodes 3, 4 and thus a concerted influencing of the field distribution in the therapy region. The displacement mechanism for the core electrode 3 is operated via a push-button rocker 7, which is integrated into the manipulator 5 that is shaped like a pistol grip for ergonomic reasons. The manipulator 5 furthermore contains a switch 8 for connecting the electrode arrangement to an HF generator, which is connected to the manipulator 5 via an electrical feed line 9. The manipulator 5 also contains a release mechanism 10, with which the core electrode 3 can be released and subsequently pulled axially from the covering electrode 4. Following the release of a locking mechanism 11, the covering electrode 4 can also be pulled out axially. By separating the electrodes 3, 4 from the manipulator 5, it is easily possible to sterilize and subsequently reuse the electrodes 3, 4. The catheter 2, comprising the core electrode and the covering electrode 3, 4, is connected to the manipulator 5 via a rotatable bearing 12 for holding and, owing to its angled form, permits an operation that is adapted to the field of vision of the physician, e.g. as is necessary for the turbinal coagulation. The illustrated arrangement 1 furthermore allows introducing a rinsing liquid into the tissue in the therapy region, in order to improve the electrical coupling. In this way, it is possible to balance the loss of liquid that occurs during coagulation, which otherwise leads to a change in the electrical impedance of the tissue in the therapy region and worsens the electrical coupling. The manipulator 5 therefore determines the tissue impedance from the applied voltage and the current via the electrodes 3, 4 and releases a corresponding amount of rinsing liquid to the tissue in order to keep the tissue impedance constant. The rinsing liquid is supplied by a separate rinsing pump via a hose 13 to the manipulator 5 and is pumped through the hollow covering electrode 4 into the therapy region. There, the rinsing liquid exits through a gap between core electrode 3 and covering electrode 4 into the tissue. The FIGS. 3 a and 3 b respectively show a catheter 14 or 15, having a proximal electrode 17 or 19 and a distal electrode 16 or 18, wherein the spacing between the two electrodes 16, 17 or 18, 19 is constant in order to reach a specified field distribution and to permit a simple design for the catheter 14, 15. The two electrodes 16, 17 or 18, 19 in this case have a cylindrical design and are mechanically connected on their fronts with the aid of an also cylindrical connecting element 20 or 21 of electrically insulating material, wherein the connecting element 20 or 21, as well as the proximal electrode 17 or 19 is provided with an axially extending hollow conduit to hold the electrode feed line. The external cross sections of the two electrodes 16, 17 and the cross section of the connecting element 20 are identical in catheter 14, shown in FIG. 3 a, so that the outside contour of the catheter 14 is smooth even at the transition points between the electrodes 16, 17 and the connecting element 20, thereby making it easier to insert the catheter 14 into the body of the patient. In contrast, the proximal electrode 19 for the catheter 15, shown in FIG. 3 b, has a larger cross section than the distal electrode 18 and the connecting element 21, wherein the proximal electrode 19 is conically tapered to match the cross section of the connecting element 21 at the transition point to the connecting element 21. The FIG. 4 also shows a catheter 22 that essentially distinguishes itself from the above-described catheters in that it has a larger number of electrodes 23. 1 to 23. 5, which are arranged along the longitudinal axis of the catheter 22 and are essentially composed of ring-shaped, metallic coatings, deposited on the surface area of a cylinder-shaped carrier element 24 of electrically insulating material. The electrodes 23. 1 to 23. 5 are respectively contacted separately via feed lines, which are placed in an axially extending hollow conduit of the carrier element. For one thing, the larger number of electrodes 23. 1 to 23. 5 makes it possible to reduce the partial current density at the electrodes 23. 1 to 23. 5, thereby preventing the temperature from increasing too much. For another thing, it is possible to generate a field distribution that differs from the one for only two electrodes by superimposing the individual fields. In addition, it is possible to purposely influence the field distribution by switching individual electron pairs on or off. In another embodiment of the invention, FIG. 5 illustrates a catheter 25, which is flexible and thus insertable insertion even into body cavities with bent inlet conduits, which is particularly important for the minimally invasive medicine (MIM). The catheter 25 essentially consists of a cylindrical core electrode 26 of spring steel wire, which is surrounded by covering electrode 27 in the shape of a hollow cylinder and formed from a flexible metal braid. The surface area of the core electrode 26 is provided with an electrically insulating coating 28, except for its distal end, which coating is designed to insulate the two electrodes 26, 27 against each other. The FIGS. 6 a, 6 b and 6 c show additional advantageous embodiments of catheters 29, 30, 31 with respectively one hollow-cylindrical, proximal covered electrode 32, 33, 34 and one cylinder-shaped, distal core electrode 36, 37, 38. With the illustrated catheters 29, 30, 31 it is advantageously possible to deliver rinsing liquid to the tissue, in order to balance the loss of liquid in the tissue during the coagulation and a therewith connected worsening of the electrical coupling. The rinsing liquid in this case is delivered through an axially extending hollow conduit in the proximal covered electrode 32, 33, 34 and delivery is ensured by a rinsing liquid pump, arranged extracorporeal. However, the release of the rinsing liquid in the therapy region occurs in different ways for the illustrated catheters 29, 30, 31. The catheter 29, shown in FIG. 6 a, is therefore provided with several distally arranged openings 35 in the surface area of the covering electrode 32, through which the rinsing liquid can exit from the hollow conduit into the tissue. In contrast, with the catheter 30, shown in FIG. 6 b, the rinsing liquid exits through a gap between covering electrode 33 and core electrode 36 into the tissue. The catheter 31, shown in FIG. 6 c, on the other hand has a continuous hollow conduit in axial direction, which also extends through the core electrode 37 and ends at the distal front of core electrode 37, so that the rinsing liquid is discharged into the tissue at the distal front of distal electrode 37. A physiological salt solution is preferably used as rinsing liquid, which ensures a good electrical coupling with the tissue and reduces the danger of tissue carbonization by limiting the temperature to &lt;100° C. In this case, the two electrodes 32, 38 or 36, 33 or 34, 37 are also insulated against each other through a coating 39, 40, 41 of electrically insulating material that is deposited on the core electrode 36, 37, 38. Instead of the feed line for the rinsing liquid, the hollow conduit for the catheter 31, shown in FIG. 6 c, can also hold an optical waveguide for a modified optical biopsy, which permits a precise positioning of the catheter 31 in the therapy region through a measuring of the backscatter signal or the tissue fluorescence during X-rays. In addition, a laser transmission through an integrated optical waveguide also offers the option of measuring the blood flow through Doppler measurement, depending on the wavelength used. Furthermore, the laser radiation transmitted via such an optical waveguide into the therapy region can then be used for the thermo-optical tissue coagulation. Finally, the hollow conduit also permits the positioning of a temperature sensor for the coagulation control. FIG. 7 finally shows another catheter 42, which permits the adjustment of the electrode spacing so that it is possible to influence the field distribution in the therapy region. For this, the illustrated catheter 42 has a cylindrical carrier element 43 of electrically insulating material, comprising at its distal end a distal electrode 44 that is deposited on the side as a ring-shaped metallic coating. This carrier element 43 is guided by a proximal electrode 45 with a hollow-cylinder design, wherein the external diameter of the carrier element 43 is smaller than the internal diameter of the proximal electrode 45, so that the carrier element 43 with the distal electrode 44 can be displaced in axial direction to adjust the electrode spacing. At its distal end, the carrier element 43 is ground such that it forms a puncturing spike for inserting the catheter 42 into the body of the patient. The design of the invention is not limited to the aforementioned, preferred embodiments. Rather, a number of variants are conceivable, which make use of the depicted solution, even if the embodiments are totally different.

Summary: An arrangement ( 1 ) for electrothermally treating the human body or an animal body, in particular for tissue coagulation or electrotomy, includes two electrodes ( 3, 4 ) for insertion into the body to be treated. The two electrodes ( 3, 4 ) are electrically insulated from each other and are disposed at a distance from each other to produce an electric or electromagnetic field heating the body tissue in the treatment area, and each electrode is connected by a feed line with a power source arranged outside the body. An elongate catheter ( 2 ) is provided for joint insertion of the two electrodes ( 3, 4 ) into the body, which are staggered in relation to each other in the axial direction of the catheter ( 2 ) and connected to the catheter ( 2 ) or a component thereof.

big_patent

en

Summarize: By. Victoria Woollaston. Since drones became mainstream there has been a constant battle between pilots and law enforcement agencies about where the unmanned crafts can fly. Data analysts from San Francisco have created a map of the U.S. that plots where owners can pilot their drones, and where specifically the drones are banned. The states with the fewest restrictions are revealed as Oregon in the northwest and Maine in the east, while Nevada and California have the most. Explore the drone map below. The Don't Fly Drones Here map of the U.S (pictured) was created by data analysts Bobby Sudekum and Amy Lee. It plots where in the U.S owners can pilot their drones, and where specifically the drones are banned. In the U.S., the Federal Aviation Authority has a blanket ban on drones flying over restricted airspace including national parks, military bases and within a five mile radius of medium and large airports. In 2012, the FAA fined a drone owner $10,000 for flying his Zephyr II drone over the University of Virginia. He was fined because he had used the drone to record photos he later sold to the university. The FAA said the flight violated regulations that forbid the use of drones in the U.S for commercial reasons. Following an appeal, Judge Patrick Geragthy overruled the decision claiming the FAA has not issued ‘an enforceable rule governing model aircraft operation.’ He. added the agency has also ‘historically exempted model aircraft from. the statutory definitions of ‘aircraft’ by relegating model aircraft to. voluntary compliance with the [FAA’s 2007] guidelines.’ It was the first time a fine had been dismissed. Drones are also banned from being used for commercial reasons. Analysts Bobby Sudekum and Amy Lee plotted the location of these bases across the U.S, using Open Street Map data, the National Park Service and U.S Military Data. They then built the map in Mapbox. By zooming all the way out, the whole of the U.S is revealed. Red areas mark the no-fly zones and show the shape and size of the region they cover. Zooming in, and hovering a mouse over these red regions show what kind of restricted airspace it covers, it also reveals the name of the location. Drones have always been restricted above military bases and airports for security reasons, but the restriction above national parks only came into effect at the start of this month. The National Park Service (NPS) outlawed launching, landing, or operating drones on or over federally operated lands and waters. It was signed by director Jonathan Jarvis on 27 June. The NPS manages all of the country's national parks, monuments, and various historical sites. Individual parks had banned drones prior to this agreement, including Yosemite National Park in California in May. Mr Jarvis said: 'We embrace many activities in national parks because they enhance visitor experience with the iconic natural, historic and cultural landscapes in our care. In the U.S, the Federal Aviation Authority has a blanket ban on drones flying over restricted airspace including national parks, military bases and within a five mile radius of medium and large airports. Nevada and California (pictured) have the most restrictions due to the large number of parks and bases. The states with the fewest restrictions are revealed as Oregon in the northwest (pictured left) and Maine in the east (pictured right). Analysts Mr Sudekum and Ms Lee plotted the location of these bases across the U.S, using Open Street Map data, the National Park Service and U.S Military Data. They then built the map in Mapbox. 'However, we have serious concerns about the negative impact that flying unmanned aircraft is having in parks, so we are prohibiting their use until we can determine the most appropriate policy that will protect park resources and provide all visitors with a rich experience.' The hope is that the ban will eliminate many noise and nuisance complaints and help ensure safety. In September, rangers in Mount Rushmore captured a drone that flew over the National Memorial amphitheater in South Dakota. Then in April, visitors to the Grand Canyon complained about noise from a drone that crashed into the canyon. Red areas (pictured) mark the no-fly zones and show the shape and size of the region it covers. Zooming in, and hovering a mouse over these red regions show what kind of restricted airspace it covers, it also reveals the name of the location. Drones (stock image pictured) have always been restricted above military bases and airports for security reasons, but the restriction above national parks only came into effect at the start of this month. The National Park Service (NPS) outlawed launching, landing, or operating drones on or over federally operated lands and waters. ‘Unmanned drones like quadcopters and fixed-wing aircraft are at the centre of new airspace regulations by the FAA,’ explained Mr Sudekum. ‘While the FAA deliberates on rules and regulations, states, cities and other national organisations have implemented their own no-fly zones. ‘To help people find safe places to fly, we’ve mapped established no-fly areas where drones are not permitted. ‘There are still many uncertainties around where and how one can fly a remotely operated aircraft. This map is a just a start.’

Summary: Don't Fly Drones Here map of the U.S. was created by data analysts Bobby Sudekum and Amy Lee. The states with the fewest restrictions include Oregon in the northwest and Maine in the east. Nevada and California have the most restrictions due to the large number of national parks and military bases. Drones. can't be flown over restricted airspace including national parks,. military bases and within a five mile radius of medium and large. airports. Hovering the mouse over a red region reveals what kind of airspace the area cover.

cnn_dailymail

en

Summarize: U.S. President Barack Obama today struck a landmark deal with China that would see both countries significantly reduce their greenhouse gas emissions over the next three decades. Under the agreement, America pledged to cut between 26 and 28 per cent of the level of its carbon emissions set in 2005 by 2025 as part of the global fight against climate change. But Chinese President Xi Jinping simply said he would aim to cap his country's emissions by 2030 - still an unprecedented move by a nation that has been reluctant to box itself in on global warming. In order to successfully accomplish this, 20 percent of China's energy needs will come from alternative sources, such as solar power and wind energy, by that year, the politician said. Scroll down for video. Deal: U.S. President Barack Obama (left) today struck a landmark deal with Chinese President Xi Jinping (right) that would see both countries reduce their greenhouse gas emissions over the next three decades. Speaking beside Xi in Beijing today, Obama declared: 'This is a major milestone in the U.S.-China relationship. It shows what's possible when we work together on an urgent global challenge.' Despite the agreement, many have called into question the feasibility of the presidents' goals - with Obama's pledge likely to confront tough opposition from ascendant Republicans in Congress. Republicans signaled they would seek to thwart Obama's efforts once the GOP controls the Senate next year, pointing out that the president was saddling future leaders with a tough-to-meet goal. 'This unrealistic plan, that the president would dump on his successor, would ensure higher utility rates and far fewer jobs,' said incoming Senate Majority Leader Mitch McConnell, R-Ky. However, a senior White House official called the deal both 'ambitious and achievable' - with Obama ultimately aiming to 'achieve deep economy-wide reductions on the order of 80% by 2050'. 'Congress may try to stop us, but we believe that with control of Congress changing hands we can proceed with the authority we already have.' the official told CNN. World leaders: Obama and Chinese President Xi Jinping making the announcement today. Shaking hands: Under the agreement, made in Beijing today, America pledged to cut between 26 and 28 per cent of the level of its carbon emissions set in 2005 by 2025 as part of the global fight against climate change. 'Milestone': Speaking beside Xi in Beijing today, Obama (pictured) declared: 'This is a major milestone in the U.S.-China relationship. It shows what's possible when we work together on an urgent global challenge' 'This is really the crusade of a narrow group of people who are politically motivated and have made this a cause celebre, but we believe we will be successful.' The official did not say whether Obama would propose legislation or use his executive powers to enact changes without lawmakers. Still, these orders could be changed under a new president. The agreement, which aims to inject fresh momentum into the climate change battle ahead of make-or-break climate talks next year, was unveiled on the last day of Obama's trip to China. Many claimed it reflected both nations' desire to display a united front that could blunt arguments from developing countries that have balked at demands that they get serious about global warming. Global fight: The agreement, which aims to inject fresh momentum into the climate change battle, was unveiled on the last day of Obama's trip to China. Above, cooling towers emit steam in Pottstown, Pennsylvania. Reviewing honor guards: Chinese President Xi Jinping said he would aim to cap his country's emissions by 2030 in an unprecedented move. Above, Xi (second left) and Obama (third left) review guards in Beijing. The U.S.'s target to reduce its emissions of heat-trapping gases by 26 percent to 28 percent by 2025 is a sharp increase from Obama's earlier vow to cut emissions by 17 percent by 2020. However, China, whose emissions are still growing as it builds new coal plants, did not commit to cut emissions by a specific amount. Rather, Xi set a target for China's emission to peak by 2030, or earlier if possible. He also pledged to increase the share of energy that China will derive from sources other than fossil fuels. 'This is, in my view, the most important bilateral climate announcement ever,' said David Sandalow, formerly a top environmental official at the White House and the Energy Department. Ceremony: Despite the agreement, many have called into question the feasibility of the presidents' goals - with Obama's pledge likely to confront tough opposition from ascendant Republicans in Congress. A landmark deal: Republicans signaled they would seek to thwart Obama's efforts once the GOP controls the Senate next year, pointing out that the president was saddling future leaders with a tough-to-meet goal. 'It sends the signal the two largest emitters in the world are working together to address this problem.' Obama's target, expected to serve as the U.S. contribution to a worldwide treaty to be finalized next year in Paris, came months before it had been expected. The U.S. has sought to show aggressive action on climate change in order to spur other nations to offer ambitious contributions, too. For China, the commitment to cap emissions marked a turning point in China's evolution on global warming and its responsibility to deal with the problem. In good spirits: Obama's target, expected to serve as the U.S. contribution to a treaty to be finalized next year in Paris, came months before it had been expected. Above, Obama and Xi smile as children wave flags. China accounts for around 30 percent of global emissions, but has only gotten serious in recent years as the level of emissions has been exacerbated by smothering smog in Beijing's skies. Above, traffic in Beijing. China accounts for around 30 percent of global emissions, but has only gotten serious in recent years as the large-scale impact on health and quality of life in China has come into focus, exacerbated by smothering smog in Beijing's skies. Environmental advocates in the U.S. heralded the announcement as a game-changer that would undermine opposition. If China can get serious about emissions, they said, surely others can, too. Al Gore, former vice president and a leading advocate for limiting climate change, called the announcement 'a major step forward in the global effort to solve the climate crisis'. Rehearsal: Chinese children arrive for a rehearsal for the welcome ceremony at the Great Hall of the People. He said more will be required — 'including a global agreement from all nations — but these actions demonstrate a serious commitment by the top two global polluters.' Senator Barbara Boxer, D-Calif., who chairs the Senate's environmental panel, added: 'Now there is no longer an excuse for Congress to block action.'

Summary: President Obama today struck a landmark deal in climate change battle. Under deal, U.S. would cut 26-28% of greenhouse gas emissions by 2025. Chinese President Xi Jinping, meanwhile, did not promise to take action. But he said he would aim to cap emissions by 2050 in remarkable move. Despite agreement, many have questioned the feasibility of Obama's goal. Vow will likely confront tough opposition from Republicans in Congress.

cnn_dailymail

en

Summarize: It’s basically a universal truth that the only thing better than Chipotle is…more Chipotle. I’m no religious scholar, but I’m pretty sure heaven is just one big Chipotle restaurant where the guac and chips are ALWAYS free and hell is just some Taco Bell. So when one of my co-workers at Apartment List brought up the question of how to hack Chipotle to get the most burrito for your buck, I was intrigued. If ever there was a noble intern task, this was obviously it. Through a lot of burrito research and even more company write-offs and office burrito donations, I’ve discovered these 6 tips that can increase the size of your burrito by 86% without spending any more money. You’re welcome, world. Please send the Nobel Prize to my mom’s house. The Experiment So I took my geeky love of data and my black hole of a belly to Chipotle for several days and ordered 5 burritos each day (35 burritos total), then returned to the Apartment List office to meticulously separate out and weigh the ingredients. Finally, I combined all the best methods to confirm the total burrito size increase. Additional methodology footnotes are below, but for now – on to the meat of the experiment (pun intended). Tip 1: Get a burrito bowl with a tortilla on the side At its onset, Chipotle introduced the innovative burrito bowl that combined its authentic Mexican cuisine with the ease of knife-and-fork dining. Burrito legend has it that the bowl’s lack of tortilla constraints influences servers to give burrito bowl customers huge portions in general. In my experiments, I found that this method alone gets 15% more ingredients across the board, without changing anything else about the order. Still craving that full burrito experience? No problem – you can easily ask for a tortilla on the side. Which leads to our next tip… Tip 2: Double wrapping (asking for two tortillas) This method of calling in tortilla reinforcements was initially introduced by Chipotle to save burritos that busted open their first tortilla, but Chipotle sometimes lets you ask for a double wrap for free, which adds another 4.25 ounce tortilla to your burrito (ask for the tortillas at the end, when the staff just wants you to go away). Congratulations, your burrito just became 25% bigger. Ordering tortillas on the side and wrapping it yourself may be a daunting task for some, but if you value the time it takes you to wrap the burrito at $0 per hour (hey, burritos are worth your time), then you should add this method to your burrito maximization arsenal. Tip 3: Order both kinds of rice The next time your server asks if you want white or brown rice, request both types – you’ll get almost 93% more rice, at no extra cost. This carbo-loading method increases the overall weight of the burrito by 23%. As an ancient American proverb puts it: more burrito, more food, more happiness. Tip 4: Order both types of beans Just like rice, there are two different types of beans we can choose from: black and pinto. If you really want to maximize burrito weight, asking for both kinds gets you 92% more beans (another note: we aren’t responsible for the gas you’ll be having afterwards). With this method, you get a 16% burrito weight increase. Tip 5: Half/half meats In theory, asking for half chicken, half steak should yield one full serving, but our tests showed that you actually get 54% more meat – basically 3/4 scoop of each. This increase in meat grows the burrito’s weight by around 9%. You must note, however, that you’ll be charged for the more expensive of the meats, but we’ve put the many finance and accounting degrees here at Apartment List to good use and determined that it’s still financially worth it. Tip 6: Ask for fajita veggies and corn salsa Hidden away and rarely mentioned by servers, the fajita vegetable mix and corn salsa are free to add, and taste good to boot. These underappreciated ingredients will cure any feeling you might have that your burrito might be lacking in terms of a balanced Food Pyramid. Grilled veggies and corn not only add more color and flavor to your burrito, but they also add around 2.55 ounces, increasing the weight by about 15% (vs. the standard burrito). Not only do you have more burrito, but you can also tell your friends and family that your burrito is totally 100% healthy. Add it all together and you get…. Doing all the tricks together (you’ll have to double-wrap the burrito yourself) gets you a giant burrito that weighs almost 32 ounces, at no additional cost! You’re going to need a course to learn how to wrap all that. Don’t worry about finding one: we got you covered. See below for the change in weight, by ingredient: So, in a nutshell: There you have it. By using each of the six tricks I suggest, you may end up with a little less cheese and salsa (that comes at the end, when your bowl will already be pretty full), but you get a lot more rice, beans, and meat. My final burrito weighed 86% more than the control. Sounds like it’s time to go to Chipotle! Methodology: I ordered a lot of burritos. Every day for about two weeks, I, the intern, set off to the same Chipotle around 3 P.M. to order five of the same burritos from the same shift of workers. The control burrito I compared everything to was a white rice, black beans, chicken, mild salsa, and cheese burrito. I excluded guacamole and sour cream from all burritos so that separating ingredients wouldn’t be such a hellish nightmare that would make me cry into the burrito and mess up the data. The weights I use are an average across these five burritos. Yes, that does mean I ordered 35 burritos. It’s okay, though, it was all a write off. There was no need to worry about wasting food afterwards because after I was done with the burritos I left them on the office kitchen counter and they all mysteriously disappeared within a few minutes. For some, my five burritos per day offering didn’t fully satisfy, so some coworkers and I had a contest to see who could get the biggest burrito (that we’d get to eat). The winner didn’t even use Tip #1 and got a 30.25 ounce burrito! Overall, I worked quite a few hours to gather all this data and consequently received funny looks from coworkers. It was then that it hit me how strange it was to be separating burritos at an apartment marketplace company. I have this irking feeling that my boss just didn’t know what to do with me and let me pursue my passion, but that would never happen to an intern. Though, with these astonishing results and all those dirty looks, I’d say it was totally worth it. This may be the most important thing you read all day. Apartment List intern Dylan Grosz has discovered how to get more burrito for your buck at Chipotle. Literally. One day he was discussing with co-workers the age-old question, “How do I get more for my money at Chipotle?” Then he decided to scientifically test it. Advertisement - Continue Reading Below Grosz said the experiment was conducted through seven trials with five burritos each, purchasing 35 burritos total—don’t worry no burritos were wasted in the conducting of this experiment. In each trial, he would deconstruct each burrito and weigh the ingredients. He would then compare the weight of each ingredient to a “control burrito,” of white rice, black beans, chicken, mild salsa, and cheese. The greatest way to nearly double the size of your Chipotle order? It’s actually human error. Requesting to go half-and-half on everything should theoretically result in an identical sized burrito or burrito bowl (that preference is a debate we won’t get into) made up of smaller portions of more ingredients. Luckily for us, human error means those additional varieties of rice, beans, and meat are actually adding significant volume—86 percent more burrito to be exact. Here are the tips: 1. Get a burrito bowl with a tortilla on the side. It increases your ingredients by 15 percent. 2. Ask for two tortillas. It increases the total weight by 25 percent. 3. Ask for both kinds of rice. This will increase the overall weight of your burrito by 23 percent. 4. Order both types of beans. It increases the total weight by 16 percent. 5. Order half/half meats. This increase in meat grows the burrito’s weight by 9 percent. 6. Add fajita vegetables and corn salsa. It increases the total weight by 15 percent. So is it possible to apply all of these tricks in one sitting to get the ultimate giant burrito at no extra cost? Yes, and Grosz said it would weigh almost 2 pounds. “It would probably require expert tortilla wrapping skills to fit it into one tortilla since it’s so much food,” Grosz said. To that, burrito lovers everywhere say “challenge accepted.”

Summary: Are you cheap and gluttonous? Do you also love Chipotle? (Just kidding; if you're cheap and gluttonous, you obviously love Chipotle.) Then you'll want to read this method for nearly doubling the size of your burrito from the Mexican restaurant chain at no extra cost. The burrito hack was discovered by an intern at Apartment List, who ordered 35 "test" burritos over seven days, took each of them apart to weigh their ingredients, and compared them to a "control" burrito, Boston.com reports. Hungry diners should end up with 86% more burrito, thanks mostly to human error in measuring out the ingredients: Order a burrito bowl, and a tortilla on the side (15% gain in ingredients) Ask for two tortillas (25% increase in weight) Ask for both kinds of rice (23% increase in weight; 93% more rice) Ask for both kinds of beans (16% increase in weight; 92% more beans) Order two kinds of meat (9% increase in meat; 53% more meat) Add free fajita vegetables and corn salsa (15% increase in weight) Apartment List runs down the exact math, noting that you'll have to roll it yourself, but you'll end up with a nearly 2-pound burrito. Or, as the enterprising intern puts it: "The only thing better than Chipotle is more Chipotle...Please send the Nobel Prize to my mom's house."

multi_news

en

Write a title and summarize: Perhaps the main reason I believe so passionately in positive parenting and not smacking is because, like so many of my generation, I was smacked as a child. Five decades on, I still clearly remember being smacked and sent to bed, feeling it was so unjustified. I was threatened with the belt, too, again a common punishment in the 60s and 70s, and although I never actually received it, I remember being afraid. Now, I myself am a mother of four. My children - aged 26 to 33 - have long since fled the nest, but I never used physical punishment to discipline them, except just once. My son was six and playing up, so eventually, after I'd thought it through, I put him over my knee and smacked him. Then I asked him, "Will you do it again?" and he said "Yes." He was even more defiant, and that's my point - beyond any moral rights and wrongs, it simply doesn't work. Of course, looking back, I suppose that was a considered smack, but most parents don't get that far; they just smack out of sheer frustration and anger. I understand how it happens and have immense sympathy for stressed parents. Whenever I see a mother struggling in a supermarket queue, I try and help by engaging the child. And if I saw a mum smack her child in a street, I suppose I would try and talk to her. But what helps is knowing that most people agree with me, especially the younger generations. Most young parents already use positive parenting techniques and have made a conscious decision not to use physical punishment to discipline their children. It is something that belongs to a different age. Welsh Government research, too, shows that, of the parents who do smack as a last resort, only 5% truly feel comfortable with it. In most cases, if they lash out, they are wracked with guilt and regret afterwards. Even in highly-charged situations, such as when a child runs into a road, I would never recommend smacking, but just grabbing them to stop them doing it. Children can sense fear, and it can be reinforced by words - there is no need for further physical punishment. Instead, clear boundaries should be set, and the use of sanctions, such as sending them to their room or docking pocket money. Much has been made in the media of this supposed "smacking ban". But it is simply about giving our smallest and most vulnerable members of society the same legal rights as adults by removing the defence of "reasonable punishment" against assault. Any change in the law won't mean parents will be locked up, as other countries have shown; for a start, cases have to be in the public interest, and there has to be significant harm done to any child before it is drawn into the protection system. But a law change will bring about a change in attitude on physical punishment. Sweden, for instance, banned corporal punishment over 30 years ago. And over that time, parents have reported a steady decrease in its use, particularly of severe or frequent punishment. Parental support for such punishment is now at a record low - below 10%. Of course, like domestic abuse, we will never fully eradicate smacking. Even in Sweden, physical punishment is still used by some parents. But a good law which protects children, supports parents and fulfils human rights obligations is the right step forward. The NSPCC is campaigning strongly for this law to come into force. But regardless of whether it does, I think more and more parents will come to the independent conclusion that not only does smacking not work, it's wrong.

Title: Why I think smacking children simply doesn't work Summary: The smacking debate is increasingly hitting the headlines. Earlier this month, Scotland announced plans to make the practice illegal, and Wales is amid a consultation. BBC Wales News has spoken to leading voices on the issue - one in favour of smacking and one against. Here, Vivienne Laing, policy and public affairs manager of NSPCC Cymru, explains why being smacked as a child turned her against physical punishment.

xlsum_en

en

Summarize: A 19-year-old US skier was lost in the Swiss Alps for 48 hours. A 19-year-old American student who disappeared over the weekend while skiing in the Swiss Alps was rescued Tuesday, alive but suffering from hypothermia, police said Tuesday. After searching for more than 48 hours, rescuers finally found the U.S. teen, who went missing while skiing off-piste Sunday near the Diablerets resort in southern Switzerland, police in the canton of Vaud said in a statement. Play Video Everything You Ever Wanted to Know About Snow We have a love/hate relationship with snow. It's beautiful falling from the sky and creates scenes of wonder once on the ground. It can also make our lives a living hell. "The man was found conscious, in a state of hypothermia and exhaustion, and stuck waist-deep in the thick blanket of snow," the statement said, describing his survival as "miraculous." He had told his rescuers that he had left the prepared slopes to "free ride" back to the resort. But on his way down the mountain, he had gotten lost and broken one of his bindings. He had tried to continue on one ski, but had fallen into a stream. Exhausted and soaked, the 19-year-old was then caught in a storm, which snowed him under and trapped him for the next two days. "The skier was relatively well-equipped when it came to clothing, but had no working means of communication and none of the vital material needed when skiing off-piste," including shovels and sensors, the police said. The skier, whose life was not in danger, was taken by helicopter to the Zweisimmen hospital near Bern. The American's rescue came after 11 off-piste skiers were killed in avalanches in the Swiss Alps over a period of four days, following heavy snow-fall. These crawls are part of an effort to archive pages as they are created and archive the pages that they refer to. That way, as the pages that are referenced are changed or taken from the web, a link to the version that was live when the page was written will be preserved.Then the Internet Archive hopes that references to these archived pages will be put in place of a link that would be otherwise be broken, or a companion link to allow people to see what was originally intended by a page's authors.The goal is to fix all broken links on the web. Crawls of supported "No More 404" sites. GENEVA A 19-year-old American skier survived more than 48 hours in the freezing Swiss Alps before being rescued and taken to hospital where he is recovering, police said on Wednesday. Mark Doose, a student from a suburb of Chicago, Illinois who has been attending university in Lausanne, disappeared while skiing in the Les Diablerets resort on Sunday during a snowstorm but was only reported missing on Tuesday. "I started following the supports for the chairlift, the gondola, and then it started to snow pretty hard, and I just ended up in this ravine," he told Radio Television Suisse from his hospital bed in the canton of Berne. "I just kept hiking down the ravine and tried to keep moving and stay warm." Doose, a former boy scout, said he spent Monday night in a small igloo he built for shelter against the minus 10 degrees Celsius temperatures. "I slept about six hours and then crossed three very small ponds, the third one was up to my neck," he said. "The ravine just came to a waterfall... There was no way down it. I was able to climb up one of the banks on the left side and at that point I was close enough to start yelling. I probably spent four or five hours just sitting there yelling." Alerted by passers-by, rescue workers found him on Tuesday afternoon, conscious but suffering from hypothermia and exhaustion and "stuck up to the waist in thick snow" in freezing temperatures, Vaud police said in a statement. "When they first answered me, it was just incredible. That was definitely pretty emotional. Then I knew I was going to get out," Doose said. Sylvain Crampe, the first rescuer to reach him, told Swiss television: "I did a body check which allowed me to determine that he was in pretty good shape. I was very surprised." At least 11 people have died in the past four days in the Swiss Alps where there have been several avalanches, according to local media. (Reporting by Stephanie Nebehay; Editing by Andrew Roche)

Summary: Eleven skiers have died in the Swiss Alps over the last few days, and police say it's a miracle that 19-year-old American Mark Doose wasn't No. 12. Doose disappeared while skiing near the Diablerets resort on Sunday and survived more than 48 hours until rescuers found him on Tuesday, stuck waist-deep in snow and suffering from hypothermia, Discovery reports. He told rescuers he had gotten lost during a snowstorm and tried to follow the chairlift supports but ended up in a ravine. He says he tried to keep going despite the storm and a broken ski. Doose, a former Boy Scout from the Chicago area, says he built an igloo to keep warm amid freezing temperatures Monday night, reports Reuters. When he tried to keep going the next day, crossing a pond that came up to his neck, "the ravine just came to a waterfall," he tells Radio Television Suisse. "There was no way down it. I was able to climb up one of the banks on the left side, and at that point I was close enough to start yelling. I probably spent four or five hours just sitting there yelling." Rescue workers say he was exhausted but still conscious when they found him in the snow, and still in surprisingly good shape despite his ordeal.

multi_news

en

Write a title and summarize: Subcellular asymmetry directed by the planar cell polarity (PCP) signaling pathway orients numerous morphogenetic events in both invertebrates and vertebrates. Here, we describe a morphogenetic movement in which the intertwined socket and shaft cells of the Drosophila anterior wing margin mechanosensory bristles undergo PCP-directed apical rotation, inducing twisting that results in a helical structure of defined chirality. We show that the Frizzled/Vang PCP signaling module coordinates polarity among and between bristles and surrounding cells to direct this rotation. Furthermore, we show that dynamic interplay between two isoforms of the Prickle protein determines right- or left-handed bristle morphogenesis. We provide evidence that, Frizzled/Vang signaling couples to the Fat/Dachsous PCP directional signal in opposite directions depending on whether Pkpk or Pksple predominates. Dynamic interplay between Pk isoforms is likely to be an important determinant of PCP outcomes in diverse contexts. Similar mechanisms may orient other lateralizing morphogenetic processes. PCP signaling controls the polarization of cells within the plane of an epithelium, orienting asymmetric cellular structures, cell divisions and cell migration. In flies, PCP signaling controls the orientation of trichomes (hairs) on the adult cuticle, orientation of ommatidia in the eye, and orientation of cell divisions, though the full range of phenotypic outputs has not been explored. While much focus has been placed on mechanistic studies in flies, medically important developmental defects and physiological processes in vertebrates are also under control of PCP signaling, motivating mechanistic studies in flies that might inform similar studies in vertebrates. Defects in the core PCP mechanism result in open neural tube defects, conotruncal heart defects, deafness, situs inversus and heterotaxy (reviewed in Butler and Wallingford, 2017; Henderson et al., 2018; Blum and Ott, 2018). PCP is also believed to participate in both early and late stages of cancer progression and in wound healing. PCP polarizes skin and hair, the ependyma and renal tubules. Paralogs of the PCP component Prickle are mutated in an epilepsy-ataxia syndrome (Tao et al., 2011; Mei et al., 2013; Bassuk et al., 2008; Ehaideb et al., 2014; Paemka et al., 2015). Mutations in ‘global’ PCP components have been associated with a human disorder of neuronal migration and proliferation (Zakaria et al., 2014) and in developmental renal disorders (Zhang et al., 2019). Work in Drosophila indicates that at least two molecular modules contribute to PCP signaling. The core module acts both to amplify molecular asymmetry, and to coordinate polarization between neighboring cells, producing a local alignment of polarity. Proteins in the core module, including the serpentine protein Frizzled (Fz), the seven-pass atypical cadherin Flamingo (Fmi; a. k. a. Starry night), the 4-pass protein Van Gogh (Vang; a. k. a. Strabismus), and the cytosolic/peripheral membrane proteins Dishevelled (Dsh), Diego (Dgo), and the PET/Lim domain protein Prickle (Pk) adopt asymmetric subcellular localizations that predict the morphological polarity pattern such as hairs in the fly wing (reviewed in Zallen, 2007; Butler and Wallingford, 2017). These proteins communicate at cell boundaries, recruiting one group to the distal side of cells, and the other to the proximal side, through the function of an incompletely understood feedback mechanism, thereby aligning the polarity of adjacent cells. A global module serves to provide directional information to the core module by converting tissue level expression gradients to asymmetric subcellular Fat (Ft) - Dachsous (Ds) heterodimer localization (reviewed in Matis and Axelrod, 2013; Butler and Wallingford, 2017; Zallen, 2007). The atypical cadherins Ft and Ds form heterodimers which may orient in either of two directions at cell-cell junctions. The Golgi resident protein Four-jointed (Fj) acts on both Ft and Ds as an ectokinase to make Ft a stronger ligand, and Ds a weaker ligand, for the other. Graded Fj and Ds expression therefore result in the conversion of transcriptional gradients to subcellular gradients, producing a larger fraction of Ft-Ds heterodimers in one orientation relative to the other. Other less well defined sources of global directional information appear to act in partially overlapping, tissue dependent ways (Wu et al., 2013; Sharp and Axelrod, 2016). Various Drosophila tissues depend primarily on either of two isoforms of Pk, Prickleprickle (Pkpk) and Pricklespiny-legs (Pksple) (Gubb et al., 1999). These isoforms have been proposed to determine the direction in which core PCP signaling responds to directional information provided by the Ft/Ds/Fj system (Olofsson and Axelrod, 2014; Hogan et al., 2011; Ambegaonkar and Irvine, 2015; Ayukawa et al., 2014). Pksple binds directly to Ds, orienting Pksple-dependent core signaling with respect to the Ds and Fj gradients (Ayukawa et al., 2014; Ambegaonkar and Irvine, 2015), while Pkpk-dependent core signaling has been proposed to couple less directly through a mechanism in which the Ft/Ds/Fj module directs the polarity of an apical microtubule cytoskeleton on which vesicles containing core proteins Fz, Dsh and Fmi undergo directionally biased trafficking (Matis et al., 2014; Olofsson and Axelrod, 2014; Shimada et al., 2006; Harumoto et al., 2010). Others, however, have argued that Pkpk-dependent core signaling is instead uncoupled from the Ft/Ds/Fj signal (Merkel et al., 2014; Ambegaonkar and Irvine, 2015; Casal et al., 2006; Lawrence et al., 2007; Brittle et al., 2012). The most intensively studied morphogenetic responses to PCP signaling in Drosophila occur in epithelia such as wing and abdomen, in which cellular projections called trichomes (hairs) grow in a polarized fashion from the apical surface, and in ommatidia of the eye, in which photoreceptor clusters achieve chirality via directional cell fate signaling. Chaete (bristles), which serve as sensory organs, are also polarized by PCP signaling (Schweisguth, 2015; Gubb and García-Bellido, 1982). Bristles comprise the 4–5 progeny of a sensory mother cell (SMC), one of which, the shaft, extends a process above the epithelium such that it tilts in a defined direction with respect to the tissue. In mechanosensory microchaete on the notum, one daughter of the SMC divides to produce the shaft and a socket cell that surrounds the shaft where it emerges from the epithelial surface; the other SOP daughter divides to produce a glial cell, a sheath cell and a neuron. Studies of microchaete polarity have shown that the initial division of the SMC is polarized by PCP in the epithelium from which it derives, such that the two daughters are born in defined positions with respect to each other (Gho and Schweisguth, 1998; Bellaïche et al., 2001). However, subsequent events that ultimately determine the direction of shaft polarity have not been described. We chose to study bristle polarity on the anterior margin of the wing (AWM). A row of stout mechanosensory bristles and a row of curved chemosensory bristles are on the dorsal surface, and a mixed row of mechano and chemosensory bristles is on the ventral side (Figure 1A, Figure 1—figure supplement 1A). All of these bristles tilt toward the distal end of the wing in wildtype. In pkpk mutant wings, and in wings overexpressing Pksple, a large fraction of the AWM bristles point proximally rather than distally; the pkpk phenotype is suppressed by mutation of dsh, implicating the core PCP signaling mechanism in this process (Gubb et al., 1999). However, the morphogenetic process resulting in polarity and the genetics of its apparent control by PCP signaling have not been explored. Here, focusing on the dorsal mechanosensory bristles, we report our analysis of the underlying morphogenesis leading to AWM bristle polarization, and show that polarization results from a corkscrew-like helical morphogenetic process involving the shaft and socket cells. Furthermore, our results reveal how interplay between Pkpk and Pksple control the handedness of the helical growth, and how the Ft/Ds/Fj system directs it in opposite orientations depending on whether the core PCP mechanism operates in a Pkpk- or Pksple-dependent mode. To begin to characterize the determinants of AWM mechanosensory bristle polarity, we labeled the externally exposed socket and shaft cells in wildtype (wt) and pkpk mutants with anti-Su (H) (Suppressor of hairless) antibody and phalloidin, respectively. In wildtype control wings at 36 hr apf, the apical ends of socket cells are tilted toward the distal end of the wing and are interspersed with the actin bundles of the shafts (Figure 1C, C’, Figure 1—figure supplement 1B–B’’). The shafts are interspersed between socket cells, and appear to ascend along the proximal side of the adjacent socket cell and pass through an opening at its apical surface. Consistent with polarity patterns of adult bristles, actin bundles of pkpk mutant shafts near the distal end of the wing show a reversed, proximal, tilt, whereas shafts in the proximal and the very most distal regions show the normal distal tilt (Figure 2A, A’, Figure 1—figure supplement 1C–C’’). Between these regions, shafts show a smooth transition between proximal and distal tilt, with some shafts pointing straight up (neutral tilt). The socket cells tilt at angles that correlate with the polarity of neighboring actin bundles in pkpk mutant wings: P-D tilt at the proximal region and D-P tilt at the distal region, with smooth transition between those regions (Figure 1—figure supplement 1C–C’’). Furthermore, shaft actin bundles with reversed polarity appear to be positioned on the distal side of the socket cell through which they pass, opposite to their relationship in wildtype and to their relationship in the proximal region in pkpk mutant wings where their tilt shows the normal, distal, direction (Figure 1—figure supplement 1B–B’’, compare with Figure 1—figure supplement 1C–C’’). Previous studies of AWM bristle ultrastructure have been insufficiently detailed to appreciate the determinants of polarity (Hartenstein and Posakony, 1989; Palka et al., 1979). To better understand the structures of shaft-socket pairs, and to unambiguously determine the relationship between sibling shaft-socket cell pairs, random individual bristle lineages were labeled by clonal expression of RFP, filling the cell bodies of labeled shaft and socket cells. Simultaneous staining of the socket cells (identified by Su (H) expression) allows one to identify the sibling shaft-socket cell pairs. 3D confocal reconstructions facilitate examination from a variety of viewpoints and enable the positions and shapes of cell bodies, nuclei, shaft, and apical opening of the socket cells to be visualized (Figure 1B–B’’’, Figure 1—video 1). These views allow us to see that the wildtype nucleus and main portion of the shaft cell is dorsal and extends slightly posterior to that of the sibling socket cell. The base of the shaft rises from the cell body, wraps clockwise along its socket sibling (as viewed from the apical side in a right wing), and then rises through a groove in the socket that extends apically along the proximal side of the socket, finally emerging through the donut shaped apical surface of the socket cell (Figure 1D–D’’, Figure 1—video 1). In contrast, in the distal bristles of pkpk mutant wings where bristles are reversed, the shaft is positioned within an oppositely oriented groove on the distal side of the sibling socket cell. The shaft nucleus is dorsal and posterior to the socket nucleus, similar to their arrangement in wildtype, though their alignment is not as regular. Therefore, the structure of pkpk mutant bristles is roughly a mirror image of that in wildtype, with nuclei in similar positions, but the shaft bending in a counterclockwise direction and rising through a groove on the opposite side of the socket cell compared to wildtype (Figure 2B–B’’). In the proximal region of the pkpk mutant wing, the relationship of shaft-socket siblings resembles that in wildtype, reflecting the normal bristle polarity in that region (Figure 1—figure supplement 1C–C’’ and Figure 3—figure supplement 1B). Therefore, the P or D position of shaft relative to the sibling socket cell correlates to the normal or reversed bristle polarity in proximal and distal regions of pkpk mutants, suggesting that the shaft position relative to the socket determines bristle polarity (tilt). Since the relative position of the shaft to the socket appears to be important for bristle polarity, we wished to identify the developmental process by which this relationship is achieved. In microchaete of the notum, the orientation of the initial division of the sensory organ precursor cell is specified by PCP signaling (Schweisguth, 2015). Assuming the orientations of subsequent daughter cell divisions are similarly regulated, the shaft-socket relationship may be determined by their relative positions at their birth. A similar process might occur in AWM mechanosensory bristles. Alternatively, a post-division morphogenetic process may determine their final configurations. To examine this process, we analyzed 3D structures of shaft-socket sibling pairs at earlier developmental stages. In wildtype bristles at 24 hr apf, the shaft cell nucleus is posterior and just slightly dorsal to the socket cell nucleus, similar to their positions at 36 hr apf (Figure 3A, B). The extending shaft is just reaching the apical surface, and is positioned in a groove on the dorsal side of the socket cell. At the apical surface, the shaft, sits in a shallow indentation in the apical surface of the socket cell, which adopts a crescent shape with the opening of the crescent pointing in the dorsal direction. Over time, from 28 to 32 to 36 hr apf, as the shaft continues to extend above the apical surface, the socket cell crescent rotates clockwise, and gradually closes to form a ring around the shaft (Figure 3A, B, Table 2, Table 1, Figure 3—videos 1,2, 3). Because the apical surface rotates while the nuclei remain relatively stationary, the shaft and socket twist to form a left-handed helical shape. As the shaft grows out above the socket cell, it points distally. The cell bodies, are initially relatively flat in the dorsal-ventral direction, but as they grow, extend dorsally, becoming flatter in the anterior-posterior direction. Quantification of rotation was performed by measuring rotation angles, as diagrammed in Figure 3B, from 3D images of socket cells captured at different time points (c. f. Figure 3C), and data are displayed in rose plots (Figure 3F, Figure 2—figure supplement 1A, Table 2). Rotation at 32 hr averages 55° in the clockwise direction. Note that throughout, we describe analyses of right wings. In all cases, left wings develop as mirror images of right wings. Based on stereotypical patterns from images of timed, fixed samples of the apical surface, we infer that a margin cell at the dorsal side of the shaft-socket pair rotates together with the pair toward the proximal side, generating new junctions with the neighboring socket and margin cells and widening the gap between shaft-socket pairs (Figure 2—figure supplement 1B). During these events, the number of margin cells surrounding the shaft-socket pair is maintained and cell-cell junctions are remodeled. To characterize the events leading to reversed bristle polarity in pkpk mutants, rotation angles of shaft-socket pairs during development were analyzed as above. At 24 hr apf, shaft cells were positioned dorsal to their socket sibling cells, as in wildtype. At later times, apical rotation proceeded counterclockwise, opposite to the wildtype direction, in the distal bristles that adopt a reversed polarity, giving rise to a right-handed helical shape in contrast to the left-handed helical shape of wildtype pairs (Figure 3E, Figure 2—figure supplement 1A, Table 3). Shaft-socket pairs in the proximal region rotated clockwise, corresponding to their normal polarity, and bristles in the region between normal and reversed bristles rotated very little, corresponding to their neutral, upright, polarity (Figure 3—figure supplement 1B). Therefore, bristle polarity does not depend on the birth positions of shaft and socket cells, which are born by 14 hr apf (Hartenstein and Posakony, 1989), but rather on the direction of apical rotation of the developing shaft-socket pair, beginning shortly after 24 hr apf. Since pkpk mutants show counterclockwise rotation leading to reversed shaft-socket positioning (D-P) and bristle reversal, and Pksple overexpression similarly reverses bristle polarity as previously reported (Figure 3—figure supplement 1E, E’ and Gubb et al., 1999), we surmised that Pksple induces the counterclockwise helical growth that leads to D-P orientation of shaft-socket pairs and reversed bristle polarity. Consistent with this, counterclockwise rotation of shaft-socket pairs and proximal polarity in pkpk mutants is suppressed by removing pksple (in pkpk-sple13/pk-sple13; Figure 3—figure supplement 1A–D’, Table 3, Gubb et al., 1999), and pksple overexpression induces counterclockwise rotation similar to that in pkpk mutants (Figure 3—figure supplement 1E, E’ Table 2, Table 3). Pksple is therefore needed to reverse shaft-socket rotation in pkpk mutants. Overexpression of Pksple induced counterclockwise rotation and reversed polarity in a wider region than in pkpk mutants (compare Figure 3—figure supplement 1B to E). Thus, endogenous Pksple is only poised to act at the distal margin, but exogenous Pksple can reverse most, if not all, bristles. Though the potential for Pksple to reverse bristle polarity is unmasked in the absence of Pkpk, it plays no essential role in wildtype polarization, as pksple bristles fully rotate, or perhaps marginally over-rotate (59. 3°±4. 2° vs 54. 6°±2. 9°, p=0. 0702; Table 3, Figure 3—figure supplement 1C, C’). Surprisingly, pkpk-sple13 mutant bristles rotate only moderately less than wildtype bristles (47. 6°±6. 6° vs. 54. 6°±2. 9°, p=0. 0143; Table 3), suggesting that Pkpk might play only a modest role in controlling the magnitude of rotation in wildtype. We propose that this is due to residual core PCP signaling activity observed in the absence of Pk (Strutt and Strutt, 2007; Lawrence et al., 2004; Adler et al., 2000), and the implications of this result are considered more fully in the Discussion. We have shown that in wildtype bristles, Pkpk antagonizes Pksple to direct clockwise rotation of shaft-socket pairs, and that Pksple, when overexpressed, outcompetes Pkpk to direct counterclockwise rotation. Although the idea that Pkpk and Pksple antagonize each other has been previously proposed (Gubb et al., 1999), how this occurs has been obscured in part by the inability to specifically visualize the endogenous expression of each isoform. We therefore modified the endogenous genomic sequence encoding Pkpk or Pksple by appending a V5 tag to the N-terminus, facilitating the tissue and cellular level evaluation of their native expression patterns at various developmental stages. Both tagged isoforms support wildtype polarity development in all tissues and various controls suggest that expression of these genomically tagged versions reflect that of the native loci (Figure 4, Figure 4—figure supplements 1 and 2). Here, we describe their expression in developing wings. Notably, V5: : Pk and V5: : Sple reveal that throughout wing development, expression is spatiotemporally dynamic. Early in wing development, Pkpk protein is strongly expressed and is present in most or all cells. In discs, Pkpk is relatively elevated in AWM proneural cells. Following a slight dip in levels around 8 hr apf, expression levels climb, peaking around 32 hr apf, when wing hairs emerge, and then decline with little detectable expression remaining by 40 hr apf (Figure 4A–A’’, Figure 4—figure supplement 1B–H, K–K’’). Expression of Pksple is below detection in discs (Figure 4—figure supplement 1B, I, J), makes a small peak at around 8 hr apf, and is then not detectable between 16 and 28 hr apf. Beginning around 28 hr apf, Pksple expression is specifically detected in dorsal AWM cells and in vein L3. This expression persists through 32 hr apf, when wing hairs emerge, and weaker expression in other veins becomes apparent (Figure 4B–B”, Figure 4—figure supplement 1B, L, L’). At these times, Pksple is below detection levels on Western blots. Beginning sometime after 32 hr apf, Pksple expression increases in most cells, with its level equaling that of the declining Pkpk by 36 hr apf and reaching its highest level at around 40 hr apf (the latest time we examined), when Pkpk is no longer detected. At 40 hr apf, when Pksple is at peak expression in most of the wing blade, expression has disappeared from vein cells (Figure 4—figure supplement 1B, L–L”). Most pertinent to bristle development, at the 24 hr apf AWM, Pkpk is expressed at apical junctions at similar levels in anterior margin and socket cells (Figure 4C, C’, Figure 4—figure supplement 2A). By 28 hr apf, Pkpk expression begins to decrease during bristle-socket rotation, first in socket cells, and later in all cells at and near the margin (Figure 4—figure supplement 2A). At the same time, Pksple expression becomes evident and increases over time, first uniformly in cells near the margin, and gradually becoming strongest in the socket and shaft cells (Figure 4D, D’, F–F’’, Figure 4—figure supplement 2B, compare with Pkpk (V5: : Pk) in Figure 4E). The timing of the shift from Pkpk to Pksple expression is accelerated at the margin relative to the interior of the wing. Mosaic experiments demonstrate that Pkpk localizes proximally in socket and other margin cells, and that, importantly, Pksple colocalizes with Pkpk to the proximal side of socket cells. Proximal Pksple localization is an unexpected observation based on previous studies in which overexpressed Pksple localized at the distal junctions of hair cells (Ayukawa et al., 2014; Ambegaonkar and Irvine, 2015). Because Pksple expression is stronger in socket cells compared to margin cells by 32 hr apf, it has the useful property of effectively being expressed as a mosaic, allowing its localization to be scored without inducing clones (Figure 4F–F’’, H–H’’, I–I’’). As Pksple activity reverses rotation direction of shaft-socket pairs in pkpk mutant wings, Pksple protein localization was analyzed in pkpk mutant wings. Because anti-Pk[C] antibody recognizes the common region of Pkpk and Pksple, the antibody reveals Pksple isoform localization in pkpk mutants. In the region of pkpk mutant wings where P-D reversal occurs, Pksple protein localized at the distal side of socket cells, whereas in the proximal region where polarity is not reversed, Pksple protein shows minimal asymmetry (Figure 4G–G’’, Figure 4—figure supplement 2C–C’’’). Distal localization of Pksple in the region of polarity reversal was verified by clonal knockdown of pksple in pkpk mutant wings. Notably, the socket-shaft pairs that lacked both Pksple and Pkpk failed to rotate (Figure 4—figure supplement 2D–E’’’). These results suggest that Pkpk normally inhibits Pksple from localizing distally by recruiting it to the proximal junction of socket cells (and likely also in nearby margin cells, although this is hard to visualize due to lower expression in those cells). Furthermore, the distal localization of Pksple in pkpk mutants correlates with its ability to determine counter-clockwise rotation of shaft-socket pairs on a cell-by-cell basis, suggesting that this localization is likely the determinant of counter-clockwise rotation. Our results thus far show that the direction of Pk polarization, whether Pkpk, Pksple or both, corresponds to the direction of bristle polarization. Suppression of polarity reversal in pkpk mutants by dsh implicates the core PCP signaling mechanism in this process Gubb et al. (1999). We therefore asked whether the remaining components of the core PCP signaling mechanism contribute to AWM bristle polarization. As with dsh mutation, knock down of fz or vang in pkpk mutants suppressed reversal of bristle tilt, shaft-socket orientation, and rotation direction (Figure 5A–D). Core PCP signaling is therefore required for reversed, Pksple-dependent polarity. To assess a potential contribution of core PCP signaling to Pkpk-dependent bristle polarization, the anterior region of adult wings from fmi RNAi, fz, vang, and dsh mutants were analyzed, and the rotation of shaft-socket pairs was evaluated for each genotype (Figure 5E–H). Adult mechanosensory bristles of core PCP mutants are less tilted toward the distal direction than those of wildtype and the tilting angles are somewhat irregular, with some bristles tilting out of the plane of the wing. Consistent with the adult wing defects, in pupal wings the shaft position relative to the socket varies, sometimes abruptly, in the same mutant wing, showing less local correlation than in wildtype. Quantification reveals substantial under-rotation of shaft-socket pairs, and a broader distribution of rotation angles than in wild type (Figure 5E–H, compare with Figure 3D, F, Table 2). Thus, careful morphological analysis reveals that core PCP signaling is required for normal, Pkpk-dependent polarity as well as reversed, Pksple-dependent polarity. Consistent with a role for core PCP components in mediating rotation of shaft-socket pairs, junctional asymmetry of Fz: : EGFP and Vang: : EYFP is well preserved between socket and margin cells and between adjacent margin cells (Figure 5I–J’). Little accumulation was observed at junctions between shaft and socket cells. Mosaic analyses demonstrated the expected distal localization of Fz and proximal localization of Vang at both margin cell-margin cell and margin cell-socket cell junctions, suggesting that PCP signaling likely occurs between margin cells and between margin and socket cells (Figure 5K, L). Similarly, the reversed bristle polarity observed in pkpk mutants was accompanied by reversed Vang localization in pkpk mutant socket and margin cells, consistent with the idea that the direction of core PCP polarization is reversed in pkpk mutants (Figure 5—figure supplement 1). To functionally test polarity propagation between margin and socket cells by core PCP components, fz or vang knock-down clones were generated, and clones at the AWM were analyzed (Figure 6, Figure 6—figure supplement 1). fz or vang knock-down clones, whether in just margin cells, just shaft-socket pairs, or both, showed non-autonomy as assessed by sequestration of Fz (fz clones) or Vang (vang clones) at the clone borders. Near fz RNAi clones, distal cells, including both bristle and hair cells, were re-oriented: sockets on the distal side of the clones showed counter-clockwise rotation, and hairs on the distal side grew toward the clones. Similarly, sockets on the proximal side of vang RNAi clones rotated counter-clockwise (Figure 6—figure supplement 1). These results indicate that core PCP signaling propagates between bristle and margin cells to control the rotation direction of shaft-socket pairs. We have previously proposed that a signal from the Ft/Ds/Fj system provides a directional cue to orient core PCP signaling in some tissues (Ma et al., 2003; Yang et al., 2002; Matis et al., 2014; Olofsson et al., 2014), although others have argued that this system operates in parallel with core PCP signaling (Casal et al., 2006; Lawrence et al., 2007; Brittle et al., 2012). An asymmetry of Ft-Ds heterodimers, with a small excess of Ds displayed on the distal side of the cell, and Ft on the proximal side, has been observed, and is proposed to provide this signal (Ambegaonkar et al., 2012; Bosveld et al., 2012; Brittle et al., 2012). We have also proposed that the core PCP module differentially interprets directional signals from Ds when operating in Pkpk- or Pksple-dependent modes, with Pksple directing localization of the Fmi-Vang complex to the side where Ds is in excess, while the Fmi-Vang complex localizes to the opposite side when functioning in a Pkpk-dependent manner [ (Olofsson and Axelrod, 2014); see also Lawrence et al. (2004). Pksple has been shown to bind to Ds and the associated Dachs protein, providing a mechanism for orienting Pksple-dependent core function to the Ft/Ds/Fj signal (Ayukawa et al., 2014; Ambegaonkar and Irvine, 2015), whereas a less direct, microtubule-dependent mechanism was proposed to mediate this response when Pkpk is predominant (Shimada et al., 2006; Harumoto et al., 2010; Olofsson and Axelrod, 2014; Matis et al., 2014). In contrast, some have proposed that Pkpk-dependent core signaling is instead uncoupled from the Ft/Ds/Fj signal (Merkel et al., 2014; Ambegaonkar and Irvine, 2015). We reasoned that our reagents would allow us to analyze effects of the Ft/Ds/Fj signal on each Pk isoform. We first examined the phenotype resulting from knockdown of Ds (Figure 7C). As previously observed (Adler et al., 1998), normal bristle tilt was substantially disturbed. The pattern of disturbance consistently showed regions of coordinated polarity that smoothly transition through neutral polarity to adjacent regions of opposite polarity, although the number and position of those domains varied. The effectively mosaic expression of V5: : Sple localization allows one to observe precisely correlated regions of distal and proximal Sple localization corresponding to the regions of reversed and normal polarity, respectively, with relatively symmetric localization in the intervening transitions (Figure 7C). These results suggest that local core PCP signaling maintains polarity correlation among immediate neighbors but that alignment to the tissue axis is eliminated in the absence of Ds. We then asked if the Pksple-dependent reversed polarity in pkpk mutants depends on Ds. When ds was knocked down in pkpk mutants, bristle reversal was blocked, producing a phenotype similar to that of core mutants, and the distal localization of Pksple was no longer observed (Figure 7A–D). Therefore, the reversed, Pksple-dependent polarity in pkpk mutants requires Ds, and we interpret this to indicate that the Ds global signal recruits Pksple to sites of enriched Ds (distal) in the absence of Pkpk (Figure 7B; compare with 7D), which drives reversal of shaft-socket orientation and therefore reversal of bristle polarity. In ds knockdowns, we are unable to readily interpret the localization pattern of V5: : Pk because levels are similar in socket and margin cells. Nonetheless, other results suggest that the local polarity correlation in the absence of Ds is mediated primarily by asymmetric localization of Pkpk rather than the asymmetric localization of Pksple that we can observe. First, recall that in wildtype, Pksple is recruited to colocalize with Pkpk at proximal sites, so Pkpk is likely to similarly recruit the colocalization of Pksple in the absence of Ds. Consistent with this idea, when ds was knocked down in pkpk mutants, neither proximal nor distal localization of Pksple was observed in socket cells, and local correlation of bristle polarity was weak (Figure 7D). Thus, the local domains of correlated asymmetric Pksple localization in ds knock-down socket cells depend on the presence of Pkpk; Pksple alone is insufficient to facilitate local signaling between neighbors. Finally, removing Pksple in ds knock-down wings failed to significantly modify ds knock-down effects on the polarity of bristles (and also hairs) while removing both Pkpk and Pksple does (Figure 7E, F, Figure 7—figure supplement 1A–D), confirming that ds knock-down affects the Pkpk-mediated, rather than the Pksple-mediated, PCP signal for wing bristle (and hair) polarity. Taken together, these observations suggest that the locally correlated domains of polarity observed in ds knock-down wings depend on Pkpk activity. These and previous results indicate that Pkpk is the principal isoform functioning in core PCP signaling during bristle polarization. They are most consistent with, though do not definitively show, that in wildtype, the Ds global signal directs orientation of core signaling such that Vang and Pkpk localize to the proximal side (and incidentally colocalizing Pksple to the proximal side) to establish normal polarity. The alternative possibility is that Ds activity is permissive, and some other signal directs this orientation of Pkpk-dependent core polarization. The proposal that Ds is instructive for orienting Pkpk-dependent core signaling, while consistent with our prior interpretation of coupling between the Ft/Ds/Fj signal and Pkpk-dependent core PCP signaling in wing hair polarization (Ma et al., 2003; Olofsson et al., 2014; Sharp and Axelrod, 2016; Yang et al., 2002), is at odds with other reports asserting that while under Pkpk control, core PCP directionality is uncoupled from the Ft/Ds/Fj signal (Merkel et al., 2014; Ambegaonkar and Irvine, 2015). Rigorous testing of this hypothesis requires reorienting the Ft/Ds/Fj signal and assessing the isoform dependence of the response. It was previously shown that reversing the gradient of Ds expression near the distal part of the wing under control of distal-less-GAL4 (dll >2 x-ds) reverses wing hair polarity (Harumoto et al., 2010). Assuming that hair polarity is determined by Pkpk, for which ample evidence exists, and that it depends on core signaling, this result would demonstrate coupling of Pkpk-dependent core PCP signaling to the Ds signal. We rigorously tested this assumption by testing the core signaling and Pk isoform dependence of this response (Figure 7G–K). dll >2 x-ds reverses polarity of a substantial swath of wing hairs, precisely in the region where the Dll expression gradient is expected to be steepest (Figure 7—figure supplement 1E). dll >2 x-ds, however does not reverse AWM bristle polarity, as it does not produce a proximal-to-distal expression gradient at the AWM. Because our results show that AWM bristle and wing hair polarization show indistinguishable responses to Ft/Ds and to core PCP manipulations, we propose that wing hairs are a suitable readout for this assay. We first asked whether dll >2 x-ds-driven hair polarity reversal depends on core module activity by removing Fz, and found that ectopic Ds-dependent reversal is blocked in a fz mutant background (Figure 7G, H). Furthermore, ectopic Ds re-orients the core PCP protein orientation (Figure 7—figure supplement 1F–I). These results rule out the possibility that ectopic Ds reverses polarity through a pathway that does not include the core PCP module. We then tested the Pk isoform dependence of reversal, and found that it is almost entirely abolished upon removal of Pkpk (pkpk or pkpk-sple), but is largely unchanged upon removal of Pksple (pksple) (Figure 7G, I–K). This result decisively demonstrates that Pkpk-dependent core PCP signaling in wing hair polarization is oriented by the Ft/Ds/Fj signal, and strongly suggests that the same coupling occurs during Pkpk-dependent AWM bristle polarization. Producing structures of defined chirality requires directional information on three Cartesian axes. Our results indicate that in determining bristle chirality, PCP provides directional information along the proximal-distal axis. The apical-basal axis is defined by the epithelium, while the dorsal-ventral axis is likely defined by the dorsal-ventral compartment boundary. We have shown that the polarity of wing margin bristles (proximal or distal tilt) is determined by controlling the handedness of helical growth. The entwined shaft and socket cells undergo an apical clockwise or counterclockwise rotation that results in a left-handed or right-handed helical structure, placing the shaft to the proximal (wildtype) or distal (pkpk mutant) side of the socket cell. The direction of rotation depends on PCP signaling among and between margin and socket cells. Helical cellular structures of defined handedness, such as the bristles resulting from properly directed rotation, have been noted in bacterial and plant species, but few examples have been described in animals. The entwined twisting of the shaft and socket is a coordinated morphogenetic event, and the apparent stereotyped junctional rearrangement of additional margin cells suggests that at least some other cells are involved as well. We do not know in which cell or cells mechanics are regulated to drive this morphogenesis. One possibility is that an internal cytoskeletal mechanism induces the helical growth of the socket and/or shaft cells. Another possibility is that the side of the socket cell crescent marked by Pk at 24 hr is anchored, while the other side grows to wrap around the shaft, inducing junctional rearrangements and propelling the rotation of the apical portion of the shaft relative to the socket cell. Apical rotation could then cause twisting of the more basal portions of the socket cell, and could in turn direct the shaft to the corresponding side of the socket cell. The precise location at which the PCP signal is required to determine rotation direction is unclear. Because we observe asymmetric core complexes at margin-socket cell junctions, but very little at shaft-margin or shaft-socket junctions, we hypothesize that interaction between the socket and surrounding margin cells is the essential determinant of rotation. PCP proteins at these junctions could control junctional dynamics, as is known to occur in other systems (Huebner and Wallingford, 2018). This will require further investigation. Core PCP signaling participates in regulating rotation, as the magnitude of rotation is substantially impaired in the core mutants fz, dsh, vang and fmi. Nonetheless, we note that a small amount of clockwise rotation still occurs in these mutants. We hypothesize that tissue scale mechanical forces may drive this rotation, though we do not rule out the possibility that some other signaling activity may also be involved. Compared to other core proteins, the impact of removing Pkpk on the magnitude of rotation is subtle. The clockwise rotation in pkpk-sple mutants is only slightly less than in wildtype. This result is reminiscent of Pkpk function in polarizing wing hairs: polarity in pkpk mutants is strongly perturbed due to the presence of Pksple, while hair polarity in pkpk-sple mutants is only weakly perturbed (Gubb et al., 1999). These findings are consistent with previous proposals that the core PCP mechanism retains a residual capacity to propagate some asymmetry in the absence of Pk (Strutt and Strutt, 2007; Lawrence et al., 2004; Adler et al., 2000). The core PCP signal, in addition to executing directed rotation in response to Pkpk or Pksple, coordinates polarity between neighboring bristles. Local correlation between rotation angles is strong when core signaling is intact, even in the absence of the Ft/Ds signal, but is weak when core signaling is disrupted. This is analogous to the proposed mechanism for locally coordinating polarity between adjacent wing hairs. It is important to note that the local polarity signal must pass through intervening margin cells to signal from bristle to bristle. Our data suggest that whether the Pkpk or Pksple isoform dominates to control the direction of PCP signaling depends not only on the relative amounts of each isoform, but also on the dynamics of expression and its effect on competition for participation in the core complex. During rotation of AWM bristle shaft-socket pairs, both Pkpk and Pksple isoforms are detected at the apical junction of the socket with an inverse temporal relationship; high expression of Pkpk decreases during rotation, while the initially undetectable level of Pksple protein increases. In these conditions, the system is controlled by Pkpk, and both Pkpk and Pksple localize proximally, thus orienting the core complex in its wildtype configuration. We hypothesize that Pksple is recruited by Pkpk through their known ability to interact heterotypically (Ayukawa et al., 2014; Ambegaonkar and Irvine, 2015). This ability of Pkpk and Pksple to colocalize has not been previously observed in wildtype conditions. Notably, however, in the wing, ectopic Pksple localization follows the expected position of Pkpk when Ds and Dachs cues are removed, though each were not independently visualized (Ambegaonkar and Irvine, 2015). Conversely, Pksple overexpression was seen to recruit Pkpk to the distal side of wing cells (Ayukawa et al., 2014), reversing hair polarity as it does bristle polarity. We suggest that the temporal expression pattern in the AWM allows the system to initiate polarization under Pkpk control, and that the gradually accumulating Pksple colocalizes with Pkpk rather than outcompeting established proximal localization. Because bristles in pksple mutant wings fully polarize, the proximal Pksple is inconsequential for normal bristle polarization. In contrast, overexpression of Pksple, producing early and sustained high level expression, enables it to outcompete endogenous Pkpk and reverse polarity by driving localization to the distal side through its interaction with Ds and Dachs, likely recruiting Pkpk along with it. Similarly, in pkpk mutants, endogenous Pksple, free from recruitment to the proximal side, localizes distally and reverses polarity. We infer that during the critical period for determining bristle rotation direction in wildtype, Pksple does not reach a sufficient level to outcompete Pkpk and reverse the rotation. That pkpk mutation only reverses polarity of a region of distal bristles, whereas Pksple overexpression can reverse polarity of most or all AWM bristles, indicates that endogenous Pksple is only poised to act in a limited region of the margin. This may reflect subtle differences in the timing of its expression increase across the margin. Alternatively, it may reflect differences in the strength of the Ft/Ds/Fj signal across the margin. Our analyses do not have sufficient resolution to distinguish these possibilities. Dynamic isoform expression appears to have important consequences for other aspects of wing development. Hair polarity is determined by Pkpk (at around 32 hr apf), but it can be inferred that some Pksple is already present, as is evident from the difference between the hair polarity patterns of pkpk and pkpk-sple mutants (Gubb et al., 1999), and as confirmed by our expression analyses. We suggest that hair polarity does not fully reverse in pkpk mutants either because levels of Pksple are not yet high enough or because expression is primarily in veins and at the AWM at the time hair polarity is fixed. In contrast, the polarity of ridges, established later in wing development [ (Merkel et al., 2014); (Doyle et al., 2008) notwithstanding], depends on Pksple. We propose that by the time ridge polarity is determined, the amount of Pksple has increased and the amount of Pkpk has decreased sufficiently to allow Pksple to exert control of ridge polarization. Though likely unimportant for normal development, the somewhat earlier expression of Pksple in veins relative to the intervein regions may contribute to polarity discontinuities observed in pkpk mutant wings, especially around L3 (Gubb and García-Bellido, 1982; Hogan et al., 2011; Merkel et al., 2014). Ft-Ds polarity appears to also be distorted around veins (Merkel et al., 2014). Pkpk and Pksple expression dynamics are likely at play in determining the PCP response in other tissues as well. The idea that Ds controls the direction of core PCP signaling was first proposed by Adler based on wing hair polarity phenotypes (Adler et al., 1998). We subsequently studied the Ft/Ds/Fj system and similarly concluded that it directs core PCP protein localization in the wing (Ma et al., 2003), a Pkpk-dependent process, and polarization of ommatidia in the eye (Yang et al., 2002), a Pksple-dependent process. We proposed that coupling in wing hair polarization is necessarily weak (Ma et al., 2003), and the more recently proposed model in which Ft/Ds/Fj orient microtubules to orient directional trafficking of Fz, Dsh and Fmi-containing vesicles (Matis et al., 2014; Olofsson and Axelrod, 2014; Shimada et al., 2006; Harumoto et al., 2010) is consistent with a weak coupling mechanism in Pkpk-dependent processes. The finding of direct binding of Pksple to Ds and Dachs (Ayukawa et al., 2014; Ambegaonkar and Irvine, 2015) suggests a model for more direct and potentially stronger coupling of Pksple-dependent processes to the Ft/Ds/Fj system. The idea of coupling in Pk-dependent signaling has been controversial, and based largely on correlation, subsequent studies have led to the argument that Pksple-dependent core signaling is coupled, but Pkpk-dependent signaling is uncoupled from the the Ft/Ds/Fj system (Merkel et al., 2014; Ambegaonkar and Irvine, 2015). Yet others have suggested that the Ft/Ds/Fj and core PCP systems always function in parallel rather than being coupled (Lawrence et al., 2007; Casal et al., 2006). Here, we report strong evidence that Pkpk-dependent core PCP signaling is responsive to the Ds signal, at least in polarizing wing hairs. We propose that the same is the case in polarizing bristles that are controlled by essentially similar responses to Pk isoforms and to the Ft/Ds/Fj system. In bristles, we directly observe the requirement for Ds to distally localize Pksple when Pkpk is absent, confirming Pksple coupling. The evidence that Pkpk-dependent core signaling is coupled to the upstream Ft/Ds/Fj signal is less apparent. In wildtype, correct bristle polarization requires Pkpk to prevent reversal by recruiting Pksple to the proximal side, though as noted above, proximal Pksple plays no essential role. But absent the need to antagonize Pksple coupling, is there evidence that core signaling in the presence of just Pkpk (pksple mutant) is coupled to Ft/Ds/Fj? When the Ft/Ds/Fj system is intact, Pkpk localizes proximally, but without Ds or Ft, Pkpk localizes proximally and distally in random domains, driving domains of correct and reversed rotation analogous to the random but locally correlated domains of hair polarity in ft or ds mutant wing tissue (Adler et al., 1998; Ma et al., 2003). The same random domains of bristle polarity are seen when only Pkpk is available (ds knockdown in a pksple mutant). This result demonstrates that the Ft/Ds/Fj system is required for correct polarization of the core PCP system while solely under Pkpk control, though it cannot distinguish a permissive from an instructive role. An instructive role is, however, concordant with its instructive role in directing Pkpk-dependent wing hair polarity. The proposal that Pkpk-dependent core signaling is coupled to and responds to the Ft/Ds/Fj signal in bristle polarization might at first appear to conflict with the observation that properly oriented rotation proceeds to a significant extent in the absence of both Pkpk and Pksple. This is explained by pointing out that our model for coupling invokes Ft/Ds/Fj directed microtubule-based transport of Fz and Dsh, but that the involvement of Pkpk is indirect (Matis et al., 2014; Olofsson and Axelrod, 2014; Shimada et al., 2006; Harumoto et al., 2010). As have others, we propose that Pkpk functions to amplify the asymmetry introduced by this transport, but that some asymmetry, and communication of polarity information between cells, can still occur in its absence (Strutt and Strutt, 2007; Lawrence et al., 2004; Adler et al., 2000). In other words, Ft/Ds/Fj coupling to Pkpk-dependent core PCP signaling is not directed by Pkpk, but rather, is permitted to occur because the Pksple-dependent mechanism is not operating to override it. Because core module function is required, this activity does not result from Pk isoform action influencing Ft/Ds/Fj output independent of core signaling, as has been recently suggested in another context (Casal et al., 2018). It is important to caution that the model for the relationship between Ft/Ds/Fj and core signaling presented here does not necessarily extend to their relationship in other tissues where their interactions may well be different, and that experiments done in other tissues may not be directly relevant to wing hair and AWM bristles. The results presented here indicate that mapping the spatiotemporal dynamics of Pk isoform expression is essential to understanding how various developmental events can be differentially coupled to upstream global directional signals in a given tissue. Chirality, or left-right laterality, is a key feature of many organs in invertebrates and vertebrates. In Drosophila, rotation of the gut and of the male genitalia occurs in a defined direction to produce such laterality. In vertebrates, rotation of the gut and heart tube also leads to left-right asymmetry in these organs. In many cases, PCP has been implicated in control of this lateralization (Blum and Ott, 2018). In the Drosophila hindgut, both core PCP and the Ft/Ds system play essential roles in directing normal dextral rotation (González-Morales et al., 2015). Though the forces that drive these organ rotations are not well understood, left-right asymmetries in actomyosin distribution, cell shape, and localization of other cellular structures, together with PCP dependence (Harris, 2018; Blum and Ott, 2018), indicate that chirality at the cellular level is an important determinant of rotational direction. Indeed, chirality of isolated cells from looping chick heart has been directly demonstrated (Ray et al., 2018). We therefore propose that regulation of chiral shaft-socket cell pair rotation may share much in common with the mechanisms that determine larger organ laterality, and its investigation could therefore yield insights that will enlighten understanding of organ rotation and laterality. Drosophila melanogaster flies were grown on standard cornmeal/agar/molasses media at 25°C. FLP-on (using the actP >CD2>GAL4 construct for trans-gene expression) and FLP/FRT mitotic clones were generated by incubating third-instar larvae at 37°C for 1 hr. 36 to 48 hr later, white prepupae were collected and aged to the desired developmental time point prior to dissection and fixation. Drosophila mutant alleles and transgenic stocks are described in the Key resources table and detailed chromosomes and genotypes are provided below. pkpk-sple13 (FBst0044230), pkpk-sple14 (Gubb, 1993), pkpk30 (FBst0044229), pksple1 (FBst0000422), vangA3 (Taylor et al., 1998), vangstbm6 (FBst0006918), fzR52 (Krasnow and Adler, 1994), dsh1 (FBst0005298), UAS-pksple (FBst0041780), UAS-pkRNAi (VDRC ID: 101480), UAS-fmiRNAi (FBst0026022), UAS-fzRNAi (FBst0034321), UAS-vangRNAi (FBst0034354), UAS-dsRNAi (FBst0032964), UAS-ds (Matakatsu and Blair, 2004), dll-Gal4 (FBst0030558), MS1096-Gal4 (FBst0008860), armP-fz: : EGFP (Strutt, 2001), actP-vang: : EYFP (Strutt, 2002), actP >CD2>vang: : EYFP (Strutt, 2002), ci-Gal4 (Croker et al., 2006), UAS-mCherry (FBst0038424), actP >CD2>Gal4 UAS-RFP (FBst0030558). Pupal wings were dissected at indicated developmental time points after puparium formation (apf). Pupae were removed from their pupal cases and fixed for 60–90 min in 4% paraformaldehyde in PBS at 4°C. Wings were then dissected and extracted from the cuticle, and were washed two times in PBST (PBS with 0. 1% Triton X-100). After blocking for 1 hr in 5% Bovine serum Albumin in PBST at 4°C, wings were incubated with primary antibodies overnight at 4°C in the blocking solution. Incubations with secondary antibodies were done for 90 min at room temperature in PBST. Washes in PBST were performed three times after primary and secondary antibody incubation, and incubations in phalloidin (1: 200 dilution) in PBST were done for 15 min followed by wash at room temperature before mounting if required. Stained wings were mounted in 15 μl Vectashield mounting medium (Vector Laboratories). Primary antibodies were as follows: goat polyclonal anti-Su (H) (1: 200 dilution, Santa Cruz, sc-15183), mouse monoclonal anti-V5 (1: 200 dilution, Thermo-fisher, R960-25), guinea pig polyclonal anti-Pk[C] (1: 800 dilution, Olofsson et al., 2014), rat monoclonal anti-dEcad (1: 200 dilution, DSHB). Secondary antibodies from Thermo Fisher Scientific were as follows: 488-donkey anti-mouse, 488-goat anti-guinea pig, 546-donkey anti-goat, 633-goat anti-guinea pig, 633-goat anti-rat, 647-donkey anti-mouse. Alexa 635 and Alexa 350 conjugated phalloidin were from Thermo Fisher Scientific. Adult wings were dissected and washed with 70% EtOH and mounted in DPX (Sigma) solution. All adult wings were imaged on a Nikon Eclipse E1000M equipped with a Spot Flex camera (Model 15. 2 64 MP). All immunofluorescence images were taken with a Leica TCS SP8 AOBS confocal microscope and processed with LAS X (Leica) and Adobe Photoshop. For three dimensional wing margin images, 50 to 100 z-stacks, each with 0. 2 μm thickness, were collected and combined using 3D reconstitution software (Leica). Scale bars are not provided for three dimensional images due to errors introduced by perspective, but approximate scale can be inferred from related two- dimensional images. To measure the apical rotation angles of socket cells, a horizontal line linking centers of circles around apical surfaces of socket cells was drawn, and perpendicular lines intersecting the center of each socket cell apex were drawn (black lines in Figure 3C). Vectors from each socket cell center passing through the center of the apical opening of the socket circles (blue vectors in Figure 3C) were drawn and angles between the vertical lines and the vectors were measured with Image J software. Statistical analysis was performed and rose plots generated using Oriana four software. Comparisons were made using Student’s t-test and p values are reported. Summary statistics are provided in Table 2. For qualitative results such as expression patterns, a minimum of 20 biological replicates from at least two independent experiments were examined and representative images are shown. To generate the donor plasmid with homology arms of the pkpk genomic sequence and the V5: : 3Xmyc: : APEX2 tag sequence, a 1. 5 kb 3’ homology arm (HR2) flanking the pkpk gRNA2 cleavage site was amplified and assembled into the pDsRed-attp (Addgene, 51019) plasmid cut with SapI to make the pDsREd-attP-pkpkHR2 plasmid. To generate the donor plasmid for tagging pkpk, three DNA fragments including 5’ 1. 5 kb homology arm (HR1; containing a 1. 2 kb homology arm flanking the pkpk gRNA1 cleavage site and a 5’ 0. 3 kb sequence of the start codon), V5: : 3Xmyc: : APEX2 tag with a linker sequence, and the fragment starting from the start codon of pkpk to the cleavage site targeted by the pkpk gRNA2, were assembled into the pDsREd-attP-pkpkHR2. To prevent the donor sequence from being cleaved by Cas9, a point mutation was introduced in the PAM sequence of the HR1 using the NEB point-mutagenesis kit after sub-cloning the fragment into the pCR-Blunt-II-TOPO vector (Thermo-Fisher, K280002). The HR1 fragment bearing the mutant PAM sequence was then amplified for the assembly process. All three fragments were assembled into the pDsREd-attP-pkpkHR2 plasmid cut with EcoRI and NheI. To generate the donor plasmid for tagging pksple, similar strategies were applied. Briefly, 1. 2 kb 5’ homology arm containing the mutant PAM sequence, the V5: : 3Xmyc: : APEX2 tag with a linker sequence, and the fragment from the start codon of pksple to the cleavage site of pksple gRNA2 were assembled into the pDsREd-attP-pkspleHR2 (bearing the 1. 25 kb 3’ homology arm, HR2) plasmid. The donor plasmids containing the tag sequence and pkpk homology, or pksple homology, arms, were sequenced and then injected into the stable transgenic flies expressing two pkpk gRNAs, or pksple gRNAs, and nosCas9, respectively, to generate recombinants. DsRed signal in the fly eyes was monitored for selecting the recombinants by BestGene, and dsRed and flanking sequences were removed by the Cre-Lox site-specific recombination method. The resulting modified alleles are referred to in the text as V5: : Pk and V5: : Sple for simplicity. Third-instar larval wing discs and pupal wings at appropriate developmental stages were dissected and lysed in protein loading buffer. Lysates from eight discs or wings were loaded per lane for SDS-PAGE analysis and western blots were performed using standard procedures. Antibodies: Guinea pig polyclonal anti-Pk[C] (1: 1000 dilution, the same antibody used for immunostaining), mouse monoclonal anti-V5 (1: 2000 dilution, the same antibody used for immunostaining), mouse monoclonal anti-γ-Tubulin (1: 1000 dilution, Sigma-Aldrich, T6557). Secondary antibodies were Peroxidase-conjugated goat anti-guinea pig (1: 10000) and goat anti-mouse (1: 10000) antibodies (both from Jackson Immuno Research), and detection used SuperSignal West Pico Chemiluminescent Substrate (Thermo-Fisher, 34080)

Title: Prickle isoforms determine handedness of helical morphogenesis Summary: Our right and left hands are mirror images of each other and cannot be precisely superimposed. This property, known as chirality, is vital for many tissues and organs to form correctly in humans and other animals. For example, fruit flies have hair-like sensory organs on the edges of their wings known as bristles. One of the cells in each bristle forms a shaft that generally tilts away from the main body of the fly and is anchored in place by another cell known as the socket. A signaling pathway known as PCP signaling controls the directions in which many chiral tissues and organs in animals form. The pathway contains two signaling modules: the global module collects "directional" information about the orientation of the body and sends it to the core module, which interprets this information to control how the tissue or organ grows. Fruit flies have two different versions of one of the core module components - known as Prickle and Spiny legs - that are thought to alter the direction the core module responds to the information it receives. Mutant flies known as pkpk mutants are unable to make Prickle and their wing bristles tilt in the opposite direction compared to those in normal flies, but it was not clear exactly why this happens. To address this question, Cho et al. studied PCP signaling in the wings of normal and pkpk mutant flies. The experiments showed that Prickle directed the bristles on the right wing of a normal fly to grow in left-handed corkscrew-like patterns in which the emerging shaft and socket of each bristle twisted around each other. As a result, the bristles tilted away from the bodies of the flies. In the pkpk mutants, however, Spiny legs substituted for Prickle, causing the equivalent bristles to grow in a right-handed corkscrew pattern and tilt towards the body. The findings of Cho et al. show that PCP signaling controls the direction fly bristles grow by selectively using Prickle and Spiny legs. In the future, this work may also aid efforts to develop effective screening and treatments for birth defects that result from the failure of chiral tissues and organs to form properly.

lay_elife

en

Summarize: IN looking back to this period, and calling to remembrance the numberless proofs of kindness and respect which I received from the natives of the valley, I can scarcely understand how it was that, in the midst of so many consolatory circumstances, my mind should still have been consumed by the most dismal forebodings, and have remained a prey to the profoundest melancholy. It is true that the suspicious circumstances which had attended the disappearance of Toby were enough of themselves to excite distrust with regard to the savages, in whose power I felt myself to be entirely placed, especially when it was combined with the knowledge that these very men, kind and respectful as they were to me, were, after all, nothing better than a set of cannibals. But my chief source of anxiety, and that which poisoned every temporary enjoyment, was the mysterious disease in my leg, which still remained unabated. All the herbal applications of Tinor, united with the severer discipline of the old leech, and the affectionate nursing of Kory-Kory, had failed to relieve me. I was almost a cripple, and the pain I endured at intervals was agonizing. The unaccountable malady showed no signs of amendment: on the contrary, its violence increased day by day, and threatened the most fatal results, unless some powerful means were employed to counteract it. It seemed as if I were destined to sink under this grievous affliction, or at least that it would hinder me from availing myself of any opportunity of escaping from the valley. An incident which occurred as nearly as I can estimate about three weeks after the disappearance of Toby, convinced me that the natives, from some reason or other, would interpose every possible obstacle to my leaving them. One morning there was no little excitement evinced by the people near my abode, and which I soon discovered proceeded from a vague report that boats, had been seen at a great distance approaching the bay. Immediately all was bustle and animation. It so happened that day that the pain I suffered having somewhat abated, and feeling in much better spirits than usual, I had complied with Kory-Kory's invitation to visit the chief Mehevi at the place called the 'Ti', which I have before described as being situated within the precincts of the Taboo Groves. These sacred recesses were at no great distance from Marheyo's habitation, and lay between it and the sea; the path that conducted to the beach passing directly in front of the Ti, and thence skirting along the border of the groves. I was reposing upon the mats, within the sacred building, in company with Mehevi and several other chiefs, when the announcement was first made. It sent a thrill of joy through my whole frame;--perhaps Toby was about to return. I rose at once to my feet, and my instinctive impulse was to hurry down to the beach, equally regardless of the distance that separated me from it, and of my disabled condition. As soon as Mehevi noticed the effect the intelligence had produced upon me, and the impatience I betrayed to reach the sea, his countenance assumed that inflexible rigidity of expression which had so awed me on the afternoon of our arrival at the house of Marheyo. As I was proceeding to leave the Ti, he laid his hand upon my shoulder, and said gravely, 'abo, abo' (wait, wait). Solely intent upon the one thought that occupied my mind, and heedless of his request, I was brushing past him, when suddenly he assumed a tone of authority, and told me to'moee' (sit down). Though struck by the alteration in his demeanour, the excitement under which I laboured was too strong to permit me to obey the unexpected command, and I was still limping towards the edge of the pi-pi with Kory-Kory clinging to one arm in his efforts to restrain me, when the natives around started to their feet, ranged themselves along the open front of the building, while Mehevi looked at me scowlingly, and reiterated his commands still more sternly. It was at this moment, when fifty savage countenances were glaring upon me, that I first truly experienced I was indeed a captive in the valley. The conviction rushed upon me with staggering force, and I was overwhelmed by this confirmation of my worst fears. I saw at once that it was useless for me to resist, and sick at heart, I reseated myself upon the mats, and for the moment abandoned myself to despair. I now perceived the natives one after the other hurrying past the Ti and pursuing the route that conducted to the sea. These savages, thought I, will soon be holding communication with some of my own countrymen perhaps, who with ease could restore me to liberty did they know of the situation I was in. No language can describe the wretchedness which I felt; and in the bitterness of my soul I imprecated a thousand curses on the perfidious Toby, who had thus abandoned me to destruction. It was in vain that Kory-Kory tempted me with food, or lighted my pipe, or sought to attract my attention by performing the uncouth antics that had sometimes diverted me. I was fairly knocked down by this last misfortune, which, much as I had feared it, I had never before had the courage calmly to contemplate. Regardless of everything but my own sorrow, I remained in the Ti for several hours, until shouts proceeding at intervals from the groves beyond the house proclaimed the return of the natives from the beach. Whether any boats visited the bay that morning or not, I never could ascertain. The savages assured me that there had not--but I was inclined to believe that by deceiving me in this particular they sought to allay the violence of my grief. However that might be, this incident showed plainly that the Typees intended to hold me a prisoner. As they still treated me with the same sedulous attention as before, I was utterly at a loss how to account for their singular conduct. Had I been in a situation to instruct them in any of the rudiments of the mechanic arts, or had I manifested a disposition to render myself in any way useful among them, their conduct might have been attributed to some adequate motive, but as it was, the matter seemed to me inexplicable. During my whole stay on the island there occurred but two or three instances where the natives applied to me with the view of availing themselves of my superior information; and these now appear so ludicrous that I cannot forbear relating them. The few things we had brought from Nukuheva had been done up into a small bundle which we had carried with us in our descent to the valley. This bundle, the first night of our arrival, I had used as a pillow, but on the succeeding morning, opening it for the inspection of the natives, they gazed upon the miscellaneous contents as though I had just revealed to them a casket of diamonds, and they insisted that so precious a treasure should be properly secured. A line was accordingly attached to it, and the other end being passed over the ridge-pole of the house, it was hoisted up to the apex of the roof, where it hung suspended directly over the mats where I usually reclined. When I desired anything from it I merely raised my finger to a bamboo beside me, and taking hold of the string which was there fastened, lowered the package. This was exceedingly handy, and I took care to let the natives understand how much I applauded the invention. Of this package the chief contents were a razor with its case, a supply of needles and thread, a pound or two of tobacco and a few yards of bright-coloured calico. I should have mentioned that shortly after Toby's disappearance, perceiving the uncertainty of the time I might be obliged to remain in the valley--if, indeed, I ever should escape from it--and considering that my whole wardrobe consisted of a shirt and a pair of trousers, I resolved to doff these garments at once, in order to preserve them in a suitable condition for wear should I again appear among civilized beings. I was consequently obliged to assume the Typee costume, a little altered, however, to suit my own views of propriety, and in which I have no doubt I appeared to as much advantage as a senator of Rome enveloped in the folds of his toga. A few folds of yellow tappa tucked about my waist, descended to my feet in the style of a lady's petticoat, only I did not have recourse to those voluminous paddings in the rear with which our gentle dames are in the habit of augmenting the sublime rotundity of their figures. This usually comprised my in-door dress; whenever I walked out, I superadded to it an ample robe of the same material, which completely enveloped my person, and screened it from the rays of the sun. One morning I made a rent in this mantle; and to show the islanders with what facility it could be repaired, I lowered my bundle, and taking from it a needle and thread, proceeded to stitch up the opening. They regarded this wonderful application of science with intense admiration; and whilst I was stitching away, old Marheyo, who was one of the lookers-on, suddenly clapped his hand to his forehead, and rushing to a corner of the house, drew forth a soiled and tattered strip of faded calico which he must have procured some time or other in traffic on the beach--and besought me eagerly to exercise a little of my art upon it. I willingly complied, though certainly so stumpy a needle as mine never took such gigantic strides over calico before. The repairs completed, old Marheyo gave me a paternal hug; and divesting himself of his'maro' (girdle), swathed the calico about his loins, and slipping the beloved ornaments into his ears, grasped his spear and sallied out of the house, like a valiant Templar arrayed in a new and costly suit of armour. I never used my razor during my stay in the island, but although a very subordinate affair, it had been vastly admired by the Typees; and Narmonee, a great hero among them, who was exceedingly precise in the arrangements of his toilet and the general adjustment of is person, being the most accurately tattooed and laboriously horrified individual in all the valley, thought it would be a great advantage to have it applied to the already shaven crown of his head. The implement they usually employ is a shark's tooth, which is about as well adapted to the purpose as a one-pronged fork for pitching hay. No wonder, then, that the acute Narmonee perceived the advantage my razor possessed over the usual implement. Accordingly, one day he requested as a personal favour that I would just run over his head with the razor. In reply, I gave him to understand that it was too dull, and could not be used to any purpose without being previously sharpened. To assist my meaning, I went through an imaginary honing process on the palm of my hand. Narmonee took my meaning in an instant, and running out of the house, returned the next moment with a huge rough mass of rock as big as a millstone, and indicated to me that that was exactly the thing I wanted. Of course there was nothing left for me but to proceed to business, and I began scraping away at a great rate. He writhed and wriggled under the infliction, but, fully convinced of my skill, endured the pain like a martyr. Though I never saw Narmonee in battle I will, from what I then observed, stake my life upon his courage and fortitude. Before commencing operations, his head had presented a surface of short bristling hairs, and by the time I had concluded my unskilful operation it resembled not a little a stubble field after being gone over with a harrow. However, as the chief expressed the liveliest satisfaction at the result, I was too wise to dissent from his opinion.

Summary: Even though Tommo is experiencing kindness at the hands of the Typee, he's still suspicious over Toby's disappearance and the idea that these people may be cannibals. More pressing is the condition of Tommo's leg, which isn't getting better at all. One day, as Tommo is resting in the Ti with Mehevi, he hears that there are boats approaching from the distance. He hopes Toby will return to rescue him. When he rises, thinking he will try to make it to the shore, Mehevi tells him quite sternly to sit down. Tommo understands that he is truly captive--bummer. Tommo also understands that most of the time, the Typee have much more information than they're willing to let on. There are exceptions, however, such as when Tommo wows Marheyo with the magic technology of a sewing needle, or when he uses his straight razor to help the great warrior Narmonee, to better shave his head.

booksum

en

Summarize: Background In 1986, a report to the President on defense management concluded that the defense industry needed to promote principles of ethical business conduct, detect acts of procurement fraud through self-governance, and voluntarily report potential fraud to the government. The report noted that DOD awarded contracts worth about $164 billion in 1985, 70 percent of which went to a group of 100 contractors. Twenty-five contractors reportedly did business of $1 billion or more, 147 contractors did $100 million or more, and almost 6,000 contractors did $1 million or more. In fiscal year 1994, the number of contractors doing business with DOD did not substantially change. Total DOD contracting for goods and services over $25,000 in fiscal year 1994 amounted to $118 billion. In response to the 1986 report, a number of defense contractors established self-governance programs that included monitoring compliance with federal procurement laws and voluntarily disclosing violations to government authorities. These efforts became known as the Defense Industry Initiative on Business Ethics and Conduct. To facilitate contractor self-governance and to encourage contractors to adopt a voluntary disclosure policy, DOD established the Voluntary Disclosure Program in July 1986. This program provides general guidelines, policy, and processes to enable DOD and its contractors to address matters of wrongdoing the contractors discover. At the time, DOD recognized that there was a need for a process to deal in a consistent manner with matters disclosed by contractors. In return for voluntarily disclosing potential wrongdoing and cooperating in any government audit and investigation, the government generally allows a contractor to conduct its own investigation, which the government then attempts to verify expeditiously. Upon receipt of an initial contractor disclosure, the DOD Inspector General’s office (1) makes a preliminary determination as to whether the disclosure satisfies the program’s requirements, (2) coordinates the execution of the standard voluntary disclosure agreement, (3) assigns the disclosure to a DOD criminal investigative organization for verification and to a suspension and debarment authority, and (4) coordinates the disclosure with the Justice Department for potential civil and criminal action. The Justice Department reviews all voluntary disclosures. It conducts, either through its Defense Procurement Fraud Unit or through referral to the appropriate U.S. Attorney’s Office, a preliminary inquiry to determine if there is credible evidence suggesting prosecutable violation of federal laws. The Justice Department has sole responsibility to initiate or decline prosecution. It also has an opportunity to concur in the voluntary disclosure agreement between the contractor and DOD. Acceptance of a voluntary disclosure into the program by DOD is based on four criteria. The contractor voluntarily disclosing the potential fraudulent action must (1) not be motivated by the recognition of imminent detection, (2) have status as a business entity, (3) take prompt and complete corrective actions, and (4) fully cooperate with the government in any ensuing investigation or audit. Defense Contractor Participation in the Program The number of voluntary disclosures under the program has been relatively small and the dollar recoveries have been modest. From its inception in 1986 through September 1994, DOD reported that 138 defense contractors made 325 voluntary disclosures of potential procurement fraud, of which 129 have been closed. According to DOD, 48 of the top 100 defense contractors made 222 disclosures. The remaining 103 disclosures were made by 90 contractors from among the more than 32,000 contractors doing business with DOD. Many contractors were one-time users, but one large contractor accounted for 23 of the closed cases. Figure 1 shows the annual number of disclosures reported since the program’s inception. Acceptance into the program has its benefits for contractors. For example, a contractor can expect (1) its liability in general to be less than treble damages, (2) action on any suspension to be deferred until after the disclosure is investigated, (3) the overall settlement to be coordinated with government agencies, (4) the disruption from adversarial government investigations to be reduced, and (5) the information may be kept confidential to the extent permitted by law and regulation. The program also benefits the government. For example, DOD commented that the existence of a structured format for addressing contractual and legal violations encourages contractor ethics and internal review programs. The Justice Department pointed out that the program promotes corporate compliance with laws and regulations. DOD/Justice Department Disagree on Some Admissions Into Program According to DOD, the key to deciding if a disclosure is voluntary is whether a contractor was aware of information the government possessed or was about to discover, thus motivating the contractor to make a disclosure. In a 1992 DOD review of the program, DOD noted cases in which it had determined that contractors’ disclosures were eligible for admission into the program, but the Justice Department disagreed and recommended that the disclosures not be admitted into the program. In 1992, when this disagreement was noted, the Justice Department proposed that it and DOD establish a working group to resolve the issue. To date, we were told, this has not occurred. According to officials from the two departments, disagreements continue over whether some disclosures should be admitted into the program. In fact, two of the three cases that were the basis of the concerns reflected in the 1992 review remain in the program as open cases, and the Justice Department still has not concurred with DOD’s acceptance of these disclosures into the program. The disagreement between the two departments revolves around whether disclosures were triggered by knowledge of imminent discovery by the government. In this regard, DOD believes that it is its prerogative, not the Justice Department’s, to accept or reject a contractor’s voluntary disclosure. DOD stated that it did not always agree with the Justice Department on whether a company should be admitted into the program. However, DOD stated that it and the Justice Department have worked well together in resolving the questions on a factual basis and that this cooperation has grown significantly over the last 2 years. DOD stated that the DOD Inspector General staff and representatives of the Defense Procurement Fraud Unit meet every 6 weeks to discuss the status of disclosures. During our review, we were told that these meetings were to resolve cases that had been open for an extended period, not to address whether disclosures should be accepted into the program. DOD-Reported Recoveries Overstated Through September 1994, DOD reported recoveries from the program of about $290 million, of which about 38 percent is associated with cases that are still open. The $290 million represents about 17 percent of the Justice Department’s $1.7 billion in reported settlements on DOD procurement fraud cases between fiscal years 1987 and 1994. While the value of the voluntary disclosure program may well extend beyond the amount of dollar recoveries, we note that most disclosures did not result in significant dollar recoveries for the government. Of 129 closed cases, 81 cases, or about 63 percent, had reported recoveries of less than $100,000, of which 52 cases, or 40 percent, had no dollar recoveries. Forty-eight cases had reported recoveries of $100,000 or more, of which 15 cases had reported recoveries of $2 million or more. Figure 2 shows the distribution of DOD-reported dollar recoveries for closed cases. The $290 million attributable to the program is overstated because it includes an amount that should not be considered a recovery from the program, as well as amounts related to disclosures made prior to the formal initiation of the program. The reported recoveries include (1) $75 million representing a contractor’s premature billings of progress payments and (2) recoveries from voluntary disclosure cases that predated the beginning of the program by up to 2 years. One case was closed before the program began. With regard to the progress payments, both the contractor’s disclosure report and the government’s subsequent investigative report showed the contractor prematurely billed the government by about $75 million. The Justice Department commented that the contractor then withheld approximately $75 million in billings at the time of the voluntary disclosure to rectify the premature billings. However, since DOD subsequently paid the contractor in full the amounts due under the contract, we believe the $75 million should not be claimed as a program recovery. DOD considers the submission of a claim for unearned progress payment to be a false claim and thus appropriate for reporting under the program. The Justice Department commented that there was no “recovery” of $75 million and that the government was damaged by the interest lost on the premature payments, the amount of which was included in the final settlement with the contractor. In our view, a recovery properly attributable to the voluntary disclosure program would be the interest cost on the $75 million premature payment. For 14 cases that predated the program, the DOD official responsible for the program told us that in 8 cases, although the disclosures predated the program announcement letter to industry, agreements were signed after the announcement and recoveries were resolved under the program. He said recoveries were made in three other cases after the program began. The DOD official believes, therefore, that these 11 cases were appropriately included in the program. However, he agreed that recoveries related to the three remaining cases should not be attributed to the program and indicated that DOD would reduce its reported recoveries—about $900,000—for these three cases. Voluntary Disclosures Take an Average of 2.8 Years to Complete For closed cases, DOD records show that it took an average of 2.8 years to complete a voluntary disclosure case, with about 25 percent taking over 4 years. DOD records also show that the contractors’ investigation took about 21 percent of the time and that the federal audit/investigation took about 52 percent of the time. Figure 3 shows the time to complete the closed cases. More than half the disclosures made since the program began are still reported as open. As of September 30, 1994, there were 173 open cases that have been open an average of 3.5 years. Twenty-nine of 44 cases disclosed in fiscal year 1990 and 13 cases disclosed in fiscal year 1987, the first full year of the program, were still reported as open. Further, the open case load is growing. The number of open cases at the end of fiscal year 1994 was greater than it was at the end of fiscal year 1990, despite a decline in the number of disclosures over the past 4 fiscal years. A Justice Department official suggested that some open cases may have been completed but not shown as closed in DOD’s records. Between October 1994 and the end of June 1995, only 2 cases were closed while 15 were accepted into the program. Contractor Cooperation May Be a Problem in Some Cases A Justice Department official responsible for the program commented that not all contractors fully cooperate with the government and that this is one factor that makes investigations a time-consuming process and delays settlements. The official stated that few companies provide the government all its witness interview memoranda and that fewer still agree to provide the government a “road map” of the cases, believing that they are not obliged to serve as the government’s investigator. According to this official, companies making voluntary disclosures tend to provide more assistance in a government investigation when the potential business and legal risks to the contractor are greater or when they want to give the impression that the company is turning over “a new leaf.” Our review identified two instances of less than full contractor cooperation. In one case, the company official destroyed records related to its disclosure. According to DOD, this company was successfully criminally prosecuted and fined, the official was sentenced to jail, and the company was debarred. The government’s investigation took 13 months, according to DOD information. In the other case, the contractor denied documents to government investigators, and the DOD Inspector General ultimately issued a subpoena to obtain the information. The government’s investigation took about 5 years, according to DOD information. The Justice Department said that the investigation included not only the disclosure but an additional series of allegations made in the related qui tam case, which was filed almost simultaneously with the company’s report. DOD officials considered removing this contractor from the program due to lack of cooperation but did not. The DOD official responsible for the program, however, stated that while there have been instances of less than total, or in a few cases very little, cooperation, they have been the exception rather than the rule. He added that disclosing a wrongdoing, conducting an internal investigation, and providing an internal investigative report without resorting to subpoenas or grand juries, were far more cooperative than would be present in any adversarial investigation. Case Management Is a Low Priority To ensure that each case is processed adequately and expeditiously, DOD guidelines require the investigative agencies to prepare a case progress report every 90 days summarizing the ongoing investigation and discussing case management issues, such as the status of the investigation and the level of contractor cooperation, and to forward the report to the DOD program manager. DOD also requires the investigative agencies to schedule a meeting with other appropriate program officials, such as those from the Justice Department and other DOD criminal investigative agencies, within 14 days of the progress report. The purpose of the meeting is to review the status of the case and determine what more needs to be done on each open investigation. According to the DOD program manager, investigative agencies are not systematically sending in the progress reports, and, in some cases, the reports that are submitted do not meet the program’s reporting requirements. Further, he told us that the meetings are not taking place because staffing is limited and priority is given to new cases over open cases. He also said DOD had not been following up to ensure that the DOD requirements were met and cases were handled expeditiously. Most Disclosures Were for Contract Mischarging and Product Substitution According to DOD data, the most frequent violation types disclosed were for contract mischarging and product substitution. Contract mischarging is applying material or labor charges to the wrong contract; product substitution is delivering products other than those specified in the contract. Other disclosures dealt with violations relating to overpricing of contracts negotiated under the Truth in Negotiations Act, false claims or statements, and excessive progress payment. Table 1 shows the number and types of violations disclosed for the closed cases. Little Overlap Exists Between Qui Tam Actions and Voluntary Disclosures In 1986, the False Claims Act was amended to increase the qui tam relator’s share of recovery in fraud settlements. Since that time, DOD procurement-related qui tam actions have steadily increased, while voluntary disclosures have decreased. Figure 4 shows the number of DOD-related qui tam actions filed and the number of DOD voluntary disclosures made since 1987. While the increase in qui tam actions may be related to the increase in a relator’s share of the recovery, we found no data to explain the decrease in disclosures. There is little overlap between voluntary disclosures and related qui tam actions. For the 129 voluntary disclosure cases closed since the program began, only 4 involved qui tam actions. In one case we examined, the government benefited because the qui tam action (1) provided a road map essential to the government’s case, (2) identified additional fraudulent activity, and (3) increased the amount of money recovered by the government. According to a DOD official, some contractors claim that the threat of a qui tam action might discourage voluntary disclosures because the company’s investigation creates potential qui tam relators as more employees become aware of the potential fraud. He added that a contractor runs the risk of an employee filing a qui tam action before it can complete its investigation or even adequately define the issue to make a sufficiently complete voluntary disclosure for acceptance into the program. On the other hand, this DOD official remarked that other contractors indicated they would make disclosures in spite of possible qui tam actions. Other reasons cited for a contractor not making a voluntary disclosure include (1) contractor management conflicts between disclosing potential fraud to the government and the contractor’s perceived duty to protect stockholder value; (2) contractor uncertainty of prosecution outcome from disclosing potential fraud; (3) the high cost of internal investigations, which is usually stipulated to be an unallowable cost for government reimbursement purposes; and (4) differences between contractor disclosure policies and its practices. According to an official in the DOD Inspector General’s office, voluntary disclosures and qui tam actions complement each other and qui tams act as a “check and balance” to the program and contractor honesty. Agency Comments In commenting on a draft of this report, DOD emphasized that the program generates positive results and is clearly in the government’s best interest. DOD’s comments are presented in their entirety in appendix I, along with our evaluation of them. The Justice Department said that it is committed to the program and that the program has been remarkably effective in nurturing business honesty and integrity and in bringing good new cases to the government’s attention. It believes the program to be a model for government voluntary disclosure programs. The Justice Department’s comments are presented in their entirety in appendix II, along with our evaluation of them. Scope and Methodology We reviewed overall statistical information on the program’s accomplishments, as well as information on qui tam actions and their relationship to voluntary disclosures. We also reviewed limited information on one of four qui tam cases. In addition, we talked to experts inside and outside of the government on the program’s merits and on its relationship to qui tam actions. We performed limited tests of the data reviewed and found some inaccuracies. Thus, while we have concerns about the reliability of the data, it represents the only source of comprehensive information on the program’s accomplishments other than individual case files. DOD and Justice Department policies and practices prevented our access to open voluntary disclosure case files. Our access to closed case file information was also limited when, according to Justice Department officials, it contained information covered by rule 6(e) of the Federal Rules of Criminal Procedure, which governs secrecy requirements of grand jury proceedings. As a result, the Justice Department would not provide us with the bulk of several closed case files we initially selected for review. Furthermore, according to the Justice Department, some of the documents in two of three closed cases we selected for initial review were unavailable because of a court-imposed protective order in one case and a confidentiality agreement between the U.S. Attorney’s Office and the company in the other case. We conducted our review from May 1994 to July 1995 in accordance with generally accepted government accounting and auditing standards. Unless you publicly announce its contents earlier, we plan no further distribution of this report until 30 days from its issue date. At that time, we will send copies to the Secretary of Defense; the Attorney General, Department of Justice; the Director, Office of Management and Budget; and other interested congressional committees. Copies will also be made available to others upon request. Please contact me at (202) 512-4587 if you or your staff have any questions concerning this report. The major contributors to this report are listed in appendix III. Comments From the Department of Defense The following are GAO’s comments on the Department of Defense’s (DOD) letter dated October 13, 1995. GAO Comments “The number of current investigative cases and resulting recoveries of money to the Government and convictions of defense contractors being conducted by the Defense Criminal Investigative Service shows that fraud is still increasing. The Federal Bureau of Investigations statistics shown for the United States substantiate the same trend. Losses due to fraud are approximately $200 billion a year.” Although our report notes that the program represented about 17 percent of the Justice Department’s $1.7 billion in reported settlements on DOD procurement fraud cases between fiscal years 1987 and 1994, actual program recoveries were a matter of disagreement. 3. We modified the report’s text to incorporate DOD’s comments. 4. We continue to disagree with DOD on reporting the $75 million in premature progress payments as a recovery of the program since the amount was ultimately paid to the contractor. 5. We modified the report’s text to incorporate DOD’s comments. 6. We modified the report’s text to incorporate DOD’s comments. 7. We modified the report’s text to incorporate DOD’s comments. Comments From the Department of Justice The following are GAO’s comments on the Department of Justice’s letter dated October 11, 1995. GAO Comments 1. We do not make the conclusion that the Voluntary Disclosure Program is not a useful or effective means of identifying or combatting fraud. 2. We agree that statistics alone do not tell the whole picture of the potential contribution of the program. We recognize that the program’s value may extend beyond that which can be measured by available statistics and that corporate compliance that comes out of voluntary disclosures can have long-term effects on business honesty and integrity. 3. DOD continues to report two open cases in which the Justice Department did not concur because it believed the contractor was motivated by recognition of imminent detection. 4. While we attempted to work with the Justice Department in obtaining information from closed case files, the length of time it took to obtain information did not allow us to complete our audit in a timely manner. Further, without knowledge of the information withdrawn from the files, we could not effectively evaluate the administration of the program. 5. We have deleted this sentence based on the Justice Department’s comments. 6. For purposes of background and brevity, we summarized the criteria for program acceptance. A full presentation of the criteria does not, in our view, add to the background presentation. 7. We have modified the report based on the Justice Department’s comments. 8. We have modified the report based on the Justice Department’s comments. 9. We have modified the report based on the Justice Department’s comments. 10. Although the government was damaged by the amount of lost interest on the premature payment to the contractor, the $75 million represents the amount of the progress payment and does not include interest lost. 11. We have modified the report based on the Justice Department’s comments. 12. We have modified the report based on the Justice Department’s comments. 13. We have modified the report based on the Justice Department’s comments. 14. We have modified the report based on the Justice Department’s comments. Major Contributors to This Report National Security and International Affairs Division, Washington, D.C. Office of General Counsel, Washington, D.C. Dallas Regional Office John E. Clary Joe D. Quicksall Ronald J. Salo The first copy of each GAO report and testimony is free. Additional copies are $2 each. Orders should be sent to the following address, accompanied by a check or money order made out to the Superintendent of Documents, when necessary. VISA and MasterCard credit cards are accepted, also. Orders for 100 or more copies to be mailed to a single address are discounted 25 percent. U.S. General Accounting Office P.O. Box 6015 Gaithersburg, MD 20884-6015 Room 1100 700 4th St. NW (corner of 4th and G Sts. NW) U.S. General Accounting Office Washington, DC Orders may also be placed by calling (202) 512-6000 or by using fax number (301) 258-4066, or TDD (301) 413-0006. Each day, GAO issues a list of newly available reports and testimony. To receive facsimile copies of the daily list or any list from the past 30 days, please call (202) 512-6000 using a touchtone phone. A recorded menu will provide information on how to obtain these lists.

Summary: Pursuant to a congressional request, GAO provided information on the Department of Defense's (DOD) Voluntary Disclosure Program, focusing on the: (1) extent to which defense contractors participate in the program; (2) amount of money that has been recovered under the program; (3) time taken to close disclosure cases; (4) most common type of disclosures; and (5) extent of overlap between voluntary disclosures and qui tam actions. GAO found that: (1) although 48 of the top 100 defense contractors have made voluntary disclosures, the total number of disclosures under the program has been relatively small and dollar recoveries have been modest; (2) from its inception in 1986 through September 1994, DOD reported that, of the thousands of defense contractors, 138 contractors made 325 voluntary disclosures of potential procurement fraud; (3) DOD reported recoveries from these disclosures to be $290 million, about 17 percent of total reported DOD procurement fraud recoveries between fiscal years (FY) 1987 and 1994; (4) GAO's review indicated that DOD's reported recoveries of $290 million were overstated because they included $75 million in premature progress payments and amounts from disclosures made prior to the program; (5) further, DOD accepted some disclosures into the program that the Justice Department believed were triggered by imminent government discovery and thus did not meet the criteria for admission; (6) voluntary disclosure cases took an average of 2.8 years to close, with about 25 percent taking over 4 years; (7) open cases are taking longer; (8) as of September 1994, DOD data showed that open cases averaged 3.5 years, with over half of the cases disclosed in FY 1990 still open; (9) less than full contractor cooperation with the government and low priority given by DOD and other investigative agencies to managing cases expeditiously may be problems in some cases; (10) most disclosures did not result in significant dollar recoveries for the government; (11) of 129 closed cases, 81 cases, or about 63 percent, had reported recoveries of less than $100,000, of which 52 cases, or 40 percent, had no dollar recoveries; (12) forty-eight cases had reported recoveries of $100,000 or more, of which 15 cases had reported recoveries of $2 million or more; (13) there is little overlap between voluntary disclosures and qui tam actions; and (14) of the 129 voluntary disclosure cases closed since the program began, 4 involved qui tam actions.

gov_report

en

Summarize: Misure coercitive e inibitorie a tutela della proprietà industriale L'art. 124 del codice della proprietà industriale stabilisce che la sentenza che accerta la violazione di un diritto di proprietà industriale può essere disposta l'inibitoria della fabbricazione, del commercio e dell'uso delle cose costituenti violazione del diritto, e l'ordine di ritiro definitivo dal commercio delle medesime cose nei confronti di chi ne sia proprietario o ne abbia comunque la disponibilità. Pronunciata l'inibitoria, per rendere più effettiva la tutela della proprietà industriale, per le ipotesi in cui non dovesse essere rispettato quando disposto in sentenza, è previsto un mezzo di coercizione indiretta, infatti, il giudice può fissare una somma dovuta per ogni violazione o inosservanza successivamente constatata e per ogni ritardo nell'esecuzione del provvedimento. L'inibitoria consiste in un ordine di non fare e importa a carico del destinatario, un obbligo di astensione dal compimento della condotta ritenuta illecita. Tale obbligo è suscettibile di esecuzione forzata nelle sole forme previste per l'eliminazione di quanto realizzato (art. 2933 c.c.), ma, nei confronti della protrazione o della reiterazione della detta condotta, opera, come strumento di dissuasione — e quindi come mezzo di coazione indiretta alla cessazione degli atti contraffattivi, con cui è violato il diritto di proprietà industriale — la penalità di mora contemplata dall'art. 124, comma 2, c.p.i. La penale può essere apposta ad un obbligo di non fare, nelle violazioni degli obblighi di non fare la misura coercitiva va raccordata non già al ritardo in un'attività esecutiva, che non può esservi, quanto alla specifica inosservanza al divieto di porre in essere gli atti che integrano illecito: sicché la penale colpisce ogni singola condotta con cui è violato l'obbligo di non fare. L'obbligo di non fare rappresenta una condotta che si dovrebbe protrarre nel tempo (come si potrebbe protrarre nel tempo il rifiuto di conformarsi all'obbligo di non fare), quindi la penale apposta ad un obbligo di non fare può essere anche calcolata sulla base del numero di giorni che trascorrono prima che il soggetto obbligato si conformi al divieto di non fare. Di conseguenza, non può tuttavia escludersi che il giudice che pronunci l'inibitoria, in presenza di una condotta suscettibile di protrarsi nel tempo senza soluzione di continuità, determini la penalità di mora in ragione del ritardo con cui l'autore dell'illecito ottemperi all'obbligo di porre fine all'attività vietata.

Summary: Cassazione 14.8.2019 n 21404 Ove il giudice non indichi l'unità temporale cui ragguagliare la somma dovuta come penale ex art 124 comma 2 c.p.i. e vengano in questione atti che integrino violazioni dell'inibitoria, la liquidazione della penalità deve attuarsi prendendo in considerazione le specifiche inosservanze alla statuizione emessa, restando esclusa una eterointegrazione della sentenza da parte del giudice chiamato a pronunciarsi ex art 124 comma 7 c.p.i. sulle contestazioni insorte.

fanpage

it

Summarize: Starting in 1996, Alexa Internet has been donating their crawl data to the Internet Archive. Flowing in every day, these data are added to the Wayback Machine after an embargo period. Jennifer Kershaw after a 2013 domestic violence incident. (Courtesy of Jennifer Kershaw) Nearly three years ago, Jennifer Kershaw was in an Ohio hospital with a broken cheekbone, a swollen eye and cuts and bruises, telling authorities she did not want to press charges against the man she said was responsible. She said she has since taken back her power. “I think, looking back now, I was just a typical battered woman trying to protect my husband,” she told the Columbus Dispatch last year. Kershaw filed a civil lawsuit in 2014 to hold her now-ex-husband accountable for beating her and to send a message to other abusers. On Tuesday afternoon, according to the Dispatch, she stood in a courtroom in Franklin County, Ohio, awaiting the verdict. A judge announced Kershaw’s award for compensatory damages: $1,580,000. Kershaw was so overwhelmed that she did not hear what the judge said next: $20 million for punitive damages. “I think I was in shock,” Kershaw told The Washington Post on Wednesday. “Now I feel a sense of relief and justice,” she added. “It’s kind of like a weight has been lifted.” [‘She had some type of fear in her heart’: A pregnant mother’s mysterious pre-death phone call] The case is believed to be one of the first in Ohio in which a domestic-violence victim has brought a civil lawsuit against an abusive spouse — and won. “The attitudes are still behind the times, which I think is why we really haven’t seen a case like this,” Kershaw’s attorney, Michael King, told The Post. King said he hopes the case will help bring attention to domestic violence and send a message that these crimes are “not okay, not acceptable and not tolerable.” Because Ohio law places limits on non-economic damages (such as pain and suffering) as well as punitive damages, King said Kershaw’s actual award will be about $3.5 million — a number the attorney called “offensive” relative to the $21 million judgement. But Kershaw has told the Columbus Dispatch that the purpose of her lawsuit was to help her “feel empowered” and to give power other domestic violence victims. “I felt like he was in control with everything,” Kershaw told the newspaper last year about her ex-husband. In filing the lawsuit, she said: “That was the first time I felt empowered throughout this whole process.” Her ex-husband, Jerry Bailey, could not immediately be reached for comment. He does not appear to have an attorney, and he did not show up in court Tuesday to hear the judge’s decision, according to the Dispatch. [‘She loved being a mother’: Pregnant woman executed for refusing abortion, family says] According to the National Coalition Against Domestic Violence, one in three women and one in four men have reported being victims of some form of physical violence by a partner — and one in five women and one in seven men have reported being victims of severe physical violence. The most commonly abused victims are women between the ages of 18 and 24, according to the data. Kershaw, a 36-year-old first-grade teacher who went by Jennifer Bailey before her divorce, said she had returned from a festival late one night in August 2013 to an “agitated” husband, according to a complaint filed in 2014 in the Court of Common Pleas of Franklin County, Ohio. The lawsuit states that Bailey, now 40, grabbed his wife and pushed her — and that when she tried to leave the home, he blocked her. “He’s thrown things at me and he’s broken things and he’s smashed I don’t know how many glasses — I think to scare me and it did scare me,” she told the Columbus Dispatch last year, “but there was a higher level of danger. “I sensed a higher level of danger that night, for sure — because it escalated so quickly.” [‘You took away my worth’: A sexual assault victim’s powerful message to her Stanford attacker] When Kershaw tried to escape, Bailey snatched her keys and her cellphone and then tried to restrain her, according to court documents. At one point, she got to the garage door and, the lawsuit claims, Bailey put her in a headlock and “repeatedly and maliciously struck her in the face with his fist and knee.” Once he realized she was injured, he told her, “I can’t believe your eye,” according to the lawsuit. “I am going to go to jail for this,” he added, the lawsuit said. “He held me against my will in my home and he punched me over and over while I was in a headlock and he kneed me on my right cheek and broke my cheekbone,” Kershaw told the Columbus Dispatch last year. “Luckily I escaped and I’m okay.” Jennifer Kershaw. (Courtesy of Jennifer Kershaw) Kershaw told authorities she made it out “screaming for help as loudly as she could” and ran to a neighbor’s house where she called her parents, according to the lawsuit. She was later taken to an emergency room with numerous injuries to her face. Bailey was found guilty of misdemeanor domestic violence and was sentenced to 180 days in jail — 178 of which were suspended — and two years’ probation, according to court documents. “I just felt like he was getting away, and he really rocked my world,” Kershaw told the Dispatch last year. So, she said, she decided to sue him in civil court for assault and battery, false arrest or imprisonment and intentional infliction of serious emotional distress. [She was jailed for murdering an abusive husband. An enraged French public helped secure her freedom.] Bailey, the Dispatch reported, tried to get the case thrown out, saying it was “a complaint of conduct and claims arising out of the marital relationship” and had been settled in the divorce. But a judge ruled that the civil case should proceed. The same judge later decided that Kershaw was entitled to damages. “He’ll have more consequences than just the slap on the wrist he received before,” Kershaw told the Dispatch. “We won all of our claims against him — I feel like that’s huge.” Kershaw told The Post that her court battle has been a long and painful struggle — but that it was worth it. “Every time I knew I was going to have a court date, all of those stressors and feelings came back up and I had to relive it,” she said. “I had to go back through some very dark times and share that with the jurors so they understood what happened that night.” “I’m hoping that it’s the closing of a book,” she added, “and I can finally put it to rest and move on with my life.”

Summary: After her husband spent just two days in jail for giving her a beating that left her with fractured facial bones, Jennifer Kershaw took the unusual step of filing a civil lawsuit-and taught him a $21.5 million lesson. On Tuesday, a jury in Franklin County, Ohio, awarded the 36-year-old elementary school teacher $1,580,000 in compensatory damages and $20 million in punitive damages, the Columbus Dispatch reports. State laws capping such awards may cut the amount by up to 90%, but Kershaw, who has now divorced Jerry Bailey, says the message the victory sends is the important part. "It's brought back a lot of dark times that I tried to grow away from," she says. "But I really believe that it's going to be healing for me, and this is for all women who have been abused in some way." Bailey-who was fined $100 after being found guilty of misdemeanor domestic violence in the 2013 attack on his wife-had tried to stop the lawsuit, arguing in legal papers that it was "a complaint of conduct and claims arising out of the marital relationship." A judge disagreed last fall and allowed the rare spouse-on-spouse civil lawsuit to proceed separately from divorce proceedings. Kershaw's lawyer tells the Washington Post that "attitudes are still behind the times, which I think is why we really haven't seen a case like this." He tells the Dispatch that he hopes the court victory will send the message that it is "not OK for people to commit domestic violence. And for those who do, there will be consequences."

multi_news

en

Summarize: BACKGROUND OF THE INVENTION A stem type femoral hip replacement prosthesis comprises an elongated stem for placement in the intramedullary cavity of the femur and a head defining the proximal end of the prosthesis for replacing proximal portions of the natural femur. The head of the prostheses is substantially spherical and is pivotally engageable in an acetabular cup which defines a separate portion of a prosthetic system which is affixed to the natural acetabular. The stem type femoral prosthesis may further include a collar for engagement against the resected proximal end of the natural femur, and a neck extending from the collar to the head. Most prior art stem type femoral prostheses have been of unitary construction. However many prior art stem type prostheses have been of modular construction with any of a plurality of heads being selectively engageable on any of a plurality of necks. The particular head and neck combination has been selected to achieve optimum fit in the patient. Examples of prior art femoral stem type prostheses are shown in U.S. Pat. No. 4,752,296 which issued to the inventors herein on Jun. 21, 1988. The best length and diameter of the stem of a stem type femoral hip replacement prostheses is dependent on the patient&#39;s physiology and pathology. For example, a small patient with considerable disuse atrophy of the femur may have a wide intramedullary cavity or femoral canal and thus may require a prostheses with a small proximal end but a large stem diameter for proper fit in the intramedullary cavity of the femur. In other instances, an extra long stem may be needed to span a femoral fracture or other defect, and thus allow the prosthesis to act as a support for the defect while healing occurs Typically the prosthesis, and particularly the stem of the prosthesis, have been custom made to accommodate the specific physiological and pathological needs of the patient. This typical prior art approach has at least three major disadvantages. In particular: the custom made prosthesis is very expensive; there is considerable time required to obtain the prosthesis, during which time the patient can be adversely affected; and, fitting the prosthesis from x-ray data is not completely reliable, and the custom made prosthesis may in fact not fit well, if at all. In view of the preceding problems, some prior art prostheses have been developed with modular stems to alter the length of the stem in accordance with the particular needs of the patient. A stem extension of a selected length can be added to the proximal portion of the stem type prosthesis to allow fitting intraoperatively. These prior art modular stem prostheses generally have employed a conical taper fit between the proximal portion of the prosthesis and the extension. Some such prior art modular stem type prostheses have employed a screw to force the mating tapered ends tightly together. The interengagement of the mating male and female tapered components of the prior art modular stem type prosthesis produces substantial tension forces on the surface of the female component. More particularly, the forceful urging of the component having the male taper into the component having the female taper urges the female tapered portion outwardly to generate the substantial tension forces on the surface of that member. These substantial tensile forces necessarily occur at critical surface areas near the stem-extension interface. The tension forces developed in this context can be compared to the hoop stresses created on the hoops of a barrel. Unlike a barrel, however, the prothesis is repeatedly subjected to bending stresses during normal usage. During instances of such bending stress, the portion of the prothesis having the female taper will be subjected to complex tension forces caused both by the wedging action of the mating tapers (e.g, hoop stress) and by the bending stresses. Such surface tensile stresses are highly undesirable in that they contribute substantially to fatigue of the prosthesis, and thus substantially weaken the stem/extension composite structure at the structurally critical interface of the stem and the stem extension. In particular, microfissures or microcracks in the surface of the component having the concave taper can experience accelerated propagation when subjected to additional tensile forces in response to the bending stresses exerted on these critical regions of the prostheses during normal usage. In view of the above, it is an object of the subject invention to provide a modular prosthesis that enable optimum fitting to the patient. It is another object of the subject invention to provide a modular prosthesis that reduces tensile forces significantly in critical areas of the prosthesis. It is a further object of the subject invention to provide a modular prosthesis having a stem and a stem extension which minimize tensile forces at surface regions adjacent the interface of the stem and the extension of the prostheses. SUMMARY OF THE INVENTION The subject invention is directed to a modular stem type prosthesis that does not include or require wedging or tapered interfit of parts at surface regions adjacent to the interface of those parts. The prosthesis of the subject invention comprises a stem and an extension. The extension has a length selected in accordance with the physiology and pathology of the patient. The diameter of the stem extension also is selected in accordance with the physiology and pathology of the patient. The diameter of the extension may exceed the diameter of the stem to which the extension is mated. In a typical embodiment, the stem may define the proximal end of the prosthesis, while the extension defines the distal end. The prosthesis may be a stem type femoral prosthesis which may further comprise a collar, a neck and a head. The stem of the prosthesis and the extension rely substantially upon a &#34;slip fit&#34; interengagement therebetween. In this context, &#34;slip fit&#34; is a term of art commonly used in machine tool technology to define an accurate interfit relying substantially upon close sliding telescoped interengagement substantially free of force fitting and/or wedge fitting and free of excessive play. One component of the modular prosthesis may comprise a plurality of longitudinally extending deflectable fingers which may terminate in enlarged arcuately extending ridges. The other component of the modular prosthesis may include a cavity into which the first component extends. The cavity may be provided with an outwardly extending arcuate groove for receiving the ridges at the ends of the deflectable fingers. The relative dimensions of the components may be selected to require an initial inward deflection of the fingers as the ridges approach the groove. The fingers may then resiliently return toward their undeflected condition such that the ridges of one component engage in the groove of the other component. The modular prosthesis system of the subject invention may further include a screw which is engageable into one of the two interengaged components for securely retaining the ridges of the one component in the grooves of the other component. The screw may be tapered along its length to effectively lock the screw into one or both members and prevent unintended threaded separation therefrom. The tapering of the screw can further ensure the locked engagement of the ridges in the groove Although this tapering may achieve some wedging action, the wedging forces are less than on conventional designs and are substantially spaced from the critical surface regions at the interface of the two components, and therefor does not create the problems of tension forces on the surface caused by the wedging interfit of the tapered members. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a front elevationaI view of a modular prosthesis in accordance with the subject invention. FIG. 2 is a front elevational view of the stem portion of the modular prosthesis. FIG. 3 is a cross-sectional view taken along line 3--3 in FIG. 2. FIG. 4 is a cross-sectional view of a stem extension of the modular prosthesis. FIG. 5 is a side elevational view, partly in section, of an alternate extension. FIG. 6 is side elevational view of a locking screw for use with the stem, and stem extension of FIGS. 2-4. FIG. 7 is a cross-sectional view taken along line 7--7 in FIG. 1. FIG. 8 is a graph showing the relationship of diameter to fatigue strength ratios. FIG. 9 is a graph showing the relationship of stem geometry to stress concentration. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT A femoral stem 100 type prosthesis in accordance with the subject invention is identified generally by the numeral 10 in FIG. 1. The prosthesis 10 comprises a stem 100, an extension 200 and a locking screw 300. Referring to FIGS. 2 and 3, the stem 100 includes an end portion 101 which comprises a first cylindrical section 102 of diameter d 1 which joins an intermediate portion 103 of the stem 100 in a large radius A. This junction of the first cylindrical section 102 and the intermediate portion 103 of the stem 100 is the critical stress area for stem bending, which is the major contributing factor to stem breakage problems. The first cylindrical section 102 of the stem 100 joins with a second cylindrical section 104 of diameter d 2 through generous fillet radii C and D as shown in FIG. 3. The end of the second cylindrical section 104 is defined by a circular ridge 105. A hole 106, which terminates in taper 111, is drilled or bored in the end 107 of the stem 100 and four slots 108 are made in the second cylindrical section 104 running parallel to the axis 109 of femoral stem 100 dividing the second cylindrical section 104 into four flexible segments 110. Turning to FIGS. 4 and 5, the extension 200 with axis 201 has a first extension cylindrical section 202 approximately of diameter d 1, which mates with the corresponding first cylindrical section 102 of the femoral stem 100. The first extension cylindrical section 202 has a chamfer 220 at its entrance 203. A second extension cylindrical section 204 approximately of diameter d 2 is disposed to mate with the second cylindrical section 104 of the femoral stem 100. The first extension cylindrical section 202 is joined to the second extension cylindrical section 204 by generous fillet radii B and E. The inner end 207 of the second extension cylindrical section 204 terminates in a circular groove 205 which is disposed to mate with the corresponding circular ridge 105 in the femoral stem 100. Adjacent to circular groove 205 of the extension 200 is a threaded hole 208 and a guide hole 209. The threaded hole 208 will be substantially the same length for extensions in a system of prostheses 10. However, the length L of the guide hole 209 will be a function of the length of the extension 200. As shown in FIG. 5, the extension 200 may be made in various lengths or outside diameter the smallest of which would be equal to the outside diameter of the femoral stem 100. With reference to FIG. 6 a locking screw 300 is used to help hold the femoral stem 100 and the extension 200 together. The locking screw 300 consists of a tapered end 311 which mates with the taper 111 of femoral stem 100, and a threaded section 308 which mates with threaded hole 208 of the extension 200. The screw end 301 contains a slot 302 or other detail for turning the screw with a screw driver or other tool. In use the surgeon selects a femoral stem 100 size appropriate to the size of the patient&#39;s proximal femur and selects an extension diameter and length appropriate for the patient&#39;s femoral shaft or intramedullary cavity. The end portion 101 of the femoral stem 100 is inserted in the entrance 203 of the extension 200 until the leading edge 112 of the circular ridge 105 engages radius E leading into the second extension cylindrical section 204. Further insertion cause deflection of the four flexible segments 110 inwardly so that they can pass through the second extension cylindrical section 204 until the circular ridge portions 105 of the four flexible segments 110 are in the circular groove 205 where they expand outwardly retaining the extension 200 on the femoral stem 100. The tapered end 311 of the locking screw 300 is then inserted in the guide hole 209 of the extension 200 until the threaded hole 208 in extension 200 engages the threaded section 308 of the locking screw 300. A screw driver, or similar tool is then used to turn the locking screw 300 until tapered end 311 of the screw 300 engages taper the femoral stem 100. Further turning of the locking screw 300 will cause outward deflection of the four flexible segments 110 such that the circular ridge portions 105 thereof are urged tightly into the circular groove 205 firmly holding extension 200 to the femoral stem 100. Further the effect of the wedge fit produced by taper 111 and tapered end 311 lock the screw 300 against loosening. It will be noted that the prosthesis 10 uses a taper and screw to hold the extension 200 to femoral stem 100. However, unlike earlier devices the taper-screw connection is a smaller secondary connection and as such produces relatively small surface tensile stresses on the outside of the extension. Furthermore, and importantly, any minor effect of this taper and screw connection is away from the critical stress regions near radii A and B in the femoral stem 100 and the extension 200 respectively. The primary connection is a cylindrical slip fit between the first cylindrical section 102 and the first extension cylindrical section 202, with the slip fit being free of significant assembly stresses. Further, the taper 111 at the end 107 of the stem 100 and the tapered end 311 of the locking screw 300 need not be very accurately made in order to function properly while a primary taper connection, as in the prior art, requires very accurately tapered surfaces. A further advantage of the prosthesis 10 is that the locking screw 300 is not strictly needed to hold the stem 100 and the extension 200 together since they are held together by the detent action of the ridges 105 of the four flexible segments 110 in the circular groove 205 of the extension 200. Thus in the unlikely event of the secondary taper connection failure, the femoral stem 100 and extension 200 would remain assembled. If a primary taper connection fails the parts will separate. The primary reason for the secondary connection provided by the screw 300 is to avoid micromotion between femoral stem 100 and extension 200, and thus to avoid metallic wear products of such motion. The relative diametrical dimensions of the stem 100 and the extension 200 in regions of the slip fit therebetween should be selected to achieve optimum strength for the prosthesis 10 in response to bending stresses exerted thereon. For example a large diameter of the first cylindrical section 102 of the stem 100 could provide a small radial thickness of the first extension cylindrical second 202 with failure of the extension 200 in response to bending stresses being possible. Conversely, a radially thicker extension 200 could yield a stem 100 that is possible to fail in response to bending stresses exerted thereon. The relative dimensions should be selected to achieve a balanced design where the stem 100 and the extension 200 contribute equally to the strength of the prosthesis 10 in response to bending stresses. The optimum relative dimensions can be derived from the calculations set forth below. The basic assumption for these calculations is that simple bending equations for shafts are adequate for this case. This assumption is clearly conservative. The stem 100 and extension 200 can only see stresses resulting from bending loads and much lower stresses from possible compressive loads on the end of the extension 200. Ignoring compression loads is conservative since this load reduces the tension bending stress component which produces fatigue failure. Referring to FIGS. 2-4 it will be appreciated that the critical region for stress in the stem 100 is at radius A and for the extension at radius B. A balanced design in which the stress becomes critical in both parts may be found from FIGS. 6 and 7 and from Eq. 1. S.sub.fe /S.sub.fs =(K.sub.e /K.sub.s)[(d.sub.1 /d.sub.2).sup.3 -d.sub.2 /d.sub.1 ] (1) where S fs, S fe, K e, and K s are the fatigue strength and the stress concentration factors of the stem and extension respectively, and M in FIG. 7 is the bending moment applied to the assembled stem and extension. The diameters d 1 and d 2 are as given in FIGS. 2, 4 and 7. The indicated calculations are obtained by noting that both parts are critically loaded when the stress in each is equal to its fatigue strength and that the bending moment in each is the same. The stress concentration factor is a function of d 1 /d 2 from FIG. 7, which is drawn from Machine Design Theory and Practice, by Deutschman et al. The stress concentration factor in the stem is assumed equal to the stress concentration factor in the extension for these calculations. This assumption is made reasonable by making radius A larger than B for the stem design. Values of d 1 /d 2 as a function of the ratio of the fatigue strengths using this assumption are given in FIG. 6. The strength of an extended stem two-piece stem may be compared to a conventional unitary stem by Eq. 2. R=[S.sub.fe /(S.sub.fs K.sub.e ](d/D).sup.3 (2) where now S fs and D now refer to the unitary stem and R is the two-piece to unitary strength ratio. From Eq. 2, and FIGS. 6 and 7 one can design a two-piece stem of titanium alloy of similar materials with a fatigue strength of 85 ksi to be comparable in strength to a cast stem made of Cobalt-Chromium, which typically has a fatigue strength of about 35 ksi, by insuring that the stress concentration factor in the extension does not exceed 1.3. This is accomplished by setting radius B of the extension as equal to 0.25 times the extension diameter &#34;d 1 &#34;. Thus a Titanium two-piece stem can be made substantially equivalent, with respect to strength, to conventional Cobalt Chromium stems, which have been found to be relatively safe from fracture after decades of clinical use. Since Titanium is more flexible than Cobalt Chromium alloy the bone into which a Titanium stem is implanted will carry more bending load than this bone would carry if a Cobalt chromium stem were implanted. Thus in general a Titanium stem will be exposed to lower bending loads than a Cobalt Chromium stem. Now in light of the fact that a properly designed Titanium alloy two-piece stem is as strong as a Cobalt Chromium stem but is exposed to lower bending loads it is clear that if Cobalt Chromium stems are safe with respect to fracture then a Titanium alloy two-piece stem must be safer still. While the invention has been described with respect to a preferred embodiment, it will be apparent that various changes can be made without departing from the scope of the invention as defined by the appended claims. For example, a modular stem prosthesis can be provided wherein the extension defines the male member and wherein the stem defines the female member. The illustrated male and female components of the subject invention would merely be reversed. Additionally, in certain embodiments the female member of the prosthesis may be free of threads, with the threaded portion being disposed on internal surfaces of the flexible segments of the male component. A wedging action between the screw and the fingers can be achieved by employing a tapered screw and a correspondingly tapered array of threads on internal surfaces of the flexible segments. In still other embodiments, the flexible fingers ma be provided with an inwardly formed groove which mates with an inwardly directed ridge on the female component of the system. These and other embodiments will be apparent to a person skilled in this art after having read this disclosure.

Summary: A modular stem type prosthesis is provided which includes a stem and an extension which are connected to one another with a slip fit interconnection that minimizes surface tensile forces in regions of the prosthesis adjacent the interface between the stem and the extension. Engagement between the stem and the extension is provided by deflectable end portions of one component of the prosthesis which are engaged in a mating deformation in the other component. The mating structures may define an interfitting ridge and groove. Micromotion between the respective parts may be prevents by a screw which may be tapered to achieve a lock fit. The extension may be of any selected length and any selected diameter in accordance with the needs of the patient.

big_patent

en

Summarize: By. Associated Press Reporter. UPDATED:. 07:09 EST, 3 April 2013. The woman who married and had a child with a notorious Rockefeller imposter has described how she was charmed by the 'intelligent' and 'quirky' con man - and said they acted out characters from Cluedo. Sandy Boss, 45, who now works in London, gave evidence yesterday in the murder trial of Christian Gerhartsreiter, who told her he was 'Clark Rockefeller', a distant scion of the famous banking dynasty, when they met in New York in 1993. Ms Boss said of Gerhartsreiter, 52, who is charged with the 1985 murder of John Sohus in California: 'I didn't have reason to think he was not the person he said he was.' 'Quirky': Christian Gerhartsreiter, left, posed as 'Clark Rockefeller' to woo Sandra Boss, seen right in court yesterday, who told jurors she found him 'intelligent', 'funny' and 'quirky' 'Heir': Gerhartsreiter, seen in court yesterday, is on trial in California, U.S. for the 1985 murder of John Sohus, who disappeared from his home in San Marino with his wife, Linda. The couple married in 1995 and had a daughter, Reigh, who the defendant was later found guilty of kidnapping in 2009 after the then seven-year-old vanished during an access visit in Boston following the pair's split. Ms Boss first met the defendant when she was invited to a cocktail party at his New York apartment while she was studying for her MBA at Harvard, the court heard. The theme was the. game 'Clue', and guests came in costume. 'I was Miss Scarlett and he was Professor Plum,' said Ms Boss, who now lives in London with the couple's 12-year-old daughter. 'I liked him. I thought he was intelligent, very funny, quirky, flattering and complimentary. A good person to get to know.' They began dating and by 1994 she had graduated, secured a finance job in New York and moved in with him. He told her he was an heir to the Rockefeller fortune but was on the outs with the rest of his relatives and never saw them. He said his parents had been killed in a car crash in 1978. 'I assumed that what he was telling me was true,' she said. 'I didn't have reason to think he was not the person he said he was.' Kidnap: 'Rockefeller' was found guilty in 2009 of kidnapping the couple's daughter Reigh Boss, then seven, who disappeared from Boston during an access visit. Ms Boss described how the defendant's charming demeanor dissipated soon after they married in 1995, as he became insistent on secrecy in all of their affairs. He handled finances but she provided the funds and signed blank cheques for him to use. She said he put charges on her credit cards and had none in his own name. He installed multiple phone lines and had their mail delivered to post office boxes. They moved frequently. Divorce: The defendant is seen with his daughter, now 12, who lives in London with her mother. He also had an aversion to certain places. He refused to visit California which he said he hated and would never set foot in Connecticut. Unknown to her, he was under investigation in both places in connection with a missing persons case. Gerhartsreiter is charged with the 1985 murder of John Sohus, who disappeared from his San Marino, California, home with his wife, Linda. The man's bones were unearthed a decade later. Linda Sohus has never been found. Ms Boss had no idea her husband was a German immigrant named Christian Gerhartsreiter who had once lived in San Marino and was under investigation in the couple's disappearance. He told her he was doing Third World debt negotiations. Their daughter was born in 2001, she said. Ms Boss left her husband in 2007 after realising he was not who he claimed to be. 'I hired private investigators who told me they couldn't tell me who I was married to," she said. Ms Boss, 45, was composed on the witness stand but never mentioned her ex-husband's name, referring to him as 'the defendant'. She now lives in London with their 12-year-old daughter. Defense attorneys deferred cross-examination of Ms Boss until Wednesday. Earlier, a key witness linked the defendant to a truck bought by the man he is charged with killing in California more than a quarter-century ago. Christopher Bishop, who became an Episcopal priest, testified that in the 1980s he met a man who called himself Christopher Crowe. Mr Bishop was a film school student and was told by his father, a priest, that there was a new young man in their Greenwich, Connecticut, community who was a filmmaker. He introduced them and they became friends. Testimony: Christopher Bishop told jurors how he met Gerhartsreiter, who was then calling himself Christopher Crowe, in Connecticut in the 1980s. Mr Bishop said Crowe talked of producing films and one day he offered to give him a truck he said had been used on a production shoot. He suggested Bishop contact California to get license plates. But when he did, he said, he was told there was a lien on the vehicle for $6,000. 'I got a bright idea to buy a cheaper model of the same truck, take the plates off and register it. I was a poor film student then,' the witness said. He said he drove the truck around with fake plates and then abandoned it at a train station. He never saw it again, and it has never been found. Mr Bishop acknowledged lying about the saga when he was first questioned by police. 'I lied,' he said. 'I said I knew nothing about a truck. I was pretty panicked... This was a person I trusted.' He added: 'It was not my finest hour.' Ex-girlfriend: Mihoko Manabe, left, testified in the trial of Christian Gerhartsreiter, right, accused of murder in California in 1985, today. She told how her fiance acted strange when police called him over the deaths. Many identities: Christian Karl Gerhartsreiter listened as his ex-fiance told the court that she knew him as Clark Rockefeller when they met in 1987. Mr Bishop said the. next time he talked to Crowe he told him a detective had been inquiring. about him, and angrily asked: 'Who the (expletive) are you?' 'He said "I gotta go", and that's the last I saw of Chris until this case,' the witness said. Other. witnesses have said victim John Sohus and his wife, Linda, bought the. truck just before they vanished in 1985. At the time they lived in a. suburban San Marino home owned by John Sohus' mother, and defendant. Gerhartsreiter - using the name Christopher Chichester - occupied a. guest cottage. Defense. attorneys claim that victim John Sohus was not killed by their client. but by his wife, who vanished at the same time he did. There has been no evidence of a motive for either Gerhartsreiter or Linda Sohus to kill John Sohus. Earlier in the. trial Gerhartsreiter's former lover Mihoko Manabe told jurors she never. knew his true identity until he was charged with murder. Manabe recalled meeting him in 1987 when they worked at a New York brokerage firm. Accused: Christian Gerhartsreiter is accused of the 1985 murder of John Sohus. Man of mystery: Manabe never knew he was Gerhartsreiter, a German immigrant charged with the murder of a California man who vanished in 1985. Ms Manabe was working as a tranlator while the defendant was head of the bonds desk. She knew him as Christopher Crowe until he began using the Rockefeller pseudonym. She didn't know until recently that he was Gerhartsreiter, a German immigrant charged with the murder of a California man who vanished in 1985. 'He was an unusual person,' she said, but after police began calling to interview him, she said he became downright odd. 'After the call, he was markedly different,' she said. Connection: The bones believed to belong to Mr Sohus were found buried at a home Garhartsreiter was living at while going by the name Chichester. Violent death: The remains believed to be of John Sohus, seen with his then-wife Linda, who is also missing, were found to have died of multiple fractures of the skull inflicted by a blunt object, possibly a baseball bat. He became paranoid. and said they had to go into hiding. She described a cloak-and-dagger. existence in which he had her dye his hair blonde, grew a beard,. exchanged his glasses for contact lenses, and made plans to leave the. country. He proposed marriage and she accepted, she said, but they neither left the country nor got married. 'The plans all fell by the wayside,' she said. Her fiance quit. his job at another major brokerage house and never worked again. She. said she supported him while he stayed home and took care of bills and. household chores. She got him a credit card in the name Clark. Rockefeller. 'Why did you stick. around that long and go along with it?' asked Deputy District Attorney. Habib Balian. 'He had asked me to marry him and I was loyal,' she said. 'Did you love him?' asked Balian. 'Yes, I did,' said the witness as her former lover sat at a courtroom table taking notes and not looking at her. 'Did you believe he loved you?' asked the prosecutor. 'Yes,' she replied. Their relationship eventually deteriorated and in 1994 she left to marry another man. Manabe appeared nervous and said she would have preferred not to testify. 'It's not a part of my life I like to talk about or remember,' she said

Summary: Sandy Boss told jurors she was charmed by 'bright, quirky' man. German immigrant Christian Gerhartsreiter told her he was a Rockefeller. Ms Boss left her husband in 2007 when she discovered his ruse. He was convicted in 2009 of kidnapping the couple's daughter, now 12. Gerhartsreiter is charged with the 1985 murder of John Sohus in California. Ms Boss now lives in London with her daughter.

cnn_dailymail

en

Write a title and summarize: Alternative splicing of mRNA precursors represents a key gene expression regulatory step and permits the generation of distinct protein products with diverse functions. In a genome-scale expression screen for inducers of the epithelial-to-mesenchymal transition (EMT), we found a striking enrichment of RNA-binding proteins. We validated that QKI and RBFOX1 were necessary and sufficient to induce an intermediate mesenchymal cell state and increased tumorigenicity. Using RNA-seq and eCLIP analysis, we found that QKI and RBFOX1 coordinately regulated the splicing and function of the actin-binding protein FLNB, which plays a causal role in the regulation of EMT. Specifically, the skipping of FLNB exon 30 induced EMT by releasing the FOXC1 transcription factor. Moreover, skipping of FLNB exon 30 is strongly associated with EMT gene signatures in basal-like breast cancer patient samples. These observations identify a specific dysregulation of splicing, which regulates tumor cell plasticity and is frequently observed in human cancer. Alternative splicing (AS) of mRNA precursors is a fundamental biological process that provides a reversible mechanism to modulate the expression of related but distinct proteins in response to internal and external stimuli (Chen and Manley, 2009). Regulation of alternative splicing occurs at several levels including the expression and the targeting of specific RNA-binding proteins (RBPs). Dysregulation of alternative splicing plays a direct role in a variety of human diseases including cancer (David and Manley, 2010). During cancer initiation and progression, the epithelial-to-mesenchymal transition (EMT) triggers the dissociation and migration of carcinoma cells from primary to distant sites (Ye and Weinberg, 2015). We previously demonstrated that the EMT is also tightly linked to a stem-like cell state in breast cancer, as overexpression of EMT transcription factors induces the expression of tumor-initiating cell markers and increases the ability of cells to form mammospheres, a property associated with mammary epithelial stem cells (Chaffer et al., 2013; Mani et al., 2008). In addition, the EMT has been implicated in several other cancer-related phenotypes, for example, in cancers that acquired resistance either to the EGFR inhibitor gefitinib or to the HER2 receptor inhibitor trastuzumab (Boulbes et al., 2015; Sequist et al., 2011). EMT also involves a dramatic reorganization of the actin cytoskeleton and concomitant formation of membrane protrusions to gain migratory and invasive properties (Yilmaz and Christofori, 2009). The dynamic change in the actin cytoskeleton, a prerequisite for cell motility and cancer cell invasion, is a highly controlled equilibrium of local assembly and disassembly of actin filaments (Yilmaz and Christofori, 2009). The filamin family proteins crosslink actin filaments and are also translocated into the nucleus to regulate the transcriptional activity of the androgen receptor and the FOXC1 transcription factor (Bedolla et al., 2009; Berry et al., 2005; Loy et al., 2003; Zhou et al., 2010). The three members of this family (FLNA, FLNB and FLNC) are involved in both development and normal tissue homeostasis through regulating diverse processes including cell locomotion and integrin signaling (Zhou et al., 2010), and mutations in the FLNB gene cause a broad range of skeletal dysplasias (Daniel et al., 2012). Alternative splicing has been previously associated with EMT. Mesenchymal cancer cells show distinct alternative splicing patterns in comparison with their epithelial counterparts (Braeutigam et al., 2014; Shapiro et al., 2011; Venables et al., 2013). While ESRP1 and ESRP2 are epithelial state-inducing RBPs that govern splicing patterns for the epithelial cell state (Shapiro et al., 2011; Warzecha et al., 2010; Warzecha et al., 2009; Yang et al., 2016), less is known about the identity and functional significance of RBPs that can promote the mesenchymal cell state. QKI and RBFOX2 have been shown to be responsible for alternative splicing events that occur during EMT, such as exon skipping in KIF13A and CTTN (Braeutigam et al., 2014; Venables et al., 2013; Yang et al., 2016) and in circular RNA formation (Conn et al., 2015). Nevertheless, it remains unclear whether the upregulation of any specific RBPs is sufficient or required for the induction of mesenchymal state transitions or is merely one of many downstream manifestations of the EMT. Furthermore, although many splicing changes occur during EMT, only a small number of specific splicing events are known to functionally contribute to EMT including changes in the splicing of CD44, FGFR2 and Exo70 (Brown et al., 2011; Lu et al., 2013; Warzecha et al., 2009). Here, we have undertaken a comprehensive approach to identify genes that regulate the EMT in breast cancer and found that genes whose protein products participate in AS regulate the transition to mesenchymal- and stem-like cell states. In prior work, we described a genetically defined, experimental model of breast cancer, derived from introducing vectors expressing the telomerase catalytic subunit, the SV40 large-T and small-t antigens, and an H-Ras oncoprotein into human mammary epithelial cells (HMLER cells) (Elenbaas et al., 2001). Subsequent work demonstrated that the CD44 cell surface antigen is a surrogate marker for the EMT cell state change in this model (Chaffer et al., 2011; Chaffer et al., 2013). Thus, we separated the CD44-high and -low populations of HMLER cells by fluorescence-activated cell sorting (FACS) and confirmed that the CD44-low cells displayed epithelial properties, as measured by levels of EMT marker expression (Figure 1—figure supplement 1A). The highly purified CD44-low cell population remained in the epithelial cell state for at least 4 weeks in the experimental conditions. In contrast, the CD44-high HMLER cells showed elevated expression of mesenchymal markers and a greater propensity to form mammospheres, an in vitro surrogate assay for the stemness of mammary epithelial cells (Figure 1—figure supplement 1B, C). To study inducers of the EMT and stem-like cell state, we performed a genome scale open-reading frame (ORF) screen to identify genes that convert the HMLER cells from the CD44-low state to the CD44-high state. Each ORF in the human ORFeome library collection 8. 1 (Yang et al., 2011) was tagged with a unique 24-nucleotide barcode and introduced into FACS purified CD44-low HMLER cells by lentiviral-mediated gene transfer. Following 7 days in culture, we purified the newly arising CD44-high HMLER cells by FACS and identified ORFs enriched in these cells by massively parallel sequencing (Figure 1A). We found that the consistency between the biological replicates of the screen was high (Figure 1—figure supplement 2A). SNAI1, a well-characterized EMT-inducing transcription factor (EMT-TF) (Nieto et al., 2016), scored as the top hit in the screen, as did BCL6, JMJD6 and FOS, which have previously been shown to play key roles in regulating EMT (Aprelikova et al., 2016; Eger et al., 2000; Yu et al., 2015) (Figure 1B, Figure 1—figure supplement 2B and Figure 1—source data 1); these findings indicated that this screen was robust. We used a cut-off of three standard deviations (S. D.) above the mean and analyzed the top-scoring candidates to identify protein complexes or pathways enriched for regulators of EMT. Sixty-eight ORFs met this criterion (Figure 1B and Figure 1—figure supplement 2B), including transcription factors, RNA splicing factors, kinases and phosphatases, epigenetic regulators, and genes involved in the regulation of spermatogenesis, apoptosis and the metabolic processing of cellular amides (Figure 1C). Other EMT transcription factors did not meet the 3 S. D. cutoff possibly due to mutations in the ORF constructs or low ORF representation in the library. Using the GeNets analysis tool (apps. broadinstitute. org/genets), we found three gene networks centered around QKI (Quaking, an RNA-binding protein), SRPK2 (a kinase involved in RNA splicing) and PPP1CC (a phosphatase) (Figure 1D). When we used the top candidates to interrogate gene ontology, we found that the ‘regulation of mRNA metabolic process’ and ‘regulation of mRNA splicing, via spliceosome’ scored as the top terms (Figure 1E) and that ‘RNA metabolic process’ was one of the top gene sets enriched by gene set enrichment analysis (GSEA) (Figure 1F) (Reich et al., 2006). Of note, ‘Regulation of mRNA metabolic process’ is a parent GO term for RNA processing and RNA splicing. Several RNA-binding proteins have been previously associated with EMT. For example, ESRP1 and 2 promote an epithelial phenotype, while QKI and RBFOX2 (a homolog of RBFOX1 that scored in the screen) regulate a number of EMT-associated splicing events (Braeutigam et al., 2014; Venables et al., 2013; Yang et al., 2016). Of note, although RBFOX2 has been shown to play a role in EMT (Braeutigam et al., 2014; Venables et al., 2013), the RBFOX2 clone present in the ORFeome collection 8. 1 library harbors three mutations (a 396–449 deletion, a 752–763 deletion and a C to T substitution at 1007), which likely explained why this ORF did not score in the screen. However, whether the expression of any RBPs is functionally sufficient or required to induce a mesenchymal cell state remains unclear. Since we found a striking enrichment of RBPs in this screen, we focused on the top candidates implicated in pre-mRNA splicing to understand their possible role in regulating the EMT and stem-like cell states in breast cancer pathogenesis. In the ORF expression screen, we identified eight candidate RBPs (QKI, RBFOX1, MBNL1, MBNL2, CELF4, SFPQ, SRSF9 and HNRNPUL1) that scored when tested individually. We systematically tested these genes in five assays to examine EMT-associated phenotypes or marker expression to find the RBPs that meet the following criteria: (1) Expression of the RBP promotes an increase in the CD44-high population (Figure 2—figure supplement 1A); (2) Expression of the RBP upregulates the expression of a panel of mesenchymal markers examined by both quantitative PCR (Figure 2A and Figure 2—figure supplement 1B) and immunoblotting (Figure 2B); (3) Expression of the RBP induces mammosphere formation when cells are grown in suspension, a characteristic of the stem-like and mesenchymal cell properties (Figure 2C and Figure 2—figure supplement 1C) (Chaffer et al., 2013; Mani et al., 2008); (4) Endogenous expression of the RBP is upregulated upon overexpression of an EMT-inducing transcription factor, SNAI1 or ZEB1 (Figure 2—figure supplement 2A–D); (5) Expression of the RBP promotes tumor formation in vivo, a feature associated with stem-like cells (Figure 2D andFigure 2—figure supplement 2; Figure 2—figure supplement 2E) (Chaffer et al., 2013; Mani et al., 2008). Together, we discovered that the expression of QKI (NCBI Reference: NM_006775. 2, also known as QKI-5) and RBFOX1 (NCBI Reference: NM_145893. 2, also known as RBFOX1 beta) strongly induced the mesenchymal and stem-like phenotypes in all the experiments tested, while MBNL1, MBNL2 and CELF4 scored in some assays. We also found that SRSF9, SFPQ and HNRNPUL1 are unlikely to initiate a mesenchymal and stem-like cell state (Figure 2J). The CD44-high cells induced by QKI, RBFOX1 or SNAI1 shared a similar elongated and spindle shape cell morphology (Figure 2—figure supplement 3A). In addition, QKI and RBFOX1 overexpression also significantly increased the CD44-high cell populations in two additional breast cancer cell lines (MCF7 and ZR75-1) (Figure 2—figure supplement 3B). We thus proceeded to focus on the role of QKI and RBFOX1 in EMT. Of note, overexpression of QKI and RBFOX1 reduced cell proliferation by 40% to 45% as would be expected if the cells undergo an EMT (Figure 2—figure supplement 3C) (Tsai et al., 2012; Vega et al., 2004). In addition, the expression of QKI, RBFOX1 and other RBPs failed to decrease the expression of epithelial markers (Figure 2A, B and Figure 2—figure supplement 1B), suggesting that the cell state triggered by expression of the RBPs involves elevated expression of mesenchymal markers with retention of pre-existing epithelial marker expression. This spectrum of marker expression is reminiscent of an intermediate EMT state that is implicated in development and tumor progression (Bierie et al., 2017; George et al., 2017; Nieto et al., 2016; Schmidt et al., 2015). To determine whether expression of QKI or RBFOX1 was also required for the induction of an EMT program, we silenced endogenous QKI or RBFOX1 by short hairpin RNA (shRNA) -mediated suppression and by CRISPR/Cas9-mediated knockout. First, we expressed the SNAI1 EMT-TF to induce EMT and then depleted QKI, RBFOX1 or other candidate RBPs with shRNAs (shSNAI1 as a positive control) (Figure 2E and Figure 2—figure supplement 3D). shRNA-mediated suppression of QKI and RBFOX1 led to a significant reduction in the CD44-high cell population (Figure 2E), suggesting that the expression of QKI and RBFOX1 was partially required for the induction of the CD44-high cell population after SNAI1 overexpression. To eliminate the potential off-target effects of the shRNAs, we used CRISPR/Cas9 to target the QKI and RBFOX1 genes and found that the ablation of QKI and RBFOX1 also significantly suppressed the induction of CD44-high cells (Figure 2F), the expression of mesenchymal markers (Figure 2G, H) and the formation of mammospheres (Figure 2I) after SNAI1 overexpression. Thus, these loss-of-function studies revealed that QKI and RBFOX1 are partially required for induction of the EMT. We next examined whether the expression of QKI and RBFOX1 also correlated with mesenchymal features in murine or human tumor samples. We discovered that the expression of QKI was highly upregulated in mesenchymal breast tumor patient samples available from the Cancer Genome Atlas (TCGA) (Ciriello et al., 2015) (Charafe-Jauffret et al., 2006) (Figure 2—figure supplement 4A and the Materials and methods section for data analysis). The lack of a significant change in expression of RBFOX1 suggested that QKI instead may play a major role in driving the alternative splicing patterns in these samples. In addition, both Qk and Rbfox1 are highly associated with the activation of an EMT program in a murine mammary tumor model (Figure 2—figure supplement 4B–D and the Materials and methods section) (Goel et al., 2016). Collectively, although QKI has been previously associated with AS changes occurring during EMT, our observations demonstrate that overexpression of QKI or RBFOX1 suffices to promote an intermediate mesenchymal and stem-like cell state and are also necessary for the SNAI1-induced EMT. Further, the expression of endogenous QKI and RBFOX1 were also induced by EMT-TFs such as SNAI1 or ZEB1 (Figure 2J). These results extend prior observations implicating these RNA binding proteins in EMT and confirm that our screen identified key regulators of EMT. Although QKI and RBFOX2 (a homolog of RBFOX1) have been shown to regulate AS events during EMT (Braeutigam et al., 2014; Venables et al., 2013; Yang et al., 2016), it remains unclear whether QKI and RBFOX1 alter splicing of genes directly involved in EMT or if the expression of these RNA binding proteins merely correlate with the mesenchymal cell state. To dissect the mechanism by which QKI and RBFOX1 induce the intermediate mesenchymal and stem-like cell states, we overexpressed each of these or a control protein (hcRED or EGFP) in HME cells and used RNA-sequencing to assess changes in transcriptional programs. We subsequently used replicate multivariate analysis of transcript splicing (rMATS) to individually quantify and analyze differences in AS events in HME cells expressing either the hcRED or EGFP control proteins versus QKI, RBFOX1 or SNAI1 (Shen et al., 2014). Indeed, HME cells that expressed QKI or RBFOX1 exhibited a > 5 fold increase in the number of alternatively spliced events compared to control cells that expressed hcRED (Figure 3—figure supplement 1A and Figure 3—source datas 1 and 2). Among all detected types of splicing events, the majority of splicing changes after overexpression of QKI or RBFOX1 occurred in skipped exons (Figure 3A). We next used pre-ranked GSEA to analyze the pathways that are regulated by QKI or RBFOX1 and found that their downstream splicing targets were enriched in gene modules involved in cell motility/cytoskeleton organization, stem cell fate determination, oncogenic signaling and epigenetic targets (Figure 3—figure supplement 1B, C). We then individually validated the top alternatively spliced genes regulated by both QKI and RBFOX1 with the hypothesis that shared targets were more likely to be involved in EMT. We focused on the genes with alternatively skipped exons, as it is the most prevalent type of AS in higher eukaryotes (Keren et al., 2010). We confirmed that, consistent with the RNA-seq results, pre-mRNAs of specific exons in the genes involved in cell motility/cytoskeleton organization, FLNB, SLK, NUMB, CA12, ESYT2 and ATP5C1 showed substantially greater skipping in cells expressing QKI and RBFOX1, as compared to control cells expressing hcRED or EGFP (Figure 3B). Interestingly, the same AS pattern for these genes was also observed in mesenchymal HME cells overexpressing SNAI1, indicating that the AS events observed in SNAI1-expressing cells are likely to be due to the activity of QKI and RBFOX1. From our RNA-sequencing analysis, we found that many AS events, and in particular, skipped exons, were regulated by both QKI and RBFOX1 (Figure 4A, Figure 4—figure supplement 1A and Figure 4—source data 1). To identify direct targets of QKI and RBFOX1, we performed enhanced UV crosslinking and immunoprecipitation followed by sequencing (eCLIP-seq) in HME cells (Figure 4—figure supplement 1B) (Van Nostrand et al., 2016). QKI-binding sites were located predominantly in introns, while the majority of RBFOX1-binding sites were found both in introns and 3’UTRs, and consistent with prior studies. We also recovered the known QKI (ACUAAC) and RBFOX1 (UGCAUG) binding motifs (Figure 4B, C). Interestingly, we found that QKI-binding sites were also highly enriched for the RBFOX-binding motif, UGCAUG (Figure 4B, C) and overall, there was a substantial degree of overlap between QKI and RBFOX1 eCLIP-binding peaks (p<0. 001, Figure 4D and Figure 4—source data 2). When examining the 183 exon skipping events that we found to be regulated by both QKI and RBFOX1, we detected binding sites for both QKI and RBFOX1 for 36 events, with peaks overlapping the exon itself or positioned in the flanking introns (Figure 4E). Since the QKI and RBFOX1 proteins have previously been shown to physically associate with one another (Lim et al., 2006), we then tested whether these two proteins were also interacting in HME cells. When we isolated endogenous QKI complexes by immunoprecipitation, we detected a robust interaction with RBFOX1 protein that did not require the presence of RNA (Figure 4—figure supplement 1C). Thus, these observations demonstrate that QKI and RBFOX1 interact in human mammary epithelial cells and suggest that they concurrently bind to and regulate the AS of common downstream targets. To identify transcripts whose AS is likely to play a functional role in promoting EMT, we assessed which QKI and RBFOX1-regulated AS events were also associated with an EMT gene signature across a panel of breast cancer cell lines from the Cancer Cell Line Encyclopedia (CCLE) (Barretina et al., 2012). We examined the AS events in breast cancer cell lines that were ranked by their EMT gene signature score (Byers et al., 2013), using the Information Coefficient (IC), an information-theoretic measure (Kim et al., 2016), and an empirical permutation test for statistical significance of the top hits (Barretina et al., 2012). Among all the common targets of QKI and RBFOX1, we found that CD44 (IC: 0. 857, p value: <6. 59e-07) and FLNB (IC: 0. 848, p value: <6. 59e-07) scored as the top two genes that most strongly associated with the EMT signature in breast cancer cell lines (Figure 4F). CD44 and FLNB were also among the top genes regulated by both QKI and RBFOX1 in HME cells (Figure 4G). Prior work has demonstrated that AS of CD44 to produce the standard shorter isoform promoting EMT, and that CD44 splicing is not only a marker of the EMT state but also contributes to EMT (Brown et al., 2011). However, the functional importance of FLNB in EMT has not yet been characterized. Exon 30 of FLNB is skipped when QKI and RBFOX1 are overexpressed (Figure 3B), and we found that both QKI and RBFOX1 were strongly bound to the intron flanking this exon (Figure 4H, QKI peak p value = 2. 2e-16; RBFOX1 peaks p value = 3. 0e-7 and 1. 8e-9). Although RBFOX1-binding downstream of an exon typically results in splicing enhancement (Conboy, 2017), we found that binding of RBFOX1 downstream of FLNB exon 30 instead results in splicing repression. Together these observations support the view that QKI and RBFOX1 coordinately regulate the AS of genes associated with EMT. Based on gene expression analysis, prior studies stratified breast cancer cell lines into basal B, basal A and luminal clusters, among which, the basal B subtype expresses mesenchymal markers and displays a high degree of stem-like cell features (Kao et al., 2009; Neve et al., 2006). To identify the alternative transcripts that correlated with the basal B subtype of breast cancer, we analyzed alternatively spliced events in breast cancer cell lines included in the CCLE (Barretina et al., 2012). We found several targets of QKI and RBFOX1, including FLNB, SLK, USO1, ENAH, ESYT2, NUMB and ARHGEF1, to be among the most differentially spliced genes in basal B breast cancer cell lines (Figure 5—figure supplement 1A). Strikingly, we observed a bimodal distribution for the AS of FLNB (Figure 5A), in which the shorter mesenchymal FLNB isoform corresponding to a lower exon 30' Percent Spliced In' (PSI) value, occurred overwhelmingly in basal B cell lines, while the longer epithelial FLNB isoform existed predominantly in luminal and basal A cell lines. We validated this finding in two basal B (BT549 and MDAMB231) and two luminal (ZR75-1 and MCF7) cell lines by RT-PCR (Figure 5A). We further found that there is a strong association between the AS of FLNB exon 30 and EMT gene expression features in breast cancer cell lines (Figure 5—figure supplement 1B). When we examined all non-hematopoietic cancer cell lines in the CCLE, we found that the degree of FLNB exon 30 splicing correlated significantly with a ZEB1 target signature, an epithelial differentiation signature, two metastasis signatures and a mammary stem cell signature (Figure 5B and Figure 5—figure supplement 1C). These observations further confirmed that the AS of FLNB exon 30 strongly associates with EMT and a stem-like cell state. In addition, the strong association between FLNB splicing and EMT features suggest that FLNB exon 30 splicing may serve as a biomarker for residence of cancer cells in a mesenchymal state. Since mesenchymal and stem-like cell features are enriched in basal-like breast cancer, we examined whether the splicing of FLNB and the expression of QKI or RBFOX1 were associated with the basal-like subtype in TCGA Breast Invasive Carcinoma (BRCA) samples. We observed lower expression of the longer FLNB isoform with exon 30 included and higher expression of the shorter FLNB isoform in samples classified as the basal subtype, consistent with the notion that FLNB splicing plays a role in regulating the mesenchymal and stem-like cell state (Figure 5—figure supplement 1D). Similarly, we discovered elevated expression of QKI (NM_006775, also called QKI-5) in basal-like breast cancers relative to other subtypes of breast cancers (Figure 5—figure supplement 1E). FLNB is a member of the Filamin family of actin-binding proteins (FLNA, B and C). Prior work has implicated the role of filamins in actin crosslinking, focal adhesion kinase and integrin signaling, and regulating transcriptional activity (Feng and Walsh, 2004; van der Flier et al., 2002; Xu et al., 2010; Zhou et al., 2010). Filamins share an N-terminal actin-binding domain, two hinge regions, and 24 filamin-type immunoglobulin-like (FLN) domains that are involved in the formation of tail-to-tail dimers (Feng and Walsh, 2004; van der Flier et al., 2002). Exon 30 of FLNB encodes the first hinge (H1) domain, which governs filamin protein flexibility and calpain cleavage sensitivity (Figure 6A) (Feng and Walsh, 2004; Xu et al., 2010). The skipping of exon 30 results in loss of the H1 domain from the full-length protein without altering the remainder of the protein. Hereafter, we refer to the longer isoform of FLNB (including exon 30) as FLNB-L, and to the shorter isoform (which lacks exon 30) as FLNB-ΔH1. When we tested whether the splicing of FLNB differed between the CD44-high and CD44-low cell populations (Figure 6B), we found that FLNB exon 30 skipping occurred exclusively in the CD44-high mesenchymal and stem-like cell population. To investigate the function of FLNB in regulating EMT, we suppressed FLNB expression using siRNAs targeting the FLNB 3’UTR region in HMLE cells, in which the FLNB-L isoform represents the majority of FLNB protein. We found that suppression of FLNB-L upregulated the expression of mesenchymal markers, VIM and FN1, indicating that FLNB-L plays a negative role in regulating EMT (Figure 6C). To dissect the respective role of FLNB-L and FLNB-ΔH1 isoforms, we rescued the suppression of endogenous FLNB by ectopically expressing each isoform of FLNB (Figure 6D). Depletion of FLNB promoted the expression of mesenchymal markers. We found that FLNB-L reduced the expression of mesenchymal markers, FN1 and VIM. In contrast, the expression of FLNB-ΔH1 did not decrease the mesenchymal marker expression. When the two isoforms of FLNB were expressed in a mesenchymal cell line, MDA-MB-231, we also found that FLNB-L overexpression suppressed mesenchymal marker expression, strongly suggesting that FLNB-L inhibits the EMT (Figure 6—figure supplement 1A). Interestingly, when we expressed each isoform in HMLE cells in the presence of the endogenous FLNB-L, FLNB-ΔH1 ectopic expression elevated mesenchymal markers while the expression of FLNB-L did not significantly alter expression of the same set of markers (Figure 6—figure supplement 1B, C). Since filamin proteins dimerize (Berry et al., 2005; Pudas et al., 2005; Stossel et al., 2001), the effects of FLNB-ΔH1 proteins likely represent interactions with the endogenous FLNB-L, which blocks the suppressive effect mediated by FLNB-L. As before, we did not observe robust changes in the expression of pre-existing epithelial markers in these experiments, reminiscent of our previous observation that QKI or RBFOX1 induces an intermediate mesenchymal state with retention of epithelial markers and acquisition of mesenchymal ones (Figure 2A, B and Figure 2—figure supplement 1B). Together, these results support the view that the skipping of the exon 30 of FLNB switches the function of the FLNB from suppressing to promoting the EMT. To manipulate the ratio of the two FLNB isoforms and dissect the function of the FLNB exon 30 skipping, we modified the genomic locus of the intron-exon junction using CRISPR/Cas9-mediated genome editing to skew the isoform ratio of the endogenous FLNB transcripts. We designed several sgRNAs that target the junction of intron 29 and exon 30 (sgFLNB-SK2 and SK4). Remarkably, we found that disrupting this junction in the genomic locus was effective in causing skipping of the endogenous exon 30 of FLNB (Figure 6E, F). In line with our previous observations, FLNB exon 30 skipping induced by this approach also increased the expression of mesenchymal markers (Figure 6G). We also discovered that FLNB exon 30 skipping induced a modest but significant increase in the CD44-high cell population and in the number of mammospheres under low attachment growth conditions (Figure 6H, I). In addition, we used two sets of siRNAs that targeted either exon 30, or the junction between exon 29 and exon 31 when exon 30 is skipped. The siRNAs that target the exon 29–31 junction selectively disrupt formation of the FLNB-ΔH1 isoform, since the FLNB-L isoform lacks the siRNA target sequences. This approach effectively altered the ratio of FLNB-L and FLNB-ΔH1 (Figure 6—figure supplement 1D, E) and revealed that an elevated ratio of the FLNB-ΔH1 isoform over the FLNB-L isoform and a reduction of FLNB protein levels significantly increased the level of mesenchymal markers, consistent with the effect of ectopically expressing FLNB-ΔH1 or CRISPR/Cas9-mediated editing of the splice junction (Figure 6C–I). Together, these observations demonstrate that the skipping of FLNB exon 30 contributes to the acquisition of a mesenchymal-like cell state. In addition to their function in the cytoplasm, actin-binding proteins, such as the Filamin family, have been shown to localize to the nucleus and regulate transcription and gene expression (Bedolla et al., 2009; Berry et al., 2005; Olson and Nordheim, 2010; Zheng et al., 2009; Zhou et al., 2010). We tested whether the two isoforms of FLNB generated by alternative splicing of exon 30 localized to different subcellular compartments. By comparing HMLE cells expressing a control sgRNA targeting GFP (sgGFP) or sgRNAs that induce exon 30 skipping (sgFLNB-SK2 and SK4) (Figure 6E), we found that the FLNB-L isoform localized to both the cytoplasm and the nucleus while FLNB-ΔH1 was preferentially localized to the cytoplasm (50% reduction in nuclear localization, Figure 7A). We confirmed this change of FLNB localization using immunofluorescence (Figure 7—figure supplement 1A). Thus, alternative splicing of exon 30 changes the nuclear localization of FLNB. Filamin A has been reported to assemble a protein complex with FOXC1 and PBX1, which inhibits FOXC1 transcriptional activity (Berry et al., 2005; Zheng et al., 2009; Zhou et al., 2010). To test whether Filamin B also forms a complex with FOXC1 in HMLE cells, we confirmed that FLNB interacts with FOXC1 by co-immunoprecipitation (Figure 7—figure supplement 1B). Furthermore, we found that the interaction among FLNB, FOXC1 and PBX1 was reduced when we induced FLNB exon 30 skipping, largely due to the decreased amount of nuclear FLNB protein (Figure 7B). Based on these observations, we conclude that FLNB nuclear exclusion, mediated by exon 30 skipping, regulates its interaction with FOXC1. FOXC1 is a transcription factor that induces EMT (Han et al., 2017; Huang et al., 2017; Ou-Yang et al., 2015; Zhu et al., 2017). Since the nuclear filamins inhibit FOXC1 activity (Berry et al., 2005; Zheng et al., 2009; Zhou et al., 2010), we hypothesized that the reduced nuclear localization of FLNB promotes EMT by releasing FOXC1 from FLNB. Specifically, we tested whether the EMT induced by FLNB isoform switching was dependent on FOXC1. Indeed, we found that FOXC1 depletion by siRNA significantly dampened the upregulation of mesenchymal marker expression (Figure 7C) and the formation of mammospheres (Figure 7D) mediated by FLNB exon 30 skipping. Furthermore, we found that FOXC1 is also partially required for the upregulation of mesenchymal marker expression (Figure 7E) and increase in mammosphere formation (Figure 7F, Figure 7—figure supplement 1C) induced by QKI and RBFOX1 expression, which regulate the alternative splicing of FLNB exon 30. In summary, the skipping of FLNB exon 30 promotes EMT by reducing FLNB nuclear localization and release of the FOXC1 transcription factor. Splicing is a key step in the regulation of almost all human transcripts. The recent genomic characterization of cancers has revealed recurrent somatic mutations and copy number alterations in RNA splicing factors and RBPs in a significant subset of human tumors (Dvinge et al., 2016). Cancer cells harboring aberrant splicing factor expression or mutations in genes encoding splicing factors display unique cancer-specific mis-splicing that may facilitate tumor formation and progression. Although alternative splicing has been associated with EMT previously, in-depth studies are needed to better understand the mesenchymal cell state-specific RBPs and their functional downstream targets. Here, we found that QKI and RBFOX1 regulate the splicing of an exon in the actin-binding protein FLNB to regulate the EMT in breast cancer. This finding suggests that the AS of a single exon may serve as a highly quantifiable surrogate molecular biomarker for the process of EMT in solid tumors. Recent work has shown that cells often progress through a spectrum of intermediate states between the fully epithelial and fully mesenchymal cell phenotypes (George et al., 2017; Nieto et al., 2016). We found that the mesenchymal cell state mediated by the expression of QKI and RBFOX1 exhibited upregulation of mesenchymal markers with continued retention of certain epithelial markers, indicating that this cell state is one that lies in-between the fully epithelial and fully mesenchymal poles of this spectrum. Consistent with prior studies (Nieto et al., 2016; Schmidt et al., 2015), our results suggest that the intermediate/partial mesenchymal cell state displays a high degree of stem cell features and fosters tumor formation in vivo. The control of AS by RNA-binding proteins is highly context dependent (Fu and Ares, 2014) and tissue specific (Yeo et al., 2004). QKI has been shown to be a tumor suppressor in brain tumors (Chen et al., 2012), colon cancers (Taube et al., 2010) and prostate cancers (Zhao et al., 2014). In contrast, QKI has also been reported to promote tumor formation in both esophageal carcinoma (He et al., 2016) and glioblastoma (Wang et al., 2013; Xi et al., 2017). Here, we found that QKI promoted tumor formation in human mammary epithelial cells. These distinct observations may be due to the differences in the initial cell states in which the cancer cells may reside. The RBFOX1 ORF that we isolated from the screen encodes an isoform (NM_145893. 2) that has been previously shown to partially localized to the cytoplasm in neuronal cells (Lee et al., 2009). In breast cells, we observed that 38% of this RBFOX1 isoform (NM_145893. 2) localize in the nucleus to regulate pre-mRNA splicing (Figure 7—figure supplement 1D). Further studies will be needed to determine whether the cytoplasmic fraction of RBFOX1 also plays an additional role in regulating EMT. Interestingly, the overexpression of EMT-related TFs such as SNAl1 and ZEB1 induced the QKI- and RBFOX1-mediated splicing program. Moreover, overexpression of the QKI and RBFOX1 splicing factors themselves promoted a mesenchymal cell state in which SNAI1 and ZEB1 expression were also elevated. These observations indicate that transcriptional and post-transcriptional regulation of EMT complement and regulate one another, suggesting how EMT can be dynamically controlled. Filamins bind to proteins with diverse functions and important roles in multiple cellular process such as the regulation of cell signaling, transcription and organ development (Zhou et al., 2010). In this study, we demonstrated that the skipping of exon 30 in FLNB, which encodes a hinge region (H1), not only serves as a marker for mesenchymal cells but also promotes EMT by releasing the FOXC1 transcription factor from an inhibitory complex. These observations provide a mechanistic explanation of how mesenchymal-specific splicing factors such as QKI and RBFOX1 induce EMT. Collectively, we conclude that QKI and RBFOX proteins play important roles in establishing the mesenchymal and stem-like cell state in breast cancers, which is in part mediated through their mutual regulation of the skipping of FLNB exon 30. Alternative splicing of pre-mRNAs represents a mechanism for flexibly regulating gene expression by enabling the generation of protein isoforms with distinct or even opposing functions without altering rates of transcription. As such, it offers yet another level of epigenetic control of gene expression. Accordingly, it may provide another means of regulation that tumor cells exploit in order to produce proteins that favor cell survival and cell state changes, such as the EMT programs studied here. The human mammary epithelial (HME) cell line, and its derived cell lines HMLE and HMLER, were grown in Mammary Epithelial Cell Growth Medium (MEGM, Lonza, #CC-3150). MCF7, BT549, MDAMB231, ZR75-1 cells were grown in Dulbecco’s minimum essential medium (DMEM) or Roswell Park Memorial Institute (RPMI) medium containing 10% fetal bovine serum and 1% antibiotics, while 293 T cells were grown in DMEM supplemented with 10% fetal bovine serum and 1% antibiotics. All cell lines were obtained from the Cancer Cell Line Encyclopedia directly from original sources and had their identity confirmed by SNP fingerprinting (Barretina et al., 2012). All cells were tested for mycoplasma periodically. The ORFs of EGFP, HcRed, CELF4, MBNL1, MBNL2, QKI, RBFOX1, SFPQ, HNRNPUL1, SRSF9, RBM47, TGFBR2 and SNAI1 were obtained from the Genetic Perturbation Platform at the Broad Institute. Plasmids containing the two isoforms of FLNB (FLNB-L and FLNB-∆H1) were generous gifts from Dr. Arnoud Sonnenberg at the Netherlands Cancer Institute. The ORFeome 8. 1 library was produced in the Genetic Perturbation Platform at the Broad Institute. There are the 17,255 ORF clones in the library, among which, 12952 ORF clones have at least 99% nucleotide and protein match (75. 1%). Of those genes 7547 ORF clones are 100% protein matches (43. 7%) and 6040 are 100% nucleotide matches (35. 0%). The construction of the ORF library has been described previously (Yang et al., 2011). All protocols with use of animals were approved by DFCI’s Institutional Animal Care and Use Committee (IACUC). For tumor studies, HMLER cells expressing different ORFs were washed and suspended in 50% Matrigel/PBS mix (Corning Matrigel Basement Membrane Matrix, #354234), then injected subcutaneously in both flanks and in the back of 6-week-old female immunocompromised NCr-nude mice (Taconic, NCRNU-F, CrTac: NCr-Foxn1nu). Two million cells were injected per site. Mice were sacrificed after 15 weeks or when tumors reached a diameter of 2 cm. Cells were trypsinized, suspended in phosphate-buffered saline (PBS) with CD44-PE-Cy7 antibody (Affymetrix # 25-0441-81; 1: 500 dilution), and stained for 20 min at room temperature; cells were mixed at 5 min intervals, and then washed with PBS to remove excess antibodies. Immediately after, cells were sorted on a BD FACSAria SORP or analyzed on a BD Fortessa, using BD FACSDiva Software (BD Biosciences, USA). Mammosphere cultures were generated as described (Chaffer et al., 2013). Briefly, 1000 cells were seeded per well in a 96-well Corning Ultra-Low attachment plate, in replicates of 6 (Corning, USA; CLS3474). Cells were grown in a serum-free mammary epithelial cell growth medium, supplemented with B27 (Invitrogen), 10 ng/mL EGF, 20 ng/mL bFGF (BD Biosciences) and 1% methycellulose. Bovine pituitary extract was excluded. Spheroid numbers were counted between days 8 and 12 microscopically. The genome-scale screen was performed in two biological replicates. HMLER cells in the CD44-low state were pre-sorted using flow cytometry. The purity of CD44-low cells was >99. 99% for each experiment. HMLER_CD44-low cells were then transduced with the ORF library and cultured for 7 days, with one passage on Day 4. On Day 7, CD44-high cells were sorted from more than 200 million transduced HMLER cells, using flow cytometry for each biological replicate. Sorted CD44-high cells (about 200 thousand cells for each replicate) and their corresponding unsorted HMLER cells were subjected to genomic DNA extraction using the QIAamp DNA Mini Kit (Qiagen # 51304). The barcodes corresponding to each ORF were amplified using PCR, and analyzed by next-generation sequencing. Enriched barcodes were analyzed as follows: (i) Each sample was normalized to a total of 1 million barcode reads. (ii) The number of each barcode after normalization was calculated to its log base two value. The log value of each barcode in the unsorted group was subtracted from the CD44-high group to obtain the log fold-change in the value of each barcode. (iii) The averages and standard deviations (SD) of the log fold-change values in all samples were determined, and Z scores for each barcode were calculated as follows: Z Barcode X= (Log value Barcode X - average) /SD. The Z score was used to evaluate the enrichment of a certain ORF in the CD44-high population, compared with the unsorted population. A higher Z score indicated an enhanced capability for an ORF to promote the conversion of HMLER cells to the CD44-high state. To prepare libraries for RNA sequencing of HME cells that overexpress HcRed, EGFP, QKI, RBFOX1 or SNAI1, we first extracted total RNA using the RNeasy Mini Kit (QIAGEN). Next, 1. 5 ug of total RNA was used to generate first strand cDNA using Oligo (dT) 12–19 primers (Invitrogen) and AffinityScript Multi-Temp Reverse Transcriptase (Agilent). Second strand cDNA was synthesized using the NEBNext mRNA Second Strand Synthesis Module (NEB) and washed with AMPure XP beads (Beckman Coulter). Finally, libraries were generated from cDNA using the Nextera XT DNA Sample Preparation Kit (Illumina) and Nextera XT Indexes (Illumina). Libraries were pooled and sequenced on the Illumina NextSeq 500 sequencer (paired-end, 150 bp). Image analysis and base calling were done using the standard Illumina pipeline, and then demultiplexed into FASTQ files. Reads were first trimmed using Trimmomatic (version 0. 33) to remove Nextera adapter sequences down to a uniform length of 100nt (for compatibility with downstream splicing analysis software). Trimmed reads were then aligned to the human genome (hg19/GRCh37) using STAR (version 2. 5. 2b) (Dobin et al., 2013) and Gencode V19 gene annotations. Alternative splicing was quantified using rMATS (version 3. 2. 5) (Shen et al., 2014) by comparing each ORF to EGFP, with at least two to three replicates per group. The output from rMATS was further filtered to include only events for which the sum of inclusion counts (IC) and skipping counts (SC) was greater or equal to 10 for both sets of samples. Alternative splicing quantification across cell lines in CCLE and TCGA breast invasive carcinoma was performed using JuncBASE v. 0. 8 with default parameters after initial sequence alignment using TopHat v1. To incorporate potentially novel exons, Cufflinks de novo transcript annotations were included from the CCLE data only. Total RNA was isolated using the RNeasy Mini kit (Qiagen, 74104) according to the manufacturer’s protocol. A cDNA sample, prepared from 1 μg total RNA, was used for quantitative reverse transcription polymerase chain reaction (RT-PCR) performed with the High Capacity cDNA Reverse Transcription Kit (Life Technologies, 4368814) or iScript Reverse Transcription Supermix (BIO-RAD, 1708840). Quantitative PCR (qPCR) was done with the Power SYBR Green Master Mix (Life Technologies; 4368708); data were collected and analyzed on a Bio-Rad Real-Time PCR Detection System or a Roche LightCycler 480 qPCR instrument. Thermal-cycling parameters for the PCR were as follows: 95°C for 10 min, followed by 45 cycles each of 95°C for 20 s, 60°C for 60 s. The relative quantity of mRNA was normalized against the relative quantity of RPLP0 or GAPDH mRNA in the same sample. Primer sequences in a 5′ to 3′ orientation are shown in Supplementary file 1. EMT UP and DOWN signatures were derived from previously published datasets based on their pattern of expression relative to the EMT phenotype (TAUBE_EMT_UP/DN, EMT gene set (Taube et al., 2010), GROGER_EMT_UP/DN, EMT gene set (Gröger et al., 2012), BYERS_EMT_UP/DN (Byers et al., 2013). The EMT signature scores across CCLE were generated by using the ssGSEA algorithm (Subramanian et al., 2005). These scores were used to identify the top associated splice targets based on degree of association, an information-theoretic measure Information Coefficient (IC) (Kim et al., 2016). An empirical permutation test was performed for statistical significance calculations. RNA-sequencing data of TCGA Breast invasive carcinoma (BRCA) samples were downloaded from the GDAC portal of the Broad Institute (http: //gdac. broadinstitute. org/). The EMT signature scores across TCGA_BRCA samples were generated by the ssGSEA algorithm based on a previously published EMT gene expression signature (CHARAFE_EMT_UP and _DOWN combined) (Charafe-Jauffret et al., 2006; Subramanian et al., 2005). The top 20% of samples (total n = 1212, mesenchymal tumor = 242) that had the highest EMT scores were counted as mesenchymal tumor samples and the top 20% of samples (n = 242) that had the lowest EMT scores were counted as epithelial tumor samples. The gene expression of EMT markers and RBPs were compared between these mesenchymal and epithelial samples in Figure 3G. In addition, these scores were used to identify the top correlated gene expression based on degree of association by calculating Pearson Correlation Coefficiency (PCC) and their p values. Breast cancer subtypes were obtained from a PAM50 gene signature-based TCGA analysis (Ciriello et al., 2015) and correlated with the expression of specific isoforms. RNA sequencing data for gene expression in primary and recurrent MMTV-HER2 mammary tumors were previously published (Goel et al., 2016). In this model, withdrawal of HER2 expression leads to primary mammary tumor regression but is eventually followed by recurrence of HER2-resistant tumors that harbor a mesenchymal phenotype (Figure 2—figure supplement 1D–F). Ten out of 11 such recurrent tumors underwent EMT as shown by the expression of mesenchymal markers and the spindle-like cellular morphology (Figure 2—figure supplement 1D) (Goel et al., 2016). Strikingly, based on an analysis of the RNA-sequencing results from Goel et al. (2016), we found that the expression of Qk (mouse homolog of human QKI) and Rbfox1 were significantly upregulated in the recurring mesenchymal mammary tumors relative to their expression in the corresponding, initially formed epithelial tumors (Figure 2—figure supplement 1D, E). The differential gene expression was evaluated by p values calculated by student’s t-test of the normalized expression values between the recurrent tumors and primary tumors. The false discovery rate (FDR) values were generated by comparative marker selection analysis in Genepattern (Reich et al., 2006). Cell extract preparation and immunoblotting were completed as described (Li et al., 2013). All antibodies used for immunoblotting were listed in Supplementary file 1. For RBFOX1 immunoblotting, we detected a 42 kDa band in HME cell lysate (predicted size). RBFOX1 levels are higher in HMLER cells and we observed a 33 kDa lower band, in addition to the 42 kDa band that corresponds to the predicted size of RBFOX1 (Figure 2—figure supplement 2C, D), which is likely a cleaved form of RBFOX1. For preparation of whole cell extract, HME or 293 T cells were harvested, and lysed on ice for 30 min with IP buffer containing 50 mM Tris HCl pH 7. 0,150 mM NaCl, 1 mM EDTA/pH 8,0. 5% Na-deoxycholate, 0. 5% NP-40 and 10% glycerol, with protease inhibitors added before use. The lysates were sonicated with 10 pulses on ice, then centrifuged at 14,000 rpm for 5 min, and the supernatants were collected for immunoprecipitation. For preparation of nuclear protein, HMLE nuclear extract was prepared using the Nuclear Complex Co-IP kit (Active Motif #54001) as described in manufacturer’s instructions. Briefly, cell pellets were resuspended in hypotonic buffer to break cell membrane and the nucleus were isolated by centrifugation. The nuclear fraction was further lysed by digestion buffer with enzymatic shearing cocktail before it was further diluted in the IP buffer provided in the kit. For immunoprecipitations, QKI antibody (Bethyl Laboratories # A310-050A) or FLNB antibody (Millipore # AB9276) was added at a concentration of 1 ug per 1 mg of cell lysate, and the lysates were incubated for 2 hr at 4°C; protein A/G agarose was then added and lysates were further incubated for 2 hr at 4°C on a rotator. Protein A/G beads were washed four times in cold IP buffer followed by centrifugation. Samples were boiled in SDS loading buffer, and separated on an SDS-PAGE gel, followed by immunoblotting. For QKI immunoprecipitations, to digest the RBP-associated RNAs, cell lysate was incubated with 50 ng/ml of RNase at room temperature for 20 min before antibodies were added. HME, HMLE or HMLER cells were transfected with siRNAs, using Lipofectamine RNAi-MAX. Six hours before the siRNA transfection, cells were split into six-well plates. To prepare transfection complexes, 5 ul of RNAiMAX was mixed into 150 ul of OptiMEM medium in one tube, while 5 ul of 20 mM siRNA was mixed into 150 ul of OptiMEM medium in another tube. Tubes were incubated at room temperature for 20 min before being added to the cells. The cells were harvested 72 hr after transfection. Immunofluorescence procedures have been described previously (Li et al., 2013). Briefly, HMLE cells were fixed with cold methanol for 2 min and permeabilized with PBS-1% Triton X-100 for 5 min. Cells were blocked in PBS-donkey serum for 1 hr before being incubated with primary antibody for 2 hr. Alexafluor 488-conjugated donkey anti-rabbit IgG (Invitrogen # R37118) was used as a secondary antibody. DNA was stained with DAPI. Images were acquired with a Nikon inverted microscope. For Phalloidin staining, cells were fixed with Formalin for 8 min and incubated with Phalloidin-Alexafluor 488 for 1 hr at room temperature before DAPI staining and image analysis. RBP-RNA interactions were crosslinked by UV exposure (254 nm, 400 mJ/cm2) using a Spectrolinker XL-1500 UV crosslinker. eCLIP was then performed as previously described (Van Nostrand et al., 2016) (ENCODE protocol v1. P 20151108) with some minor modifications as follows: (1) immunoprecipitated RNA was 3’ end ligated to a custom RNA adapter (‘3 SR_RNA’); (2) RNA was released from the nitrocellulose membrane after transfer by treatment with 200 ul of an SDS solution (100 mM Tris, pH 7. 5; 50 mM NaCl; 1 mM EDTA; 0. 2% SDS) containing 10 ul of proteinase K (Life Technologies, AM2546) and incubating in an Eppendorf thermomixer (60 min at 50°C: 15 s at 1000 r. p. m., 30 s rest), as described in the irCLIP protocol (Zarnegar et al., 2016); (3) reverse transcription was done with a custom RT primer (‘SR_RT’); (4) the 3’ end of the cDNA was ligated to a custom DNA adapter (‘SR_DNA’); (4) amplification of ligated cDNA was done with NEBNext Multiplex Oligos for Illumina (NEB, E7335S); (5) PCR amplified libraries were purified twice with AMPure XP beads (1. 0X both times) and then directly quantified by qPCR and run on a Bioanalyzer High Sensitivity DNA chip, before being pooled and submitted for sequencing on the Illumina NextSeq 500 (single-end, 75 bp). For each RBP (QKI and RBFOX1), we prepared and sequenced two replicates and a single size-matched input control derived from the first replicate. Sequenced reads were processed as previously described (Van Nostrand et al., 2016) (ENCODE pipeline v1. P 20160215), with some minor modifications. First, the unique molecular index (UMI) from the 5' end of each read was extracted using UMI Tools (parameters: umi_tools extract --bc-pattern=NNNNN). Next, adapters were trimmed using cutadapt (parameters: cutadapt --match-read-wildcards --times 1 -e 0. 1 -O 1 --quality-cutoff 6 m 18 -a NNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC). Trimmed reads were first aligned to a database of human repetitive elements (RepBase) using STAR (v2. 5. 2b) (parameters: STAR --runMode alignReads --genomeDir/path/to/RepBase --readFilesCommand zcat --outSAMunmapped Within --outFilterMultimapNmax 30 --outFilterMultimapScoreRange 1 --outSAMattributes All --outStd BAM_Unsorted --outSAMtype BAM Unsorted --outFilterType BySJout --outReadsUnmapped Fastx --outFilterScoreMin 10 --outSAMattrRGline ID: foo --alignEndsType EndToEnd). Reads not mapping to RepBase were then aligned to the human reference genome (hg19 with Gencode V19 annotations) using STAR (v2. 5. 2b) (parameters: STAR --runMode alignReads --genomeDir/path/to/hg19 --readFilesIn --outSAMunmapped Within --outFilterMultimapNmax 1 --outFilterMultimapScoreRange 1 --outStd BAM_Unsorted --outSAMattributes All --outSAMtype BAM Unsorted --outFilterType BySJout --outReadsUnmapped Fastx --outFilterScoreMin 10 --outSAMattrRGline ID: foo --alignEndsType EndToEnd). PCR duplicates were then removed using UMI Tools (parameters: umi_tools dedup --method directional-adjacency --spliced-is-unique) leaving only uniquely mapping reads. Finally, CLIP peaks were called using CLIPper software (Lovci et al., 2013) and identified peaks were normalized to the appropriate size-matched input control with ‘Peak_input_normalization_wrapper. pl’ (https: //github. com/YeoLab/gscripts) before being merged between replicates. Binding motifs were identified using MEME-ChIP (Machanick and Bailey, 2011). All data represent the average of at least three independent experiments, unless otherwise indicated. Significance was calculated by two-tail Student' s t-test, using GraphPad software. Differences were considered significant when p was <0. 05. All primer and oligo sequences are listed in Supplementary file 1. Both the RNA-seq data and the CLIP-seq data are deposited at NCBI Gene Expression Omnibus (accession number GSE98210).

Title: An alternative splicing switch in FLNB promotes the mesenchymal cell state in human breast cancer Summary: As the human body develops, countless cells change from one state into another. Two important cell states are known as epithelial and mesenchymal. Cells in the epithelial state tend to be tightly connected and form barriers, like skin cells. Mesenchymal state cells are loosely organized, move around more and make up connective tissues. Some cells alternate between these states via an epithelial-to-mesenchymal transition (EMT for short) and back again. Without this transition, certain organs would not develop and wounds would not heal. Yet, cancer cells also use this transition to spread to distant sites of the body. Such cancers are often the most aggressive, and therefore the most deadly. The epithelial-to-mesenchymal transition is dynamically regulated in a reversible manner. For example, the genes for some proteins might only be active in the epithelial state and further reinforce this state by turning on other 'epithelial genes'. Alternatively, there might be differences in the processing of mRNA molecules - the intermediate molecules between DNA and protein - that result in the production of different proteins in epithelial and mesenchymal cells. Li, Choi et al. wanted to know which of the thousands of human genes can endow epithelial state cells with mesenchymal characteristics. A better understanding of the switch could help to prevent cancers undergoing an epithelial-to-mesenchymal transition. From a large-scale experiment in human breast cancer cells, Li, Choi et al. found that a group of proteins that bind and modify mRNA molecules are important for the epithelial-to-mesenchymal transition. Two proteins in particular promoted the transition, most likely by binding to the mRNA of a third protein called FLNB and removing a small piece of it. FLNB normally works to prevent the epithelial-to-mesenchymal transition, but the smaller protein encoded by the shorter mRNA promoted the transition by turning on'mesenchymal genes'. This switching between different FLNB proteins happens in some of the more aggressive breast cancers, which also contain mesenchymal cells. Finding out which FLNB protein is made in a given cancer may provide an indication of its aggressiveness. Also, looking for drugs that can target the mRNA-binding proteins or FLNB may one day lead to new treatments for some of the most aggressive breast cancers.

lay_elife

en

Summarize: Pope Francis warned during a visit to Albania today that religion can never be used to justify violence, making apparent reference to the bloodshed wreaked by the Islamic State group in Iraq and Syria. 'Let no one consider themselves to be the armour of God while planning and carrying out acts of violence and oppression,' the pontiff said in speech at the presidential palace in Tirana in front of Albania's leaders. 'May no one use religion as a pretext for actions against human dignity and against fundamental rights,' he said. 'To kill in the name of God is a grave sacrilege. To discriminate in the name of God is inhuman.' Scroll down for video. Pope Francis arrives at Tirana's Mother Teresa international airport this morning to begin his day-long visit. The Pope touched down in Albania this morning for a 11-hour visit with security tight amid threats from Islamic State militants. While the Vatican insisted no special measures were being taken, Albania's Interior Ministry promised'maximum' protection from 2,500 police and beefed-up patrols at border crossings. Francis' interactions with the crowds were also much reduced compared to his previous foreign trips. His open-topped vehicle sped down Tirana's main boulevard, not stopping once for him to greet the faithful, as is his norm. He said: 'All believers must be particularly vigilant so that, in living out with conviction our religious and ethical code, we may always express the mystery we intend to honor. 'This means that all those forms which present a distorted use of religion must be firmly refuted as false since they are unworthy of God or humanity.' Francis has said it was legitimate to use force to stop the Islamic extremists, but that the international community should be consulted on how to do so. Pope Francis has used the visit as an opportunity to denounce how religion has been 'perverted' to justify violence. Francis told Prime Minister Edi Rama at the start of his 11-hour visit Sunday that Albania's inter-religious harmony was an 'inspiring example' for the world, showing that Christian-Muslim coexistence was not only possible but beneficial for a country's development. He said: 'This is especially the case in these times in which authentic religious spirit is being perverted by extremist groups, and where religious differences are being distorted and instrumentalized.' Snipers watch on from a building roof as crowds gather below for the Holy Mass which will take place today. Pope Francis greets the media during an airborne press conference on his flight to Albania this morning. It was reported Albanian law enforcement had flagged to Interpol concerns that Muslim militants who trained in Iraq and Syria had returned and might pose a threat to Pope Francis. The Vatican has downplayed the reports, and Pope Francis has used the same open-topped vehicle he uses in St. Peter's Square. That said, even at the Vatican security has been beefed-up in recent days: More barricades and police were out in force during Francis' weekly general audience this past week and Italian media reported security had been doubled. Albanian police said they had the situation under control, though security was tight Sunday: People attending the pope's Mass were told to avoid wearing heavy clothing since they would be checked by police and not to bring bags, suitcases or glass bottles. 'There is no threat to the pope's security. We have undertaken all the measures and everything will go well,' police chief Artan Didi told reporters after a meeting with Interior Minister Saimir Tahiri on final security arrangements. The Pope bends down to kiss a baby as he makes his way through the crowds upon his arrival in Albania. Thousands turned out to the streets this morning for Mass with Pope Francis. Left, a police sniffer dog inspects the podium where Pope Francis will be seated for the Holy Mass, while right, the greets the crowds who have gathered to see him. It is Francis' first visit to a majority Muslim nation since the Islamic State crackdown on Christians in Iraq. During his visit, he will address Albanian authorities and an inter-religious gathering, celebrate Mass in a square named for Albania's most famous Catholic - Mother Teresa - and greet children cared for by charitable groups. The capital's main Boulevard Martyrs of the Nation was decorated with Albanian and Vatican flags, as well as pictures of 40 Catholic priests who were persecuted or executed under Stalinist dictator Enver Hoxha, who declared Albania the world's first atheist state in 1967. During this time, hundreds of priests and imams were jailed, scores executed. Francis paid tribute to these martyrs and those from other faiths, saying they showed witness to their faith even under persecution. 'Recalling the decades of atrocious suffering and harsh persecutions against Catholics, Orthodox and Muslims, we can say that Albania was a land of martyrs,' he said in his homily. Deviating from his text, Francis thanked Albanians for their ancestors' sacrifice, recalling the national symbol of the eagle. 'Do not forget your wounds, but don't avenge them,' he said. 'Go forward, flying on the hopes of a great future.' Muslims make up about 59 percent of the population, with Catholics amounting to 10 percent and Orthodox Christians just under that. Believers arriving in the Albanian capital of Tirana for today's Holy Mass which will be held in a city square named after Mother Teresa. Crowds awaiting the Pope's appearance this morning where he will address an interreligious gathering. Pope Francis and Albanian President Bujar Nishani pictured side by side just after he first arrived in the country. The Pope's decision to visit tiny Albania before any major European capital is in keeping with his desire for the Catholic Church to go to the 'periphery'. Albania is seeking European Union membership and his visit comes just a few weeks before he delivers a major speech to the European Parliament in Strasbourg, France. The visit also affords him a chance to visit a majority Muslim nation at a time when Christians are being persecuted, killed and forced from their homes by the Islamic State group in northern Iraq. The Vatican has voiced mounting concern about the exodus of Christians from lands where Christian communities have existed for 2,000 years. Last month the Pope, who has often condemned the concept of war in God's name, said it would be legitimate for the international community to use force to stop 'unjust aggression' by Islamic State militants who have killed or displaced thousands of people in Iraq and Syria, many of them Christians. Despite some concerns over his safety, Pope Francis eagerly engaged with the Albanian crowds. Here he is carried through the crowd on his specially designed car known as the Popemobile. Pope Francis signs the guest book as he arrives at the Albanian Presidential Palace this morning

Summary: Pope Francis touches down to red carpet welcome in Albanian capital Tirana. He told the crowd violence should never be used to justify religion. Albania's Interior Ministry provided added protection of 2,500 police officers. Police sniper teams and sniffer dogs used while border patrols also boosted. Vatican has played down reports of threats to Pope from Muslim militants. Pope says the country's inter-religious harmony is an 'inspiring example'

cnn_dailymail

en

Summarize: A wealth of artwork, furnishings and jewelry owned by the late Listerine heiress Rachel 'Bunny' Mellon netted a total of $218.1 million following a five-day auction in New York this week. All up there were 1,521 objects owned by Mellon - who died in March at the age of 103 - and 98 percent of the lots sold after going under the hammer at Sotheby's. Some 43 post-war and contemporary paintings by artists including Pablo Picasso, Georges Seurat and Edward Hopper were among the collection. However the highlight was a pear-shaped blue diamond weighing 9.75 carats that sold for $32.6 million, an auction record for a blue diamond, according to Bloomberg. Scroll down for video. Prized possessions: The auction of Rachel 'Bunny' Lambert Mellon’s estate, which offered collectibles from a $39.9 million Mark Rothko painting to a blue diamond ring(right), fetched $218.1 million at Sotheby’s New York. Star lot: Untitled (Yellow, Orange, Yellow, Light Orange), from 1955 and owned by the late Rachel 'Bunny' Mellon, sold for $36.5 million in the Sotheby's sale on Monday night. Gold: A rare time watch sold for $68,750 (left) while a gold, turqouise and emerald Tiffany compact (right) sold for $40,000. One extreme to the next: While the jewelry was quickly snapped up for top dollar, so too were some less-appealing items, such as this rabbit doorstop (right) which sold for $5,313. Decadent: A Russian enamel-and-gem box (left) sold for $100,000, while an Austrian gold and hardstone box (right) went for $112,500. Antique: These late 18th century gold and enamel perfume bottles were sold as a set for $18,750. Unique: This stunning gold and amethyst bracelet sold for $10,625. While the larger figurine of an elephant (left) went for $4750, the smaller, a small gold, rock-crystal and sodalite rhinoceros (right) sold for $143,000. The previous auction record was $24.3 million, set at Christie’s in in December 2008. The furnishings, including an 18th century porcelain dinner service that sold for $293,000, were from Mellon’s homes in the U.S., Europe and the Caribbean. The star art items proved to be two paintings by American abstract impressionist Mark Rothko, which made a combined $76.4 million. Untitled (Yellow, Orange, Yellow, Light Orange), from 1955, sold for $36.5 million, just over its pre-sale estimate high of $30 million. Meanwhile, Untitled - a dark blue expanse created 15 years later - brought in just under $40 million, almost double its top pre-sale estimate. At least two wall hangings brought in nearly quadruple their pre-auction estimates. Bouquet de Fleurs by the French impressionist painter Eva Gonzalez sold for $1.56 million and Le Saladier by the Russian master Nicolas de Stael netted $2.04 million. 'Richest couple in America': Rachel 'Bunny' Mellon is pictured in 1987 with her husband Paul Mellon - himself an heir and successful banker. He passed away in 1999 and their estate will go to family and charities. Sought-after: Rothko's Untitled brought in just under $40 million, almost double its top pre-sale estimate. Top price: This painting, L'Autre Son de Cloche by Rene Magritte, sold for $2.285 million. Going, going, gone: It was anticipated that the slice of Mellon's artwork would bring in a high of $121 million but eager collectors pushed that figure through the roof (above, the White Barn by Georgia O'Keeffe) Picasso: The 'La Plage' painting went fr $845,000. Classic: This piece by Camille Pissarro went for $2.461 million. Haunting: Georges Seurat's Femme Tenant un Bouquet sold for $5.317 milion. Eight paintings by the late American painter Richard Diebenkorn sold for a combined $32.2 million at the November 10 auction. At the other end of the scale, one bidder picked up a 1901 beach scene by Pablo Picasso for $700,000 - roughly half its estimated value. 'The bidding was big, was broad, was frantic,' Sotheby's auctioneer Oliver Barker said shortly after dropping the final hammer. 'We saw bidding from literally all over the world... We are absolutely delighted.' It was anticipated that the slice of Mellon's artwork would bring in a high of $121 million but eager collectors pushed that figure through the roof. Vast collection: Eight paintings by American painter Richard Diebenkorn - including this one - sold for a combined $32.2 million. Collectible: The piece from Edward Hopper sold for $1.08 million. Exceeding expectation: This oil on canvas titled Paysage Bord de Mere by Russian painter Nicolas de Staël smashed its pre-sale estimate of $100,000 to $150,000 with a final selling price of $425,000. Other items from the Mellon collection, including jewelry and furnishings, were offered in a series of sales from November 20 to 23. Proceeds will benefit The Gerard B. Lambert Foundation, which supports The Oak Spring Garden Library in Upperville, Virginia. The library houses Mellon's collection of rare books, manuscripts and works of art related to landscape design, horticulture and natural history. Mellon, a noted horticulturist and widow of philanthropist Paul Mellon, died in March at age 103 at her Virginia estate following a 15-year battle with stomach cancer. Well-connected: Here Mellon is pictured with Jacqueline Kennedy in 1961. The two women became firm friends and Mellon, a self-taught horticulturist, designed the White House Rose Garden. Mellon's grandfather Jordan W. Lambert created Listerine, and her father, Gerald Lambert, built a company that made everything from Dentyne to Schick razors. Paul Mellon had his own fortune, inherited from his Pittsburgh industrialist father and built on holdings in banking, coal, railroads, steel and aluminum. Bunny Mellon was a self-taught botanist and close friend of Jacqueline Kennedy Onassis. In 1961 she redesigned the White House Rose Garden, and later she created another White House garden that was named for Kennedy after her death. The Mellons donated hundreds of important artworks to museums, including the National Gallery of Art, founded in 1937 by Paul Mellon's father, Andrew Mellon

Summary: The Listerine heiress and horticulturist passed away in March aged 103 after a 15-year battle with stomach cancer. A selection of her vast art collection, jewelry, furnishings and other possessions went under the hammer at Sotheby's New York. 'We saw bidding from literally all over the world We are absolutely delighted,' said Sotheby's auctioneer Oliver Barker. Total of 1,521 items sold for $218.1 million. Precious blue diamond sold for $32.6 million. One Mark Rothko painting went for almost $40 million.

cnn_dailymail

en

Summarize: Republican candidate Mitt Romney on Thursday launched his first sharp attack on rival Newt Gingrich — choosing to focus on Gingrich’s leadership as House speaker and using old colleagues to paint him as vain, erratic and unreliable. The effort began in earnest with a morning conference call with the news media, in which James M. Talent, a former congressman and senator from Missouri, and John Sununu, who had been chief of staff to President George H.W. Bush, ripped into Gingrich. “What we’re here to say — with reluctance, but clearly — is that he’s not a reliable and trusted conservative leader,” Talent said. “Because he’s not a reliable or trustworthy leader.” Gingrich “is more concerned about Newt Gingrich than he is about conservative principle,” Sununu said. The new approach marks a clear turn in a campaign that has been notable so far for a lack of one-on-one combat. It was also a signal that Romney feels threatened by Gingrich’s sudden lead in three of the four early states and aims to aggressively take him on as the pair head for a series of January showdowns, starting with the Iowa caucuses in less than four weeks. Gingrich, who said on Thursday that he would “stay positive,” is aiming to use the next few weeks to remind voters that he’s the same leader whose big ideas and sharp rhetoric inspired a Republican “revolution.” Romney will try to make certain voters remember that Gingrich is the same leader who had to leave that revolution in mid-stream, resigning in 1998 after less than four years as speaker amid ethics charges and dissension from GOP lawmakers. Gingrich “got a plane that hadn’t flown in 40 years to fly,” said former congressman Christopher Shays (R-Conn.), who supports Romney. “But sometimes we went to the left. Sometimes we went to the right. Sometimes we went straight up. Sometimes we went straight down.” “Newt is an entrepreneur more than he’s a manager,” Shays said. Romney could have hit Gingrich in other ways. The candidate’s biography includes three wives, a $300,000 fine for ethics violations and a $250,000-plus charge account at Tiffany. Gingrich has changed his tune on subjects from health-care reform to climate change — and he recently scoffed at the entire notion of child-labor laws. But Romney hopes to reverse a slide by turning one of Gingrich’s biggest assets — his experience in Washington — into a weakness. The campaign hopes to paint Gingrich as a philosopher-politician whose inconsistent behavior has undercut the conservative agenda. In contrast, Romney’s campaign will stress its own candidate’s years as a businessman working in the real world. “Gingrich creates theories,” their message goes. “Mitt creates jobs.” The Romney campaign provided talking points to its congressional supporters that stressed this contrast: “Gingrich has spent a lifetime operating in theory while Mitt has succeeded in practice.” Asked about Romney’s attacks on Thursday, Gingrich responded with the same combination of charm and ego that distinguished him in the 1990s. He dismissed the charges, and the candidate himself, at the same time. “We’re going to stay positive, we’re going to stay solution-oriented and talk about what America needs to do,” Gingrich said after a campaign stop in Greenville, S.C. “The only opponent I have is Barack Obama.” Even before Romney’s attacks, Gingrich’s chaotic, historic years as speaker had already become a focal point in the campaign. In interviews, his former colleagues have said that Gingrich was a brilliant insurgent — energizing a Republican caucus that had not held power in 40 years, and winning a historic victory in the 1994 elections. After taking office, Gingrich led the House into a series of battles with then-President Bill Clinton over deficits and spending. One standoff, in the winter of 1995-96, led to a temporary shutdown of the federal government. But several colleagues said the fights were worth it. Republicans under Gingrich won major changes to the welfare program, as well as a budget agreement with Clinton that led to four years of balanced budgets. “This is the single most successful speakership in modern American history,” former congressman Robert Walker (R-Pa.) said of Gingrich on Thursday. He called Romney’s attacks “nonsense.” Several former colleagues said that Gingrich’s personality — full of rapid-fire ideas but sometimes short on personal skills — might actually be well suited for a tumultuous time in Washington. “Everybody in politics enjoys peace and quiet,” said Rep. Jack Kingston (R-Ga.), a Gingrich supporter. “But we really weren’t sent here for peace and quiet. We were sent here to get things done. It would certainly be putting the vehicle of government in a different gear” if Gingrich were elected, he said. But other colleagues remembered Gingrich as a deeply flawed boss. Former congresswoman Susan Molinari (R-N.Y.) said that Gingrich had begun as an inclusive leader, sharing credit and public appearances with his rank and file. Slowly, however, Gingrich began to portray the GOP revolution as “All Newt, all the time,” Molinari said. She said Gingrich often issued conflicting marching orders from day to day, and focused on a decades-long plan for GOP dominance, ignoring real problems in the present. “That’s when his leadership style really sort of evolved into leadership by chaos.” Gingrich’s time as speaker was marred by a series of public gaffes. He intimated that the government shutdown was, in part, the result of a personal snub by Clinton: Gingrich had been made to sit in the back when he flew once on Air Force One. Eventually, Gingrich had a press aide stand in his field of vision when he spoke to reporters — nodding, or shaking her head, to signal if he was in trouble. Gingrich’s high-handed style led to an abortive effort to oust him as speaker, in 1997. Gingrich survived that, but after a disappointing election cycle, he resigned in 1998. “It’s amazing to me” that Gingrich is back as a serious presidential candidate, Molinari said. Her husband, former congressman Bill Paxon (R-N.Y.), was a player in the abortive coup, and resigned his position in the GOP leadership. “He’s the guy that got thrown out. I mean, people just don’t lose their speakership.” Do Gingrich’s troubles as speaker mean that he’d be a bad president? Former congressman Zach Wamp (R-Tenn.) said he wasn’t sure. In some ways, he said, Gingrich might actually be more suited to the White House than the House — after all, the speaker can’t fire lawmakers who disagree with him. “He’s not a real relational guy. He’s not a back-patting politician,” said Wamp, who has not endorsed a candidate. “That was harder for him as speaker than it would be as president, because as president you lay out the vision” and others carry it out. So a combative, ambitious, ego-driven President Gingrich might succeed, Wamp said. At least for one term. “He would actually get something done,” Wamp said. “Even if he never got reelected.” Staff writer Nia-Malika Henderson and staff researcher Alice Crites contributed to this report. Dow Jones Reprints: This copy is for your personal, non-commercial use only. To order presentation-ready copies for distribution to your colleagues, clients or customers, use the Order Reprints tool at the bottom of any article or visit www.djreprints.com The Republican presidential campaign took a sharply negative turn on Thursday, a result of increasing signs that Mitt Romney's main argument to GOP voters—that he alone can beat President Barack Obama in November—is coming under pressure from a surging Newt Gingrich. In a change of tone, Mr. Romney's campaign lit into Mr. Gingrich, calling him an inconstant conservative and loose cannon who would sink the GOP's shot at the White House. The attacks on Mr. Gingrich came as new surveys showed him either leading or threatening Mr. Obama in the critical states of Florida, Ohio and Pennsylvania, though by slimmer...

Summary: Mitt Romney has taken the gloves off. Advisers James Talent and John Sununu held a conference call with reporters yesterday to trash Newt Gingrich, with Talent saying he was "not a reliable and trusted leader," and Sununu alleging that he "is more concerned about Newt Gingrich than he is about conservative principle," the Washington Post reports. Their central point: If Gingrich is nominated, the focus will shift from President Obama's record to Gingrich's. And "then the president is going to win," Talent concluded. The Romney campaign also circulated anti-Gingrich talking points among congressional supporters. One suggested slogan: "Gingrich creates theories. Mitt creates jobs." Romney allies also sought to remind voters of Newt's dismissal of Paul Ryan's Medicare voucher plan as "right-wing social engineering," the Wall Street Journal reports-delighting Obama officials, who said embracing Ryan's controversial plan would be a "huge strategic error" for Romney. And many observers saw Romney's recent ad about his family as a subtle attack on Gingrich's more-spotted personal life. Gingrich took all these attacks in stride. "We are going to take the high road," a spokesman said, "and let our opponents attack us."

multi_news

en

Summarize: Story highlights A woman is hospitalized after breaking into an Omaha zoo to pet a tiger, police say Jacqueline Eide, 33, has been cited for criminal trespass over the incident A tiger at Henry Doorly Zoo bit Eide on the left hand after she reached into a cage, police say (CNN) Breaking into a Nebraska zoo to "pet" a tiger has left a woman with injuries from the big cat and a citation for criminal trespass. Jacqueline Eide, 33, apparently evaded security to sneak into Omaha's Henry Doorly Zoo on Halloween night. She was bitten Sunday morning and taken to Creighton University Medical Center by a friend, the Omaha Police Department said in a statement Sunday. Officers were later called "regarding a disturbance" at the hospital. "Eide was aggressive toward staff and showed signs of intoxication of alcohol and/or drugs," police said. "Through investigation, it was learned that Eide had made unauthorized entry into the Zoo to pet a tiger. When she reached into the cage, she was bitten causing severe trauma to her hand," police said. Read More A tiger bit a woman at the Henry Doorly Zoo Sunday morning. [Video: Woman sneaks into Henry Doorly Zoo, is bitten by tiger] Police said the woman was intoxicated and went into an unauthorized area around 7:20 a.m. to pet the animal, somehow getting past the fence and security before the zoo had opened. Jacqueline Eide, 33, is in the hospital Sunday with a severe injury to her left hand. She was transported to Creighton University Medical Center by a friend. The wounds are so bad that she might lose parts of her fingers. Eide, according to a release from the Omaha Police Department, was aggressive toward staff and showed signs of intoxication. She was cited for criminal trespass. Eide was sentenced to prison time for her third DUI in 2011. She was arrested twice in Omaha this year and has criminal convictions, including drunk driving, graffiti, disturbing the peace, obstruction of justice and shoplifting. The incident is under investigation. It's believed that Mai, an 18-year-old Malayan tiger, was the animal involved in the biting, according to a release from the zoo. The zoo is not releasing surveillance video of the incident. They say the tiger won't be quarantined. Dennis Pate, the zoo's executive director and CEO, issued the following statement: “The safety and security of our guests and animals are always a priority at Omaha’s Henry Doorly Zoo and Aquarium. Emergency phone numbers are printed on maps for guests to call in case of an emergency and security staff keep watch on grounds around the clock. We have added security cameras, new path lighting and computer-controlled locks to track exit and entry. Additional path lighting is planned for the new African Grasslands exhibit and more cameras will be installed to monitor the grounds and gates. "We will continue to keep security a top priority for Zoo guests and animals.” [Read the zoo's full statement]

Summary: Halloween really did involve horror for an Omaha., Neb., woman who reportedly slipped into a zoo and stuck her hand in a tiger cage. Police say Jacqueline Eide, 33, jumped a fence into Henry Doorly Zoo as early as 4am on Sunday and headed for Mai, an 18-year-old Malayan tiger. When she tried to pet the animal through a cage, Eide was bitten on her left hand, authorities say. A friend took her to Creighton University Medical Center, where police were called regarding a disturbance around 7:20am, per the Omaha World-Herald. "Eide was aggressive toward staff and showed signs of intoxication of alcohol and/or drugs," police say, per CNN. She's now recovering but may lose parts of her fingers, reports KETV. Eide, who has a lengthy criminal record, was cited for criminal trespass. She's previously been convicted of drunk driving, disturbing the peace, obstruction of justice, and shoplifting, per KETV. A rep for the zoo says "emergency phone numbers are printed on maps for guests to call in case of an emergency and security staff keep watch on grounds around the clock." It isn't clear how Eide managed to evade security cameras, but the zoo says "more cameras will be installed to monitor the grounds and gates." Visitors haven't had qualms about the zoo or its tigers since Eide's encounter, though. "If you stick your fingers in a cat's cage, you're going to get what you deserve," says one guest. "It's not a smart decision."

multi_news

en

Summarize: By. Daily Mail Reporter. Arrested: Jessica Low, 32, pictured, is accused of having a personal relationship with a male student at Joplin High School who was aged under 17, and also texting sexually explicit photographs of herself to at least one student. A Missouri high school teacher has been arrested on charges of second degree statutory sodomy and sending pornography to a minor. Jessica Low, 32, is accused of having a personal relationship with a male student at Joplin High School who was aged under 17, and also texting sexually explicit photographs of herself to at least one student. Police said the Joplin School District alerted them to the case after receiving a tip about the teacher. Low has worked as a communication arts teacher at the freshman sophomore building for the past two years. She was arrested while at work on Wednesday afternoon and taken into custody. According to KOAMTV.com The Southwest Missouri Cyber Crimes Unit checked into cell phones and found low had sent images of herself to several students. Police said they discovered that Low was involved in a personal relationship with one student, which led to the sodomy charge. The Joplin School District placed Low on administrative leave after her arrest. Joplin Schools Superintendent CJ Huff told KOAMTV that he would seek to have Low's teaching certificate revoked if the allegations against her are confirmed. 'It angers me, it frustrates me to no end, to know those people are out there,' he said. Investigators interviewed two male students Thursday at the Children's Center. Scroll down for video. School: Low has worked as a communication arts teacher at the freshman sophomore building of the school, pictured, for the past two years. Lt. Matt Stewart of the Joplin Police Department. said more charges are possible in the case. 'She had sent some inappropriate pictures of herself to the students,' Lt. Stewart said. He told the TV station that his department has seen an increase in the number of sex crimes being picked up through the use of smartphones. 'Remember, when you take that picture and you send that and you've lost control of that, and it may go many places you didn't intend for it to go even thought you may have intended it for one person, all that one person has to do is send it out to three or four of their friends and then they send it,' he said. Low is being held in the Joplin Municipal Jail. Charges have been forwarded to the Jasper County Prosecutor for review. KOAM TV 7

Summary: Jessica Low, 32, is accused of having a personal relationship with a male student at Joplin High School who was aged under 17. She also allegedly texted sexually explicit photographs of herself to at least one student. Low, a communication arts teacher, was arrested while at work on Wednesday and taken into custody. The Southwest Missouri Cyber Crimes Unit checked into cell phones and found Low had sent images of herself to several students. They discovered that Low was involved with one student through statements, and this led to the sodomy charge.

cnn_dailymail

en

Summarize: This application is a continuation application of Ser. No. 798,930 filed Nov. 18, 1985, now U.S. Pat. No. 4,817,015. FIELD OF INVENTION The present invention relates to tissue characterization of ultrasound images, and, more particularly, to a high speed texture discriminator that measures first and second order statistical properties of echo signals. BACKGROUND OF THE INVENTION In many medical applications, ultrasonic imaging has provided a low cost and effective method of diagnosing disease. B-scan images are two-dimensional maps of acoustic echoes from tissue components. These images have a textured or speckled appearance that is characteristic of the interaction between the fairly coherent pulse transmitted and the scattering sites in tissues. Texture is often viewed as image noise which hinders the detection and interpretation of such signals of soft tissue lesions. However, with appropriate statistical analysis, quantitative information specific to imaging performance and tissue characteristics can be extracted from the image texture Detecting the presence of disease in tissue parenchyma on a quantitative, operator independent basis is the objective of tissue characterization methods. Toward this goal, many ultrasonic tissue characterization techniques have been proposed. The success of these methods depends, however, on how well measured acoustic properties or signal parameters correlate with disease states. The most widely studied characterization method is measurement of ultrasonic attenuation, which represents the total lineal loss of acoustic energy for ultrasound propagating through tissue. A number of spectral and time domain techniques have been proposed. Two attenuation techniques have been implemented in prototype commercial clinical B-scanning hardware. Several patents, such as U.S. Pat. Nos. 4,475,397 and 4,515,163, have disclosed devices for determining the attenuation coefficient of tissue from zero crossings to frequency spectrum of reflected waves. Others like Miwa in U.S. Pat. No. 4,509,524 determine the attenuation coefficient of the tissue by comparing reflected waves of different, frequencies with a reference medium. The Flax et al. U.S. Pat. No. 4,475,396 discloses a time-based method of determining attenuation coefficient. Stochastic methods for analyzing image texture have become a topic of increasing scientific interest because the results can be directly related to observable image characteristics and physical scattering properties. Several research groups have conducted off-line studies of the moments of first order statistics such as mean, variance and kurtosis as measures of tissue characterization. A common limitation of these studies is that the analysis is performed off-line with long turn-around times, diminishing effectiveness in any proposed clinical environment application. Fellingham and Sommer (Ultrasonic Characterization of Tissue Structure in the In Vivo Liver and Spleen, IEEE Transactions on Sonics and Ultrasonics, Vol. SU-31, No. 4, July 1984) describe measurement of mean scatterer spacing as a tool for tissue characterization. In all the above systems, there is either insufficient information for tissue characterization and discrimination, or there is not present a strong physical-statistical basis for the analysis of tissue images, specifically for discrimination in low contrast media. Thus, in spite of the great need which has existed for many years, and the very great activity among researchers and practical workers in the art, there has not previously been provided a satisfactory system for rapidly detecting on-line the presence of disease in tissue parenchyma on a quantitative, operator independent basis, using ultrasonic imaging. SUMMARY OF THE INVENTION Accordingly, it is an object of the present invention to overcome deficiencies in the prior art, such as indicated above. It is another object of the invention to provide improved ultrasonic imaging information. It is a further object to detect the presence of disease in tissue parenchyma on a quantitative, operator independent basis. It is yet another object to provide an improved method of tissue characterization that uses, in addition to the mean spacing of periodic tissue scatterers, intrinsic backscatter properties of tissues which can be estimated from the image statistics. Still another object of the present invention is to provide a device for high speed on-line implementation of the above method which is adaptable to currently in-use ultrasound imaging devices. A further object of the present invention is to provide a device for detecting low contrast lesions, and another object is to provide a device for producing parametric images. BRIEF DESCRIPTION OF THE DRAWINGS Other objects and the nature and advantages of the instant invention will be more apparent from the following detailed description of the invention taken in conjunction with the drawing, wherein: FIG. 1 is a graph which shows the average autocorrelation function in the range direction, specifying t, p, and b, three parameters of texture discrimination. FIG. 2 is a graph which illustrates the average power spectrum, and in which the area 12 below the curve 10 indicates the Rician noise contribution to the image variance, and d a fourth texture parameter is specified by the inverse of the spatial frequency of peaks 14 in the power spectrum. FIG. 3 is a graph 16 showing the power spectrum with Rician noise subtracted and in which error bars denote ± one standard deviation. FIG. 4 is a schematic block diagram of a common ultrasound imaging device equipped with a texture discriminator according to the invention. FIG. 5 is a three section flowchart outlining the process of obtaining first and second order statistics of the scanned region of interest ROI. FIG. 6 is a schematic block diagram of a preferred embodiment of the present invention. FIG. 7 is detailed flowchart of a process of measuring second order statistics of a texture discriminator of the present invention as shown in block 700 of FIG. 5. DETAILED DESCRIPTION OF EMBODIMENTS Studies over the years have shown that tissue scatterers vary in size and shape, and that different biological structures have varying degrees of spatial order. The simplest biological scattering medium is unclotted blood which is completely disordered, consisting of randomly distributed Rayleigh scatterers. At the other extreme is the very complex anisotropic structure of skeletal muscle tissue. This tissue is highly ordered, with nearly periodic scatterers that repeat over a long range. The organization of scattering structures for most media falls somewhere in between blood and skeletal muscle, and it is for these structures that the problem of detecting such organized structure by means of ultrasonic imaging has been so difficult. Backscatter properties can be derived from the intensity image I(z,θ), which is defined as the squared envelope of the complex ultrasonic echo signal g(z,θ), or I=|g| 2. Here z is the range direction and θ is the sector angle in a sector B-scan image or the scan direction in a rectangular format. The echo signal g(z,θ) is the sum of scattering from a diffuse (incoherent) component, g r +ig i, and a specular (coherent) component R(z,θ) from scattering sites with semi-periodic, long range order, a function of position. The average intensity autocorrelation function, R I (Δz) for a region of interest (ROI) in the intensity image is calculated along the range direction, i.e. along the z direction. The ROI is chosen so that the effect of specular scatterers such as blood vessels and organ surfaces can be assumed to be negligible. We have now derived the expression for R I (Δz) assuming a Rician probability distribution function (pdf): R.sub.I (Δz)=&lt;I(z.sub.1)I(z.sub.2)&gt;=I.sub.d.sup.2 (1+|ρ|.sup.2)+2I.sub.d I.sub.s +&lt;I.sub.s (z.sub.1)*I.sub.s (z.sub.2)&gt;+2 I.sub.d ρ&lt;R(z.sub.1)*R(z.sub.2)&gt;(1) I d =diffuse or average incoherent backscatter intensity, I s is the average specular backscatter intensity, I=I d +I s, and ρ is the complex coherence factor. For stationary data, the last two terms can be interpreted as average autocorrelations of I s and R averaged over θ. To form the features space, in the present invention the following three values of R I (Δz) at the lags Δz are defined, recognizing that the mean square I 2 and squared mean (I) 2 may be obtained by setting ρ=1 and ρ=0, respectively, in Eq. 1. t=R.sub.I (0)=2I.sub.d.sup.2 +4I.sub.d I.sub.s =I.sub.s.sup.2 (2) p=R.sub.I (d)=I.sub.d.sup.2 +2I.sub.d I.sub.s +I.sub.s.sup.2 (3) b=R.sub.I (Δz&gt;&gt;d)=(I.sub.d +I.sub.s).sup.2 (4) There is also a fourth parameter d, the average spacing between resolvable specular scatterers, which may be found from the lag value separating correlation peaks in R I (Δz) (FIG. 1). It is however, more easily measured from peaks in the power spectrum. Through simple quadratic relations, the parameters t, p, and b are related to the scattering properties of the imaged tissues. I.sub.d =(b).sup.1/2 -(b-t+p).sup.1/2 (5) I.sub.s =(b-t=p).sup.1/2 (6) var.sup.1/2 (I.sub.s)=(p-b).sup.1/2 (7) Here t is the second moment of the intensity image and b is the square of the first moment. Thus, the parameter b is the squared mean of the intensity image, a measure of mean ultrasound backscatter intensity in the ROI. The parameter t-b is the variance in the intensity image from both random and specular scatterers, i.e. the Rician noise variance. If the tissue contains no specular scatterers or if the spacing between the specular scatterers is closer than the resolution of the imaging system, then only the two first order parameters t and b are relevant; i.e., p=b and d cannot be measured. There are, however, tissues which contain a semi-periodic array of specular scatterers at some spacing d resolvable by the ultrasonic imaging device but not detectable in the image by the human observer due to the image texture noise. It is difficult to measure the height p (peak) in R I (d) because, for most soft tissues, the correlation peaks are small compared to the uncertainty of the measurement and often there is more than one set of semi-periodic structures. A better estimate of p involves partitioning the power spectrum estimate, W(f) (FIG. 2). W(f)=δ(f)(I.sub.d +I.sub.s).sup.2 +I.sub.d.sup.2 P*P+&lt;ΔI.sub.s.sup.2 (f&#39;)&gt;+2I.sub.d PR.sup.2 +2I.sub.d P*&lt;ΔR.sup.2 (f&#39;)&gt;, (8) where ρ and P, R and R, and I s and I s are Fourier transform pairs, and δ indicates as usual the Dirac delta function of its argument. Furthermore, we have written I s (f) as δ(f)I.sub.s +ΔI.sub.s (f&#39;), where f&#39; means for all f other than f=0. We can show that for line spectra, the variance in the specular intensity, the integral of the third term in Eq. 8 over for can be separated from the rest of the spectrum. In practice, this is done by fitting the spectral minima to a Gaussian function 10, as shown in FIG. 2. The Gaussian function is chosen because the incident pulse has a Gaussian spectrum and because data is processed only along the beam axis. The Rician noise 12, the area below the fitted line 10, is then subtracted from the original spectrum 14, and the result integrated (FIG. 3) to obtain the difference quantity p-b. The scattering quantities t, p, b, and d form a four-dimensional feature space that is sensitive to changes in tissue microstructure which may result from disease processes and may, therefore, provide diagnostically significant tissue signatures. The analysis has been shown to accurately discriminate among subtle changes in texture that are not easily detected by the human observer. The structure of a preferred embodiment of a texture discriminator (TD) according to the invention and its application in an ultrasound B-scanner is discussed in detail below in accordance with FIGS. 4-7. FIG. 4 shows a block diagram of a typical ultrasonic B-scanner, in this case a conventional sequential linear array system. The scanner includes a transducer 100, receiver circuitry 110 including any delay line and video processing, a scan convertor 120, the subject texture discriminator 200, and a display monitor 130. The insert 140 for the display monitor illustrates a cross-sectional B-scan in normal rectangular format consisting of many B-mode lines. The image also includes a region of interest as shown by the dashed rectangle. The letters p, t, b and d in the upper left corner of the image illustrate the numerical display of the tissue signature variables obtained by the texture discriminator to be described below. Analogous block diagrams would apply for all other clinical ultrasonic B-scan devices including mechanical sector scanners, phased array sector scanners and static compound B-scanners. In a typical embodiment of the invention, the texture discriminator operates on digital pixel data contained in a region of interest of the conventional B-mode scan convertor. In this preferred embodiment, the ROI consists of an N=64 pixel by M=64 pixel area of eight bit image data chosen by the operator from a 512×512 field of view. The image pixel data in the ROI, thus isolated from the original pixel data, is available for transfer to the texture discriminator. The ROI selection is a common feature of commercial ultrasound imaging devices used for length and area calculations, magnification views and prototype attenuation tissue signature measurements. In this embodiment one complete operation of the texture discriminator is carried out in less than 90 msec. Thus, display of the tissue signature parameter is updated at a rate of approximately, once every three video frames. The echo signals in the ROI have been processed by the same conventional envelope detection as the B-scan image. The first step of the TD is to square the 2-dimensional array of echo envelope data x ij in the ROI to form a corresponding intensity image of values I ij =x ij 2. This is followed by calculation of two first order image statistics b and t, ##EQU1## To characterize tissues with texture having generalized Rician character, the TD, in parallel with the measurement of b and t, also determines two second order texture statistics from the ultrasound intensity image. These are d and p which are obtained from the average noise power spectrum (NPS). FIG. 2 shows an average NPS 14 from a B-scan of normal human liver obtained by averaging, in the lateral direction, 64 one-dimensional NPSs measured from data along the axial direction of a 64×64 ROI. The average NPS 14 shows several peaks at identifiable spatial frequencies from which the tissue scatterer average spacing d is obtained. The other second order statistical parameter measured by the texture discriminator is p, the variance of ultrasonic backscatter intensity due to the ordered tissue structure discussed above. p-b is obtained from the NPS by numerically separating the Rician noise 10 contribution to the NPS 14 from the variance in the specular intensity. Curve 10 illustrates the Rician noise component which is removed, so that a resulting summation of the net NPS 16 (FIG. 3) yields the described parameter p - b. The four parameters t, p, b, and d uniquely specify the acoustic characteristics of the tissue in the defined ROI for medical diagnosis. The details of the on-line measurement of these variables in the texture discriminator will now be described. The operation of the texture discriminator (TD) 200 of FIG. 4 in determining b is illustrated further in FIG. 6. The flowchart 400 which shows the b measurement includes tee squaring of the pixel data, x(m), the accumulated sum of the intensities, and the final scaling and squaring to obtain b. The flowchart 500 of FIG. 5 shows the t measurement; which includes raising the pixel data x(m) to the fourth power I 2 (m), the summing operation, and the final averaging to obtain t. Similarly higher moments of the first order statistics, such as variance or kurtosis, can be determined and displayed by analogous high speed digital operations. FIG. 6 is a schematic of the texture discriminator (TD). In this preferred embodiment, the ROI feature of a conventional ultrasound scanner is assumed to operate continually so that the image pixel data within the ROI is stored in its own ROI memory 208 and is updated by conventional means every three video frames or 10 updates/second for a conventional 30 frame/per second real time ultrasound imaging device. The TD is initiated with the reception of a vertical sync pulse from the TV sync generator which is used to synchronize conventional scanners. The vertical sync pulse passes through a÷3 counter 201 so that the TD is initialized 10 times per second. The Init pulse sets the 13 bit ROI address counter 206 to all 1&#39;s. The Init pulse also sets flip-flop 203 whose Q output is one input to And gate 204. The operation of the TD is paced by a 20 MHz master clock 300 resulting in a pulse rate of one pulse per 50 nsec. The output of the master clock 300 passes through the ÷2 counter 202 and then forms the other input to And gate 204. Thus after the Init pulse, the output of And gate 204 increments the 13 bit ROI address counter 206 every 100 nsec. The most significant bit (MSB) of the counter 206 passes to the ÷2 counter 207. The 13 bit ROI address counter 206 is incremented every 100 nsec. The 12 least significant bits of the address counter 206 determine the memory address of the 4096×8 bit ROI memory 208 which contains the ultrasound pixel data for the 64×64 ROI. The counter 206 also determines the address for the 4096×16 bit intensity memory 214. The ROI memory 208 is also cycled by the output of And 204 after a delay 205. Each eight bit pixel is then transferred in turn to both inputs of multiplier 210 to obtain the square of the pixel data, multiplier 210 in turn is cycled after the delay 209, and the 16 bits of the pixel intensity word is transferred to latch 212. Latch 212 is cycled after delay 211, and the pixel intensity word is transferred to three destinations simultaneously: accumulator 216, multiplier 217 and the correct address of the intensity memory 214. The intensity data is summed in accumulator 216 with each count of the 12 bit ROI address counter 206 as delayed by delay 213. When the counter 218 reaches 4095, the accumulated sum is passed to scaler 220 which forms a mean value of the backscattered ultrasound intensity and then to latch 224 after delay 222. The data is then sent to multiplier 228 after a delay 226 to form the mean intensity squared. Finally, this value is sent to latch 232 after a delay 230 and then to the digital encoder 234 for display. The b value is also sent to the signal processor 215 for later use. In the parallel operation for the t parameter, the output of latch 212 passes to multiplier 217, after delay 213, to form the square of each intensity pixel. This data passes to latch 221 after delay 219 and then to accumulator 225 after delay 223 to form the sum. When the address counter 227 or delay reaches 4095 the sum is passed to scaler 229 to form a mean and then to latch 233 after delay 231 and then to encoder 235 to form the t display. In the third parallel operation, the pixel intensity data from latch 212 is loaded into the intensity memory 214, which is cycled after delay 213. These three parallel operations consume 409.6 μsec so that the b and t parameters are displayed at that time. When the counter 206 reaches the count of 4096, at which point all the pixels are retrieved, the most significant bit (MSB) of the counter 206 passes to the ÷2 counter 207. The output of the ÷2 counter 207 resets flip-flop 203 so that its Q output is &#34;low&#34;, disabling And gate 204 and thus holding the b and t values. The output of the ÷2 counter 207 also is sent to the signal processor 215 initiating the signal processor 215 operations, explained below, to determine the d and p parameters. The final value of the d parameter measured in signal processor 215 is transferred to latch 240 and then to digital encoder 241 for the display. The parameter p, which is also measured in signal processor 215, is passed to the latch 242 and then to encoder 243 for display. Referring to FIGS. 5-7, the operation of signal processor 215 is explained in detail. The output of the ÷2 counter 207 initiates a Fourier transform (FT) operation in signal processor 215. The FT pulse is also passed to the scan converter 120 of FIG. 4 to initiate updating of the ROI memory 208 for the next video frame. A 64 sample FT is performed in the axial direction for each of the 64 intensity lines in the intensity memory 214 corresponding to the 64 B-mode lines in ROI. The initial 64 pixel intensity line is read from the intensity memory 214 into the random access memory (RAM) of the signal processor 215. The resulting complex FT is squared to obtain a 32 sample NPS and then stored in the RAM for subsequent averaging. The 64 FT&#39;s are performed sequentially, the resulting NPS&#39;s are accumulated in memory and then scaled to obtain an average NPS in the axial direction of the ROI. The elapsed time to perform these operations is approximately 41 msec. Following the determination of the average NPS of the image ROI, additional signal processing functions are performed to obtain the parameters d and p as shown in FIG. 5 in the flow path 600 and in FIG. 7. By conversion of the algorithm to assembly language, this additional, non-FT signal processing will consume approximately 46 msec per ROI. The 32 sample average NPS is scanned to find the location of any local peaks as shown in the example average NPS of FIG. 2. The height of each detected peak in the average NPS is then compared to a Gaussian noise function G(K), K=1, 32 stored in a look-up table in the memory of the signal processor 215 illustrated by the curve 10 in FIG. 2. The Gaussian noise function is precalculated based on conventional speckle size theory and the impulse response of the ultrasound transducer. If a detected peak in the NPS exceeds 120% of the Gaussian noise function, the sample location of the peak (K=8, 32) is stored. Next, the spatial frequency location of each unique NPS peak is converted to a spatial length via a look-up table contained in memory, which includes a scaled inverse of the samples K=8, 32. The sample locations of each peak are then tested for redundancy, i.e. the presence of harmonics or subharmonics. The locations of only unique peaks are averaged to obtain the average inter-scatterer spacing d. Subsequently, the Gaussian noise envelope G(K) is subtracted from the average NPS(K). The net values of the difference function are accumulated forming an equivalent integral of the area under the tissue structure peaks. The b value from latch 232 is then added to this integral, the sum being then scaled to form the parameter p. An alternative method for determining the noise envelope, which need not depend on the pre-calculated spectral characteristics of the individual transducer, is to fit a Gaussian function to the minima of the average NPS. The function is then subtracted from NPS to determine p. In this preferred embodiment of texture discriminator, it is assumed that the original 512×512 pixel image is obtained over a maximum range of 20 cm and is digitized in the scan convertor so that a 64×64 ROI results in a sample of approximately 25 mm×25 mm. Thus, a 64 sample FT yields an NPS of 32 unique values and a spatial frequency resolution of 0.04 mm 1. This yields a useful range to search for average tissue scatterer spacing of 0.8 to 3.1 mm, which lies within the axial resolution limits of a conventional 3.5 MHz abdominal or cardiac transducer. In one embodiment, the Fourier transform is carried out using the commercially available Texas Instrument TMS32010/20 digital signal processor (including 8 kB of external memory for the TMS32010 and 256 kB for the TMS32020) which obtains a 64 sample FT in 0.63 msec. The TMS32010/20 uses a 20 MHz clock which is synchronized with the master clock. The peak detection routine is limited from sample 8 to 32 to adhere to the spatial frequency limitation described above. The total elapsed time for measurement of t, p, b and d is less than 90 msec. With the reception of the next television vertical sync pulse, from the ÷3 counter 201, flip-flop 203 is set again, and the texture discriminator is reset for operation. In certain alternative embodiments, the texture discriminator includes measurement of the second order statistical parameters in the lateral direction. Furthermore, measurements can be made of higher order statistics using analogous designs. Also, second order statistical measurements can be obtained from the autocorrelation function (ACF), the Fourier transform of the NPS. Furthermore, implementation of high speed on-line matched filters can be included to eliminate non-Gaussian interference, such as that due to blood vessels. Analogous hardware and standard algorithms can be used to implement, on-line and at high speed, other texture analyses such as cepstra and pattern recognition techniques, such as the co-occurrence matrix. Finally, analogous hardware and standard algorithms can be used to process the radio-frequency echo signals or the B-mode echo envelope signals instead of the intensity echo signal as described above. In each of these alternatives, multiple signal processing paths can be performed in parallel to increase speed. Another feature of the TD is to store the ROI pixel data using the freeze frame option of the imaging device and then determine the tissue signature parameter at a slower rate. The advantage of this freeze frame implementation is that only data within a given frame is analyzed. This allows analysis of cardiac muscle, for example, that would normally be moving in and out of an ROI in real time. Of course, other various sizes and shapes of the ROI can also be used with corresponding longer or shorter operation times of the TD for any given examination. The foregoing description of the principle and the specific embodiments will so fully reveal the general nature of the invention that others can, by applying current and disclosed knowledge, readily modify and/or adapt the disclosed embodiments for various implementation and/or other pertinent applications without departing from the generic concept. Therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and scope of the disclosed embodiments. It is also possible to carry out the invention by measuring other second order parameters, on-line and at high speed, such as cepstra and pattern recognition variables, e.g. run length statistics, co-occurrence matrices, &#34;entropy&#34;.

Summary: Tissue signatures are obtained from first and second order statistics of an image texture to discriminate between different normal tissues and to detect abnormal conditions. These signatures described intrinsic backscatter properties of the tissue imaged and are used as the basis of an automatic tissue characterization algorithm. A device for on-line classifying of the texture of an image measures a total of four first and second order statistical properties of echo signals of a region of interest (ROI) selected by an operator, the echo signals being contained in an image memory. These can be used to obtain the tissue signatures, to detect low contrast lesions by machine, and to produce parametric images.

big_patent

en

Summarize: This Sept. 17, 2018, photo shows Kyoto University Professor Tasuku Honjo in Kyoto, western Japan. James P. Allison and Tasuku Honjo are jointly awarded the Nobel Prize in medicine or physiology on Monday,... (Associated Press) This Sept. 17, 2018, photo shows Kyoto University Professor Tasuku Honjo in Kyoto, western Japan. James P. Allison and Tasuku Honjo are jointly awarded the Nobel Prize in medicine or physiology on Monday, Oct. 1, 2018. (Ryosuke Ozawa/Kyodo News via AP) (Associated Press) STOCKHOLM (AP) — The Latest on the awarding of the Nobel Prizes (all times local): 12:05 p.m. The two winners of this year's Nobel Prize in Medicine or Physiology made discoveries that "constitute a landmark in our fight against cancer," according to a statement from the Nobel Assembly of the Karolinska Institute that awarded the prize. James Allison of the University of Texas and Tasuku Honjo of Japan's Kyoto University did parallel work to stimulate the body's immune system's ability to attack tumors. Allison studied a protein that acts as a brake on the immune system and the potential of releasing that brake. Honjo separately discovered a new protein on immune cells and eventually found that it also acts as a brake. "Therapies based on his discovery proved to be strikingly effective in the fight against cancer," the assembly said in a statement. Releasing the potential of immune cells to attack cancers joins other treatments including surgery, radiation and drugs. ___ 11:45 a.m. The citation for this year's Nobel Prize in Medicine says the two honorees developed therapies for treating cancer. American James Allison studied a protein that functions as a brake on the immune system. He realized the potential of releasing the brake and unleashing immune cells to attack tumors. He developed this concept into a new approach for treating patients. Tasuku Honjo of Japan "discovered a protein on immune cells and revealed that it also operates as a brake, but with a different mechanism of action. Therapies based on his discovery proved to be strikingly effective in the fight against cancer." ___ 11:30 a.m. The Nobel Prize in Medicine has been jointly awarded to James Allison of the University of Texas and Tasuku Honjo of Japan's Kyoto University for discovering a form of cancer therapy. The 9 million-kronor ($1.01 million) prize was announced Monday by the Nobel Assembly of Sweden's Karolinska Institute. ___ 6 a.m. This year's Nobel Prize recipients will be revealed starting Monday with the prize for medicine or physiology. The Nobel Assembly of the Karolinska Institute — 50 professors at the Stockholm facility — chooses the winner or winners of the prize honoring research into the microscopic mechanisms of life and ways to fend off invaders that cut it short. A maximum of three laureates are selected. Last year's prize went to three Americans for work in identifying genes and proteins that work in the body's biological clock, which affects functions such as sleep patterns, blood pressure and eating habits. The physics prize is to be announced Tuesday, followed by chemistry. The winner of the Nobel Peace Prize will be named Friday. No literature prize is being given this year. Published on Apr 20, 2017 http://bit.ly/2cri805 MD Anderson’s Jim Allison, Ph.D., has been named one of TIME magazine’s 100 Most Influential People of 2017. Allison has also been awarded the 2018 Nobel Prize in Physiology or Medicine. Dr. Allison’s immunotherapy research launched a completely new way to treat cancer by training the immune system to attack cancer. This breakthrough, called immune checkpoint blockade, has helped extend patients’ lives and transform cancer research. #endcancer. Learn about Dr. Allison's receipt of the 2018 Nobel Prize in Physiology and Medicine: https://www.mdanderson.org/newsroom/2.... Request an appointment at MD Anderson by calling 1-877-632-6789 or online at: https://my.mdanderson.org/RequestAppo... The interactive transcript could not be loaded. Rating is available when the video has been rented. This feature is not available right now. Please try again later. The Nobel Prize in physiology or medicine was awarded Monday to cancer researchers James P. Allison and Tasuku Honjo, whose studies led to groundbreaking drugs that unleash the immune system against the deadly disease. The researchers’ work revolutionized cancer treatment by determining how to disengage the “brakes” that prevent the immune system from attacking cancer, said the Nobel Assembly at Sweden’s Karolinska Institute, which awards the prize. The discoveries led to a new class of drugs, called checkpoint inhibitors, that now form the fourth pillar of cancer treatments, along with surgery, radiation and chemotherapy. Allison studied a protein that previously had been identified as a restraint on the immune system, while Honjo discovered another protein that keeps the immune system at bay. Allison, chair of the immunology department at MD Anderson Cancer Center, said at a news conference in New York that he was “in a state of shock” after hearing from his son early Monday that he had won the award. The honor, he added, underscored the importance of supporting basic science. “I didn’t get into this to cure cancer. I wanted to know how T cells work,” he said, referring to a key part of the immune system. The 70-year-old Allison noted that his mother died of lymphoma when he was a preteen, the first of many family members to die of cancer. The new treatments have proved especially helpful for some patients with advanced melanoma, bladder and lung cancers, sparking new hope in oncology and a billion-dollar market for the drugs. James P. Allison with collaborator and spouse Padmanee Sharma. Allison developed Yervoy, the first of the checkpoint inhibitors. (Ilana Panich-Linsman for The Washington Post) But many patients have not benefited, and the drugs have not been found effective in treating pancreatic cancer and glioblastoma. In addition, the therapies can cause serious side effects and typically cost over $100,000 a year. Allison acknowledged that researchers have much more work ahead to make the new treatments help more patients — most likely by using them with other types of therapies. “The biggest challenge,” he said in an interview, “is to develop the right combinations to get the percentage of patients who respond much higher. It’s just going to take a while.” Honjo, 76, speaking Monday at Kyoto University in Japan, where he works, said he began his research after a medical school classmate died of stomach cancer, according to the Associated Press. An avid golfer, Honjo said a member of a golf club once walked up to him to thank him for the discovery that led to a treatment for his lung cancer. “He told me, ‘Thanks to you, I can play golf again,’ ” Honjo said, according to the AP. “A comment like that makes me happier than any prize.” Scientists had worked on trying to use the immune system as an anti-cancer weapon for more than a century but scored only incremental gains until the work on checkpoint inhibitors, the Swedish academy noted. Allison did his landmark work while at the University of California at Berkeley in the 1990s and later at Memorial Sloan Kettering Cancer Center in New York. While studying a protein known as CTLA-4 that had been identified as a brake on the immune system, he realized the implications for cancer treatment. He developed an antibody that counteracted the protein and got spectacular results in mouse studies. In 1994, he and his co-workers performed a pivotal experiment that showed mice with cancer had been cured by the treatment. Allison pushed for years for the medication, called ipilimumab, to be developed for humans. In 2011, the Food and Drug Administration approved the drug, also known as Yervoy, for patients with late-stage melanoma. It was the first of the checkpoint inhibitors. Meanwhile, in 1992, Honjo discovered a different protein, called PD-1, that also acted as a brake on the immune system, but through a different mechanism. That led to the development of anti-PD-1 drugs such as pembrolizumab, also known as Keytruda, that was approved in 2014. Several similar medications have since been approved. Former president Jimmy Carter, who was diagnosed with advanced melanoma, was successfully treated in 2015 with Keytruda, along with surgery and radiation. The Nobel statement noted that anti-PD-1 therapies have proved more effective than anti-CTLA-4 treatments. Combining the two can be even more effective, as demonstrated in patients with melanoma. Combining immunotherapies, however, also can lead to dangerous side effects that have to be carefully managed. Allison, who started his career at MD Anderson in Houston and then returned there in 2012, grew up in a small town in South Texas where his country-doctor father made house calls. He is married to oncologist Padmanee Sharma, a scientific collaborator and a specialist in renal, bladder and prostate cancers at MD Anderson. The two are working on studies that use serial biopsies of prostate and other cancers to try to determine how the immune system reacts over time to different treatments. With long, unruly gray hair that hangs almost to his shoulders, Allison is well known in scientific circles for his musical prowess, playing harmonica in a band called the Checkpoints. At concerts at big cancer meetings, he growls out classics like “Big Boss Man” and “Take Out Some Insurance on Me, Baby.” In 2016, he played with his idol, Willie Nelson, at the Redneck Country Club near Houston. For years, Allison has shown up on lists of potential Nobel winners. He has won so many other awards that some sit on the floor of his crowded office. On Monday, other researchers praised Allison’s selection, saying it was long overdue. “For 100 years, we were trying to turn on the immune system, and it didn’t work for cancer, or just anecdotally,” said Antoni Ribas, an immunologist at the University of California at Los Angeles. “He figured out how to allow our immune system to attack cancer. It opened the door to a new line of therapies.” Allison went into cancer research because he always wanted to be the first person to figure something out, he said in an interview with The Washington Post last year. Early on in classes at the University of Texas at Austin, he realized that medical school wasn’t for him. “If you are a doctor, you have to do the right thing; otherwise, you could hurt somebody,” he said. As a researcher, “I like being on the edge and being wrong a lot.” Read more Cancer-fighting power couple tackles mysteries of the immune system I thought melanoma would kill me. Here’s why it didn’t. ‘Manhattan project’ for cancer aims to turn it into a chronic disease

Summary: The first Nobel of the year is out, with an American and a Japanese researcher sharing the prize for medicine. The winners are James Allison of the University of Texas and Tasuku Honjo of Japan's Kyoto University, reports the AP. The two researchers did not work together, but both made independent breakthroughs in the same field: figuring out ways to help the body's own immune system fight cancer. Emerging field: Both men "discovered methods of removing the brakes on cells that fight invaders, paving the way for cancer immunotherapy, which has joined surgery, radiation, and chemotherapy as a major weapon in the battle against cancer," per the Washington Post. Allison: He talks about his own work here. Honjo: Listen to Honjo in an interview here. Nobel panel, on Allison: He "studied a protein that functions as a brake on the immune system," the organization tweets. He (realized) the potential of releasing the brake and unleashing our immune cells to attack (tumors). He developed this concept into a new approach for treating patients. "Nobel panel, on Honjo: He"discovered a protein on immune cells and revealed that it also operates as a brake, but with a different mechanism of action, "the group tweets."Therapies based on his discovery proved to be strikingly effective in the fight against cancer. "

multi_news

en

Summarize: Mauro Icardi and Wanda Nara's controversial relationship reached a new level on Tuesday as the couple married in Buenos Aires. Nara (or Icardi as she will now be called) is the ex-wife of Maxi Lopez, but publicly split from the Argentine to hook up with compatriot and Inter Milan striker Icardi in November 2013. Icardi and Lopez famously clashed during a Serie A game between Sampdoria and the Nerazzurri in April, with the latter refusing to shake the 21-year-old's hand. VIDEO:Scroll down to see Lopez refuse to shake Icardi's hand. The happy couple: Inter Milan star Mauro Icardi and Argentine model Wanda Nara got married on Tuesday. Brief: They have been dating for just six months, with Nara the ex-wife of Icardi's old team-mate Maxi Lopez. Brief: They have been dating for just six months, with Nara the ex-wife of Icardi's old team-mate Maxi Lopez. Ceremony: The wedding took place in Buenos Aires in front of just 12 relatives (and the groom wore jeans) Making no secret about it: Mauro Icardi took to Twitter at first to publicly devote his love to Wanda Nara. Three's company: Icardi and Lopez (left) fell out after the Inter forward started to see his former friend's wife. Where is the love? Wanda Nara revealed in an interview that he marriage with Maxi Lopez was failing apart. The wedding took place by civil union and was in front of only 12 invited guests, with the groom in jeans. Unsurprisingly, Lopez wasn't one of them. The former Barcelona forward looked after Icardi when he first came to Italy and the pair spent lots of time together and with Lopez's then wife Nara, as well as the couple's three children. The love triangle between the two players and Argentinian WAG Nara was exposed in November 2013 when it was revealed Icardi had made moves on his former friend's wife as their marriage fell apart. The Inter Milan forward took to Twitter to declare: 'I love you [Wanda Nara], it will never be easy to say what I feel,. because I discovered that those two words ('I love you' = 'te amo' in Spanish) carry with them one feeling without limits!' The tweet coincided with an interview given by Nara released by Revista People, in which the model revealed: 'It’s been three months since my husband had sex. Maxi has neglected me. Although I’ve been living in luxury, I am also living with hidden pain. 'I think. the time has passed for me to save my family. I will not fight for the money,. because he knows me.' Good times: The couple pose with a relative at the service. Tradition: The cake is cut in Argentina... the couple have been officially dating for months. Love triangle: While Mauro Icardi has gained a wife, he has lost a friend in Maxi Lopez (right) Coming out: Wanda Nara and Mauro Icardi attend a Serie A match together after their union was exposed. The pair have since become renowned. for posting almost daily declarations of their love over social media as. well as numerous'selfie' pictures. But, it is pictures of a different kind that have angered her husband after Lopez hit out this week at the couple for putting up Twitter images featuring the two children he fathered with Nara. 'I can understand that, being a public figure, he publishes photos. But I'm not comfortable with my kids being in those photos,' Lopez said to Sky Sport. He added: 'The kids are my strength... and they know I will do everything to protect them because they mean everything to me.'

Summary: Icardi and Nara marry in front of 12 relatives in Buenos Aires. Couple have officially been dating since November 2013. Nara is the ex-wife of Icardi's former team-mate Maxi Lopez. Pair clashed on-pitch in April, with Lopez refusing to shake Icardi's hand. Nara said her and Lopez 'hadn't had sex in months' before split. Icardi plays for Inter Milan and Lopez for Sampdoria.

cnn_dailymail

en

Write a title and summarize: Tomato Yellow Leaf Curl Virus Disease incited by Tomato yellow leaf curl virus (TYLCV) causes huge losses in tomato production worldwide and is caused by different related begomovirus species. Breeding for TYLCV resistance has been based on the introgression of multiple resistance genes originating from several wild tomato species. In this study we have fine-mapped the widely used Solanum chilense–derived Ty-1 and Ty-3 genes by screening nearly 12,000 plants for recombination events and generating recombinant inbred lines. Multiple molecular markers were developed and used in combination with disease tests to fine-map the genes to a small genomic region (approximately 70 kb). Using a Tobacco Rattle Virus–Virus Induced Gene Silencing approach, the resistance gene was identified. It is shown that Ty-1 and Ty-3 are allelic and that they code for a RNA–dependent RNA polymerase (RDR) belonging to the RDRγ type, which has an atypical DFDGD motif in the catalytic domain. In contrast to the RDRα type, characterized by a catalytic DLDGD motif, no clear function has yet been described for the RDRγ type, and thus the Ty-1/Ty-3 gene unveils a completely new class of resistance gene. Although speculative, the resistance mechanism of Ty-1/Ty-3 and its specificity towards TYLCV are discussed in light of the function of the related RDRα class in the amplification of the RNAi response in plants and transcriptional silencing of geminiviruses in plants. Plant pathogens are a major limiting factor for agricultural productivity worldwide. Viruses are among these and cause large yield losses in a variety of economically important crops. Although most viruses have small genomes and code for a very limited amount of proteins, they can cause a variety of disease symptoms, and the mechanisms underlying these are still mostly unknown. Plants utilize several lines of defense mechanisms to protect themselves from pathogen invasion. The mechanism that has been studied the most is resistance (R) gene-mediated resistance, which relies on the ability of a plant to recognize a pathogen and consequently trigger the hypersensitive cell death response (HR) [1]. Meanwhile, a large number of R genes have been identified, including ones responsible for the (in) direct recognition of viruses, such as Sw-5 for tospoviruses in tomato [2], Rx2 for Potato virus X [3] and the I locus for Bean common mosaic virus [4]. In addition to these dominant R genes, a second type of resistance gene is inherited recessively, which is more common in resistances to viruses compared with resistance to fungi or bacteria [5]–[6]. Most of these genes are linked to the eukaryotic translation initiation complex and negatively affect the viral RNA replication cycle [7]. RNA silencing (also called RNA interference, RNAi), is a conserved eukaryotic gene regulation mechanism that involves the biogenesis of small (s) RNA molecules of ∼21–26 nucleotides in size from perfect or imperfect long double stranded (ds) RNA molecules by an enzyme designated Dicer (mammals, insects), or Dicer-like protein (DCL) (plants) [8]. One strand of these sRNA molecules is incorporated into an RNA-induced silencing complex (RISC) and enables the latter to sense and target RNA molecules with sequence complementarity to the uploaded RNA strand for degradation or translational arrest by means of the core Argonaute (AGO) protein. In recent years, RNA silencing has become known as an antiviral defense mechanism in plants and insects in which viral double-stranded RNA replicative intermediates or secondary RNA folding structures are cleaved into primary, small-interfering (si) RNA molecules. In plants, the viral primary siRNA molecules also act as primers for the host RNA-dependent RNA polymerases (RDR) to convert (aberrant) RNA target sequences into new long dsRNAs. These in turn become processed into secondary siRNAs. This not only leads to an amplification of the siRNA signal, but also results in a distributional spread of siRNA molecules from the entire RNA target sequence, referred to as transitive silencing [9]. The amplification of siRNAs is required to mount a strong antiviral RNAi response. Arabidopsis RDR1,2 and 6, and orthologs of these genes, have been demonstrated to be involved in this amplification and plants from which these genes have been knocked-out exhibit higher susceptibility to various plant viruses [10]–[14]. The whitefly transmitted tomato yellow leaf curl disease (TYLCD) is one of the most devastating diseases of tomato (Solanum lycopersicum) and is caused by several species of the Begomovirus genus (Geminiviridae) [15]. Tomato yellow leaf curl viruses (TYLCV) are the most widespread and currently rank 3rd among the economically and scientifically most important plant viruses worldwide [16]. They have a single-stranded circular bi-directionally organized DNA genome with six partially-overlapping open reading frames [17]. Because of their limited coding capacity they rely, like most viruses, not only on their own proteins but also on the host cell machinery for their infection cycle [18]. Since the whitefly insect vector is hard to control, breeding TYLCV resistant tomato cultivars provides an attractive strategy to manage TYLCV. All domesticated tomatoes are susceptible to TYLCV, but high levels of resistance were found in several related wild tomato species. Genetic studies have led to the mapping of five TYLCV resistance/tolerance genes which are being exploited for resistance breeding. These genes have different origins: Ty-2 was introgressed from S. habrochaites, Ty-5 (ty-5) was introgressed from S. peruvianum while Ty-1, Ty-3 and Ty-4 all originated from different S. chilense accessions [19]–[24]. So far, none of these genes have been cloned and the underlying resistance mechanisms are still unknown. In contrast with classical R-genes none of the resistances to TYLCV described so far are associated with a HR. Moreover, in almost all TYLCV resistant materials, viral replication occurs [25]–[28]. This also holds true for Ty-1/Ty-3, where in the donors (S. chilense LA1969/LA1932) as well as in a commercial line with a Ty-1 introgression (3761, A. B. Seeds, Ness Ziona, Israel) TYLCV is replicating and detectable [29]–[31], although the level does not exceed more than 10% of that in susceptible tomato cultivars. Though many loci (i. e. Ty-1 to Ty-5) for TYLCV resistance have been described, the genes conferring resistance have not been identified. Recently, several papers have reported on host genes in a gene network contributing to the resistance originating from S. habrochaites [32]–[34]. By differential cDNA library comparisons of susceptible and resistant tomato lines before and after TYLCV inoculation, approximately 70 genes were found to be preferentially expressed in a tomato line with a resistance introgressed from S. habrochaites. For three of those, a lipocalin-like protein (SlVRSLip), a Permease I-like protein and a hexose transporter LeHT1, it was shown that their silencing (partly) compromised resistance. In our previous study we found that Ty-1 and Ty-3 map closer than previously reported and that they might be allelic [35]. In the present study Ty-1 and Ty-3 are fine mapped, and using a Tobacco Rattle Virus (TRV) induced silencing approach, the genes have been identified and found to be allelic. They code for an RNA-dependent RNA polymerase (RDR) of the γ class, a class of RDRs for which no function is yet described. The role of this new class of resistance genes will be discussed in light of the TYLCV infection cycle. Previously, we mapped Ty-1 in the interval between MSc05732-4 and MSc05732-14 [35]. To fine-map Ty-1, markers T0774 and SL_2. 40ch06_30. 891, which flank this interval, were used to screen an F2 population derived from a cross between the susceptible Fla. 7776 and a recombinant inbred line (RIL) carrying the S. chilense Ty-1 introgression. Approximately 2,000 F2 plants were screened, 13 recombinants were identified, and RILs were developed for each of these (designated R1 to R13). Four RILs (R1,4, 12 and 5) containing the S. chilense introgression between markers Hba0161K22 and WU_M31 were resistant, while eight RILs that lacked this interval were susceptible (Figure 1A). R7, which resulted from a recombination event between markers WU-M27 and UF_TY3-P19, showed an intermediate response. These results were confirmed for the three most informative recombinants (R7, R8 and R11) (Table S1) using agroinoculation and show that Ty-1 is located between HBa0161K22 and WU_M31, an interval of approximately 70 kb. The Ty-3 gene was previously mapped between T0774 and T1079 [21]. By screening an F2 population (n = 717) from a cross between the susceptible line Fla. 7781 with the resistant line Fla. 8680 (carrying the Ty-3 introgression from S. chilense LA2779), 30 recombinants were identified. RILs of these recombinants were generated and tested with TYLCV. Results mapped Ty-3 to the interval between T0774 and P6-25 (Table S2). To further narrow down the Ty-3 interval, RILs of two key recombinants were used to generate three F2 sub-populations, A, B and C. Screening more than 10,500 individuals of these sub-populations with markers Mi23 and P6-25 (sub-population A and B) and markers T0774 and T0834 (sub-population C) identified 309 recombinants (Table S3). Cuttings of these recombinants were evaluated for TYLCV disease severity (Table S3; control experiments, Table S4) and interval QTL mapping confirmed the location of Ty-3 between markers T0774 and P6-25, with a LOD of over 50 in an interval between markers SL_2. 40ch06_30. 696 and cLEG-31-P16 (Figure S1). Recombinants in this interval were further analysed by testing their RILs with TYLCV and by saturating this region with additional molecular markers (Figure 1B, Table S5). RILs carrying the S. chilense LA2779 introgression between markers UF_TY3_P1 and UF_TY3_P23 were resistant (recombinant class C to I, Figure 1B), while RILs with introgressions that did not span this region were susceptible; these results map Ty-3 to a region of approximately 71 kb that overlaps the region containing Ty-1 (Figure 2). According to the ITAG2. 3 release of the tomato genome, the region to which Ty-1/Ty-3 mapped was predicted to contain five genes; Solyc06g051160 (408 bp), Solyc06g051170 (1728 bp), Solyc06g051180 (438 bp), Solyc06g051190 (957 bp) and Solyc06g051200 (843 bp) [36] (Figure 2). While gene Solyc06g051160 has an unknown function and Solyc06g051200 encodes a predicted ribosomal protein, the other three genes are each predicted to encode (parts of) an RNA-dependent RNA polymerase (RDR). Arabidopsis thaliana RDRs in general are approximately 3 kb in size, but these three predicted genes are all much shorter. Since the genes only share low sequence similarity they likely are not paralogous. Interestingly, the crossing-over event in the intermediate resistant R7 occurred within the candidate gene Solyc06g051190. After amplification and sequence analysis of this gene from R7 and subsequent alignment to the corresponding regions of a Ty-1 line and a ty-1 line, the recombination site in R7 could be pinpointed between two SNPs. This region covered less than 100 base pairs in which the recombination point mapped to the last part of predicted exon number 4 (Figures S2 and S3). Plants of R7 thus contained a chimeric predicted gene Solyc06g051190. To identify the Ty-1 gene from the five candidate genes predicted in the Ty-1 interval, a Tobacco Rattle Virus (TRV) based Virus Induced Gene Silencing (VIGS) approach was applied. For three out of five genes a VIGS construct could be made; TRV2-160 for Solyc06g051160; TRV2-180 for Solyc06g051180 and TRV2-190 for Solyc06g051190. The two VIGS vectors, TRV2-180 and TR2-190, are specific and both are assumed to target an individual RDR, due to low sequence similarity between Solyc06g051180 and Solyc06g051190. Several attempts to make a VIGS construct for Solyc06g051170 and Solyc06g051200 failed so experiments were done with the available constructs. When plants containing Ty-1 were agroinfiltrated with empty vector control (EV, TRV2 without an insert) or TRV2-160, and two weeks later superimposed with a TYLCV challenge, the plants maintained resistance to TYLCV. However, when either TRV2-180 or TRV2-190 was used, the resistance was compromised as observed by the appearance of TYLCV disease symptoms (Figure 3). Repeated analysis confirmed these results, which, together with the fact that both Solyc06g051180 and Solyc06g051190 are predicted RDRs located in close proximity to one another within the Ty-1/Ty-3 region, suggest that Solyc06g051180 and Solyc06g051190 might belong to one and the same gene. Our initial mapping studies indicated that Ty-1 and Ty-3 could be alleles of the same gene [35], and the fine mapping of both genes to a similar marker interval strengthened this hypothesis. To test this, the Ty-1 VIGS approach was again applied to compromise TYLCV resistance in plants carrying the Ty-3; as a control, plants with resistance based on Ty-2 were included. As in the Ty-1 plants, resistance in the Ty-3 lines was compromised by TRV2-180 and TRV2-190, but not by TRV-160 (Figure 3). On the other hand, plants containing Ty-2 remained fully resistant against TYLCV after silencing with all three constructs. Altogether these data indicate that Ty-1 and Ty-3 indeed are allelic, while Ty-2 belongs to another class of resistance genes. To test the hypothesis that Solyc06g051170, Solyc06g051180 and Solyc06g051190 were part of the same gene, and to clone the entire Ty-1 gene, several primer pairs were designed to enable RT-PCR amplification of the exons from the three predicted genes, and tested on cDNA of Ty-1 lines and TYLCV susceptible cv. Moneymaker. Primers designed on the start and stop codons of the three predicted genes did not amplify any products. However, when primers were used that were located a bit downstream of the start codon or upstream of the stop codon products were amplified, indicating that the predicted start and stop codons were wrong. To test whether the initially predicted genes were all part of one RDR-encoding ORF other primer pairs were tested. When primers targeting Solyc06g051170 were combined with Solyc06g051190 (Figure S4, F6-R4) surprisingly a product of approximately 700 bp was amplified indicating that all three predicted genes were indeed not paralogous but part of one and the same RDR gene. This was confirmed by sequence analysis of all overlapping PCR fragments obtained (Figure S4). Using a GeneRacer (Invitrogen) approach the genuine start and stop codons of the RDR gene were identified. Based on these sequences new primers (Table S6, Ty-F7-CACC and Ty-R5) were designed that supported the amplification of a product of approximately 3. 1 kb from cDNA of a Ty-1 line, a Ty-3 line and from cv. Moneymaker. Sequence analysis of the amplified Ty-1/Ty-3 gene products revealed that the gene contained 19 exons. Compared with the three predicted genes the first predicted exon of Solyc06g051190 was not expressed, nor was the last exon containing the stop codon (Figure 2). For Solyc06g051180 the first exon started earlier than predicted, the last exon was shorter than predicted, again losing the stop codon. Finally for Solyc06g051170 the first predicted exon was not expressed. Alignment of the amino acid (aa) sequences of Ty-1, Ty-3 and ty-1 (the susceptible allele from tomato cv. Moneymaker) revealed high sequence identity between all alleles, with only small differences. The most significant difference was a four aa deletion in the N-terminal domain of the susceptible allele. In addition, 20 aa changes were observed, with only small differences between Ty-1 and Ty-3. Multiple sequence alignment with the six RDRs identified in A. thaliana (Figure S5 and S6) showed a high sequence similarity to RDR3, RDR4, and RDR5 and the presence of the atypical DFDGD catalytic motif of these genes in both Ty-1 and Ty-3 alleles (Figure 4A). The homology inferred from the sequence similarity was supported by a phylogenetic analysis using an unrooted neighbor joining tree, in which Ty-1 and Ty-3 grouped in the clade containing RDR3,4 and 5 (Figure 5). Interestingly, although the ty-1 allele (Moneymaker) appeared in the same clade, it showed less similarity to RDR3/4/5 then the Ty-1/Ty-3 allele (Figure 4B). Considering a potential role of the Ty-1 encoded RDR in mounting a strong antiviral RNAi response, its transcriptional expression level was analyzed. To this end, a time-series experiment was performed during which expression of the resistant Ty-1 and the susceptible ty-1 allele was quantified upon TYLCV-challenge via agroinoculation in both tomato lines. The expression level of the specific allele was measured by qPCR at several time points (Figure 6). The results showed that at all time points the basic transcription level of the Ty-1 allele was significantly higher compared to the ty-1 allele. In the resistance line, no significant difference was observed for the Ty-1 expression between mock and TYLCV inoculated plants at all time points. However, in the susceptible Moneymaker line, the expression of the ty-1 allele was induced upon TYLCV inoculation at 12 and 19 days. Compared with day 0 of resistant and susceptible lines, the respective expression of Ty-1 and ty-1 was decreased at day 5 and increased at day 19. Nowadays many dominant and recessive virus resistance genes are well characterized and used in breeding of various crops. Most of these genes either do not allow/prevent viral replication or limit this to the first cells of entry in the host. The TYLCV resistance genes Ty-1 and Ty-3 are different from these because they lead to a level of virus tolerance (rather than immunity). Plants carrying these genes and challenged by the virus still show low levels of viral replication and systemic spread but with moderate (as with Ty-3) or no (as with Ty-1) visual symptoms. Recently we observed that the S. chilense LA1969 derived Ty-1 and the S. chilense LA2779 derived Ty-3 map close to each other and that they might be allelic [35]. Here we show by fine mapping and functional analysis that Ty-1 and Ty-3 are alleles of the same gene and code for RNA-dependent RNA polymerases from a class of functionally unknown RDR genes. Sequence data shows that most of the SNPs that are present in Ty-1 are also present in Ty-3, which is logical since both alleles originate from S. chilense accessions. The most striking difference between Ty-1/Ty-3 and the ty-1 allele is a deletion of 4 amino acids in the first amino-terminal part of the protein. However, it is not likely that this deletion solely causes a functional loss, since recombinant R7 contains a chimeric RDR – with the N-terminal part of ty-1, and still confers partial resistance to TYLCV. Recently, three genes have been reported which are involved in different networks related to TYLCV resistance introgressed from S. habrochaites [32]–[34]. Of the three identified genes, SlVRSLip functions downstream LeHT1 within the same network, while Permease I-like protein functions in a different network [32]–[34]. In another study, 18 host genes with a potential role in Tomato Yellow Leaf Curl Sardinia Virus (TYLCSV) infection were identified. Interestingly, almost half of these genes had a role in posttranslational modifications [37]. Whether RDRs encoded by Ty-1 and Ty-3 play a role in one any of these networks remains to be analysed. RDRs are defined by a conserved catalytic domain and are found in RNA viruses and multicellular organisms (plants, fungi and invertebrate animals), but so far are not described in vertebrates and insects. For RNA viruses, the RDR is required to enable replication of its RNA genome to render viral progeny [38]. In multicellular organisms, three major classes of eukaryotic RDRs have been described and some of their functions have been unraveled. The first class is presented by RDRα and members of these are found in plants, animals and fungi. The class of RDRβ genes has been found only in animals and fungi while RDRγ members are only found in plants and fungi [39]. In the model plant A. thaliana a total of six RDRs have been identified [40]. Three of them belong to the RDRα type, i. e. RDR1, RDR2 and RDR6, and are characterized by a catalytic DLDGD motif. The other three belong to the RDRγ class of genes and are denoted RDR3, RDR4 and RDR5 (also referred to as RDR3a, RDR3b and RDR3c, respectively). Members of this class have an atypical DFDGD motif in the catalytic domain [40]. The RDRα genes are all known to be involved in RNA silencing, specifically in the amplification of the siRNA signal and resulting in transitive silencing. RNA silencing is generally accepted as a defense system against viral invasion, and is induced by viral dsRNA replicative intermediates or folding structures [41]. Geminiviruses are also targeted by RNAi, as observed by the synthesis of geminivirus-specific siRNAs, (small-RNA directed) viral DNA methylation and post-transcriptional gene silencing of the protein-coding genes [42]–[45]. Although geminiviruses contain a single stranded DNA genome, siRNAs have been observed to originate from the entire virus genome although their distribution was not always equal. The siRNAs are postulated to originate in two ways; 1) as a result of DCL processing from dsRNA molecules that are generated by RDR from bidirectional geminivirus transcripts with overlapping 3′ ends, and 2) mRNA folding structures [42]–[43], [45]–[46]. It is proposed that plants employ silencing of DNA by RNA-directed methylation as a strategy to repress geminivirus replication/transcription [47]. This is supported by two major observations; methylation of geminivirus DNA greatly reduces its ability to replicate in protoplasts [48], and the identification of geminivirus RNA silencing suppressor proteins (RSS) C2, C4 and V2 that exert their activity by interference in the process of DNA methylation and transcriptional gene silencing [49]–[56]. Antiviral RNAi defense against geminiviruses thus seems to mostly rely on a methylation-based defence, a process that involves the action of siRNA-directed methylation pathway component Ago4. Although several studies have pointed towards the involvement of RDR1 and RDR6 in the biogenesis of geminivirus-specific siRNAs, the involvement of other antiviral RDRs in this cannot yet be excluded [10], [57]. Besides their role in RNAi, several studies have described other (endogenous) functions of the RDRα (1,2 and 6) genes [58], e. g. being involved in herbivore resistance (RDR1) [59], female gamete formation (RDR2 and 6) [60] or in developmental timing (RDR6) [61]. While a knockdown of RDR from the RDR1/2/6 class renders plants highly susceptible to many different viruses [11], their transcriptional up-regulation has been observed to lead to (elevated) resistance levels against different plant viruses [62]. Viruses are able to counteract RNAi by coding for viral RSS proteins, and many of these have been shown to sequester siRNAs and prevent their uploading into RISC [63]. The presence of a viral RSS, however, does not seem to enable viruses to overcome elevated levels of resistance caused by transcriptional up-regulation of the RDR1/2/6 class of genes. For RDR3, RDR4, and RDR5 a function has not yet been described [64]. How to explain the resistance mechanism of the Ty-1/Ty-3 encoded RDRs remains speculative at present. The resistance spectrum of these alleles is not well studied; Ty-3 also provides resistance to the bipartite Tomato mottle virus (ToMoV), but studies describing disease tests with other geminiviruses on Ty-1/Ty-3 carrying lines are not available [21]. These genes act specifically on geminiviruses; what then is the identity of the (conserved?) Avr protein, and what are the characteristics of resistance breaking isolates? Considering the role of the DLDGD type of RDRs (1,2 and 6) in the generation of secondary siRNAs, irrespective of the RNA virus involved, it is tempting to propose a role of the DFDGD type of RDRs (3,4 and 5), and thus of Ty-1/Ty-3, in the formation of dsRNA too. Since Ty-1/Ty-3 lines are resistant to TYLCV, but still allow for a symptomless (Ty-1) or an almost symptomless (Ty-3) infection with low titres of TYLCV, a resistance strategy as earlier described for the RDRα (1,2 and 6) genes could be possible, where transcriptional up regulation provides (elevated) resistance levels against different plant viruses. In light of this, transcriptional expression analysis of Ty-1 showed elevated expression levels in resistant lines compared to those in susceptible lines, even without TYLCV challenging. Whether differences in the Ty-1 vs. ty-1 protein or just those in transcriptional expression levels, or even a combination of both, are the cause of resistance remains to be investigated. However, since we did not observe hyper-susceptibility in tomato Moneymaker after silencing of the susceptible allele, as what is observed for Potato Virus X (PVX) and potato potyvirus Y (PVY) after silencing of Nicotiana benthamiana RDR6 [14], a function of ty-1 in resistance is highly unlikely. The functionality and transcriptional upregulation of Ty-1 thus seems the most plausible reason to explain the resistance. To solve this issue, transgenic tomato lines (over) expressing either the resistant allele or the susceptible allele will be made. Analysis of the expression level and protein sequence of Ty-1/ty-1 in other resistant/susceptible tomato varieties and wild species will additionally be informative and experiments for these are currently being prepared. The observed resistance specificity of Ty-1/Ty-3 against TYLCV does seem to contradict the idea that its transcriptional up regulation provides (elevated) resistance levels against other geminiviruses unless people have somehow overlooked a partial resistance to other, distinct geminiviruses. Furthermore, it is possible that the RDRγ (3,4 and 5) class of genes may be involved in the generation of siRNAs that will mainly direct methylation of DNA and thereby support transcriptional silencing of geminivirus DNA genomes. If this hypothesis is true, this could explain why these genes will not confer (partial) resistance to most other plant viruses, of which ∼75% harbours an RNA genome and thus cannot be transcriptionally silenced by the siRNA-directed DNA methylation pathway. The possibility of an alternate route for dsRNA formation during geminivirus infections, besides the one involving RDR1/2/6, is being supported by the observations that mutants lacking RDR1, RDR2 and RDR6 still revealed basal levels of RNA silencing and siRNA biogenesis, and plants infected with TYLCV only showed a moderate increase in susceptibility to geminiviruses in plants deficient in RDR2 and 6 [11], [47]. Whether the Ty-1/Ty-3 encoded RDR represents a player in this, and how the resistance mechanism acts, will be a challenge to investigate in the near future. For fine-mapping Ty-1 from S. chilense accession LA1969, a TYLCV-resistant commercial hybrid Tygress with an introgression between markers Mi23 and P6-25, reflecting the same interval as described by Verlaan et al. (2011), was used. This Ty-1 introgression was done by Jaap Hoogstraten of the Royal Sluis Seed Company, and it is different from the LA1969 Ty-1 introgression that was done in Israel [19]. This hybrid was self-pollinated to produce F2 progeny. Through two cycles of selection for recombination in this F2 population, two recombinants were identified and used to generate RILs by selfing and selection with marker genotyping for homozygous introgressions. The first recombination event resulted in a resistant RIL containing a S. chilense introgression flanked by markers Mi23 and HBa0045I03 and was used as a control (named as Ty-1 RIL, Figure 1) in all Ty-1 experiments. Another recombination event resulted in a resistant RIL containing a S. chilense introgression between markers T0774 and HBa0045I03. The susceptible Fla. 7776 was crossed to this inbred and an F2 population was generated. Approximately 2000 F2 plants were screened for recombination between the markers T0774 and SL_2. 40ch06_30. 891 and 13 recombinants were identified. These recombinants were selfed to develop F4 RILs as described before. RILs were evaluated, along with the controls Fla. 7776, Tygress and the Ty-1 RIL in fall 2011. Four week-old seedlings were inoculated with TYLCV for 11 days then transplanted to the field on 4 October in a non-randomized trial with two replications of 4-plant plots. TYLCV disease severity was evaluated on each plant 6 weeks after exposure to whiteflies. For the three most informative recombinants (R7, R8 and R11) results were confirmed in the greenhouse using agroinoculation as described below. Fla. 8680, which contains Ty-3 within an approximately 27 cM introgression from the S. chilense accession LA2779, was crossed to the susceptible breeding line Fla. 7781 to produce an F2 population. F2 plants (n = 717) were individually screened in fall 2006 for recombination between the molecular markers C2_At2g39590 and T0834, located near the distal ends of the introgression. Recombinants selected from this F2 population were used to develop RILs as described above. The F4 and F5 RILs were evaluated for resistance in fall 2007 and spring 2008, respectively, in a randomized complete block design with three blocks and 12-plant plots. To further fine-map the Ty-3 locus, three F2 sub-populations were developed using two key recombinants, i. e. 554 and 157 (Table S3). Sub-population A was an F4 generated by self-pollinating F3 progeny of recombinant 554 which were heterozygous for the introgression; sub-population B was an F2 derived from a cross between the susceptible breeding line Fla. 7776 and the F5 RIL of recombinant 554 (RIL 554). Sub-population C was also an F2 developed from a cross of Fla. 7776 and the F5 RIL of recombinant 157 (RIL 157). Seeds of all three sub-populations were sown and leaf tissue was collected from each plant at approximately 5 weeks after sowing. Sub-populations A and B were screened with the markers Mi23 and P6-25, and the markers T0774 and T0834 were used to screen sub-population C. Recombinants were transplanted to the field, along with controls, in early to mid-March, 2009. Controls included the TYLCV resistant commercial hybrids Tygress and SecuriTY 28, the resistant inbreds Fla. 8680 and Fla. 8602, the susceptible inbreds Horizon and Fla. 7776, RILs 554 and 157 and their F1 hybrids with Fla. 7776. One month after transplanting to the field, 6–8 cuttings were taken from each plant, rooted in a 1∶1 perlite, fine vermiculite media under mist for 2 weeks, then inoculated with whiteflies viruliferous for TYLCV for 11 days. Inoculated cuttings were transplanted to the field on 11 May in a non-randomized design with 3 replications of 2-plant plots, with the exception that only 2 replications were planted for recombinants having cross-overs outside the T0774 to P6-25 interval. TYLCV disease severity was evaluated on each plant at 5–6 weeks after exposure to whiteflies. Self-pollinated seed was harvested from all original recombinant plants, and progeny were grown out in summer 2009 from 26 individuals with recombination between markers SL_2. 40ch06_30. 696 and cLEG-31-P16. Plants homozygous for the recombined introgression were selected for producing RILs. These RILs were grown in spring 2010, along with the controls Fla. 7776, Fla. 8680, the F1 hybrids between Fla. 7776 and each of RILs 554 and 157, and the commercial hybrid Tygress. Three week-old seedlings were inoculated with TYLCV for two weeks then transplanted to the field on 23 March in a randomized complete block design with three blocks and six-plant plots. TYLCV disease severity was evaluated on each plant at seven weeks after exposure to whiteflies. Whitefly mediated inoculation: Plants were inoculated with whiteflies viruliferous for the TYLCV-IL strain according to the method of [65] with some modifications. Briefly, plants were exposed to viruliferous whiteflies in growth chambers for the specified period of time. After inoculation, the whiteflies were killed by treating plants with an insecticidal soap and with Admire (imidacloprid), and the plants were then transplanted to the field. Plants were rated for disease severity on a 0 to 4 disease severity index scale as described by Scott et al. (1996), where 0 = no symptoms and 4 = severe symptoms and stunting. Intermediate scores such as 1. 5,2. 5, etc. were incorporated to allow for more precise disease severity ratings. Agrobacterium mediated inoculation: An infectious TYLCV-IL clone (pTYCz40a) was used for agroinoculation using the method as described in [35]. Briefly, A. tumefaciens LBA4404 was transformed, cultured in LB, pelleted and resuspended in infiltration medium at an OD600 of 0. 5. Three week old seedlings were infiltrated by pressure inoculation in the leaves with a needle-less syringe. For the VIGS experiments the agro infiltration was done two weeks after TRV inoculation. DNA was extracted from young leaves using the cetyltrimethyl ammonium bromide (CTAB) protocol of [66] with minor modifications as described by [67]. Molecular markers used in this study were either publicly available, or were designed using the software Primer3 [68] from Ty-3-region BAC-end sequences, FOS-end sequences, the draft tomato genome available through the Sol Genomics Network (SGN; http: //solgenomics. net/) [36], or from a private database of S. lycopersicum sequences. Polymerase chain reaction (PCR) parameters, primer sequences, restriction enzymes, and detection methods were described by [69] or [35]. Additional molecular markers designed are described in Table S5 and Figure S3, and used the same PCR parameters described by [69]. Analyses of variance, se calculations, and Duncan' s multiple range tests were performed in SAS (Version 9. 1; SAS Institute, Cary, NC). Mapping and interval analysis of Ty-3 was performed in Windows QTL Cartographer 2. 0 (2007, N. C. State University) using mean disease severity of the cuttings for each recombinant and a subset of molecular markers specific to the Ty-3 region. For gene silencing, the TRV based VIGS system as described in [70] was used. Briefly, fragments of approximately 350 base pairs of Solyc06g051160, Solyc06g051180 and Solyc06g051190 were amplified from Ty-1 cDNA using primers compatible with the Gateway system (Table S6). After cloning to pENTR the inserts were sequenced to confirm their identity. Positive clones were selected for further processing of the inserts into the TRV2 vector and subsequently transformed to Agrobacterium tumefaciens strain GV3101. A 3 ml culture of A. tumefaciens strain GV3101 containing the TRV replicons was grown overnight at 28°C, 200 RPM in appropriate selective LB medium. Cultures were transferred to 20 mL LB containing proper selection pressure, 10 mM MES and 200 µM acetosyringone, and further grown overnight in a 28°C shaker. A. tumefaciens cells were pelleted, and resuspended in infiltration buffer (20 g/L sucrose, 5 g/L MS salts (no vitamins), 10 mM MES) to a final OD600 of 1. Agro infiltration was performed on cotyledons of 10 day old seedlings using pressure inoculation with a 2,5 mL syringe without a needle. A neighbour joining tree with a bootstrap value of 1000 was generated using MEGA version 5 [71]. Arabidopsis RDR sequences were downloaded from The Arabidopsis Information Resource (www. arabidopsis. org) [72]. For gene expression analysis, 17 day old seedlings were agroinoculated as described above. For the mock treatment infiltration buffer without bacteria was used. Top leaves of plants were harvested 0,5, 12 and 19 days after TYLCV inoculation and grinded in liquid nitrogen using mortar and pestle. Total RNA was extracted by using the RNeasy Plant Mini Kit (Qiagen) as described by the manufacturer. One µg RNA was digested using DNase I (Amp. Grade) following the manufacturers protocol (Invitrogen) and cDNA was synthesized using the iScript cDNA Synthesis Kit following the protocol (Bio-Rad). Quantitative Real-Time PCR was performed in 10 µl reactions in a Bio-Rad iCycler iQ5 using SYBR Green Supermix (Bio-Rad) according to the protocol provided by the manufacturer. For quantitative RT-PCR of Ty-1/ty-1 the forward primer 180-F1 (5′-GGCAAAATATGCAGCCAGGCTTTCC-3′) and the reverse primer 180-R1 (5′-TCAGTATGTATACGAGGTTCGCCGT-3′) were used. As a reference the ACT gene was used as described by [73] with primers: ACT-F (5′-GAAATAGCATAAGATGGCAGACG-3′) and ACT-R (5′-ATACCCACCATCACACCAGTAT-3′). Gene expression levels were calculated using the ΔΔCt method as described by [74].

Title: The Tomato Yellow Leaf Curl Virus Resistance Genes Ty-1 and Ty-3 Are Allelic and Code for DFDGD-Class RNA-Dependent RNA Polymerases Summary: Tomato yellow leaf curl virus and related begomoviruses cause major economic damage to tomato production in tropical and subtropical regions around the world. Because cultivated tomato is inherently susceptible to these viruses, breeders have incorporated several resistance alleles from wild tomato relatives. Among these are the commercially important alleles, Ty-1 and Ty-3, which were introgressed from the wild tomato relative Solanum chilense. These genes were originally mapped to different regions on chromosome 6, but recent findings suggest they may rather be alleles of the same gene. Here, we describe the precise mapping of Ty-1 and Ty-3 to a common chromosomal region, and we show that Ty-1 and Ty-3 are alleles that code for an RNA-dependent RNA polymerase of a class for which no function had been described before. Thus, Ty-1/Ty-3 unveils a completely new class of resistance genes. These results will be useful to breeders who utilize these genes in their breeding programs, and further studies should shed new light on the mechanism by which this gene functions.

lay_plos

en

Summarize: By. Emma Reynolds. PUBLISHED:. 05:23 EST, 5 November 2012. |. UPDATED:. 02:25 EST, 8 November 2012. Parents and pupils are furious after a religious studies GCSE textbook was discovered to be littered with errors - including a caption that identifies a picture of a Muslim as a Jew. Staff at JFS (formerly known as Jews' Free School) in Kenton, North West London, have had to issue a four-page list of corrections to the 300 pupils using the book to prepare for their exam. The AQA GCSE Religious Studies A: Judaism, produced for the exam board by educational publishers Nelson Thornes, has been branded 'offensive' and 'laughably bad'. Hard to study: The textbook, left, has been slammed for being 'confused' and misleading' for pupils. Right, a picture from the textbook of a kneeling Muslim labelled as a Jew. It not only includes a picture of a Muslim kneeling in prayer described as a Jew - who do not kneel to pray - but also shows a picture of a family 'celebrating Shabbat', when in fact they are having a Passover Seder meal. Shabbat, or Sabbath, is a weekly day of rest and spiritual enrichment and the most important ritual observance in Judaism, while the Passover Seder is a Jewish ritual feast that marks the beginning of the Jewish holiday, conducted on one or two evenings in March or April, on the 14th and 15th day of Nisan in the Hebrew calendar. The blunders are especially embarrassing for AQA after it was accused of 'justifying' anti-semitism in schools in May of this year, when one of its exam papers asked GCSE. pupils to explain 'why some people are prejudiced. against Jews'. One pupil said: 'It was so bad, the teacher kept telling us, "don't listen to this, ignore this, half of this is wrong".' The mother of a JFS pupil told the Jewish Chronicle: 'The textbook contains countless errors and general, confused assertions about Judaism. The factual errors are laughably bad. Clanger: The textbook says that this family is celebrating Shabbat, when in fact they are having their Passover seder meal. 'A section headed "Reform Judaism" in. fact talks about the practice of Orthodox Jews. A picture of a person. kneeling in prayer, described as a Jew, is in fact a Muslim. 'Other. assertions in the text, including commentaries on women who wear wigs,. and why Jews think they do what they do, are misleading and offensive'. AQA has become infamous for errors in its exam questions and marking. It is a concern for pupils battling to get the best grades possible in GCSE and A-level exams:. (2010) (2011) (2012) She claimed that JFS had to contact AQA to confirm that if students used the correct information about Judaism it. would not be marked incorrect by examiners because it did not tally. with the information in the textbook. Religious studies GCSE is a compulsory exam at many schools and a new textbook is now in production. A spokesperson for AQA said: 'AQA doesn't publish textbooks. We do liaise with publishers to try to ensure references to our syllabus are accurate; however the publisher is responsible for the content of the book and, therefore, any errors. 'JFS brought the errors to our attention and we raised them with the publisher. This book is being reprinted by the publisher and we have asked them to address these concerns. 'The reprinted book will no longer carry the confirmation that it covers our syllabus, because of the serious level of concern we have flagged to the publishers about their errors.' The school's headteacher, Jonathan Miller, said he had worked closely with AQA over the past year and was pleased there would be a new draft of the textbook. Steven Mintz, the head of Jewish studies at Manchester's King David High School, confirmed that he had co-written the textbook, but declined to comment further. This is not the first time AQA has come under fire for its association with mistakes that could affect pupils' exam grades. In the summer of 2010, 13 A-level students missed out on university places after marking errors by the exam board left them with lower grades than they should have received. The errors occurred when a failure with AQA's online system meant that not all of students' material was marked, an inquiry found. The awarding body was criticised for not piloting its system properly, and for a delay in reporting the problem to exam regulators - meaning students were got given the university places they deserved. In June 2011, thousands of pupils sat an AQA GCSE Maths test in which two-thirds of the questions were identical to ones they had answered in a paper just three months earlier. This year, there were complaints over an 'unfair' AQA English language GCSE, after pupils who took the exam in January found it easier to gain C grades than those who sat it in the summer

Summary: Exam board-approved textbook gets key facts about religion wrong. It shows a picture of a Muslim praying - and claims it is actually a Jew. Teachers forced to tell pupils: 'Ignore this book' AQA was accused of 'justifying' anti-semitism in May of this year, when one of its GCSE exam papers asked why people are prejudiced against Jews. It has also made previous blunders with exam questions and marking.

cnn_dailymail

en

Summarize: A businessman jailed for fraud after being'swallowed' by his addiction to online gambling has written a repentant letter to his family revealing the double life he kept from them for 30 years. David Bradford, 58, of Waterthorpe, Sheffield, was jailed for two years in April after swindling a Welsh company out of more than £50,000 to repay private bank loans and secret gambling debts. His wife Denise and three children had no idea he was in trouble until his sentencing - and the father recently decided to come clean to them, telling them about the'money bug' that wrecked their family. Happier times: David Bradford (right) is pictured with son Adam, (left) who was unaware that his father had a gambling problem and was thousands of pounds in debt until the day before his sentencing. In a repentant letter from behind bars, the former chair of governors at a children's school, who was paid £71,000 a year in his role for a healthcare supplies company, said he was'stung by the power of money'. He said a love of money led to a mountain of debt which sparked his pursuit of a quick 'win'. Bradford has appealed to anyone falling into a similar situation to seek help and support at the first sign of trouble. In the letter, he writes: 'This is my truth. I am a fraudster. I am a gambler, maybe a compulsive gambler. 'I discovered money talked and those dreams on the horizon could be brought closer. The'money bug' was a disease idolised by all. 'I became a keen follower. I did not have to look far to find a bank or organisation that would lend me money and it seemed this was the way one bettered oneself. Warning: Adam Bradford, (above) who received a letter from his father from prison, has warned people about the dangers of online gambling and has started a campaign calling for tighter regulations on the industry. 'I was swallowed down this tunnel to a point where I could only borrow money to finance the repayments of earlier borrowing, a self-perpetuating and self-defeating spiral of debt. 'I never shared the state of my debt ridden life - not with my family, not even with myself. 'This part of my life has an unknown beginning buried by me in my mind under lock and key. 'Along this journey of deceit I took to gambling - firstly as a way of making a quick win to kill this mountain of debt and then, as it failed to live up to those expectations, it became an escape with potential to cure my money ailments. 'The atmosphere of my life was turning very sour and yet I still was not brave enough to openly admit the absolutely devastating money mess I was burying myself in. 'But the atmosphere can be sourer, more putrid and in my dark side this was the natural course to take - fraud!' Mr Bradford said he gambled 'like it was an Olympic sport'. 'This is my truth. I am a fraudster. I am a gambler, maybe a compulsive gambler. 'I discovered money talked and those dreams on the horizon could be brought closer. 'The'money bug' was a disease idolised by all. 'I became a keen follower. I did not have to look far to find a bank or organisation that would lend me money and it seemed this was the way one bettered oneself. 'I was swallowed down this tunnel to a point where I could only borrow money to finance the repayments of earlier borrowing, a self-perpetuating and self-defeating spiral of debt. 'I never shared the state of my debt ridden life - not with my family, not even with myself. 'This part of my life has an unknown beginning buried by me in my mind under lock and key. 'Along this journey of deceit I took to gambling - firstly as a way of making a quick win to kill this mountain of debt and then, as it failed to live up to those expectations, it became an escape with potential to cure my money ailments.' Now, the Bradford family face losing their home in Sheffield, South Yorkshire, and say their lives have been left in turmoil by the revelations. He added: 'Now my family do not trust me and all my good points count for nothing. My friends have retreated and are ashamed even to call me an acquaintance. 'My colleagues, my MP and most who know me have put a big distance between me and them. I would do the same if I was them. 'My sentence extends to a family distraught, a family set to lose everything now. My friends' views of me are tainted and I am damaged forever. 'If anyone sees a little piece of themselves in my story may I offer them this advice - never lie. Seek help and support at the first sign of trouble.' His son Adam, 21, claimed after the sentencing that he 'was in absolute disbelief and disgust' at his father's actions. The young businessman has now launched a campaign calling for tighter regulations and control of the online gambling industry to protect those suffering from compulsive behaviours. He said: 'We will lose everything we've got. Our house is on the line, our life is in turmoil and my father is similarly suffering from psychological problems. 'Life will never be the same for us and my dad's letter shows for the first time how dangerous compulsive behaviour can be, made ever worse by the availability of money and gambling in the modern world. 'I hope my father's story and honesty helps others to know this situation is not as rare as it sounds, help and support is available. Do not be afraid to reach out and access it.' Apologetic: The fraudster sent four pages of scrawling writing to his family, in which he came clean about the double life that he had kept from them for 30 years. Confession: In the heartfelt letter Bradford writes 'I was swallowed down this tunnel to a point where I could only borrow money to finance the repayments'

Summary: David Bradford, 58, of Sheffield, jailed in April for defrauding firm of £50,000. He had developed a secret gambling habit to pay off his mountains of debt. Family were left in dark and only learned of fraud the night before sentencing. Financial controller has written to them explaining why he committed crime. Heartfelt letter says he 'was swallowed into self-defeating spiral of debt' Son, Adam, 21, now campaigning for tighter regulation in gambling industry.

cnn_dailymail

en

Summarize: These crawls are part of an effort to archive pages as they are created and archive the pages that they refer to. That way, as the pages that are referenced are changed or taken from the web, a link to the version that was live when the page was written will be preserved.Then the Internet Archive hopes that references to these archived pages will be put in place of a link that would be otherwise be broken, or a companion link to allow people to see what was originally intended by a page's authors.The goal is to fix all broken links on the web. Crawls of supported "No More 404" sites. Ellen Page Death Threats 'Needs To Die In My Hands' Ellen Page Receives Death Threats Over Instagram EXCLUSIVE Ellen Page has been getting death threats on her Instagram and now the LAPD is on the hunt for the culprit. The perp sent several messages, including one calling her a "lying worthless Canadian" and a "bitch actress" who "needs to die in my hands." It didn't stop there. Another message read, "I find Ellen and kidnap her and kill her throat and let everyone see it on my Instagram." Detectives got a search warrant last month so they could trace the IP address of the IG name, but we're told so far no arrests. Despit­e threat­s, she defian­tly contin­ues to post pictur­es on her social media accoun­t X-men star Ellen Page has been receiving death threats on her Instagram account, prompting the Los Angeles Police Department to launch an investigation, MailOnline reported. One Instagram user expressed the need to pursue the 30-year-old actor and post photos of her death online as evidence. According to TMZ, one threat read: “I find Ellen and kidnap her and kill her throat and let everyone see it on my Instagram [sic].” A post shared by @ellenpage on May 21, 2017 at 10:21pm PDT The actor who played Kitty Pryde in X-Men was also labelled a “b****'” and a “lying worthless Canadian” by the Instagram user, who claimed she must “die in my hands”. Despite the threats, the actress has defiantly continued to post pictures on her social media account as she shared her last post in the early hours of Sunday morning. ❤️ #Wiig A post shared by @ellenpage on Jul 22, 2017 at 8:58pm PDT Police ascertained a search warrant in June and are reportedly on the hunt to trace the IP address of the Instagram user who made the threats. Selena Gomez receives death threat However, no arrests to date have been made in connection with the death threats. Ellen’s return to Instagram signals a busy time for the star, who has two films Flatliners and Mercy set to be released later this year. Earlier this month, Ellen scooped an Emmy Award nomination for her globe-trotting docu-series Gaycation, which is an unstructured reality show. The beauty was seen celebrating her nod with a passionate smooch with dancer Emma Portner outside the Café Gratitude located in LGBTQ-friendly West Hollywood. The kiss appears to signal an end to her long-term relationship with artist and surfer Samantha Thomas as they were last pictured together in January. The Oscar nominee famously came out three years ago during a speech at the Human Rights Campaign’s ‘Time to Thrive’ conference in Las Vegas. Tiny Detectives taking off to solve a new case. ❤️️‍♀️ @katemara A post shared by @ellenpage on May 16, 2017 at 12:16pm PDT “I’m so stoked to get married,” Ellen told THR that same year. “I’m such a romantic, it’s awful. And I don’t think I’d want to make a kid, but I’d love to raise one. I’d love to raise a kid.” Ellen was linked to several men including Mark Rendall, Alexander Skarsgard, Elijah Wood, Ben Foster, Sam Riley, Frankie Muniz, and Emile Hirsch. Read full story

Summary: "I find Ellen and kidnap her and kill her throat and let everyone see it on my Instagram." This unnerving message was just one among many posted to actress Ellen Page's Instagram page, and now LAPD is getting involved. TMZ reports that detectives obtained a search warrant in June to trace the menacing Instagram user's IP address. Other threatening messages sent by the user called Page a "lying worthless Canadian" and a "b**** actress" who "needs to die in my hands." Despite the threats, Page continues to post regularly on Instagram to her 1.1 million followers. Per the Express Tribune, Page has two films, Flatliners and Mercy, coming out this year, and recently received an Emmy nod for her travel docu-series, Gaycation. No arrests in connection with the actress' social media threats have yet been reported.

multi_news

en

Summarize: CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims the benefit of Provisional Patent Application No. 61/532,280, filed Sep. 8, 2011. FIELD OF THE INVENTION [0002] The present invention generally relates to therapeutic devices and the like and methods for providing comfort from and in mitigating the effects of hot flashes caused by the hormonal changes brought about by menopause and perimenopause. BACKGROUND OF THE INVENTION [0003] It is well known that hot flashes are a common symptom of menopause and hot flash manifestations are suffered predominantly by women. Hot flashes are also a common side effect from the use of such pharmaceutical compounds as Tamoxifen, or other aromatase inhibitors. Men have also reported hot flashes as a result of their treatment for certain forms of cancer. There are pharmaceutical treatments, injected or taken orally, and herbal remedies and the like, available to fend off the discomfort of hot flashes. U.S. Pat. No. 5,956,963 describes a wrist cooler which the inventor contends offers relief for hot flash symptoms of menopause and body overheating. The wrist cooler includes pellets that are broken to provide cooling in a one-time use manner. U.S. Pat. No. 5,545,199 describes a hot and cold therapeutic pillow that contains a gel pack that may be heated in a microwave oven or cooled by freezing. [0004] It is also known to block the stellate-ganglion by injecting a local anesthetic in the sympathetic nerve tissue of the neck to reduce the number of hot flashes and night awakenings suffered by breast cancer survivors and women experiencing extreme menopause. The stellate ganglion (or cervicothoracic ganglion or inferior cervical ganglion) is a sympathetic ganglion formed by the fusion of the inferior cervical ganglion and the first thoracic ganglion, located at the level of the C7 (7th cervical vertebrae), anterior to the transverse process of C7, anterior to the neck of the first rib, and just below the subclavian artery. Such treatments require clinical procedures. BRIEF SUMMARY OF THE INVENTION [0005] The present invention overcomes the foregoing drawbacks by providing a reusable therapeutic cooling pillow that can be applied to the body of a person in need of relief from hot flashes or body overheating or insomnia. Insomnia is one of the key symptoms of overheating. The apparatus can be applied around the neck area works to reset the body&#39;s thermostat naturally, via chilling the Stellate Ganglion, which, in turn, quells hot flashes, night sweats, and relieves insomnia because cooling the brain induces sleep. In its broader application, the apparatus can be applied to any part of the body where icing is desired, (for example by wrapping it around the hand, foot, or knee, to treat a burn or an athletic injury) because the chill it provides is uniform, lengthy, and dry, maintaining maximum cold for thirty minutes. [0006] In a particular embodiment, the apparatus drapes over the stellate-ganglion area of the neck to relieve hot flashes, body overheating or insomnia. Of significant importance, solid pellets are used as filler for the pillow, the pellets having sufficient weight and flow properties to provide a comforting wrapping effect on the back of the neck. In a specific important embodiment of the invention, the pillow is filled with raw, natural whole grains composed of its bran, germ, and endosperm. In its most advantageous form, the pillow is filled with reddish, natural wheat berries (also referred to as wheatberries), which the inventor has found to provide the unique ability to be easily cooled in the freezer compartment of a refrigerator, but which when applied over the back side of the neck of a user retains its coolness for a time sufficient to provide the desired relief. [0007] In a further embodiment of the invention, the pillow comprises an inner elongate sleeve, closed at one end and open at the other end to receive the pellets. It is preferably of muslin, such as is formed from unbleached or white cloth produced form carded cotton yarn. The inner sleeve is filled with the solid pellets, and then closed, e. g., with opposing Velcro strips sewn to the inner surfaces of the open end of the inner sleeve. The inner sleeve is inserted into an outer sleeve of about the same size of soft cotton and can bear a decorative design. It also is closed at one end and open at the other end to receive the inner sleeve, then also closed with opposing Velcro strips sewn to the inner surfaces of the open end of the outer sleeve. BRIEF DESCRIPTION OF THE DRAWINGS [0008] For a more complete understanding of the present invention, reference is now made to the following descriptions taken in conjunction with the accompanying drawing, in which: [0009] Referring to FIG. 1, a perspective view of the therapeutic pillow 10 of this invention; [0010] FIG. 2 is a perspective view of the therapeutic pillow of FIG. 1 shown placed on the neck of a user to relieve hot flashes; [0011] FIG. 3 is a view of the open end of the outer sleeve of the pillow of FIG. 1 showing the end of an inner sleeve inserted therein; [0012] FIG. 4 is a perspective view of the filled inner sleeve of the pillow of FIG. 1 and partially shown in FIG. 3 ; [0013] FIG. 5 is a view of the open end of the inner sleeve of FIG. 4 and showing wheat berries therein; [0014] FIG. 6 shows wheat berries that are used to fill the inner sleeve of FIG. 4 as partially shown in FIG. 5 [0015] FIG. 7 is a planar view of a sheet of muslin used to form the inner sleeve; [0016] FIG. 8 is a planar view of the sheet of muslin of FIG. 7 folded in preparation for sewing one end and the elongate edge; [0017] FIG. 9 is a planar, partially perspective, view of a sheet of soft cotton used to form the outer sleeve of the pillow; and [0018] FIG. 10 is a planar view of the sheet of soft cotton of FIG. 9 folded in preparation for sewing one end and the elongate edge. DETAILED DESCRIPTION OF THE INVENTION [0019] Referring to FIG. 1 is a perspective view of the therapeutic pillow 10 of this invention. It is flexible, and has an outer sleeve cover 12 formed from soft cotton and bears a color or pattern as desired. The pillow is kept in the freezer compartment of a refrigerator so it is ready to use when needed, such as when one is disturbed by hot flashes, night sweats, an overheated body, insomnia, menopausal or perimenopausal symptoms, or andropause in men. As shown in FIG. 2, the therapeutic pillow is draped over the neck of a user 14 on the stellate-ganglion area of the neck to relieve hot flashes and the like. [0020] The cooled pillow can be used while sitting, standing, walking, or lying down. It contains filler that is chosen to have sufficient weight and flow properties to provide a comforting wrapping effect on the back of the neck and feels exquisitely comfortable when applied directly on bare skin. It requires no preparation, just storing in a freezer prior to use. Because of the nature of its filler can fold in half to save freezer space. It has a machine washable outer sleeve, is easily portable and made to last. [0021] FIG. 3 is a view of the open end 16 of the outer sleeve 12. The outer sleeve 12 is made of soft cotton and can bear a decorative design. It is fitted with opposing hook and loop Velcro strips 18 and 20 sewn to the inner edge surfaces of the open end 16. A portion is shown of the end of an inner sleeve 22 inserted into the outer sleeve 12, which is about the same size as the inner sleeve 22. After the inner sleeve 22 is filled and closed and slid into the outer sleeve 12, the outer sleeve 12 is closed by “zipping” the Velcro strips 18 to form the pillow 10. [0022] FIG. 4 shows the filled inner sleeve 22. The inner sleeve 22 is made of muslin, such as is formed from unbleached or white cloth produced form carded cotton yarn. FIG. 5 is a view of the open end 24 of the inner sleeve 22. It is fitted with opposing hook and loop Velcro strips, one of which is shown at 26, sewn to the inner edge surfaces of the open end 24. A portion of wheat berries 28 is shown inside the inner sleeve 24. The inner and outer sleeves 12 and 22 are each about 18 inches long, 5½ inches wide and 1½ inches thick. The inner sleeve 22 contains 2½ pounds of the wheat berries 28, which together with the dimensions of the inner and outer sleeves, has sufficient weight and flow properties to provide a comforting wrapping effect on the back of the neck. [0023] FIG. 6 shows the 2½ pounds of wheat berries 28 measured out in a container 30 used to fill the inner sleeve. The wheat berries, also referred to as wheatberries, are reddish, raw, natural whole grains composed of its bran, germ, and endosperm. The inner sleeve 22 is filled with the wheat berries and closed and slid into the outer sleeve 12. The outer sleeve 12 is closed by “zipping” the Velcro strips 18 to form the pillow 10. [0024] The inner sleeve 22 is constructed from a sheet of muslin 32 shown in FIG. 7, which is folded over as shown in FIG. 8. The folded sheet is sewn along its left and top edges to form the elongate inner sleeve 22. Velcro strips, one of which 18 is shown, is sewed to the inner edges of the open end 24 of the sleeve 22. Muslin is formed from unbleached or white cloth produced form carded cotton yarn, and provides a strong container when the Velcro strips are “zipped” together. [0025] The outer sleeve 12 is constructed from a sheet of soft cotton 34 to enable it to have a soft feel to the skin. It can be decorated with a pattern, design or logographic. The cotton sheet 34 forming the outer sleeve is shown in FIG. 9, which is folded over as shown in FIG. 10. As with the inner sleeve 22, the material 34 for the outer sleeve 12 is sewn along its left and top edges to form the elongate outer sleeve 22. Velcro strips, one of which 26 is shown, is sewed to the inner edges of the open end 16 of the sleeve 22. [0026] Although the present invention has been described in connection with the preferred embodiments, it is to be understood that modifications and variations may be utilized without departing from the principles and scope of the invention, as those skilled in the art will readily understand. Accordingly, such modifications may be practiced within the scope of the following claims.

Summary: An apparatus and method of relieving hot flashes or body overheating or insomnia by applying to the body of a person in need of relief therefrom a cooled elongate flexible pillow filled with pellets having sufficient weight and flow properties to provide a comforting wrapping effect on the back of the neck. A preferred filler is wheat berries. In a particular embodiment, the pillow is draped over the stellate-ganglion area of the neck.

big_patent

en

Summarize: Chinese Gmail users have been unable to access their accounts since Friday after the service was apparently blocked across the country. Google data shows real-time traffic to its email service in China dropping significantly on 26 December - and this traffic has not yet been restored. It has also been reported that users of Google's search engine have today been hit with the same issue. Gmail users in China have been unable to access their accounts since Friday. The block is said to be a move by the government to crack down on outside web services. However, the Foreign Ministry said it wasn't involved and added it was committed to providing a good business environment for foreign investors. It is said to be the latest move by the Chinese government to crack down on outside web services, but the Foreign Ministry has denied any involvement. Earl Zmijewski, vice president of data analytics at the New Hampshire firm Dyn, told the Washington Post the changes aren't accidental. 'This was deliberate,' Zmijewski says. 'It was pushed out to the whole country at once.' The gmail block was reported by GreatFire.org - a China-based freedom of speech advocacy group - and was later confirmed by Dyn Research group, and Google's Transparency Report. Google's report tracks and monitors ongoing disruptions to Google services around the globe. Traffic is shown rising and falling at normal levels in the build up to Christmas, before dropping at the start of Boxing Day, and plummeting further as the day went on. China has a history of censoring sites that have potential to distribute anti-government content. It has previously blocked services including Facebook and Twitter. In 2010, Google partially removed its search engine from the country after a cyberattack was linked to the accounts of human rights activists. Instead, the company routed users visiting its Chinese site through Hong Kong. Earlier this year, a number of Google services were disrupted ahead the 25th anniversary of of China's crackdown on pro-democracy activists in Tiananmen Square on 4 June. GreatFire.org has blamed the latest Gmail block on the government, and Google said it has not been caused by a problem with its servers. However, the Foreign Ministry has denied any involvement. Users are still reporting problems this morning - but the exact number of affected accounts is not known. 'I think the government is just trying to further eliminate Google's presence in China and even weaken its market overseas,' said a member of GreatFire.org, who used a pseudonym. 'Imagine if Gmail users might not get through to Chinese clients. 'Many people outside China might be forced to switch away from Gmail.' And a Singapore-based spokeman for Google said: 'We've checked and there's nothing wrong on our end.' Almost all of Google's services have been heavily disrupted in China since June this year, but until last week Gmail users could still access emails downloaded via protocols like IMAP, SMTP and POP3. These had let people communicate using Gmail on apps such as the Apple built-in Mail app and Microsoft Outlook. The latest so-called block restricts access from an IP level, which means it catches people trying to access the service on any device or app when connected to a network. China has a history of remaining tight control over the web, and challenging services that appear disruptive to the ruling Communist Party's leadership. The country is host to the world's most sophisticated internet censorship mechanism, known as the Great Firewall of China. Google's Transparency Report (pictured) shows real-time traffic to Gmail dropping significantly on 26 December. Traffic is shown rising and falling at normal levels last week, before dropping at the start of Friday. Users are still reporting problems this morning, but exact number of affected accounts is not known. The block was reported by GreatFire.org - a China-based freedom of speech advocacy group - and was later confirmed by Dyn Research group on Twitter (pictured) Critics say China has stepped up its disruption of foreign online services like Google over the past year to create an internet cut off from the rest of the world. The Google disruption began in the run-up to the 25th anniversary of the government's crackdown on pro-democracy demonstrators in Beijing's Tiananmen Square on 4 June, 1989. However, Chinese Foreign Ministry spokeswoman Hua Chunying said she did not know anything about Gmail being blocked, adding the government was committed to providing a good business environment for foreign investors. 'China has consistently had a welcoming and supportive attitude towards foreign investors doing legitimate business here,' she said. 'We will, as always, provide an open, transparent and good environment for foreign companies in China.' One way for companies and people to get around China's internet censorship is to use a Virtual Private Network (VPN) which allows unhindered access to blocked sites and services. 'It's becoming harder and harder to connect and do work in China when services like Gmail are being blocked,' said Zach Smith, a Beijing-based digital products manager at City Weekend magazine. 'Using a VPN seems to be the only answer to doing anything these days online in China.'

Summary: Gmail users have been unable to access accounts in China since Friday. Google data reveals traffic to its services dropped on 26 December. Users are still reporting issues but number of people affected isn't known. It is said to be a move by the Chinese government to crack down on outside web services. But the Chinese Foreign Ministry has denied any involvement in the block. Block was reported by Chinese advocacy group GreatFire.org. It was later confirmed by Dyn Research and Google's Transparency Report.

cnn_dailymail

en

Summarize: By. Helen Pow. PUBLISHED:. 15:14 EST, 21 November 2013. |. UPDATED:. 15:55 EST, 21 November 2013. Thousands of Arizona children may be suffering abuse despite bravely calling government help hotlines that then ignored their pleas for help. A shocking 6,000 potential child abuse cases have gone uninvestigated since 2009 because a blunder in the system meant the calls were misclassified, the state's director of child welfare revealed today. And the department also admitted it had no idea if those children are still at risk of abuse. Department of Economic Security Director Clarence Carter said all 6,000 cases will be reviewed after they were incorrectly logged as not requiring investigations by a staffer in the agency's call center. Shocking discovery: A frightening 6,000 potential child abuse cases have gone uninvestigated since 2009 because a blunder in the hotline system meant the calls were misclassified, the state's director of child welfare revealed today. Responsible: Clarence H. Carter, left, Director of the Arizona Department of Economic Security, said Governor Jan Brewer, right, was livid and holding him responsible. They learned of the error after the introduction of a new hotline process in January led to the number of cases rapidly escalating. A probe then revealed the system had been failing children for more than four years. According to Azcentral.com, CPS caseloads are currently 77 per cent above standards. At least 125 cases already have been identified where children subsequently became the subject of child abuse investigations. Arizona's Child Protective Services department has been one of Governor Jan Brewer's major priorities. Brewer's response to the unbelievable news was 'unprintable.' 'I have never seen my boss with such a combination of anger and sadness,' he said, according to AzCentral.com. The director, who has been in his post for three years, added that while he felt he still had the governor's support, 'I did get the sense she is holding me responsible.' A lot at stake: At least 125 cases already have been identified where children subsequently became the subject of child abuse investigations (stock photo) In January, Brewer signed a bill allowing the immediate hiring of 50 new CPS workers after the state Legislature overwhelmingly approved her emergency request for $4.4 million. She was surrounded by Senate and House members from both parties in a rare example of bipartisan cooperation. There was no opposition to the measure in either chamber. Of the 6,000 reports, 5,000 have come into the state hotline in the last 20 months. In addition to the internal review, the Arizona Department of Public Safety to look over the process the agency has used to classify cases. Arizona politicians slammed the discovery at a legislative oversight hearing this afternoon in the state Senate. 'This has to come out,' said Phoenix Republican Kate Brophy McGee who is co-chair of the oversight committee on CPS. 'I am hopeful it's the start to finding solutions to what the heck is going on.' She added: 'I've just had this horrible feeling that something is so wrong, and has been so for so very long. This seems to be a systemic issue, and maybe this is the start of unwinding the problems. We can fix them. This is an enormous finding, an enormous one.'

Summary: A shocking 6,000 potential child abuse cases have gone uninvestigated since 2009. This is because a blunder in the system meant the call to government hotlines were misclassified as not requiring an investigation, the state's director of child welfare revealed today. The department admitted it had no clue whether those children whose pleas for help were ignored are still at risk of abuse. At least 125 cases already have been identified where children subsequently became the subject of child abuse investigations. Governor Jan Brewer's response to the shocking news was reportedly 'unprintable'

cnn_dailymail

en

Write a title and summarize: Hantaviruses are important emerging human pathogens and are the causative agents of serious diseases in humans with high mortality rates. Like other members in the Bunyaviridae family their M segment encodes two glycoproteins, GN and GC, which are responsible for the early events of infection. Hantaviruses deliver their tripartite genome into the cytoplasm by fusion of the viral and endosomal membranes in response to the reduced pH of the endosome. Unlike phleboviruses (e. g. Rift valley fever virus), that have an icosahedral glycoprotein envelope, hantaviruses display a pleomorphic virion morphology as GN and GC assemble into spikes with apparent four-fold symmetry organized in a grid-like pattern on the viral membrane. Here we present the crystal structure of glycoprotein C (GC) from Puumala virus (PUUV), a representative member of the Hantavirus genus. The crystal structure shows GC as the membrane fusion effector of PUUV and it presents a class II membrane fusion protein fold. Furthermore, GC was crystallized in its post-fusion trimeric conformation that until now had been observed only in Flavi- and Togaviridae family members. The PUUV GC structure together with our functional data provides intriguing evolutionary and mechanistic insights into class II membrane fusion proteins and reveals new targets for membrane fusion inhibitors against these important pathogens. The Bunyaviridae is a large and diverse virus family of human, animal and plant pathogens that encompasses five genera; Phlebovirus, Orthobunyavirus, Hantavirus, Nairovirus and Tospovirus. Members of the Hantavirus genus are rodent-borne zoonotic viruses and are important human pathogens responsible for severe illnesses such as hemorrhagic fever with renal syndrome (HFRS), and hantavirus pulmonary syndrome (HPS) [1–4]. Puumala virus (PUUV), the causative agent of a mild form of HFRS was first isolated in Finland [5]. In humans, PUUV infection is mostly asymptomatic or manifested with minor symptoms. However, outbreaks were recently reported in central Europe with growing numbers of affected patients [6–8]. The bank vole (Myodes glareolus) is the main reservoir of the virus and transmission to humans occurs typically via aerosols of the rodent excreta with no role for arthropod vectors. Hantaviruses encompass a tripartite, negative sense ssRNA genome. The viral medium (M) segment encodes the two glycoproteins, GN and GC, originating from a glycoprotein precursor (GPC) that is cleaved into N- and C-terminal fragments [9–11]. GN and GC assemble into a lipid bilayer envelope to form an outer protein shell. The non-continuous, pleomorphic envelope projects GN and GC as a spike complex bearing an apparent four-fold symmetry [12]. Recently, the atomic resolution structure of GN was published and together with electron cryo-tomography data it was proposed to be located at the membrane distal part of the spike complex [13]. However the structure, orientation and stoichiometry of GC within the spikes remain unclear. To deliver their RNA genome into the host cell cytoplasm, hantaviruses must fuse their envelope with a cellular membrane. Like other enveloped viruses, hantaviruses rely on their glycoproteins to induce membrane fusion [14]. Following attachment to the host cell, hantaviruses usually undergo clathrin-mediated endocytosis (CME). Interestingly, clathrin-independent endocytosis was reported for some hantaviruses [15,16], implying that different routes may be involved in these viruses entry. In both routes, however, the virus is directed to an endosomal compartment where the glycoproteins respond to the reduced pH of the compartment with a sequence of conformational changes [17]. These conformational changes expose a hydrophobic motif, which is inserted into the endosomal membrane [18,19]. The glycoprotein then folds back on itself, forcing the cell membrane (held by the fusion motif) and the viral membrane (held by a transmembrane anchor) to proximity, inducing the viral and endosomal membranes to fuse [20–22]. Based on bioinformatic studies and in vitro experiments using synthetic peptides it was postulated that hantavirus GC adopts a class II membrane fusion protein fold [23,24]. Until recently, viral class II fusion proteins were thought to be restricted to members of the Flavivirus genus (family: Flaviviridae) and the Togaviridae. However, the crystal structure of GC from Rift Valley fever virus (RVFV—family Bunyaviridae, genus: Phlebovirus) showed that the class II fold extends beyond these two families [25]. Interestingly, not all Flaviviridae members contain a class II membrane fusion protein as bovine viral diarrhea virus (BVDV, genus: Pestivirus) E2 protein and hepatitis C virus E2 (HCV, genus: Hepacivirus) exhibit completely different folds in their proposed fusion proteins [26,27]. In the absence of high-resolution structures for the complete E1 proteins from these viruses this data suggests that BVDV and HCV (flavivirus) fusion proteins do not adopt a class II fold. The transition of class II membrane fusion proteins from their pre-fusion homo- or heterodimers on the virus surface to a post-fusion homotrimer has been shown to depend on the acidification of the virus’ environment [21,28–30]. Recently, Acuña and colleagues have shown that GC from Andes virus (ANDV, genus: Hantavirus) forms trimers in response to acidic environment at pH 5. 5 [17]. Hantavirus fusion activity was also demonstrated by syncytia formation upon low pH treatment of Vero E6 cells expressing GN and GC glycoproteins [14,31]. In this cellular context, a pH of 5. 9 was found to activate fusion of Andes virus while a pH of 6. 3 was reported as the activation threshold for Hantaan virus [14,32]. In the absence of experimental high-resolution structural data for GC, the molecular basis of membrane fusion in hantaviruses remains obscure. Here we present the first high-resolution structure of a fusogen from the hantavirus genus. The ectodomain of PUUV GC spans residues 659–1114 (GPC numbering, 1–456 in GC numbering). To obtain soluble protein for structural studies, we expressed only PUUV GC residues 659–1106 (1–448, soluble GC or sGC) using baculovirus expression system and purified it to homogeneity (see material and methods). During the elution step of ion exchange (IEX) chromatography we obtained two populations (termed sGCXF1 and sGCXF2) that each crystallized in a distinct crystal form. We then determined the crystal structures of sGCXF1 and sGCXF2 to 1. 8 Å and 2. 5 Å resolution, respectively, with excellent crystallographic statistics (Table 1). Although sGCXF1 crystals appeared in pH 6. 0 and sGCXF2 in pH 8. 0, in both crystal forms PUUV sGC adopts the three-domain architecture of the post-fusion conformation of class II viral fusion proteins. It is not unprecedented that some class II membrane fusion proteins were crystallized in their post-fusion conformation without low pH triggering [33,34], however we cannot exclude that for sGCXF2 the pH was not changed during the crystallization period. The overall structure in both crystal forms is similar so to simplify our discussion we will refer mainly to the sGCXF1 unless mentioned otherwise. Viral class II membrane fusion proteins were found previously only in flaviviruses, alphaviruses, rubivirus and more recently in a phlebovirus [25,35–37] (Figs 1, S1). The crystal structure of PUUV sGC spans residues 666–1076 (GPC numbering), lacking seven N-terminal and 30 C-terminal residues of the expressed ectodomain. Domain I, an eight-stranded β-sandwich (with strands termed B0-I0), is the center of the structure that arranges domain II and III around it (Fig 1). Two insertions in domain I between strands D0-E0 and strands H0-I0 form the elongated, mostly β-stranded domain II. The putative fusion loop, the endosomal membrane anchor, is located on the part of domain II that is distal to domain I. Domain III is an IgC-like module with six β-strands and is followed by a segment of eight amino acids of the so-called stem region. Compared to fusion proteins from flaviviruses and alphaviruses, PUUV GC has a longer stem region connecting domain III to the transmembrane (TM) domain. The stem region of PUUV GC spans approximately 44 residues, including two conserved cysteines (S2 Fig). Due to its disordered nature we could not detect electron density for most of this region. However, the first eight residues of the stem (1068–1076) could be modeled in both, sGCXF1 and sGCXF2. The last residue visible in both of our structures is T1076, which lays ~30 Å from the fusion loop (Fig 1). The remaining 38 residues connecting to the TM anchor can easily cover the distance to the fusion loop. The overall domain organization (in particular the position of domain III), the parallel trimeric assembly and the stem peptide directionality imply that our structure represents sGC in its post-fusion conformation, or at least in the final stages of the fusion between the viral and the host-cell membranes. PUUV sGC from both preparations (sGCXF1 and sGCXF2) is a monomer in solution as determined by size exclusion chromatography (SEC) (S3A Fig). To investigate the oligomeric state of sGC at different pHs, we used size exclusion chromatography combined with multiangle light scattering (SEC-MALS) at pH 8. 0 and pH 5. 0. Unexpectedly, we found that low pH does not trigger sGC trimerization in solution as sGC scatters as a monomer even at pH 5. 0 (S3B Fig). Elution of sGC was significantly retarded at pH 5. 0 compared to pH 8. 0, most likely due to non-specific interaction of the protein with the dextran resin [38]. The same effect was reported also for RVFV GC ectodomain [25]. Nevertheless, in both PUUV sGc structures, one molecule in the asymmetric unit assembles into a homotrimer around the crystallographic three-fold axis (Fig 1). The protomers adopt the post-fusion domain arrangement, resembling other class II post-fusion structures [14,20,21,33,34] (S1 Fig). They associate in a parallel arrangement with the fusion loop placed at the same end of a stable elongated molecule. The C-terminal stem region is pointing towards the target membrane (Fig 1). PUUV GC and RVFV GC (Genus: Phlebovirus), both members of the Bunyaviridae family, share some structural features that are different from other class II proteins. Similar to phleboviruses, GC from hantaviruses has a high cysteine content, with 26 cysteine residues. In our structure we located 24 cysteines involved in 12 disulfide bonds. Electron density for the remaining cysteines (C1094 and C1098), at the C-terminal end of the protein, could not be detected. It was suggested before that the 787C-X-X-C790 motif, mapped to domain II, might be involved in disulfide rearrangement to prevent hantavirus inactivation under conditions of low-pH treatment [39]. In our structure, C787 and C790 are located at the membrane proximal region of domain II and are involved in two different disulfide bonds (with C749 and C913, respectively). From the only other Bunyaviridae fusogen structures (RVFV GC in its pre-fusion and pre-hairpin conformations, PDB ID 4HJ1 and 4HJC, respectively), the analogous cysteines have a similar arrangement [25] despite the hinge motions between the two conformations. Therefore, from comparing these two structures with the post-fusion structure of PUUV sGC we conclude that in contrast to the fusogen activation in some class I membrane fusion proteins, where disulfide rearrangement is essential for preventing a premature fusion [40], these disulfides do not reorganize. Instead, they are responsible to rigidify the structure and stabilize the orientation of the putative fusion loop. Our structure provides a direct view on the putative endosomal membrane anchor of GC known as the fusion loop and contained between β strands c and b (Fig 2). It was previously demonstrated for Andes virus (ANDV) GC, a member of the Hantavirus genus, that single mutations in the conserved residues W773, N776 and D779 (W115, N118 and D121 in GC numbering) located at the fusion loop eliminate cell-cell fusion activity and ANDV pseudotyped particles infectivity [32]. From our structure it is apparent that W773 and P781 form a conserved hydrophobic surface (Fig 2B and 2C), exposed towards the target membrane. The N-H group of the W773 side chain forms a hydrogen bond with the carbonyl oxygen of P781, reducing its hydrophilicity and thereby favors the penetration of the fusion loop into the outer leaflet of the endosomal membrane (Fig 2D). This interaction was reported also for dengue virus E trimer where W101 is interacting in the same way with the carbonyl group of G106 [21]. Notably, the side chain of the charged D779, also located in the fusion loop, is pointing to the opposite direction, away from the purportedly membrane plane. Notably, the essential residue N776 maintains a network of hydrogen bonds principally with the main chain carbonyls of residues C780, G782 and with the amine group of residue G785. Therefore, N776 stabilizes the architecture of the fusion loop, thus explaining its importance for fusion. The fusion loop of PUUV GC contains other genus-specific features. It has a three-residue insertion (777P-X-D779) conserved among hantaviruses (Figs 2A, S2) where X is typically a proline but can be replaced by serine or glycine (S2 Fig). Unlike post-fusion trimers from the Flavivirus, Alphavirus and Phlebovirus genera, the hydrophobic surface at the tip of domain II is extended by the conserved F907 positioned at the loop connecting strands i and j (Fig 2B). Even though it is less conserved, Y746 located at a third loop contained between strand a and αA helix, might participate in the membrane anchoring as its side chain directing towards the target membrane and is nearly at the same plane of the other hydrophobic side chains of the fusion loop (Fig 2B and 2C). PUUV sGC trimerizes through central interactions in domain I and in the domain-I proximal half of domain II. The total surface buried in trimer interfaces is 5850 Å2 (1950 Å2 per monomer), 17% larger than in DENV2 E trimer (PDB code 1OK8), but only 3% larger than in the Semliki forest virus (SFV) E1 trimer (PDB code 1RER). In addition to the extensive trimerization interface, there are few elements that are exclusive to the PUUV sGC trimer: unlike other class II members, PUUV GC has an N-terminal extension of domain I that donates a strand, A0, to the B0-I0-H0-G0 β-sheet from the neighboring protomer, creating an intermolecular continuous beta sheet (Figs 1 and 3A). This N-terminal extension has not been found in structures from the well characterized class II fusion proteins, including that of phlebovirus GC [25], and therefore it seems to be a unique feature of hantaviruses. Cross-protomer interactions are not common in class II trimers. Typically, the protomers are packed against one another making interactions between secondary structure elements in adjacent protomers. A cross-protomer swap was reported only in Rubella virus E1 protein where the C-terminal stem region donates two strands to two different β-sheets of a neighboring protomer [34]. Additionally, there are few cross-protomer salt bridges in the PUUV sGC trimer. The most notable one is at the membrane proximal part of domain II, close to the fusion loop, where E770 forms a salt-bridge with R902 from the neighboring molecule (Fig 3B), thereby stabilizing the trimer in the membrane-proximal region. To functionally test the significance of this salt-bridge in a hantavirus glycoprotein-mediated cell-cell fusion assay (14,32) we introduced an alanine substitution of R902 (R244 in GC numbering) into PUUV GPC. In addition, the same mutation was also introduced to GPC of ANDV to exploit several approaches that have been established for this virus. The GC sequence of hantaviruses is highly conserved and amounts in the case of PUUV and ANDV to 76% of identity and 89% of similarity (S2 Fig). When cells expressed the wild type and R902A constructs of PUUV and ANDV, GC localized efficiently at the cell surface (S4A Fig). Upon acid-induced incubation, the PUUV and ANDV GC R902A mutants induced syncytia as the wild type proteins (S4B Fig), indicating that the inter-protomer salt bridge may have a less crucial role for fusion activity (see discussion below). PUUV GC is predicted to have two glycosylation sites, N898 and N937. In our crystal structure we observed N-linked glycans only on N937 whereas N898 is buried in the trimer interface with no available space to accommodate a glycan chain. We therefore conclude that N898 is not glycosylated. In contrast to other class II post-fusion trimers, where the glycans decorate the perimeter of the trimer assembly, in PUUV GC the glycans linked to N937 are tightly packed between domain II of one protomer and domain III of the neighboring protomer (Fig 3C). Except one hydrogen bond between N999 (domain III) and the first N-acetylglucosamine residue, all contacts with the glycans are via hydrophobic interactions. Indeed, it was previously reported that eliminating the glycosylation on N928 in Hantaan virus GC (analogous to PUUV GC N937) is sufficient to prevent cell fusion [41]. Based on our structure and the previous biochemical data, we conclude that the contribution of the glycans to the PUUV GC trimer interface is a key element in stabilizing trimer assembly in hantaviruses. Previous studies on Hantaan virus (HNTV) neutralizing monoclonal antibodies (MAb) against GC showed sequence dependent reactivity. While the antibodies cross-reacted with other hantaviruses (SEOV, DOBV), they failed to neutralize PUUV [42]. In addition, binding of neutralizing and non-neutralizing MAbs to HNTV GC was mapped to a region that include most of domain III but no specific epitope was determined [43]. Several neutralizing MAb against PUUV have been selected [44–46], two of which were shown to recognize GC (human MAb 1C9 and bank vole MAb 4G2). A peptide scan assay was used to identify the linear epitopes for these MAb [39,47,48]. The epitopes for 1C9 and 4G2 MAb map to domain I and II, respectively, and both epitopes contribute to the trimer interface (Fig 4). The GN-GC dissociation at pH 6. 2–6. 4 [39] implies exposure of epitopes in GC that were previously buried or partially exposed in the assembled virion. However it seems that each antibody targets a different stage in the membrane fusion process. In class II proteins the major conformational change within a protomer during membrane fusion is the relocation of domain III [20,21,33]. Our structural overlay analysis shows that PUUV sGC is more structurally related to alphaviruses then to phleboviruses (S5A Fig). Furthermore, previous homology modeling studies used various alphavirus E1 proteins as a template for hantavirus GC [39]. To generate a pre-fusion model for PUUV sGC monomer, we therefore used SFV E1 protein as our reference model. Interestingly, the 1C9 epitope is exposed in our pre-fusion model while in the post-fusion structure it is protected by domain III (Fig 4). This suggests that binding of MAb 1C9 restricts domain III relocation and thus inhibits the fusion process. However, the multimerization arrangement of GC on the virus envelope needs to be taken into account as this epitope might be partially or completely buried in the context of the mature virion. In contrast, the epitope of MAb 4G2 maps to domain II in proximity to the fusion loop. It was shown for PUUV that the neutralizing MAb 4G2 binds to GC at neutral pH, however 4G2 does not recognized GC that was exposed to low pH [39]. The 4G2 epitope was narrowed down to five residues that are sufficient for the antibody to bind and neutralize (Fig 4, dark yellow surface) [42]. Although this region of the epitope barely makes contacts with the neighboring protomer, the presence of a bound antibody will sterically hinder the formation of the trimer and thereby is expected to prevent fusion. Once a trimer is formed, the 4G2 antibody can no longer bind this epitope and therefore will not be reactive. Taken together, our structural epitope analysis and the disappearance of the 4G2 epitope below pH 6. 2 [39] propose that the 4G2 MAb inhibit membrane fusion through interfering in trimer formation. It has been shown that in class II membrane fusion proteins there is a hinge motion between domain I and II [reviewed in [19]], and mutations at that region affect the pH threshold for fusion. However it seems that in phlebovirus GC this region is more rigid [25]. As mentioned before, we also obtained crystals of PUUV sGC at pH 8. 0 (sGCXF2, see Table 1). Intriguingly, despite the slightly basic pH of the crystallization condition, sGC still adopted the post-fusion conformation and assembles as trimers around the crystallographic 3-fold axis, however in a different space group lattice (Table 1). Although individual domains superposition did not reveal significant differences (Fig 5A) we still observed some noteworthy differences in the post-fusion structure of PUUV sGCXF2, particularly in the membrane proximal part of domain II including the fusion loop. In sGCXF2 this region has higher B-factor values than in the crystal form obtained at pH 6. 0 (Fig 5B and 5C). Domain II undergoes a hinge motion of 4. 5° away from the three-fold axis in the Cα backbone with respect to the sGCXF1 structure, increasing the distances between the fusion loops by approximately 35% (Fig 5D). Intriguingly, in sGCXF2, E770 and R902 adopt different rotamers that do not allow the salt bridge to form that is in contrast to the β-barrel at the domain I-II interface which limits the hinge motion at that region, unlike other class II membrane fusion proteins, but similar to RVFV GC (Fig 5A) [25]. The absence of this inter-protomer salt-bridge plausibly contributes to the flexibility of the trimer at domain II membrane proximal region in the sGCXF2 structure (Fig 5E). However the unaffected fusion activity of the R902A in our functional assay suggests that it is not mandatory for fusion activity (S4B Fig). Indeed it was suggested before that there is no preferred distance between fusion loops of class II proteins required for fusion activity [49]. Finally, it was postulated that histidine residues function as pH sensors in class II membrane fusion proteins from flaviviruses [50–53]. We did not observe any significant differences in rotamers of histidine residues between the low and high pH crystal form. Furthermore, the poor sequence similarity between PUUV GC (post fusion) and RVFV GC (pre-fusion) shows no conserved histidines neither in sequence nor in three-dimension position (S5B Fig) implying that pH-sensing mechanism might be different in these two viruses. The total length of the stem region connecting between domain III and the TM domain is 46 residues (1069–1114) (S2 Fig). To maximize solubility we included in our expression construct just the first 38 residues of the stem. However, in both our crystal structures (sGCXF1 and sGCXF2) only the first eight residues of the stem (1069–1076) are visible in the electron density map, indicating either major flexibility or proteolytic cleavage at the C-terminus of sGC during preparation. Unlike flaviviruses, in which the stem has an α-helical structure [54], or rubella virus in which the stem has a mixed α/β secondary structure content [34], secondary structure prediction of the stem region from PUUV GC shows mostly random coil structure with a few residues predicted to be in β-strand conformation towards the TM domain (S2 Fig, pink/gray arrow). This might resemble the rubella E1 C-terminal β-strand ‘n’ as it joins the i-j β-sheet of a neighboring protomer [34]. It is possible that the C-terminal part of the stem region of PUUV GC might extend the i-j β-sheet from domain II of the adjacent protomer and thereby might enhance the stability of the trimer. Most of the inter- and intramolecular contacts at that region of the stem of PUUV sGC are either main-chain/main-chain or main-chain/side-chain interactions (Fig 6A). Interestingly, R1074 side chain at the N-terminal of the stem is inserted into a negatively charged cavity at the same protomer (Fig 6A). The main-chain carbonyls of G883, D884, K893 and C894 create the cavity’s negative charge and lead the stem to a canyon formed by two adjacent protomers (Fig 6A). In flaviviruses the domain III-proximal part of the stem participates in both, intramolecular contacts with domain II and intermolecular interactions with the adjacent protomer, in what that appears to be a late-stage fusion intermediate [55]. The resemblance of our stem region orientation to flavivirus E stem implies the same for PUUV GC. The stem region’s sequence is conserved among hantaviruses (S2 Fig). A recently published work exploring the stem region characteristics in ANDV showed inhibition of fusion activity for stem peptides derived from the C-terminal half of the stem region but not for peptides that were derived from the N-terminal half (domain III-proximal) [56]. The nature of the stem interactions with domain II observed in our structure might explain a weak binding of such exogenous peptides. Nevertheless, the zipper-like contact that we observed for residues 1069–1076 is evidently strong enough to immobilize a covalently attached stem segment but apparently not to bind a soluble peptide. In Semliki forest virus (genus: Alphavirus) it was shown that no specific sequence of the stem region was required for membrane fusion [57]. R1074 (R417 in Gc numbering) is the only residue at the base of PUUV sGC stem that maintains side chain intramolecular contacts with domain II and it is highly conserved among hantaviruses (except HNTV and SEOV where it is substituted with lysine of similar properties, S2 Fig). To investigate the role of R1074 in membrane fusion, we introduced an alanine substitution of R1074 in both, PUUV and ANDV GPC in order to test their activity in the available in vitro systems established mostly for ANDV [17,58]. The R1074A mutants of ANDV and PUUV GC were expressed as the wild type proteins, localized on the cell surface and assembled into virus like particles (VLPs) (S4A Fig). However, despite being present on the cell surface, we found that the fusion index of the R1074 mutants from PUUV and ANDV dropped below 0. 2, indicating a strong impairment of the acid pH-triggered syncytia formation activity (Fig 6B and 6C). The fact that the mutation of a conserved residue such as R1074 in hantavirus GC from PUUV and ANDV led to equivalent fusion activity results provides a direct proof for its high conservation among hantaviruses in both, structure and function. Therefore, this data imply that the PUUV GC structure can be used for rational design and characterization of mutations in different hantaviruses. In this context, and to further assess mechanistically the stage in which the R1074A mutant was arrested in the fusion process, we used the ANDV system to test acid-induced trimerization. Therefore, the wild type or R1074A mutant GC from ANDV was incorporated together with wild type GN into VLPs, that were collected and concentrated from the supernatants of cells expressing ANDV wild type or R1074A mutant GPC (S4 Fig). The concentrated VLPs were then treated at pH 7. 4 or pH 5. 5 and the glycoproteins subsequently extracted by non-ionic detergent. Their sedimentation on sucrose gradients revealed that the R1074A mutant underwent trimerization at pH 5. 5 as efficient as the wild type control (Fig 6D). However, when the resistance of the trimer was tested for its stability by trypsin digestion, not only the neutral pH form, but also the acid-treated R1074A mutant was readily degraded by trypsin, in contrast to the low pH form of wild type GC (Fig 6E). From these data it can be concluded that the R1074A mutant underwent acid-induced trimerization, but this trimer did not reach a stable post-fusion conformation. This difference in stability may be related to an incomplete fold-back of the stem region against the trimeric core. Combining our structural and functional data we conclude that the ‘base’ of the stem region in hantaviruses is essential for fusion through the formation of a stable post-fusion trimer. It was shown previously for class II membrane fusion proteins that the activity of small molecule inhibitors in an assay for infectivity correlates well with their capacity to compete with stem-derived peptides [59]. Schmidt and co-workers suggested that the conformational transition from a pre-fusion arrangement to a post-fusion trimer will require removal of the ligand, imposing a barrier to completion of the fusion process. For this reason, in silico screens found potential pocket-binding compounds, that in some cases yielded active inhibitors [60–63]. Thus the electrostatic interaction of R1074 in a well-defined cavity at the base of the stem region and our functional data showing its role in trimer stabilization and membrane fusion activity suggest that this cavity might be a target for small molecule fusion inhibitors. The existence of a class II fold in a virus family other than Flaviviridae and Togaviridae was already suggested to diverge either from a viral or a common cellular class II ancestor [25,35,64,65]. What are the driving forces that shaped the evolution of class II membrane fusion proteins? To address this question we computed structure-based sequence alignment based on both, the full-length ectodomains and the individual domains of various class II membrane fusion protein structures and calculated the corresponding cladograms (Fig 7). As expected, cladograms based on the structures of the individual domains do not show significant difference in topology compared to the full-length-based cladogram. Despite the structural similarities of phlebovirus GC to flavivirus E proteins [25], PUUV GC seems to be more structurally related to alphavirus E1 proteins (S5A Fig). On the other hand, rubella virus (RV) E1 and PUUV GC appear to be more related in terms of the particle arrangement. Both assemble into pleomorphic virions with a non-continuous protein envelope with local symmetry properties in contrast to other viral class II membrane fusion proteins that are part of an icosahedral envelope arrangement [12,34]. Furthermore, while the viruses containing class II membrane fusion proteins assembled into icosahedral symmetry are all arthropod-borne, hantaviruses and RV are transmitted among mammals (rodent-to-human and human-to-human, respectively). As suggested before for RV, a human-restricted infection cycle forced the virus to evolve unique structural features for its fusogen [34]. It is possible that hantaviruses followed a similar evolutionary path in mammals and further diverged to an additional branch separated from arboviruses containing class II membrane fusion proteins (Fig 7). Nonetheless, other evolutionary mechanisms such as convergent evolution, cannot be ruled out for this observation. Hopefully with the determination of more fusogens structures from the Bunyaviridae family the molecular basis for these proteins evolution will be more comprehensively studied. The open reading frame encoding the ectodomain of GC (sGC) from PUUV (M segment residues 659–1106) were amplified from the M segment cDNA of Puumala virus P360 strain (GenBank accession code P41266. 1) and subcloned into the pAcGP67 vector (BD Biosciences) in frame with the baculovirus gp67 signal sequence and a C-terminal eight-histidine purification tag. Sf9 insect cells (Expression Systems) were co-transfected with sGC expression constructs and linearized baculovirus genomic DNA (Expression Systems) to produce recombinant baculoviruses expressing sGC. Virus stocks were amplified with three sequential infections of Sf9 cells. For sGC expression, Tni insect cells (Expression Systems) grown at 27°C were infected at a density of 2 × 106 cells/ml with 1% (v/v) of third-passage (P3) baculovirus stock. After culture in suspension for 96–108 h at 20°C the culture media was collected and its pH was adjusted with addition of Tris pH 8. 0 to final concentration of 20 mM. Following media concentration, secreted sGC was purified by nickel affinity chromatography (Ni-NTA agarose, QIAgen). A subsequent anion-exchange chromatography purification step (monoQ, GE Healthcare) resulted in two populations of sGC eluting in different salt concentrations. From this point on the two populations (termed sGCXF1 and sGCXF2) were separated and further went through the same steps. The His-tag was subsequently removed with carboxypeptidase A (CPA) treatment at 4°C for 16 h (1 mU CPA per microgram of sGC). CPA was then inhibited with 1 mM EDTA and 1 mM 1,10-phenanthroline and separated from sGC by size-exclusion chromatography (Superdex 200 10/300 GL, GE Healthcare). Protein samples were concentrated to 2. 5–3. 5 g/l, frozen in liquid nitrogen and stored at -80°C in 10 mM Tris pH 8,0. 1 M NaCl. Crystals of sGCXF1 (eluted from the mono-Q at low salt concentration) were grown by hanging drop vapor diffusion at 16°C. sGCXF1 at 2. 4 g/l in 10 mM Tris pH 8. 0,0. 1 M NaCl was mixed in 2: 1 protein to reservoir containing 12% (w/v) polyethylene glycol 2000 mono-methyl ether (PEG 2000 MME), 0. 1 M MES pH 6. 0 and 0. 2 M ammonium sulfate. Multi-crystals clusters appeared after 3–5 weeks and very few single crystals were observed after 6–8 weeks. A single crystal was then crushed and used as microseeds in drops pre-equilibrated for 24 h prior to seeding. Rhombohedron shaped crystals reached a size of 150 × 70 × 70 μm 7–10 days post-seeding and belonged to space group R32. Crystals were frozen in liquid nitrogen in reservoir solution supplemented with 30% PEG 400 as a cryoprotectant. Derivative sGCXF1 crystals were obtained by soaking in reservoir solution plus 1 mM methyl mercury phosphate (Hampton Research) for one week. sGCXF2 crystals appeared in 40% (w/v) polyethylene glycol 400 (PEG 400), 0. 1 M Tris pH 8. 0,0. 2 M lithium sulfate (1: 1 protein to reservoir ratio). After 12 weeks sharp-edges cubic crystals were observed and reached a size of 60 × 60 × 60 μm. Upon optimization, crystals with cubic morphology at the size of 75 × 75 × 75 μm appeared after 4–6 weeks and belonged to space group I213. Data were collected at 100 K on a PILATUS detector (Dectris) and processed with XDS [66]. The structure of sGCXF1 was determined by single isomorphous replacement with anomalous signal (SIRAS) with PHENIX [67]. Initial atomic coordinates for sGCXF1 built with PHENIX were used as starting model in refinement and building cycles with the highest resolution (1. 84 Å) native data set. The atomic model was completed with COOT [68] and refined to an Rfree of 21% with PHENIX and REFMAC [69]. The structure of sGCXF2 was determined by molecular replacement using domains I+III and domain II of sGCXF1 as separate search models. Atomic coordinates and structure factors for sGCXF1 and sGCXF2 have been deposited in the Protein Data Bank (ID codes 5J81and 5J9H, respectively). See Table 1 for data collection and refinement statistics. All molecular graphics were produced using PyMol (PyMOL Molecular Graphics System, Version 1. 8 Schrödinger, LLC). Molecular surface calculations were performed using UCSF Chimera [70]. Surface electrostatic potential was calculated with APBS [71]. B-factor analysis was calculated using baverage module in the CCP4 suite [72]. Surface conservation was calculated using CONSURF server (http: //consurf. tau. ac. il/) [73]. PUUV sGC structure was superimposed on the crystal structure of Semliki forest virus E1 in its pre-fusion state (PDB ID codes 2ALA) using domains I+II and domain III as two separate rigid bodies. The flexible linker between domain I and domain III was eliminated from the model. Analytical size-exclusion chromatography and multiangle light scattering (MALS) experiments were performed in 20 mM sodium acetate pH 5. 0, or Tris⋅HCl pH 8. 0 and 0. 1 M NaCl. A total of 0. 2 mL sGC at 2. 5 g/L was loaded onto a Superdex 200 (10/300) column coupled to mini DAWN TREOS spectrometer and Optilab T-rEX (Wyatt technology) refractometer at a flow rate of 0. 7 mL/min. PUUV sGC was detected as it eluted from the column with a UV detector at 280 nm, a light scattering detector at 690 nm, and a refractive index detector. The molar mass of PUUV sGC was determined from the Debye plot of light scattering intensity versus scattering angle. Data processing was performed with ASTRA software (Wyatt Technology). Mutations were introduced into the expression vectors pI. 18/ANDV-GPC [74] and pWRG/PUUV-M (s2) (kindly provided by Jay Hooper, USAMRIID, USA) [75] coding for GPC from ANDV strain Chi-7913 and PUUV strain K27 (GenBank accession numbers AAO86638 and L08754), respectively, by using DNA synthesis and sub-cloning into the corresponding expression vectors (Genscript). For expression and localization analysis, 8 μg of plasmids were calcium-transfected into 293FT cells (Invitrogen) grown on 100 mm plates and 48 hrs later, proteins located on the cell surface were biotinylated using a cell-surface protein isolation kit (Pierce), and the fractions corresponding to intracellular and surface proteins separated on a neutravidin resin. The presence of Gc and β-actin in each fraction were analyzed by western blot using anti-Gc 2H4/F6 [76] and anti-β-actin (Sigma) MAb at a 1: 2,500 dilution. Primary antibodies were detected by chemiluminsecence using anti-mouse immunoglobulin horseradish peroxidase conjugate (Thermo Fisher Scientific). To prepare VLPs, a previously established protocol was used [17]. Briefly, 48 hrs post-transfection the supernatant of 293FT cells transfected with wild type or mutant pI. 18/ANDV-GPC or pWRG/PUUV-M (s2) constructs was collected and VLPs concentrated by ultracentrifugation for 1 hr at 135,000 g. The presence of VLPs was assayed by western blot analysis as described above. A fluorescence-based syncytia assay was performed as reported before (32). Vero E6 cells (ATTC) seeded in 16-well chamber slides were transfected with 0. 5 μg of wild type or mutant pI. 18/ANDV-GPC or pWRG/PUUV-M (s2) constructs using lipofectamin 2000 (Invitrogen). 48 hrs later, the cells were incubated for 5 min at 37°C with MEM culture media adjusted to the corresponding pH. Next, incubation of cells was continued for 3 hrs at 37°C in neutral pH MEM culture media. To label the cell cytoplasm, cells were subsequently incubated for one hr with 1 μM 5-chloromethylfluorescein diacetate (Cell Tracker CMFDA, Molecular Probes). Subsequently, cells were fixed with 4% (w/v) paraformaldehyde, permeabilized with 0. 1% (v/v) Triton X-100 and Gc detected with anti-Gc 2H4/F6 MAb and anti-mouse immunoglobulin MAb Alexa555 conjugate (Invitrogen). Cell nuclei were stained with DAPI 1 ng/μl in PBS. To visualize syncytia samples were examined under a fluorescence microscope (BMAX51; Olympus) and pictures taken for quantification (ProgRes C3; Jenoptics). The fusion index of Gc-expressing cells was calculated using the formula: 1- [number of cells/number of nuclei]. For each sample approximately 200 nuclei per field were counted (200 x magnification) and the mean fusion index of five fields calculated from at least two independent experiments. Acid-induced Gc trimerization was tested by sucrose sedimentation using a previous protocol [17]. Briefly, VLPs were incubated for 30 min at the indicated pH to allow for Gc conformational changes. The pH back-neutralized, and Triton X-100 (0,5%; v/v) -extracted glycoproteins were subsequently loaded to the top of a sucrose step gradient (7–15%, w/v). After 16 hrs of centrifugation at 150,000 g, fractions were collected and the presence of Gc in each fractions tested by western blot analysis. The stability of neutral pH and acid pH conformation of a Gc mutant was assayed by its resistance to trypsin as shown for wild type Gc previously [17]. In brief, VLPs including wild type or mutant Gc were incubated at the indicated pH and presence of Gc assessed by western blot as described above. A set of structures of class II fusion proteins in their post fusion conformation was obtained from the DALI server [77] with the atomic coordinates of PUUV sGC as the query. Structures of viral class II fusion proteins and of C. elegans EFF-1 were aligned with the MUSTANG server [78]. The resulting structure-based sequence alignment was used for the estimation of the cladogram by the neighbor-joining method with the BLOSUM62 substitution matrix using Jalview [79,80]. The same process was further executed on individual domains.

Title: Crystal Structure of Glycoprotein C from a Hantavirus in the Post-fusion Conformation Summary: Hantaviruses (family: Bunyaviridae) encompass pathogens responsible to serious human diseases and economic burden worldwide. Following endocytosis, these enveloped RNA viruses are directed to an endosomal compartment where a sequence of pH-dependent conformational changes of the viral envelope glycoproteins mediates the fusion between the viral and endosomal membranes. The lack of high-resolution structural information for the entry of hantaviruses impair our ability to rationalize new treatments and prevention strategies. We determined the three-dimensional structure of a glycoprotein C from Puumala virus (PUUV) using X-ray crystallography. The two structures (at pH 6. 0 and 8. 0) were determined to 1. 8 Å and 2. 3 Å resolutions, respectively. Both structures reveal a class II membrane fusion protein in its post-fusion trimeric conformation with novel structural features in the trimer assembly and stabilization. Our structures suggest that neutralizing antibodies against GC target its conformational changes as inhibition mechanism and highlight new molecular targets for hantavirus-specific membrane fusion inhibitors. Furthermore, combined with the available structures of other class II proteins, we remodeled the evolutionary relationships between virus families encompassing these proteins.

lay_plos

en

Summarize: Emma could not forgive her;--but as neither provocation nor resentment were discerned by Mr. Knightley, who had been of the party, and had seen only proper attention and pleasing behaviour on each side, he was expressing the next morning, being at Hartfield again on business with Mr. Woodhouse, his approbation of the whole; not so openly as he might have done had her father been out of the room, but speaking plain enough to be very intelligible to Emma. He had been used to think her unjust to Jane, and had now great pleasure in marking an improvement. "A very pleasant evening," he began, as soon as Mr. Woodhouse had been talked into what was necessary, told that he understood, and the papers swept away;--"particularly pleasant. You and Miss Fairfax gave us some very good music. I do not know a more luxurious state, sir, than sitting at one's ease to be entertained a whole evening by two such young women; sometimes with music and sometimes with conversation. I am sure Miss Fairfax must have found the evening pleasant, Emma. You left nothing undone. I was glad you made her play so much, for having no instrument at her grandmother's, it must have been a real indulgence." "I am happy you approved," said Emma, smiling; "but I hope I am not often deficient in what is due to guests at Hartfield." "No, my dear," said her father instantly; "_that_ I am sure you are not. There is nobody half so attentive and civil as you are. If any thing, you are too attentive. The muffin last night--if it had been handed round once, I think it would have been enough." "No," said Mr. Knightley, nearly at the same time; "you are not often deficient; not often deficient either in manner or comprehension. I think you understand me, therefore." An arch look expressed--"I understand you well enough;" but she said only, "Miss Fairfax is reserved." "I always told you she was--a little; but you will soon overcome all that part of her reserve which ought to be overcome, all that has its foundation in diffidence. What arises from discretion must be honoured." "You think her diffident. I do not see it." "My dear Emma," said he, moving from his chair into one close by her, "you are not going to tell me, I hope, that you had not a pleasant evening." "Oh! no; I was pleased with my own perseverance in asking questions; and amused to think how little information I obtained." "I am disappointed," was his only answer. "I hope every body had a pleasant evening," said Mr. Woodhouse, in his quiet way. "I had. Once, I felt the fire rather too much; but then I moved back my chair a little, a very little, and it did not disturb me. Miss Bates was very chatty and good-humoured, as she always is, though she speaks rather too quick. However, she is very agreeable, and Mrs. Bates too, in a different way. I like old friends; and Miss Jane Fairfax is a very pretty sort of young lady, a very pretty and a very well-behaved young lady indeed. She must have found the evening agreeable, Mr. Knightley, because she had Emma." "True, sir; and Emma, because she had Miss Fairfax." Emma saw his anxiety, and wishing to appease it, at least for the present, said, and with a sincerity which no one could question-- "She is a sort of elegant creature that one cannot keep one's eyes from. I am always watching her to admire; and I do pity her from my heart." Mr. Knightley looked as if he were more gratified than he cared to express; and before he could make any reply, Mr. Woodhouse, whose thoughts were on the Bates's, said-- "It is a great pity that their circumstances should be so confined! a great pity indeed! and I have often wished--but it is so little one can venture to do--small, trifling presents, of any thing uncommon--Now we have killed a porker, and Emma thinks of sending them a loin or a leg; it is very small and delicate--Hartfield pork is not like any other pork--but still it is pork--and, my dear Emma, unless one could be sure of their making it into steaks, nicely fried, as ours are fried, without the smallest grease, and not roast it, for no stomach can bear roast pork--I think we had better send the leg--do not you think so, my dear?" "My dear papa, I sent the whole hind-quarter. I knew you would wish it. There will be the leg to be salted, you know, which is so very nice, and the loin to be dressed directly in any manner they like." "That's right, my dear, very right. I had not thought of it before, but that is the best way. They must not over-salt the leg; and then, if it is not over-salted, and if it is very thoroughly boiled, just as Serle boils ours, and eaten very moderately of, with a boiled turnip, and a little carrot or parsnip, I do not consider it unwholesome." "Emma," said Mr. Knightley presently, "I have a piece of news for you. You like news--and I heard an article in my way hither that I think will interest you." "News! Oh! yes, I always like news. What is it?--why do you smile so?--where did you hear it?--at Randalls?" He had time only to say, "No, not at Randalls; I have not been near Randalls," when the door was thrown open, and Miss Bates and Miss Fairfax walked into the room. Full of thanks, and full of news, Miss Bates knew not which to give quickest. Mr. Knightley soon saw that he had lost his moment, and that not another syllable of communication could rest with him. "Oh! my dear sir, how are you this morning? My dear Miss Woodhouse--I come quite over-powered. Such a beautiful hind-quarter of pork! You are too bountiful! Have you heard the news? Mr. Elton is going to be married." Emma had not had time even to think of Mr. Elton, and she was so completely surprized that she could not avoid a little start, and a little blush, at the sound. "There is my news:--I thought it would interest you," said Mr. Knightley, with a smile which implied a conviction of some part of what had passed between them. "But where could _you_ hear it?" cried Miss Bates. "Where could you possibly hear it, Mr. Knightley? For it is not five minutes since I received Mrs. Cole's note--no, it cannot be more than five--or at least ten--for I had got my bonnet and spencer on, just ready to come out--I was only gone down to speak to Patty again about the pork--Jane was standing in the passage--were not you, Jane?--for my mother was so afraid that we had not any salting-pan large enough. So I said I would go down and see, and Jane said, 'Shall I go down instead? for I think you have a little cold, and Patty has been washing the kitchen.'--'Oh! my dear,' said I--well, and just then came the note. A Miss Hawkins--that's all I know. A Miss Hawkins of Bath. But, Mr. Knightley, how could you possibly have heard it? for the very moment Mr. Cole told Mrs. Cole of it, she sat down and wrote to me. A Miss Hawkins--" "I was with Mr. Cole on business an hour and a half ago. He had just read Elton's letter as I was shewn in, and handed it to me directly." "Well! that is quite--I suppose there never was a piece of news more generally interesting. My dear sir, you really are too bountiful. My mother desires her very best compliments and regards, and a thousand thanks, and says you really quite oppress her." "We consider our Hartfield pork," replied Mr. Woodhouse--"indeed it certainly is, so very superior to all other pork, that Emma and I cannot have a greater pleasure than--" "Oh! my dear sir, as my mother says, our friends are only too good to us. If ever there were people who, without having great wealth themselves, had every thing they could wish for, I am sure it is us. We may well say that 'our lot is cast in a goodly heritage.' Well, Mr. Knightley, and so you actually saw the letter; well--" "It was short--merely to announce--but cheerful, exulting, of course."-- Here was a sly glance at Emma. "He had been so fortunate as to--I forget the precise words--one has no business to remember them. The information was, as you state, that he was going to be married to a Miss Hawkins. By his style, I should imagine it just settled." "Mr. Elton going to be married!" said Emma, as soon as she could speak. "He will have every body's wishes for his happiness." "He is very young to settle," was Mr. Woodhouse's observation. "He had better not be in a hurry. He seemed to me very well off as he was. We were always glad to see him at Hartfield." "A new neighbour for us all, Miss Woodhouse!" said Miss Bates, joyfully; "my mother is so pleased!--she says she cannot bear to have the poor old Vicarage without a mistress. This is great news, indeed. Jane, you have never seen Mr. Elton!--no wonder that you have such a curiosity to see him." Jane's curiosity did not appear of that absorbing nature as wholly to occupy her. "No--I have never seen Mr. Elton," she replied, starting on this appeal; "is he--is he a tall man?" "Who shall answer that question?" cried Emma. "My father would say 'yes,' Mr. Knightley 'no;' and Miss Bates and I that he is just the happy medium. When you have been here a little longer, Miss Fairfax, you will understand that Mr. Elton is the standard of perfection in Highbury, both in person and mind." "Very true, Miss Woodhouse, so she will. He is the very best young man--But, my dear Jane, if you remember, I told you yesterday he was precisely the height of Mr. Perry. Miss Hawkins,--I dare say, an excellent young woman. His extreme attention to my mother--wanting her to sit in the vicarage pew, that she might hear the better, for my mother is a little deaf, you know--it is not much, but she does not hear quite quick. Jane says that Colonel Campbell is a little deaf. He fancied bathing might be good for it--the warm bath--but she says it did him no lasting benefit. Colonel Campbell, you know, is quite our angel. And Mr. Dixon seems a very charming young man, quite worthy of him. It is such a happiness when good people get together--and they always do. Now, here will be Mr. Elton and Miss Hawkins; and there are the Coles, such very good people; and the Perrys--I suppose there never was a happier or a better couple than Mr. and Mrs. Perry. I say, sir," turning to Mr. Woodhouse, "I think there are few places with such society as Highbury. I always say, we are quite blessed in our neighbours.--My dear sir, if there is one thing my mother loves better than another, it is pork--a roast loin of pork--" "As to who, or what Miss Hawkins is, or how long he has been acquainted with her," said Emma, "nothing I suppose can be known. One feels that it cannot be a very long acquaintance. He has been gone only four weeks." Nobody had any information to give; and, after a few more wonderings, Emma said, "You are silent, Miss Fairfax--but I hope you mean to take an interest in this news. You, who have been hearing and seeing so much of late on these subjects, who must have been so deep in the business on Miss Campbell's account--we shall not excuse your being indifferent about Mr. Elton and Miss Hawkins." "When I have seen Mr. Elton," replied Jane, "I dare say I shall be interested--but I believe it requires _that_ with me. And as it is some months since Miss Campbell married, the impression may be a little worn off." "Yes, he has been gone just four weeks, as you observe, Miss Woodhouse," said Miss Bates, "four weeks yesterday.--A Miss Hawkins!--Well, I had always rather fancied it would be some young lady hereabouts; not that I ever--Mrs. Cole once whispered to me--but I immediately said, 'No, Mr. Elton is a most worthy young man--but'--In short, I do not think I am particularly quick at those sort of discoveries. I do not pretend to it. What is before me, I see. At the same time, nobody could wonder if Mr. Elton should have aspired--Miss Woodhouse lets me chatter on, so good-humouredly. She knows I would not offend for the world. How does Miss Smith do? She seems quite recovered now. Have you heard from Mrs. John Knightley lately? Oh! those dear little children. Jane, do you know I always fancy Mr. Dixon like Mr. John Knightley. I mean in person--tall, and with that sort of look--and not very talkative." "Quite wrong, my dear aunt; there is no likeness at all." "Very odd! but one never does form a just idea of any body beforehand. One takes up a notion, and runs away with it. Mr. Dixon, you say, is not, strictly speaking, handsome?" "Handsome! Oh! no--far from it--certainly plain. I told you he was plain." "My dear, you said that Miss Campbell would not allow him to be plain, and that you yourself--" "Oh! as for me, my judgment is worth nothing. Where I have a regard, I always think a person well-looking. But I gave what I believed the general opinion, when I called him plain." "Well, my dear Jane, I believe we must be running away. The weather does not look well, and grandmama will be uneasy. You are too obliging, my dear Miss Woodhouse; but we really must take leave. This has been a most agreeable piece of news indeed. I shall just go round by Mrs. Cole's; but I shall not stop three minutes: and, Jane, you had better go home directly--I would not have you out in a shower!--We think she is the better for Highbury already. Thank you, we do indeed. I shall not attempt calling on Mrs. Goddard, for I really do not think she cares for any thing but _boiled_ pork: when we dress the leg it will be another thing. Good morning to you, my dear sir. Oh! Mr. Knightley is coming too. Well, that is so very!--I am sure if Jane is tired, you will be so kind as to give her your arm.--Mr. Elton, and Miss Hawkins!--Good morning to you." Emma, alone with her father, had half her attention wanted by him while he lamented that young people would be in such a hurry to marry--and to marry strangers too--and the other half she could give to her own view of the subject. It was to herself an amusing and a very welcome piece of news, as proving that Mr. Elton could not have suffered long; but she was sorry for Harriet: Harriet must feel it--and all that she could hope was, by giving the first information herself, to save her from hearing it abruptly from others. It was now about the time that she was likely to call. If she were to meet Miss Bates in her way!--and upon its beginning to rain, Emma was obliged to expect that the weather would be detaining her at Mrs. Goddard's, and that the intelligence would undoubtedly rush upon her without preparation. The shower was heavy, but short; and it had not been over five minutes, when in came Harriet, with just the heated, agitated look which hurrying thither with a full heart was likely to give; and the "Oh! Miss Woodhouse, what do you think has happened!" which instantly burst forth, had all the evidence of corresponding perturbation. As the blow was given, Emma felt that she could not now shew greater kindness than in listening; and Harriet, unchecked, ran eagerly through what she had to tell. "She had set out from Mrs. Goddard's half an hour ago--she had been afraid it would rain--she had been afraid it would pour down every moment--but she thought she might get to Hartfield first--she had hurried on as fast as possible; but then, as she was passing by the house where a young woman was making up a gown for her, she thought she would just step in and see how it went on; and though she did not seem to stay half a moment there, soon after she came out it began to rain, and she did not know what to do; so she ran on directly, as fast as she could, and took shelter at Ford's."--Ford's was the principal woollen-draper, linen-draper, and haberdasher's shop united; the shop first in size and fashion in the place.--"And so, there she had set, without an idea of any thing in the world, full ten minutes, perhaps--when, all of a sudden, who should come in--to be sure it was so very odd!--but they always dealt at Ford's--who should come in, but Elizabeth Martin and her brother!--Dear Miss Woodhouse! only think. I thought I should have fainted. I did not know what to do. I was sitting near the door--Elizabeth saw me directly; but he did not; he was busy with the umbrella. I am sure she saw me, but she looked away directly, and took no notice; and they both went to quite the farther end of the shop; and I kept sitting near the door!--Oh! dear; I was so miserable! I am sure I must have been as white as my gown. I could not go away you know, because of the rain; but I did so wish myself anywhere in the world but there.--Oh! dear, Miss Woodhouse--well, at last, I fancy, he looked round and saw me; for instead of going on with her buyings, they began whispering to one another. I am sure they were talking of me; and I could not help thinking that he was persuading her to speak to me--(do you think he was, Miss Woodhouse?)--for presently she came forward--came quite up to me, and asked me how I did, and seemed ready to shake hands, if I would. She did not do any of it in the same way that she used; I could see she was altered; but, however, she seemed to _try_ to be very friendly, and we shook hands, and stood talking some time; but I know no more what I said--I was in such a tremble!--I remember she said she was sorry we never met now; which I thought almost too kind! Dear, Miss Woodhouse, I was absolutely miserable! By that time, it was beginning to hold up, and I was determined that nothing should stop me from getting away--and then--only think!--I found he was coming up towards me too--slowly you know, and as if he did not quite know what to do; and so he came and spoke, and I answered--and I stood for a minute, feeling dreadfully, you know, one can't tell how; and then I took courage, and said it did not rain, and I must go; and so off I set; and I had not got three yards from the door, when he came after me, only to say, if I was going to Hartfield, he thought I had much better go round by Mr. Cole's stables, for I should find the near way quite floated by this rain. Oh! dear, I thought it would have been the death of me! So I said, I was very much obliged to him: you know I could not do less; and then he went back to Elizabeth, and I came round by the stables--I believe I did--but I hardly knew where I was, or any thing about it. Oh! Miss Woodhouse, I would rather done any thing than have it happen: and yet, you know, there was a sort of satisfaction in seeing him behave so pleasantly and so kindly. And Elizabeth, too. Oh! Miss Woodhouse, do talk to me and make me comfortable again." Very sincerely did Emma wish to do so; but it was not immediately in her power. She was obliged to stop and think. She was not thoroughly comfortable herself. The young man's conduct, and his sister's, seemed the result of real feeling, and she could not but pity them. As Harriet described it, there had been an interesting mixture of wounded affection and genuine delicacy in their behaviour. But she had believed them to be well-meaning, worthy people before; and what difference did this make in the evils of the connexion? It was folly to be disturbed by it. Of course, he must be sorry to lose her--they must be all sorry. Ambition, as well as love, had probably been mortified. They might all have hoped to rise by Harriet's acquaintance: and besides, what was the value of Harriet's description?--So easily pleased--so little discerning;--what signified her praise? She exerted herself, and did try to make her comfortable, by considering all that had passed as a mere trifle, and quite unworthy of being dwelt on, "It might be distressing, for the moment," said she; "but you seem to have behaved extremely well; and it is over--and may never--can never, as a first meeting, occur again, and therefore you need not think about it." Harriet said, "very true," and she "would not think about it;" but still she talked of it--still she could talk of nothing else; and Emma, at last, in order to put the Martins out of her head, was obliged to hurry on the news, which she had meant to give with so much tender caution; hardly knowing herself whether to rejoice or be angry, ashamed or only amused, at such a state of mind in poor Harriet--such a conclusion of Mr. Elton's importance with her! Mr. Elton's rights, however, gradually revived. Though she did not feel the first intelligence as she might have done the day before, or an hour before, its interest soon increased; and before their first conversation was over, she had talked herself into all the sensations of curiosity, wonder and regret, pain and pleasure, as to this fortunate Miss Hawkins, which could conduce to place the Martins under proper subordination in her fancy. Emma learned to be rather glad that there had been such a meeting. It had been serviceable in deadening the first shock, without retaining any influence to alarm. As Harriet now lived, the Martins could not get at her, without seeking her, where hitherto they had wanted either the courage or the condescension to seek her; for since her refusal of the brother, the sisters never had been at Mrs. Goddard's; and a twelvemonth might pass without their being thrown together again, with any necessity, or even any power of speech.

Summary: Just as Mr. Knightley is about to give Emma some news, the Bateses arrive with Jane to thank the Woodhouses for the hindquarter of pork they have sent; they manage to precede Knightley in divulging that Mr. Elton is to marry a Miss Hawkins. Emma is caught off guard, and Mr. Knightley's looks suggest he knows something of what has transpired between them. However, she soon regains enough composure to make another failed attempt to engage Jane in conversation. The company departs, and Harriet bursts in with news that she has run into Mr. Martin and his sister in town. She relates that after some awkwardness, the pair greeted her with kindness, leaving Harriet flustered. Emma is impressed by the Martins' behavior and briefly second-guesses her judgment of them, but she concludes that their station in life is still too low for Harriet. She is only able to distract Harriet from the episode by sharing the news of Mr. Elton's impending marriage.

booksum

en

Summarize: Documenti originali e copie dei documenti Nel giudizio civile possono essere depositati i documenti in originale o in copia. I documenti in copia possono essere riprodotti mediante il metodo della fotocopia cartacea oppure scannerizzazione (se il deposito avviene in modo telematico). Nulla esclude che i documenti in originale o in copia siano stati falsificati. I modi (le modalità processuali) attraverso le quali è possibile contestare la falsificazione di un documento variano se si è in presenza di un documento depositato in "originale" oppure di un documenti depositato in copia (semplice). Nel caso di avvenuta produzione in giudizio di copia di un documento – la cui conformità all'originale non sia già attestata da pubblico ufficiale – certamente la parte contro cui il documento è prodotto deve innanzitutto prendere posizione sulla conformità della copia all'originale, se vuole impedire l'effetto che la copia valga come autentica e sia idoneo mezzo di prova (art. 2709 c.c.). Qualora la parte che ha prodotto il documento in copia non provveda alla produzione dell'originale, il giudice non resta vincolato dal disconoscimento della riproduzione, potendo egli apprezzarne l'efficacia rappresentativa di conformità all'originale attraverso altri mezzi di prova, comprese le presunzioni (ex multiis, Cass. n. 4395 del 2004). (Cass. civ. sez. III, del 20 agosto 2015 n. 16998) Naturalmente, per impedire, nonostante il disconoscimento di conformità, che la controparte faccia valere il documento la cui idoneità come mezzo di prova sia stata altrimenti accertata, la parte contro cui il documento sia stato prodotto è onerata del disconoscimento del contenuto e della sottoscrizione. Ed entrambe le ipotesi di disconoscimento, nel silenzio normativo sui modi e termini in cui deve procedersi, restano disciplinate dagli artt. 214 e 215 c.p.c., con la conseguenza che anche il disconoscimento del contenuto e della sottoscrizione deve essere fatto in modo formale e inequivoco alla prima udienza, o nella prima risposta successiva alla sua produzione (da ultimo Cass. n. 13425 del 2014). (Cass. civ. sez. III, del 20 agosto 2015 n. 16998) In presenza di quest'ultimo profilo di disconoscimento, la parte che intenda valersi del documento disconosciuto, anche per l'ipotesi che abbia prodotto l'originale o in presenza di elementi di prova da cui il giudice potrebbe trarre la rispondenza di conformità della copia all'originale, deve chiederne la verificazione, con conseguente applicabilità degli artt. 216 e ss. c.p.c. (Cass. civ. sez. III, del 20 agosto 2015 n. 16998) In definitiva, in presenza di disconoscimento della conformità della copia all'originale, i poteri del giudice possono sopperire solo alla inerzia della parte che ha prodotto il documento in copia rispetto alla mancata produzione dell'originale e possono sopperire alla necessità di produzione dell'originale per la procedura di verificazione. Ma, non rendono il documento in copia, per ciò solo, riconosciuto anche nel suo contenuto e nella sua sottoscrizione, restando immutate le condizioni previste dalla legge processuale affinché il documento disconosciuto nel suo contenuto e sottoscrizione possa essere utilizzato a favore della parte che lo ha prodotto. (Cass. civ. sez. III, del 20 agosto 2015 n. 16998) Il convenuto deve costituirsi in giudizio almeno 20 giorni prima della prima udienza altrimenti decade da tutte le eccezioni processuali e di merito non rilevabili d'ufficio ex art. 166 cpc e 167 cpc.

Summary: Cassazione 23.5.2019 n 14100 il convenuto contro il quale l'attore, in sede di costituzione in giudizio, abbia prodotto una scrittura privata, non è onerato di disconoscerla nel termine di venti giorni prima dell'udienza di comparizione, alla stessa stregua delle eccezioni non rilevabili d'ufficio, essendo sufficiente che il disconoscimento venga effettuato nella prima udienza o nella prima risposta successiva alla produzione.

fanpage

it

Summarize: Background Foreign nationals who wish to visit the United States, including business travelers and tourists, must generally obtain a nonimmigrant visa. The majority of travelers visiting the United States from Mexico receive an NIV Border Crossing Card, which is valid for 10 years. In order to obtain a Border Crossing Card, applicants must generally: (1) schedule an appointment for a visa interview at a U.S. consulate, (2) fill out an application and pay applicable fees, (3) have their photos taken and fingerprints collected at a U.S. consulate, (4) have their information checked in the Consular Lookout and Support System—State’s name- check database that consulates use to access critical information for visa adjudication, and (5) have an interview with a consular officer, who is responsible for making the adjudication decision. In 1996, Congress passed the Illegal Immigration Reform and Immigrant Responsibility Act (IIRIRA), which required that every Border Crossing Card issued after April 1, 1998, contain a biometric identifier, such as a fingerprint, and be machine readable. The law also mandated that all Border Crossing Cards issued before April 1, 1998, would expire on October 1, 1999, regardless of when their validity period ended. This deadline was extended by Congress two times, first to September 30, 2001, and then to September 30, 2002. The passage of IIRIRA created a significant surge in Mission Mexico’s NIV workload, as Border Crossing Card holders sought to obtain the new visas before the congressionally mandated expiration date. This culminated in a historic high in NIV workload in fiscal year 2001, when the mission processed 2,869,000 NIV applications. We have previously reported on challenges State faced in managing its NIV workload. Among other things, we found that NIV applicants have often had to wait for extended periods of time to receive appointments for interviews. Believing that wait times for NIV interviews were excessive, in February 2007, State announced a worldwide goal of interviewing NIV applicants within 30 days. In the year before the 30-day goal was announced, the average wait time across the consulates in Mexico had been as high as 73 days; by the time of the announcement of the 30-day goal, however, Mission Mexico had already successfully reduced the average wait time to less than 30 days at all but one of its posts. Since February 2007, the mission has successfully kept the average wait time among the consulates at less than 30 days. The Western Hemisphere Travel Initiative In response to recommendations in the 9/11 Commission report, the Intelligence Reform and Terrorism Prevention Act of 2004, as amended, required that the Secretary of Homeland Security, in conjunction with the Secretary of State, develop and implement a plan that requires United States citizens to provide a passport, other document, or combination of documents that the Secretary of Homeland Security deems sufficient to show identity and citizenship when entering the United States from certain countries, including Mexico. This will represent a significant change for many U.S. citizens living in Mexico, who have until recently been able to routinely cross between the United States and Mexico with more limited documentation. The Department of Homeland Security (DHS) and State are implementing these requirements through WHTI. DHS implemented WHTI at all air ports of entry into the United States on January 23, 2007, and plans to implement the requirements at land and sea ports of entry beginning in June 2009, assuming that DHS and State can certify 3 months in advance that certain criteria have been met, as required under the law. State Anticipates Significant Increases in Mission Mexico’s Nonimmigrant Visa and Passport Workload from Fiscal Years 2007 to 2011 Ten years after the first surge in demand for Border Crossing Cards began in fiscal year 1998, State anticipates another surge in NIV demand in Mexico as these cards begin to expire and millions of card holders apply for renewals at U.S. consulates. In addition to this cyclical surge in demand caused by the expiring Border Crossing Cards, State officials anticipate that Mission Mexico will continue to experience steady growth in demand from first-time visa applicants. To assist in preparing for these increases, State has developed forecasts of the expected future NIV workload in Mexico. The NIV projections and forecasting methodology discussed in this report are based upon data State provided to us in February and April 2008. On June 18, State informed us that it has developed revised NIV forecasts for Mission Mexico based upon an alternative methodology. We have not yet had time to analyze these NIV forecasts or incorporate them into this testimony, but we may include a discussion of them in our final report, which is scheduled to be completed at the end of July 2008. State’s forecasts, as of April 2008, anticipate that the upcoming surge in NIV demand will follow a pattern similar to the previous Border Crossing Card surge from fiscal years 1998 to 2002, as shown in figure 1. According to the forecasts, the surge will begin in fiscal year 2008, with missionwide NIV demand peaking at a little more than 3 million applications in fiscal year 2011—a 103 percent increase in demand from fiscal year 2007. The forecasts show the surge beginning to abate in fiscal year 2012. In addition to the missionwide forecast, State has developed demand forecasts for individual consulates. As shown in figure 2, State’s forecasts anticipate that Mexico City will have the highest levels of demand, with applications growing to over 580,000 in fiscal year 2010. While Mexico City is projected to have the highest overall demand, State anticipates that the steepest increases in demand will occur at border posts. This follows a pattern similar to the previous Border Crossing Card surge, where the border consulates assumed a greater share of the total mission workload during the surge, with this share then diminishing again at the surge’s end. Estimating future NIV demand is inherently uncertain, and State acknowledges that several factors could affect the accuracy of its April 2008 NIV demand forecasts. First, the forecasts are based heavily upon Change Navigators’ 2005 Consular Affairs Futures Study (CAFS), which generated NIV demand forecasts for various high-volume and high-growth missions around the globe, including Mexico. Thus, the extent to which the underlying CAFS numbers prove to be accurate affects State’s revised forecasts. While the CAFS includes a general analysis of how various demographic, economic, and political factors impact NIV demand across countries, it does not explain how it arrived at its specific forecasts for Mexico. Based upon our review of the forecasts, it appears that the CAFS authors relied primarily upon historical workload data from the previous Border Crossing Card surge, but we could not assess how, if at all, other considerations were factored into the forecasts. Second, methodological issues associated with State’s April 2008 NIV forecasts may affect their accuracy in projecting demand. For example, State relied heavily on actual demand data from fiscal year 2007 to revise the CAFS forecasts, in order to try to better account for growth in demand from first-time visa applicants. In doing so, State assumed demand for fiscal year 2007 was representative of the underlying long-term growth in NIV demand. However, this is not necessarily the case, as State officials acknowledge demand may have been artificially high in fiscal year 2007 as posts worked off backlogs that had accumulated from previous years. State officials also noted that they chose to be conservative and assume all Border Crossing Card holders would renew their cards when they expire. However, this is not likely to happen, as a portion of Border Crossing Card holders have had their cards lost or stolen and already had them replaced, while others have either legally or illegally immigrated to the United States and will not be returning to renew their cards. Consequently, the forecasts could prove to be higher than actual demand depending on the share of Border Crossing Card holders who do not seek a renewal at the expiration of their card. State’s approach to forecasting NIV workload, based on historical precedent and underlying growth in demand, and other factors, provide a reasonable basis for addressing the anticipated surge in NIV demand. State has detailed data on the number of Border Crossing Cards issued during the previous surge and when they are expiring, which gives it a strong basis for its projections. Further, even if the NIV forecasts do not prove completely accurate, State officials do not expect significant risks for several reasons. First, State officials believe that the forecasts are conservative, with NIV demand likely to be lower than forecasted. Second, State intends to avoid relying on the exact numbers in the forecasts and is instead using them as a rough guide in developing plans to meet the upcoming surge in NIV workload. Third, State officials believe they have developed these plans with sufficient flexibility to be able to respond as needed if actual workload deviates from the forecasts. Finally, State plans to continually track demand at the consulates as the NIV surge unfolds and will revise these forecasts periodically. Passport Workload In addition to the surge in NIV workload, Mission Mexico will also experience a surge in its passport workload as a result of the implementation of WHTI at air ports of entry in January 2007 and its subsequent, intended implementation at land ports in June 2009. According to State officials, the mission has already seen a significant increase in its passport workload as U.S. citizens living in Mexico have begun to apply for passports in response to the new documentary requirements. Mission Mexico’s passport and CRBA workload, which State tracks together because both types of applications are handled by consular officers in posts’ American Citizen Services units, grew to 34,496 applications in fiscal year 2007, a 77 percent increase from fiscal year 2006. Despite the expected increases, passport workload will continue to be only a fraction of Mission Mexico’s workload, relative to NIV applications. While State expects passport workload in Mexico to continue to increase significantly in the coming years, it is difficult to predict precisely what the magnitude of this increase will be. Unlike with the NIV surge, there is not a clear historical precedent to the WHTI surge. Additionally, there is a great deal of uncertainty regarding the number of U.S. citizens living in Mexico and the number of these citizens who are potential passport applicants. Therefore, efforts to forecast increases in passport workload due to WHTI are extremely challenging. Nonetheless, State has developed rough estimates of Mission Mexico’s passport and CRBA workload with the implementation of WHTI. These estimates are based on the input of experienced consular officers because the lack of data on U.S. citizens living in Mexico made any type of statistical analysis problematic. Based upon State’s estimates, Mission Mexico’s WHTI workload is projected to peak at 73,000 passport and CRBA applications in fiscal year 2009 with the implementation of WHTI at land ports of entry. State anticipates that passport and CRBA workload will continue at that peak rate in fiscal year 2010 and then begin to decline. In its estimates, State predicts that from fiscal years 2007 to 2009, workload will increase by around 177 percent for Mission Mexico. To this point, State has not revised its WHTI estimates based on workload in fiscal year 2007, or year to date in the current fiscal year, even though the workload estimates were low in fiscal year 2007. State says it has not needed to revise its estimates at this point, because posts have been able to keep up with workload increases without the need for additional resources. In addition, rather than focusing on developing precise workload estimates in order to prepare for the surge, State has instead chosen to pursue strategies designed to provide it with the flexibility to respond to increases in workload as they occur—particularly as a more limited number of resources will be needed to cover increases in passport and CRBA applications than NIV applications, given their small share of Mission Mexico’s overall consular workload. State Is Adding Interviewing Windows and Temporary Adjudicators to Posts in Mexico to Keep Pace with Projected Workload Increases To keep pace with the expected NIV renewal surge, State is increasing the total number of hardened interview windows in the consulates’ NIV sections by over 50 percent before the demand peaks in 2011. State added windows to the consulate in Hermosillo in fiscal year 2007 and will soon be adding windows to the consulates in Monterrey and Mexico City. In addition, new consulate compounds in Ciudad Juarez and Tijuana will result in additional windows for adjudicating NIV applications. The new facility in Ciudad Juarez is set to open in September 2008, and construction on the new building in Tijuana began this past April. Once completed, these projects will provide Mission Mexico with the window capacity to interview about 1 million additional NIV applicants per year. Table 1 compares the number of interview windows available in fiscal year 2007 to the number that will be available by fiscal year 2011, when NIV demand peaks. Consulate officials at the posts we visited generally expressed confidence that they will have sufficient window capacity to keep pace with the expected NIV demand and avoid excessive wait times for interviews beyond State’s standard of 30 days. As shown in figure 3, our analysis of expected window capacity also indicates that Mission Mexico generally appears to have enough window capacity to keep pace with projected demand, based on the April 2008 projections. However, State officials acknowledge that two posts, Nuevo Laredo and Matamoros, will not have adequate window capacity during the NIV surge. Consequently, NIV applicants may face longer wait times for an interview appointment at these posts. State officials noted that individuals who would typically apply at one of these two posts will have the option to schedule appointments at the relatively nearby consulate in Monterrey, which is expected to have excess window capacity during the surge in demand. At other posts, the potential shortfall in window capacity, reflected in figure 3, appears to be small enough that it can likely be managed by extending hours that windows are open, if necessary. Although Guadalajara also appears to have a significant shortfall, consular officials there believe the post should be able to absorb the increased workload with the number of windows available as long as they have enough staff to work the windows in shifts to keep them open all day, if necessary. State Plans to Hire Temporary Adjudicators In addition to the increase in hardened windows, Mission Mexico requires a significant increase in adjudicators over the next few years. Based on NIV and passport workload projections, provided in April 2008, State estimates it will need 217 adjudicators throughout Mission Mexico in fiscal year 2011, which is the expected peak year of the surge in NIV demand. This number is an increase of 96 adjudicators, or about 80 percent, over the number of adjudicator positions in place in fiscal year 2007. State may revise its staffing plans as it generates updated forecasts. State plans to meet its staffing needs during the expected workload surge primarily by hiring a temporary workforce of consular adjudicators that can be assigned to posts throughout Mission Mexico, depending on each post’s workload demands. Figure 4 shows the number of temporary adjudicators and career adjudicators planned for Mission Mexico in fiscal year 2011. State officials noted that relying on a temporary workforce allows Mission Mexico to avoid having excess staff after the workload surge and reduces costs per staff compared to permanent hires. State has budgeted for about 100 temporary adjudicators to be in place during the surge in workload demand, although State officials noted that these budgeted funds could be reprogrammed if fewer than expected adjudicators are needed. State has already posted the job announcement on its Web site and expected to begin placing these additional temporary adjudicators at posts in fiscal year 2009. State officials noted that they will try to fill slots gradually to help posts absorb the additional staff. The temporary hires will be commissioned as consular officers with 1- year, noncareer appointments that can be renewed annually for up to 5 years. They will also receive the same 6-week Basic Consular Course at the Foreign Service Institute in Arlington, Virginia, as permanent Foreign Service officers. These individuals must be U.S. citizens, obtain a security clearance, and be functionally fluent in Spanish. Housing in Mexico for the temporary adjudicators will be arranged for by the State Bureau of Consular Affairs in Washington, D.C., through contract services, which will provide greater flexibility to move adjudicators from one post to another, if necessary. As figure 4 indicates, posts in Monterrey, Mexico City, Ciudad Juarez, and Tijuana are expected to be the heaviest users of temporary adjudicators. Consequently, these posts would be at greatest risk of increased NIV backlogs if temporary adjudicator slots cannot be filled as needed or if their productivity is not as high as anticipated. However, State officials believe they have an adequate pool of potential candidates from among returning Peace Corps volunteers, graduates of the National Security Education Program, eligible family members, and retired Foreign Service officers. These officials noted that they recently began reaching out to targeted groups of potential applicants and have already received strong interest. Furthermore, officials from the posts we visited were confident that State’s plan to provide them with additional consular officers would enable them to keep pace with workload demand. Post officials anticipate the same level of productivity and supervision requirements as they would expect from new career Foreign Service officers. The officials noted that new consular adjudicators typically take about 2 months of working the NIV interview windows to reach the productivity levels of more experienced adjudicators. New Processing Practices May Help Mission Keep Pace with NIV Demand State began a pilot program in the spring of 2008 at two posts, Monterrey and Nuevo Laredo, to outsource part of the NIV application process, including biometric data collection, to an off-site facility. The pilot is part of an effort by State to establish a new service delivery model for processing visas worldwide in response to long-term growth in demand for visas. State envisions expanding this model throughout Mexico and other high-demand posts worldwide through a formal request for proposal process. State also envisions the possibility of providing off-site data collection facilities serving NIV applicants in cities that do not have consulates. In Monterrey, the pilot made space available in the consulate facility to add much needed NIV interview windows. The pilot is implemented by a contractor that handles functions that do not require the direct involvement of a consular officer, including scanning of applicants’ fingerprints and passports, live-capture digital photograph, and visa passback. Consular officers at these two posts focus on their “core mission” of making adjudication decisions after the contractor has electronically transferred the applicants’ application and biometric data. The cost of outsourcing these functions is covered through an additional fee of $26 paid by the applicants. Consulate officials at the posts involved in the pilot are responsible for monitoring the performance of the contractor through the use of surveillance cameras, random visits to the off-site facility, and validation reviews of NIV applications to check for incidence of fraud or incorrect information. According to State officials, the contractor does not have the ability to alter any of the data it collects, and a U.S. citizen with a security clearance is on site to manage the facility. Consular officials in Monterrey stressed the importance of monitoring contractor employees to help ensure they do not coach applicants. State officials stated that the department intends to assess the pilot to ensure that the technological challenges of remote biometric data collection and data transfer have been overcome. They will also assess whether the new software involved presents the data to consular officers in a user-friendly format to facilitate the adjudication. In addition, State will monitor adjudication rates at the participating posts. State has neither established specific milestones for completing the pilot nor provided us with any metrics that would be part of an assessment of the potential impact on productivity, fraud, or security. In another step to help posts keep pace with NIV demand, Mission Mexico has also begun to waive interviews of NIV renewal applicants allowable under certain circumstances established by federal law and State regulations. State recently provided guidance to posts worldwide on waiving interviews for certain applicants, following the transition to the collection of 10 fingerprints and technology allowing reuse of fingerprints. The policy only applies to applicants seeking to renew their biometric NIVs within 12 months of expiration. Consular officers retain the discretion to require any applicant to appear for an interview, and no applicant may have an interview waived unless they clear all computer- based security screening. According to State guidance, consular officers will also have the discretion to waive interviews of applicants as part of the off-site data collection model being piloted in Monterrey and Nuevo Laredo, when prints collected off site match with the applicant’s fingerprints already in the system. According to State officials, this will be possible beginning in 2009, when Border Crossing Cards issued after 1999 containing biometric data start to expire. The Monterrey and Ciudad Juarez posts have already begun to waive interviews of applicants renewing NIVs and found significant productivity gains. As a result, officers there were able to adjudicate cases more rapidly and better utilize window capacity, according to consular officials. These posts also found no significant difference in denial rates for NIV renewal applicants who were interviewed compared to those whose interviews were waived, although post and Bureau of Consular Affairs officials noted it was necessary to continue monitoring the effect of waiving interviews. These officials also highlighted the need to adjust consular training to be consistent with State’s current guidance on waiving interviews under certain circumstances. Efforts to Meet Increased Passport Demand Posts in Mexico will also be increasing resources for adjudicating additional passport applications, which are expected to peak in fiscal year 2009. Although the volume of passport applications is much smaller than NIV applications, adjudicating passport applications for American citizens takes precedence over NIV applications. Consular officials at posts we visited noted that because of the uncertainty over future passport demand, they will depend on their flexibility to shift adjudicators from NIV work to passport work, as needed. In addition, consular officials stated they will have the option of using NIV interview windows to adjudicate passports applications—possibly during off hours, if necessary. In addition, posts are seeking ways to become more efficient in how they process the increasing volume of passports. For example, many posts have recently implemented an appointment system to better manage the flow of passport applicants and have also improved their Web sites to help provide better assistance to applicants, many of whom do not speak English and are applying for passports for the first time. State is also upgrading its software used for passport processing in overseas posts to enable posts to scan passport applications, which they expect will reduce staff resources needed for data entry. Some posts are also considering increased use of consular agents in other locations, such as Puerto Vallarta or Cabo San Lucas, to accept passport applications to help relieve some of the workload for consular staff. In addition, some posts have suggested exploring possibilities for processing passport renewals by mail, which would also help relieve overcrowding. Concluding Remarks In anticipation of the expected surge in demand for NIVs and U.S. passports in Mexico over the next several years, State has taken several steps to project workloads and expand the capacity of its consulates to avoid the type of backlogs that have occurred in Mission Mexico in the past. State’s efforts to increase the number of hardened interview windows at several of its consulates and hire additional temporary consular officers represent a substantial increase in resources needed to keep pace with the projected surge in NIV and passport workload. As State continues to revise its estimates of future workload, it may need to adjust its plans for increasing these resources to reflect the latest assumptions about future demand for passports and NIVs. The success of the efforts to prepare for the surges in passport and NIV workload is likely to depend on State’s ability to fill the roughly 100 slots it has budgeted for temporary adjudicators in time to meet the surge in workload. Several posts in Mexico will rely heavily on these additional staff to keep pace with expected demand for NIVs and avoid excessive wait times for interviews of applicants. However, State officials have expressed confidence that they will be able to fill these positions with qualified candidates. In addition, Mission Mexico may reap productivity gains from a pilot program to outsource part of the NIV application process at off-site facilities and from State’s policy to waive interviews for some renewal applicants; however, these efforts are in their early stages and are not yet widely implemented. Consequently, it would be premature to assess the potential effects of these efforts. We discussed this testimony with State officials, who agreed with our findings. Mr. Chairman, this concludes my prepared statement. I would be happy to answer any questions you or other Members of the Subcommittee may have at this time. GAO Contact and Staff Acknowledgments For further information regarding this testimony, please contact Jess T. Ford at (202) 512-4128 or [email protected]. Juan Gobel, Assistant Director; Ashley Alley; Joe Carney; Howard Cott; David Dornisch; Michael Hoffman; and Ryan Vaughan made key contributions to this statement. This is a work of the U.S. government and is not subject to copyright protection in the United States. The published product may be reproduced and distributed in its entirety without further permission from GAO. However, because this work may contain copyrighted images or other material, permission from the copyright holder may be necessary if you wish to reproduce this material separately.

Summary: The U.S. Mission in Mexico is the Department of State's largest consular operation. In fiscal year 2007, it processed 1.5 million of the 8 million nonimmigrant visas (NIV) State handled worldwide. The U.S. Mission in Mexico also provided services, including passport processing and emergency assistance, to 20,000 American citizens in fiscal year 2007. This already significant consular workload is expected to increase dramatically in the coming years as millions of NIV Border Crossing Cards issued in Mexico between fiscal years 1998 and 2002 expire and need to be renewed. In addition, the implementation of new travel requirements under the Western Hemisphere Travel Initiative (WHTI) will, for the first time, require U.S. citizens to carry passports, or other approved documentation, when traveling between the United States and Mexico. This testimony addresses (1) State's estimates of the workload for consulates in Mexico through 2012 resulting from, in particular, new travel requirements and the reissue of Border Crossing Cards; and (2) the actions State has taken to ensure consulates in Mexico keep pace with projected workload increases through 2012. This testimony is based on work currently in process that involves analyzing State's workload forecasts and forecast methodology, interviewing State officials, and visiting five posts in Mexico. GAO discussed this testimony with State officials, who agreed with GAO's findings. According to State forecasts, as of April 2008, the U.S. Mission in Mexico's (Mission Mexico) NIV demand will peak at slightly over 3 million applications in fiscal year 2011, about twice the number from fiscal year 2007. State acknowledges there are uncertainties regarding the number of Border Crossing Card holders who will renew their cards and the number of first time NIV applicants, which may affect the accuracy of its forecasts. State will be revising the forecasts on a periodic basis as new data become available. In addition to its increase in NIV workload, Mission Mexico will also be facing increases in its passport workload due to the implementation of WHTI. The exact magnitude of the increase in passport workload is more difficult to forecast than for NIVs, because there is not the same historical precedent. There is also a great deal of uncertainty as to how many U.S. citizens actually live in Mexico or the number of these citizens likely to apply for a passport. In anticipation of this surge in demand for NIVs and U.S. passports, State is taking steps to ensure consulates in Mexico keep pace, including adding consular interview windows to several high-demand posts and planning to hire about 100 temporary adjudicating officers. Consular officials GAO met with at several posts in Mexico generally agreed that these efforts to expand resources should be adequate for Mission Mexico to keep pace with expected workload increases, and GAO's analysis indicates the mission will generally have enough interviewing windows during the surge. Several posts will rely on the addition of temporary adjudicators to keep pace with increased NIV demand and would face backlogs if these slots cannot be filled or if the temporary staff are not as productive as expected. However, State is confident that it has an adequate pool of potential applicants. Mission Mexico may also gain additional capacity from a pilot program, currently under way at two posts, that outsources a portion of the NIV application process to off-site facilities; however, the pilot was implemented too recently to assess its potential impact on productivity, fraud, or security.

gov_report

en

Summarize: L’estate inizia all’insegna delle notti magiche. Dopo un anno di rinvio a causa dello stop imposto dalla pandemia, l’11 giugno prende il via il campionato Europeo di calcio UEFA Euro2020, e tutti saremo pronti a tifare l’Italia guidata da Roberto Mancini che si presenta tra le favorite, grazie ad una fase di qualificazione affrontata in maniera impeccabile. Che sia la volta buona per sfatare una tradizione negativa per la nostra Nazionale in questa competizione? In quindici edizioni degli Europei, infatti, gli Azzurri sono riusciti a vincere soltanto una volta, nel lontano 1968 in un’edizione giocata proprio in Italia. Mai come quest’anno la denominazione di campionato europeo ha un senso. Per la prima volta infatti, per festeggiare i 60 anni del torneo, non ci sarà un’unica Nazione ospitante, ma la competizione sarà itinerante svolgendosi in ben undici città del nostro continente. Quale migliore occasione per fare un giro d’Europa senza muoversi dal divano di casa? Ci saranno infatti città famose e conosciute, come Londra, che allo stadio di Wembley ospiterà ben sette gare, comprese le due semifinali e la finalissima, Monaco di Baviera per la Germania e Amsterdam per l’Olanda. Per il nostro Paese è stata scelta come sede Roma, e allo stadio Olimpico si disputeranno quattro partite, tra cui la gara inaugurale e un ottavo di finale. Ma questo torneo sarà l’occasione per scoprire città magari a noi meno note, ma ricche di fascino. Come Baku, la capitale dell’Azerbaigian affacciata sul Mar Caspio, l’elegante Bucarest in Romania, o Siviglia, con le sue incantevoli architetture in stile moresco, figlie dell’influenza araba. E poi andremo al nord, a Glasgow, la città più grande della Scozia pur non essendone la capitale, e a San Pietroburgo, che della Russia incarna tutta la grandeur dell’epoca zarista. Non mancheranno un salto in Danimarca, a Copenaghen, nel 2014 premiata come capitale verde europea, e in Ungheria nella splendida Budapest, affacciata sul Danubio. E in questo splendido scenario saranno 24 le squadre pronte a darsi battaglia per il titolo finale. Ci saranno le principali favorite Inghilterra e Francia, ma anche le outsider Belgio, Spagna e Germania. E ovviamente l’Italia, che può contare su un gruppo giovane, affiatato e desideroso di riscattare le ultime delusioni. Prima tra tutte la mancata qualificazione agli ultimi Mondiali, ma anche le più recenti partecipazioni agli Europei chiedono una rivincita: la cocente sconfitta con la Spagna per 4-0 in finale nel 2012, e l’eliminazione ai quarti di finale con la Germania nel 2016, in una sfida infinita decisa ai calci di rigore dopo ben diciotto tiri dal dischetto. Attenzione poi alle possibili sorprese, come Polonia, Ucraina, Svizzera e Croazia, tutte vincitrici dei propri gironi di qualificazione. E chissà cosa farà la cenerentola Macedonia del Nord, alla sua prima partecipazione. D’altro canto, gli Europei sono da sempre una competizione aperta a qualsiasi risultato. Basti pensare alle imprevedibili vittorie della Danimarca nel 1992 e della Grecia nel 2004. Per godere di questo evento e di questo viaggio virtuale nelle città europee, dobbiamo essere preparati al meglio. Se non sarà possibile essere sul posto, almeno organizziamoci per vedere le partite nella maniera più confortevole e attrezzata possibile. Il posto dove trovare tutto quello che occorre è eBay. A partire dai migliori divani, poltrone e pouf per potersi godere comodamente la partita. Ma se la comodità è importante, non va dimenticata la qualità della visione: una partita seguita su un televisore ad alta definizione e con la migliore tecnologia è tutta un’altra cosa, e in un attimo avremo la sensazione di essere a bordo campo. Magari sorseggiando un caffè o la nostra bibita preferita e sgranocchiando uno snack, armati di smartphone per commentare con gli amici a distanza. E se la partita non è andata come avremmo desiderato, c’è sempre la possibilità di rigiocarla con una bella console per prendersi la rivincita.

Summary: Dall'11 giugno all'11 luglio va in scena il campionato Europeo di calcio rinviato l'anno scorso a causa della pandemia. Per festeggiare i 60 anni della manifestazione, questa edizione sarà itinerante: non ci sarà un solo Paese ospitante ma le partite si terranno in undici diverse città europee, tra cui Roma. Un giro d'Europa che i telespettatori potranno fare senza muoversi da casa e tifando Italia.

fanpage

it

Write a title and summarize: Human γ-secretase is an intra-membrane protease that cleaves many different substrates. Aberrant cleavage of Notch is implicated in cancer, while abnormalities in cutting amyloid precursor protein lead to Alzheimer' s disease. Our previous cryo-EM structure of γ-secretase revealed considerable disorder in its catalytic subunit presenilin. Here, we describe an image classification procedure that characterizes molecular plasticity at the secondary structure level, and apply this method to identify three distinct conformations in our previous sample. In one of these conformations, an additional transmembrane helix is visible that cannot be attributed to the known components of γ-secretase. In addition, we present a γ-secretase structure in complex with the dipeptidic inhibitor N-[N- (3,5-difluorophenacetyl) -L-alanyl]-S-phenylglycine t-butyl ester (DAPT). Our results reveal how conformational mobility in the second and sixth transmembrane helices of presenilin is greatly reduced upon binding of DAPT or the additional helix, and form the basis for a new model of how substrate enters the transmembrane domain. γ-Secretase clears the anchors of type-I membrane proteins that are left behind in the membrane after shedding of their ectodomain. The substrate specificity of this intra-membrane protease is remarkably relaxed. It will cleave a wide range of substrates, as long as they form a single hydrophobic transmembrane helix, and the remaining ectodomain is not too large (Struhl and Adachi, 2000). As a manifestation of its promiscuous substrate specificity, γ-secretase also cleaves its substrate in different positions. For two of its most studied substrates, the Notch receptor and the amyloid precursor protein (APP), γ-secretase performs an initial endopeptidase-like ε-cleavage, which is followed by carboxypeptidase-like trimming, called γ-cleavage. Cleavage of APP leads to secretion of β-amyloid (Aβ) peptides into the extracellular environment. Abundant deposits of Aβ peptides in the brain, clinically known as β-amyloid plaques, are a defining characteristic of Alzheimer' s disease (AD). Variability in the position of both ε– and γ-cleavages results in Aβ peptides with lengths ranging from 36 to 49 residues, with Aβ40 being the most common form. Longer peptides seem to be more prone to aggregation, and increased ratios of Aβ42/Aβ40 are thought to play a role in AD pathogenesis (Tanzi and Bertram, 2005). Because of its central role in Aβ generation, γ-secretase is an attractive target for treatment of AD. However, a clinical trial with the γ-secretase inhibitor semagacestat had to be interrupted prematurely due to strong side effects, including skin cancer, weight loss and a faster decline of the cognitive skills of patients receiving the highest dose of the drug (De Strooper, 2014). Probably, global inhibition of the complex to reduce the formation of Aβ-peptides is undesirable, as this may also affect other pathways such as Notch signaling. Therefore, the development of modulators of γ-secretase activity that leave ε-cleavage intact but stimulate γ-cleavage has been suggested as an alternative (Wolfe, 2012). Moreover, the development of specific inhibitors of Notch cleavage may be beneficial for the treatment of cancer. However, such developments are currently hindered by a lack of quantitative insights into the mechanism of γ-secretase proteolysis. The γ-secretase complex consists of four essential, integral membrane proteins: presenilin (PS), nicastrin, anterior pharynx defective 1 (Aph-1), and presenilin enhancer 2 (Pen-2) (De Strooper, 2003; Kimberly et al., 2003). PS provides the two essential aspartates that form the proteolytic active site where both ε and γ-cleavages occur. More than 200 missense mutations in the gene for PS have been linked to an early-onset, familial form of Alzheimer' s disease (FAD) ( (De Strooper et al., 2012) and http: //www. alzforum. org/mutations). In humans, two genes encode two homologous forms of PS (PS1 and PS2), but most FAD-derived mutations target PS1. Because there are also two forms of Aph-1 (Aph-1a and Aph-1b), four possible complexes may form, of which nicastrin: Aph-1a: PS1: Pen-2 is the most abundant. Nicastrin has a large, heavily glycosylated ectodomain, which is thought to play a role in substrate recognition (Shah et al., 2005). Aph-1 has been proposed to play a scaffolding role (Lee et al., 2004). Pen-2 is essential for proteolytic activity of the mature complex, and facilitates auto-proteolysis of PS1 in a long cytosolic loop between its sixth and seventh transmembrane helices (TM6 and TM7) (Thinakaran et al., 1996). We recently solved the cryo-EM structure of a nicastrin: Aph-1a: PS1: Pen-2 complex to a resolution of 3. 4 Å (Bai et al., 2015a). This structure allowed building a near-complete atomic model, and revealed how Aph-1 and Pen-2 hold a remarkably flexible PS1 subunit underneath the nicastrin ectodomain. In particular, TM2, the cytoplasmic side of TM6 and the long linker between TM6 and TM7 of PS1 were largely disordered. The presence of the linker could only be inferred from fuzzy densities in 2D class averages, whereas the approximate position of TM2 could only be inferred from a 7 Å low-pass filtered map. This low-pass filtered map also showed a rod-shaped density in the cavity between TM2, TM3 and TM5, but the identity of this density could not be determined. Although the sample used for structure determination did show proteolytic activity for APP (Lu et al., 2014), the active site appeared to be in an inactive conformation as the two catalytic aspartates were too far apart to catalyze proteolysis. In this paper, we set out to gain further insights into the proteolytic mechanism of γ-secretase by using two complementary approaches to sample the conformational landscape of its catalytic subunit. With the aim of trapping the complex in a more defined conformation, we solve a structure in complex with the non-transition-state analogue inhibitor DAPT, which is a precursor in the development of semagacestat (Dovey et al., 2001). In addition, we describe how masked cryo-EM image classification combined with subtraction of part of the signal from the experimental images allows visualizing molecular dynamics of the catalytic subunit in its apo-state at the secondary structure level. The resulting four structures represent a significant step towards understanding how this protease cleaves its many substrates. A powerful method of dealing with structural heterogeneity in cryo-EM data sets is to' focus' refinement on a defined region of the protein complex of interest. In this approach one masks out part of the reference during 3D refinement, thereby effectively ignoring structural variability in less interesting parts. For example, we used masked refinements to deal with variability in the relative orientations of ribosomal subunits (Amunts et al., 2014; Wong et al., 2014). Similarly, masked multi-reference refinement may be used as a clustering tool, i. e. to separate experimental particle images based on differences in a defined region of interest. We refer to this approach as masked 3D classification. However, masked 3D classifications aimed at analyzing the conformational landscape of γ-secretase in its apo-state were unsuccessful. An initial data set of 400,000 particles gave rise to a 3. 5 Å map. Using different masks on the transmembrane domain, masked 3D classification consistently yielded only a single class showing good density. Although this approach did result in the selection of 160,000 particles from which we could calculate a better 3. 4 Å map, it did not reveal the nature of conformational freedom within the catalytic subunit (Bai et al., 2015a). A fundamental problem with masked refinements is that one compares projections of a partial map with experimental projections of the entire particle (Figure 1). This leads to inconsistencies in the comparisons that underlie the refinement procedure. For example, one might want to focus classification on the part of the particle that is depicted in red in Figure 1A, and ignore any variations in the yellow part. Masking away the yellow part from the reconstruction in masked refinements (Figure 1C) yields reference projections that only contain the red part (Figure 1F). However, each experimental image (Figure 1D) contains signal coming from the entire particle, i. e. from both the yellow and the red parts. Therefore, the yellow part of the signal will act as an additional source of noise in the comparison between the experimental image and the masked reference projection. It will depend on the signal-to-noise ratio in the original image and on the size of the part of the complex that is masked away, whether this additional noise will affect the refinement. For large particles, high signal-to-noise ratios in the data make masked refinements relatively robust, but even for ribosomes masked refinements of the small subunit proved much more difficult than for the large subunit (Wong et al., 2014). 10. 7554/eLife. 11182. 003Figure 1. Masked classification with residual signal subtraction. (A) A 3D model of a complex of interest. (B) The part of the complex one would like to ignore in masked classification (V1) is shown in yellow. (C) The part of the complex one would like to focus classification on (V2) is shown in red. (D) An experimental particle image is assumed to be a 2D projection of the entire complex in panel A that is affected by the contrast transfer function (CTF), and to which experimental noise (N, shown in grey) has been added. (E) A CTF-affected 2D projection of V1. (F) A CTF-affected 2D projection of V2. Previous approaches to masked classification in RELION (Amunts et al., 2014; Wong et al., 2014) compared experimental particles (panel D), with reference projections of only V2 (panel F). This results in inconsistent comparisons. (G) In the modified masked classification approach, one subtracts the CTF-affected 2D projection of V1 (panel E) from the experimental particle (panel D). This results in a modified experimental particle image that only contains experimental noise and the CTF-affected projection of V2, so that comparison with the reference projection in panel F becomes consistent. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 003 To reduce the inconsistency in image comparison, we explored a modification of the masked classification approach. Using the example in Figure 1, if the noisy experimental image were to contain only signal from the red part, then a masked refinement would be consistent. To emulate this situation, we subtract projections of the yellow part of the reconstruction (Figure 1B, E) from every experimental image. This requires knowledge about the relative orientation of each particle, which is obtained from a consensus refinement of the entire data set against a single, unmasked reference. Also, we apply the CTF of each experimental image to the projection of the yellow part prior to the subtraction. The resulting, modified experimental particle image (Figure 1G) then ideally only contains the signal from the red part of the particle, and the only inconsistency in the image comparison is the original experimental noise. Therefore, using the subtracted experimental particle images in masked refinements that are focused on the red part of the signal will be better than using the original images. Because the PS1 subunit showed the highest level of disorder in our high-resolution structure, we decided to perform masked classification on PS1 with subtraction of the signal from the rest of the complex. Since the total molecular weight of the ordered part of PS1 in our previous map was less than 30 kDa, we reasoned that the remaining signal in the subtracted experimental images would probably not be strong enough to allow the determination of their relative orientations. Therefore, we performed masked classification on the set of 400,000 particles, while keeping all orientations fixed at the values determined in the refinement of the 3. 5 Å consensus map. Classification into eight classes yielded three majority classes that showed good density (Figure 2). Five smaller classes gave suboptimal reconstructions, and the particles from these classes were discarded. The (original, non-subtracted) particles from the good classes were then subjected to separate 3D auto-refinement runs (Scheres, 2012), all of which were started from the same 40 Å low-pass filtered reference to avoid model bias. The resulting maps were very similar in the nicastrin and Aph-1 subunits, but obvious differences were present in the PS1 and Pen-2 subunits. The maps had resolutions in the range of 4. 0–4. 3 Å, which allowed reliable main-chain tracing, but left density for many side chains less well defined (Table 1, Figure 3, Figure 3—figure supplement 1). 10. 7554/eLife. 11182. 004Figure 2. Masked classification with signal subtraction on PS1. (A) From a masked 3D classification run on the PS1 subunit, the three largest classes (in cyan and blue, labeled class 1–3) showed good density. The five smallest classes (in grey) were ignored in further analyses as they showed suboptimal density. (B) Superposition of classes 1 and 2 and of classes 2 and 3 reveals the different orientations of TM6 in all three classes (indicated with red arrows), and the fact that TM2 (indicated with a red dashed box) is only ordered in class 1. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 00410. 7554/eLife. 11182. 005Figure 2—figure supplement 1. Cross-refinement of the masked classification results. A 10Å low-pass filtered version of the map from class 3 (left) was refined against the particle subset identified for class 1. The resulting map (right) is undistinguishable from the original map from class 1, indicating that artifacts due to model bias did not play a role. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 00510. 7554/eLife. 11182. 006Figure 2—figure supplement 2. Masked classification on Aph-1. (A) From a masked 3D classification run on the Aph-1 subunit with subtraction of the residual signal, all eight classes look very similar. (B) A superposition of all eight maps. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 00610. 7554/eLife. 11182. 007Figure 2—figure supplement 3. Reproducibility of masked classification on PS1. Resulting maps from masked classifications on PS1 with subtraction of the residual signal using (A) six instead of eight classes; (B) a different random seed; and (C) ten classes and a slightly different mask from the run shown in Figure 2. The classes similar to the three largest classes shown in Figure 2 are highlighted in the same cyan and blue colors. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 00710. 7554/eLife. 11182. 008Figure 2—figure supplement 4. Masked classification with simulated data. (A) Three examples of experimental particle images. (B) Three examples of simulated particle images. In total, 50,000 images of particles from Class 1 and 50,000 images of particles from Class 2 were simulated (also see Methods). (C) Resulting maps for a masked classification with signal subtraction on the catalytic subunit using two references. (D) Distribution of the simulated particles in the resulting classes: 93% of the particles were clustered correctly. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 00810. 7554/eLife. 11182. 009Figure 3. Three classes from the apo-state ensemble. (A) The reconstructed density for the three classes. Nicastrin is shown in green, Aph-1 in orange, PS1 in cyan, and Pen-2 in yellow. α-Helical density that is unaccounted for by the γ-secretase model is shown in purple. The same color code is used throughout this paper. (B) Schematic representation of the γ-secretase atomic models. TMs of PS1 are numbered. The active site aspartates are shown in red. The purple dashed box highlights TM2 of PS1, which is only ordered in class 1. The purple arrows indicate the orientation of TM6, which is different in each class. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 00910. 7554/eLife. 11182. 010Figure 3—figure supplement 1. Fourier shell correlations for the three apo-state classes. (A) FSC between the refined atomic models and the maps. (B) FSC between reconstructions from independently refined halves of the data sets. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 01010. 7554/eLife. 11182. 011Table 1. Refinement and model statisticsDOI: http: //dx. doi. org/10. 7554/eLife. 11182. 011Class1Class2Class3DAPTData collection Particles63,87379,26366,72051,366 Pixel size (Å) 1. 41. 41. 41. 4 Defocus range (μm) 0. 7–3. 20. 7–3. 20. 7–3. 20. 6–2. 8 Voltage (kV) 300300300300 Electron dose (e-/Å−2) 40404040Map features Density TM2+--+ Cα-Cα distance D257– D385 (Å) 9. 512. 79. 18. 0 Conformation Pen-2ininoutin α-helical density++--Model composition Non-hydrogen atoms10,4439,9229,91610,543 Protein residues1,3151,2451,2471,329Refinement Resolution (Å) 4. 14. 04. 34. 2 Map sharpening B-factor (Å2) −100−100−130−130 Fourier Shell Correlation0. 82360. 88180. 80500. 8602 Rfactor0. 29170. 30280. 28160. 3426Rms deviations Bonds (Å) 0. 01120. 00950. 01200. 0093 Angles (°) 1. 73521. 60831. 79221. 6186Model geometry Molprobity score3. 172. 893. 163. 22 Clashscore (all atoms) 17. 359. 3113. 2618. 15 Good rotamers (%) 89. 690. 986. 688. 9Ramachandran plot Favored (%) 85. 184. 484. 284. 3 Allowed (%) 10. 912. 311. 511. 8 Outliers (%) 4. 03. 34. 33. 9 As a control for model bias we performed a cross-refinement, where the 10 Å low-pass filtered map from class 3 was used as initial reference for refinement of the particles assigned to class 1 (Figure 2—figure supplement 1). The initial reference did not influence convergence, as the cross-refinement yielded a map that was indistinguishable from the one obtained for class 1 in Figure 3. As a negative control, we performed masked classification with signal subtraction using eight classes on the Aph-1 subunit (Figure 2—figure supplement 2). The density for this subunit in the consensus map was very well defined, indicating that this subunit is much more rigid than PS1. In this case, the eight resulting classes attracted similar numbers of particles and all eight classes gave rise to very similar reconstructions. Finally, in a third control to test reproducibility we performed multiple different masked classifications on the PS1 subunit (Figure 2—figure supplement 3). We used different numbers of classes (six and ten instead of eight), a different random seed, or slightly different masks on PS1. In all cases, although the class distributions and the structural details varied, the resulting classes revealed similar differences for TM2 and TM6. In addition, we tested our method on a simulated set of images containing a mixture of projections from the maps of classes 1 and 2 in Figure 3. For these simulations we used similar signal-to-noise ratios, CTF parameters and orientational distributions as observed in our experimental data set (also see Methods). Masked classification with signal subtraction on the PS1 subunit correctly identified 93% of the simulated particles (Figure 2—figure supplement 4). Comparison of the three structures that were identified in the experimental data set using masked classification on the PS1 subunit (Table 1, Videos 1–2) explained observations made in the consensus structure. In the high-resolution structure, density for the cytoplasmic side of TM6 was weak, while density for TM2 was only visible after applying a 7 Å low-pass filter. This agrees with the observation that TM2 is only ordered in class 1, whereas TM6 adopts different orientations in all three classes. Control classifications with variations in the number of classes, random seeds or masks revealed even more variations in the conformation of TM6 (e. g. see Figure 2—figure supplement 3). Probably, TM6 adopts a wide range of conformations in solution and our classification merely provides discrete snapshots of a continuum. 10. 7554/eLife. 11182. 012Video 1. A morph between the atomic models from class 1 and 2 of the apo-state ensemble. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 01210. 7554/eLife. 11182. 013Video 2. A morph between the atomic models from class 2 and 3 of the apo-state ensemble. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 013 Despite the fact that we did not focus our classification on Pen-2, we also observe significant variations in the conformation of Pen-2. Compared to classes 1 and 2, Pen-2 in class 3 has rotated away from PS1. This rotation concurs with a large conformational change in PS1, where TM3 and TM4 rotate in the same direction as Pen-2, TM5 and TM6 move towards the extracellular space, and TM6 rotates towards TM7 (see Video 2). The rotation and upward motion of TM6 positions the two catalytic aspartates within close enough distance of each other to potentially catalyze proteolysis (although we do not see density for the aspartate side chains). When the high-resolution consensus map was low-pass filtered to 7 Å, besides density for TM2 a second, unidentified rod-shaped density was also observed in the cavity formed by TM2, TM3 and TM5 of PS1 (Bai et al., 2015a). A similar density that could not be attributed to any of the known γ-secretase components is also visible in classes 1 and 2, but not in class 3. The rod-shaped density is best defined in class 1, where it shows clear features of α-helical pitch. We modeled this density as an α-helix with an almost 90-degree kink at the extracellular side of the transmembrane domain (Figure 4). The kink of this helix is in close proximity of the loop of residues 240–244 of nicastrin, and then extends into the membrane through the cavity formed by TM2, TM3 and TM5 of PS1, until it disappears just before reaching the active site. The density closest to the active site looks less helical, and in this region we modeled it as an extended chain. The entire cavity in which the helix is present is lined with residues from TM2, TM3 and TM5 of PS1 that have been implicated in FAD. The cryo-EM density was not of sufficient quality to allow the identification of this helix. Mass spectrometry analysis suggested the presence of multiple proteins with a single predicted transmembrane helix in our sample, and the presence of three of these proteins was further confirmed by Western blot analysis (Figure 4—figure supplement 1). 10. 7554/eLife. 11182. 014Figure 4. Helical density in class 1 of the apo-state ensemble. (A–C) Three different views of the map and the atomic model are shown. The kinked α-helix that is unaccounted for by the γ-secretase model is shown in purple. PS1 residues that interact with this helix are labeled. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 01410. 7554/eLife. 11182. 015Figure 4—figure supplement 1. Mass spectrometry and Western blot analyses. (A) The lower part of a Coomassie blue-stained SDS-PAGE gel of the γ-secretase sample that was also used for cryo-EM imaging was cut out and submitted for mass spectrometric analysis. Besides known γ-secretase components (bold text), several proteins with a single predicted transmembrane helix were also identified. (B) Western blot analyses confirmed the presence of at least three of the identified proteins in the sample. Arrowheads indicate their expected molecular weights. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 015 In order to gain further insights into the plasticity of the catalytic subunit, we also performed cryo-EM single-particle analysis on γ-secretase in complex with DAPT (Figure 5, Figure 5—figure supplement 1). Despite collecting a comparable amount of micrographs as we did for the apo-state complex, 2D and 3D classification approaches selected less than 20% of the complexes as suitable for high-resolution reconstruction. This contrasts with a selection of approximately 40% for the apo-state data set. Because the overall appearance of the micrographs for both data sets was similar, it could be that either DAPT or the dimethyl sulfoxide (DMSO) in which DAPT was dissolved interfered with the structural integrity of the complex. Nonetheless, from the selected 51,366 particles we calculated a 4. 2 Å map, which was of sufficient quality to build a reliable main-chain model, although the density for many side chains was less clear. For these data, masked classifications with signal subtraction revealed only a single class with good density for the transmembrane helices, and this class did not show any helical-like density in the cavity between TM2, TM3 and TM5 of PS1 (Figure 5—figure supplement 2). 10. 7554/eLife. 11182. 016Figure 5. Cryo-EM structure of γ-secretase in complex with DAPT. (A) The reconstructed density for the entire complex. Density attributed to DAPT is shown in blue. (B) Schematic representation of the atomic model. TMs of PS1 are numbered. (C) Two approximately orthogonal close-ups of the DAPT-binding site. Residues that interact with DAPT, as well as His163 and Glu280 are labeled. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 01610. 7554/eLife. 11182. 017Figure 5—figure supplement 1. Fourier shell correlations for the DAPT-bound structure. (A) FSC curves of the refined atomic model versus the map it was refined against (in black); of a model refined in the first of the two independently refined half-maps versus that same map (in red); and of a model refined in the first of the two independent half-maps versus the second half-map (in green). (B) FSC between the two independently refined half-maps. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 01710. 7554/eLife. 11182. 018Figure 5—figure supplement 2. Masked classification with signal subtraction on the DAPT-bound data. Using either masks around the PS1 subunit (top row) or the entire transmembrane domain (bottom row), masked classification with signal subtraction revealed only a single majority class (pink) that showed good density for the transmembrane helices (corresponding to 23% and 26% of the particles, respectively). In these maps, no helical-like density was observed in the cavity between TM2, TM3 and TM5 of PS1DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 01810. 7554/eLife. 11182. 019Figure 5—figure supplement 3. Newly ordered elements in the DAPT-bound structure. Two orthogonal views of a cartoon representation of the transmembrane domain of the DAPT-bound structure are shown. Those parts of the atomic model that were built in this structure but were disordered in the high-resolution consensus structure of the apo-state are shown in red. The density attributed to the DAPT molecule is shown in blue. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 01910. 7554/eLife. 11182. 020Figure 5—figure supplement 4. Similarity between the DAPT-bound structure of PS1 and class 1. Two orthogonal views of an overlay of the DAPT-bound PS1 structure (in cyan) and class 1 of the apo-state ensemble (in grey) are shown. The catalytic aspartates in the DAPT-bound structure are shown in red. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 020 Upon inhibitor binding, there are no prominent changes in Aph-1 and nicastrin, and Pen-2 is in a very similar conformation as in classes 1 and 2 of the apo-state ensemble. The largest changes occur in PS1, which is much better ordered in the complex with DAPT. TM2 and its linkers with TM1 and TM3, the cytoplasmic ends of TM3 and TM6, and part of the long linker between TM6-7 all become ordered upon DAPT binding (Figure 5—figure supplement 3). The linker between TM1 and TM2 sticks partially into the transmembrane region to fold back out again to connect to TM2. This helix contains 32 residues and runs at an angle of approximately 40 degrees with the plane of the membrane. At the cytoplasmic side of the membrane a short linker connects TM2 to TM3, and TM3 extends 7 residues longer than in the apo-state. Interestingly, apart from local changes in the cytoplasmic sides of TM2 and TM6, the overall conformation of PS1 in the DAPT-bound structure is very similar to class 1 from the apo-state ensemble, and the two structures overlap with a root mean squared deviation (r. m. s. d.) of 0. 4 Å between 265 Cα atom pairs (Figure 5—figure supplement 4). Near the active site, TM6 displays a strong kink at Pro264, which positions its cytoplasmic side underneath a cavity formed by TM2, TM3, TM5, TM6 and TM7. This cavity contains the only peak of strong density in the transmembrane domain that is unaccounted for by the protein model (Figure 5C). It breaks up into disconnected pieces at 4. 5 standard deviations above the mean, which is somewhat weaker than the surrounding transmembrane helices in PS1, which break up at approximately 6 standard deviations above the mean. The size of this density is consistent with the expected size of a single DAPT molecule. Therefore, we tentatively assign this density to the inhibitor, although at the limited resolution of our map we cannot determine its exact orientation or conformation. The pocket where the inhibitor binds is very hydrophobic, which is as anticipated given the hydrophobic nature of the DAPT molecule. In particular, Met146 and Met233, as well as Trp165, Phe283 and Gly384 seem to be involved in interactions with the inhibitor. Except for Phe283, all these residues have been targeted for mutations in FAD patients. The location of the inhibitor right next to the active site is also in good agreement with previous observations that the DAPT binding site is distinct from, but in close proximity of the active site (Kornilova et al., 2003; Morohashi et al., 2006). Combined with a small movement of TM7 towards TM6, the kink in TM6 brings the Cα atoms of the two catalytic aspartates within 8. 0 Å of each other, which may again be close enough to facilitate catalysis. Also the conformation of the highly conserved 433PAL435 motif, which is important for γ-secretase activity (Wang et al., 2004,2006), changes upon DAPT binding. A large part of the linker between TM6 and TM7 remains invisible, but at the cytoplasmic end of TM6 part of this linker becomes ordered as it passes beneath the inhibitor (Figure 5C). There, residues 280-283 form a single α-helical turn, which is stabilized by a hydrogen bond between Glu280 and His163, while Phe283 interacts with the inhibitor. Mutation of Glu280 into an alanine (the so-called Paisa mutation) is by far the most common cause of FAD (http: //www. alzforum. org/mutations). Residues 285–288 form a short β-strand before the density of the linker disappears just three residues before the auto-proteolytic cleavage site between Thr291 and Met292. The density then reappears at residue 378, where residues 378–381 form a second β-strand that hydrogen bonds with the first. Although many proteins employ functionally important flexibility at the level of secondary structure, few experimental techniques exist for the study of this dynamics. Nuclear magnetic resonance (NMR) is a powerful tool for the characterization of structural ensembles in dynamic complexes, but its applicability is typically limited to proteins with a molecular weight below 40– 50 kDa. For complexes larger than several hundred thousand daltons, dynamic changes in tertiary and quaternary structure have been studied by cryo-EM image classification, in particular with the recent advent of direct electron detectors and improved computer algorithms (Bai et al., 2015b; Dashti et al., 2014). However, for complexes that are too large for NMR, the characterization of molecular dynamics within individual protein domains has typically been restricted to computer simulations. The procedure for masked cryo-EM image classification combined with residual signal subtraction fills part of this gap in experimental techniques. The idea to subtract part of the signal from experimental cryo-EM images is not new. Michael Radermacher and colleagues subtracted partial projections from cryo-EM images to study symmetry mismatches in bacteriophage ϕ29 (Morais et al., 2003) and flaviviruses (Zhang et al., 2007); Steven Ludtke and colleagues used image subtraction in the e2ligandclassify. py program to separate ribosomes with and without secY channels (Park et al., 2014); Hongwei Wang and colleagues used a modified version of RELION to subtract projections of NSF rings to analyze a symmetry mismatch and structural variability in the SNAP-SNARE complex (Zhou et al., 2015); we used an iterative image subtraction method in RELION to improve the density of a flexible domain of the spliceosomal U4/U6. U5 tri-snRNP complex (Nguyen et al., 2015); and most recently, Huiskonen and colleagues also used RELION to subtract viral capsid densities in order to visualize an RNA polymerase bound inside the virus (Ilca et al., 2015). The procedure described here provides an easily accessible and generally applicable tool for signal subtraction coupled to masked refinements and/or classifications of single-particle data. Its successful application to γ-secretase demonstrates its potential for complexes that are considered to be relatively small for cryo-EM structure determination, and shows that it allows separation of protein structures that differ only in the orientation and position of a few α-helices. Application of the masked classification approach to the data set of apo-state γ-secretase particles revealed a range of different conformations for TM6. This conformational flexibility leads to a variation in the distance between the two aspartates that form the active site. Interestingly, the class where the aspartates are closest together also shows a markedly different conformation of Pen-2 and a re-arrangement of TM3, TM4 and TM5 in PS1. Pen-2 is required for autocatalytic maturation and protease activity of γ-secretase. Binding of Pen-2 to the complex activates the active site, and binding of Pen-2 was observed to have an allosteric effect on TM6 (Takeo et al., 2012). However, in the absence of PS1 structures without Pen-2 bound, it will probably remain unclear whether the changes in Pen-2 and PS1 observed here are relevant to this allosteric activation mechanism. Our analysis of the structure in complex with DAPT provides complementary insights into the conformational freedom of γ-secretase. Upon binding of the inhibitor, the catalytic subunit undergoes a marked rigidification. TM2 and its linkers to TM1 and TM3 become ordered, and so do the cytoplasmic half of TM6 and part of the linker between TM6 and TM7. Around the active site, the conformations of the kink in TM6 and the conformation of the long linker between TM6 and TM7 are noticeably different from the apo-state consensus structure. Maturation of the γ-secretase complex requires auto-proteolytic cleavage at Thr290 (or alternatively at Val292 or Met297). The observed kink in TM6 may expedite the U-turn that is required to position the auto-proteolytic cleavage site back into the active site. Moreover, auto-proteolytic cleavage is predicted to occur in an α-helix spanning residues 280–300 of the linker. In the DAPT-bound structure, a single helical turn starts at Glu280, but residues 285–288 form a short β-sheet with the end of the linker that connects to TM7. The auto-proteolytic site is still flexible in this structure, as the density disappears after Tyr288. Since auto-proteolysis appeared to be complete in our sample (Lu et al., 2014), it could be that residues 280–300 do form a helical structure prior to self-cleavage. Alternatively, it could be that the inhibitor specifically alters the secondary structure in the linker, for example through its observed interaction with Phe283. TM2 of PS1 is well ordered in both the DAPT-bound structure and in class 1 of the apo-state, whereas it is invisible in the other apo-state classes. This helix only seems to be ordered when something is bound in the large cavity that is lined with FAD-derived mutations between TM2, TM3 and TM5. In the inhibitor-bound structure this cavity contains the density that we attribute to DAPT, while density for a kinked α-helix is visible in class 1 of the apo-state. Although the density for the kinked α-helix was not of sufficient quality for unambiguous identification, mass spectrometry and Western blot analyses suggest that a mixture of different proteins with a single transmembrane helix may be present in our sample. Four of the proteins that were identified by mass spectrometry had also previously been observed to co-purify with γ-secretase: TMP21/p23, p24a, Vamp-8 and Sec22B (Wakabayashi et al., 2009). TMP21 was also observed to be a component of the γ-secretase complex that acts as a negative regulator of γ-cleavage, while leaving ε-cleavage intact (Chen et al., 2006). We hypothesize that the kinked α-helix in our structure arises from a mixture of co-purified proteins in our sample that bind to the γ-secretase complex in a manner that mimics substrate binding. This hypothesis is in good agreement with previous biochemical observations about an' initial substrate-binding site' that is distinct from the active site (Beher et al., 2003; Das et al., 2003; Esler et al., 2002; Tian et al., 2002). Photolabeling experiments suggest that the initial substrate-binding site partially overlaps with the DAPT-binding site (Kornilova et al., 2003; Morohashi et al., 2006), and mutational analysis identified TM2 and TM6 to be involved in substrate binding (Watanabe et al., 2010). Experiments with photoaffinity probes based on α-helical substrate-like inhibitors showed that DAPT could not displace a 10-residue long helical probe, suggesting spatially separated binding sites of the substrate and the inhibitor. This however was not the case for a 13-residue long peptide, for which addition of DAPT led to a strong reduction in photolabeling. Because this peptide also prevented labeling of a transition-state mimicking photoprobe, the longer α-helical probe probably also interacts with the active site (Kornilova et al., 2005). Our hypothesis explains these data well. A superposition of the kinked α-helix on top of the DAPT structure shows that after the kink, the α-helix extends for 10 residues into the transmembrane domain, before its four C-terminal residues overlap with the DAPT-binding site and almost reach the active site (Figure 6A). 10. 7554/eLife. 11182. 021Figure 6. A hypothesis for substrate binding. (A) A superposition of the kinked α-helix from class 1 and the DAPT-density and atomic model for PS1 from the DAPT-bound structure. The lower end of the kinked helix and the DAPT density overlap. The recently identified residues that interact with a phenylimidazole-like γ-secretase modulator are shown with spheres. (B) Ensemble of NMR-models for an Aβ42 peptide in an aqueous solution of fluorinated alcohols. (C) Hypothetical model for how APP (one of the NMR models is shown in pink) binds to γ-secretase. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 02110. 7554/eLife. 11182. 022Figure 6—figure supplement 1. Predicted transmembrane regions. APP and proteins that were identified by mass spectrometry to be present in the cryo-EM sample contain a large, positively charged residue (boxed) next to the N-terminus of their predicted transmembrane helix (indicated with a purple cylinder). TMP21 is the product of the TMED10 gene; P24a is the product of the TMED2 gene. The products of the TMED1, TMED4, TMED9, VAMP2 and VAMPB genes were observed after additional mass-spectrometric analysis of specific gel bands. DOI: http: //dx. doi. org/10. 7554/eLife. 11182. 022 Furthermore, the NMR structure of the Aβ42 peptide in an aqueous solution of fluorinated alcohols shows a strikingly similar 90-degree kink in its α-helical structure, which is positioned right after Lys699 (Figure 6B). A superposition of the NMR model on the kinked α-helix in our structure places its N-terminus flat on the extracellular side of the membrane, while the cleavage site that would result in the formation of Aβ42 peptides is placed in close proximity to the active site (Figure 6C). Interestingly, all the proteins that were both identified in our sample by mass spectrometry and that had also previously been observed to co-purify with γ-secretase (Wakabayashi et al., 2009) contain either an arginine or a lysine just before their predicted transmembrane helix (Figure 6—figure supplement 1). It is therefore tempting to speculate that the large, positively charged residue together with the kink in the α-helix act as an anchor to delimit the cleavage position in the substrate. This would explain why mutations in Lys699 have a marked effect on the length of the Aβ cleavage products (Kukar et al., 2011). In addition, the kink in the α-helix is positioned next to the recently mapped binding site of a phenylimidazole-like γ-secretase modulator (highlighted with spheres in Figure 6A), which could explain how this modulator affects cleavage in the distant active site through changes in the substrate conformation (Takeo et al., 2014). It could also explain why replacement of Lys699 or increasing the positive charge at Gly700 has been observed to block or attenuate the effects of γ-secretase modulators (Jung et al., 2014). In conclusion, we show that masked cryo-EM image classification combined with the subtraction of part of the signal from the experimental images allows separation of structures that differ at the secondary structure level. Application of this approach to our previously described data set of γ-secretase in its apo-state reveals distinct conformations for TM2 and TM6 of PS1. In one of the identified structures, we observe a kinked α-helix in the cavity between TM2, TM3 and TM5 of PS1 that cannot be attributed to any of the γ-secretase components. Mass spectrometry and Western blot analyses suggest the presence of a mixture of proteins with a single transmembrane helix that co-purified with the complex, one of which is a known modulator of γ-secretase cleavage. These results are complemented with a cryo-EM structure of the complex bound to the dipeptidic inhibitor DAPT. Binding of the inhibitor leads to a marked reduction in the flexibility of the catalytic subunit. Together, our results form the basis for a hypothesis that substrate enters the transmembrane domain through the cavity formed by TM2, TM3 and TM5 of PS1. The disordered nature of TM2 in the absence of substrate or inhibitor suggests that this helix may act as a lateral gate through which the transmembrane helix of the substrate enters the cavity. The observation that the inhibitor-bound structure closely resembles the class with the kinked α-helix suggests that the inhibitor and the substrate stabilize a similar conformation from the apo-state ensemble. DAPT would then act as an inhibitor by blocking access of the substrate to the active site. An appealing route to confirm our hypothesis, and to gain further mechanistic insights, is the determination of additional cryo-EM structures in complex with different substrates, substrate analogues, inhibitors or other modulators of activity. Masked classification with signal subtraction will be a useful tool in this endeavor, as understanding how different factors shift the equilibrium of conformational states in this flexible enzyme will be key to increase our understanding of its functioning. The sample preparation procedure and imaging conditions for the apo-state data were described previously (Bai et al., 2015a). To prepare the complex with DAPT, we incubated 20 μl of the same γ-secretase sample for 20 min at 4°C with 0. 2 μl of a 10 mM solution of DAPT in 100% DMSO (yielding an approximate concentration of 4 μM γ-secretase, 100 μM DAPT and 1% DMSO). Subsequently, aliquots of 3 μl were applied to previously glow-discharged holey carbon grids (Quantifoil Au R1. 2/1. 3,300 mesh), and flash frozen in liquid ethane using an FEI Vitrobot. The imaging conditions were kept identical as for the apo-state data. In brief, zero-energy loss images were recorded manually on an FEI Titan Krios microscope at 300 kV, using a slit width of 20 eV on a GIF-Quantum energy filter. A Gatan K2-Summit detector was used in super-resolution counting mode at a calibrated magnification of 35,714× (yielding a pixel size of 1. 4 Å), and a dose rate of ~2. 5 electrons/Å2/s (~5 electrons/pixel/s). Exposures of 16 s were dose-fractionated into 20 movie frames. Defocus values in the DAPT-bound data set ranged from 0. 6–2. 8 µm. Similar image processing procedures were employed for the apo-state and the DAPT-bound data sets. We used MOTIONCORR (Li et al., 2013) for whole-frame motion correction, CTFFIND4 (Rohou and Grigorieff) for estimation of the contrast transfer function parameters, and RELION-1. 4 (Scheres, 2012) for all subsequent steps. References for template-based particle picking (Scheres, 2015) were obtained from 2D class averages that were calculated from a manually picked subset of the micrographs. A 20 Å low-pass filter was applied to these templates to limit model bias. All low-pass filters employed were cosine-shaped and fell to zero within 2 reciprocal pixels beyond the specified frequency. To discard false positives from the picking, we used initial runs of 2D and 3D classification to remove bad particles from the data. The selected particles were then submitted to 3D auto-refinement, particle-based motion correction and radiation-damage weighting (Scheres, 2014). The resulting' polished particles' were used for masked classification with subtraction of the residual signal as described in the main text, and the original particle images from the resulting classes were submitted to a second round of 3D auto-refinement. All 3D classifications and 3D refinements were started from a 40 Å low-pass filtered version of the high-resolution consensus structure. Fourier Shell Coefficient (FSC) curves were corrected for the effects of a soft mask on the FSC curve using high-resolution noise substitution (Chen et al., 2013). Reported resolutions are based on gold-standard refinement procedures and the corresponding FSC=0. 143 criterion (Scheres and Chen, 2012). Prior to visualization, all density maps were corrected for the modulation transfer function (MTF) of the detector, and then sharpened by applying a negative B-factor that was estimated using automated procedures (Rosenthal and Henderson, 2003). For the apo-state data set, the template-based algorithm picked 1. 8 million particles from 2,925 micrographs, and 412,272 particles were selected after initial 2D and 3D classification. Subsequent 3D auto-refinement and particle polishing yielded a 3. 5 Å map with fuzzy densities in the transmembrane region. Masked classification into eight classes with subtraction of the residual signal yielded three classes with good density as described in the main text. Poor reconstructed density was observed in the other five classes. Separate 3D auto-refinements of the corresponding particles in the original data set for the three best classes gave rise to reconstructions to 4. 0– 4. 3 Å resolution (also see Figures 2–3, Table 1). For the DAPT-bound state, 1. 4 million particles were picked from 2,206 micrographs, and initial classification selected 271,361 particles. After particle polishing, this subset gave rise to a 4. 3 Å resolution map with relatively poor density in the transmembrane domain. Application of the masked classification procedure with residual signal subtraction into eight classes identified a single class with good density. After 3D auto-refinement, the corresponding 51,366 particles gave a map with a resolution of 4. 2 Å, which showed improved density in the transmembrane domain. To expedite application of the modified classification procedures proposed in this paper by others, we describe these steps in more detail. The mask for masked classification on the PS1 subunit (the red part of the signal in Figure 1) was generated by converting the atomic model of the PS1 subunit from the high-resolution consensus structure (including a poly-alanine model for TM2) into a density map using the program e2pdb2mrc. py from EMAN2 (Tang et al., 2007). This map was then converted into a soft-edged mask using relion_mask_create. A mask around the entire γ-secretase complex, including the belt of fuzzy density from the amphipols, was generated using standard auto-masking from the RELION post-processing procedure. Subtraction of the PS1 mask from the mask of the entire complex using relion_image_handler yielded a mask containing only nicastrin, Aph-1, Pen-2 and the amphipol belt (the yellow part of the signal in Figure 1). This mask was applied to the 3. 5 Å map that was calculated from a consensus refinement using all 400 thousand selected apo-state particles. The resulting masked map (yellow. mrc) was used for subtraction of the signal from the experimental particles as outlined in Figure 1. The corresponding program has been available in RELION from release 1. 3 onwards and is used as follows: relion_project --i yellow. mrc --subtract_exp --angpix 1. 4 --ctf --ang Refine3D/run1_data. star --o newparticles The Refine3D/run1_data. star file was produced by the consensus refinement and contains the orientation and CTF parameters of all 400 thousand particles. The command generates a new particle image stack called newparticles. mrcs and a new STAR-file with all relevant metadata called newparticles. star. The latter is used directly as input in the masked classification run, which may be launched from the RELION GUI using standard inputs, and providing the mask around the PS1 subunit as' Reference mask' on the Optimisation tab. Because of the small size of the PS1 subunit, we chose to set the' Perform image alignment' option on the Sampling tab to' No'. To generate the simulated particle images described in Figure 2—figure supplement 4, we also used the relion_project program: relion_project --i Refine3D/run1_class001. mrc --osimulated_run1 --ctf --angpix 1. 4 --angRefine3D/run1_data. star --add_noise --model_noiseRefine3D/run1_model. star By providing the data. star file (option --ang) and final map (option --i) from the refinements of the classes described in Figure 3, we generated simulated particles with similar orientational distributions and CTF parameters as those observed for the experimental data. By using the estimated power spectra of the noise for the experimental images (as provided through the --model_noise option), also the simulated spatial frequency-dependent signal-to-noise ratios are similar to those in the experimental data. Model building for the three apo-state classes and the DAPT-bound structure was started from the coordinates that were built in our 3. 4 Å apo-state consensus structure (PDB ID: 5A63). Nearly all of the residues from Aph-1 and nicastrin fitted well into the four maps, but parts of PS1 and Pen-2 had to be manually adjusted in COOT (Emsley et al., 2010). Building of TM2 and the lower part of TM6 in PS1 was started from idealized α-helices, and sequence assignment of TM2 was guided by comparison with the structure of PSH (PDB ID: 4HYC) and by recognizable side chain features for Phe and Tyr residues. All models were refined in REFMAC (Murshudov et al., 1997), using modified procedures for cryo-EM maps (Brown et al., 2015) and secondary structure restraints generated by ProSMART (Nicholls et al., 2014). Overfitting of the atomic model for the DAPT-bound structure was monitored by refining the model in one of the half-maps from the gold-standard refinement approach, and testing the resulting model against the other half-map (Amunts et al., 2014). The same relative weight between the EM-density and geometric terms that resulted in good fits to the density without overfitting for the DAPT-bound structure was used for the final refinement of all four structures. Protein samples (5 μg purified γ-secretase) were resolved by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) on 4–12% Bis-Tris gels (Life Technologies, Carlsbad, CA) using MES running buffer (Formedium, UK) for 32 min at 200V. The gel was stained with InstantBlue protein stain (Expedeon, San Diego, CA) for direct protein visualization. Gel slices were prepared for mass spectrometric analysis using the Janus liquid handling system (PerkinElmer, UK). Briefly, the excised protein gel pieces were placed in a well of a 96-well microtitre plate and destained with 50% v/v acetonitrile and 50 mM ammonium bicarbonate, reduced with 10 mM DTT, and alkylated with 55 mM iodoacetamide. After alkylation, proteins were digested with 6 ng/µl trypsin (Promega, UK) overnight at 37°C. The resulting peptides were extracted in 2% v/v formic acid, 2% v/v acetonitrile. The digest was analysed by nano-scale capillary LC-MS/MS using an Ultimate U3000 HPLC (ThermoScientific Dionex, San Jose, USA) to deliver a flow of approximately 300 nl/min. A C18 Acclaim PepMap100 5 µm, 100 µm x 20 mm nanoViper (ThermoScientific Dionex, San Jose, USA), trapped the peptides prior to separation on a C18 Reprosil-pur 3 µm, 75 µm x 105 mm PicoCHIP (New Objectives, MA, USA). Peptides were eluted with a gradient of acetonitrile. The analytical column outlet was directly interfaced with a hybrid linear quadrupole fourier transform mass spectrometer (LTQ Orbitrap XL, ThermoScientific, San Jose, USA). Data-dependent analysis was carried out, using a resolution of 30,000 for the full MS spectrum, followed by five MS/MS spectra in the linear ion trap. LC-MS/MS data were then searched against a protein database (UniProt KB) using the Mascot search engine programme (Matrix Science, UK) (Perkins et al., 1999). Database search parameters were set with a precursor tolerance of 10 ppm and a fragment ion mass tolerance of 0. 8 Da. One missed enzyme cleavage was allowed and variable modifications for oxidized methionine, carbamidomethyl cysteine, pyroglutamic acid, phosphorylated serine, threonine and tyrosine were included. MS/MS data were validated using the Scaffold programme (Proteome Software Inc., USA) (Keller et al., 2002). All data were additionally interrogated manually. Protein samples (1. 6 μg purified γ-secretase) were resolved by SDS-PAGE on 4–12% Bis-Tris gels (Life Technologies) using MES running buffer (Formedium) for 32 min at 200V. The gel was transferred to Immobilon-P 0. 45 µm PVDF membrane (Millipore, Germany) in 1X transfer buffer (Life Technologies) supplemented with 20% methanol for 1 hr at 65V. The membrane was subsequently blocked for 1 hr at room temperature in 5% bovine serum albumin/Tris-buffered saline and Tween-20 (TBST) prior to incubation with indicated primary antibodies (anti-TMP21, ab133771,1: 500, Abcam, UK; anti-VAMP-8, ab76021,1: 5000 Abcam, UK; anti-Miner1,13318-AP, 1: 500, Proteintech, UK) overnight at 4°C. The membrane was washed with TBST and incubated with horseradish peroxidase-linked goat anti-rabbit IgG (NA934VS, GE Healthcare) for 1 hr at room temperature. The membrane was washed extensively with TBST and target proteins detected on FUJI Medical X-Ray Super RX film (100 NIF 18 x 24, Fujifilm, UK) using Amersham ECL Western Blotting Detection Reagent (GE Healthcare, UK).

Title: Sampling the conformational space of the catalytic subunit of human γ-secretase Summary: An enzyme called gamma-secretase cuts other proteins in cells into smaller pieces. Like most enzymes, gamma-secretase is expected to move through several different three-dimensional shapes to perform its role, and identifying these structures could help us to understand how the enzyme works. One of the proteins that is targeted by gamma-secretase is called amyloid precursor protein, and cutting this protein results in the formation of so-called amyloid-beta peptides. When gamma-secretase doesn' t work properly, these amyloid-beta peptides can accumulate in the brain and large accumulations of these peptides have been observed in the brains of patients with Alzheimer' s disease. Earlier in 2015, a group of researchers used a technique called cryo-electron microscopy (cryo-EM) to produce a three-dimensional model of gamma-secretase. This revealed that the active site of the enzyme, that is, the region that is used to cut the other proteins, is particularly flexible. Now, Bai et al. - including many of the researchers from the earlier work - studied this flexibility in more detail. For the experiments, gamma-secretase was exposed to an inhibitor molecule that stopped it from cutting other proteins. This meant that the structure of gamma-secretase became more rigid than normal, which made it possible to collect more detailed structural information using cryo-EM. Bai et al. also developed new methods for processing images to separate the images of individual enzyme molecules based on the different shapes they had adopted at the time. These methods make it possible to view a mixture of very similar enzyme structures that differ only in a small region of the protein (in this case the active site). In the future, it would be useful to repeat these imaging experiments using a range of different molecules that alter the activity of gamma-secretase. Furthermore, the new image processing methods developed by Bai et al. could be used to study flexibility in the shapes of other proteins.

lay_elife

en

Summarize: BACKGROUND OF THE INVENTION 1. Field of the Invention The invention relates to valve structures and refers more specifically to a rapid acting valve for release of fire retardant material from a container in the shortest possible time. 2. Description of the Prior Art Most prior valve structures for release of fire retardant materials have not reacted rapidly enough to prevent damage to property and/or injury to personnel in response to temperature changes due to fire and the like. Where, in the past, valve structures have reacted rapidly, they have either been complicated and expensive to manufacture or have not been automatically actuated or have not included a manual operation alternative or have not been readily rechargeable and reuseable. Further, valve structures of the past have often not provided adequate sealing for fire retardant material to be evacuated from a container to which the valve structure is secured, whereby pressure leaks have caused failure of the fire retardant to evacuate from the container at the desired time, or has unduly retarded the evacuation of the container. Also, with valve structures of the past, wherein adequate sealing has been provided, mechanical biasing structures have often been used which retard the rapid operation of the valves and are therefore undesirable. Adequate sealing has additionally required close machining tolerances in the past, increasing the cost of prior valves. SUMMARY OF THE INVENTION The valve structure of the invention includes a pilot valve, means for actuating the pilot valve, either automatically by an electric signal or manually by mechanical structure, to open a poppet valve which permits rapid evacuation of a container through structure for securing the valve structure to the container into a discharge manifold. The poppet valve is guided into movement into and out of sealing engagement with the securing structure by means of an angularly movable, sealed sleeve in which the poppet valve is positioned, which sleeve is positioned in a recess in a valve body member. The poppet valve has a diameter larger than the opening through the container which it seals, whereby with the pilot valve closed, the poppet valve is biased into a closed position by a pressure differential. The pressure differential is maintained by means of an orifice bypassing a check valve positioned in the poppet valve, which check valve permits filling the container with fire retardant material under pressure and provides initial pressure to close the poppet valve prior to the check valve opening. Both the electrical and mechanical actuating structure for the pilot valve are adjustable to ensure rapid operation of the pilot valve. Structure is also provided in conjunction with the pilot valve to prevent accidental opening of the poppet valve during shipment and the like. The pilot valve is further provided with an annular, radially movable valve seat. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a cross section of the valve structure of the invention, taken substantially on the line 1--1, in FIGS. 2 and 3. FIG. 2 is a bottom view of the valve structure illustrated in FIG. 1, taken in the direction of arrow 2, in FIG. 1. FIG. 3 is an elevation view of the valve structure illustrated in FIG. 1, taken in the direction of arrow 3, in FIG. 1. FIG. 4 is a partial cross section of a portion of the valve structure illustrated in FIG. 1, taken substantially on the line 4--4, in FIG. 1. FIG. 5 is a partial cross section of the valve structure illustrated in FIG. 1, taken substantially on the line 5--5, in FIG. 1. FIG. 6 is a partial cross section of the valve structure illustrated in FIG. 1, taken substantially on the line 6--6, in FIG. 1. DESCRIPTION OF THE PREFERRED EMBODIMENT The valve structure 10 as best shown in FIG. 1 includes a valve body 12 having a pilot valve structure 14 therein, the poppet valve structure 16, guide structure 18 for the poppet valve structure 16, securing means 20 for securing the valve structure 10 to a container 22 for fire retardant material and a manifold 24 secured together as shown. Both electrical means 26 and mechanical means 28 are provided in actuating mechanism 25 for actuating the valve structure 10. In more detail, the valve body 12 includes an opening 30 extending therethrough having the different diameter portions shown best in FIG. 1. A second opening 32, best shown in FIG. 4, also extends through the valve body member 12 from the charging connector 34 across the opening 30 to the cylindrical recess 36 in the valve body member 12. The charging connector 34 shown best in FIG. 4 may be any coupling for a pressure line through which fire retardant material such as Halon and supercharging material such as Nitrogen may be passed under pressure into the container 22 through the valve structure 10. As shown, the charging connector 34 is threadedly engaged with the outer end of the opening 32. The spring biased check valve structure 40 which permits passing the fire retardant material under pressure into the container 22 through the valve structure 10, but prevents leakage of fluid in the container 22 out through the passage 32 is positioned as shown in FIG. 4 in passage 32. The pilot valve structure 14 positioned within the multi-diameter passage 30 in the valve body member 12 includes the valve member 42 having the cylindrical stem portion 44 and the spherical valve portion 46. The stem portion 44 of the valve member 42 is sealed in passage 30 by the O-ring seal 48. The valve stem portion 44 includes a small diameter portion 50 terminating in a threaded portion 52 which is threadedly engaged with the armature 54 of the actuating structure 25. The spherical portion 46 of the pilot valve member 42 is engaged with the inner periphery of an annular valve seat 56. Valve seat 56 is secured in opening 30, for slight radial movement therein whereby the valve seat 56 is self-centering on the spherical valve portion 46 of valve member 42, by the sealing ring 58 in opening 30 and the locking ring 60 which is threaded into the opening 30. O-ring seals 62 and 64 are provided between the sealing ring 58 and the body member 12 and between the sealing ring 58 and the radially movable annular valve seat 56. A seal 59 is also provided between the locking ring 60 and body member 12, as shown. The poppet valve structure 16 includes the valve member 66 having the variable diameter opening 68 extending therethrough. A ball check valve 70 is held between the valve seat 72 threaded into one end of the opening 68 by the bias spring 74 acting against the valve cage 76, best shown in FIG. 6. The annular valve seat 72 further includes a bleed opening 72 for bleeding pressure through the valve member 66 past the check valve 70. The poppet valve 66, when in the closed position shown, provides a seal on the surface 80 of the securing structure 20 by means of the annular rubber sealing member 82 set therein as shown best in FIG. 1. An O-ring seal 84 is provided in the annular exterior groove 86 of the valve member 66 and seals between the valve member 66 and the guide structure 18. Guide structure 18 includes the guide sleeve 88 having a variable diameter exterior surface as shown in FIG. 1 and the O-ring seal 90 positioned between the guide sleeve 88 and the valve body member 12 within the recess 36 in the valve body member 12, again as shown best in FIG. 1. The securing structure 20 is a sleeve having an opening 92 extending therethrough. Sleeve 92 has a threaded end 94 to which the container 22 is secured. Sleeve 92 further has a reduced diameter portion 96 for receiving the manifold structure 24, again as shown best in FIG. 1. Openings 98, 100 and 102 extend radially through the securing structure 20 in which a bleed valve 104, a pressure relief valve 106 having a rupture disc therein, which may rupture at 1600 pounds per square inch for example, and a pressure gauge 108 are secured. Manifold structure 24 as shown best in FIGS. 1 and 2 includes the openings 110 and 112 extending therethrough for receiving the guide structure 18 and the securing structure 20, respectively. The manifold structure 24 further includes a discharge opening 114 best shown in FIGS. 2 and 3. The securing structure 20, manifold structure 24, poppet valve structure 16 and guide structure 18 are held in assembly with the valve body member 12 by the assembly bolts 116. The actuating mechanism 25 includes the armature 54 threadedly engaged with the poppet valve structure 14 secured in the solenoid case 118. The solenoid case 118 is provided with a cover 120. The solenoid case 118 and cover 120 are held in position on the valve body 12 and solenoid case 118 respectively by means of the bolts 121 and 122 as shown in FIGS. 1 and 3. The structure 26 for electrically actuating the valve structure 10 of the actuating mechanism 25 includes the electrical connector 123, shown best in FIG. 3, and the solenoid 124 in the solenoid housing 118, which may be automatically energized by a remote sensing circuit for heat or the like producing an output electrical signal applied to valve 10 through the electrical connector 123, and which is provided with the adjusting screws 126 and 128 in the cover 120 whereby the distance of the solenoid 124 from the armature 54 may be closely regulated. Solenoid 124 is supported in housing 118 by bolts 125, again shown best in FIG. 3. The mechanical means 28 for actuating the pilot valve structure 14 of the actuating mechanism 25 includes the lever 130 mounted on the pivot pin 132 between the mounting ears 134 on the cover 120. Screws 136 and 138 extend through the lever 130 and abut the cover 120 for limiting the pivotal movement of the lever 130 in both directions about the pivot pin 132. A bias spring 140 is provided, acting between the lever 130 and the cover 120 to resiliently bias the lever 130 as shown in FIG. 1 in a counterclockwise direction. In overall operation of the valve structure 10, the valve structure 10 is first screwed onto a container 22 for storing fire retardant material such as Halon under pressure. The container 22 is filled with the fire retardant material and may be supercharged to a desired pressure by Nitrogen, for example, through the connector 34, passage 32 and check valves 40 and 70. During supercharging of the valve structure 10 with Nitrogen at, for example 750 P.S.I., after it has been charged with Halon, the Halon is displaced from the area around the pilot valve structure 14 and over the poppet valve structure 16 and in particular in the chamber 150. Since the Nitrogen is lighter than Halon, the opening time of the poppet valve member 66 is thus reduced. The container 22 having the valve structure 10 thereon is then positioned with the discharge opening 114 of manifold structure 24 directed to discharge the fire retardant material into the desired area. On receipt of a predetermined electrical signal in the solenoid 124, the solenoid will move the armature 54 to open pilot valve structure 14, that is, to the left as shown in FIG. 1. The valve member 42 of the pilot valve structure 14 is thus moved to the left as shown in FIG. 1 against the bias provided by the bias spring 142 and bias ring 144. Alternatively, armature 54 may be moved to the left by mechanically actuating the lever 130 with the screw 136 moved to the left sufficiently to permit pivoting of the lever 130 in a clockwise direction as shown in FIG. 1. The screws 126 and 128 determine the position of the solenoid 124 relative to the armature 54 and place the solenoid 124 sufficiently close to the armature 54 to produce extremely rapid actuation of the armature 54 over the required distance to open the pilot valve structure 14. Similarly, the screw 138, when properly adjusted, positions the bolt 146 which is set in the recess 148 in the lever 130 and is threadedly engaged with the armature 54 exactly in engagement with the lever 130 so that any movement of the lever 130 is immediately transferred to the armature 54. The screw 136 is provided to lock the lever 130 in a predetermined position so that the lever 130 will not accidentally be pivoted to open the pilot valve structure 14 during storage, shipment and the like. On opening of the pilot valve structure 14, the pressure in chamber 150 is substantially immediately reduced to atmospheric pressure from the pressure of the fire retardant material in the container 22 at which the pressure is maintained in the chamber 150 while the pilot valve structure 14 is closed by the pressure bleed opening 78 in the valve seat member 72 of the poppet valve structure 16. Prior to opening of the pilot valve structure 14, the pressure in the chamber 150 has produced a differential pressure on the poppet valve member 66 due to the small diameter of the opening 92 in securing means 20 compared to the larger diameter of the valve member 66 in the chamber 150, causing the poppet valve member 66 to firmly seat on the surface 80 of the securing means 20, whereby the container 22 is prevented from discharging into the manifold 24. The positive seating of the poppet valve member 66 is facilitated by placing the valve member 66 within the guide sleeve 88. The guide sleeve 88 permits slight angular adjustment about the axis of generation thereof of the sleeve 88 and valve member 66 so that exact alignment of the surface 80 of the securing means 20 and the valve member 66 in production is not required. Slight misalignments in manufacture may be compensated for by angular adjustments of the guide sleeve 88 due to loose fit of sleeve 88 in recess 36 which sleeve is sealed and biased centrally by O-ring seal 90. A leakage of less than 1% per year from the container 22 is thus accomplished by poppet valve structure 16 which is not spring biased and in which alignment in manufacturing is not critical, as compared to other valves requiring the same leakage characteristics. On opening of the pilot valve structure 14 and exhausting the pressure in the chamber 150 through the opening 30, the poppet valve structure 16 is caused to move up in FIG. 1 to immediately begin discharging the fire retardant material from the container 22 through the securing structure 20 into the manifold 24. The upward movement of the poppet valve structure 16 will continue even though the pilot valve structure 14 is subsequently closed prior to complete opening of the poppet valve structure 16, since the pressure is not returned to the chamber 150 except through the small bleed opening 78. Due to the large area of the valve member 66, the contents of the container 22 are thus rapidly discharged through the securing structure 20 and the manifold 24 into the desired area. The action of the valve structure 10 is particularly rapid. Thus, for example, initial actuation of the valve structure 10 is accomplished in less than five milliseconds and the complete discharge of a container of five pounds of Halon under 750 pounds per square inch gauge pressure is accomplished in less than 100 milliseconds. After the electrical or mechanical actuation force is removed from the valve structure 10, the pilot valve structure 14 is closed by the bias spring 142 acting against the bias ring 144 and the container 22 may again be charged through the passage 32 and connector 34 for subsequent use, as above. In recharging the valve structure 10, a force of approximately 100 pounds per square inch is applied in chamber 150 by the fire retardant material prior to opening of ball check valve 70 to reseat the poppet valve member 66 and thus close the valve structure 10. In closing the valve structure 10, the valve seat 56 is caused to move radially in passage 30 to axially align with the sperical portion 46 of valve member 42. The seal between the valve seat 56 and sealing ring 58 is maintained by O-ring 64 bearing on the face of the valve seat opposite the valve member 42. In the valve structure 10, it will be particularly noted that there is minimum trapped gas above the poppet valve structure 16 to discharge through the pilot valve structure. There is no spring bias on the poppet valve to exert a force which must be overcome before the poppet valve is opened. There is a minimum of external sealing members required and once discharge of the container through the valve structure 10 is initiated, it is continuous. That is to say, discharge is not cut off by reseating of the pilot valve. While one embodiment of the invention has been disclosed, other embodiments and modifications thereof are contemplated. It is the intention to include all embodiments and modifications as are defined by the appended claims within the scope of the invention.

Summary: Fast-acting valve structure for rapidly evacuating a container of fire retardant material or the like comprising a pilot valve including an annular radially movable, self-centering valve seat, means for actuating the pilot valve either automatically or manually, a poppet valve, structure operably associated with the poppet valve to cause the poppet valve to be biased closed when the poppet valve is in a closed position without mechanical biasing structure, and operable to cause immediate opening of the poppet valve on initial opening of the pilot valve to permit rapid discharge of the container into a discharge manifold through structure for securing the valve structure to the container, and a resiliently mounted and sealed sleeve for guiding the poppet valve between open and closed position.

big_patent

en

Summarize: TECHNICAL FIELD The disclosure herein resides generally in the art of maternity garments and, more particularly, to a maternity garment having leggings and maternity support. BACKGROUND ART Many maternity garments, especially undergarments, have been developed over the years to address various problems associated with providing appropriate clothing and support to women during pregnancy. U.S. Pat. No. 5,094,648 discloses a maternity support top with a built in bra and a two-inch bellyband that lifts weight off of the pelvis. This garment, however, focuses only on the upper torso of a pregnant woman and does not address the hip or buttock area, or the legs. Spanx® brand maternity hosiery provides undergarment support in a full-length panty hose with a non-binding waistband with under belly support. However, the Spanx® maternity hosiery is not configured to providing support for the upper body. U.S. Pat. No. 5,702,286 discloses a back and abdominal support worn over the brassiere and under the panties, and with a supportive band under the tummy. However, this garment only covers the upper torso of a pregnant woman and does not address the hip or buttock area, or the legs. U.S. Pat. No. 7,181,755 discloses a knit fabric band that is worn over pants that are either too tight or too loose, holding them in place. The band is worn as a single layer over the tummy and is designed to stretch as the tummy grows. The band, however, does not address the torso, the back, or the legs. Nor does the band perform a support function. U.S. Pat. No. 8,864,551 discloses a maternity garment made of high performance fabric which provides mild support to shape a woman&#39;s body. The garment, however, requires either the garment to be worn over the shoulders of the woman, or the degrees of compression of the fabric are not properly tailored to the needs of a pregnant woman. Thus, traditional maternity support garments such as those described above only target a specific area of the body and only solve a limited few problems. Therefore, a need exists for an all-in-one garment that simultaneously addresses several areas, including smoothing a woman&#39;s profile, improving her level of comfort, providing her needed support, and complimenting her desired aesthetics. There is also a need in the art for a maternity support garment that may be worn throughout the entirety of a pregnancy while providing the necessary comfort and support that the expecting mother needs and deserves. SUMMARY The needs apparent from the deficiencies of the prior art as noted above are satisfied by various embodiments of the disclosure presented directly below and as will become apparent in detail with reference to the drawings and detailed description. In a first exemplary embodiment, a maternity garment is disclosed wherein the maternity garment comprises: a leggings portion, a belly bump portion, and a built-in support belt. In a second exemplary embodiment, the built-in support belt may further comprise an enhanced back support panel. In a third exemplary embodiment, the leggings portion and the belly bump portion is formed from a light compression weave. In a fourth exemplary embodiment, the built-in support belt is formed from a medium compression weave. In a fifth exemplary embodiment, the enhanced back support panel is formed from a heavy compression weave. In a sixth exemplary embodiment, the maternity garment is constructed as a seamless maternity garment. In a seventh exemplary embodiment, the maternity garment further comprises a friction, tension and/or elastic band. In an eighth exemplary embodiment, the friction, tension and/or elastic band is located above the built-in support belt. In a ninth exemplary embodiment, the maternity garment is made from a material selected from the group consisting of Lycra®, Spandex®, Nylon®, micro denier, polyester, cotton or the like, including various blends thereof. In a tenth exemplary embodiment, a maternity support garment comprises a lower belly support section, an upper belly support section, a baby bump section, and a back support panel. In an eleventh exemplary embodiment, the back support panel further comprises an enhanced back support panel. In a twelfth exemplary embodiment, the belly bump section is formed from a light compression weave. In a thirteenth exemplary embodiment, the maternity support garment further includes two side support sections, and wherein the lower belly support section, the upper belly support section, and the back support panel are formed from a medium compression weave. In a fourteenth exemplary embodiment, the enhanced back support panel is formed from a heavy compression weave. In a fifteenth exemplary embodiment, the maternity support belt is a seamless maternity support belt. In a sixteenth exemplary embodiment, the maternity garment further comprises a friction, tension and/or elastic band located above the upper belly section and the back support panel. In a seventeenth exemplary embodiment, a maternity support garment is disclosed that further comprises a pair of leggings extending from said two side support sections, the lower belly support section, and the back support panel. In an eighteenth exemplary embodiment, the leggings are in seamless interconnection with said two side support sections, the lower belly support section, and the back support panel. In a nineteenth exemplary embodiment, the leggings are formed from a light compression weave. DESCRIPTION OF DRAWINGS For a complete understanding of the various aspects of the disclosure, reference should be made to the following detailed description and accompanying drawings, wherein: FIG. 1 is a front elevational view of a legging with maternity support according to a first exemplary arrangement; FIG. 2 is a back view of the legging with maternity support of FIG. 1 ; FIG. 3 is a right side view of the legging with maternity support of FIG. 1 ; FIG. 4 is a left side view of the legging with maternity support of FIG. 1 ; FIG. 5 is a front view of a support belt according to an exemplary arrangement; FIG. 6 is a back view of the support belt of FIG. 5 ; FIG. 7 is a right side view of the support belt of FIG. 5 ; and FIG. 8 is a left side view of the support belt of FIG. 5. DETAILED DESCRIPTION Referring now to the drawings and more particularly to FIGS. 1 through 4, it can be seen that a maternity garment, made in accordance with an exemplary arrangement, is designated generally by the numeral 10. The garment 10 has a leggings portion 12, a belly bump portion 14, a built-in maternity support belt 16, and an enhanced back support panel 18. The maternity support belt 16 may be constructed with two side support sections 20, a lower belly support section 22, an upper belly support section 24, and a back support panel 26. The maternity support garment 10 also optionally contains an elastic or friction band 28. In one exemplary arrangement, the maternity garment 10 may cover a woman&#39;s belly, back, sides, hips, and legs, extending down from right above a pregnant woman&#39;s “belly bump” to the woman&#39;s ankles, right above her feet. However, other arrangements are also contemplated. For example, in one arrangement, the maternity garment 10 may be designed to extend just past the woman&#39;s knee, so as to be capri length. In another exemplary arrangement, the maternity garment may be designed to extend above the knee such as shorts. With reference to FIGS. 1, 3 and 4, in one exemplary arrangement, the belly bump portion 14 of the maternity garment 10 is configured to cover the portion of the woman&#39;s belly that will expand due to the growth of the baby. Belly bump portion 14 desirably adapts to the changing size of the woman&#39;s belly and is configured to expand with the growing belly for maximum comfort. In one exemplary arrangement, the belly bump portion 14 is made of a light compression weave, which will cover the baby bump and expand with limited resistance as the baby develops. In an alternative arrangement, the belly bump portion 14 of the maternity garment 10 is configured as an opening. More specifically, rather than forming the belly bump portion 14 with a layer of material that will gradually stretch to accommodate the mother&#39;s growing belly, the growing belly will naturally extend out of the opening that is bounded by the two side support sections 20, lower belly support section 22, and upper belly support section 24. With reference to FIGS. 1 through 4, in one exemplary arrangement, the leggings portion 12 of the maternity garment 10 covers the legs of the woman, extending down from around the hips of the woman, all the way to the woman&#39;s ankles. However, as set forth above, the present disclosure is not limited to leggings of this length. The leggings portion 12 of the maternity garment 10 is also made of a light compression weave, and in one exemplary arrangement, from the same light compression weave as the belly bump portion 14, for those arrangements that include a fabric belly bump portion 14. Due to the light compression provided by the light compression weave, the leggings portion 14 may serve to provide vascular support to the legs to minimize problems such as varicose veins, which are common during pregnancy. With reference to FIGS. 1 through 4, the built-in maternity support belt 16 of the maternity garment 10 comprises two side support sections 20, a lower belly support section 22, an upper belly support section 24, and a back support panel 26. The maternity support belt 16 of the maternity garment 10 is made of a stronger compression weave than the light compression weave of the belly bump portion 14 and leggings portion 12. The strong compression weave of the maternity support belt 16 provides support to the ever-growing belly of a pregnant woman. Specifically, the two side support sections 20 and the lower belly support section 22 help lift and cradle the belly and desirably alleviate some discomforts caused by the weight and pressure of the growing belly. Furthermore, the upper belly section 24 also cradles the belly while the back support panel 26 provides back support to alleviate similar discomforts in the woman&#39;s back caused by the weight and pressure of the growing belly. With reference to FIG. 2, the enhanced back support panel 18 of the maternity garment 10 is located in the small of the back of the woman to provide for enhanced back support in this particular area of the woman&#39;s back where she feels the most discomfort caused by the weight and pressure of the growing belly. Although the exemplary arrangement shown in the figures is depicted in a diamond shaped pattern, the back support panel 18 is not limited to such a shape and can be any shape necessary to provide the proper support to the small of the woman&#39;s back. The enhanced back support panel 18 of the maternity garment 10 is made of the strongest compression weave relative to the other components of the maternity garment 10, even stronger than the compression weave used for the maternity support belt 16 of the maternity garment 10. Having the enhanced back support panel 18 being made of the strongest compression weave used in the maternity garment 10 allows for the enhanced back support panel 18 to provide the strongest compression needed at the troublesome area of a woman&#39;s small of the back during pregnancy. In one exemplary arrangement, the entire maternity garment 10 is constructed as a seamless garment. By seamless, it is understood that, in certain embodiments, the maternity garment is made of one single material having a continuous weave. This means, that the transition from the light compression leggings 12 to the medium compression maternity support belt 16, from the medium compression maternity support belt 16 to the light compression baby bump section 14, and from the medium compression maternity support belt 16 to the strongest compression enhanced back section 18 is seamless. The change in the compression from section to section of the maternity garment 10 may be changed by changing only the density and weight, or grams per square meter, of the weave itself, as the garment 10 is formed with no seams being needed. Alternatively, and as contemplated by the disclosure, the material, or blend of materials, may change in the continuous wave process to achieve the desired compression characteristics from section to section. Because the maternity garment 10 is seamless, it avoids unnecessary bulk and ensures a comfortable and smooth silhouette while at the same time providing no irritation to the pregnant woman, irritation which a garment having seams would deliver. Any fabrics having the appropriate compression and/or elasticity as described above could be used to create the maternity garment 10, such as, and without limitation, Lycra®, Spandex®, Nylon®, micro denier, polyester, cotton or the like, including various blends thereof. According to one exemplary embodiment of the disclosure, the material used to form the garment 10 is of the same composition throughout, with only the density of the weave changing, although it is contemplated that the material itself may be of varying blends in the various sections and panels. One embodiment contemplates the light compression weave to be of a fabric weight of 120-320 grams per square meter (“gsm”), the medium compression weave to be a fabric weight of 200-400 gsm, and the heavy compression weave to be of a fabric weight of over 300 gsm. Of course, for the various garments made according to the invention, the general ratios of light-to-medium-to-heavy will remain rather consistent as between the lower and upper ends of the spectrum. In particular, the light compression weave will have a fabric weight lighter than the medium compression weave, and the medium compression weave will have a fabric weight lighter than the heavy compression weave. Those skilled in the art will appreciate that the elasticity of any particular section or panel of the garment 10 will be a function of the material composition, thread weave, and density or weight of the material. The optional elastic or friction band 28 may be attached to the top of the upper belly section 24 and back support panel 26 of the maternity support belt 16. Friction band 28 preferably serves to ensure that the entire maternity garment 10 stays put where desired. In some exemplary arrangements, the friction band 28 is generally made of a slip-resistant material and preferably having elastic qualities, such as for example silicone. To one having ordinary skill in the art it is understood that various materials with elasticity may be used so as to ensure proper resistance without restriction on the body. In an alternative embodiment, friction band 28 may be created using tighter knit or higher compression fabric than even the strongest compression weave of the enhanced back support panel 18. It some embodiments it is desirable that the friction band 28 be attached to garment 10 in a seamless fashion so as to avoid any additional bulk and to ensure a comfortable, smooth silhouette; however, it is considered that an appropriately strong yet concealed and/or concealable seam may alternately be utilized. Referring now to FIGS. 5 through 8, an alternative exemplary arrangement of a maternity garment is designated generally by the numeral 100. The garment 100 is generally in the form of a maternity support belt and is generally the nature of the garment 10, but without the leggings 12. In that regard, its characteristics, method of manufacture, and the materials employed are quite akin to those characteristics listed above in regards to garment 10. The maternity support belt 100 comprises two side support sections 120, a lower belly support section 122, an upper belly support section 124, a belly bump portion 125, a back support panel 126, and an enhanced back support panel 130. The maternity support belt 100 also optionally contains an elastic or friction band 128. The maternity support belt 100 preferably provides support for a woman&#39;s belly, back, sides, and hips, extending down from right above a pregnant woman&#39;s “belly bump” to right below her belly. The two side support sections 120, the lower belly support section 122, the upper belly support section 124, and the back support panel 126 of the maternity support belt 100 is made of a strong compression weave. The strong compression weave of the two side support sections 120, the lower belly support section 122, the upper belly support section 124, and the back support panel 126 provides support to the ever-growing belly of a pregnant woman. Specifically, the two side support sections 120 and the lower belly support section 122 help lift and cradle the belly and desirably alleviate some discomforts caused by the weight and pressure of the growing belly. Furthermore, the upper belly section 124 also cradles the belly while the back support panel 126 provides back support to alleviate similar discomforts in the woman&#39;s back caused by the weight and pressure of the growing belly. With reference to FIGS. 5, 7 and 8, the belly bump portion 125 of the maternity support belt 100 may be configured to cover the belly of the woman that will expand due to the growth of the baby. In one exemplary arrangement, the material for the belly bump portion 125 adapts to the changing size of the woman&#39;s belly and is configured to expand for maximum comfort. In this arrangement, the belly bump portion 125 is made of a light compression weave, which will cover the baby bump and expand as the baby develops. Alternatively, as described above in connection with the arrangement for maternity garment 10, the belly bump portion 125 may be configured as an opening through which the expending belly may protrude. As the opening is bounded by the side support section 120, the lower belly support section 122, and the upper belly support section 124, the expanding belly is supported by the garment 100. With reference to FIG. 6, the enhanced back support panel 130 of the maternity support belt 100 is located in the small of the back of the woman to provide for enhanced back support in this particular area of the woman&#39;s back where she is most likely to feel the most discomfort caused by the weight and pressure of the growing belly. Although shown in the figures as being in a diamond shaped pattern, the back support panel 130 is not limited to such a shape and can be any shape necessary to provide the proper support to the small of the woman&#39;s back. The enhanced back support panel 130 of the maternity support belt 100 is made of a stronger compression weave than the strong compression weave of the two side support sections 120, the lower belly support section 122, the upper belly support section 124, and the back support panel 126. Having the enhanced back support panel 130 being made of the strongest compression weave used in the maternity support belt 100 allows for the enhanced back support panel 130 to provide the strongest compression needed at the troublesome area of a woman&#39;s small of the back during pregnancy. One exemplary feature of the maternity support belt 100 is that the entire garment is a seamless garment. By seamless, it is understood that the maternity garment is made of one single material having a continuous weave. This means that the transition from the strong compression weave of the back support panel 126 to the strongest compression weave of the enhanced back section 130 is seamless. The change in the compression from section to section of the maternity support belt 100 is effected by changing only the density and strength of the weave itself, no seams are needed. By having the maternity support belt 100 be seamless, it allows for the maternity support belt 100 to avoid any additional bulk and it ensure a comfortable and smooth silhouette while at the same time providing no irritation to the pregnant woman, irritation which a garment having seams would deliver. Any fabrics having the appropriate compression and/or elasticity as described above could be used to create the maternity support belt 100, such as, and without limitation, Lycra®, Spandex®, Nylon®, micro denier, polyester, cotton/polyester blend or the like, including various blends thereof. The optional elastic or friction band 128 may be attached to the top of the upper belly section 124 and back support panel 126 of the maternity support belt 100. Friction band 128 preferably serves to ensure that the entire maternity support belt 100 stays put where desired. In some embodiments, the friction band 128 is generally made of a slip-resistant material, preferably having elastic qualities, such as for example silicone. To one having ordinary skill in the art it is understood that various materials with elasticity may be used so as to ensure proper resistance without restriction on the body. In an alternative embodiment, friction band 128 may be created using tighter knit or higher compression fabric than even the strongest compression weave of the enhanced back support panel 130. It some embodiments it is desirable that the friction band 128 be attached to the maternity support belt 100 in a seamless fashion so as to avoid any additional bulk and to ensure a comfortable, smooth silhouette; however, it is considered that an appropriately strong yet concealed and/or concealable seam may alternately be utilized. It will be appreciated that the maternity garments and components thereof described herein have broad applications. The foregoing embodiments were chosen and described in order to illustrate principles of the garments as well as some practical applications. The preceding description enables others skilled in the art to utilize the various embodiments and with various modifications as are suited to the particular use contemplated. In accordance with the provisions of the patent statutes, the principles and modes of operation of this disclosure have been explained and illustrated in exemplary embodiments. It is intended that the scope of the present methods and apparatuses be defined by the following claims. However, it must be understood that this disclosure may be practiced otherwise than is specifically explained and illustrated without departing from its spirit or scope. It should be understood by those skilled in the art that various alternatives to the embodiments described herein may be employed in practicing the claims without departing from the spirit and scope as defined in the following claims. The scope of the disclosure should be determined, not with reference to the above description, but should instead be determined with reference to the appended claims, along with the full scope of equivalents to which such claims are entitled. It is anticipated and intended that future developments will occur in the arts discussed herein, and that the disclosed systems and methods will be incorporated into such future examples. Furthermore, all terms used in the claims are intended to be given their broadest reasonable constructions and their ordinary meanings as understood by those skilled in the art unless an explicit indication to the contrary is made herein. In particular, use of the singular articles such as “a,” “the,” “said,” etc. should be read to recite one or more of the indicated elements unless a claim recites an explicit limitation to the contrary. It is intended that the following claims define the scope of the invention and that the method and apparatus within the scope of these claims and their equivalents be covered thereby. In sum, it should be understood that the invention is capable of modification and variation and is limited only by the following claims.

Summary: Maternity garments are presented herein. The maternity garments are intended for use by pregnant women throughout the entirety of their pregnancy. In one exemplary arrangement, the maternity garments include a built-in support belt and a belly bump portion. The maternity garment may further include leggings. In some arrangements, the maternity garment is formed of light compression weaves in areas such as the baby bump area and the leggings area of the garment, while the areas around the periphery of the baby bump, as well as the back area of the garment are formed of slightly stronger compression weave so as to provide needed support and lift in these areas. Finally, the area associated with the middle of the back of the pregnant woman may be formed of an even stronger compression weave so as to provide even greater support in this area to deal with the troublesome soreness and pain often had by pregnant woman as the pregnancy progresses.

big_patent

en

Summarize: FIELD OF THE INVENTION [0001] The invention relates to a posterior flexible vertebral linking device which works in tension, compression and flexion, and which damps all mechanical stresses. This device will have operational advantages that will be described. PRIOR ART [0002] We know many posterior vertebral attachment units rigidifying a certain number of vertebrae by depriving them of any mobility, thus allowing the containment of all mechanical stresses. However, the first vertebra adjacent to this rigid block keeps all its mobility and this abrupt discontinuity between the rigid block and this free vertebra very often generates a very high stress of the linking elements. The result is an acceleration of the degeneration of this level. [0003] This problem was only partially solved by semi-rigid systems conceived to create an intermediate rigidity between the mobile vertebrae and the fixed vertebrae. These systems present the following disadvantages: [0004] Either: they work only in tension: this is the case of all the devices based on artificial ligaments. These systems are hardly elastic and leave with the discretion of the operator the care to regulate the tension in particular making thus random the mechanical characteristics in the operating mode tension/compression that concerns us. [0005] Or: they work in compression with a thrust in tension, which makes these devices ineffective once they must assist displacements in extension. [0006] In either case: none of the known devices entirely solves the problem which is posed, namely, damping the mechanical stresses existing in tension/compression and flexion to which a moving vertebra can be subjected [0007] We will name the first prior art: patent EP 0576 379 A1 which presents a shock absorber which seems to approach the most closely at least from the point of view of the general outline of this invention; claim 1 of this patent protects “a uni-axial shock absorber working only in compression while playing the part of an abutment which opposes any displacement of the piston beyond a given value. [0008] In this case the exponential limitation of the displacement solved by the prior art, is a problem which has nothing to do with that the person who wants to solve the present invention. [0009] We now quote a second prior art: the patent application Ser. No. 0,012,998 which describes and claims “a flexible and cast solid vertebral linking device functioning in a multidirectional way”. This anteriority does not solve exactly the same problem as the one that the present invention seeks to solve, this invention having different means and functions. [0010] In the present invention, one can choose in a precise way the desired working method: tension/compression or flexion, or the combination of the two working methods, this in order to avoid any contact between the articular facets. DESCRIPTION [0011] We will list the drawings which help us understand the invention. [0012] FIG. 1 and 1 bis of sheet 1/6 presents perspective views (two alternative embodiments) of the device in the case of a working method combined in tension, compression and flexion. [0013] The FIGS. 2 and 2 bis of sheet 1/6 are longitudinal cross-sections of two alternatives of the same device. [0014] FIG. 3 of sheet 2/6 is an exploded view of the device and its means. [0015] FIG. 4 of sheet 3/6 is a view in perspective of the device working only in tension/compression. [0016] FIG. 5 of sheet 3/6 is a cross-section of the device working only in tension/compression. [0017] FIGS. 6 to 11 of sheet 4/6 represent all the individual parts constituting the device. [0018] FIG. 12 of sheet 4/6 shows another specific means working according to the tension/compression mode. [0019] FIG. 13 of sheet 5/6 shows an alternative of the device working along two axes. [0020] FIGS. 14 to 17 of sheet 5/6 show four forms of the mobile end of another alternative of device 1. [0021] FIG. 18 of sheet 6/6 shows the device in position. [0022] The device 1 consists of two sets of means: A first set of means 11 composed of rigid means manufactured out of preferably metal, biocompatible material ensuring a good mechanical resistance of the device by completely transmitting the forces. [0023] A second set of means 12 formed of flexible or damping means manufactured out of viscoelastic biocompatible materials, supporting the repeated elastic strain. It is the combination of these two sets of means which makes possible the functioning of the invention. [0024] The first set of means 11 includes four mechanical structures 110, 112, 114, 116 which have the function of transmitting the stresses, without becoming deformed, and to which device I is subjected. [0025] The mechanical structure 110 is made up of a mechanical rod 111, one of its ends being surmounted by a circular plate 113 b connected to the aforementioned rod 111 with a broad joining radius 113 a, the whole being able to slide in the hollow part of the structure 114 which encloses a visco-elastic element 121. [0026] The mechanical structure 112 is a cap provided with a thread 117 allowing for the fixing of the aforementioned structure 112 on structure 114 ; the means 112 has a shoulder area 118 which makes possible the enclosure of a viscoelastic-centering ring 121 between the plate 113 b and itself. [0027] The mechanical structure 114 is made up of two hollow cylinders, one of which is tapped to allow the fixing of a rod 116 with a threaded end. The means 110 and 116 will be fixed on the vertebrae to allow the operation of the device 1. [0028] The second set of means 12 is made up of two viscoelastic means 121 and 122. [0029] The first means 121 is preferably a centering ring which lets the rod 111. slide in its center [0030] The second means 122 is a disc full of viscoelastic material. These two centering rings 121 and 122 can undergo compressive stresses which may not be uniformly distributed, they were conceived to resist many cyclic fatigue stresses without breaking, tests were carried out in this direction, means 121 and 122 are able to undergone these tests of elastic deformation as many times as necessary. [0031] The selected material is preferably a biocompatible polyurethane; thanks to their integration inside mechanic means 110, 112, 114, 116, the viscoelastic means 121 and 122 are protected by the preceding mechanical structures of the aggressive environment of the human body, which avoids in particular the formation of fibers around these means which could deteriorate the viscoelastic properties of the material and consequently disturb the correct operation of device 1. [0032] This device 1 makes possible the damping of the stresses in tension/compression and flexion which it undergoes by the intermediary of rods 110 and 116. This function is assured owing to the fact that means 112 has a sufficiently broad opening 119 to allow a clearance of rod 111 and that there is a functional allowance between plate 113 and the hollow body of means 114 ; the shoulder area 118 serves as a stop and maintains in its housing the viscoelastic mass 121 thus locked up. [0033] If one wishes to work in a uni-axial mode of tension/compression, means 112 is replaced by another means 115 equipped with a threading 117, which includes a cap 115 c, whose opening 119 is adjusted to the diameter of the rod 110 while being extended by a guiding rod 115 a. [0034] This device 1 is thus able to react dynamically to the stresses applied. It is essential that structure 114 comprises a bore 114 a to allow a guidance without excessive friction of rod 110 in the aforementioned means 114. [0035] The adjustment of the diameter of the viscoelastic centering rings 121 and 122 must be carried out with precision to enable them to be crushed freely until a stress threshold corresponding to a point of contact of the bore 114 a of means 114. [0036] An alternative of the set of means 11 includes metal structures having the same functions as the structures 110, 112, 114, 116, but the assembly of these three parts ( 110, 130, 131 ) being of a weaker barrier than that of the structures previously described ( FIG. 2 ). [0037] The rod 131 is fixed at its cap 130 by the intermediary of a threading located on shoulder 132 of the rod. [0038] In the case of this alternative, the possibilities of displacement of rod 110 subjected to the stresses in flexion are ensured by play 119 located between cap 130 and rod 110. [0039] For a uni-axial operation of device 1, it is preferable to use means 110, 112, 114, 116 which provide a better guidance of rod 110. If small overall dimensions are needed, means 110, 130, 131 may be preferably used. [0040] Device 1 is able to function with rods 110 and 131 moving on convergent axes ( FIG. 13 ) with a small angle of displacement and according to given clearances. [0041] The set of means 12 is therefore comprised of two visco-elastic means 141 and 142. The means 141 is a cylinder full of visco-elastic biocompatible material, and whose face in contact with a plate is inclined. The means 142 is a centering ring whose face in contact with the back of a plate is inclined. [0042] The set of means 11 (rigid means) is identical to the previous one that is described above, the orifice 119 being however eccentric depending on the chosen angle. The shape of orifice 119 is defined depending on the clearances which are allowed to the rod 110. [0043] The rod 110 is thus able, thanks to these new technical characteristics, to function in tension/compression with a given angle with respect to the rod 116 or the rod 131 in case in which the 119 orifice is eccentric and adjusted to the rod 116 or 131 ( FIG. 14 ). [0044] The rod 110 forming an angle as against the rod 116 or 131 (the case in which the 119 orifice is oblong and eccentric) can in this case function equally well in tension/compression as in lateral flexion. ( FIG. 15 ). [0045] The rod 110 can function in tension/compression and in flexion following a preferred axis which can be for instance in the sagital plane of the spinal column and this one on the one side and one the other side of a given position of the rod 110 forming at rest an angle with the rod 116 or the rod 131, this also in the case where the means 119 is oblong or eccentric, ( FIG. 16 ). [0046] Finally, the rod 110 can function in tension/compression and in flexion in all directions, forming an angle, as against the rod 116 or 131 in case the orifice 119 is eccentric or larger than the diameter of the rod 110 ( FIG. 17 ).

Summary: The invention concerns a flexible intervertebral linking device ( 1 ) consisting of two sets of means. A first set of means ( 11 ) consisting of rigid means ( 110, 112, 114, 116 ) preferably made of biocompatible metallic materials providing the device with good mechanical resistance by integral load transmission without deformation. A second set of means ( 12 ) consisting of flexible or damping means ( 121 and 122 ) made of biocompatible viscoelastic materials, admitting repeated elastic deformations, the combination of said two sets of means providing it with both resistance and mechanical stress damping whereto it is subjected, to compensate for any deficiency of flexible anatomical links of the human body.

big_patent

en

Write a title and summarize: Among the most common human congenital anomalies, cleft lip and palate (CL/P) affects up to 1 in 700 live births. MicroRNA (miR) s are small, non-coding RNAs that repress gene expression post-transcriptionally. The miR-17-92 cluster encodes six miRs that have been implicated in human cancers and heart development. We discovered that miR-17-92 mutant embryos had severe craniofacial phenotypes, including incompletely penetrant CL/P and mandibular hypoplasia. Embryos that were compound mutant for miR-17-92 and the related miR-106b-25 cluster had completely penetrant CL/P. Expression of Tbx1 and Tbx3, the DiGeorge/velo-cardio-facial (DGS) and Ulnar-mammary syndrome (UMS) disease genes, was expanded in miR-17-92 mutant craniofacial structures. Both Tbx1 and Tbx3 had functional miR seed sequences that mediated gene repression. Analysis of miR-17-92 regulatory regions uncovered conserved and functional AP-2α recognition elements that directed miR-17-92 expression. Together, our data indicate that miR-17-92 modulates expression of critical T-box transcriptional regulators during midface development and is itself a target of Bmp-signaling and the craniofacial pioneer factor AP-2α. Our data are the first genetic evidence that an individual miR or miR cluster is functionally important in mammalian CL/P. The evidence that there is a genetic component underlying CL/P is compelling. Analysis of a Danish cohort of CL/P cases revealed that relatives of patients with CL/P have a higher relative risk for CL/P compared to background risk levels. This notion of CL/P heritability is also supported by twin studies [1], [2]. Genome wide association studies (GWAS) and mouse genetics studies have also pointed to genes and genomic regions that are associated with CL/P [3], [4]. MiRs repress gene expression post-transcriptionally by Watson-Crick base pairing to the seed sites in the 3′UTR of target genes. The miR-17-92 cluster, encoding miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92a-1, is within a region on chromosome 13q that when deletion is associated with CL/P, lung hypoplasia, microphthalmia, microcephaly, and small stature in human patients and has phenotypic similarities to Feingold syndrome [5], [6]. Moreover, miR-17-92 is found in an amplified region associated with small cell lung cancer, as well as in B-cell lymphomas, and is over-expressed in several solid tumor types, including breast, colon, lung, pancreas, and prostate cancers [7]. The mouse embryos with miR-17-92 loss-of-function have smaller body size, microphthalmia, heart defects, and lung hypoplasia [6], [8], [9]. Moreover, the miR-17-92 gain-of-function mutants develop lymphoma, indicating that the mouse is an accurate model for the human syndrome [10]. Unlike the miR-17-92 loss-of-function mice, its two homologous clusters, miR-106a-363 and miR-106b-25 loss-of-function embryos do not exhibit any gross abnormalities. Our previous findings indicated that miR-17-92 is directly regulated by Bmp-signaling in heart development [9]. Bmp-signaling deficiency in mice and humans has been shown to cause CL/P and other craniofacial anomalies [11], [12]. Interestingly, miR-17-92 has also been shown to be directly regulated by Myc family transcription factors [7]. Here, we show that miR-17-92 deficiency results in orofacial clefting and that the human disease genes Tbx1 and Tbx3 are direct targets for miR-17-92. Our findings also reveal that miR-17-92 is a direct target for the master regulator of cranial neural crest development AP-2α. We found that miR-17-92 (miR17-92null/null) mutant embryos had severe craniofacial defects including CL/P and mandibular hypoplasia with notching, revealing that miR-17-92 is a critical regulator of craniofacial development (Figure 1A–H, Figure S1). Moreover, by genetically reducing miR-106b-25 dose on the miR-17-92null background, the clefting phenotype was both more severe and completely penetrant, indicating that there is genetic redundancy between these two miR complexes (Figure 1C–F, Figure S1E–H and Table S1). In addition to cleft lip and mandible defects, both miR-17-92 mutants and miR-17-92null; miR-106b-25null compound mutants had cleft secondary palate (Figure 1 B, D, H). Expression of mitotic cell marker phospho-Histone H3 (pHH3) was greatly reduced in miR-17-92 mutants, indicating that miR-17-92 is required for normal progenitor cell proliferation during orofacial development (Figure 1I–L, Figure S2). Taken together, these data provide the first genetic evidence that miRs are important regulators of mammalian orofacial development and are involved in CL/P. We generated a miR-17-92 bacterial artificial chromosome (BAC) transgenic LacZ reporter line to follow the expression of primary (pri) -miR-17-92 (Figure S3A). Three individual transgenic lines showed similar LacZ expression pattern, revealing that pri-miR-17-92 was expressed in branchial arches and frontonasal process (Figure 2A). LacZ was also detected in the nasal structures, calvarial bones, auricle, periocular mesenchyme, and limb mesenchyme (Figure 2K). Sagittal sections on E11. 5 embryos revealed LacZ activity in epithelium and mesenchyme of first branchial arch and frontonasal process (Figure 2I). Coronal sections through E12. 5 and E13. 5 embryos demonstrated LacZ staining in distal tips of the palatal shelves, the mandibular mesenchyme and mesenchyme of forming frontal bones (Figure 2J, L). In situ with a pri-miR-17-92 probe revealed similar expression pattern as the transgenic LacZ data (Figure 2E–F). Furthermore, in situ analysis with locked nuclei acid (LNA) probes to detect mature miR-17 and miR-92a showed that miR-17 and miR-92a were highly expressed in branchial arch and frontonasal process (Figure 2 B–D, G–H). Unlike miR-17-92, expression of miR-106b-25 was relatively low (Figure S3B–E). Tbx1 gain-of-function causes cleft lip and is a miR-17-92 target in the heart [9], [13]. We evaluated the expression of candidate craniofacial miR-17-92 target genes based on bioinformatics analysis, including Tbx3, Fgf10, Pax9, Shox2 and Osr1, in both miR-17-92 null and conditional knock out mutants using AP-2α cre driver [14]. In situ hybridization in miR-17-92 mutants demonstrated up-regulated Tbx3 expression in mandible, frontonasal-derived structures, tongue, and secondary palate at E13. 5 (Figure S4A–F, Figure S5E–F) and in paired maxillary processes and nasal process at E10. 0 and E10. 5 (Figure 3A–B, Figure S4 G–N). Changes in Tbx1 and Fgf10 expression were not detected at E10. 0 likely because the expression changes were not dramatic enough to be detected by in situ hybridization (data not shown). Tbx1 was expanded primarily in the secondary palate, tongue, and oral ectoderm at E13. 5 (Figure 3C–D, Figure S5A–D). In addition, Fgf10 was expanded in distal mandible and tongue (Figure S5I–L), while ectopic Shox2 expression was observed in distal mandible at E13. 5 (Figure S5G–H). Expression of Osr1 was upregulated in the distal mandible and frontonasal structures at E13. 5 (Figure S5M–P). In contrast, the expression pattern of Pax9 in miR-17-92 null mutant embryos was unchanged compared to control embryos (data not shown). qRT-PCR experiments also showed up-regulation of Tbx1, Tbx3, Fgf10, Shox2 and Osr1 in miR-17-92; miR106b-25 compound mutants at E13. 5 (Figure 3E). To evaluate the expression changes of the above genes, we used a miR-17-92 conditional, cre-activated gain-of-function line (miR-17-92OE) and the Wnt1cre driver to activate miR-17-92 in cranial neural crest (CNC) [10], [15]. qRT-PCR analysis from Wnt1cre; miR-17-92OE orofacial tissue revealed that Fgf10, Tbx1, Tbx3, Osr1 and Shox2 were significantly repressed (Figure 3F), while there was no obvious morphological defect detected in miR-17-92 overexpression mutants potentially due to moderaterepression of the miR-17-92 target genes. Target genes that are repressed by miR-17-92 have a mixture of miR-17/20a/106b and miR-92a/25 family seed sites in their 3′UTRs (Figure S6). Bioinformatics analysis revealed conserved miR-17/20a/106b family seed sequence in the 3′ UTR of Fgf10, Shox2 and Osr1 (Figure S6A–C, F). The Tbx3 3′ UTR contained both a miR-17/20a/106b family seed site and a miR-92a/25 family seed site (Figure S6D–E). We cloned the 3′ UTRs of Fgf10, Shox2, Tbx3 and Osr1 into luc reporter plasmids to test miR seed sequence function in vitro. Transfections with miR mimics of miR-17-92 resulted in drastic reduction in luciferase activity for all of the reporter plasmids (Figure 3G, Figure S7). Mutation of the respective miR seed sequences within 3′ UTRs of those genes ablated the inhibition by the corresponding miR (Figure 3G, Figure S7). These data suggest that miR-17-92 directly inhibits Fgf10, Shox2, Tbx3 and Osr1. Previous work showed that conditional inactivation of Bmpr1a, Bmp4, and Bmp2; Bmp4 in developing facial processes using the Nestincre transgenic driver result in orofacial clefting ([11] and Figure S8). This cre driver directs cre activity in facial prominences [11]. Moreover, miR-17-92 is a direct target for Bmp-signaling in cardiac progenitors [9]. We crossed the miR-17-92OE line into Nestincre, Bmp4, Bmp7 conditional mutant background to test whether miR-17-92 gain-of-function could genetically rescue the defects in Bmp mutants. All NestinCre, Bmp4 flox/+, Bmp7 flox/+ embryos (23 out of 23) and embryos without NestinCre (29 out of 29) had normal morphology (Figure 4A, Figure S9A, D, table S2), while all NestinCre, Bmp4 flox/flox, Bmp7 flox/+ mutant embryos (6 out of 6) had bi-lateral cleft lip and heart defects with incompletely penetrant embryonic lethality at E12. 0 likely due to heart defects (Figure 4B, Figure S9B, E, table S2). Most (5 out of 6) NestinCre, Bmp4 flox/flox, Bmp7 flox/+, miR-17-92OE embryos were rescued by miR-17-92 overexpression (significant different compared to NestinCre, Bmp4 flox/flox, Bmp7 flox/+ mutants, CHI-TEST, p<0. 01), with full suppression of cleft lip and heart defect caused by Bmp loss-of-function, but not eye defect (Figure 4C, Figure S9C, F, table S2). Consistently, qRT-PCR data indicated that pri-miR-17-92, miR-17, and miR-20a were reduced in Bmp2/4 mutant midface (Figure 4D). In situ analysis using miR-17 LNA probe also indicated that miR-17 was dramatically reduced in Bmp2/4 mutants (Figure S10C, D) compared to controls (Figure S10A, B). In addition, qRT-PCR indicated that Fgf10, Tbx1, Tbx3, Osr1 and Shox2 were up-regulated in the midface of Bmp2; Bmp4 conditional mutants (Figure S10E), further suggesting that these genes are regulated by a BMP-miR-17-92 genetic pathway in craniofacial structures. Moreover, in vivo chromatin immunoprecipitation (ChIP) data using embryonic midface extracts showed enrichment in the anti-Smad1/5/8 immunoprecipitated chromatin, indicating that Smad1/5/8 directly binds miR-17-92 chromatin (Figure 4E). Co-transfection of a constitutively active Bmpr1a construct with miR-17-92 luc reporter resulted in approximately 3-fold induction supporting the hypothesis that Bmp signaling directly regulates miR-17-92 in developing craniofacial structures (Figure 4F). Together, a conserved Bmp-miR-17-92 genetic pathway plays a critical role in the orofacial development. Mouse mutants for AP-2α have CL/P and human patients have branchio-oculo-facial syndrome that has CL/P as a cardinal feature (BOFS MIM 113620). ChIP-sequencing (ChIP-seq) indicated that AP-2α bound to miR-17-92 chromatin in cultured human neural crest [16] (Figure 4H, S11A). To determine if AP-2α directly regulates miR-17-92, we evaluated pri-miR-17-92, mature miR-17, and mature miR-20a levels in the AP-2α mutant midface. qRT-PCR experiments indicated that pri-miR-17-92 and mature miRs were down-regulated in AP-2α mutants (Figure 4G). We used ChIP-PCR to determine whether AP-2α binds to miR-17-92 chromatin in developing midface tissue. Because there are multiple predicted AP-2α binding sites in miR-17-92, we subdivided miR-17-92 into four regions based on ChIP-seq (Figure 4 H–J and S11). ChIP-PCR experiments using midface extracts indicated that AP-2α bound to miR-17-92 regions 1, region 2, and region 4 (Figure 4 K). Transfection experiments with a miR-17-92 reporter containing AP-2α binding sites revealed that AP-2α transcriptionally activated miR-17-92 although synergism with Smad1 was not detected using this miR-17-92 reporter (Figure 4 L). Moreover, AP-2α may also directly regulate miR-106b-25 as suggested by the analysis of ChIP-seq data [16] (Figure S12). Tbx1 loss- and gain-of-function result in cleft palate in human DGS patients and mouse models [13], [17]–[19]. Consistent with our findings, Tbx1 gain-of-function results in cell cycle arrest [17]. DGS is characterized by highly variable phenotypes indicating that there are strong modifiers in the human genome [18], [20]. Our findings suggest miR-17-92 as a candidate genetic modifier for Tbx1 since it fine-tunes Tbx1 expression levels. Mouse mutants for Tbx3 and the related Tbx2 have cleft palate [21]. Furthermore, human patients with UMS have abnormal and distinct facial appearance indicating a requirement for Tbx3 in human craniofacial development [22]. While our findings suggest that elevated Tbx3 inhibits proliferation, there is other evidence suggesting that Tbx3 promotes proliferation [23]. However, an in vivo study reveals that Tbx3 overexpression results in reduced cardiomyocyte proliferation in the zebrafish heart [24]. More work will be required to evaluate Tbx3 function and target genes in vivo in the context of the miR-17-92 mutant midface to better understand contextual Tbx3 function. Both Fgf10 and Fgfr null mice have cleft secondary palate [25], [26]. Mutations in Fgf10 and Fgf receptors cause lacrimo-auricular-dento-digital (LADD) syndrome in human patients indicating a requirement for Fgf-signaling in human craniofacial development [27]. Fgf10 mRNA is enriched in anterior and middle regions of the secondary palate. Moreover, Fgf10 deficiency results in abnormal fusion of the palatal to oral cavity epithelium, suggesting that Fgf10 is required for maturation of palate epithelium. Importantly, elevated Fgf signaling is pathologic in human patients as shown by the extensive investigations into Fgf receptor mediated craniosynostosis [28]. Homozygosity for the Fgfr2 gain-of-function Crouzon mutation in mice results in cleft palate, as well as, craniosynostosis [29] indicating that elevated Fgf signaling also causes cleft palate. Our data demonstrate that miR-17-92 directly represses Fgf10 as a mechanism to maintain correct levels of Fgf10 during palate closure. Currently, there are no other genetic loss-of-function data indicating that single miRs or miR clusters are important in mammalian orofacial clefting. Data from zebrafish indicate that miR-140 targets pdgfra to regulate primary palate development [30]. GWAS in human patients reveal important genome regions that are associated with CL/P, including 8q24 [3], [31]. Within the 8q24 region is the c-myc gene, a known miR-17-92 regulator [32], [33]. Chromosomal deletions that include miR-17-92 cause a variant of Feingold syndrome in human patients with small stature and skeletal abnormalities [6]. Human patients with hemizygous miR-17-92 deletion do not have CL/P likely reflecting phenotypic heterogeneity in miR-17-92 loss of function families. These data are consistent with our findings indicating that there is incomplete penetrance of the CL/P phenotype in miR-17-92 mutant mouse embryos (table S1). Consistent with previously finding that Bmp-deficiency results in CL/P in mice and humans [11], [12], our data indicate that Bmp signaling activates miR-17-92 in craniofacial development. Moreover, we show that AP-2α also regulates miR-17-92 expression although our transfection assays failed to uncover synergistic miR-17-92 activation by AP-2α and Bmp-signaling (not shown). One possibility is that Bmp-signaling and AP-2α activate miR-17-92 sequentially during craniofacial progenitor cell development. The assays we employed here cannot easily distinguish molecular events that occur in neighboring or closely apposed cells rather than in the same cell. We also failed to detect up-regulated miR-17-92 target genes in AP-2α mutants perhaps due to functional redundancy with other AP-2 family members [34]–[36]. Nonetheless our findings have important implications since AP-2α has been shown to regulate Irf6, a common genetic defect in syndromic and non-syndromic CL/P in human patients [37]. AP-2α regulation potentially connects miR-17-92 to a gene regulatory network that may be involved in a large portion of human CL/P. In summary, we identified a miR-mediated genetic pathway that plays critical roles during orofacial development (Figure S13). All animal experiments detailed within the manuscript were approved by the Baylor College of Medicine review board. The miR-17-92 and miR-106b-25 alleles, Bmp2, Bmp4 and Bmp7 conditional null, AP-2α cre, Nestin cre and Wnt1cre alleles were previously described [8], [10], [11], [14], [15], [38]. To generate miR-17-92-lacZ reporter transgenic lines, we obtained the BAC from BACPAC Resources Center, Children' s hospital Oakland Research Institute (BAC number: RP23-89P9) and replaced miR-17-92 sequence with lacZ coding sequence by recombineering, followed by pro-nuclear injection. Constructs were generated using PCR, cloning and recombineering. A LoxP site flanked neo cassette was isolated from PL452 plasmid using BamHI and EcoRI. lacZ coding sequence was isolated from hsp68-lacZ plasmid using BamHI and NcoI. All fragments were cloned into pBluescript SK+ to generate miR-17-92-lacZ construct, followed by recombineering and subsequently Cre mediated recombination for removal of the neo cassette (Figure S3A). Mouse embryos were harvested in ice-cold Phosphate Buffered Saline (PBS), then fixed overnight (O/N) in 4% paraformaldehyde (PFA) and 2% glutaraldehyde in PBS at 4°C. The samples were then dehydrated in ethanol series to a final 100% ethanol, followed by transferring to graded series of increasing concentrations of hexamethyldisilazane (HMDS) for 5 min each and air dried O/N. Samples were mounted on to double-stick carbon tabs (Ted Pella. Inc.), which have been pre-mounted on to aluminum specimen mounts (Electron Microscopy Sciences). The samples were then coated with a thickness of 25 nm platinum alloy under vacuum using a Balzer MED 010 evaporator (Technotrade International), then immediately flash carbon coated under the same vacuum. The samples were transferred to a desiccator for later examination. JSM-5910 scanning electron microscope (JEOL, USA, Inc.) was used at an accelerating voltage of 5 kV. Embryos were fixed in 4% PFA, embedded in paraffin and cut to 5 µm sections mounted on Superfrost/Plus slides (Fisher Scientific). The antigens were retrieved by incubating in the citrate buffer (10 mM) for 2 minutes in microwave oven. The primary antibody was anti-Phospho-Histone H3 with 1∶200 dilution (Cell Signaling). Broad HRP conjugated secondary antibody (Invitrogen) was used and visualized using TSA Plus Fluorescence Systems from PerkinElmer on a Zeiss LSM 510 Confocal Microscope. Nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI). Tissue preparation and in situ hybridization were as previously described [39], [40]. The gene probes were synthesized using DIG RNA Labeling Kit (Roche) following manufacturer' s guidelines. The enzymes used for digestion and transcription of in situ constructs are SacII and T7 for Fgf10, XhoI and T7 for Shox2 (gift from Dr. Yiping Chen' s lab), EcoRI and T7 for Osr1 (gift from Dr. Rulang Jiang' s lab), EcoRI and T3 for Tbx1 (gift from Dr. Antonio Baldini' s lab), PstI and T3 for Tbx3 (gift from Dr. Robert Kelly' s lab). miRCURY LNA probes were purchased from Exiqon and used per manufacturer' s guidelines. To generate 3′ UTR luciferase reporter plasmids, 3′ UTR genomic sequence of genes including Fgf10, Osr1, Shox2 and Tbx3 were amplified using a high-fidelity PCR system (Roche) with designed oligonucleotides and subcloned into the pMIR-REPORT Luciferase miRNA Expression Reporter Vector (Ambion). Oligonucleotides used to amplify 3′ UTR genomic sequence of Fgf10 are sense, 5′-CGACTAGTAAGAAAACACTGTTGGTGGATGCAG -3′, and antisense, 5′-GCACGCGTTTTTATTCTCTTTTCCCAGC-3′. Oligonucleotides used to amplify 3′ UTR genomic sequence of Osr1 are sense, 5′- GACTAGTATAAACAGAGCCTGCGGG -3′, and antisense, 5′- CGACGCGTGCCTGTAAAATAACCGTTTATTT -3′. Oligonucleotides used to amplify 3′ UTR genomic sequence of Shox2 are sense, 5′-ACTAGTCGCCGGCGCCAGCGCCACGGT-3′, and antisense, 5′-AAGCTTCTTTTTTGTATGAACGTCC-3′. Oligonucleotides used to amplify 3′ UTR genomic sequence of Tbx3 are sense, 5′- GACTAGTAAACAAGAAAAACAAAATCGCC -3′, and antisense, 5′- CCCAAGCTTTCATTTCAATAAAAATTTATTG -3′. Oligonucleotides used to amplify 3′ UTR genomic sequence of Tbx3 without mir17/mir-20a seed site are sense, 5′- GACTAGTGTGTAACCAGGCTGCTGTTGCTTT -3′, and antisense, 5′- CCCAAGCTTTGGTCGTTTGAACCAAGTCCCTCT -3′. Underlined letters represent enzyme restriction sites for subcloning. All PCR products were sequenced to make sure no mutations were introduced. All site-directed mutagenesis of the miR seed sites in the 3′ UTR reporter constructs were achieved by using the QuikChange II site-directed mutagenesis kit (Stratagene). The sense-strand sequences of the oligonucleotides used for mutagenesis (underlined letters indicate the mutation of miR seed sites) were: 5′-TAAGACACGCAAGCATTTACTGGAAAGACACTGGGTCATATCATATGCACAACCAAAG- 3′ (Fgf10-mut1,), 5′-CCCCATGCGCTCTCAGTTGACTTAATTTGACACTCTGCAATAAAAAACACCAGCAAT- 3′ (Fgf10-mut2), 5′-ACAGCAAATAGTGCAGACGTTGGATTCTTATTTCAACCCGCCATTTAGATTACTAAAGAGA- 3′ (Fgf10-mut3); 5′-GCTGACCTTTTTCTGCGAAGTTGAATTCAATAGGAGACATTTGATAAGAG - 3′ (Shox2-mut); 5′- GCCGGGCGTTGTATTGCGACTGGGAATTCATGCTGACCATCGGTAACGGAC - 3′ (Osr1-mut); 5′- GGACCATTAGTTCTTTTAACTGTATAGAATTCAACAAGGTTTTAAAAGATAATAATA - 3′ (Tbx3-mut). All PCR products were sequenced to make sure no unexpected mutations were introduced. Wild type mouse embryonic orofaces were dissected at E12. 5 (for Smad1/5/8 ChIP) or E10. 5 (for AP-2α ChIP) and followed by ChIP analysis as previously described [9]. As control, normal rabbit immunoglobulin G was used as a replacement for the anti-Smad1/5/8 (sc-6031 X, Santa Cruz) and 3B5 mouse monoclonal AP-2α antibody [41] to reveal nonspecific immunoprecipitation of the chromatin. The PCR products were evaluated for appropriate size on a 2% agarose gel and were confirmed by sequencing. The primers for amplifying the regulatory element in the 5′ upstream of mir-17-92 genomic sequence were: sense, 5′- CTGGCGGGAAGCCTGAGC -3′, antisense, 5′-CACGGCGGCTCGTTCTTG -3′ (for AP-2α region1); sense, 5′- CCTTCATTCACCCACATGGTCCTT -3′, antisense, 5′- AGCAGCCGCCACCATCTT -3′ (for AP-2α region2); sense, 5′- GCACACAATGGCCCTCGG -3′, antisense, 5′- GCGCGCACAAAGTTTCGG -3′ (for AP-2α region3); sense, 5′- CGCAGCCGCCCAGAAAC -3′, and antisense, 5′-TCCGCGCCAGCTTATCAAGAGAAA -3′ (for AP-2α region4 and Bmp/Smad regulatory element). Total RNA was isolated using RNeasy Micro Kit (QIAGEN) and real-time thermal cycling was performed using StepOne Real-Time PCR Systems (Applied Biosystems). Super Script II Reverse Transcriptase (Invitrogen) was used for RT-PCR and SYBR Green JumpStart Taq ReadyMix (SIGMA) was used for real-time thermal cycling. All error bars represent SEM. Plasmids used for transfection were generated as described above or previously reported [9]. LS8 cells were transfected using Lipofectamine 2000 (Invitrogen). Luciferase activity assays were measured using the luciferase Assay System (Promega). hNCC AP-2α ChIP-seq and histone modification markers ChIP-seq datasets were accessed from GEO under accession number GSE28876 [16], [42]. Raw fastq reads were mapped to hg19 genome using Bowtie2 [43]. The total number of tags of each ChIP-seq run was normalized to 10 million. ChIP-seq tracks were visualized and compared in UCSC Genome Browser.

Title: MicroRNA-17-92, a Direct Ap-2α Transcriptional Target, Modulates T-Box Factor Activity in Orofacial Clefting Summary: CL/P are very common birth defects in humans. The genetic mechanism underlying CL/P pathogenesis is poorly understood. MiRs, small non-coding RNAs that function to post-transcriptionally regulate gene expression, have been identified as pivotal modulators of various developmental events and diseases. To date, there is no individual miR or miR cluster that has been identified as functionally essential in mammalian CL/P. Here, we have discovered that deletion of miR-17-92 cluster in mice results in craniofacial malformations including CL/P. Importantly, MIR-17-92 is located on a critical human chromosome region associated with 13q deletion syndrome, a chromosomal disorder that presents with defects including CL/P, suggesting the advantages of our animal model to study human disease. Moreover, our work demonstrated that miR-17-92 cluster directly repressed T-box factors, which have critical functions during craniofacial development. We further showed that miR-17-92 was directly activated by Bmp-signaling and transcription factor AP-2α. Together, our work identified a novel miR-mediated transcriptional network underlying CL/P, providing new insights into craniofacial developmental biology.

lay_plos

en

Summarize: By. Alisdair Glennie. PUBLISHED:. 17:49 EST, 8 August 2013. |. UPDATED:. 02:13 EST, 9 August 2013. The BBC suppressed an independent review of its executive pay which found its top brass were paid up to three times more than their public sector counterparts. Despite being warned four years ago that the pay of the director general and his lieutenants far outstripped what they might earn in equivalent jobs in the civil service, corporation bosses failed to take immediate action to curb top-level pay. A study by accountants PricewaterhouseCoopers (PwC) for the BBC Trust in 2009 found their basic salaries were instead on a par with the chiefs of aggressively profit-making FTSE 100 companies, despite the fact they are paid with licence fee payers’ money. No action: Despite warnings, Corporation bosses failed to take action to curb top salaries. Instead of risking embarrassment by publishing it in full, BBC bosses kept the report under wraps until it was released under Freedom of Information laws. Last night, MPs condemned the BBC for failing to publish the explosive findings earlier and said it illustrated a ‘fill your boots at public expense’ culture at the top of the corporation. Laying bare the true extent of BBC largesse, the newly released documents reveal:. Last night Conservative MP Stephen Barclay, who sits on the influential public accounts committee of MPs, said executives would be asked to explain why the report was suppressed at its next hearing in September. The PwC report was commissioned by former BBC Trust chairman Sir Michael Lyons in April 2009 in response to widespread dismay at senior staff bonuses that year. Instead of publishing the report, the BBC’s executive remuneration committee – including Mr Thompson – discussed its findings in private and never published it in full. Review: The PwC report was commissioned by former BBC Trust chairman Sir Michael Lyons in April 2009. At a meeting in July 2009, the committee decided BBC pay should be aligned with executives in the commercial public sector meaning the BBC could justify paying its executives far higher salaries. Yesterday a BBC spokesman justified the decision to benchmark its pay against the commercial public sector by saying the corporation needed to compete for talent with commercial media rivals. But Tory MP Stewart Jackson, who also sits on the public accounts committee, said: ‘There seems to have been a culture under the previous director general of “fill your boots at public expense and the expense of the licence fee payer”. The gravy train has finally hit the buffers. Those responsible must be held fully accountable for it.’ A BBC spokesman said: ‘A great deal has been done since 2009 to address issues around executive remuneration at the BBC. ‘Following this review, the senior management paybill has been reduced by more than 30 per cent, the director general’s salary has come down almost 33 per cent, while the ratio of director-general’s salary to median pay has fallen from 16.8 to 11 and bonuses have been permanently withdrawn from executive directors.’

Summary: The BBC Trust commissioned a study of basic salaries back in 2009. Bosses salaries found to be on a par with those at top FTSE 100 companies. But the BBC kept the report under wraps until an FOI request was made. MPs have condemned the BBC for not publishing findings earlier. The BBC's executive remuneration committee was warned former director general Mark Thompson's £651,000 basic salary was more than three times what he would be able to earn in an equivalent role in the civil service, Army or judiciary. The corporation's top ten earners, including former deputy director general Mark Byford on £609,000 and former chief operating officer Caroline Thomson on £430,000, were paid on average more than twice their public sector counterparts. On average, basic salaries were only 4 per cent lower than the private sector. The BBC's executive remuneration committee decided to use high-paying 'commercial public sector' institutions - such as Network Rail or the Tote - as a benchmark for pay rather than more frugal 'core' public sector examples, such as the civil service. Minutes show they realised the decision was 'likely to be contentious'. Similar reviews have been carried out every year since 2009. They show executive salaries still exceed the agreed benchmark, but the BBC has redacted the documents to prevent the public from knowing by how much.

cnn_dailymail

en

Summarize: |ANNE was bringing the cows home from the back pasture by way of Lover's Lane. It was a September evening and all the gaps and clearings in the woods were brimmed up with ruby sunset light. Here and there the lane was splashed with it, but for the most part it was already quite shadowy beneath the maples, and the spaces under the firs were filled with a clear violet dusk like airy wine. The winds were out in their tops, and there is no sweeter music on earth than that which the wind makes in the fir trees at evening. The cows swung placidly down the lane, and Anne followed them dreamily, repeating aloud the battle canto from _Marmion_--which had also been part of their English course the preceding winter and which Miss Stacy had made them learn off by heart--and exulting in its rushing lines and the clash of spears in its imagery. When she came to the lines The stubborn spearsmen still made good Their dark impenetrable wood, she stopped in ecstasy to shut her eyes that she might the better fancy herself one of that heroic ring. When she opened them again it was to behold Diana coming through the gate that led into the Barry field and looking so important that Anne instantly divined there was news to be told. But betray too eager curiosity she would not. "Isn't this evening just like a purple dream, Diana? It makes me so glad to be alive. In the mornings I always think the mornings are best; but when evening comes I think it's lovelier still." "It's a very fine evening," said Diana, "but oh, I have such news, Anne. Guess. You can have three guesses." "Charlotte Gillis is going to be married in the church after all and Mrs. Allan wants us to decorate it," cried Anne. "No. Charlotte's beau won't agree to that, because nobody ever has been married in the church yet, and he thinks it would seem too much like a funeral. It's too mean, because it would be such fun. Guess again." "Jane's mother is going to let her have a birthday party?" Diana shook her head, her black eyes dancing with merriment. "I can't think what it can be," said Anne in despair, "unless it's that Moody Spurgeon MacPherson saw you home from prayer meeting last night. Did he?" "I should think not," exclaimed Diana indignantly. "I wouldn't be likely to boast of it if he did, the horrid creature! I knew you couldn't guess it. Mother had a letter from Aunt Josephine today, and Aunt Josephine wants you and me to go to town next Tuesday and stop with her for the Exhibition. There!" "Oh, Diana," whispered Anne, finding it necessary to lean up against a maple tree for support, "do you really mean it? But I'm afraid Marilla won't let me go. She will say that she can't encourage gadding about. That was what she said last week when Jane invited me to go with them in their double-seated buggy to the American concert at the White Sands Hotel. I wanted to go, but Marilla said I'd be better at home learning my lessons and so would Jane. I was bitterly disappointed, Diana. I felt so heartbroken that I wouldn't say my prayers when I went to bed. But I repented of that and got up in the middle of the night and said them." "I'll tell you," said Diana, "we'll get Mother to ask Marilla. She'll be more likely to let you go then; and if she does we'll have the time of our lives, Anne. I've never been to an Exhibition, and it's so aggravating to hear the other girls talking about their trips. Jane and Ruby have been twice, and they're going this year again." "I'm not going to think about it at all until I know whether I can go or not," said Anne resolutely. "If I did and then was disappointed, it would be more than I could bear. But in case I do go I'm very glad my new coat will be ready by that time. Marilla didn't think I needed a new coat. She said my old one would do very well for another winter and that I ought to be satisfied with having a new dress. The dress is very pretty, Diana--navy blue and made so fashionably. Marilla always makes my dresses fashionably now, because she says she doesn't intend to have Matthew going to Mrs. Lynde to make them. I'm so glad. It is ever so much easier to be good if your clothes are fashionable. At least, it is easier for me. I suppose it doesn't make such a difference to naturally good people. But Matthew said I must have a new coat, so Marilla bought a lovely piece of blue broadcloth, and it's being made by a real dressmaker over at Carmody. It's to be done Saturday night, and I'm trying not to imagine myself walking up the church aisle on Sunday in my new suit and cap, because I'm afraid it isn't right to imagine such things. But it just slips into my mind in spite of me. My cap is so pretty. Matthew bought it for me the day we were over at Carmody. It is one of those little blue velvet ones that are all the rage, with gold cord and tassels. Your new hat is elegant, Diana, and so becoming. When I saw you come into church last Sunday my heart swelled with pride to think you were my dearest friend. Do you suppose it's wrong for us to think so much about our clothes? Marilla says it is very sinful. But it is such an interesting subject, isn't it?" Marilla agreed to let Anne go to town, and it was arranged that Mr. Barry should take the girls in on the following Tuesday. As Charlottetown was thirty miles away and Mr. Barry wished to go and return the same day, it was necessary to make a very early start. But Anne counted it all joy, and was up before sunrise on Tuesday morning. A glance from her window assured her that the day would be fine, for the eastern sky behind the firs of the Haunted Wood was all silvery and cloudless. Through the gap in the trees a light was shining in the western gable of Orchard Slope, a token that Diana was also up. Anne was dressed by the time Matthew had the fire on and had the breakfast ready when Marilla came down, but for her own part was much too excited to eat. After breakfast the jaunty new cap and jacket were donned, and Anne hastened over the brook and up through the firs to Orchard Slope. Mr. Barry and Diana were waiting for her, and they were soon on the road. It was a long drive, but Anne and Diana enjoyed every minute of it. It was delightful to rattle along over the moist roads in the early red sunlight that was creeping across the shorn harvest fields. The air was fresh and crisp, and little smoke-blue mists curled through the valleys and floated off from the hills. Sometimes the road went through woods where maples were beginning to hang out scarlet banners; sometimes it crossed rivers on bridges that made Anne's flesh cringe with the old, half-delightful fear; sometimes it wound along a harbor shore and passed by a little cluster of weather-gray fishing huts; again it mounted to hills whence a far sweep of curving upland or misty-blue sky could be seen; but wherever it went there was much of interest to discuss. It was almost noon when they reached town and found their way to "Beechwood." It was quite a fine old mansion, set back from the street in a seclusion of green elms and branching beeches. Miss Barry met them at the door with a twinkle in her sharp black eyes. "So you've come to see me at last, you Anne-girl," she said. "Mercy, child, how you have grown! You're taller than I am, I declare. And you're ever so much better looking than you used to be, too. But I dare say you know that without being told." "Indeed I didn't," said Anne radiantly. "I know I'm not so freckled as I used to be, so I've much to be thankful for, but I really hadn't dared to hope there was any other improvement. I'm so glad you think there is, Miss Barry." Miss Barry's house was furnished with "great magnificence," as Anne told Marilla afterward. The two little country girls were rather abashed by the splendor of the parlor where Miss Barry left them when she went to see about dinner. "Isn't it just like a palace?" whispered Diana. "I never was in Aunt Josephine's house before, and I'd no idea it was so grand. I just wish Julia Bell could see this--she puts on such airs about her mother's parlor." "Velvet carpet," sighed Anne luxuriously, "and silk curtains! I've dreamed of such things, Diana. But do you know I don't believe I feel very comfortable with them after all. There are so many things in this room and all so splendid that there is no scope for imagination. That is one consolation when you are poor--there are so many more things you can imagine about." Their sojourn in town was something that Anne and Diana dated from for years. From first to last it was crowded with delights. On Wednesday Miss Barry took them to the Exhibition grounds and kept them there all day. "It was splendid," Anne related to Marilla later on. "I never imagined anything so interesting. I don't really know which department was the most interesting. I think I liked the horses and the flowers and the fancywork best. Josie Pye took first prize for knitted lace. I was real glad she did. And I was glad that I felt glad, for it shows I'm improving, don't you think, Marilla, when I can rejoice in Josie's success? Mr. Harmon Andrews took second prize for Gravenstein apples and Mr. Bell took first prize for a pig. Diana said she thought it was ridiculous for a Sunday-school superintendent to take a prize in pigs, but I don't see why. Do you? She said she would always think of it after this when he was praying so solemnly. Clara Louise MacPherson took a prize for painting, and Mrs. Lynde got first prize for homemade butter and cheese. So Avonlea was pretty well represented, wasn't it? Mrs. Lynde was there that day, and I never knew how much I really liked her until I saw her familiar face among all those strangers. There were thousands of people there, Marilla. It made me feel dreadfully insignificant. And Miss Barry took us up to the grandstand to see the horse races. Mrs. Lynde wouldn't go; she said horse racing was an abomination and, she being a church member, thought it her bounden duty to set a good example by staying away. But there were so many there I don't believe Mrs. Lynde's absence would ever be noticed. I don't think, though, that I ought to go very often to horse races, because they _are_ awfully fascinating. Diana got so excited that she offered to bet me ten cents that the red horse would win. I didn't believe he would, but I refused to bet, because I wanted to tell Mrs. Allan all about everything, and I felt sure it wouldn't do to tell her that. It's always wrong to do anything you can't tell the minister's wife. It's as good as an extra conscience to have a minister's wife for your friend. And I was very glad I didn't bet, because the red horse _did_ win, and I would have lost ten cents. So you see that virtue was its own reward. We saw a man go up in a balloon. I'd love to go up in a balloon, Marilla; it would be simply thrilling; and we saw a man selling fortunes. You paid him ten cents and a little bird picked out your fortune for you. Miss Barry gave Diana and me ten cents each to have our fortunes told. Mine was that I would marry a dark-complected man who was very wealthy, and I would go across water to live. I looked carefully at all the dark men I saw after that, but I didn't care much for any of them, and anyhow I suppose it's too early to be looking out for him yet. Oh, it was a never-to-be-forgotten day, Marilla. I was so tired I couldn't sleep at night. Miss Barry put us in the spare room, according to promise. It was an elegant room, Marilla, but somehow sleeping in a spare room isn't what I used to think it was. That's the worst of growing up, and I'm beginning to realize it. The things you wanted so much when you were a child don't seem half so wonderful to you when you get them." Thursday the girls had a drive in the park, and in the evening Miss Barry took them to a concert in the Academy of Music, where a noted prima donna was to sing. To Anne the evening was a glittering vision of delight. "Oh, Marilla, it was beyond description. I was so excited I couldn't even talk, so you may know what it was like. I just sat in enraptured silence. Madame Selitsky was perfectly beautiful, and wore white satin and diamonds. But when she began to sing I never thought about anything else. Oh, I can't tell you how I felt. But it seemed to me that it could never be hard to be good any more. I felt like I do when I look up to the stars. Tears came into my eyes, but, oh, they were such happy tears. I was so sorry when it was all over, and I told Miss Barry I didn't see how I was ever to return to common life again. She said she thought if we went over to the restaurant across the street and had an ice cream it might help me. That sounded so prosaic; but to my surprise I found it true. The ice cream was delicious, Marilla, and it was so lovely and dissipated to be sitting there eating it at eleven o'clock at night. Diana said she believed she was born for city life. Miss Barry asked me what my opinion was, but I said I would have to think it over very seriously before I could tell her what I really thought. So I thought it over after I went to bed. That is the best time to think things out. And I came to the conclusion, Marilla, that I wasn't born for city life and that I was glad of it. It's nice to be eating ice cream at brilliant restaurants at eleven o'clock at night once in a while; but as a regular thing I'd rather be in the east gable at eleven, sound asleep, but kind of knowing even in my sleep that the stars were shining outside and that the wind was blowing in the firs across the brook. I told Miss Barry so at breakfast the next morning and she laughed. Miss Barry generally laughed at anything I said, even when I said the most solemn things. I don't think I liked it, Marilla, because I wasn't trying to be funny. But she is a most hospitable lady and treated us royally." Friday brought going-home time, and Mr. Barry drove in for the girls. "Well, I hope you've enjoyed yourselves," said Miss Barry, as she bade them good-bye. "Indeed we have," said Diana. "And you, Anne-girl?" "I've enjoyed every minute of the time," said Anne, throwing her arms impulsively about the old woman's neck and kissing her wrinkled cheek. Diana would never have dared to do such a thing and felt rather aghast at Anne's freedom. But Miss Barry was pleased, and she stood on her veranda and watched the buggy out of sight. Then she went back into her big house with a sigh. It seemed very lonely, lacking those fresh young lives. Miss Barry was a rather selfish old lady, if the truth must be told, and had never cared much for anybody but herself. She valued people only as they were of service to her or amused her. Anne had amused her, and consequently stood high in the old lady's good graces. But Miss Barry found herself thinking less about Anne's quaint speeches than of her fresh enthusiasms, her transparent emotions, her little winning ways, and the sweetness of her eyes and lips. "I thought Marilla Cuthbert was an old fool when I heard she'd adopted a girl out of an orphan asylum," she said to herself, "but I guess she didn't make much of a mistake after all. If I'd a child like Anne in the house all the time I'd be a better and happier woman." Anne and Diana found the drive home as pleasant as the drive in--pleasanter, indeed, since there was the delightful consciousness of home waiting at the end of it. It was sunset when they passed through White Sands and turned into the shore road. Beyond, the Avonlea hills came out darkly against the saffron sky. Behind them the moon was rising out of the sea that grew all radiant and transfigured in her light. Every little cove along the curving road was a marvel of dancing ripples. The waves broke with a soft swish on the rocks below them, and the tang of the sea was in the strong, fresh air. "Oh, but it's good to be alive and to be going home," breathed Anne. When she crossed the log bridge over the brook the kitchen light of Green Gables winked her a friendly welcome back, and through the open door shone the hearth fire, sending out its warm red glow athwart the chilly autumn night. Anne ran blithely up the hill and into the kitchen, where a hot supper was waiting on the table. "So you've got back?" said Marilla, folding up her knitting. "Yes, and oh, it's so good to be back," said Anne joyously. "I could kiss everything, even to the clock. Marilla, a broiled chicken! You don't mean to say you cooked that for me!" "Yes, I did," said Marilla. "I thought you'd be hungry after such a drive and need something real appetizing. Hurry and take off your things, and we'll have supper as soon as Matthew comes in. I'm glad you've got back, I must say. It's been fearful lonesome here without you, and I never put in four longer days." After supper Anne sat before the fire between Matthew and Marilla, and gave them a full account of her visit. "I've had a splendid time," she concluded happily, "and I feel that it marks an epoch in my life. But the best of it all was the coming home."

Summary: An Epoch in Anne's Life On a beautiful September evening, Anne is bringing the cows back from the pasture when she runs into Diana, who has exciting news: Aunt Josephine has invited the two girls to her mansion in Charlottetown to see an exhibition, an event similar to a fair. The girls go to Aunt Josephine's estate, called Beechwood, and they relish their drive. The house is richly decorated, with silk curtains, velvet carpets, and a spare bedroom specially made up for them. Anne finds that these luxuries, which she has dreamed about and yearned for, are actually disappointing and alienating in real life. She reflects later to Marilla that part of growing up is realizing that "he things you wanted so much when you were a child don't seem half so wonderful to you when you get them. The exhibition is exciting, with its displays of knitted lace, flowers, vegetables, and horseracing. Afterward, when Anne laments that she will have difficulty returning to normal life, Aunt Josephine offers to take the girls to a fancy restaurant for ice cream at eleven P. M. This restaurant visit comes to represent the excitement of city life to Anne. Upon returning home, Anne decides she would rather be sleeping in bed at Green Gables than gallivanting around a city.

booksum

en

Summarize: American cable networks Showtime and HBO are preparing to charge a record $99.95 (£65) for a pay-per-view subscription to watch the richest fight in history between Floyd Mayweather and Manny Pacquiao. A bidding war is under way for TV rights in at least 200 countries outside the US, the UK included with Sky, BT, BoxNation and perhaps ITV in contention for the bout, which is due to take place in Las Vegas on May 2. With the combined purse for Mayweather and Pacquiao totalling at least $250million, projections for the value of the event are rising from an initial $300m to close on half a billion. Floyd Mayweather has confirmed he will face Manny Pacquiao at the MGM Grand in Las Vegas on May 2. Mayweather shared the official signed contract for the fight via his Shots social media account on Friday. Pacquiao and Mayweather were pictured together for the first time at a basketball game last month. If that comes to pass – and there are 10 weeks of promotional hype and hysteria to come - the rewards for the combatants will increase. Come May 2, all the MGM properties will screen closed-circuit transmission on giants screens with entrance fees reaching $200 (£130) plus. Millions in the Philippines will also watch on giant screens in city squares and parks. This was an offer that Mr Moneybags could not refuse. Not that the world would let him. The MGM sold out all its 5,005 rooms within 15 minutes of Mayweather firing the starting gun online. The base room rate for the nights of May 1 and 2 is upward of $500. Accommodation is already hard find all over the Strip. Tickets for ringside seats, expected face value $5,000 (£3,300), are already appearing on the black market at up to $20,000 (£13,000). The fight has been years in the making and, after the hype was ramped up when the boxers were pictured together at a basketball game in Miami last month, Maywetaher finally delivered the news last week via shots.com. AS SPORTSMAIL REVEALED: Click here to read how Jeff Powell told when the big fight would be announced. Miami Heat projected the two fighters onto the big screen and asked the question: 'Coming in 2015?' Mayweather last fought when he beat Marcos Maidana in the pair's rematch last September in Las Vegas. Pacquiao was last in action when he dominated Chris Algieri over 12 rounds in Macau last November

Summary: Floyd Mayweather to take on Manny Pacquiao in Las Vegas on May 2. Rivals will fight for the mythical title of greatest pound-for-pound boxer. American cable networks preparing to charge $99.95 for a subscription. Sky, BT and BoxNation are in contention for the fight's TV rights. Black market ringside tickets are being advertised for $20,000 (£13,000) CLICK HERE to follow the Floyd Mayweather vs Manny Pacquiao fight live!

cnn_dailymail

en

Summarize: An alleged Florida fraudster charged with stealing dozens of people's identities in order to file fake tax returns pleaded with a court for a lighter sentence, saying he has turned his life around. Derek Denesevich, 26, of Lauderhill, paid a Broward Clerk of Courts employee to steal drivers identities from a state database in 2011 and 2012, in a scam that netted him $57,238. Despite a raft of distinctive facial tattoos and piercings - including the logo for luxury car dealer Bentley across his forehead - Denesevich was still able to pretend to be other people, filing about 80 fraudulent income tax returns, according to WPTV. He was facing four and a half years in prison and has a long list of prior convictions, including illegal possession of an alligator, robbery, firearm and drug offenses. Reformed: Derek Denesevich, 26, pleaded for a lighter sentence on crimes of aggravated identity theft, saying he has turned his life around, starting with the attempted removal of his facial tattoos. However Denesevich said he is actively trying to reform, starting with several months of tattoo removal treatment to rid his face of ink. He has also gone undercover for the FBI to help catch a team of identity and tax fraudsters. Denesevich wore a wire as part of the plot, which lead to the arrest of six people who had stolen more than 1,200 identities. At his sentencing hearing on Friday, the court heard how Denesevrich fled to Canada in 2012 after police approached him over his crimes. However he returned to South Florida following the birth of his son. 'I came back here for my son,' Denesevich told the judge, according to WPTV. 'I'm extremely sorry to my victims.' FBI agents also appeared in court to corroborate Denesevich's work for them. Before: Derek Denesevich's attorney declined to comment on his client's decision to get the luxury car tattoo, however the Florida father is now having all his facial ink removed. Scene: Denesevich paid a woman at the Broward Clerk of Courts (pictured) to steal the identities of drivers. As a result he received a sentence of one year and three months, following by three years of supervised release. However he must pay back the $57,328 he stole as part of his tax fraud scheme. Part of the money will be paid by Porscha Kyles, the Clerk of Courts employee who helped him with the scam. She is serving three years for her crimes. Although he is trying to erase his facial tattoos, Denesevich is said to have a tattoo on his back featuring his own face, complete with the Bentley logo on his forehead

Summary: Derek Denesevich, 26, of Lauderhill, Florida, was facing four and a half years prison on charges of aggravated identity theft in 2011 and 2012. On Friday he was sentenced to one year and three months. Denesevich managed to pretend to be different people despite his facial tattoos in a scam that netted him $57,238. However he proved he caught his attempts to reform, including working for the FBI. He is also trying to have his tattoos removed.

cnn_dailymail

en

Summarize: CROSS REFERENCE TO RELATED APPLICATIONS This is a continuation of U.S. patent application Ser. No. 07/612,617 filed Nov. 23, 1990, now abandoned, and entitled &#34;Method and Apparatus for Extracting Ingrown Electrode Spirals from a Body Organ&#34; and which in turn was based on German Patent Application No. P 39 37 594.3 filed Nov. 11, 1989; and U.S. patent application Ser. No. 07/952,498, filed as PCT/DE91/00490, Jun. 10, 1991, now abandoned, and entitled &#34;Device for Extracting a Pacemaker Helical Electrode Embedded in the Heart&#34; which in turn was based on International Application No. PCT/DE91/00490 having an International filing date of Jun. 10, 1991 and which designated the United States. BACKGROUND OF THE INVENTION The invention concerns a method for extracting a pacemaker lead whose electrode head has become embedded in a body organ such as the heart, by means of exerting a traction force on the distal lead end. A method frequently applied for removing nonfunctioning or infected pacemaker leads and their electrodes from the body is the so-called continuous traction method, whereby the lead with its electrode is exposed in the pacemaker pocket and is stressed for hours and days by a continuous traction force of a magnitude between 100 and 500 grams, until the electrode separates from the body organ tissue. A weight acts as traction load on the electrode by means of a cable. The disadvantage of this method is that the continuous traction method often needs to be applied for days, so that the patient is required to remain in bed, connected to the traction device. Another known method for extracting nonfunctioning or infected embedded pacemaker leads and their electrodes is by the use of a loop catheter, whereby a loop is advanced over the lead up to the electrode embedment site and is then attached to the electrode. Traction can then be applied directly to the electrode at the embedment site. A disadvantage of the prior art loop method is that a loop catheter should not be used in the case of infected pacemaker electrodes because germs may be carried into the heart as the loop catheter is advanced over the electrode. The use of the continuous traction method greatly affects the emotional and physical condition of the patient because of the enforced long bedrest. SUMMARY OF THE INVENTION The problem underlying the instant invention is to facilitate the extraction of implanted, nonfunctional or infected helical leads with their respective electrodes embedded in a body organ. The traction force required to extract the electrode is exerted directly at the embedment site, and infection of the organ by germ migration, such as may be caused by advancing the extraction device over the electrode lead as in the above mentioned loop method, is precluded. The extraction procedure according to the present invention provides a solution to this problem by the introduction of a thin extractor into the lumen of the helical lead up to the vicinity of the pacemaker electrode head, by the subsequent, tractionally secure connection of the extractor head to the wall of the helical lead, and the application of an individually exertable traction on the helical lead and its electrode until the electrode separates from its embedment site in the body organ. A novel aspect of the invention is that the extractor head is connected to the wall of the helical electrode lead by expansion of the extractor head to a diameter larger than that of the diameter of the lumen of the helical lead or coil. Modifications of the procedure may additionally consist in establishing the connection of the extractor head to the wall of the helical electrode lead by hooking or positively anchoring the extractor head into the lumen wall or by expanding the extractor head to a diameter which is larger than the lumen diameter and thereafter hooking or positively anchoring the extractor head into the lumen wall of the lead or coil. A further embodiment of the inventive method provides for considerably improved handling and more accurately locating the connection of the extractor head to the helical electrode lead wall since the attachment of the extractor head into the helical electrode lead wall is effected by relative displacement of a wire which is disposed inside an extractor shell. To prevent injuries to the body organ, or heart, in the case of overly embedded pacemaker leads or electrodes, and to enable the abortion of the extraction procedure at any time, another embodiment of the inventive method provides the option of releasing the extractor from the helical lead lumen. The connection between the wire and the extractor head can be severed once a predetermined traction force is exceeded. As a modification of this procedure, the wire may be released from the extractor head by twisting the wire and extractor head relative to each other about the helix axis. Additionally the connection between the extractor head and the wall of the helical electrode lead may be released by relative displacement of the internal wire, in the axial direction of the helix, relative to the extractor shell. The procedures according to the invention provide considerable relief for the physician while sparing the patient physical and emotional discomfort. The extraction of embedded electrodes according to the invention is also performed with greater safety and simplicity, because unnecessary manipulations are avoided and because the need for expensive equipment is largely eliminated. As stated hereinabove, electrode heads are occasionally so firmly embedded in the heart that the extraction attempt must be aborted due to the risk of injury. In these cases, in accordance with the invention, the connection between the extractor and the helical electrode lead lumen is released and the extractor is removed. This may in certain cases not be readily managed, if the connection between the internal wire and the extractor head cannot be released. The Applicant has discovered that by rotating the extractor while it is connected to the wall of the helical electrode lead it is possible to release that extractor by twisting it out of the helical turns and thereby removing it completely from the helical electrode lead. When an internal wire is used, the internal wire is rotated in synchronism with the extractor shell to release the extractor from the helical electrode lead. The invention also provides a suitable apparatus to practice the inventive process. In one embodiment of the invention an extractor having an expandable, spreadable extractor head is provided which can be introduced into the lumen of the helical electrode lead. The extractor head includes at least two barbs which are spring biased radially outwardly so that, upon reversal of the direction of movement of the extractor, the barbs hook into the lumen wall. Another embodiment of the invention provides an extractor having an extractor shell. An extractor head is attached to an internal wire which is longitudinally movable within the extractor shell. This embodiment provides an apparatus which can be readily manipulated, since the internal wire allows the precise location and adjustment of the extractor head. In a first embodiment the extractor head is provided with at least two barbs which are arranged on an umbrella head and which can be spread out by relative displacement of the internal wire with respect to the extractor shell. In a second embodiment the extractor head includes a chamber for accommodating an umbrella head with at least two barbs secured thereto. The barbs can be spread out by the effect of spring bias. The barbs are released and spread out upon relative displacement between the chamber and umbrella head so that the barbs are forced out of the chamber. Lastly, according to a still further embodiment the umbrella head is detachably secured to the end of the interior wire. Still other variations and refinements of these various embodiments are possible based on one of the basic concepts of the invention, namely an extractor head, which will positively grip or hook into the inside wall of the helical electrode lead, to create a connection therewith so that a discrete traction force may be applied to the electrode lead in the immediate vicinity of the point of embedment of the electrode head in the body organ. By providing an internal wire in the extractor it is possible to selectively manipulate the extractor apparatus and thereby permit various embodiments of the invention which cause the extractor head to engage the inside wall of the electrode lead lumen in order to apply traction force at the desired point of the electrode lead. The extraction of an overly embedded electrode in the described way may at times fail due to the fact that the electrode is too firmly embedded in the body tissue. The extractor must then be extracted from the lumen. This can be accomplished according to the invention by rotating the extractor out of the helical turns of the electrode lead. A manually operated device is therefor provided at the tending end of the extractor or the extractor shell, to provide a torque thereto. As a variation thereof, the device may be fashioned in such a way that, in the region of the tending ends of the extractor and the internal wire, means are arranged for establishing a rotationally fixed connection between the extractor and internal wire. An additional option is to connect the tending end of the extractor and/or the internal wire to a motor for application of a torque. For the operation of the extractor apparatus a handle and a grip ring are provided which are respectively connected to the internal wire and the extractor shell. For synchronization of the rotary movement between the extractor shell and the internal wire, an additional provision may be that a rotationally fixed connection can be established between the extractor wire handle and the extractor shell grip ring. Furthermore, it may be suitable to provide the handle with a coupling device for the motor. BRIEF DESCRIPTION OF THE DRAWINGS Further characteristics and details of the invention will be explained with the aid of the embodiments illustrated in the following drawings, which respectfully show: FIGS. 1 shows the apparatus according to the invention, in partial cross-section, in its simplest embodiment as it is introduced in the helical electrode pacemaker lead electrically connected to a pacemaker electrode; FIG. 2 shows the apparatus according to FIG. 1 hooked into the helical electrode lead; FIG. 3 shows another embodiment of the apparatus, in partial cross-section, with the extractor being introduced into the helical electrode lead; FIG. 4 shows the apparatus according to FIG. 3 hooked into the helical electrode lead; FIG. 5 shows still another embodiment of the apparatus, in partial cross-section, as it is introduced into the helical electrode lead; FIG. 6 shows the apparatus according to FIG. 5 hooked in the helical electrode lead; FIG. 7 shows a simplified illustration of an embodiment of the apparatus as used with a motor drive for rotation and removal of the extractor; FIG. 8 shows a longitudinal cross-section of the apparatus of FIG. 7; and FIG. 9 shows the apparatus according to FIG. 7 together with a motor drive. Corresponding reference characters indicate corresponding parts throughout the several views. The exemplifications set out herein illustrate preferred embodiments of the invention, in one form thereof, and such exemplifications are not to be construed as limiting the scope of the invention in any manner. DETAILED DESCRIPTION OF THE INVENTION The embodiment of the extractor according to the invention, illustrated in FIGS. 1 and 2 shows, in a schematic illustration, the front region of the metallic helical electrode lead 10 of a cardiac pacemaker electrode and a component signified as extractor 3, which can be introduced into the lumen 4 of the helical electrode lead 10. While an electrode is commonly provided at the end of helical electrode lead 10 as is well known in the prior art, such an electrode as well as an insulation sleeve around lead 10 have not been shown in the drawings. Near the bottom end of the extractor 3, as shown in FIG. 1, an extractor head K is attached to a torsionally rigid internal wire 1 which for most of its length extends through an extractor shell 2 of extractor 3. Extractor shell 2 is fashioned as a tube which may be made of a suitable material such as metal or plastic. Two, three or four barbs 6 are provided on extractor head K. Extractor shell 2 has a length of approximately 70 cm and an outside diameter of about 0.4 mm. Wire 1 has a diameter of about 0.2 mm and, with extractor shell 2 retracted, protrudes about 1 cm out of the front end of the extractor shell 2. Extractor head K has a length of about 1.5 mm and consists of a thin section of tube which, starting from its rear end, is slit along a central plane. By slightly spreading the slit ends of the metal tube, spreading tongues or barbs 6 are formed. The free ends of barbs 6 protrude radially outwardly relative to the central axis of the umbrella shaped extractor head K. Upon insertion of the extractor head K into lumen 4 of cardiac pacemaker electrode lead 10, barbs 6 can be spread further in a simple way, namely by exerting a spreading force with the front edge 2&#39; of extractor shell 2 on barbs 6 by relative movement between the internal wire 1 and the extractor shell 2. By sliding the extractor shell 2 forward while holding the wire 1 stationary it is thus possible, by application of a thrust force on shell 2, to anchor the extractor head K into the end of the helical cardiac pacemaker electrode lead 10, so that embedded lead 10 as well as the electrode can be pulled out of the organ tissue of a patient. Anchoring of extractor head K can be accomplished at the desired location within electrode lead 10 by manipulating extractor 3 until head K is located at the desired location, such as near the point of embedment of electrode lead 10 and its electrode (not shown in FIG. 2). In another embodiment of the invention as shown in FIGS. 3 and 4 wherein extractor shell 2 extends up to extractor head K, barbs 6 tend to spread outwardly under the effect of a permanently acting spring biasing force. In that embodiment extractor head K and barbs 6 are formed integrally and may be molded from a plastic material. After introduction of umbrella head 5 into helical electrode lead 10 the free ends of barbs 6 contact its wall W. When the extractor head K has reached its final position near the site of embedment of helical electrode lead 10, grip ring 7 and extractor shell 2 which is attached thereto are moved in direction A opposite to the direction of introduction E. Barbs 6 thereupon hook into the lumen wall 4 of helical electrode lead 10 and wedge themselves in place, so that a traction force can be exerted on electrode lead 10. Extractor 3 is provided with a grip ring 7 and a handle 8 which has a grip hole 9 so that extractor 3 can be readily manipulated. The design also may be such that extractor head K with its umbrella head 5 is detachably connected to extractor 3. The connection is released when a predetermined traction force on umbrella head 5 is exceeded. The value of this predetermined traction force should be such that injuries to the patient at the point of embedment of the electrode in the patient&#39;s body are avoided. In operation extractor 3 is inserted into lumen 4 of helical pacemaker electrode lead 10 in the direction of arrow E. In the embodiment of FIGS. 1 and 2 extractor shell 2 is moved forwardly relative to wire 1 once umbrella head 5 has reached its desired position within lumen 4. The front edge 2&#39; of extractor shell 2 will then cause the free ends of barbs 6 of umbrella head 5 to spread radially outwardly and contact wall W of lumen 4. When handle 8 with wire 1 attached thereto is now pulled in the direction of arrow A as shown in FIG. 2, the free ends of barbs 6 will hook into wall W. Further traction on wire 1 will then tend to loosen pacemaker electrode lead 10 and its electrode from its point of embedment in the organ of the patient. If extractor 3 is so constructed that a predetermined force will disconnect umbrella head 5 from wire 1, a traction force in excess of the predetermined force will sever the connection between wire 1 and umbrella head 5 so that umbrella head 5 is left behind in the electrode lead 10 and no damage to the organ or injury to the patient will occur. In the embodiment of FIGS. 3 and 4, an umbrella chamber 11 is provided at the end of extractor shell 2. On the front end of wire 1 an umbrella head 5 with barbs 6 attached thereto is provided. A grip ring 7 is attached to the other end of extractor shell 2 whereas wire 1 is attached to handle 8. Movement of grip ring 7 and handle 8 toward each other causes wire 1 to be shifted relative to extractor shell 2 so that umbrella head 5 and barbs 6 slide out of umbrella chamber 1, thus allowing barbs 6 to unfold radially outwardly in umbrella fashion to contact lumen wall W. By reversing the movement between wire 1 and the extractor shell 2, the free ends of barbs 6 will meet resistance and hook into walls of lumen 4, thus establishing a positive connection between extractor 3 and electrode 10 and making it possible to pull electrode lead 10 as well as the electrode head at its end out of the organ by means of handle 8. A further modification is illustrated in FIGS. 5 and 6. The radial wall of umbrella chamber 11 is provided with slots 13 which are aligned with each of barbs 6. Barbs 6 are spring biased radially outwardly. The arrangement and design of slots 13 is such that, once the umbrella head 5 has reached its farthest forwardly advanced position in umbrella chamber 11 and wire 1 is subsequently moved backwardly relative to extractor shell 2, the free ends of barbs 6 will extend outwardly through slots 13 and contact wall W of lumen 4. Similarly to the operation shown in FIGS. 3 and 4, due to the contact of the free ends of barbs 6 with wall W, wall W is deformed and the free ends of barbs 6 will hook into helical electrode lead 10 as wire 1 is pulled by the operator. The retraction of extended barbs 6 can be brought about by relative displacement of wire 1 relative to extractor shell 2 in the opposite or backward direction as compared with the direction of pull, i.e., in the direction E as shown in FIG. 1. Such retraction of barbs 6 will cause them to be unhooked and released from contact with wall W. Extractor 3 may then be pulled out of lumen 4 and removed by pulling on the grip ring 7. Alternatively, the connection between wire 1 and umbrella head 5 maybe so constructed that head 5 will release from wire 1 upon exceeding a predetermined traction limit. While not illustrated in the drawings, handle 8 may be provided with a device such as a holding knob or groove, by means of which a rotationally fixed connection can be established between internal wire 1, grip ring 7, extractor 3, and handle 8. By using a suitable coupling, a motor can be connected to handle 8 in such a way that rotational torque will be transmitted to extractor 3 and wire 1. This makes it possible to withdraw extractor 3 and extractor head K from helical electrode lead 10 by rotation of extractor 3 about its longitudinal axis in screw fashion. A preferred embodiment of such an arrangement is illustrated in FIGS. 7, 8 and 9. As shown in FIG. 7 the outside diameter of extractor head K is smaller than the diameter of lumen 4 of a helical cardiac pacemaker electrode head lead 10. Extractor head K is attached to the front end of internal wire 1 which extends through extractor shell 2, and which, as compared to its actual length, is illustrated greatly shortened in FIGS. 7-9. As can be seen from FIGS. 7 and 8, extractor shell 2, which is fashioned as a thin tube, is provided with a grip 7&#39;. Grip 7&#39; consists of a sleeve 27 which is about 5 cm long and which includes knurls 28. Sleeve 27 is closed at its front end by closure 29. Closure 29 includes an axial bore in which extractor shell 2 is fastened and through which wire 1 extends. Wire 1 extends to connector 18 which is rotatable and axially movable inside sleeve 27. Wire 1 is joined to connector 18 by a weld 30 (FIG. 8). Located at the rear end of connector 18, as shown in FIG. 8, is a weld 31 for connecting pull wire 22 which serves to transmit traction force to connector 18, and thus via wire 1 to extractor head K. On the upper end of connector 18 a recess 32 is provided as shown in FIGS. 7, 8 and 9. Recess 32 allows a fixed coupling of connector 18 with chuck 19 of a drive motor 20 (FIG. 9). When the extraction device 3 illustrated in FIGS. 1, 2, 7, 8 and 9, is inserted into a lumen 4, extractor head K is first advanced into the immediate vicinity of the front end of electrode lead 10. Once the extractor head K is located at the desired location, grip 7&#39; is advanced while connector 18 is held back. This relative movement of grip 7&#39; and connector 18 causes a spreading force to be exerted by way of extractor shell 2 on extractor head K, thereby causing the free ends of barbs 6 to engage with and hook into wall W of helical electrode lead 10. Once a good connection between head K and helical electrode lead 10 has been established, electrode lead 10 and the electrode may be released from the organ by pulling on connector 18. The traction force may also be applied via pull wire 22, which has a length of about 1 m and is fashioned as a sturdy metal strand with a plastic coating. If removal of the pacemaker electrode lead 10 and the electrode from the patient&#39;s body fails, pull wire 22 is cut off at the upper end of connector 18 and the upper end of connector 18 is assembled in chuck 19 of drive motor 20 (FIG. 9). A ball provided in chuck 19 locks into recess 32. The drive motor 20 allows rotation of connector 18 clockwise or counterclockwise, depending on the direction of rotation of the helix of the electrode lead 10. The rotation of the connector 18 is transmitted via wire 1 on extractor head K, so that barbs 6 can be unthreaded from the coils of helical electrode lead 10. Since the number of turns of the helical electrode lead 10 is very large, the speed of rotation of drive motor 20 is selected so that extraction 3 can be rotated out of pacemaker electrode lead 10 in a relatively short time. Thus, in case of a failed extraction attempt to remove an electrode it is possible to easily completely remove the extractor from the body of the patient. While this invention has been described as having a preferred design, the present invention can be further modified within the spirit and scope of this disclosure. This application is therefore intended to cover any variations, uses, or adaptations of the invention using its general principles. Further, this application is intended to cover such departures from the present disclosure as come within known or customary practice in the art to which this invention pertains and which fall within the limits of the appended claims.

Summary: The invention relates to a method and apparatus for extracting a pacemaker electrode whose electrode head has become embedded in the heart. An extractor including an elongated hollow shell, a wire which is located therein and which is movable relative to the shell, and an extractor head attached to the end of the wire. The extractor head includes spreadable barbs, the free ends of which can be spread out radially outwardly to hook into the wall of the lead of the embedded electrode. The extractor head is inserted into a lumen of a pacemaker electrode lead. When the wire is pulled the barbs will hook into the lumen wall. A handle is attached to the other end of the wire for exerting a pulling force on the electrode lead and the electrode when it has become firmly engaged with the umbrella head whereby the electrode will be dislodged from the heart.

big_patent

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Military Health Services Improvement Act of 2005''. SEC. 2. FINDINGS. Congress finds the following: (1) More than 160,000 United States servicemembers are serving their country in Operation Enduring Freedom and Operation Iraqi Freedom. (2) There currently are more than 100,000 activated National Guard and reserve component forces engaged in the war on terrorism. (3) According to the Department of the Army, nearly one in six soldiers who have served in Operation Iraqi Freedom suffers from post-traumatic stress disorder. (4) More than 900 soldiers have been evacuated from Iraq since the beginning of Operation Iraqi Freedom because of mental health problems. (5) The stigma associated with mental health treatment remains a significant obstacle to seeking mental health care. (6) Untreated post-traumatic stress disorder and other mental health illnesses have been linked to severe social problems, including alcohol and drug abuse, domestic violence, child abuse, familial disintegration, and homelessness. SEC. 3. PRE- AND POST-DEPLOYMENT SCREENING PROGRAM FOR MEMBERS OF THE ARMED FORCES. (a) Pre- and Post-Deployment Evaluations.--Not later than 180 days after the date of the enactment of this Act, the Secretary of Defense shall prescribe in regulations-- (1) a requirement that members of the Armed Forces deploying to a combat theater receive a mental health evaluation conducted in person by a qualified mental health professional before their deployment; and (2) a requirement that members of the Armed Forces returning from service of more than 30 days in a combat theater or who were injured in a combat theater receive a combat stress evaluation conducted in person by a qualified mental health professional within 30 days after the date on which the member returns from the combat theater. (b) Mental Health Awareness Program.-- (1) Program.--The Secretary of Defense shall implement a program designed to-- (A) raise awareness about mental health issues that members of the Armed Forces and their families may encounter during and after deployment of the member; and (B) reduce the stigma associated with mental health care. (2) Implementation.--The Secretary, pursuant to regulations, may enter into arrangements with an accredited college, university, hospital-based, or community-based mental health center to carry out the program under this subsection. The Secretary shall ensure that the program is made available in foreign languages if necessary to aid comprehension among persons to be helped by the program. (3) Deadline.--The Secretary shall carry out this subsection not later than 180 days after the date of the enactment of this Act. (c) Hold-Harmless for Mental Health Treatment.--In carrying out any mental health-related program, the Secretary shall ensure that neither the provision of mental health services nor inquiries about mental health services shall adversely affect an individual's career. SEC. 4. MENTAL HEALTH AWARENESS FOR DEPENDENTS. (a) Program.--Not later than one year after the date of the enactment of this Act, the Secretary of Defense shall develop a program to improve awareness of the availability of mental health services for, and warning signs about mental health problems in, dependents of members of the Armed Forces whose sponsor served or will serve in a combat theater during the previous or next 60 days. (b) Matters Covered.--The program developed under subsection (a) shall be designed to-- (1) increase awareness of mental health services available to dependents of members of the Armed Forces on active duty; (2) increase awareness of mental health services available to dependents of Reservists and National Guard members whose sponsors have been activated; and (3) increase awareness of mental health issues that may arise in dependents referred to in paragraphs (1) and (2) whose sponsor is deployed to a combat theater. (c) Toll-Free Number.--In carrying out this section, the Secretary of Defense shall establish a toll-free informational telephone number and website devoted to helping members of the Armed Forces and their dependents recognize, and locate treatment providers for, post- traumatic stress disorder and other forms of combat stress. (d) Coordination.--The Secretary may permit the Department of Defense to coordinate the program developed under subsection (a) with an accredited college, university, hospital-based, or community-based mental health center or engage mental health professionals to develop programs to help implement this section. (e) Availability in Other Languages.--The Secretary shall ensure that the program developed under subsection (a) is made available in foreign languages if necessary to aid comprehension among persons to be helped by the program. SEC. 5. IMPROVED COORDINATION BETWEEN THE DEPARTMENT OF DEFENSE AND THE DEPARTMENT OF VETERANS AFFAIRS. (a) Memorandum of Understanding.--Not later than 180 days after the date of the enactment of this Act, the Secretary of Defense and the Secretary of Veterans Affairs shall enter into a memorandum of understanding to improve the transition of mental health-related cases from the Department of Defense to the Department of Veterans Affairs. (b) Matters Covered.--The memorandum of understanding under subsection (a) shall specifically include requirements-- (1) that the Department of Defense report to the Department of Veterans Affairs any case or suspected case of post- traumatic stress disorder, or other disorders or symptoms that result from deployment to a combat theater, in a member of the Armed Forces upon the member's discharge from the Armed Force; and (2) that the Department of Defense report to the Department of Veterans Affairs any disciplinary measures taken against a member of the Armed Forces during or after service in a combat theater upon the member's discharge from the Armed Forces. (c) Report.--Not later than one year after the date of the enactment of this Act, the Secretary of Defense shall submit to Congress a report on the implementation of this section. SEC. 6. CLEARINGHOUSE FOR INFORMATION RELATING TO COMBAT STRESS TREATMENT PROFESSIONALS. Not later than 180 days after the date of the enactment of this Act, the Secretary of Defense shall create an information clearinghouse to improve the availability of information about mental health professionals who treat combat stress. SEC. 7. AVAILABILITY OF MENTAL HEALTH SERVICES UNDER TRICARE FOR CERTAIN RESERVE MEMBERS AFTER DEACTIVATION. The Secretary of Defense shall prescribe regulations to provide for the availability of mental health services under the TRICARE program under chapter 55 of title 10, United States Code, for an eligible member of a reserve component of the Armed Forces and the family members of the member, during the 24-month period following the date of termination of the member's service in the reserve component. In this section, a member of a reserve component is eligible if the member was called or ordered to active duty for a period of more than 30 days under a provision of law referred to in section 101(a)(13)(B) of title 10, United States Code, and who served continuously on active duty for 90 or more days in a combat zone pursuant to such call or order. SEC. 8. DEFINITION. In this Act, the term ``qualified mental health professional'' means-- (1) an accredited psychologist, psychiatrist, child psychiatrist, psychiatric nurse, or clinical social worker; or (2) a student seeking a post-graduate degree in one of the following mental health-related fields: psychiatry, psychology, psychiatric nursing, or clinical social work.

Title: To require pre- and post-deployment mental health screenings for members of the Armed Forces, and for other purposes Summary: Military Health Services Improvement Act of 2005 - Directs the Secretary of Defense to prescribe a requirement that members of the Armed Forces: (1) deploying to a combat theater receive a pre-deployment mental health evaluation conducted by a qualified mental health professional; and (2) returning from service of more than 30 days in a combat theater, or injured in a combat theater, receive a post-deployment combat stress evaluation conducted by a qualified mental health professional. Directs the Secretary to implement a program designed to: (1) raise awareness about mental health issues that members may encounter during and after deployment; and (2) reduce the stigma associated with mental health care. Directs the Secretary to develop a program to improve awareness of the availability of mental health services for, and warning signs about mental health problems in, dependents of members who served or will serve in a combat theater during the previous or next 60 days. Requires such program to include a toll-free number and informational website. Directs the Secretary: (1) and the Secretary of Veterans Affairs to enter into a memorandum of understanding to improve the transition of mental health-related cases from the Department of Defense (DOD) to the Department of Veterans Affairs (VA); (2) to create an information clearinghouse to improve the availability of information about mental health professionals who treat combat stress; and (3) to provide for the availability (for a two-year period) of mental health services under the TRICARE program (a DOD managed health care program) for reserve personnel who performed certain active duty (and their family members).

billsum

en

Summarize: Health Tennessee Will Now Criminally Charge Pregnant Women Who Use Drugs CREDIT: Shutterstock Tennessee Gov. Bill Haslam (R) has approved a measure that will allow Tennessee to bring criminal charges against pregnant women who use drugs for potentially harming their fetuses, even though there isn’t conclusive scientific evidence that being exposed to illicit drugs in the womb causes long-term harm to children. The governor’s approval of the legislation comes despite a massive outcry from reproductive rights and criminal justice groups across the country, who say that criminalizing pregnant women is the wrong policy approach. Threatening to bring charges against women who are struggling with substance abuse dissuades them from coming forward to seek the medical treatment they need. It’s also a policy that disproportionately harms low-income and non-white women. “Today, the Tennessee governor has made it a crime to carry a pregnancy to term if you struggle with addiction or substance abuse,” Alexa Kolbi-Molinas, a staff attorney with the ACLU Reproductive Freedom Project, said. “This deeply misguided law will force those women who need health care the most into the shadows. Pregnant women with addictions need better access to health care, not jail time.” In a statement accompanying his signature on the bill, Haslam claimed that he had “extensive conversations with experts including substance abuse, mental health, health and law enforcement officials” and will “be monitoring the impact of the law through regular updates with the court system and health professionals.” But most experts — including the American Medical Association, the American Academy of Pediatrics, the American College of Obstetricians and Gynecologists, and the American Public Health Association — oppose efforts to arrest pregnant women who use drugs. Medical professionals are concerned about women getting the prenatal care they need, since skipping out on those services actually leads to a greater risk of miscarriage, stillbirth, and infant death. Specialists in obstetric medicine and drug addiction called on Haslam to veto the measure. Although drug possession and drug sales can result in criminal charges, states typically do not arrest people simply for using drugs. Addiction is considered to be a medical issue, and under the Constitution’s definition of cruel and unusual punishment, states aren’t allowed to criminalize those types of disorders. But Tennessee is making an exception for pregnant people. “Do we arrest new fathers who come into the emergency room who test positive for drugs? This is not really about arresting pregnant women because they use drugs. This is arresting women because they became pregnant, making them vulnerable to charges of child endangerment for risking harm to a newborn,” Lynn Paltrow, the executive director of National Advocates for Pregnant Women (NAPW), one of the groups that’s been fighting against the criminalization of pregnant women for years, told ThinkProgress in an interview earlier this month. Two years ago, Tennessee barred the use of criminal charges against pregnant women for using drugs, opting to encourage drug-addicted women to enter treatment. Advocates are frustrated that the state is backtracking on that policy, which they supported. “Now we’re seeing the General Assembly take two big steps back,” Farah Diaz-Tello, a staff lawyer for NAPW, recently told the New York Times. “It’s going from a state with some of the best practices to one of the worst.” Buy Photo Dr. Stephen Patrick, right, and Michael Botticelli, deputy director of the White House Office of National Drug Control Policy, take a close look at a baby inside the NICU on Monday while touring the Monroe Carell Jr. Children’s Hospital at Vanderbilt University. (Photo: Jae S. Lee, The Tennessean)Buy Photo Tennessee women who use drugs while pregnant can be criminally charged for harm done to their infants beginning July 1. Gov. Bill Haslam signed the legislation Tuesday after "extensive conversations with experts including substance abuse, mental health, health and law enforcement officials," he wrote in a statement. "The intent of this bill is to give law enforcement and district attorneys a tool to address illicit drug use among pregnant women through treatment programs." The governor's decision comes after a week of mounting nationwide opposition from civil and reproductive rights groups. They argued that criminalization would drive vulnerable women away from drug addiction treatment. "I understand the concerns about this bill, and I will be monitoring the impact of the law through regular updates with the court system and health professionals," Haslam wrote. Simple Answer: What's best for babies born to drug-addicted mothers? The law brings back criminalization, which lawmakers had eliminated two years ago as the state moved toward programs that incentivize expecting mothers to get into treatment. Tennessee officials have wrestled with what to do about the growing numbers of infants born dependent on drugs and who often suffer from a condition known as neonatal abstinence syndrome. The legislation would allow mothers to avoid criminal charges if they get into one of the state's few treatment programs. Haslam said he wants doctors to encourage women to get into treatment before delivering their babies so they can avoid charges. The proposal also includes an unusual sunset provision, which means the criminal penalty will be in effect until 2016. At that time, lawmakers will have to revisit the issue. Opponents, including five national medical organizations and local doctors who treat pregnant women, worry that criminalization will scare women away from treatment and reverse last year's Safe Harbor Act, which protected the custody rights of mothers and gave them priority placement into the state's limited number of treatment programs. The director of the American Civil Liberties Union of Tennessee — joined by the national ACLU — said she was "extremely disappointed" by the governor's decision. "A pregnant woman struggling with drug or alcohol dependency will now be deterred from seeking the prenatal care she needs," said Hedy Weinberg. Abuse of prescription painkillers has fueled a tenfold increase in such births in the past decade, sending health officials scrambling. There were 921 drug-dependent births in 2013 and 253 so far this year. Reach Tony Gonzalez at 615-259-8089 or on Twitter @tgonzalez. MOMS AND DRUGS 921: The number of drug-dependent births in Tennessee in 2013 253: The number of drug-dependent births so far this year. The legislation would allow mothers to avoid criminal charges if they get into one of the state's few treatment programs. Read or Share this story: http://tnne.ws/1kqiiEn Public Health Tennessee Bill Could Send Addicted Moms To Jail itoggle caption Katie Collins/PA Photos/Landov Pregnant women addicted to illegal narcotics or prescription pain pills could soon be jailed in Tennessee under a bill awaiting the governor's signature. The strict proposal enjoys bipartisan support — despite objections from doctors. The medical term for what happens when a newborn has withdrawal symptoms a day or two after birth is "neonatal abstinence syndrome." At its worst, these babies suffer from seizures; it's not clear whether there might also be lasting effects. Tennessee last year forced every hospital to start reporting such cases, and the numbers have only been going up. As health officials have made drug-dependent babies a priority, the Legislature has taken a more punitive approach. "It's always somebody else's fault," says state Rep. Terri Lynn Weaver. "What's wrong with: 'You screwed up, you're wrong, you've got to pay the consequences.' What's wrong with that?" It's always somebody else's fault.... What's wrong with: You screwed up, you're wrong, you've got to pay the consequences? Weaver initially wanted to make it possible to charge women with homicide if their drug-dependent newborn died, but ultimately she had to tone it down. The women would now have the option to seek treatment. "We can't make her get help herself," says Weaver, "but, by golly, we can give her an option and a choice." Weaver is a conservative Republican, but Democrats jumped on board too. State Rep. John DeBerry admits it seems unnatural to punish a pregnant woman for harming her unborn child. "We are always trying to save children who should be saved by their families, and I have said if there is a better way, bring it to me," he says. "I haven't seen it yet." In some other states, prosecutors have gone after addicts whose newborn dies, trying to charge them with murder. Farah Diaz-Tello of the National Advocates for Pregnant Women points to a case in Mississippi. "What Tennessee is doing is creating a law that would permit this kind of prosecution — not for murder," says Diaz-Tello, "but it would allow for reckless endangerment, which is a misdemeanor, all the way up to aggravated assault." And an assault charge could mean 15 years behind bars for the mother. Being a poorly controlled diabetic is terrible for pregnancy — probably equally as bad as drug addiction — and we don't legislate those choices. New mother Jackie Bains has returned to a Nashville women's clinic for a checkup. Her son is 7 weeks old and perfectly healthy. Bains says she was hooked on narcotic pain pills when she found out she was pregnant — but she got help. She says it was hard to tell people, but it would have been even harder if she thought she could be punished for her addiction. "I mean, some people are worried about going to jail and what it could do. But then you also have to worry about what it would do to the baby, too," she says. "I do think it will deter people from wanting to come in to seek help." It's a concern that worries many in the medical community — that the punitive approach, even with its treatment option, will drive away women or encourage more abortions. Jessica Young, an obstetrician at Vanderbilt University Medical Center who specializes in drug treatment during pregnancy, says lawmakers don't fully understand that addiction can be a sickness. "Being a poorly controlled diabetic is terrible for pregnancy — probably equally as bad as drug addiction — and we don't legislate those choices," says Young. "I just think this is an easy group to pick on because addiction has such a stigma." Tennessee Gov. Bill Haslam, a relatively moderate Republican, has been hearing from women's groups around the country asking him to veto the bill, but he says he's comfortable with the final language, given that a woman always has a way to avoid jail time, even after giving birth to a child going through drug withdrawal.

Summary: Starting July 1, if you're pregnant and use drugs while living in Tennessee, you can be charged with a crime for causing harm to your unborn baby. Gov. Bill Haslam signed the controversial law yesterday, the Tennessean reports. Civil and reproductive rights groups had opposed it, saying it would scare women away from getting treatment for drug addiction, but Haslam said he talked to "experts including substance abuse, mental health, health, and law enforcement officials" before signing the legislation, and will closely monitor its impact. Critics also say the law disproportionately affects low-income and non-white women, ThinkProgress notes. Using drugs while pregnant was previously criminalized in the state, but decriminalized two years ago as lawmakers moved toward programs encouraging pregnant women to get treatment. But the law is back as the number of babies born dependent on drugs is on the rise. Pregnant drug users can avoid criminal charges if they enter a treatment program, and Haslam is asking doctors to encourage women to enter treatment programs before delivery to avoid being charged. If they don't enter treatment, women charged under the law could face as many as 15 years in jail, NPR reported last week.

multi_news

en

Summarize: An ultra-conservative Jewish newspaper has digitally removed female politicians from an iconic image of world leaders marching through Paris, following last week's terror attacks. Israel's The Announcer airbrushed out German Chancellor Angela Merkel and Paris Mayor Anne Hidalgo - and cropped the front-page picture to completely exclude Danish Prime Minster, Helle Thorning-Shmidt. It's believed the women were removed from the historic image, taken on January 11, so the newspaper would not offend its highly devout Orthodox readers. Scroll down for video. Remembrance: The original picture, taken on January 11, shows all three female leaders marching in Paris. Removed: The altered picture on the front page of Israeli newspaper, The Announcer, excludes German Chancellor Angela Merkel and Paris Mayor Anne Hidalgo - while only the hand of Danish Prime Minster Helle Thorning-Shmidt makes the picture. 'Airbrushed out': This before and after picture shows how the three women, Helle Thorning-Shmidt (below, left), Anne Hidalgo (below, centre) and Angela Merkel (below, right) were digitally removed from the photo. Swiss President, Simonetta Sommaru, has been left as a blur behind a crowd of faces, while the EU's foreign affairs and security chief, Frederica Mogherini, was left out entirely. The women were among 40 world leaders who lined arms with their male counterparts to lead a million people through Paris, in a statement of international solidarity following the Charlie Hebdo massacre. Six of the magazine's journalists, killed by two masked gunmen, were among 17 innocent people to lose their lives in a wave of terror attacks in Paris last week. French newspapers have blasted The Announcer's 'hypocritical' front page, which they believe disrespects 'the unity of the march'. One reader in Israel said: 'They are not protecting women from leering men, or men from illicit thoughts. They are telling their community that women have no place in society outside the home. Very sad and very disturbing.' Three years ago, another orthodox Jewish newspaper, Di Tzeitung, sparked anger in the US by removing then Secretary of State, Hillary Clinton, from a 2001 image of the White House situation room during the raid which killed Osama Bin Laden. While The Announcer - known in Hebrew as HaMevaser - has refused to print the names of female members of the Israeli parliament. Solidarity: The female politicians were among 40 world leaders taking part in a march through Paris. Deleted: Danish Prime Minister, Helle Throning-Shmidt (right) - seen here with French President Francois Hollande - was one of the female leaders digitally removed from the image. 'Hypocrisy': Paris' own mayor, Anne Hidalgo (right), was airbrushed out of the images as her city mourned 17 deaths in a wave of terror attacks. German Chancellor, Angela Merkel (pictured, centre), seen here at a community rally condemning the Paris terror attacks, was removed from the iconic image. It has allegedly defended the removal of Angela Merkel and other women leaders from this week's front page for'reasons of modesty' and its stance not to depict women in the media. According to another Israeli publication, Haaretz, removing women from such pictures is nothing new. They also claim that Israeli parties representing the ultra-orthodox electorate openly ban women from running for the Knesset - and female images are completely absent from media outlets and advertisements aimed at that demographic. The photograph's manipulation was first spotted by a regional reporter on the Hebrew news website, Walla, who said: 'The paper didn't blur out Merkel's image or white it out, but completely re-edited the photograph and moved the images of the participants around, so that you could never tell that Merkel was ever there.' The Announcer was founded by Meir Porush, a former member of the ultra-orthodox United Torah Judiasm party

Summary: German Chancellor, Angela Merkel, one of the woman digitally removed. Paris Mayor and Danish Prime Minister also edited out by The Announcer. Allegedly altered its front page so as not to offend 'ultra-orthodox' readers. Israeli newspaper says the women were removed for'reasons of modesty' They were among 40 world leaders who led a million people through Paris. 17 innocent people died last week in wave of terror attacks on the city.

cnn_dailymail

en

Summarize: A Saturday Night Live sketch written and performed by one of the team’s recently hired black female writers has come in for sharp criticism from an editor at African American magazine Ebony who labelled the ‘slave draft’ routine an ‘embarrassment.’ The sketch, performed by Leslie Jones during Saturday’s Weekend Update spot, started with the news that Oscar-winning actress Lupita Nyong’o had recently been named People magazine’s ‘World’s Most Beautiful.’ Jones then joked about her own dating woes and admitted that while she wasn’t as attractive as Nyong’o by current standards, her six foot stature wouldn’t have been a problem in the days of slavery. Scroll down for video. Ashamed? SNL performer Leslie Jones has come in for sharp criticism on social media platforms following her'slave draft' routine on Saturday night. One of the harshest critics of Jones' routine was Ebony.com senior editor Jamilah Lemieux who was quick to tweet her disapproval. ‘See, I’m single right now, but back in the slave days, I would have never been single. I’m six feet tall and I’m strong,’ she joked. ‘I mean, look at me, I’m a mandingo... I’m just saying that back in the slave days, my love life would have been way better. Massah would have hooked me up with the best brotha on the plantation… I would be the No. 1 slave draft pick.’ The sketch attracted much commentary on Twitter, with significantly more negative than positive comments using hashtags including #LeslieJones. 'Shame on you #LeslieJones U combined all the disgusting stereotypes about black women & insulted your enslaved ancestors at the same time,' said Torchy Brown. Video: Saturday Night Live. Ebony.com senior editor Jamilah Lemieux, right, said she was appalled and embarrassed by SNL writer and performer Leslie Jones, left, after her'slave draft' sketch was broadcast on Saturday night. One of the harshest critics was Ebony.com senior editor Jamilah Lemieux, who tweeted ‘This Leslie Jones person is an embarrassment @msmarypryor. I'm so appalled right now.’ Moments later she tweeted 'So the Lupita moment had to be counteracted by a Black woman acting like a big loud monkey? Just...wow.' Jones took to Twitter on Sunday to answer her critics. ‘If anybody should be offended it's white folks cause it’s what they did,’ she tweeted. ‘Y’all so busy trying to be self righteous you miss what the joke really is. Very sad I have to defend myself to black people. 'Now I’m betting if Chris Rock or Dave [Chappelle] did that joke or jay z or Kanye put in a rap they would be called brilliant. 'Cause they all do this type of material. Just cause it came from a strong black woman who ain’t afraid to be real y’all mad.’ During the sketch Jones joked about being single and how her six foot stature wouldn't have been a problem in the days of slavery. Jones ones took to Twitter on Sunday to answer her critics who she accused of being self righteous. ‘So here is my announcement black folks, you won’t stop me and Im gonna go even harder and deeper now. 'Cause it’s a shame that we kill each other instead of support each other. This exactly why black people are where we are now cause we too f***** sensitive and instead of make lemonade out of lemons we just suck the sour juice from the lemons. Wake up.’ Not content with voicing her disapproval on social media, Lemieux has also written an article on Ebony.com criticizing the sketch entitled Once Again No One Is Laughing At SNL. According to Lemieuz, Jones should be ashamed of herself, the program’s director and producers have shown poor judgement and a similar routine which sought to make light of the Jewish holocaust won never be aired. ‘Whether SNL will ever get it right when it comes to Black women remains to be seen, but I'm even more curious to know when Leslie Jones will get it right for herself - and our ancestors,’ she wrote. Jones was one of two black female writers to join the show in January, along with performer Sasheer Zamata, as the long running comedy program sought to counteract criticism about a lack of diversity on the show

Summary: Leslie Jones' SNL sketch about how she would have fared better at dating during slavery times has come in for some sharp criticism. Ebony senior editor Jamilah Lemieuz has labelled the routine an 'embarrassment' After watching it she tweeted: 'So the Lupita moment had to be counteracted by a Black woman acting like a big loud monkey? Just...wow' Jones has defended her routine, calling her critics'self-righteous' and saying that a male comedian or rapper wouldn't be criticized like this. In an article on Ebony.com Lemieuz has said Jones should be ashamed of herself and the show wouldn't have broadcast a holocaust-based routine.

cnn_dailymail

en

Write a title and summarize: Mechanically gated ion channels convert sound into an electrical signal for the sense of hearing. In Drosophila melanogaster, several transient receptor potential (TRP) channels have been implicated to be involved in this process. TRPN (NompC) and TRPV (Inactive) channels are localized in the distal and proximal ciliary zones of auditory receptor neurons, respectively. This segregated ciliary localization suggests distinct roles in auditory transduction. However, the regulation of this localization is not fully understood. Here we show that the Drosophila Tubby homolog, King tubby (hereafter called dTULP) regulates ciliary localization of TRPs. dTULP-deficient flies show uncoordinated movement and complete loss of sound-evoked action potentials. Inactive and NompC are mislocalized in the cilia of auditory receptor neurons in the dTulp mutants, indicating that dTULP is required for proper cilia membrane protein localization. This is the first demonstration that dTULP regulates TRP channel localization in cilia, and suggests that dTULP is a protein that regulates ciliary neurosensory functions. The auditory system allows animals to communicate and obtain information about their environment. The hearing organs transform sound into an electrical signal through a process called mechanotransduction, the conversion of a mechanical force impinging on a cell into an intracellular signal [1]. Although the recent discovery of several molecules involved in mechanotransduction allows interpretation of the biophysical properties of the mechanotransduction process for hearing [2], many additional molecular players in auditory development and function are waiting to be unveiled. Drosophila melanogaster has been suggested as a model organism to study the fundamental process of hearing [3], [4]. Hearing in the fly is necessary for the detection of courtship songs [5]–[7]. Male-generated courtship song causes females to reduce locomotion and enhances female receptivity, whereas it causes males to chase each other [8]. The ability to hear courtship songs is ascribed to Johnston' s organ (JO) in the second antennal segment. Near-field sounds rotate the sound receiver; the third antennal segment and the arista and this rotation of the antennal receiver transmits mechanical forces to the JO in the second antennal segment, which is connected to the third antennal segment by a thin stalk [9]. Each JO sensilla consists of two or three chordotonal neurons and several supporting cells. The outer dendritic segments of the JO neurons are compartmentalized cilia which are directly connected to the antennal sound receiver via extracellular caps. The distortion of the junction between the second and third segment stretches the cilia and stimulates the JO neurons. Several transient receptor potential (TRP) channels have been shown to be required for Drosophila hearing transduction and amplification [4], [10]–[14]. Mutation in nompC, the Drosophila TRPN channel, resulted in substantial reduction of sound-evoked potentials [4]. Reports showing that NompC and TRP-4 (the C. elegans ortholog of NompC) are bona fide mechanotransduction channels support the idea that NompC is the Drosophila hearing transducer [15], [16]. Two Drosophila TRPV channel, inactive (iav) and nanchung (nan), mutants showed complete loss of sound-evoked action potentials [11]. However, they have not been considered to be the hearing transduction complex per se; rather they are thought to be required to amplify the electric signal generated by the hearing transduction complex, since Iav and Nan reside in the proximal cilia which are distant from the distal cilia where NompC is localized and mechanical force is directly transmitted [17], [18]. A recent study which employed a new method to measure subthreshold signals from the JO neurons suggested the opposite possibility that the TRPV (Iav and Nan) complex is the hearing transduction complex modulated by TRPN (NompC) [14]. Although the exact roles of each TRP in Drosophila hearing are still controversial, it is clear that TRPN and TRPV have essential and distinct roles in Drosophila hearing. Several attempts have been made to identify molecular players regulating the function of the ciliated mechanoreceptor neurons. Gene expression profiling identified chordotonal organ-enriched genes from campaniform mechanoreceptors, developing embryo chordotonal neurons, and the second antennal segment [19]–[21]. Alternatively, chordotonal neuron-specific genes were identified by searching for regulatory factor X (RFX) -binding sites, because ciliogenesis of the chordotonal neurons mainly depends on the RFX transcription factor [22]. However, so far only a limited number of genes involved in TRP channel localization in the JO neuron cilia have been identified and characterized, including axonemal components and intraflagellar transports (IFTs) [17], [23]. IFTs are indispensable for the formation and maintenance of cilia as well as for the transport of proteins along the microtubules in and out of the cilia [24]–[26]. Therefore, mutation of many of the characterized genes results in not only delocalization of the TRPs but also profound structural abnormality in cilia, rendering it difficult to delineate the gene functions specific to TRP localization. Tubby is the founding member of Tubby-like proteins (TULPs) [27]. Loss-of-function of the Tubby gene exhibits adult-onset obesity, retinal degeneration, and hearing loss in mice. The Drosophila genome encodes one Tubby homolog called King tubby (hereafter designated dTULP), which shares approximately 43% amino acid identity with mouse Tubby (Figure S1A) [28]. At the embryonic stage, dTULP is expressed in various types of neuronal cells including the chordotonal neurons. Although previous expression analyses and bioinformatic approaches detected dTulp in the chordotonal organs, its presence did not attract much interest because of its distribution in various neuronal cell types [22]. In this study, we aimed to investigate the novel molecular function of dTULP in Drosophila hearing. dTULP is localized to the well-defined ciliary structure of Drosophila auditory organs. Loss of dTULP has no effect on the ciliary structure of the JO neurons, but NompC and Iav localization in cilia was severely altered. These data demonstrate a new role of dTULP as a regulator of TRP localization in the hearing organs. To test whether dTULP plays a role in Drosophila hearing, we generated two dTulp mutant alleles by ends-out homologous recombination [29]. The first allele was dTulp1, which harbours a deleted C-terminal containing the conserved “tubby domain” (residues 220 to 460; Figure 1A). The second allele, dTulpG, was generated by replacing an N-terminal portion of the dTULP coding region (residues 18 to 261; Figure S1B) with GAL4 coding sequences at the site corresponding to the initiation codon of the short splicing variant of dTulp. Genomic PCR analyses showed that the dTulp genomic locus was deleted in dTulp1 and dTulpG flies (Figure 1B and Figure S1B). We raised antibodies to dTULP, which recognized a 51 kDa protein as predicted in wild-type fly extracts on a Western blot, and confirmed that dTULP was not detected in dTulp1 and dTulpG fly extracts (Figure 1C). Both alleles are homozygous viable and fertile. Since both dTulp1and dTulpG mutant alleles showed postural problems and uncoordinated movement, we performed a climbing assay. Flies were banged down to the bottom of a vertical tube and the percentage of the flies climbing above half of the height of the vertical tube within 10 seconds was recorded as the climbing index. dTulp1, dTulpG, and transheterozygote flies exhibited a decreased climbing index compared to control flies (Figure 1D). Introduction of a P[acman] clone containing the dTULP coding region (CH321-59C17) in the dTulp1 mutant background rescued this phenotype [30]. These data suggested that dTulp mutants may have functional defects in the JO neurons [13]. To check for hearing defects in dTulp mutant flies, we recorded extracellular sound-evoked potentials in wild-type and dTULP-deficient flies. Sound-evoked potentials were completely abolished in dTulp1, dTulpG, and dTulp1 in trans with a deletion that completely removed dTulp, Df (2R) BSC462. Genomic rescue using the P[acman] clone produced sound-evoked potentials similar to those in the wild-type, suggesting that the hearing defect was specifically due to dTulp ablation (Figure 1E and 1F). To test whether dTULP is expressed in the JO neurons, we first attempted to take advantage of the GAL4/UAS system using the dTulpG allele. However, the GAL4 reporter inserted in dTulpG was not expressed. This may be caused by inserting GAL4 at the site corresponding to the initiation codon of the short splicing variant of dTulp rather than the long splicing variant. Therefore, we performed immunohistochemistry with dTULP antibodies. We found that dTULP was expressed in the cilia as well as the cell body of the chordotonal neurons (Figure 2A, left). We did not detect dTULP immunoreactivity in the JO neurons in dTulp1flies, indicating that the immunosignal is specific for dTULP (Figure 2A, right). To further characterize the ciliary localization of dTULP, we compared the localization of dTULP with that of Iav and NompC. The subcellular localization of Iav and NompC are in the proximal and distal cilia, respectively, in a mutually exclusive manner (Figure 2B) [11], [17], [18], [31]. dTULP staining extended from the proximal to distal cilia with a much weaker signal observed in the distal portion (Figure 2C and 2D). The mouse Tubby protein has been reported to shuttle from the plasma membrane to the nucleus upon Gq-coupled G protein-coupled receptor (GPCR) activation [32]. dTULP was also detected in the cell body as well as the nucleus in the JO neurons (Figure 2A and Figure S7B). We also found that dTULP was expressed in other types of sensory neurons with cilia (Figure S2). To examine whether the dTulp mutants have developmental defects in the JO neuron structure, we observed the expression of a membrane-targeted GFP (UAS-mCD8: GFP) driven by the pan-neuronal promoter (elav-GAL4) in the JO neurons. We found no gross structural abnormalities in dTulp1flies (Figure 3A). Electron microscopy of the JO revealed that most dTulp mutants had normal ciliary ultrastructure (Figure 3B). Approximately 9. 3% of chordotonal scolopidia appeared abnormal in terms of cilia number or cap-cilia connections (Figure S3). In addition, we did not observe any discernible changes in the expression of the dendritic cap protein NompA, which transmits mechanical stimuli to the distal segment of chordotonal neurons in dTulp mutants (Figure 3C) [33]. These observations suggest that structural changes in the JO cannot account for severe hearing impairment in dTulp mutants. Mutations of trps, including iav and nompC, cause hearing defects in Drosophila [4], [11]. To investigate the possibility that dTULP controls the expression of TRPs and other genes which are indispensable for Drosophila hearing, we performed quantitative PCR analysis of such genes and no significant differences in expression levels were present between wild-type and dTulp1 antennae (Figure S4). This suggested that dTULP plays other roles in Drosophila chordotonal neurons rather than as a transcription factor that controls transcription of known hearing related genes, although we cannot exclude the possibility that dTULP regulates the expression of hearing related genes we did not survey. Next we examined the ciliary localization of Iav and NompC in the dTulp mutants. Surprisingly, Iav was not localized to the proximal cilia in dTulp1 flies (Figure 4A). Furthermore, NompC, characteristically localized to the distal cilia (Figure 2B), was redistributed toward the proximal cilia (Figure 4B). Spacemaker (Spam) is an extracellular protein which protects cells from massive osmotic stress [34]. Localization of Spam was also altered in dTulp mutants from its two typical locations: the luminal space adjacent to the cilia dilation and the scolopidium base (Figure 4C) [35]. Introduction of the dTulp+ transgene rescued the localization of Iav, NompC, and Spam (Figure 4). IFTs are involved in the localization of Iav, NompC, and Spam [17], [23]. Because IFT mutants show similar phenotypes to the dTulp mutant, we investigated the localization of IFT proteins in dTULP-deficient flies. Ciliary localization of the two IFTs, NompB (the ortholog of human IFT-B, IFT88) and RempA (the ortholog of human IFT-A, IFT140), was unaffected in dTulp1 mutants (Figure S5). To further address the functional relationship between dTULP and IFTs, we examined distribution of dTULP in three IFT (nompB, rempA, and oseg1) mutants and a retrograde motor dynein heavy chain (beethoven) mutant. Although the rempA, oseg1, and beethoven mutants show different degrees of defective cilia structure, dTULP is localized to the deteriorated cilia of each mutant, suggesting that rempA, Oseg1, and beethoven are not required for the transport of dTULP into the cilia (Figure S6A–S6C). Since the nompB mutant does not develop cilia structure, dTULP was present in the inner segment at a high level (Figure S6D) [36]. However, it is possible that other IFTs may play a role for dTULP ciliary localization even though the IFTs we examined are not involved in ciliary localization of dTULP. Mammalian Tubby have two distinct domains: nuclear localization signal (NLS) and phosphoinositide (PIP) -binding domain. An NLS, which allows Tubby to translocate into the nucleus, resides in the N-terminal region of Tubby [32]. Recently, a short stretch of amino acids including the NLS in TULP3, a mammalian member of the Tubby-like protein family, has been reported as an IFT-A binding domain [37]. A PIP-binding domain in the C-terminal tubby domain allows Tubby to be localized under the inner leaflet of the plasma membrane through binding to specific phosphoinositides. These domains are also conserved in dTULP (Figure 5A). In order to investigate the mechanism by which dTULP regulates the ciliary localization of Iav and NompC, we introduced mutations into the putative NLS/IFT-binding (dTULPmutA), PIP-binding domain (dTULPmutB), or both domains (dTULPmutAB) of dTulp cDNA and generated UAS-wild-type dTulp (UAS-dTulpwt), UAS-dTulpmutA, UAS-dTulpmutB, and UAS-dTulpmutAB transgenic flies, respectively. To eliminate positional effects, all transgenes were integrated into the same loci using site-specific recombination with an attP landing site on the third chromosome [38]. To test the effect of each mutation on the subcellular localization of dTULP, we examined the subcellular localization of dTULPwt, dTULPmutA, and dTULPmutB in Drosophila salivary glands. dTULPwt was detected mainly in the plasma membrane and nucleus (Figure S7A). Mutations in the NLS/IFT-binding domain or PIP-binding domain of dTULP resulted in significant exclusion from the nucleus or accumulation in the nucleus, respectively, which suggested that the NLS/IFT-binding and PIP-binding properties of mouse Tubby are conserved in dTULP in Drosophila salivary glands (Figure S7A). However, the localization of dTULPwt, dTULPmutA, and dTULPmutB in the JO neurons in terms of the cell body and nuclear distribution was virtually the same (Figure S7B). These data suggested that dTULP is not shuttled between the plasma membrane and the nucleus in the JO neurons and these domains may have other functions in the JO neurons rather than controlling the translocation of dTULP from the plasma membrane to the nucleus. To evaluate the functional consequences of each mutation, we expressed dTULPwt, dTULPmutA, dTULPmutB, or dTULPmutAB in the JO neurons of dTulp1 flies. The expression of dTULPwt in the dTulp mutant background restored the distribution and the expression level of Iav and NompC similar to those of wild type (Figure 5B and 5C). The expression of dTULPmutA or dTULPmutB rescued the Iav trafficking defect of the dTulp mutant, but the expression levels of Iav in the proximal cilia in dTULPmutA- or dTULPmutB-expressing flies were reduced compared to those of dTULPwt-expressing flies (Figure 5B and 5E). NompC localization to the distal cilia in dTULPmutA- or dTULPmutB-expressing flies was similar to that in dTULPwt-expressing flies (Figure 5C). dTULPmutAB could not rescue the Iav or NompC localization defects of the dTulp mutant. This difference was not due to the expression levels of the mutant dTulp transgene since the expression levels of mutant forms of dTULP were similar to those of wild-type dTULP (Figure S8). Next, we examined whether the different degrees of rescue of Iav and NompC localization was due to differential ciliary trafficking of variant forms of dTULP. The ciliary expression level of dTULPmutB was similar to that of dTULPwt, whereas the ciliary expression levels of dTULPmutA and dTULPmutAB were reduced compared with those of dTULPwt (Figure 5D and 5F). These data suggested that the putative NLS/IFT-binding domain of dTULP has a regulatory function to control the trafficking of dTULP into the cilia. Consistent with immunohistochemical analyses, dTULPwt fully rescued the hearing defect of the dTulp mutant. dTULPmutA and dTULPmutB restored a partial function and dTULPmutAB had no such activity (Figure 5G and 5H). In the current study, we demonstrate that dTULP is a cilia trafficking regulator in the Drosophila hearing system. Mutation of dTulp results in hearing loss due to the mislocalization of two TRP channels, Iav and NompC, which are ciliary membrane proteins. In addition, Spam, whose localization is dependent on the IFT machinery, is also mislocalized in dTulp mutants. How does dTULP regulate the ciliary distribution of TRPs in the JO neurons? Several studies have shown that mutations in IFT machinery or cilia components result in mislocalization of Iav, NompC, and Spam, along with abnormal axonemal structure [17], [23]. It is notable that, in contrast to IFT or cilia component mutants, ciliogenesis and maintenance appear normal in dTULP-missing flies. Furthermore, the altered distribution of Iav, NompC, and Spam in dTulp mutants was not due to the mislocalization of IFT proteins, since the localization of two IFTs (NompB and RempA) was normal in dTulp mutants (Figure S6). These data suggest that dTULP acts downstream of the IFTs to regulate TRP localization. Even though the mutation of dTulp affected the trafficking of both Iav and NompC, the compartmentalized ciliary localization of Iav and NompC is differentially regulated by dTULP. An individual mutation in either the putative IFT- or PIP-binding domain reduced Iav expression levels in cilia, whereas NompC localization was not altered until both domains were mutated. Even after the double mutations in both domains of dTULP, NompC is still situated inside the cilia, but in abnormal locations. These findings demonstrate that ciliary entry of NompC is not dependent on dTULP while the distal ciliary localization of NompC is dependent on dTULP. One possibility is that dTULP allows NompC to disengage from the IFT complex at the distal cilia so that NompC is enriched in the distal cilia through the mechanism that required both IFT- and PIP-binding domains. It is also possible that the distal ciliary localization of NompC is regulated by an unidentified factor (s) whose ciliary localization is dTULP-dependent as is Iav. Both the putative IFT- and PIP-binding domains play important roles in the proper Iav distribution in cilia, but they appear to have different roles. Even though the IFT- or PIP-binding mutant forms of dTULP could only partially rescue the ciliary levels of Iav to the similar extent, the mutation of the IFT-binding domain reduced the ciliary levels of dTULP while disruption of the PIP-binding domain had no effect on the ciliary levels of dTULP. These findings suggest that two domains play distinct roles in the regulation of the ciliary localization of Iav. The IFT-binding domain is the motif required for the ciliary entry for dTULP, and the PIP-binding domain is not related to dTULP ciliary entry itself, rather it affects recruitment of Iav-containing preciliary vesicles to dTULP. By these two linked steps, Iav localization to cilia would be facilitated by dTULP. In mammals, IFT-A directs the ciliary localization of TULP3 through physical interaction between TULP3 and the IFT-A core complex (WDR19, IFT122, and IFT140), and in turn, promotes trafficking of GPCR to the cilia. Indeed, the depletion of individual IFT-A core complex components affects the ciliary localization of TULP3, which results in the inhibition of GPCR trafficking to the cilia [37]. It appears that dTULP and TULP3 have the similar molecular mechanisms to regulate ciliary membrane proteins. However, unlike TULP3, dTULP ciliary access is not dependent on IFT-A. dTULP ciliary trafficking was not affected by the mutation of Oseg1 (an ortholog of human IFT-A, IFT122) or rempA (an ortholog of human IFT-A, IFT140). Furthermore, the presence of dTULP in cilia did not determine the normal localization of Iav. For example, in the rempA mutant, even when dTULP was localized to the cilia (Figure S6B), Iav was not found in cilia [23]. Taken together, dTULP facilitates the relay of preciliary vesicles to the IFT complex at the base of cilia rather than moving together with ciliary membrane proteins into the cilia as an adaptor between IFT and cargo. dTULP may have other additional roles in cilia, which needs to be explored in the future. Based on our finding that dTULP but not Iav could be found in cilia of IFT mutants, it is also possible that recruitment of Iav-containing preciliary vesicles requires dTULP and additional unknown factors, whose function is altered in IFT mutants. Thus, Iav-containing preciliary vesicles may not be able to form stable interactions with dTULP and IFTs. After the cloning of the Tubby gene two decades ago, one promising hypothesis has been that Tubby is a transcription factor, since Tubby translocates to the nucleus upon GPCR activation and the N-terminal region of Tubby has transactivation potentials [32], [39]. However, candidate target genes for Tubby have not been identified. Tubby is thought to have additional functions including vesicular trafficking, insulin signaling, endocytosis, or phagocytosis [40]–[43]. It is still not clear how these molecular functions lead to the in vivo phenotypes observed in the tubby mouse. Meanwhile, several studies have hinted at possible connections between the phenotypes of tubby mutant mice and ciliary dysfunction. Tubby mice phenotypes comprise syndromic manifestations that are commonly observed in ciliopathies such as Bardet-Biedle syndrome [44] and Usher syndrome [45], [46]. Recently, GPCR trafficking into neuronal cilia was reported to be misregulated in tubby mice [47]. Mutation of Tulp1, a member of the TULPs, in human and mice, exhibits retinal degeneration due to the mislocalization of rhodopsin [48]. TULP3 represses Hedgehog signalling, which is a crucial signalling cascade in cilia, via the regulation of the ciliary localization of GPCRs [49]. Our current study provides additional supports for the idea that TULPs play an important role in ciliary signalling and that the tubby mouse syndrome might be due to the ciliary defects. In contrast to mammalian cells, only specialized cell types have the ciliary structure in Drosophila, and the expression of dTULP is not restricted to organs with the ciliary structure, which suggested that dTULP may have other roles not related to the ciliary function [28]. For example, dTULP mediates rhodopsin endocytosis in Drosophila photoreceptor cells which do not have cilium in contrast to its mammalian counterpart [50]. In summary, we demonstrate an intriguing role of dTULP in governing the ciliary localization of TRP proteins. This is the first in vivo evidence showing that dTULP may have important roles in the maintenance of ciliary functions by regulating the localization of ciliary proteins, thereby maintaining sensory functions. All fly stocks were maintained in regular laboratory conditions (conventional cornmeal agar molasses medium, 12-h light/12-h dark cycle at 25°C, 60% humidity). Iav-GFP and NompA-GFP were reported previously [13], [33]. RempA-YFP and NompB-GFP were from M. Kernan. Y. Jan and M. Noll provided UAS-NompC: GFP and Poxn-GAL4, respectively. Df (2R) BSC462, elav-GAL4, UAS-mCD8: GFP, AB1-GAL4, F-GAL4, and Orco-GAL4 were from the Bloomington Stock Center (Bloomington, IN). We employed ends-out homologous recombination to generate dTulp mutant alleles. To make the dTulp1 allele, 3 kb genomic DNA at the 5′ and 3′ ends of the tubby domain (220 to 460 residues) coding sequence was PCR amplified from w1118 and subcloned into the pw35 vector. The primer sequences for the 5′ homologous arm of the pw35 vector are 5′-AAAGCGGCCGCCACCGGTGACATCCTCATGTTC-3′ and 5′-AAAGCGGCCGCGTTGCATCACGAACTGGTCGATATTG-3′. The primer sequences for the 3′ homologous arm of the pw35 vector are 5′-TGAGCTGGCTGGGATCCTCGGGTTGG-3′ and 5′-GTGGATCCTTCCTGGTTGGCATCACGTTGAC-3′. To generate the dTulpG allele, we used the pw35GAL4loxP vector in which GAL4 and white are flanked by loxP sequences so the cassette can be removed by introducing Cre recombinase. We subcloned the 3 kb of genomic DNA from each of the 5′ and 3′ ends of the dTULP coding region (18 to 261 residues) into the pw35GAL4loxP vector. The primer sequences for the 5′ homologous arm of the pw35GAL4loxP vector are5′-ACAGATCTCACCGTCGCCTGGCTCAGTGCCC-3′ and 5′-GTGGTACCCAGCTGGCGCTGCAAAGCAGTTAAATC-3′. The primer sequences for the 3′ homologous arm of the pw35GAL4loxP vector are5′-AAAGCGGCCGCGTGGGTTATTGATAGTGATCCTCTA-3′ and 5′-AACCGCGGCGTACAGAATACTCCCTGTTCATGTCT-3′. We generated transgenic flies by germ line transformation (BestGene Inc., Chino Hills, CA) and screened for the targeted alleles as described previously [51]. Targeted alleles were subjected to outcross for five generations into a w1118 genetic background. We amplified dTulp cDNAs from cDNA clones (RE38560) with PCR and subcloned the fragments into the pUASTattB vector. These constructs were subjected to further modification. We generated the dTulpmutA and dTulpmutB mutant constructs using site-directed mutagenesis to change the sequence encoding R23QKR to L23AAA, and K292LR to A292LA, respectively. The dTulpmutAB construct was generated by introducing the mutation corresponding to dTulpmutB into the dTulpmutA construct. To generate genomic rescue transgenic flies, we obtained the BAC clones CH321-59C17 from the BACPAC Resource Center (Oakland, CA) and used these as genomic rescue constructs. Transgenic flies were generated using PhiC31 integrase-mediated transgenesis on the third chromosome to minimize position effect (Bloomington stock number 24749). Sound-evoked potentials were recorded as described by Eberl et al [4]. Briefly, the fly' s antennal sound receivers were stimulated by computer-generated pulse songs. Neuronal responses were detected using a recording electrode inserted in the junction between the first and second antennal segment and a reference electrode was inserted in the dorsal head cuticle. The signals were subtracted with a DAM50 differential amplifier (World Precision Instruments, Sarasota, FL) and digitized using Superscope 3. 0 software (GW Instruments, Somerville, MA). Each trace represents the average responses to 10 stimuli. For whole-mount staining, antennae were dissected at the pupa stage and the labellum and legs were prepared at the adult stage. Salivary glands were dissected from third instar larvae. For antenna sections, fly heads were embedded in OCT medium and 14 µm frozen cryostat sections were collected. Dissected tissues and sections were fixed for 15 min with 4% paraformaldehyde in 1× PBS containing 0. 2% TritonX-100 (PBS-T) and washed three times with PBS-T. The fixed samples were blocked for 30 min with 5% heat-inactivated goat serum in PBS-T and incubated overnight at 4°C in primary antibodies diluted in the same blocking solution. The tissues were washed three times for 10 min with PBS-T and incubated for 1 h at room temperature in secondary antibodies diluted 1∶500 in blocking solution. Following three washes with PBS-T, the samples were mounted with Vectashield (Vector Laboratories, Burlingame, CA) and examined using a Zeiss LSM710 confocal microscope (Jena, Germany). To quantify Iav-GFP and dTULP expression levels in cilia, all samples were prepared at the same time and all confocal images were obtained under the same conditions. The pixel intensity of each protein was measured using Zen Software (Jena, Germany). Iav-GFP intensity was measured without immunostaining. Rabbit dTULP antibodies were raised by injecting animals with a purified His-tagged dTULP fusion protein (residue 95–339), followed by affinity purification. The primary antibodies were used in immunohistochemistry at the following dilutions: rabbit anti-dTULP, 1∶400; 22C10,1∶200 (Hybridoma Bank, University of Iowa); 21A6,1∶200 (Hybridoma Bank); rabbit anti-Orco, 1∶1,000 (gift from L. Vosshall); rabbit anti-NompC, 1∶20; rabbit anti-GFP, 1∶1,000 (Molecular Probes, Eugene, OR); mouse anti-GFP, 1∶500 (Molecular Probes). The secondary antibodies used were Alexa 488-, Alexa 568-, and Alexa 633-conjugated anti-mouse or anti-rabbit IgG (Molecular Probes; 1∶500). DNA and actin were visualized by DAPI and Alexa Fluor 633 Phalloidin (Molecular Probes) staining, respectively. Fly head or antennae lysates from each genotype were subjected to electrophoresis on SDS-polyacrylamide gels and transferred onto polyvinylidene fluoride membranes. The membranes were blocked for 1 h with 5% nonfat milk plus 0. 1% Tween-20. Membrane-bound proteins were analyzed by immunoblotting with primary antibodies against dTULP (1∶1,000) and tubulin (Hybridoma Bank, 1∶2,000). Fly heads were dissected and fixed in 2% paraformaldehyde, 2. 5% glutaraldehyde, 0. 1 M cacodylate, and 2 mM CaCl2, pH 7. 4. The tissue was embedded in LR white resin. Thin sections were cut, mounted on formvar-coated single slot nickel grids, counterstained with uranyl acetate and lead citrate, and examined on a Hitachi H-7500 electron microscope (Hitachi, Tokyo, Japan). Total RNA was extracted from adult antennae using Trizol reagent (Invitrogen, Carlsbad, CA). cDNA was generated from 0. 5 µg of RNA from each genotype using the SuperScript III First Strand Synthesis System (Invitrogen). Quantitative PCR was performed using an ABI7500 real-time PCR machine (Applied Biosystems, Foster City, CA) and the ABI SYBR green system. Transcript levels were normalized to rp49 as an internal control and the ΔCT (CT = threshold cycle) method was used to calculate the relative amount of mRNAs. The primers used for qRT-PCR are listed in Table S1. Fifteen 3- to 6-day-old flies were placed in an empty fly food vial. The climbing index is the fraction of flies that climb halfway up the vials in 10 s after being tapped down to the bottom of the tube. We performed each experiment twice and used the average of the two trials to calculate the climbing index. Data shown are the mean ± SEM. To compare two sets of data, unpaired Student' s t-tests were used. ANOVA with the Tukey post-hoc test was used to compare multiple sets of data. Asterisks indicate statistical significance.

Title: dTULP, the Drosophila melanogaster Homolog of Tubby, Regulates Transient Receptor Potential Channel Localization in Cilia Summary: Tubby is a member of the Tubby-like protein (TULP) family. Tubby mutations in mice (tubby mice) cause late-onset obesity and neurosensory deficits such as retinal degeneration and hearing loss. However, the exact molecular mechanism of Tubby has not been determined. Here we show that Drosophila Tubby homolog, King tubby (dTULP), regulates ciliary localization of transient receptor potential protein (TRP). dTULP-deficient flies showed uncoordinated movement and complete loss of sound-evoked action potentials. dTULP was localized in the cilia of chordotonal neurons of Johnston' s organ. Two TRP channels essential for auditory transduction, Inactive and NompC, were mislocalized in the cilia of chordotonal neurons in the dTulp mutants, indicating that dTULP is required for proper cilia membrane protein localization. This is the first demonstration that dTULP regulates TRP channel localization in cilia, and thus provides novel insights into the pathogenic mechanism of tubby mice.

lay_plos

en

Summarize: RELATED APPLICATIONS This application is a continuation of U.S. patent application Ser. No. 09/800,074, filed Mar. 6, 2001, now issued as U.S. Pat. No. 6,558,416, which is a continuation of U.S. patent application Ser. No. 09/085,944, filed May 27, 1998, now issued as U.S. Pat. No. 6,283,993, which is a continuation of U.S. patent application Ser. No. 08/902,654, filed Jul. 30, 1997, now abandoned, which is a continuation of U.S. patent application Ser. No. 08/474,048, filed Jun. 7, 1995, now issued as U.S. Pat. No. 5,683,402, which is a continuation of U.S. patent application Ser. No. 08/190,755, filed Feb. 2, 1994, now issued as U.S. Pat. No. 5,496,336, which is a divisional of U.S. patent application Ser. No. 08/004,214, filed Jan. 13, 1993, now issued as U.S. Pat. No. 5,290,300, which is a continuation of U.S. patent application Ser. No. 07/739,925, filed Aug. 2, 1991, now abandoned, which is a continuation-in-part of U.S. patent application Ser. No. 07/387,909, filed Jul. 31, 1989, now abandoned, and a continuation-in-part of U.S. patent application Ser. No. 07/444,189 filed on Nov. 30, 1989, now issued as U.S. Pat. No. 5,041,130. BACKGROUND OF THE INVENTION During surgical repair of an organ or other body part, the surgeon typically makes an incision to open the organ. Upon closure of the surgical wound, sutures are placed in the various layers of tissue to draw the two edges of the wound together so that the healing process can reform a smooth and competent surface. However, sutures often tear through the tissue if they are subjected to stress, thus damaging the surgical closure of the wound. It would be desirable in many instances to have a means for lending permanent support to strengthen and support the wall of the organ into which the surgical incision has been placed. Alternatively, in many instances it would be preferred to have a biodegradable suture guide. In many cases, the incision is not a straight line, but is shaped to conform to an anatomical requirement, making it difficult for the surgeon to balance the tension on the sutures to form the desired shape. In a number of instances the suture line is substantially curvilinear and it is of utmost importance that the suture line maintain a predetermined dimension. For example, when two blood vessels, or other vessels, such as intestines, are sutured together, the need exists for some means of preventing the suture line from constricting the vessel so as to create a potential point of blockage. Similar problems arise during bowel and bronchial resection. As another example, when the surgeon is reducing the size of a stomach by surgical means, the need exists for a means to assure that the reshaped organ will have a particular circumferential dimension and that the pleats used to reduce the size of the organ are evenly distributed so as to avoid formation of areas of reduced flexibility along the suture line. In other situations, such as in cosmetic surgery, the surgeon may desire to assure that the suture line is limited to a predetermined length. In all of these situations, it is desirable to use a suture guide to aid the surgeon in achieving the desired dimension of the surgical closure and/or to rigidly support the area where the sutures are placed, thus avoiding the danger that the sutures will tear through the tissue or that the suture line will act like a draw string and undesirably bunch up the tissue. These problems are particularly acute in the surgical procedure known as annuloplasty wherein any of a number of types of prostheses have been used in surgical correction of deformed mitral or bicuspid heart valves. Diseases and certain natural defects to heart valves can impair the functioning of the cusps of the valves in preventing regurgitation of blood from the ventricle into the atrium when the ventricle contracts. For example, rheumatic fever and bacterial inflammations of the heart tissue can distort or dilate the valvular annulus, thus resulting in displacement of the cusps away from the center of the valve and causing leakage of blood during ventricle contraction. Two techniques, generally known as annuloplasty, are used to reshape the distended and/or deformed valve annulus. In the technique known as “plication,” the circumference of the valve annulus is reduced by implanting a rigid or semi-rigid prosthetic ring of reduced circumference about the base of the annulus while the annulus is pleated to reduce its circumference to that of the ring. In the technique known as “reconstruction”, the circumference of the annulus is not reduced, but the annulus is restructured into an elongate shape. To accomplish this goal, a rigid or semi-rigid ring having the same circumference as the annulus but in an elongate or elliptical shape is surgically implanted about the base of the valve. Both plication and restructuring are intended to eliminate the gap in the closure of the distended valve by bringing back together the tips of the valve cusps. Many different types of prostheses have been developed for use in annuloplasty surgery. In general, prostheses are annular or partially annular shaped members that fit about the base of the valve annulus. Initially the prostheses were designed as rigid frame members, or “rings”, of metallic or other rigid materials that flex little, if at all, during the normal opening and closing of the valve. Since a normal heart valve annulus continuously flexes during the cardiac cycle, a rigid ring prosthesis interferes with this movement and thereby restricts movement of the valve itself. Sutures used to implant rigid ring prostheses consequently undergo stresses sufficient to tear the sutures loose. Examples of rigid annuloplasty ring prostheses are disclosed in U.S. Pat. No. 3,656,185, issued to Carpentier on Apr. 18, 1972; and U.S. Pat. No. 4,164,046, issued to Cooley on Aug. 14, 1979. Others have suggested the use of completely flexible annuloplasty ring prostheses. Examples of completely flexible ring prostheses are disclosed in U.S. Pat. No. 4,290,151, issued to Massana on Sep. 22, 1981, and are discussed in the articles of Carlos D. Duran and Jose Luis M. Ubago, “Clinical and Hemodymanic Performance of a Totally Flexible Prosthetic Ring for Atrioventricular Valve Reconstruction”, 5 Annals of Thoracic Surgery, (No. 5), 458-463, (November 1976) and M. Puig Massana et al, “Conservative Surgery of the Mitral Valve Annuloplasty on a New Adjustable Ring”, Cardiovascular Surgery 1980, 30-37, (1981). Flexible prostheses generally include an inner support member formed from a flexible material. This support member is wrapped in woven, biocompatible cloth material. Realignment of the valve cusps during opening and closing of the valve is obtained by the proper suturing of the ring about the valve annulus. However, completely flexible ring prostheses provide almost no support to the suture area during the precarious implant procedure. Even though the surgeon attempts to evenly distribute the sutures along the periphery of the valvular annulus, during implant the drawstring effect of the sutures tends to bunch the material covering the flexible ring so that the sutures also bunch together at localized areas around the ring. This phenomenon, known as multiple plications in the heart valve annulus, causes rigid areas around the annulus. Thus, the flexible ring actually ends by imparting areas of rigidity and thereby distorts the valve annulus during the opening and closing of the valve despite the desired reduction in circumference of the valvular annulus. To overcome some of the drawbacks of rigid ring prostheses, still further types of annuloplasty prostheses have been designed to allow for adjustment of the ring circumference, either by the surgeon during implant, or automatically as the implanted ring moves during the opening and closing of the valve. This type of adjustable prosthesis is typically designed in combination with a rigid, or at least partially rigid, frame. An example of a self adjusting ring prosthesis is taught in U.S. Pat. No. 4,489,446, issued to Reed on Dec. 25, 1984. To provide for self adjustment of the prosthetic annulus, two reciprocating rigid metal pieces form the frame. U.S. Pat. No. 4,602,911, issued to Ahnadi et al. and U.S. Pat. No. 4,042,979, issued to Angell on Aug. 23, 1977, provide further adjustable ring protheses having a mechanism for adjusting the circumference of the ring. But due to rigidity of the frame members, the self-adjusting prostheses do not overcome many of the disadvantages of other types of rigid ring prostheses. U.S. Pat. No. 4,055,861, issued to Carpentier on Nov. 1, 1977, teaches an annuloplasty ring prosthesis having a flexibility between the completely flexible rings discussed above and the various types of rigid ring. The ring of Carpentier is deformable to an equal degree and simultaneously in all directions and preferably has the elasticity of an annular bundle of 2 to 8 turns of a cylindrical bristle of poly(ethylene terephthalate). While rigid and semi-rigid annuloplasty rings eliminate the bunching caused by flexible rings, the restrictive nature of such rings is generally detrimental to the valve&#39;s ability to open and close normally. It thus remains an object of the invention to provide a surgical means for reshaping a deformed or dilated heart valve annulus having none of the above described drawbacks associated with known annuloplasty ring prostheses. For use in annuloplasty of heart valves, as in other applications, it is desirable that a suture guide be entirely flexible, light weight, and compliant while having sufficient strength to withstand stress placed upon the sutures sewn through and around it. However, an entirely flexible suture guide cannot prevent bunching of the tissue in the draw-string effect described above and thus cannot assure that the suture line and the tissue into which it is placed will maintain any desired dimension, for example, a desired circumference. Therefore the need exists for a means of temporarily providing rigidity and fixed dimension to the suture guide during the surgery, but rendering the suture guide freely flexible once the surgery has been accomplished. DESCRIPTION OF THE DRAWINGS The present invention may be better understood and the advantages will become apparent to those skilled in the art by reference to the accompanying drawings, wherein like reference numerals refer to like elements in the several figures, and wherein: FIG. 1 is a perspective exploded view of a flexible suture guide mounted on a rigid holder assembly in accordance with an embodiment of the invention. FIG. 1A is a top view in partial cross-section of a length of a flexible suture guide in accordance with the present invention. FIG. 1B is a top view in partial cross-section of the flexible suture guide of the present invention sutured into a ring configuration. FIG. 2 is an exploded view of the guide mount portion and lower part of the handle portion of the holder assembly of FIG. 1 without the suture guide. FIG. 3 is a perspective view of a flexible suture guide of the present invention mounted on the assembled guide mount and lower handle portions seen in FIG. 2. FIG. 4 is a cross-sectional view of the assembled guide mount and lower handle portions of FIG. 3 along line 4 — 4. FIG. 5 is a top view of the guide mount seen in FIG. 3 with a flexible suture guide tautly secured thereto. FIG. 6 is a perspective view of a guide mount in accordance with another embodiment of the invention. FIG. 7 is a cross-sectional view of a suture guide having a lenticular cross-sectional shape in accordance with another embodiment of the invention. FIG. 8 is a side perspective sectional view of a handle assembly in accordance with another embodiment of the invention. FIG. 9 is a bottom view of the handle extension of FIG. 8. FIG. 10 is a top view of the housing of FIG. 8. FIG. 11 is a perspective view of a suture guide holder in accordance with another embodiment of the invention. FIG. 12 is an exploded view of the guide mount portion and lower handle portion of the suture guide holder of FIG. 11. FIG. 13. is a top view of the guide mount portion of the suture guide holder of FIG. 11. FIG. 14 is a perspective view of a linear suture guide holder in accordance with another embodiment of the invention. FIG. 15 is a perspective view of the suture guide holder of FIG. 14 with a suture guide attached. FIG. 16 is a perspective view of a circular suture guide holder in accordance with another embodiment of the invention. FIG. 17 is a perspective view of the suture guide holder of FIG. 16 with a suture guide attached. FIG. 18 is a cross-sectional view of the suture guide and holder of FIG. 17 taken along line 18 — 18. SUMMARY OF THE INVENTION The present invention overcomes the above discussed disadvantages by providing an assembly for holding a substantially flexible suture guide in a substantially taut position for placing a suture line having a predetermined dimension. When attached to the holder assembly, the flexible suture guide assumes a shape or geometry, such as a circumference, that conforms to the shape or geometry of that portion of the body organ or vessel that is being sutured. The holder assembly can be formed to hold the suture guide in any desired shape, whether straight, curvilinear, or a combination of the two and the suture guide can be either biodegradable or permanently implantable. Thus the surgeon undertaking reconstructive surgery is aided in achieving a suture line of any desired shape, geometry and/or dimension. The assembly includes a holder portion having a surface against which the suture guide is positioned and held tautly in a fixed shape, geometry and/or dimension. More particularly, the holder assembly includes a body having an outwardly facing surface, generally flat, against which the suture guide is tautly positioned so that the suture guide assumes the shape, geometry and/or dimension desired for the suture line. Preferably, this surface is formed with at least one depression for receiving a portion of the suture guide. The assembly further includes a detachable handle and a mechanism for releasably binding the suture guide to the surface. The flexible suture guide used with the assembly of the invention comprises a generally elongated flexible body element having an internal flexible rib encased within a biocompatible covering, such as a woven cloth material. The suture guide can be formed of either biodegradable or non-biodegradable materials depending upon whether its purpose is to serve as a permanent support to prevent tearing out of the sutures placed through it or whether the suture-supporting function is to be a temporary one. In addition to its function as a post-surgical support for sutures, during surgery when used in combination with the holder disclosed herein, the suture guide serves as a rigid support and template by which the surgeon controls the length of the finished suture line. For instance, if the task is to suture together two ends of a bowel from which a section has been removed, the combination of suture guide and holder assure that the circumference of the surgical jointure is substantially similar to the circumference of the nearby regions of the colon, rather than smaller or larger. Therefore, the holder device is designed to lend a temporary rigidity or tautness to the suture guide while lending to it a shape selected to facilitate the suturing task. For instance, when the task is to place a line of sutures around the circumference of a curvilinear surface, the holder is designed to fit around at least a portion of the circumference while holding the suture guide against the said circumference to aid the surgeon in making a surgical jointure that does not distort the said circumference. In use, the suture guide is releasably retained against the outwardly facing body surface by a means for releasable attachment, for example one or more threads, pieces of Velcro™, and the like, placed so that the suture guide lies along and temporarily substantially assumes the shape of the body. The means for attachment may also be a biodegradable adhesive having the capacity to firmly attach the suture guide to the holder body for sufficient time to complete the surgery, but having the capacity to dissolve or be dissolved once the suture line has been placed. In one embodiment, the thread attaches the suture guide to the body surface at least at two points, for example at its extreme ends, by passing at least partially through the suture guide and about the body, i.e., by means of an in and out stitch or stitches. The means for releasable attachment of the suture guide to the body must be such that the suture guide can be released from the body once the suture line has been placed by the surgeon without disturbing the sutures sufficiently to cause dislocation or tearing of the sutures through the tissue. For example, if the means for releasable attachment is one or more threads, a portion of the thread(s) affixing the suture guide to the body can be positioned to be cut by scissors, or the like, to freely release the suture guide from the body. When the thread or threads are cut or otherwise ruptured, the suture guide is freely released from the body. DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention is directed to a holder assembly for holding a substantially flexible, implantable suture guide in a substantially taut position for suturing along a suture line having a desired shape or dimension, such as the desired circumference to which an enlarged heart valve annulus is to be reduced by the formation of pleats about the base of the valve annulus. The suture guide of the invention is formed from a freely flexible rib encased within a woven cloth covering. In use, the flexible suture guide of the invention is held taut by the holder assembly and in a configuration determined by the shape of the holder assembly while the surgeon uses the support provided by the taut suture guide to evenly place the sutures and to draw the tissue by means of the sutures passed through the suture guide into a suture line having a shape substantially similar to that of the suture guide and holder. For example, for use in annuloplasty, the holder assembly can be C-shaped so that the suture guide temporarily affixed thereto assumes a C-shaped configuration. The suture guide can then be sutured to the base of a heart valve annulus so as to restrict the circumference of a dilated and/or deformed valve annulus to a more normal one. When the suture guide is released from the holder, it will assume any shape that that portion of the body organ or vessel assumes in accordance with the dynamic function of the organ or vessel. Generally the guide mount assembly includes a guide support formed with a shape similar to that of the desired suture line, as in the above example wherein the holder assembly is in the general shape of the valve annulus about which the suture guide is to be surgically placed to assist in holding pleats in the walls of the annulus. The suture guide is mounted along at least a portion of this guide support, for example along a straight or a curved portion. The holder assembly allows the surgeon to properly position the suture guide while the suture guide is used to draw the sutures and associated tissue into the desired configuration during the suturing process. The freely flexible suture guide is given temporary rigidity during surgery by the detachable holder assembly, thus lending precision to the surgeon in controlling the placement and location of the stitches in the suture line. In an annuloplasty, for example, the potential for forming multiple plications as the circumference of the valve annulus is adjusted is thus greatly reduced. Referring now to FIG. 1A, the suture guide 10 is an elongate, flexible member of a predetermined dimension. Due to its flexibility, the length of suture guide 10 can be manipulated to assume any desired shape, ie., circular, C-shaped, straight, curvilinear or a combination of curvilinear and straight segments. In FIG. 1B, suture guide 10 is shown as shaped into a ring by suturing the two ends together with sutures 11. As shown in FIG. 1A, suture guide 10 comprises a substantially flexible inner rib 14 encased within covering 16. Rib 14 comprises a flat, rod-like or tubular piece of biocompatible resilient, flexible material, such as mylar or silicone rubber. Rib 14 can also contain a substance opaque to x-rays, for example, about 10 to 15 weight percent, preferably 13 weight percent, of barium sulfate so that the location of the suture guide can be determined in post-operative x-rays. The outer covering 16 is formed from any biocompatible material having sufficient strength to serve as an anchor to sutures without tearing and sufficient flexibility to be formed into a tight covering for rib 14 without restricting flexibility of suture guide 10. Preferably, the outer covering 16 is a woven cloth having a nap to encourage tissue ingrowth, for example a dacron velour. This outer covering 16 is tightly wrapped and sewn about frame 14 so as to completely encase it. The thickness of the outer cloth 16 is sufficient to allow the surgeon to pass a suture therethrough. FIG. 1 shows an exploded view of one embodiment of a holder assembly to which a suture guide is mounted, as seen generally at 12 and 10 respectively. The holder assembly 12 includes a guide mount assembly 18 and handle assembly 40 comprising a handle 42 and housing 44. FIGS. 2 through 5 illustrate in greater detail the guide mount assembly 18 and how the suture guide 10 is mounted thereon. Guide mount assembly 18 includes a guide support 20. For illustrative purposes, the suture guide assembly 18 here shown is one intended for use in plication of a distended heart valve annulus. Therefore facing edge of guide support 20 is generally C-shaped or annular, having a shape and circumferential dimension similar to that the surgeon desires to achieve in the human heart annulus by means of annuloplasty surgery. More particularly, support 20 is generally lenticular, having a C-shaped portion 28, with its ends connected by a straight side 30. The suture guide 10 is fitted into a groove or trough 32 located about the curved C-shaped portion 28 of the guide support 20 Trough 32 is dimensioned to receive a portion of the suture guide 10, as best seen in FIG. 4. The positioning of the suture guide 10 within the trough 32 conforms guide 10 to the shape of the guide support 20 while exposing a substantial portion of the covering 16 outside of the trough 32 to allow the surgeon to pass a suture therethrough. In the embodiment shown in FIGS. 2-5, the guide mount assembly 18 also includes a central support hub 22 to which the guide support 20 is attached by a multiplicity of integrally formed spokes, preferably three, one of which is seen at 24. The arrangement of mount assembly 18 including, in this instance, a curved guide support 20 with hub 22 and spokes 24, allows the surgeon to visually observe the heart valve during the suturing process. Central support hub 22 is formed with an annular groove 36. This groove 36 is formed proximate that end 34 of hub 22 opposite guide support 20, and defines a post member 38. That portion of hub 22 remaining on the side of the groove 36 opposite the guide support 20, and hub end 34, includes an inwardly tapering peripheral surface, as seen generally at 35. The hub 22 also includes an open bore 37 through which is fitted a cylindrical plug 39. The plug 39 is dimensioned to extend out from both sides of the bore 37. The purpose of tapered surface 35, and the plug 39 will be described hereinafter. As is further seen in FIG. 1, the handle assembly 40 includes an elongated handle 42 having end 54 mounted to housing 44. While housing 44 may be integrally formed at the end 54 of the post 42, preferably end 54 is formed with outwardly facing threads that threadably mate with threads formed along a surface of an opening 59 formed in the top of the housing 44. The opposite end of post 42 is formed with an external etched surface 52 to assist the surgeon in gripping post 42. In another embodiment, end 54 of post 42 and opening 59 of housing 44 can be formed so that end 54 can be press fit into opening 59. Housing 44 is a thimble-shaped structure having a circular wall 60 defining a cavity 46. As seen better in FIG. 4, cavity 46 is open at one side, seen generally as opening 45. The inner surface of the circular wall 60 inwardly converges a short distance from the opening 45. The cavity 46 is generally wide enough at the open side 45 to snugly receive hub 22, but the plug 39 extends sufficiently outward from hub 22 to prevent passage through open side 45 into cavity 46. Wall 60 is formed with two J-shaped notches, seen at 48 and 49 in FIGS. 2 and 3. These J-shaped notches 48 and 49 are formed and positioned to respectively receive the ends of the plug 39 extending outward from the hub 22. The shape of the notches 48 and 49 defines a landing 50 between the long and short legs of each notch. Handle assembly 40 is coupled to the guide mount assembly 18 by inserting end 34 of the hub 22 into the cavity 46, with one of the outwardly extending ends of the plug 39 passing through a respective one of the J-shaped notches 48 and 49. The tapered surface 35 of the hub 22 engages the inwardly tapering surface of the wall 60. This causes a slight compression of the hub end 34, resulting in a spring force. The spring force acts to restrain the movement of the outwardly extending ends of the plug 39 through the larger legs of the J-shaped notches 48 and 49. Additional exertion moves the ends of plug 39 through the larger legs of J-shaped notches 48 and 49, with rotation of handle 40 passing the outward ends of plug 39 across the landings 50 and into the smaller leg of the J-shaped notches 48 and 49. The spring force established by the slight compression of the hub end 34 maintains the coupling between housing 44 and guide mount assembly 18. The handle 40 is decoupled from the guide mount assembly 18 by reversing the described procedure. One embodiment of the means for releasably attaching suture guide 10 to guide support 20 of guide mount assembly 18 is seen in FIG. 5. Guide support 20 is formed with two apertures 66 and 68 extending through guide support 20 and communicating with groove 32. The exact positioning of apertures 66 and 68 is not critical. As illustrated, apertures 66 and 68 are formed along the straight portion of guide support 20, at a location proximate two of the spokes 24. One end 71 of a cord or suture thread 70 is passed through one of the apertures, as illustrated hole 66, and tied off on guide support 20. The other end 73 of suture 70 is passed through the body of suture guide 10 from one end to the other. This end 73 is then passed first through hole 68 and then through and tied off at hole 66. After suture guide 10 is sutured into position during surgery, i.e., about the valve annulus, that portion of the suture 70 between apertures 66 and 68 is snipped or cut in two. Suture 70 passes out of suture guide 10 by withdrawing the handle assembly 12. In accordance with another embodiment (not shown), the first end 71 is tied off at hole 66, with the second end 73 passed first through one end of the suture guide 10, and then brought back across and passed through the other end of suture guide 10, through hole 68 and again tied off at hole 66. Removal of suture 70 is accomplished by snipping the suture in two at any point between the two holes and withdrawing it. An alternative embodiment of the guide mount assembly 80 as seen in FIG. 6 includes a guide support 82 having an open C-shaped side 84 but no straight side joining the ends of the C. Except for the stated difference in shape of the guide support 82, guide mount assembly 80 in FIG. 6 includes elements similar to those described for the suture guide of FIG. 5 (as is indicated by the prime of the previously provided element number), and will be described in no further detail herein. In this embodiment of guide mount assembly 80, the means for releasably attaching the suture guide to the guide support is a suture (not shown) positioned by tying off as described above across an open space between holes 68 ′ and 66 ′ (not shown). In a preferred embodiment of the invention, the handle assembly 40 is tethered to the guide mount assembly 18. As seen in FIG. 1, this tethering is performed by connecting one end of a lanyard, seen generally at 100, to the handle assembly 40 and the other end of the lanyard 100 to the guide support 20, for instance to one of spokes 24. Lanyard 100 allows a surgeon to detach the handle assembly 40 from the guide support 20 during the suturing procedure to get a clearer view of the surgical site. By tethering handle 40 to the guide mount assembly 18, the risk of the surgeon leaving the guide support 20 in the patient after completion of the surgical procedure is greatly reduced. Lanyard 100 also allows the surgeon to easily remove the guide support 20 after the handle has been detached. In a still further preferred embodiment, a handle assembly 40 is modified to house a spool of suture or string that acts like a tether for the guide mount assembly. The tether is attached at opposite ends to the handle assembly and the guide mount assembly respectively and automatically spools out of the handle assembly when the handle is disconnected from the guide mount assembly. This preferred embodiment is better seen in the several FIGS. 8 through 10. The lower portion of a handle assembly in accordance with this embodiment is seen in FIG. 8 at 90. Handle assembly 90 includes a housing 92, a handle extension 94, and a handle post 96. Housing 92 includes a pair of opposing J-shaped notches 98 and 99 that function similarly to the J-shaped notches 48 and 49 described above. The handle extension 94 is fastened to the lower end of the handle post 96 in any suitable manner. As shown, the handle extension 94 includes at one end a bore 102 for receiving the lower end 104 of the handle post 96. End 104 of the handle post may be held in bore 102 by welding, stamping, or by providing the respective members with interlocking threaded surfaces. Accordingly, neither of these structures of the handle assembly 90 will be discussed in any greater detail. The main distinction to the previously described embodiment is that the handle assembly 90 is formed to carry a spool of suture, seen generally at 106. This suture spool 106 is housed in a bore 112 formed in the handle extension 94. Handle extension 94 and housing 92 are formed to releasably fit together. Handle extension 94 and housing 92 include mating collars 108 and 110, respectively. Collar 108 is formed with a groove 114 that receives a tongue 116 extending upward from collar 110. Tongue 116 is formed with a central aperture 122, and two opposing cut-aways 118 and 120 that extend out in opposite directions from this aperture 122. Each of the collars 108 and 110 possesses four apertures. Apertures 126 - 129 of collar 108 align with apertures 130 - 133 of collar 110 when the handle extension 94 and housing 92 are fitted together. Suture spool 106 comprises a length of suture wound into a cylindrical configuration along lower end 104 of handle post 96, which fits into bore 112. The opposite ends of this suture length are tied to the tongue 116 and the handle extension 94. One end of the suture is drawn through the central aperture of 122 and tied to tongue 116, as seen at 115. The opposite end of the suture is drawn through an opening 124 extending from the bore 112 through the handle extension 94 and is tied around the handle extension 94, as seen at 117. It should be noted that for the purpose of this invention, the meaning of the term “suture” shall include any cord, string or filamentous material useful for tethering the housing 92 to the handle extension 94. Handle extension 94 and housing 92 are fitted together by placing the tongue 116 into the groove 114. Sutures are run through aligned apertures to hold the handle extension 94 and housing 92 together. For example, one suture 134 is passed through apertures 126 and 127 of handle extension 94 and apertures 130 and 131 of housing 92, while a second suture 136 is passed through apertures 128 and 129 of handle extension 94 and apertures 132 and 133 of housing 92. The handle assembly 90 of this embodiment is coupled to the guide mount assembly 18 as stated above. The handle post 96 is removed from the housing 92 by cutting the sutures 134 and 136 and pulling the handle extension 94 away from the housing 92. Pulling away the handle post 96 unravels the suture spool 106. After the suture guide is sutured into position along the suture line, i.e., about a heart valve annulus, the suture(s) holding the guide mount assembly to the suture guide is cut. The guide mount assembly is then removed by pulling on the handle post 96. In another embodiment of the invention, shown in FIGS. 11-13, handle assembly 140 is also modified to house a spool of suture or string that acts like a tether for the guide mount assembly 142. Referring to FIG. 11, handle assembly 140, includes housing 144, handle post 146, and an enlarged handle portion 148. Handle post 146 is preferably made of a malleable metal or other material that allows the surgeon to bend the handle to the desired angle while using the suture guide holder assembly. The enlarged handle portion 148 allows the surgeon to grip the handle more easily and also makes it easier for the surgeon to maneuver the suture guide holder into the surgery site. Housing 144 is releasably attached to guide mount 150 as will be described in more detail with reference to FIG. 12. Suture guide 152 is releasably attached to guide mount 150 by threads or sutures (not shown) in a manner which will be described with reference to FIG. 13. Referring to FIG. 12, housing 144 includes bore 154 for receiving handle post 146. The end of handle post 146 may be held in bore 154 by a press fit or friction fit, by welding, or by providing the respective members with interlocking threaded surfaces. Housing 144 also includes a pair of opposing slots 156 for receiving dog ears 158 of the suture spool 160. Suture spool 160 includes a length of suture or thread 162 wound into a cylindrical configuration along spindle post 164. One end of the suture 162 is tied to an aperture (not shown) in upper end 166 of suture spool 160. The other end of suture 162 is affixed to hub 168 of guide mount 150. Specifically, suture 162 passes down through aperture 170, up through aperture 172, and is tied off at aperture 172. The lower end of spindle post 164 has a pair of opposing notches 174 formed therein which are sized to be received by bore 176 of hub 168. Spindle post 164, therefore, is press fit or friction fit into bore 176. Suture spool 160 is housed within the interior cavity (not shown) of housing 144 and is held in place when dog ears 158 snap fit into opposing slots 156. Housing 144 with suture spool 160 in place is then releasably attached to guide mount 150 by sutures or threads 178 and 180 shown in FIG. 11. Suture 180 passes through a pair of apertures 182 in housing 144 and a pair of apertures 184 in guide mount 150 as illustrated by dotted lines 186 in FIG. 12. Suture 178 passes through a pair of apertures 188 in housing 144 and a pair of apertures 190 in guide mount 150 as shown by dotted lines 192 in FIG. 12. Once the suture guide and guide mount assembly has been placed at the surgery site, the surgeon can remove the handle if desired by cutting sutures or threads 178 and 180 at the location of the cutting guides 194 and 196 shown in FIGS. 11 and 12. Cutting guides 194 and 196 consist of a raised platform with a shallow groove 195 formed therein through which the suture passes and a deeper groove 197 formed in the platform perpendicular to the shallow groove through which scissors or other cutting tools can be inserted to clip or cut the suture at that location. When the sutures are cut and the handle is removed, spool 160 remains within housing 144 and suture 162 remains attached to hub 168. As the handle is pulled away from the guide mount, the suture or thread spools off spindle post 164 thereby providing a tether for removal of the guide mount after the suture guide has been detached from the guide mount and the surgery has been completed. Referring to FIG. 13, suture guide 152 is releasably attached to guide mount 150 by sutures or threads 198, 200 and 202. Suture 198 is tied off at aperture 204 and then passes through one end of the suture guide and up through aperture 206 over cutting guide 208 down through aperture 206 again, through suture guide 152, through aperture 209, then up through aperture 210 where the other end of suture 198 is tied off. Suture 200 is at one end tied off through aperture 210 and then passes under the guide mount 150 through aperture 211, through suture guide 152 and up through aperture 212, across cutting guide 214 and back down through aperture 212. Suture 200 then passes through suture guide 152 again, through aperture 215 and up through aperture 216 where it is tied off. Finally, suture 202 is tied off at one end at aperture 216 and passes under suture guide 150 through aperture 217, through suture guide 152, up through aperture 218, across cutting guide 220, down through aperture 218 again where it passes through suture guide 152 and up through aperture 222 where it is tied off. Apertures 224 and 226 disposed in guide mount 150 at opposite ends of the suture guide 152 are used to temporarily attach each end of suture guide 152 to each end of the guide mount 150 to hold the suture guide in place during the process of threading sutures 198, 200 and 202 through the apertures of the guide mount and the suture guide. Once the threading of sutures 198, 200 and 202 is complete, the sutures at 224 and 226 are then removed. The sutures at 224 and 226 are shown for illustration purposes in FIG. 11 at 223 and 225. Referring to FIG. 13, cutting guides 208, 214 and 220 consist of a raised platform with a shallow groove 228 formed therein through which the suture passes and a deeper groove 230 formed in the platform perpendicular to the shallow groove through which a cutting tool may pass in order to cut the suture at the location lying over the deeper groove. The deeper groove is closed at one end by a stop 232 so that the tip of the cutting tool or scissors cannot pass beyond that point. This stop prevents the cutting tool from dipping down into the open space 234 between the spokes of guide mount 150 and accidentally cutting the tissue of the patient. When the surgeon is ready to release the suture guide from the suture guide mount 150 he merely snips the sutures 198, 200 and 202 by passing the cutting tool into the cutting groove of the cutting guides. When the sutures have been snipped at all three locations, the guide mount can be retrieved by pulling on the tether or otherwise removing it and sutures 198, 200 and 202 are removed with the guide mount 150 since they are tied off on the guide mount. Referring to FIGS. 14 through 18, there are shown two additional embodiments of suture guide holders for holding a suture guide. FIGS. 14 and 15 illustrate a linear suture guide holder for placing a linear suture guide. FIGS. 16, 17 and 18 illustrate a circular or ring-shaped suture guide holder for placing a circular suture guide. Referring to FIG. 14, the linear suture guide holder has a detachable handle 240 of the type shown in FIG. 2 and linear-shaped guide mount 242. However, the handle embodiment with the tether illustrated in FIGS. 8 and 12 could also be used. Guide mount 242 has a linear groove or trough 244 into which suture guide 246 is fitted as shown in FIG. 15. Apertures 248 formed in guide mount 242 are used to suture the suture guide to the guide mount as shown in FIG. 15. Guide mount 242 also includes cutting guides 252 and 254 at each end of the guide mount. Suture guide 246 is tautly secured to the linear guide mount 242 by suture 250. One end of suture 250 is tied off at aperture 248 a, passes through suture guide 246 up through aperture 248 b cross cutting guide 252 down through aperture 248 c through suture guide 246 up through aperture 248 d where it is tied to a second length of suture 256. Suture 256 is threaded down through aperture 248 e through suture guide 246 up through aperture 248 f across cutting guide 254 down through aperture 248 g through suture guide 246 and up through aperture 248 h where it is tied off. Thus, as in previous embodiments, when the surgeon is ready to release the suture guide from the suture guide holder, he merely inserts the cutting tool in the cutting grooves 252 and 254 and cuts sutures 250 and 256 at that location. Suture 250 and 256 are then removed with the suture guide mount 242. The linear suture guide shown in FIGS. 14 and 15 would be used for any surgical procedure in which the incision is a substantially straight line. The suture guide mount 242 can be any desired length and the suture guide 246 can extend the full length of the suture guide mount 242 as shown in FIG. 15 or could be of a shorter length and sutured to just a portion of suture guide mount 242. If the surgeon desires a suture guide with a hook or curved end, the suture guide could extend around the edge of suture guide mount 242 to provide one or two curved or hooked ends. Referring to FIG. 16, there is shown a circular suture guide holder which would be useful for suturing two blood vessels or other vessels, such as intestines, together. It would also be useful for bowel and bronchial resection. The suture guide holder has a handle 260 which in this embodiment is not shown to be detachable. However, any of the various handle embodiments illustrated previously could be utilized, including the tethering concepts. The suture guide mount 258 is ring shaped with a groove or trough 260 formed on the interior cylindrical surface of the ring. The groove or trough 260 is shaped to receive a circular suture guide 261 as shown in FIG. 17. Suture guide mount 258 has a plurality of apertures 262 evenly spaced about its circumference for use in suturing the suture guide 261 to the suture guide holder as shown in FIG. 17. Suture 264 is threaded through the apertures and through the suture ring in a manner similar to that described with reference to FIGS. 14 and 15 and will not be further be described in connection with this embodiment. Suture 264 can be clipped at two locations such as at 266 and 268 in order release the suture guide from the suture guide holder. Alternatively, cutting guides can be provided as shown in the embodiments previously described and illustrated. FIG. 18 shows a cross section of the suture guide holder with the suture guide attached thereto taken along line 18 — 18 of FIG. 17. FIG. 18 illustrates how groove 260 engages suture guide 261 and depicts rib 263 and the outer covering 265 of the suture guide. Various shaped suture guide holders, C-shaped, linear and circular, have been described and illustrated in the figures, however, in accordance with the present invention, the suture guide holder can be constructed in any desired shape depending on the surgical procedure involved. For example, the suture guide holder could be curvilinear for stomach reduction surgery or for certain cosmetic surgeries when it is necessary to place a suture line along an eyelid or an ear. While the preferred embodiments have been described, various modifications and substitutions may be made thereto without departing from the scope of the invention. Accordingly, it is to be understood that the invention has been described by way of illustration and not limitation.

Summary: An assembly for holding a substantially flexible suture guide of predetermined length in a substantially taut position used to achieve a suture line having a dimension equal to the length of the suture guide, such as the circumference about a heart valve annulus. The assembly includes a rigid suture guide holder having a surface against which the length of suture guide is releasably positioned. The guide holder can have a shape or geometry, such as a circumference or circumferential segment, equivalent to the shape or geometry of the intended suture line. The shape of the guide holder can therefore be selected to hold the suture guide in the shape most advantageous to placing the desired suture line. The assembly further includes a mechanism for releasably binding the suture guide to the surface of the holder and a detachable handle extendibly attached to the holder by means of a lanyard so that the handle can be detached to afford an unobstructed view of the surgical site, but cannot be removed from the surgical site until the holder has also been removed.

big_patent

en

Summarize: Breaking News Emails Get breaking news alerts and special reports. The news and stories that matter, delivered weekday mornings. SUBSCRIBE More than 100 people have now reported they got sick with suspected food poisoning at a national Food Safety Summit held earlier this month in Baltimore. Maryland state health officials say they still don’t know what caused the outbreak of gastroenteritis that left participants suffering symptoms that included diarrhea and nausea. “We are working on evaluating possible exposures and doing testing at the Maryland state public health laboratory to attempt to identify an agent,” officials said in a letter to attendees. The conference, held April 8 to 10 at the Baltimore Convention Center, attracted at least 1,300 of the top food safety officials in the nation, including staff from federal agencies such as the Food and Drug Administration and the Centers for Disease Control and Prevention as well as businesses such as McDonald’s, Tyson and ConAgra Foods. Health officials have heard back from about 400 of those who attended, so the actual toll of illness might be higher. City health officials inspected the convention center and its food service provider, Centerplate. The company was issued a violation notice for condensation dripping from one of the two ice machines in the kitchen, a spokesman said. April 29 (Reuters) - A U.S. food safety summit in Maryland earlier this month has become a cautionary tale after more than 100 attendees came down with suspected food poisoning. Most of those affected complained of diarrhea, the Maryland Department of Health and Mental Hygiene said in a statement. Local health officials have heard from about 400 of the 1,300 attendees and are at a loss as to the exact cause of their illness. The April 8-10 meeting at the Baltimore Convention Center included representatives from the U.S. Food and Drug Administration and the Centers for Disease Control and Prevention, and food companies such as McDonald's Corp, Tyson Foods Inc and ConAgra Foods Inc. "We are working on evaluating possible exposures and doing testing at the Maryland state public health laboratory to attempt to identify an agent," the health department said in the statement. The convention center and its food service provider, Centerplate, were inspected by city health officials. Centerplate was issued a violation notice for condensation dripping from an ice machine in the kitchen, according to NBC News. Centerplate declined a Reuters' request for comment. (Reporting by Lindsay Dunsmuir in New York; Editing by Ian Simpson and Andre Grenon in New York)

Summary: Irony alert: Maryland health officials suspect that food poisoning sickened more than 100 attendees of a national conference about, yes, food safety, reports Reuters. Representatives of the FDA, the CDC, and food giants such as McDonald's and ConAgra attended the April 8-10 summit at the Baltimore Convention Center, and dozens ended up with diarrhea and nausea, reports NBC News. The food service provider was cited for condensation dripping from an ice machine, though it's not clear whether that's the culprit. The Consumerist views it as a "prank from the food gods."

multi_news

en

Summarize: FIELD OF THE INVENTION [0001] This invention relates to site specific delivery of therapeutic agents, structures and catheter systems to achieve site specific delivery of therapeutic agents, and means for implanting and using these systems to enable delivery of therapeutic agents to the body. More specifically, this invention relates to delivery of pharmacological agents to specific regions of the heart at a depth within the heart wall. BACKGROUND OF THE INVENTION [0002] It is possible to identify particular sites within the myocardium which may benefit from local drug release therapy. Examples of problematic tissue which may benefit form local drug release therapy are ischemic sites and arrhythmogenic sites. Different means and methods for delivering agents to these sites will be disclosed in detail. [0003] Ischemic Sites [0004] Ischemic tissue is characterized by limited metabolic processes which cause poor functionality. The tissue lacks oxygen, nutrients, and means for disposing of wastes. This hinders the normal functioning of the heart cells or myocytes in an ischemic region. If an ischemic, or damaged, region of the heart does not receive enough nutrients to sustain the myocytes they are said to die, and the tissue is said to become infarcted. Ischemia is reversible, such that cells may return to normal function once they receive the proper nutrients. Infarction is irreversible. [0005] Non-invasive systemic delivery of anti-ischemic agents such as nitrates or vasodilators allows the heart to work less by reducing vascular resistance. Some vascular obstructions are treated by the systemic delivery of pharmacological agents such as TPA, urokinase, or antithrombolytics which can break up the obstruction. Catheter based techniques to remove the vascular obstructions such as percutaneous transluminal coronary angioplasty (PTCA), atherectomy devices, and stents can increase myocardial perfusion. More drastic, but very reliable procedures such as coronary artery bypass surgery can also be performed. All of these techniques treat the root cause of poor perfusion. [0006] It should be noted that these therapies are primarily for the treatment of large vessel disease, and that many patients suffer from poor perfusion within smaller vessels that cannot be treated with conventional therapies. [0007] The delivery of angiogenic growth factors to the heart via the coronary arteries by catheter techniques, or by implantable controlled release matrices, can create new capillary vascular growth within the myocardium. Recent work has shown substantial increases in muscular flow in a variety of in vivo experimental models with growth factors such as Tumor Angiogenic factor (TAF), basic fibroblast growth factor (bFGF), vascular endothelial growth factor (VEGF), and acidic fibroblast growth factor (aFGF). The methods of delivering these agents to the heart include implantable controlled release matrices such as ethylene vinyl acetate copolymer (EVAC), and sequential bolus delivery into the coronary arteries. Recently similar techniques have been attempted in peripheral vessels in human patients with the primary difficulty being systemic effects of the agents delivered. [0008] U.S. Pat. No. 5,244,460 issued to Unger describes a method of introducing growth factors over time by delivering them through fluid catheters into the coronary arteries, but this does not result in efficient delivery of these agents to the ischemic tissue. If these or other agents are delivered to the coronary artery, a region of tissue that is equivalent to that supplied by the artery will receive the therapeutic agents. This may be substantially more tissue than is in need of local drug delivery therapy. Further, if a vessel is occluded, the growth factors will act in the tissue which the coronary arteries successfully perfuse. As the underlying problem of ischemic tissue is poor perfusion, excess growth factor must be delivered in order to obtain the desired effects in the poorly perfused tissue. Further, growth factors may cause unwanted angiogenesis in tissues where inappropriately delivered. The cornea is described by Unger as such a location, but perhaps more critical is inappropriate delivery of these factors to the brain. Further, placement of delivery devices within these coronary arteries as Unger describes tends to obstruct these arteries and may augment occlusive thrombosis formation. There is a significant need for minimizing the amount of growth factors for introducing angiogenesis by delivering these agents only to the site where they are most needed. [0009] There are complications with clinically acceptable procedures where special devices for delivering agents to ischemic tissue will be useful. After opening vessels using PTCA, the vessels often lose patentcy over time. This loss of patentcy due to re-stenosis may be reduced by appropriate pharmacological therapy in the region of the artery. There is a need for new techniques that will enable pharmacological therapy to reduce the incidence of restenosis. [0010] Arrhythmogenic Sites [0011] Cardiac arrhythmias are abnormal rhythmic contractions of the myocardial muscle, often introduced by electrical abnormalities, or irregularities in the heart tissue, and not necessarily from ischemic tissue. In a cardiac ablation procedure, the arrhythmogenic region is isolated or the inappropriate pathway is disrupted by destroying the cells in the regions of interest. Using catheter techniques to gain venous and arterial access to the chambers of the heart, and possibly trans septal techniques, necrotic regions can be generated by destroying the tissue locally. These necrotic regions effectively introduce electrical barriers to problematic conduction pathways. [0012] U.S. Pat. No. 5,385,148 issued to Lesh describes a cardiac imaging and ablation catheter in which a helical needle may be used to deliver fluid ablative agents, such as ethanol, at a depth within the tissue to achieve ablation. Lesh further describes a method of delivering a pharmacological agent to the tissue just before performing the chemical ablation procedure to temporarily alter the conduction of the tissue prior to performing the ablation. Such temporary alteration of tissue has the advantage of allowing the physician to evaluate the results of destructive ablation in that region prior to actually performing the ablation. This method of ablation has the advantage that the ablative fluid agents are delivered to essentially the same tissue as the temporary modifying agents. However, with ablative fluid agents it is difficult to control the amount of tissue which is destroyed—especially in a beating heart, and ablative RF energy is in common use because of its reproducible lesions and ease of control. There is a need for an ablation catheter that uses a single structure within the heart wall for both temporary modification of tissue conductivity by delivery of therapeutic agents at a depth within the tissue, and delivery of RF energy. [0013] U.S. Pat. No. 5,527,344 issued to Arzbaecher and incorporated by reference herein, describes a pharmacological atrial defibrillator and method for automatically delivering a defibrillating drug into the bloodstream of a patient upon detection of the onset of atrial arrhythmias in order to terminate the atrial arrhythmias. By delivering agents to a blood vessel, Arzbaecher requires systemic effects to be achieved in order to terminate the atrial arrhythmias. The advantages of local drug delivery are absent from the system described. There is a need for a system and method to transiently treat atrial arrhythmias by local delivery of pharmacological agents which affect the excitation of the cardiac tissue locally. [0014] Many patents describe systems for delivering anti inflammatory agents to the endocardial surface of the heart. Such surface delivery is less viable for regions at a depth within the tissue. Further, because of the volume of fluid moving by the inner surfaces of the heart, higher concentrations may be required at the surface to counteract the effects of dilution. These higher doses result in greater likelihood of problematic systemic effects from the therapeutic agents. Delivering agents within the tissue will minimize the dilution of agents, and decrease the possibility of the agents being delivered to inappropriate sites. This is particularly important with growth factors whose systemic affects are not well documented, just as it is important for antiarrhythmic agents whose pro-arrhythmia systemic effects have been recognized. There is a need for a means to deliver agents to ischemic and arrhythmogenic sites within the myocardium. [0015] To deliver substances at a depth within the heart, U.S. Pat. Nos. 5,447,533 and 5,531,780 issued to Vachon describe pacing leads having a stylet introduced anti inflammatory drug delivery dart and needle advanceable from the distal tip of the electrode. U.S. Pat. No. 5,002,067 issued to Berthelson describes a helical fixation device with a groove to provide a path to introduce anti-inflammatory drug to a depth within the tissue. U.S. Pat. No. 5,324,325 issued to Moaddeb describes a myocardial steroid releasing lead whose tip of the rigid helix has an axial bore filled with a therapeutic medication such as a steroid or steroid based drug. None of these patents provides a means for site specific delivery of agents as all applications of the drug delivery systems are at the location selected for pacing. None of these provides a means or method for delivering agents to ischemic or infarcted tissues. Only Vachon and Moaddeb provide a means for effectively delivering the anti-inflammatory agents to a depth within the myocardium. U.S. Pat. No. 5,551,427 issued to Altman describes a catheter system capable of delivering drugs to the heart at a depth within the heart tissue. [0016] U.S. Pat. No. 5,431,649 issued to Mulier describes a hollow helical delivery needle to infuse the heart tissue with a conductive fluid prior to ablation to control the lesion size produced. The system does not have drug delivery capabilities. [0017] None of the prior art includes the use of macromolecular controlled release matrices such as ethylene vinyl acetate copolymer to deliver agents with large molecular weights to a depth within the heart tissue. OBJECTS AND ADVANTAGES [0018] In general it is an object of the present invention to provide a biocompatible drug delivery catheter which will improve the ability to deliver drugs to a depth within the heart tissue. [0019] Another object of the invention is the delivery of growth factors to a depth within the heart tissue over an extended period of time to increase collateral flow in poorly perfused tissue. [0020] Yet another object of the invention is to provide a permanently implantable system that will enable transient delivery of pharmacological agents to a depth within the heart tissue such that cardiac arrhythmias may be terminated. [0021] It is also an object of the invention to provide a combination drug delivery and ablation catheter that will enable a region of the heart tissue to be modified pharmacologically prior to performing RF ablation at a depth within the heart tissue. [0022] It is a further object of the invention to provide catheters with implantable osmotic pumps at their distal ends that deliver pharmacological agents to a depth within the myocardium. [0023] Another object of the invention is to provide catheters with controlled release matrices at their distal ends that deliver pharmacological agents to a depth within the heart tissue. [0024] A further object of the invention is to provide catheters with fluid pathways from proximally located reservoirs which may deliver fluids to a depth within the myocardium, with an electrical conductor to sense the heart so an external device may determine when to deliver pharmacological therapy to a depth within the heart tissue. [0025] A further object of the invention is to provide catheters with fluid pathways from proximally located reservoirs which may deliver fluids to a depth within the myocardium, with a high conductivity electrical conductor capable of delivering RF therapy to the heart from the metallic structure used to deliver drugs to the heart. [0026] Yet another object of the invention is to provide catheters with a means to clear the agents from a catheter and replace them with other agents. [0027] Further objects and advantages of this invention will become apparent from a consideration of the drawings and ensuing description. DESCRIPTION OF THE DRAWINGS [0028] [0028]FIG. 1 a is a partial cross sectional view of a drug delivery catheter. [0029] [0029]FIG. 1 b is a cross sectional view of the proximal portion of a dual lumen drug delivery catheter. [0030] [0030]FIG. 1 c is a partial cross sectional view of the distal portion of a drug delivery catheter with a hollow fixation helix. [0031] [0031]FIG. 2 is a partial cross sectional view of the distal portion of a drug delivery catheter with a short needle located in the axis of the helical fixation device. [0032] [0032]FIG. 3 a is a partial cross sectional view of the distal portion of a drug delivery catheter which incorporates an osmotic pump. [0033] [0033]FIG. 3 b is a partial cross sectional view of the distal portion of a drug delivery catheter which incorporates an osmotic pump. [0034] [0034]FIG. 4 is a partial sectional view of a distal portion of a drug delivery catheter. [0035] [0035]FIG. 5 a is a partial sectional view of the distal portion of a drug delivery catheter with a rate control barrier. [0036] [0036]FIG. 5 b shows a partially sectioned view of the distal portion of a drug delivery catheter with a second lumen for stylet use during implantation. [0037] [0037]FIG. 5 c is a transverse section of the catheter in FIG. 5 b. [0038] [0038]FIG. 6 is a partial sectional view of a subcutaneous injection port, and a drug delivery catheter. [0039] [0039]FIG. 7 is a partial sectional view of the distal end of a drug delivery catheter. [0040] [0040]FIG. 8 is a partial sectional view of a filled helical drug delivery fixation means. [0041] [0041]FIG. 8 a is a transverse section of the fixation means in FIG. 8. [0042] [0042]FIG. 9 is a partial sectioned view of the distal end of a drug delivery catheter. [0043] [0043]FIG. 10 a is a partial sectioned view of a drug delivery catheter with a nitinol transient delivery means. [0044] [0044]FIG. 10 b is a partial cross sectional view of the distal portion of drug delivery catheter with a vapor pressure transient delivery means. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS [0045] New concepts for delivering agents for the treatment of heart failure, ischemia, arrhythmias, and restenosis are disclosed. The main embodiments consist of transvenous or transarterial catheter delivery techniques for delivering agents directly to a chosen site within the heart at a depth within the heart tissue. Hollow helical delivery devices, needle delivery devices, and implantable controlled release matrices may be inserted such that metabolic agents, anti ischemic agents, growth factors, antiarrhythmic agents, anti-inflammatory agents anti-proliferative agents, gene therapy preparations, and combinations of these agents may be delivered directly to the tissue that can benefit most from these agents. [0046] These drug delivery structures may be made from different materials depending upon whether the device is to be used chronically or acutely. For example, metal components in the preferred implantable embodiments, formed of a Platinum Iridium alloy consisting of ninety percent Platinum and ten percent Iridium, typically are replaced with 316L surgical stainless steels in the acute embodiments. Likewise implantable grades of silicone and polyurethane are replaced with polyurethanes, polyolefins, fluoropolymers, nylon, and the like in the acute uses of the devices. Herein the term catheter is used to describe both chronically and acutely implantable systems. [0047] [0047]FIG. 1 a shows a first cardiac drug delivery catheter with a sectional view of the proximal end. A pin 2 is shown mechanically crimped at a crimp 6 to an electrically conductive helical coil 8. Crimp 6 is typically covered by a compliant polymer molding 4 which may form a seal with a catheter port on a drug delivery reservoir or pumping means 16. Such a reservoir, shown schematically at 16, may be implanted subcutaneously or located outside the patient. A line 18 represents a fluid coupling of reservoir 16 to lumen 12, which enables delivery of fluid treatment agents from the reservoir to fixation end 24. Further molding 4 and a catheter body or sheath 14 may have external sealing rings to provide fluid tight seals with such ports. Pin 2 connects to an internal tubing 10 with a lumen 12 which extends the entire length of the catheter to the distal end 22 and allows for fluid agents to be delivered through a fluid pathway in a fixation end 24. The catheter body or sheath 14, 20, and 22 covers the coil 8 along the entire length of the delivery system distal to crimp 4 such that rotation of pin 2 or crimp 4 relative to proximal catheter body 14 rotates coil 8 within catheter body 14, 20, and 22 and deploys fixation mechanisms at fixation end 24. The central lumen 12 in some embodiments may also be used to pass a stylet for use during implantation to facilitate the implantation procedure. [0048] The catheter shown in FIG. 1 a is made of permanently implantable materials, it has electrical continuity from end to end for sensing cardiac activity, it has a lumen for conveying fluidic agents along its length, and a hollow fixation means for delivering fluidic agents to a depth within the heart tissue. [0049] Further as to the sensing of cardiac activity, a monitor and control device 26 is electrically coupled to pin 2 through a line 28, thus to enable a sensing of highly localized cardiac electrical activity at device 26. Cardiac activity can be recorded at device 26, e.g. stored in a memory chip (not shown). Further, sensed cardiac activity may be employed to provide controlling signals to reservoir 16 through a line 30, e.g. to. initiate or terminate the supplying of a fluid agent from the reservoir, responsive to sensing a predetermined activity or condition in cardiac tissue proximate fixation end 24. The materials selected are suited for permanent implantation to provide for transient drug delivery driven by a proximal reservoir and energy source. For example, catheter body 14, 20, and 22 is an implant grade polyurethane or silicone, and the distal fixation mechanism at fixation end 24 is a platinum iridium alloy. The catheter has a single electrode to facilitate implantation by sensing the electrical potential at the implant site. This combination achieves the advantages of ease of implantation, and delivery of fluidic agents to a depth within the heart from a proximally located reservoir. [0050] In another embodiment, the monitor and control device 26 is not required. Instead, reservoir 16 pumps at a low, constant rate, supplying infusing agents to a depth within the myocardium, thus to locally apply selected agents, such as angiogenic growth factors, at a steady rate over an extended period, e.g. one week. [0051] [0051]FIG. 1 b shows another embodiment of the proximal end of a catheter delivery system in which a stylet lumen 66 is provided for insertion of a stylet. Such an additional lumen may be useful to prevent contamination of an inner drug delivery tubing 62 during implantation. Inner tubing 62 is connected to a pin 52 at a connection 56, which may be performed simply by pulling tubing 62 over pin 52 at connection 56. An electrically conductive coil 60 surrounds tubing 62 and may be rotated relative to outer jacket or catheter body 58 of the delivery system. After implantation using a stylet in stylet lumen 66, pharmacological agents may be delivered to the heart by a fluid pathway defined by a delivery system lumen 64. In this specific embodiment, crimp 54 which connects pin 52 and coil 60 is not overmolded, and a single set of seals 70 are shown molded over the proximal end of catheter body 58. Seals 70 prevent migration of fluids into the catheter after connection with a catheter port in a drug delivery reservoir or pumping means. In one embodiment, the distal end of the drug delivery catheter shown in FIG. 1 b would be the distal embodiment shown in FIG. 5 b. [0052] [0052]FIG. 1 c shows a partial cross sectional view of the distal portion of a delivery catheter which is to be implanted endocardially by the appropriate venous or arterial access. Here, a simple pathway for fluid to pass from a subcutaneous reservoir or delivery pump (not shown) through a deployable helical needle is provided. Helical coil 102 is multifilar, but could be single filar as well. The number of filars can be varied to determine the flexibility of the catheter as well as the coil&#39;s ability to transmit torque to fixation helix 114. The fixation helix is screwed into the heart by turning a coil 102 inside an outer catheter body 106. A fixed structure 130, on the inner wall of the catheter body 106, facilitates advancement and retraction of the fixation helix 114 by forcing the helical fixation structure 114 to advance from the distal end of the catheter when the central helical coil 102 and tube for drug delivery 104 are rotated counterclockwise. Fixed structure 130 is typically formed from a radio opaque material to assist the implanting physician in identifying when fixation helix 114 has been deployed. Fixed structure 130 also will retract the fixation helix 114 from the heart wall when the coil 102 is rotated clockwise. These directions could be reversed by varying the direction of the winding of the fixation helix 114. The helical coil 102 which provides torque to implant the fixation helix 114 is welded or crimped to a coupling structure or torque delivery structure 110 at a coil to torque delivery structure connection 128. Here, the coil is shown crimped at connection 128. Proximal stop 124, and distal stop 112 are raised portions on the inside of the catheter body 106, and prevent the fixation helix 114 from being extended or retracted too far. A fluid path is provided from the proximal end of the catheter (not shown) by tube for drug delivery 104 which connects to the tube fitting 126 of the hollow fixation helix 114. The hollow fixation 114 may have a number of small holes or helix apertures 116, 118, 120, 122 along its length where it is penetrated into the heart tissue. These holes provide a means for delivering agents into the heart tissue at a depth within the tissue. Helix tip 132 is sharp to facilitate penetration of the heart tissue, and acts as a further opening for the agents to migrate from the tissue. In some embodiments the helix apertures may be on only the distal portion of the helix to minimize the possibility of agents being delivered within the heart chambers. In other embodiments, the helix apertures are not present to maximize the structural integrity of the fixation helix. Where this is the case, agents are delivered to the heart from the aperture at the hollow helix tip 132. The fixation helix 114 is rigidly attached to the torque delivery structure 110 to provide means for advancement when coil 102 is rotated. [0053] [0053]FIG. 1 c shows a means for delivering agents by a fluid path to a depth within the heart tissue, to provide a wide variety of agents by way of a fluid pathway to a depth within the tissue from a proximally located reservoir. Helix 114 acts as an electrode, with electrical energy being transmitted along helical coil 102 to and from fixation helix 114 by way of electrically conductive torque delivery structure 110. It can be viewed as the distal end of the implantable catheter whose proximal end is shown in FIG. 1 a or FIG. 1 b. In one embodiment, the device of FIG. 1 could be used for chronic delivery of antiarrhythmic agents to alter local conduction either continuously, or on demand based upon the signals sensed through fixation helix 114. Such algorithms have been described for pharmacological atrial defibrillation by Arzbaecher in U.S. Pat. No. 5,527,344. In other embodiments agents for a variety of disease states may be continuously infused by the fluid pathway to a specific site within the myocardium. The proximal end of the catheter may be connected to a drug pumping mechanism or to a proximally located reservoir. Such proximal devices may be implanted or located outside the patient. Access to implantable proximal devices for refilling agents is achieved with a subcutaneous port. [0054] Transient delivery of pharmacological agents based upon demand requires the presence of electrical conductors along the length of the drug delivery catheter to monitor the electrical action of the heart, e.g. the heart rate as indicated by a time-dependent voltage. Delivering of agents upon demand locally alters the conduction or automaticity of the cardiac tissue and allows for the arrhythmia to be treated. Only a small amount of drug is required to treat a specific location within the tissue, which has substantial benefits. Small doses of antiarrhythmic agents minimize the need to refill the proximally located reservoir; and reduce the systemic effects from large drug doses as well as the effects of the agents on normally functioning cardiac tissue. In one application of this embodiment, the device is implanted in the right atrium at a location determined to be most likely to terminate a patients supraventricular arrhythmia. A subcutaneous infusion pump is triggered by the electrical activity of the heart, and a very small region of tissue receives local drug delivery for a preprogrammed duration. A small region of heart is then modified such that cardiac excitation wavefronts are altered by the tissue treated. This provides substantial advantages to patients. Typical of the drugs delivered are antiarrhythmic agents such as those described in U.S. Pat. No. 5,551,427 issued to Altman. [0055] In another embodiment, the device in FIG. 1 c is an acute catheter made of nonimplantable materials. Catheter body 106 is formed of polyurethane or a fluoropolymer such as ETFE or PTFE; helical fixation structure 114, and torque delivery structure 110 are made of Titanium or 316L stainless steel. Such a catheter is used for acute ablation procedures in which antiarrhythmic agents are delivered to temporarily alter the conduction of the heart at the site of the implanted helix. Electrical mapping and stimulation measurements are made to determine if the region is appropriate to be ablated. If the region is not appropriate the device is removed and repositioned. If the region treated by the antiarrhythmic agents which affect tissue conduction is desired to be ablated, RF energy is delivered from the electrically active helix to a large surface electrode, such as that used in electrocautery. Such an electrode is shown schematically in FIG. 1 a as a patch electrode 32 that can be in contact with the patient&#39;s skin outside the body. A conductor 34 electrically couples electrode 32 with monitor and control device 26, whereby device 26 is employed in a known manner to utilize a circuit including conductors 28 and 34, electrode 32, pin 2, crimp 6, coil 8 and a fixation element at the distal end of the coil, to generate an RF current through tissue between the fixation element and electrode 32. The region ablated is that near the surface of the implanted helix. The helical coil 102 is highly conductive to enable RF energy to be conducted to the distal fixation structure to allow ablation of the region immediately at the fixation structure. Such a high conductivity coil can be formed from a number of wires wrapped in parallel in which each wire has a high conductivity silver core jacketed by an MP35N non corrosive alloy. This catheter provides for both temporary modification of tissue conductivity by delivery of therapeutic agents to a depth within the tissue, and delivery of RF energy from the same structure. [0056] [0056]FIG. 2 shows another distal portion of a delivery catheter for endocardial placement. The operation is similar to that just described. However, here the fixation structure 202 is solid and does not provide a fluid path for delivery of agents. The fluid pathway is instead provided by a centrally located hollow needle 204. Apertures could also be made along the needle to provide more exposure to the tissue within the heart wall. Fluid agents flow through connecting tube 104, inside the hollow needle 204, and out through apertures in the surface (not shown) and the needle tip 206. Agents are delivered via the needle to a depth within the tissue. Thus, needle 204 provides a tissue penetrating element distinct from the fixation element, whereas in FIG. 1 c the penetrating element and fixation element are the same, i.e. helix 114. The solid fixation structure 202 advances in the same manner as described in FIG. 1, and may be rigidly attached to the torque delivery structure 110 by a weld 208. Other methods of connection are possible. The primary advantage of this design is that the solid helical fixation structure 202 is structurally more robust than that of the hollow structure shown in FIG. 1 c. This facilitates implantation of the structure. [0057] Other embodiments which incorporate osmotic pumps, controlled release matrices, membrane barriers, and catheter based transient delivery means increase the ability to control the delivery of agents to a depth within the heart tissue. They have substantial advantages in delivering agents such as growth factors and gene therapy preparations in that very small amounts of the agents are effective, the delivery is controlled over time, and the agents are delivered to a depth within the heart. [0058] [0058]FIG. 3 a shows an osmotic pump located at distal end of a catheter to drive therapeutic agent into heart tissue using a needle 318. Alternatively a hollow helix fluid transport system as described can be employed. Agents may be delivered via the fluid pathway previously described, through the check valve 302, and into the drug volume or drug reservoir 304. After the drug reservoir 304 is full, agents migrate out the needle tip 320, and apertures 322. Reservoir 304 may be loaded before, during, or after implantation from the proximal end of the drug delivery catheter. Once advanced into the heart tissue, diffusion of a liquid across the semipermeable membrane 312 occurs because of an osmotic salt 310. As this salt expands with hydration, pressure is exerted against the flexible barrier 306 and the rigid osmotic pump housing 308. The expansion constricts the drug volume 304. As check valve 302 is closed to reverse flow, the agents are forced through the delivery structure and into the heart wall. The pathway to needle tip 320 includes proximal needle apertures 316 and proximal needle opening 324 within the reservoir 304. The rigid support 314 supports the fixation helix and the needle delivery structure. [0059] Placing an osmotic pump directly at the site where agents are delivered has the benefit of limiting the amount of agent in the system. In devices where the agent in the filling tube can be removed, the site specific osmotic pump does not require a long length of tubing filled with pharmacological agent. This may be particularly useful for agents whose systemic effects are undesirable or unknown. To deliver agents by a fluid pathway along the length of a catheter system requires a length of tubing to be filled with the appropriate agent. Although minimizing the cross sectional area of such a tube reduces excessive amounts of agents, putting the pump at the site for delivery eliminates the problem. Placing the osmotic device at the end of the catheter tube provides the advantageous means for follow-up delivery after the pump has delivered all of the agents in the reservoir 304. Further, only a very small amount of agent is required and the osmotic pump is placed on a catheter at the site for delivery. A catheter based osmotic pump as in FIG. 3 a may be filled proximally after implant, and agents may be altered during delivery. Such delivery techniques have substantial advantages for macromolecules such as growth factors and genetic material. Further, they may allow for very controlled delivery of microsphere or micelle encapsulated agents. [0060] The drug reservoir 304 can contain either a solution or a solid formulation in a semipermeable housing with controlled water permeability. The drug is activated to release in solution form at a constant rate through a special delivery orifice (e.g. either 316 or 322 ). The release of drug molecules or encapsulated drug molecules from this type of controlled release drug delivery system is caused by osmotic pressure and controlled at a rate determined by the water permeability and the effective surface area of the semipermeable housing as well as the osmotic pressure gradient. Devices which use hydrodynamic pressure gradients are similar except the semipermeable membrane is replaced by an opening, and the osmotic salt is replaced by an absorbent and swellable hydrophilic laminate. [0061] [0061]FIG. 3 b shows a partially sectional view of another embodiment of the distally located osmotic pump. Here a check valve 402 is located at the proximal end of a needle 404 which extends through drug volume or reservoir 304. Needle 404 provides more structural stability to the drug delivery device and guarantees a fluid pathway to the delivery needle 320 even after the osmotic action has driven all of the agent out of the drug volume 304. Further, a section of a seal 406 is shown attached to the inside of the catheter body. Osmotic pump housing 308 is moveably contained within seal 406, which acts to prevent migration of fluids into the catheter body. [0062] [0062]FIG. 4 shows another embodiment of a cardiac drug delivery system. Here the fixation mechanism consists of a needle 484 with apertures 486 that penetrates the myocardium and is held in place by barbs 466. In a chronic implant barb 466 may be composed of either a rigid metallic alloy or a biodegradable polymer. If a biodegradable material is used, long term tissue attachments will maintain fixation with the heart, and the barb 466 will not cause undue trauma should the drug delivery system need to be explanted. [0063] In addition, FIG. 4 shows a multilumen catheter and valve system for the filling of reservoir 462. Agents are delivered along the fluid path defined by a filling lumen 452 in a bitumen tubing 450 such that unidirectional check valve 456, shown here as a ball check valve, is opened allowing agents to flow through lumen 458 of tube 460 and out the distal end of tube 480. The ball check valve has a sphere in a generally conical tube which allows unidirectional flow by obstructing the smaller diameter fluid pathway to reverse flow and not obstructing the larger diameter circular pathway of the open flow direction in various embodiments it could be replaced with a reed check valve, a hinged plate check valve, or the equivalent. After the reservoir 462 is filled, the fluid will open check valve 472 and flow out clearing lumen 468 in bilumen tube 450. This filling action will force ball check valve 470 closed. After filling, the remaining agent in the bilumen tube may be cleared by delivering sterile distilled water, which may contain anticoagulants such as heparin to assure long term patentcy of the catheter lumens, to clearing lumen 468. This clearing fluid will force check valve 472 closed, and check valve 470 open such that agents may be flushed from the bilumen tube and replaced with the distilled water or other flushing agents. If the system is chronically implanted, such a bilumen tube and series of valves would allow one to fill the reservoir 462 and clear the bilumen tube 450 after implant. Further, because the distal end of the tube 480 allows for filling of the reservoir 462 from the distal end, agents may be changed merely by filling via filling lumen 452 which will force the existing agents out through proximal reservoir exit 474, through valve 472 and clearing lumen 468. If the proximal end of such a bilumen delivery system were connected to a dual port subcutaneous reservoir (not shown) agents would be injected into one port while withdrawn from the second port. [0064] In this delivery catheter, the distal housing also acts as an osmotic delivery system with semi permeable membrane 496, hydrophilic salt or agent 476, and flexible polymer barrier 464 allowing for controlled delivery of agents over a period of time. After the expiration of the osmotic energy source, agents may be delivered via the fluid pathway by an external pumping means if desired. The valve housing 454 houses the three unidirectional valves 456, 470, and 472, and provides tube fittings 488 and 490 for connection to the bilumen tubing. This valve housing 454 is also attached by a crimp 494 to the coil 492. This structure is assembled from the separate components and combined. Alternatively, separate valves could be fit into openings in a simpler metallic form, and the whole mechanically and hermetically attached to the rigid osmotic pump housing 478. Rigid support 482 is fixed to needle 484, and may also have structural elements which enter into the region of the hydrophilic salt, and possibly attach to the valve housing 454. [0065] [0065]FIG. 5 a shows partially in section an embodiment where a membrane or rate controlling barrier 506 stands between the agent reservoir 502 and the apertures 518 in the proximal end of the delivery needle 520 which would allow the agents to be delivered to the distal end of the delivery needle 524, and through the apertures 522. The needle could be replaced with a hollow helical delivery device as shown in FIG. 1 c if desired. An optional controlled release structure 508 provides chronic delivery of agents to the implant site. As this agent diminishes, new agents can be provided through the connecting tube and check valve 402, such that rate of release is governed by control barrier 506. Barrier 506 is shown here with substantial thickness, but it could be formed of a simple membrane, a membrane reinforced with a substantially porous structure, such as a laminate of expanded polytetrafluoroethylene (ePTFE), or any other structure which could be used to govern the rate of drug delivery to the side of the barrier connected by a fluid pathway to the tissue to be treated. The design of the control release barrier would be customized for the agents to be delivered and may be intentionally designed to specify a rate of delivery substantially different from that which the optional control release structure 508. Needle plug 516 prevents flow through the needle lumen, while maintaining a rigid axial support, and could be formed of an inert polymer or metallic material. Rigid support 510 acts to support axial location of needle 524 and may be a mechanical base for the helical fixation means. Controlled release structure 508 could be composed of a macromolecular controlled release matrix such as EVAC housing a growth factor such as TAF, bFGF, or aFGF. [0066] In another preferred embodiment of FIG. 5 a, controlled release structure 508 would be left out and the space would be filled with pharmacological agents and act as a reservoir for acute delivery immediately after implantation. The fluid path for subsequent agents would then include tubing 104, check valve 402, proximal needle 512 and proximal apertures 514 into agent reservoir 502, contained by drug reservoir housing 504. The fluid agent then passes through rate control barrier 506 acute into the fluid reservoir. [0067] In other embodiments of FIG. 5 a, the control barrier 506 could be electrically activated to allow rapid delivery of positive pressure and agent delivery from one side to the other. In this electrically activated embodiment, the optional control release structure or acute reservoir 508 could merely deliver agents acutely to preserve the viability of the fluid pathway for the time when therapy is deemed necessary. Acute delivery of antithrombolytics and anti-inflammatory agents would limit blockages and tissue inflammation resulting from the implantation of the structure in the heart wall and improve the ability of a transient system to deliver agents quickly and effectively to the region within the tissue. An electrically controlled barrier could be fashioned much like any electrically controlled microvalve. [0068] [0068]FIG. 5 b is a partially sectional view of the drug delivery system described in FIG. 5 a which incorporates a separate stylet lumen 552 within the same catheter body 550. Such a stylet lumen accommodates a removable wire element to allow the implanting physician to control the shape of the device to guide it to the appropriate site. This additional lumen 552 allows the drug delivery tubing to travel the length of the coil in its own lumen 554. Although shown here as a continuous part of catheter body 550, stylet end stop 556 usually is attached as a separate component. FIG. 5 c shows the diameter of stylet lumen 552 to be substantially smaller than lumen 554. These lumens may change depending upon the requirements for different applications. Such an additional lumen for stylet use could easily be combined with any of the drug delivery systems presented here. This additional lumen will prevent the lumen of the drug delivery tubing 104 from getting obstructed with body fluids during stylet use, prevent damage to tubing 104 by the stylet, and allow the materials of both stylet and tubing 104 to be chosen without regard to the requirements of the other. [0069] [0069]FIG. 6 is a partially sectioned view of one preferred embodiment of a subcutaneous reservoir structure 626 and a drug delivery catheter 628. Subcutaneous reservoir structure 626 may be connected to the proximal end of the delivery catheters shown. Subcutaneous reservoir structure 626 consists of a housing 602 whose reservoir 606 may be filled with a fluid pharmacological agent. The agent is introduced by transcutaneous injection into the reservoir 606 through the polymer injection barrier 604. This barrier is typically composed of silicone rubber such that it creates a seal after removal of the filling needle. In addition, the housing 602 is typically constructed of titanium, polyurethane, or other known rigid biocompatible and nonreactive materials. [0070] [0070]FIG. 6 shows a means for connecting the drug delivery catheter to the subcutaneous reservoir, a constant pressure pumping means, or automatic infusion pump. Subcutaneous reservoir structure 626 has a port 610 which accepts the proximal end of delivery catheter 628 such that the region of separation 622 between the crimp structure 620 and proximal end of the jacket body 614 is completely within port 610. This prevents fluids from entering the separation 622 which allows the coil and inner tubing 624 to rotate relative to the jacket body 614 for advancement of fixation structure 616 and needle delivery system 618. After the proximal end is inserted into port 610 of subcutaneous reservoir structure 626, a set screw may be advanced within threads 608 to secure the catheter in position by applying force to pin 612. This set screw connection to the pin is common in devices used to deliver electrical therapy to the heart, and could be used to perform an electrical connection to the fixation means 616 or needle 618 in order to sense the electrical activity of the tissue. This electrical signal could be monitored by devices with algorithms similar to those designed to deliver electrical therapy to the heart, accept that instead of electrical therapy they introduce pharmacologic therapy. [0071] [0071]FIG. 7 shows another embodiment of an acute drug delivery system. The catheter body 702 houses a lumen 704 for fluid transport of therapeutic agents and a lumen 706 for stylet use during implantation. Lumen 704 travels the length of the delivery catheter and connects to needle delivery structure 714. During implantation through the vasculature, blood soluble coating 710, e.g. as in U.S. Pat. No. 4,827,940 issued to Mayer, completely protects the vasculature from the sharp elements of the fixation helix 712 and the needle delivery structure 714. Blood soluble coatings such as sugars may be used. After the appropriate heart chamber is accessed, the physician waits for the coating 710 to dissolve. The coating may be combined with a radio opaque material such as barium sulfate to identify better when this has been accomplished. After the coating 710 has dissolved, the physician implants the fixation helix 712 by rotating the entire catheter about its own axis. Torque is delivered from the catheter body 702 to the fixation helix 712 by the embedded portion 708 of the fixation helix. This embedded region can be manufactured using molding and bonding technology. The principle advantage of this device is the small cost of manufacturing such a simple design with no moving parts. [0072] [0072]FIG. 8 shows a hollow fixation helix 802 with apertures 804 along its length. FIG. 8 a shows the hollow helix to be filled with a second material 810. Second material 810 in the preferred embodiment is a controlled release polymer matrix filled with a therapeutic agent for extended delivery of agents through apertures 804 in fixation helix 802. In one embodiment the controlled release matrix is comprised of silicone rubber and the agent to be delivered is lidocaine. In another embodiment the agent may be amiodorone HCL. In another embodiment, the controlled release matrix is EVAC and the agent is aFGF. Other variations are also possible. After implantation of the structure within the heart wall by penetration of helix tip 808, the rest of the helix is rotated such that all apertures 804 are within the tissue. Agents then migrate from the controlled release matrix to the tissue in which it is implanted. Such a controlled release matrix filling of the hollow core which penetrates the heart could be pursued with other penetrating structures as well. [0073] [0073]FIG. 9 shows a drug delivery system with VEGF in an EVAC matrix 908 housed in a reservoir defined by cylinder 906, and ends 904 and 914. In the preferred embodiment, these are nonpermeable, although in other embodiments permeability may be desirable. End 904 acts both to transmit torque to fixation helix 916, but also as a stop for a stylet (not shown) which may be used during implantation down the coil lumen 902. After implantation of the drug delivery catheter, body fluids migrate through apertures in distal needle 920 and into a reservoir through a proximal region 912 of the needle and dissolve pharmacological agents in acute dosage 910 which may be present to counter inflammation associated with implantation. Over time, growth factors are delivered via needle 920 to a depth within the heart. Note that the absence of a tube for agent delivery enables stylet use during implantation. In variations on this embodiment, other controlled release means could be housed within a semi permeable structure that would allow increased fluid transport to assist in delivery of agents through needle 920 to a depth within the heart wall. [0074] [0074]FIG. 10 a shows another drug delivery catheter in which agents may be delivered transiently to a depth within the tissue. Here, helical coil consists of four coradial wires which are electrically isolated from one another by a layer of insulation. The electrical insulation allows a current pathway to be defined which allows current to flow through electrical connection 1018 from two of the coradial wires and into Nitinol thermally activated shape memory ribbon or band 1020, which wraps around flexible polymer barrier 1010 as shown in section. Current flowing through Nitinol ribbon 1020 completes its circuit to the other two coradial wires at electrical connection 1002 to torque delivery structure 1004 via conduction through a connection to support structure 1012 which is electrically connected to needle 1028. Insulating structure 1032 separates the two electrical connection regions on torque delivery structure 1004 and allows current to pass through ribbon 1020. If the electrical resistance of the Nitinol is sufficiently high, ohmic heating causes a constricting shape change upon the flexible polymer barrier 1010. Contained within flexible polymer barrier 1010 is a partially porous polymer controlled release matrix structure 1022 such as silicone rubber containing lidocaine, which upon compression by the Nitinol ribbon, forces agents out of the controlled release matrix 1022 and into the needle 1028 within the reservoir 1026, then out the distal region 1016 of the needle into the heart. [0075] [0075]FIG. 10 b shows another transient drug delivery structure in which a reservoir contains a fluid whose vapor pressure provides the energy to delivery therapeutic agents. As in FIG. 10 a, the different filars in the helical coil, such as filar 1068, are electrically insulated from one another such that two independent electrical connections may be made at a crimp 1050 and a crimp 1072 which are separated from each other by electrically insulating barrier 1070. The electrical connections made at crimp 1050 and 1072 have an electrical path between them which is defined by resistive heating element 1052 which passes through a reservoir 1056. Within reservoir 1056 is a fluid gas mixture which provides a constant pressure at human body temperature via a plate 1058 to a drug matrix 1060. If drug matrix 1060 is a substantially porous controlled release matrix, the pores surrounding the matrix will be filled with relatively high concentration of agents in fluids. As electrical energy is delivered along the two independent electrical conductors to resistive heating element 1052, the temperature of the fluid within reservoir 1056 increases. As reservoir housing 1066 and support structure 1064 are rigid and noncompliant, this increases the pressure within reservoir 1056 to cause expansion of bellows 1054 and apply pressure to the controlled release matrix 1060. This forces the concentrated fluid from within the porous controlled release matrix into proximal end of needle delivery system 1074 and out through the distal end of the needle into the heart wall. Such vapor pressure energy sources have been used in infusion pumps such as an infusion pump available from Infusaid of Norwood, Mass. However, that system has not been implanted on a catheter, nor does that pressure system provide a thermal element to increase the temperature within the charging fluid and thus deliver the pressure transiently. In addition to the porous matrix, there is a soluble anti-thrombogenic and anti inflammatory agent for use in acute dosage form 1062 which surrounds proximal length of needle 1074, while still leaving the end free for agent administration. Such acute dosage forms may be very useful for guaranteeing the long term outcome of such controlled delivery systems by minimizing the response of the tissue to the trauma of implantation. [0076] A method for delivering therapy using a combined drug delivery ablation catheter proceeds as follows. Initially the arrhythmogenic site is located using techniques common to those in the field of cardiac electrophysiology. The delivery system is inserted into the appropriate site within the heart by the internal or external jugulars, cephalic vein, subclavian vein, femoral artery, or the other vascular delivery routes. Then, the drug delivery structure is implanted at the arrhythmogenic site supply an appropriate agent for altering the local conduction properties. After implantation, agents are delivered and the effect on the arrhythmogenic site is evaluated by electrical techniques such as mapping. If the location is appropriate, and the agents appear to terminate the critical arrhythmia, RF energy is delivered to the tissue by way of the same structure used to deliver the agents to the heart. If the position is inappropriate and the local pharmacological agents do not correct for the arrhythmia, the device is repositioned, and the procedure repeated. [0077] A method for transient treatment of supraventricular arrhythmias using a chronically implantable transient drug delivery catheter proceeds as follows. After electrophysiologists have specified the appropriate region for implantation based upon the patient&#39;s cardiac electrical action, a catheter is implanted at this site to deliver antiarrhythmic agents at a depth within the heart transiently, as well as to sense the electrical activity near the device. The catheter is then connected to an external controller and power source, which determines suitability of therapy and delivers energy to a device such as those described in FIGS. 10 a and 10 b for transient delivery of pharmacological agents, or to a device such as that shown in FIG. 1 c coupled to a proximally located pumping means. The device then senses cardiac activity through the surface of the drug delivery structure. When the heart experiences an arrhythmic event, the controller identifies the event and activates the energy source which delivers the drug to the heart. This drug modifies the selected area of tissue and either terminates the arrhythmia, or substantially reduces the magnitude of the required electrical therapy. If the arrhythmia does not terminate, the pump may deliver a secondary dosage, or trigger an external electrical therapy device. If no arrhythmia is sensed, the device is maintained in a monitoring mode. [0078] Thus the different embodiments of the invention provide a means to effectively deliver agents at a depth within the myocardium to provide a new means for delivering pharmacological therapy to specific locations within the heart. These delivery systems will allow therapies for ischemic tissue, arrhythmogenic sites, and other cardiac disease to be delivered over an extended period of time through a chronic implant, or rapidly over a short period of time during an acute procedure. They enable controlled deliver of small amounts of macromolecular agents such as growth factors, transient drug delivery to the tissue for treating cardiac arrhythmias, and may be used with other cardiac devices. [0079] Many other variations are possible. For example, the flow of liquid agents maybe driven by implantable infusion pumps with a variety of energy sources, and the device could be made from different biocompatible materials. Other examples include distally located electrically activated piezoelectric crystals as energy sources for drug delivery, and distally located ultrasound transducers for implantation using ultrasound imaging. In addition, in the embodiments where unipolar sensing through the drug delivery structure is insufficient, it is a simple task to add another electrode to enable bipolar sensing. [0080] Catheters with a straight cylindrical lumen from one end to the other could be used with a thin bundle of optical fibers passed through the lumen to photoablatively create channels within the heart for improving the flow of pharmacological agents within the heart. In other variations, the thin optical fiber could be replaced with a thin RF electrode structure which could literally burn channels within the tissue. Such procedures could be viewed as a combined transmyocardial revascularization (TMR) and drug delivery. For example, after a catheter is implanted and agents are delivered to minimize reflow damage to the heart, simple TMR could be introduced with a centrally placed optical fiber. Subsequent to the TMR, angiogenic growth factors could be introduced. [0081] In other embodiments, the devices described may be used for acute delivery of metabolic agents, and anti-ischemic agents to poorly perfused tissue just prior to introducing reflow. The agents improve the health of the poorly perfused tissue and minimize the amount of reflow injury introduced by the white blood cells. In another embodiment the devices described may be used to deliver specific antiarrhythmic agents over a time course of days to weeks while physicians determine whether an implantable system is appropriate. In a another embodiment, the catheters described may be used to deliver gene therapy at a depth in the diseased myocardium over a period of days to weeks. [0082] Further, the delivery of the agents could be performed with appropriately modified catheter shapes such that curves are located to effect a certain position within the heart. Such curves in a catheter could be molded into place, or held in place by plastic deformation of the helical coil in the region it is desired. Such curved structures may provide improved access to certain regions within the right atrium, left atrium, right ventricle and left ventricle. [0083] Further, the implantable versions of the different catheters could have their fixation mechanisms coated with radioactive agents such as Phosphorous 32 to emit beta radiation for the minimization of tissue growth on the fixation structures. This has particular advantages for catheters meant to be implanted for durations longer than a few days, to be removed after the therapy has been delivered. [0084] Further, acute embodiments of this device could incorporate standard sensor technologies for measuring pH and P 02 within the heart chamber or even within the myocardium, and mapping electrodes could be placed along the distal portion of the catheter body to facilitate implantation relative to measured electrical signals through the myocardium. [0085] Accordingly, the scope of the invention should be determined not by the embodiments illustrated, but by the appended claims and their legal equivalents.

Summary: A system is disclosed, for administering a therapeutic agent locally and to a depth within cardiac tissue. An elongate, flexible catheter contains a flexible electric conductor and supports at its distal end an implantable electrode incorporating a penetrating element, typically a fixation helix or a linear needle that penetrates cardiac tissue as the electrode is implanted. A therapeutic agent is delivered through the electrode, to the cardiac tissue surrounding the penetrating element. The electrode acts as a sensor, electrically coupled through the flexible conductor, and monitors an electrical condition of the surrounding cardiac tissue. A controller is coupled to the sensor and to a pump or reservoir containing the therapeutic agent, to control delivery of the agent responsive to the sensed electrical condition. The implanted electrode further can be used to deliver RF current to ablate the surrounding tissue. Several embodiments feature a distal reservoir adjacent the electrode, for effecting transient deliveries of the therapeutic agent in minute quantities or chronic delivery of growth factors. Another embodiment incorporates a bilumen catheter and a set of unidirectional valves, to facilitate changing therapeutic agents or purging the catheter of an agent after delivery.

big_patent

en

Summarize: These crawls are part of an effort to archive pages as they are created and archive the pages that they refer to. That way, as the pages that are referenced are changed or taken from the web, a link to the version that was live when the page was written will be preserved.Then the Internet Archive hopes that references to these archived pages will be put in place of a link that would be otherwise be broken, or a companion link to allow people to see what was originally intended by a page's authors.The goal is to fix all broken links on the web. Crawls of supported "No More 404" sites. TALLAHASSEE, Fla. - Siding with a coalition of individual doctors and medical groups, a federal appeals court ruled Thursday that major portions of a controversial Florida law restricting physicians and other health-care providers from asking patients about guns is unconstitutional. The statute, dubbed the "docs vs. glocks" law, included a series of restrictions on doctors and health providers. For example, it sought to prevent physicians from entering information about gun ownership into medical records if the physicians know the information is not "relevant" to patients' medical care or safety or to the safety of other people. Also, the 2011 law said doctors should refrain from asking about gun ownership by patients or family members unless the doctors believe in "good faith" that the information is relevant to medical care or safety. And the law sought to prevent doctors from discriminating against patients or "harassing" them because of owning firearms. The plaintiffs in the case, including individual doctors, argued that the restrictions were a violation of their First Amendment rights. A federal district judge agreed with them and blocked the law from going into effect. A three-judge panel of the 11th U.S. Circuit Court of Appeals upheld the constitutionality of the law in three separate rulings, but the ban keeping the law from going into effect remained in place. Thursday's 90-page decision --- comprised of two majority opinions authored by different judges, as well as a dissent --- came from the full appellate court after the plaintiffs requested what is known as an "en banc" review. The court found that the record-keeping, inquiry and anti-harassment provisions of the law are unconstitutional, but upheld the portion of the law that bars doctors from discriminating against patients who have guns. "Florida may generally believe that doctors and medical professionals should not ask about, nor express views hostile to, firearm ownership, but it'may not burden the speech of others in order to tilt public debate in a preferred direction,' " Judge Adalberto Jordan wrote in one of the majority opinions. Lawyers for the state argued that the law did not violate the First Amendment. "The act's goals are not only substantiated; they are compelling,'' the state argued in one brief. "The act shields patients who own firearms from purposely irrelevant record-keeping, questioning, discrimination, and harassment, and thereby furthers the state's compelling interest in protecting citizens' fundamental right to keep and bear arms for defense of self and state." But Jordan noted that lawmakers relied on six anecdotes as the basis for the "Firearms Owners' Privacy Act," or FOPA, and that the court's analysis focused on the First Amendment, not gun rights. "The first problem is that there was no evidence whatsoever before the Florida Legislature that any doctors or medical professionals have taken away patients' firearms or otherwise infringed on patients' Second Amendment rights. This evidentiary void is not surprising because doctors and medical professionals, as private actors, do not have any authority (legal or otherwise) to restrict the ownership or possession of firearms by patients (or by anyone else for that matter)," Jordan wrote. The court also rejected the state's argument that the restrictions in the law were minor. "Saying that restrictions on writing and speaking are merely incidental to speech is like saying that limitations on walking and running are merely incidental to ambulation," Jordan wrote. And Jordan pointed out that patients are free to refuse to answer questions about guns or firearms if they want to. "There is nothing in the record suggesting that patients who are bothered or offended by such questions are psychologically unable to choose another medical provider, just as they are permitted to do if their doctor asks too many questions about private matters like sexual activity, alcohol consumption, or drug use," he wrote. The "anti-harassment" provision in the law "forces doctors to choose between adequately performing their professional obligation to counsel patients on health and safety on the one hand and the threat of serious civil sanctions on the other," Judge Stanley Marcus wrote in the other majority opinion. But in a dissent, Judge Gerald Tjoflat argued that the state law was narrowly drawn and is an "attempt to regulate a very specific part of the relationship" between a health care provider and a patient. "It does not prevent medical professionals from speaking publicly about firearms, nor does it prevent medical professionals from speaking privately to patients about firearms so long as the physician determined in good faith the relevancy of such discussion to the patient's medical care, safety, or the safety of others," he wrote. "The act does not categorically restrict the speech of medical professionals on the subject of firearms. Instead, it simply requires an individualized, good faith judgment of the necessity of speech related to firearm ownership to provide competent medical care to a patient." Gov. Rick Scott's office is reviewing the decision, an aide said Thursday evening. House Minority Leader Janet Cruz hailed the ruling. "From the beginning, this was nothing more than a solution in search of a problem. Unfortunately, that's an all-too-common occurrence among Republicans in Tallahassee who write legislation that's intended to appeal to their base rather than the best interests of all Floridians," Cruz, D-Tampa, said in a statement. News Service of Florida

Summary: Doctors in Florida are now free to ask patients about guns in their home despite protests from the National Rifle Association. A federal appeals court struck down a provision of the so-called "Docs vs. Glocks" law barring doctors from asking patients about gun ownership unless the information is medically relevant in a 10-1 decision Thursday, noting it violates a doctor's right to free speech. The provision was included in 2011's Firearm Owners' Privacy Act after a few incidents: In one, a couple complained their doctor refused to see them because they wouldn't discuss guns, per the Miami Herald. The Washington Post puts some doctors' position thusly: That it's "within the bounds of ethical medical care for doctors to ask about gun safety at home, in the way a physician might ask parents of small children if they have a backyard pool." The court found Thursday "there was no evidence whatsoever" that doctors "infringed on patients' Second Amendment rights." Indeed, the law meant doctors could face penalties simply by "adequately performing their professional obligation," read the majority opinion, per WJXT. Florida's ACLU branch says "the court has finally put to bed the nonsensical and dangerous idea that a doctor speaking with a patient about gun safety somehow threatens the right to own a gun," per Reuters, though the issue could still be brought in front of the Supreme Court. With Thursday's decision, doctors will still be barred from discriminating against patients because they own guns. As always, patients can also refuse to answer questions from doctors.

multi_news

en

Summarize: Recent Progress to Identify and Refer Delinquent Nontax Debt for Offset The Subcommittee’s November 1997 oversight hearing on DCIA’s implementation underscored the need for progress in referring delinquent nontax debts to Treasury for offset. At about the time of the hearing, agencies had referred $9.4 billion of nontax debt over 180 days delinquent to Treasury for administrative offset. Initially, agencies had been slow to refer delinquent nontax debt for administrative offset under DCIA largely because of uncertainty as to the delinquent nontax debt that should be referred. Also, Treasury had not made a concerted effort to identify delinquent nontax debt that could be offset or to develop time frames for agencies to refer the debt for offset. In January 1998, Treasury began actively working with agencies to reach agreement on the outstanding nontax debts over 180 days delinquent that can be referred for administrative offset and to obtain commitments from the agencies on referral of those debts. Treasury initially met with the five major credit agencies—the Departments of Agriculture, Education, Housing and Urban Development, and Veterans Affairs (VA) and the Small Business Administration. Later, Treasury expanded its work to include the other CFO Act agencies. As of April 1998, the CFO Act agencies had referred about $16.7 billion of delinquent nontax debt to Treasury for administrative offset—a 78 percent increase over about 7 months. Most of this increase resulted from Treasury’s work with the agencies to bring the nontax delinquent debts they submitted for the Internal Revenue Service’s (IRS) tax refund offset program into Treasury’s administrative offset database. Debts that agencies normally would have referred to IRS for tax refund offsets in calendar year 1998 were, instead, referred to Treasury’s Financial Management Service. These debts were incorporated into the database Treasury uses for matching debts for administrative offset and then referred to IRS, which maintains a separate database. In addition to the delinquent nontax debt that has been referred for offset, the CFO Act agencies also hold considerable delinquent nontax debt that has not been referred to Treasury. According to Treasury reports, in April 1998, these agencies held $43.1 billion of nontax debt over 180 days delinquent, including the $16.7 billion of referred debt. Treasury and the CFO Act agencies have determined that $19.4 billion, or almost 75 percent, of the $26.4 billion in unreferred nontax delinquent debt would not be referred for administrative offset, at least not in the near term, for the following reasons: about $12.3 billion relates to nontax delinquent debts that are involved with bankruptcies, foreclosures, statutory forbearance, or formal appeals. An automatic stay that generally prevents the government from pursuing collection against debtors in bankruptcy is provided by 11 U.S.C. Section 362. In addition, debts in foreclosure are governed by state laws that may preclude the government from pursuing foreclosure if collection is attempted through offset. Further, debts subject to forbearance generally are not legally enforceable, thus precluding collection of the debt until the forbearance process is completed. Also, agencies generally cannot certify debts under appeal as valid and legally enforceable until the appeal process is completed. Consequently, Treasury has agreed with agencies that these types of debts should be excluded from referral for offset. about $3.6 billion involves delinquent foreign debts. Treasury has stated that, for the most part, collecting these delinquent debts through administrative offsets is infeasible primarily due to foreign diplomacy considerations and affairs of state. about $3 billion of delinquent nontax debt has been referred by agencies to DOJ for litigation. (See footnote 3.) These debts are no longer under the control of the agencies and, therefore, Treasury does not hold the agencies responsible for referring such debt for administrative offset. Rather, DOJ is to determine if, and when, such debt is referred for offset. about $525 million of delinquent nontax debt owed to HUD, much of which will be scheduled for sale, is not being required to be referred for administrative offset at this time. In addition to these categories of unreferred debt, about $7 billion of outstanding nontax debt over 180 days delinquent remains. Most of this debt involves circumstances that may delay or preclude offset. For example, the vast majority of the Department of Education’s approximate $3.1 billion of unreferred nontax delinquent debt consists primarily of debts related to student loans, most of which were being serviced by state or private guaranty agencies. According to Education officials, although delinquent debt serviced by guaranty agencies is subject to referral for administrative offset, many referrals have not yet been made because the required due process for the debtors has not been completed. Another example involves delinquent debts related to the Department of Agriculture’s (USDA) state-administered food stamp program and farm loans. According to USDA officials, the food stamp program’s delinquent debts, which totaled about $775 million, must be further reviewed by the states to determine whether these debts are in repayment status or whether the debtors have been afforded due process. Also, according to USDA officials, statutory servicing rights normally require that the farm loan debtors be offered workout alternatives prior to collection by offset. As such, this debt, which totaled about $420 million, will not be made available for offset until this statutory process has been completed. Finally, according to a DOD official, DOD delinquent debts totaling about $2 billion are primarily in protest or dispute. Accordingly, these debts have not yet been referred to Treasury for offset. Few Payments Brought Into Administrative Offset Program While referring all legally enforceable delinquent nontax debts for offset is an essential element of an effective administrative offset program, the program’s objectives cannot be achieved in the absence of another equally essential element—payments that can be offset. As discussed later, systems development problems have hampered Treasury’s ability to attempt to bring additional payments into its administrative offset program. Currently, payments that are available for administrative offset are limited to (1) vendor payments disbursed by Treasury and (2) retirement payments made by the Office of Personnel Management (OPM). These types of payments have been in the administrative offset program since 1996. Further, they comprised about 5 percent of the total number of disbursements made, and about 21 percent of the total dollars paid, by Treasury disbursing offices during fiscal year 1997. In addition, although almost all of the vendor payments disbursed by Treasury are currently available for administrative offset, many of these payments cannot be matched against debtor information in Treasury’s delinquent debtor database because the vendor records do not contain Taxpayer Identification Numbers (TIN). According to Treasury, during March 1998, about one-third of the payment requests submitted by the agencies for payment by Treasury did not include TINs. Further, Treasury does not yet know the total number of federal payments that may be available for administrative offset. In addition to federal payments made by Treasury, more than 50 Non-Treasury Disbursing Offices (NTDO) make federal payments. However, Treasury has not yet identified the total volume of NTDO payments, which include those made by DOD, the U.S. Postal Service (USPS), and numerous other federal agencies. Moreover, Treasury has not yet fully determined the extent to which payments will be exempt from administrative offset. Currently, Treasury has a request pending from the Pension Benefit Guaranty Corporation for discretionary exemption for a number of payment types, including those related to premium refunds to pension plans. In the future, other agencies may identify payments exempt by statute or request means-tested or discretionary exemption of payments. To date, Treasury has primarily relied on the agencies to identify potentially exempt payments. For example, VA informed Treasury that certain payments were exempted based on Section 5301(a) of Title 38, and Treasury confirmed the exemption. In addition, the Social Security Administration (SSA) and USDA requested and received exemptions for Supplemental Security Income and certain Food and Consumer Services payments, respectively, based on DCIA’s requirement that the Treasury Secretary exempt payments under means-tested programs. At this stage, Treasury does not know the total effect on the administrative offset program of payments that will be excluded from the program in accordance with DCIA, or other statutory provisions, and on the basis of requests for exclusions by heads of agencies. To facilitate implementation of payments into the administrative offset program, Treasury is developing several regulations applicable to payment issues. Some regulations have been published as Interim Rules (for example, those relating to federal salary offset), while others are currently being drafted or are with another agency for comment. For example, the rule for offset of federal benefit payments has been forwarded to SSA for consultation. Retirement and Survivors Benefits and Disability Insurance Benefits under the Social Security Program accounted for about 61 percent of the number of payments made by Treasury Disbursing Offices in fiscal year 1997. According to Treasury’s most recent DCIA Implementation Plan, it does not intend to publish a final rule for offsetting federal benefit payments, including Social Security payments, until October 1998. In addition, according to Treasury and SSA officials, even if the final rule were published, SSA will not be ready to make required systems changes until 1999 because of demands on its staff related to the Year 2000 computing crisis. Offset Programs Not Yet Consolidated One of the DCIA’s goals is to minimize debt collection costs by consolidating related functions and activities. To date, however, Treasury has not yet consolidated the administrative, tax refund, and federal salary offset programs. The Federal Tax Refund Offset Program (TROP) has been a cooperative effort of IRS and the federal program agencies. Legislation, beginning with the Deficit Reduction Act of 1984 (Public Law 98-369), authorized the use of tax refund offsets to recover delinquent federal nontax debts. The Emergency Unemployment Compensation Act of 1991 (Public Law 102-164) provided permanent authority to use tax refund offsets. Since TROP’s inception in 1986, approximately $8.5 billion of delinquent debt has been recovered through the program. The Debt Collection Act of 1982 authorized, but did not require, federal salary offsets and administrative offsets to liquidate delinquent nontax debt owed to federal agencies. The DCIA requires agencies to participate in an annual matching of records to identify federal employees delinquent on federal debts. Since 1987, the federal employee salary offset program has been a cooperative effort between the federal agencies and DOD’s Defense Manpower Data Center (DMDC). Under the program, DMDC performs the computer matching necessary to identify federal employees who are delinquent on their debts using delinquent nontax debtor files provided by the various creditor agencies. DMDC matches these files against active and retired civilian employment files provided by OPM, as well as against DOD’s active, retired, and reserve military personnel files. Under a similar program, creditor agencies submit delinquent nontax debtor files to USPS for matching against USPS personnel files. According to Treasury data, during fiscal year 1997, agencies collected over $42 million through these programs. Treasury’s lack of progress in consolidating the offset programs is primarily the result of its problems with the development of a new administrative offset system. I would now like to highlight these problems. Systems Development Problems Must Be Effectively Addressed Treasury does not have a system that can perform all the administrative offset functions envisioned as a result of DCIA. This can be directly attributed to problems Treasury has experienced in managing the development of such a system. Although Treasury has recently taken several actions to address systems development issues, it will be some time before enough information is available to accurately assess the effectiveness of those actions. In addition, we have identified several areas where additional actions must be taken immediately to reduce the risk of further system development problems. Prior to the passage of DCIA in April 1996, Treasury in conjunction with the Federal Reserve Bank of San Francisco (FRBSF), developed a pilot system to demonstrate the feasibility of conducting administrative offsets on a routine basis. The system, referred to as the Interim Treasury Offset Program (ITOP), is currently operational and is used to offset vendor payments disbursed by Treasury Disbursing Offices and OPM retirement payments. However, Treasury never intended the system, as it was originally developed, to perform all of the administrative offset functions envisioned as a result of DCIA. In September 1996, Treasury awarded a contract for the development and implementation of a new and expanded administrative offset system, known as the Grand Treasury Offset Program (GTOP). This system was to be used to consolidate the administrative, tax refund, and federal salary offset programs, and was to include all eligible delinquent federal nontax debt and federal payments. In addition, Treasury intended the system to be capable of incorporating state child support debts and other state debts, which DCIA authorizes to be recovered through federal payment offsets. GTOP was scheduled to be implemented in January 1998. However, because of systems development problems, it has not been placed into operation. Currently, Treasury is focusing its efforts on enhancing ITOP to handle all eligible debts and payments for the administrative offset program, as well as the consolidation of the administrative, tax refund, and federal salary offset programs. GTOP’s Development Treasury has concluded that it currently cannot use GTOP for the administrative offset program primarily because Treasury did not apply a disciplined system development process for that system. Treasury’s policies, including its systems life cycle methodology, and our guidancecall for the completion of a concept of operations and functional requirements in the development of a major system. The GTOP development effort was undertaken without (1) completing an overall concept of operations, which includes the high-level information flows for the system and (2) documenting the functional requirements that the system must meet. Treasury’s policies call for such generally accepted steps to be completed before a system is developed. We are unsure why the previous management team responsible for GTOP’s oversight allowed GTOP to be developed before these critical steps were completed. However, according to Treasury, the effect was that the completeness and usefulness of the software delivered by the GTOP contractor in October 1997 cannot be reasonably measured and the system cannot be tested to determine if it would meet Treasury’s needs. Thus, Treasury has not placed the system into operation. Current Treasury Efforts In December 1997, Treasury established a new management team for DCIA implementation, which includes managing a new systems development effort for the administrative offset program. The new management team has decided to halt all work on GTOP and enhance ITOP. Treasury recognizes that one of the disadvantages of this approach is that it may result in little or no return on the approximately $5 million it has paid to the contractor for development of the system software that has been delivered. However, it also believes that modifying ITOP is the most practical way to consolidate the administrative and tax refund offset programs for the 1998 tax year and to begin adding federal salary and benefit payment streams in the administrative offset program during calendar year 1998 or early 1999. According to Treasury officials, the enhancement of ITOP will comply with Treasury guidance for systems development efforts. Based on our review of documentation recently provided to us, there are indications that some of the critical system development requirements are being addressed. For example, Treasury has identified the information flows associated with several payment types and has begun to develop the corresponding functional requirements for those payment types. It has also developed a DCIA Implementation Plan that includes many of the steps necessary to enhance ITOP and projected completion dates for each step. This plan should enable Treasury management and others to promptly and objectively measure whether the ITOP enhancement is on schedule. In addition, Treasury’s Financial Management Service’s Debt Management Services is now routinely briefing the Under Secretary for Domestic Finance and other top Treasury officials on progress relating to the administrative offset program with the intention that such high-level oversight will facilitate keeping the implementation of DCIA on schedule and help to identify any significant problems early so that corrective actions can be taken promptly. While these efforts are positive steps, we have identified several areas where additional actions are needed. Actions Needed to Reduce Significant Risks Further In reviewing Treasury’s plans and actions to date, we have identified several areas where additional actions must be taken immediately to adequately reduce the risk of costly modifications and further delays in the effective implementation of the administrative offset provisions of DCIA. First, a documented overall concept of operations has not yet been developed. A concept of operations includes high-level descriptions of information systems, their interrelationships, and information flows. It also describes the operations that must be performed, who must perform them, and where and how the operations will be carried out. According to Treasury officials, they understand the importance of such a document, but until recently, have not placed a high priority of completing it because they believe the individuals involved with the project have an overall view of how the offset processes should work. After we discussed this issue with Treasury officials, they have agreed to increase the priority associated with this effort and have projected completion of an overall concept of operations in July 1998. It is important for Treasury to place a high priority on ensuring that this effort is completed on schedule because it is the primary building block on which the entire systems development effort is based. Moreover, if personnel changes occur prior to completion of the project, it would be difficult to effectively complete the project promptly without such documentation. Second, overall functional requirements for the administrative offset system are not yet available. Functional requirements, which describe a system’s functional inputs, processes, and outputs, are derived from the concept of operations and serve as the rationale for a system’s detailed requirements. They are generally expressed in user terminology and are the foundation that guides the development process. Although Treasury has begun to develop and document functional requirements for several key processes, such as federal salary and tax refund offsets, it has not developed overall functional requirements for the administrative offset system. While the development of functional requirements for each key process is a necessary step in the incremental systems development approach being used, it does not replace the need for overall functional requirements. Until the functional requirements for the overall system are defined, the requirements for a given process may not be adequate. We discussed this issue with Treasury officials, and they have agreed to increase the priority associated with this effort and have projected completion of overall functional requirements by the end of August 1998. Treasury is in the process of preparing functional requirements for certain key processes. Treasury personnel stated that for each key process, the functional requirements would be clearly defined and that a requirements traceability matrix would be developed so that a test plan could be prepared. Treasury must place a high priority on (1) completing the overall functional requirements, (2) clearly defining the specific functional requirements as they are prepared for each key process, and (3) ensuring that the key process functional requirements are consistent with the applicable overall functional requirements. This is important because many system developers and program managers have identified ill-defined or incomplete requirements as one of the root causes of system failures. In addition, as previously stated, the lack of documented functional requirements is a major reason GTOP was not able to be tested. Third, Treasury’s DCIA Implementation Plan does not yet include all facets of the administrative offset program. The most recent version of the plan, dated May 1, 1998, includes the tasks and projected milestone dates involved with several of the key processes. However, the plan does not include information on handling certain payment types, such as payments made by NTDOs (other than USPS and DOD), miscellaneous payments, and salary payments made by payroll offices other than USDA’s National Finance Center (NFC), for which Treasury makes the disbursement.According to Treasury officials, because of the priorities they have put on merging the administrative and tax refund offset programs, processing salary payments from NFC, and processing Social Security Benefit payments, they have not as yet devoted time to fully developing an overall DCIA Implementation Plan. We recognize that Treasury’s current focus is largely directed toward consolidating existing payment offset programs to improve efficiency and attempt to minimize the costs of debt collection, which is an important objective of DCIA. In addition, the degree of specificity associated with a particular facet of the program may vary depending on the priority that Treasury assigns to it. However, a complete DCIA Implementation Plan is critical to the success of Treasury’s systems development efforts. Such a plan is needed for Treasury management and others to effectively evaluate (1) how the development and implementation of the overall system is progressing and (2) when corrective action is needed to ensure that major slippages do not occur. Treasury officials have agreed to more fully develop the DCIA Implementation Plan in the near future. Fourth, Treasury has not yet completed a risk management plan. A risk management plan is critical for the successful implementation of a systems development project because it provides management and others the ability to focus their efforts on the areas that pose the greatest risks. It also outlines the actions that Treasury will take to mitigate the risks identified. Treasury officials stated that although they have not developed such a plan for the overall system, they have developed a plan for the software development efforts. A risk management plan takes on even more importance when tight time frames are involved in a given effort because it outlines the actions that will be taken should the project miss key delivery dates. Treasury officials agreed that an overall risk management plan is needed and has projected completion in July 1998. Finally, Treasury has not yet evaluated the adequacy of the hardware and software platforms. Treasury has decided to use the hardware and software platforms that were selected for GTOP until it can conduct tests to determine if these platforms are adequate. Treasury officials acknowledge that this decision increased project risk because development efforts were being based on these platforms prior to knowing whether they were adequate for the requirements of the enhanced ITOP system. However, they believe the risk is justified because (1) the hardware has already been acquired and an evaluation of the adequacy of the platforms should be completed by June 30, 1998, and (2) some work had been performed to evaluate the adequacy of the platforms before they were selected for GTOP. Management must ensure that the evaluation of the hardware and software platforms is completed by the estimated completion date of June 30, 1998. Otherwise, Treasury runs a risk that the system it is developing cannot become operational without costly modification. Treasury’s commitment to address the systems development issues we have raised is encouraging. But it will be important for Treasury’s top management to ensure that the planned corrective actions are effectively and expeditiously completed prior to making any significant investment in the development of an administrative offset system. Otherwise, Treasury is significantly exposed to the risk of costly systems modifications and additional delay in developing a system to implement the administrative offset provision of DCIA. Mr. Chairman, this concludes my statement. I would be happy to respond to any questions that you or other members of the Subcommittee may have at this time. The first copy of each GAO report and testimony is free. Additional copies are $2 each. Orders should be sent to the following address, accompanied by a check or money order made out to the Superintendent of Documents, when necessary. VISA and MasterCard credit cards are accepted, also. Orders for 100 or more copies to be mailed to a single address are discounted 25 percent. U.S. General Accounting Office P.O. Box 37050 Washington, DC 20013 Room 1100 700 4th St. NW (corner of 4th and G Sts. NW) U.S. General Accounting Office Washington, DC Orders may also be placed by calling (202) 512-6000 or by using fax number (202) 512-6061, or TDD (202) 512-2537. Each day, GAO issues a list of newly available reports and testimony. To receive facsimile copies of the daily list or any list from the past 30 days, please call (202) 512-6000 using a touchtone phone. A recorded menu will provide information on how to obtain these lists.

Summary: Pursuant to a congressional request, GAO discussed the Department of the Treasury's implementation of the administrative offset provision of the Debt Collection Improvement Act (DCIA) of 1996, focusing on: (1) the status of referrals by agencies of delinquent nontax debts to Treasury for administrative offset; (2) actions Treasury has taken and plans to take to include all eligible federal payments in the administrative offset program; and (3) actions Treasury has taken, or plans to take, to consolidate the administrative, tax refund, and federal salary offset programs. GAO noted that: (1) Treasury has recently made progress in getting the 24 agencies covered by the Chief Financial Officers (CFO) Act of 1990 to refer nontax debt over 180 days delinquent for administrative offset; (2) as of April 1998, the CFO Act agencies had referred to Treasury about $16.7 billion in nontax debt over 180 days delinquent, and Treasury has entered these delinquencies into its debtor database; (3) this is a substantial increase over the $9.4 billion that had been referred to Treasury about 7 months earlier, at about the time the congressional subcommittee held DCIA oversight hearings in November 1997; (4) as of April 1998, about $26.4 billion of reported nontax debt over 180 days delinquent had not been referred to Treasury and is unlikely to be referred in the near future; (5) on the payment side, Treasury does not yet have a system capable of matching all federal payments against the delinquent debtor database; (6) as of April 1998, 2 years after DCIA's enactment, Treasury had collected about $1.2 million of delinquent nontax federal debt through its administrative offset program; (7) payments subject to offset through the administrative offset program are limited to those made by Treasury to vendors and to federal retirees by Treasury disbursing offices in fiscal year 1997; (8) also, Treasury has made little progress in fully determining the extent to which federal payments can be made available for offset; (9) Treasury has not yet consolidated the administrative, tax refund, and federal salary offset programs; (10) Treasury's systems development problems have also caused delay in consolidating these programs and thus, any debt collection efficiencies envisioned by such a consolidation have not yet been realized; (11) in developing an administrative offset system, Treasury did not apply a disciplined systems development process; (12) the resulting system, which was planned for implementation in January 1998, was not placed into operation, and a subsequent systems development effort is under way; (13) in efforts to develop an administrative offset system, Treasury has recently taken several actions to address systems development issues; (14) it will be important for Treasury's top management to ensure that the planned corrective actions are effectively and expeditiously completed prior to making any significant investment in the development of an administrative offset system; and (15) otherwise, Treasury is significantly exposed to risks that it may experience costly modifications and additional delays in developing a system for implementing the administrative offset provision of DCIA.

gov_report

en

Summarize: A 17th-century sailor’s confession about a rape, of which he became so ashamed that he sought to cover it up for ever, has been exposed by conservation workers who discovered the note hidden under a rewritten version in his journal. The confession went unseen for more than 300 years because the sailor pasted his second account so neatly over the top of the original that scholars missed it. Edward Barlow’s lavishly illustrated journal of his extraordinary life is now held at the National Maritime Museum in Greenwich. The farm worker’s son joined the navy as a child, sailed as a teenager on the same ship as Samuel Pepys to bring Charles II back to England, survived several shipwrecks and captivity, and eventually rose to become a captain. Maritime museum in choppy waters for offering superyacht owners art advice Read more He began the journal when taken prisoner in the Dutch East Indies in 1671, and continued it when he got safely back to England. He originally wrote an excruciatingly frank account of his rape of Mary Symons, a young female servant in a house where he was lodging, an encounter he admitted was “much against her will, for indeed she was asleep but being gotten into the bed I could not easily be persuaded out again, and I confess that I did more than what was lawful or civil, but not in that manner that I could ever judge or, in the least, think that she should prove with child, for I take God to witness I did not enter her body, all though I did attempt something in that nature”. Barlow inserted a line of warning: “I found by her that women’s wombs are of an attractive quality and dangerous for a young man to meddle with.” He continued that though he wrote “a loving letter”, he wanted to “forget her and blot her out of my remembrance … as I had done with some before”. However, when his ship returned to England from Jamaica, he agreed to meet Symons and found her “weeping most pitifully and saying she was undone”. Against the advice of friends urging him that he had a good chance of finding a rich wife, Barlow married her in Deal, “a very decent marriage where we had several people of good repute”. The union celebrated with a two-day party that cost him £10. Their child was stillborn while Barlow was at sea, but they went on to have several more children and, despite initial doubts, he heaped praise on his wife: “Had I searched England over for a mate I could not have met with one more obliging and ready to do any thing that should give me content.” It was Paul Cook, a senior paper conservator at the National Maritime Museum in Greenwich, who spotted the newly pasted page and exposed Barlow’s shame. Cook was told the manuscriptwas “a problem” when he joined the museum in 1985. The document was bought at a country house sale in the early 20th century and partly published by the scholar Basil Lubbock, who then presented it to the museum. Facebook Twitter Pinterest A page from Edward Barlow’s journal, written between 1659 and 1703. Photograph: Jon Stokes/National Maritime Museum, Greenwich, London He has spent nine years working on it, reversing the damage caused by previous attempted repairs. The final effort in the 1970s, using a technique Cook says was then widely accepted, involved pasting a fine silk gauze to strengthen the pages – but it was in fact damaging Barlow’s illustrations, including battles at sea and a shark devouring a naked man, whales, an elephant and a rhinoceros. Cook became the first person in more than 300 years to read Barlow’s original words, hidden under the rewritten version, which included the weeping woman on the shore but omitted the account of the rape. Instead, Barlow wrote: “I had in part promised her at London that I would marry her … having had a little more than ordinary familiarity with her”. Roberth Blyth, a senior curator at Greenwich, who has included pages from the journal in the Tudor and Stuart navy gallery opening this week, thinks Barlow probably came back from sea, reread his journal and was horrified at how honest he had been. “By then, he is a respectably married man, with a house and children, and he must have thought: ‘is this really the account I wish to leave of myself to history? With every voyage there’s a chance I may never return, and is this what I want my children to read about their mother?’” Barlow’s spelling and punctuation are erratic, but the handwriting is beautiful, swirling across tightly ruled lines on high-quality paper, which Blyth thinks must have been pilfered from stores. “The official account is that he learned to read and write while a prisoner, where he certainly would have had time to start a journal, but that is what is technically known as bollocks,” Blyth said. “Nobody ever taught themselves to write like that – he must already have been at least partly literate, which was rare enough for an ordinary seaman.” Fate caught up on Barlow in 1706, when the ship he finally commanded, the Liampo, was wrecked off Mozambique. His bequests included a silver supper dish, two cups, four small teaspoons – and a secret that would be kept for centuries. • Pages from Barlow’s journal and a digitised version of the manuscript will go on display for the first time at the National Maritime Museum in one of four galleries opening on 20 September. Many people in Manchester will have heard the name of Edward Barlow, Ambrose Edward Barlow, born at Barlow Hall, now Chorlton Golf Club, martyred for his Catholic Beliefs in 1641 at Lancaster. But there is another Edward Barlow, born just a year after the death of Ambrose, whose life path would take a very different path. This Edward Barlow born in Whitefield in 1642 and who sailed the seven seas between 1659-1703. We know of his life because he kept a journal and it is unique in that it is as far we know the only narrative from an ordinary sailor in the restoration period who worked his way up to be captain of a merchant ship. One of six children, his father was a farm labourer and the young Edward supplemented the family income fetching horse loads of coal for which he received 2d per load. He tried his hand as a farmer’s boy, a bleacher in a cotton mill According to his journal, he told his friends at the age of sixteen that they would see him no more during one holiday. Thinking that he was bluffing, he proved them wrong, putting on his best clothes and running off to sea. His journal pictures the scene, in one of its early entries, entitled running away from my father’s house in the Whitefeld, his mother stands beckoning her hand calling him back. He became an apprentice seaman on board HMS Naseby, the flagship of Admiral Montague He appears to have travelled the world, fighting against Barbary pirates under the command of Lord Sandwich in 1661 and fighting the Dutch off the coast of Lowestoft in 1665, when the Dutch flagship famously blew up, a campaign brilliantly depicted by Barlow in his journal by a magnificent water colour of the scene. He travelled to Brazil, Portugal and China, served as a merchant on an East India Company boat and carried herring from the Clyde to the Mediterranean He was captured by the Dutch in Batavia, (modern day Indonesia) in 1673, which is where he wrote up the first installment of life story brought home in a leaky Dutch vessel. Three years later he is in Marseille over Christmas where he writes: Having put all our goods on shore that we were to deliver [to Marseilles], we walked ashore being Christmas, to take our recreation and see all about the town, which is a place of very good buildings and a pretty large town or city, where all things are very plentiful, both for meat and drink. They have a very good wine of several sorts and very cheap, especially a red wine, which is a king of wine much like to claret, only a clearer red and better wine to drink.” Food often featured in his diary, whilst a prisoner of the Dutch he wrote that “instead of good pies and roast meat, we were content with a little boiled rice and a piece of stinking beef, which they gave us three days in the week, and a quart of stinking water to drink for a day, the weather being exceeding hot.” While he also gives a lesson in the eating of turtle eggs “[Turtle’s] eggs are not so good as the flesh of them, it being very good and wholesome and very sweet, making excellent good broth. Their eggs are not like hens” eggs, but are as round as a ball, and their shell is white, and a kind of tough thick skin over them, but when the shell is dry it will break like another egg shell Man overboard was an oft heard cry about the ships and Barlow would often write of such occurrences it [was] blowing pretty hard and some of our men going up into the foretop to reef our fore topsail [reduce its size to increase stability of the ship], a young youth fell from the fore topsail yard into the sea, and was drowned, yet he could swim pretty well, but the ship driving away, and hoisting out ye boat, and it blowing very hard, the boat looked for him but could not find him, for the waves running high had swallowed him up and he was lost.”5 He would often comment on the differing nationalities that he met, the men of Lisbon were according to him “fiercely jealous and would not allow any stranger to come close to their wives”. Nor did the Spaniards allow their wives any freedom.The men “ were very proud, even if not worth a groat and with hardly victuals to put in his belly, yet he will have asword by his side and a cloak upon his back.” The 225,000-word journal, preserved in a joint of bamboo sealed with wax from the rigours of shipborne life, in some ways paints a dark picture of life on board a seventeenth century ship, the suffering of hunger, violent punishments, and fundamental lack of liberty. “ The best literary study of Barlow’s journal classifies him as an outstanding example of the mobile consciousness of early modern England’s working poor”, wrote Steve Mentz. Indeed Edward would in his journal, advise young men to follow any trade apart from going to sea where they would suffer, “ abuse, hardships and a life little better than a slave going with many a hungry belly and a wet back.”.He added that the injustices made England the worst kingdom in all of Christendom for seaman. Yet we should not forget the magnificence of the journal, Barlow improved as an artist as the years went on, sketching and later using watercolors to depict harbours, ships and animals. He appeared to enjoy depicting wildlife in particular, drawing a shark which he describes as the most “ raucous fish that swims in the sea.” He would draw gulls catching flying fish as well as an elephant and a Rhinoceros. How the journal came to be published is something of a mystery.It was written neatly on foolscap sheets and transcribed and edited by Basil Lubbock who boiught the mauscript from the Earl of Hardwicke. It had previous to that resided in the library of Sidney Lodge in Hampshire, once the home of vice admiral Sydney Yorke but the family had no idea how the manuscript had come to be there. Some have claimed that it is fake, questioning how an untutored sailor could have taught himself to write, been supplied with all the ink and kept in such good condition while at sea.Experts have studied it and believe it to be genuine, its style of writing consonant with that of contemporary sea journals.

Summary: The elegant script and color illustrations of Edward Barlow's 225,000-word diary documenting the 17th-century sailor's life at sea have been admired for some 300 years. Hidden beneath was his darkest secret: a note providing what the Guardian calls an "excruciatingly frank account" of his rape of Mary Symons, a female servant in a house in which he was staying. He would eventually marry her. "She was asleep but being gotten into the bed I could not easily be persuaded out again, and I confess that I did more than what was lawful or civil, but not in that manner that I... think that she should prove with child," he wrote. "I take God to witness I did not enter her body, all though I did attempt something in that nature." The note was uncovered by Paul Cook, a senior paper conservator at London's National Maritime Museum. He has worked to repair the diary over the last nine years and discovered a rewritten account had been carefully pasted over the first. It made no mention of the earlier rape. Barlow-who would go on to describe his wife as "obliging and ready to do any thing that should give me content"-instead wrote that "I had in part promised her at London that I would marry her... having had a little more than ordinary familiarity with her." As Barlow became a husband, father, and captain, per About Manchester, NMM curator Roberth Blyth suspects he grew to regret how forthcoming he had been and appreciate the risk of leaving that account behind for his family to read. Thanks to his handiwork, Barlow's secret was kept long after his ship went down off Mozambique in 1706.

multi_news

en

Summarize: BACKGROUND OF THE INVENTION The invention relates to orthopedic leg braces and especially those which brace the upper and the lower portions of a user&#39;s leg and which incorporate a knee joint assembly. Attention is called to the following patents: ______________________________________4,361,142 11/30/82 Lewis et al4,289,122 9/15/81 Mason et al3,826,251 7/30/74 Ross3,575,166 4/20/71 Rosman et al3,557,782 1/26/71 Wafer3,552,786 5/12/69 Schmid3,230,952 1.25/66 Terron2,949,111 8/16/60 Ruotoistenmaki2,107,095 2/1/38 Wagner______________________________________ It is well known, as is extensively discussed in the Lewis et al patent, for example, that there is particular difficulty in providing knee orthoses which provide stability while duplicating or accommodating the complex actions of a normal knee during flexion and extension. The long term need for a leg or leg braces stems from loss of neuro-muscular control and it is particularly for such long term use that the invention is useful. For stability or bracing, the bracing is required to be secured firmly to the leg both below and above the knee and with the knee joint intervening between the bracings. If the knee joint is not effective to duplicate the compound, complex actions of a normal knee, not only is needless reaction imposed upon the user&#39;s knee during flexion and extension, but the tendency for relative movement between the firmly secured bracings and the user&#39;s leg is also a certainty. The former may well be injurious to the user and the latter results in proclivity to chafing, soreness or the like. BRIEF SUMMARY OF THE INVENTION It is, therefore, of concern to provide a knee orthosis which overcomes the above problems. At the same time, it is desired that the device be particularly suited for long term use and, to that end, it is of light weight and is simple to remove and replace by the user without the need for assistance. Moreover, the unit is modular so that it is easily modified from time-to-time to accommodate for the user&#39;s growth. At the same time, the device is not bulky and for that reason may be worn beneath normal clothing so as to be relatively unobtrusive. This is important particularly for children, although its benefit should not be disregarded for all classes of potential users. Although the invention in its most fundamental form is especially applicable as a knee orthosis, the addition of upper thigh and hip bracings, united by a hip joint, is also within the scope of the invention. Of basic concern is the utilization of upper and lower bracing elements, firmly secured to the user&#39;s leg respectively above and below the knee, knee joint means carried by the respective bracing elements and interengaged to duplicate or at least approximate for the compound, complex actions of a normal knee, a flexible tension member, and means for variably altering the tension imparted to the tension member so that, with increased tension, the entire structure tends to become a rigid and aligned unit particularly useful when the leg is extended and, wth diminished tension, the structure is easily flexed at the knee joint to duplicate or accommodate the compound, complex actions of a normal knee. In a preferred embodiment, a pair of lower brace members are united to lie along the inner and outer sides of a user&#39;s leg and are provided with securing means for firmly anchoring them to the lower portion of a user&#39;s leg. A pair of upper brace members likewise are united and are provided with securing means for firmly anchoring them to the user&#39;s thigh. The upper and lower brace members have proximal ends which are joined by knee joint means which allows pivotal and sliding movement so that as a user&#39;s leg is flexed or extended, the normal action of a human knee is accommodated. A user actuated tensioning means is employed to frictionally engage elements of the knee joint means so as to form a rigid brace between upper and lower members when the user&#39;s leg is extended and a locking device may additionally be provided, responsive to the tensioning means, to effect a positive locking action. In this preferred embodiment, part of the uniting means for the lower brace members may be in the form of an ankle-foot orthosis. The tensioning means includes a flexible member such as a cable and which preferably acts to string some of the elements together in bead-like fashion. This allows the brace assembly to be of very compact form so that it may be worn beneath a user&#39;s clothing, while at the same time permitting the novel knee movement simulation and rigid bracing action. It also allows the aforesaid ease of modification from time-to-time to accommodate for the user&#39;s growth, i.e., it is of modular form. These and other objects of the invention will become apparent as the following Description proceeds. BRIEF DESCRIPTION OF THE DRAWING FIGURES FIG. 1 is a perspective view of one embodiment of the invention; FIG. 2 is an enlarged perspective view of portions of upper and lower brace members connected by a knee joint; FIG. 3 illustrates the components of FIG. 2 in exploded relation; FIG. 4 is a partial section of the knee joint illustrated in FIG. 3; FIG. 5 is a partial section as indicated by section line 5--5 in FIG. 4; FIG. 6 is a horizontal section as indicated by section line 6--6 in FIG. 4; FIG. 7 is a horizontal section through one of the base members as indicated by section line 7--7 in FIG. 4; FIG. 8 is a perspective view of another embodiment of the invention; FIG. 9 is a perspective view similar to FIG. 1; FIG. 10 is a perspective view of a further embodiment of the invention; FIG. 11 is a diagrammatic view illustrating the need for sliding connection in the knee joint of the brace; FIG. 12 is a perspective view of still another embodiment of the invention using a modified knee joint; FIG. 13 is an exploded perspective view of the modified knee joint; FIG. 14 is an elevation of upper and lower brace members connected by the modified knee joint; FIG. 15 is a view similar to FIG. 14 but showing the modified knee joint in flexed position; FIG. 16 is a vertical section taken along section line 16--16 in FIG. 15; FIG. 17 is a diagrammatic view illustrating one form of tensioning means; and FIG. 18 is a diagrammatic view illustrating another form of tensioning means. DETAILED DESCRIPTION OF THE INVENTION With reference to FIG. 1, one form of the invention is illustrated therein and in this configuration it will be seen to include a lower leg assembly indicated generally by the reference character 10, an upper leg or thigh assembly indicated generally by the reference character 11, and a hip assembly indicated generally by the reference character 12. The lower assembly 10 comprises a pair of rigid, elongate side braces 13 and 14 which, in the embodiment shown, are associated with an ankle-foot orthosis indicated generally by the reference character 15. These two members 13 and 14 are rigidly interconnected by an arch-like brace or rigidifying member 16 provided with suitable padding material 17 which overlaps on the inner side of the members 13 and 14 as well and there is provided a securing means in the form of a strap 18 of flexible material such as cloth or the like and provided with a Velcro fastening joint as indicated by the reference character 19 or with other means for joining. The orthosis 15 has the lower ends of the members 13 and 14 embedded therein and thus functions, together with the member 16 to unite the brace members 13 and 14 rigidly so that they are adapted to lie alongside inner and outer sides of the user&#39;s leg from the ankle and foot region to the region of the knee. The upper assembly 11 includes the inner side member 20 and the outer side member 21 which are rigidly united by the arch-like member 22 which is provided, as is the case for the member 16 with the padding 23 overlapping the inner sides of the members 20 and 21 as shown. Also associated with these two members 20 and 21 is the securing means in the form of a flexible strap 24 again provided with a Velcro joint at 25. In this embodiment of the invention, the upper member 21 is extended as indicated by the reference character 26 to terminate in the region of the user&#39;s hip joint. A waistband member comprising a rigid arch-like construction 27 carries a short brace element or member 28 and is also provided with interior padding as at 29 and has associated with it a flexible strap 30 also having a Velcro type fastening. As thus far described, it will be appreciated that the two members 13 and 14 which form the lower brace mechanism and the upper brace member 20 and 21 are more or less in alignment with each other when the user&#39;s leg is extended as is shown in FIG. 1 and the proximal ends of these members 13,20 and 14,21 are pivotally and slidably interconnected by the knee joint means indicated generally by the reference characters 31 and 32, the details of which will be presently described. Likewise, the extension 26 and the short brace member 28 are joined by hip joint mechanism indicated generally by the reference character 34 which establishes a pivotal connection between these members, there being no necessity for the sliding connection which characterizes the knee joint means 31,32. It will be readily apparent that the orthopedic device shown in FIG. 1 may be easily removed and replaced by the user simply by disconnecting the straps 18, 24 and 30 or restrapping them in place. For added comfort, the knee joint means 31 and 32 have padding 35 and 36 associated therewith and the hip joint 34 likewise has padding 37, substantially as is shown. In addition to the components generally described above, the rigid waistband 27 carries a pawl and ratchet assembly indicated generally by the reference character 38, the pivotal axis of which is indicated at the reference character 39 for rotatably receiving the ratchet wheel 40 and the operating lever 41 thereof. The pawl (not shown) is accessible and releasable by the user, as is the lever 41. The purpose of this mechanism is to allow the user to manipulate the tensioning means which is a characteristic of this invention. In the embodiment shown, the tensioning means includes an upper flexible tension member or cable 42 and a lower flexible tension member or cable 43. One end of the cable 43 is connected to a tension spring 44 which is anchored at 45 to the lower end of the brace member 14 and the cable 43 extends upwardly within a channel of the member 14, through the knee joint means 32, through the upper member 21 and then in crossing over relation within the channel or bead 46 of the arch-like member 22 and thence downwardly within the member 20, through the knee joint means 31, and through the member 13 to connect to a further tension spring 47 which is anchored at 48 to the lower end of the member 13. The cable 42 is connected to the cable 43 by means of a suitable ring or loop so that when the pawl and ratchet mechanism 38 is operated to tension the cable against the springs 44 and 47, components of the several joints 31, 32 and 34 will be frictionally engaged so as to at least resist pivotal motions thereat and effectively function as a rigid orthopedic brace unit for the user&#39;s leg and hip in the particular embodiment shown. By releasing or relaxing the tension, the user may then allow normal pivotal motions of the knee joint means 31 and 32 and of the hip joint 34 so as to allow easy motion of the hip joint as well as the knee joint. To facilitate an understanding of the cable arrangement shown in FIG. 1, reference is had to FIG. 17. From FIG. 17, it will be appreciated that at those points where the cable 43 must be directed substantially through right angles, suitable guide elements 50 and 51 may be employed. FIG. 17 also shows the ring or loop 52 which connects the upper cable 42 to the lower cable 43, the purpose of the loop or ring connection at 52 being to allow the cable 43 to be tensioned evenly throughout its length so as to impose the same frictional interengaging force at both of the knee joint means 31 and 32. An alternative cable construction employing but a single cable is shown in FIG. 18. In this case, the single length of cable 53 is connected to one end of the tension spring 54 which is pin connected at 55 to the upper end of the member 20 and passes beneath the user&#39;s foot within the foot orthosis 15 through any suitable guiding mechanism 56 which may, if desired, be formed as extensions of the lower ends of the members 13 and 14, and thence upwardly for connection ultimately to the pawl and ratchet mechanism which is not illustrated in FIG. 18. Referring at this time more particularly to FIGS. 2-7 wherein one of the knee joint means is shown, it will be noted first of all from FIG. 7 that the brace members are formed as two halves in this embodiment, preferably metal halves of aluminum or other materials, one of which is indicated by the reference character 60 and the other by the reference character 61. The side flanges of these halves are spot welded or otherwise suitably secured together and it will be noted that their intermediate portions define a longitudinal channel 62 by virtue of the bead formations 63 formed on each half. These channels 62 receive the flexible tension member such as the cable 43, substantially as is shown. As can be seen from FIG. 4, the ends of the brace members are rounded as is indicated at reference characters 64 and the two main components 65 and 66 of the two knee joint assemblies 31,32 are recessed correspondingly to receive these ends in slip-fitted relationship therewithin, see also FIG. 5. This relationship is extremely useful when the orthopedic device is fitted to a growing person such as a child inasmuch as it will be readily apparent that at time intervals such as are indicated by growth, a new orthopedic device may be fabricated simply by replacing the various brace elements with slightly longer ones to accommodate for that growth. The construction of the knee joints 31 and 32 is probably best illustrated in FIGS. 2 and 3. As is shown in FIG. 3, the lower element 66 is provided with a top flat surface 68 interrupted by the slot or channel 69 which slot is adapted to receive the tongue 70 of the semicylindrical member indicated generally by the reference character 71. The member 71 presents a semicylindrical surface 72 and is provided with a generally fan-shaped slot 73 which receives the cable 43 or its equivalent therethrough, substantially as is shown in FIG. 3. The member 71 is adhesively secured to the upper portion of the member 66 by suitable adhesive material such as synthetic resin cured to effect the requisite bonding action of these two components together. The reason for the separate construction of the member 71 rather than integrally with the member 66 is to allow the cylindrical surface 72 to be positioned very accurately back and forth by sliding the tongue 70 in the groove 69 to fit the needs of an individual user. The opposite sides of the member 66 are provided with the side face recesses 75 and 76 which are adapted to receive the pivot bosses 77 and 78 (see also FIG. 5) which are mutually oppositely directed toward one another on the inner side of the depending leg portions 80 and 81 of the upper member 65. In addition to the boses 77 and 78, the inner sides of the legs 80 and 81 are provided with the cam surfaces 82 and 83 which are adapted to cooperate with the rounded cam corners 84 and 85 of the lower part 66 as will be more evident hereinafter when a further description of FIG. 4 is given. Between the cam surfaces 82 and 83, the juncture between the two legs 80 and 81 is formed as a saddle to present the arcuate surfaces 87 and 88 as shown in FIG. 4 which are adapted to seat upon the cylindrical surface 72 in full engagement therewith insofar as the full extents of the surfaces 87 and 88 are concerned. The two surfaces 87 and 88 are disposed on either side of the central channel 89 which passes the tensioning member 43 therethrough. When, however, the upper portion 65 is rotated with respect to the lower portion 66, the rounded corners 91 and 92 of the saddles are effective to allow the camming action illustrated by the various dashed line positions of the upper member 65 shown in FIG. 4. For example, the more the upper member 65 is rotated toward the right angular position with respect to the member 66, the rounded corner 92 becomes the only bearing point on the surface 72, the remainder of the saddle having been moved away as is clearly shown and, ultimately, the cam surfaces 82 and 83 engage their respective corners 84 and 85. The purpose of this camming action is to cause a relative sliding movement between the upper and lower portions 65 and 66. Thus, the bosses 77 and 78 ride upwardly within their recesses 75 and 76. This action may be to correspond accurately with the normal action of the user&#39;s knee. To illustrate this normal action, reference is had to FIG. 11 wherein the two distances a and b are shown. When the leg is flexed as shown in FIG. 11, the total distance a plus b has to be accommodated, the distance b being that to which the lower leg portion is extended relative to the upper leg portion and this is the extent to which the camming action must be applied to allow the lower brace members 13 and 14 to move away from, relatively, the upper brace members 20,21. When the user is standing upright or when the leg is extended, the distance b must be foreshortened as between the upper and lower brace members. The camming mechanism may be accurately constructed to accomodate precisely for the distance b for a particular user. This will assure that there is absolutely no stress or strain applied to the user&#39;s knee joint during flexion and extension of his leg and that the firmly anchored upper and lower braces will not tend to ride or creep along the user&#39;s skin such as might cause chafing or soreness. On the other hand, it is not essential that the exact duplication of the knee action be attained but, that sufficient sliding action be achieved as to alleviate any such tendencies. To aid in this application, it is appreciated that the springs such as 47 and 44 or the spring 54 will, when the tensioning means is relaxed, still have sufficient tension in them to easily allow accommodations for variations in motions as between the knee joint means and the actual normal action of the user&#39;s knee. It will also be appreciate from FIG. 4 that when the knee joint component parts 65 and 66 are in the leg extended position as is shown in full lines in that Figure, an increased tension on the cable 43 will firmly frictionally interengage the component 71 in the arcuate saddle surfaces 87 and 88 of the upper member 66. This tends to rigidly unite the upper and lower brace portions so that the user&#39;s leg is stiffened despite the fact that significant muscle deterioration is present in the leg musculature. When the user desires to flex the leg, the pawl and ratchet mechanism 38 is released to decrease the tension on the cable 43 and thus allow relatively easy sliding motion between the portions 65 and 66 for flexing the leg. FIG. 9 shows the assembly of FIG. 1 whereas FIG. 8 shows a modified form of the invention wherein the hip joint and waist connector are not employed, the pawl and ratchet 38 then being located at the thigh connection as illustrated. Alternatively, a full orthopedic hip and knee brace for both legs may be utilized as is shown in FIG. 10, in which case there will be an individual pawl and ratchet 38 for each leg. Insofar as the hip joints 34 of this invention are concerned, where used, they need not be of a sliding and pivoting type but merely provide a pivoting action and thus they may be identically constructed as is shown in FIGS. 2-7 except for the camming surfaces mentioned in connection therewith. A modified form of knee joint means is illustrated in FIGS. 12-16. In this configuration, the lower member 100 of the knee joint means is provided on one side face 101 thereof with an outstanding circular boss 102 as can be seen best in FIG. 13. The upper knee joint means component 103 is provided with a portion having a downwardly angled, elongate opening or slot 104 which is adapted to receive the boss 102 to allow the pivotal and sliding connection requisite for the proper operation of the knee joint means. As can be seen best in FIG. 16, with the boss 102 received in the opening 104 of the downwardly angulated portion 105, and with the upper and lower knee joint components 103 and 100 in the leg extended position as shown in FIG. 16, the boss 102 is seated in the upper end of the slot or opening 104 and the two cut away faces 106 and 107 of the two components 100 and 103 provide a space therebetween through which the cable 43 passes as shown. The upper member 103 has a bore receiving a locking pin 108 whose head 109 bears against a Belleville type spring 110. The inner end of the pin 108 is provided with a bore therethrough which receives the cable 43 so that when the cable is tensioned to frictionally seat the boss 102 within the slot 104, the pin 108 is inwardly retracted from its dotted line position in FIG. 16 to the full line position therein wherein the head or inner end thereof 111 seats within a recessed or detent in the inner face 107 of the lower unit 100. This provides a positive locking action when the leg is in an extended position. On the other hand, when the tensioning means is relaxed and the pin 108 is urged by the Belleville spring 110 to the dotted line position to unlock the two components 100 and 103, the user&#39;s leg may then be flexed to a position as is shown in FIG. 15. At this time, the two cam surfaces 112 and 113 come into play so as to cause the sliding action between the two knee joint means components 100 and 103 so that the boss 102 tends to travel towards the lower or opposite end of the opening 104. As has been noted hereinbefore, either one of the cable systems shown in FIGS. 17 and 18 are possible. It will be noted that whereas the cable 43 passing between connecting points 45 and 48 through the two springs 44 and 47 and over the guide means 51 and 50 can, when the cable 42 is completely relaxed, establish a predetermined tension in the springs 44 and 47 which cannot be lessened. That is to say, the only action which can happen through the ring or loop 52 is that the spring tension in 44 and 47 can be equalized and increased to achieve the requisite locking or rigidifying action necessary. In the FIG. 18 embodiment, the minimum tension in the spring 54 is not so easily controlled. Having now fully described the invention, it will be apparent to one of ordinary skill in the art that many modifications can be made thereto without departing from the spirit of scope of the invention as set forth herein.

Summary: The modular components of an orthopedic leg brace assembly are strung together in bead-like fashion on a flexible cable arrangement and the components are removable so that they may be unstrung and replaced for repair or for replacement with longer components to accommodate for a user&#39;s growth. The components include an ankle-foot orthosis and upwardly extending side braces of stanchion form with an upper securing strap arrangement for securely surrounding a user&#39;s lower leg, a second pair of side braces of stanchion form with an upper securing strap arrangement for securely surrounding a user&#39;s thigh, and knee joint assemblies joining the ends of the braces to simulate the normal action of a user&#39;s knee during flexion and extension of the leg. The flexible cable arrangement allows the user to rigidly hold the entire unit in aligned, fixed relation when the leg is extended.

big_patent

en

Summarize: By. David Kent. David Ospina has posed in his new all-black Arsenal goalkeeper's strip after finalising the £3.2million move to the Emirates that he describes as a 'dream come true'. The 25-year-old goalkeeper cemented the interest of Arsene Wenger after impressive performances for Colombia as they reached the quarter finals at the World Cup. He then completed the transfer from Nice on Sunday and will be in north London long-term after signing a four-year deal. VIDEO Scroll down to watch David Ospina break down in tears during Nice farewell. Back of the net: David Ospina poses in his new Arsenal strip after signing for £3.2million from Nice. Number to come: Ospina will be pushing for Wojciech Szczesny's starting spot. Long-term: Ospina signed a four-year deal at the Emirates after impressing for Colombia at the World Cup. Colombian goalkeeping legend Rene Higuita took to Twitter to congratulate his young countryman on his arrival in the Premier League. 'I know you and I know you will do an excellent job @Arsenal What great news brother,' Higuia wrote. Ospina is set to push Wojciech Szczesny for the No 1 shirt this season with Wenger confirming he is not the Poland keeper's support act and will start if he proves he's the best man for the job. The new man in is showing due respect to his team-mate and training partner Szczesny. 'He is a great goalkeeper, very skilful,' Ospina told Arsenal.com. 'He has been a regular at a top side like Arsenal, so he is quality. We also have the Argentine goalkeeper Damien Martinez. They are both young players but very experienced.' Support: Colombia legend Jose Rene Higuita (left) with Arsenal's new signing Ospina. Competition: Wojciech Szczesny (right) will be pushed for his place this season by Ospina (left) VIDEO Ospina signs for Arsenal. After the deal was completed Wenger said: 'David Ospina is an excellent goalkeeper, with good experience and a proven record of performing with Nice and Colombia.' 'He will add strength to our squad and we are very pleased that he will be joining us.' The keeper is expected to take the field for his new club during next weekend's Emirates Cup friendly tournament in which the Gunners face Benfica and Monaco. After his signing, Ospina posted: 'The race closes with a wonderful Nice cycle and a dream fulfilled upon arrival at Arsenal. Thank you Nissarts, Go Gunners'. In safe hands: Arsenal have announced the signing of Colombia keeper David Ospina

Summary: Arsenal signed Nice keeper Ospina in a deal worth £3.2million. He said the move to north London was 'a dream come true' The club confirmed the signing of a four-year contract on Sunday. The Colombia World Cup star has done a photo shoot in an all-black kit. Ospina will challenge Wojciech Szczesny to be club's first-choice keeper. Colombian legend Rene Higuita congratulated Ospina on Twitter.

cnn_dailymail

en

Write a title and summarize: SECTION 1. SHORT TITLE; FINDINGS. (a) Short Title.--This Act may be cited as the ``National Capital Transportation Amendments Act of 2007''. (b) Findings.--Congress finds as follows: (1) Metro, the public transit system of the Washington metropolitan area, is essential for the continued and effective performance of the functions of the Federal Government, and for the orderly movement of people during major events and times of regional or national emergency. (2) On 3 occasions, Congress has authorized appropriations for the construction and capital improvement needs of the Metrorail system. (3) Additional funding is required to protect these previous Federal investments and ensure the continued functionality and viability of the original 103-mile Metrorail system. SEC. 2. FEDERAL CONTRIBUTION FOR CAPITAL PROJECTS FOR WASHINGTON METROPOLITAN AREA TRANSIT SYSTEM. The National Capital Transportation Act of 1969 (sec. 9-1111.01 et seq., D.C. Official Code) is amended by adding at the end the following new section: ``authorization of additional federal contribution for capital and preventive maintenance projects ``Sec. 18. (a) Authorization.--Subject to the succeeding provisions of this section, the Secretary of Transportation is authorized to make grants to the Transit Authority, in addition to the contributions authorized under sections 3, 14, and 17, for the purpose of financing in part the capital and preventive maintenance projects included in the Capital Improvement Program approved by the Board of Directors of the Transit Authority. ``(b) Use of Funds.--The Federal grants made pursuant to the authorization under this section shall be subject to the following limitations and conditions: ``(1) The work for which such Federal grants are authorized shall be subject to the provisions of the Compact (consistent with the amendments to the Compact described in subsection (d)). ``(2) Each such Federal grant shall be for 50 percent of the net project cost of the project involved, and shall be provided in cash from sources other than Federal funds or revenues from the operation of public mass transportation systems. Consistent with the terms of the amendment to the Compact described in subsection (d)(1), any funds so provided shall be solely from undistributed cash surpluses, replacement or depreciation funds or reserves available in cash, or new capital. ``(c) Applicability of Requirements for Mass Transportation Capital Projects Receiving Funds Under Federal Transportation Law.--Except as specifically provided in this section, the use of any amounts appropriated pursuant to the authorization under this section shall be subject to the requirements applicable to capital projects for which funds are provided under chapter 53 of title 49, United States Code, except to the extent that the Secretary of Transportation determines that the requirements are inconsistent with the purposes of this section. ``(d) Amendments to Compact.--No amounts may be provided to the Transit Authority pursuant to the authorization under this section until the Transit Authority notifies the Secretary of Transportation that each of the following amendments to the Compact (and any further amendments which may be required to implement such amendments) have taken effect: ``(1)(A) An amendment requiring that all payments by the local signatory governments for the Transit Authority for the purpose of matching any Federal funds appropriated in any given year authorized under subsection (a) for the cost of operating and maintaining the adopted regional system are made from amounts derived from dedicated funding sources. ``(B) For purposes of this paragraph, the term `dedicated funding source' means any source of funding which is earmarked or required under State or local law to be used to match Federal appropriations authorized under this Act for payments to the Transit Authority. ``(2) An amendment establishing the Office of the Inspector General of the Transit Authority in accordance with section 3 of the National Capital Transportation Amendments Act of 2007. ``(3) An amendment expanding the Board of Directors of the Transit Authority to include 4 additional Directors appointed by the Administrator of General Services, of whom 2 shall be nonvoting and 2 shall be voting, and requiring one of the voting members so appointed to be a regular passenger and customer of the bus or rail service of the Transit Authority. ``(e) Amount.--There are authorized to be appropriated to the Secretary of Transportation for grants under this section an aggregate amount not to exceed $1,500,000,000 to be available in increments over 10 fiscal years beginning in fiscal year 2009, or until expended. ``(f) Availability.--Amounts appropriated pursuant to the authorization under this section-- ``(1) shall remain available until expended; and ``(2) shall be in addition to, and not in lieu of, amounts available to the Transit Authority under chapter 53 of title 49, United States Code, or any other provision of law.''. SEC. 3. WASHINGTON METROPOLITAN AREA TRANSIT AUTHORITY INSPECTOR GENERAL. (a) Establishment of Office.-- (1) In general.--The Washington Metropolitan Area Transit Authority (hereafter referred to as the ``Transit Authority'') shall establish in the Transit Authority the Office of the Inspector General (hereafter in this section referred to as the ``Office''), headed by the Inspector General of the Transit Authority (hereafter in this section referred to as the ``Inspector General''). (2) Definition.--In paragraph (1), the ``Washington Metropolitan Area Transit Authority'' means the Authority established under Article III of the Washington Metropolitan Area Transit Authority Compact (Public Law 89-774). (b) Inspector General.-- (1) Appointment.--The Inspector General shall be appointed by the vote of a majority of the Board of Directors of the Transit Authority, and shall be appointed without regard to political affiliation and solely on the basis of integrity and demonstrated ability in accounting, auditing, financial analysis, law, management analysis, public administration, or investigations, as well as familiarity or experience with the operation of transit systems. (2) Term of service.--The Inspector General shall serve for a term of 5 years, and an individual serving as Inspector General may be reappointed for not more than 2 additional terms. (3) Removal.--The Inspector General may be removed from office prior to the expiration of his term only by the unanimous vote of all of the members of the Board of Directors of the Transit Authority, and the Board shall communicate the reasons for any such removal to the Governor of Maryland, the Governor of Virginia, the Mayor of the District of Columbia, the chair of the Committee on Government Reform of the House of Representatives, and the chair of the Committee on Homeland Security and Governmental Affairs of the Senate. (c) Duties.-- (1) Applicability of duties of inspector general of executive branch establishment.--The Inspector General shall carry out the same duties and responsibilities with respect to the Transit Authority as an Inspector General of an establishment carries out with respect to an establishment under section 4 of the Inspector General Act of 1978 (5 U.S.C. App. 4), under the same terms and conditions which apply under such section. (2) Conducting annual audit of financial statements.--The Inspector General shall be responsible for conducting the annual audit of the financial accounts of the Transit Authority, either directly or by contract with an independent external auditor selected by the Inspector General. (3) Reports.-- (A) Semiannual reports to transit authority.--The Inspector General shall prepare and submit semiannual reports summarizing the activities of the Office in the same manner, and in accordance with the same deadlines, terms, and conditions, as an Inspector General of an establishment under section 5 of the Inspector General Act of 1978 (5 U.S.C. App. 5). For purposes of applying section 5 of such Act to the Inspector General, the Board of Directors of the Transit Authority shall be considered the head of the establishment, except that the Inspector General shall transmit to the General Manager of the Transit Authority a copy of any report submitted to the Board pursuant to this paragraph. (B) Annual reports to local signatory governments and congress.--Not later than January 15 of each year, the Inspector General shall prepare and submit a report summarizing the activities of the Office during the previous year, and shall submit such reports to the Governor of Maryland, the Governor of Virginia, the Mayor of the District of Columbia, the chair of the Committee on Government Reform of the House of Representatives, and the chair of the Committee on Homeland Security and Governmental Affairs of the Senate. (4) Investigations of complaints of employees and members.-- (A) Authority.--The Inspector General may receive and investigate complaints or information from an employee or member of the Transit Authority concerning the possible existence of an activity constituting a violation of law, rules, or regulations, or mismanagement, gross waste of funds, abuse of authority, or a substantial and specific danger to the public health and safety. (B) Nondisclosure.--The Inspector General shall not, after receipt of a complaint or information from an employee or member, disclose the identity of the employee or member without the consent of the employee or member, unless the Inspector General determines such disclosure is unavoidable during the course of the investigation. (C) Prohibiting retaliation.--An employee or member of the Transit Authority who has authority to take, direct others to take, recommend, or approve any personnel action, shall not, with respect to such authority, take or threaten to take any action against any employee or member as a reprisal for making a complaint or disclosing information to the Inspector General, unless the complaint was made or the information disclosed with the knowledge that it was false or with willful disregard for its truth or falsity. (5) Independence in carrying out duties.--Neither the Board of Directors of the Transit Authority, the General Manager of the Transit Authority, nor any other member or employee of the Transit Authority may prevent or prohibit the Inspector General from carrying out any of the duties or responsibilities assigned to the Inspector General under this section. (d) Powers.-- (1) In general.--The Inspector General may exercise the same authorities with respect to the Transit Authority as an Inspector General of an establishment may exercise with respect to an establishment under section 6(a) of the Inspector General Act of 1978 (5 U.S.C. App. 6(a)), other than paragraphs (7), (8), and (9) of such section. (2) Staff.-- (A) Assistant inspector generals and other staff.-- The Inspector General shall appoint and fix the pay of-- (i) an Assistant Inspector General for Audits, who shall be responsible for coordinating the activities of the Inspector General relating to audits; (ii) an Assistant Inspector General for Investigations, who shall be responsible for coordinating the activities of the Inspector General relating to investigations; and (iii) such other personnel as the Inspector General considers appropriate. (B) Independence in appointing staff.--No individual may carry out any of the duties or responsibilities of the Office unless the individual is appointed by the Inspector General, or provides services procured by the Inspector General, pursuant to this paragraph. Nothing in this subparagraph may be construed to prohibit the Inspector General from entering into a contract or other arrangement for the provision of services under this section. (C) Applicability of transit system personnel rules.--None of the regulations governing the appointment and pay of employees of the Transit System shall apply with respect to the appointment and compensation of the personnel of the Office, except to the extent agreed to by the Inspector General. Nothing in the previous sentence may be construed to affect subparagraphs (A) through (B). (3) Equipment and supplies.--The General Manager of the Transit Authority shall provide the Office with appropriate and adequate office space, together with such equipment, supplies, and communications facilities and services as may be necessary for the operation of the Office, and shall provide necessary maintenance services for such office space and the equipment and facilities located therein. (e) Transfer of Functions.--To the extent that any office or entity in the Transit Authority prior to the appointment of the first Inspector General under this section carried out any of the duties and responsibilities assigned to the Inspector General under this section, the functions of such office or entity shall be transferred to the Office upon the appointment of the first Inspector General under this section. SEC. 4. STUDY AND REPORT BY COMPTROLLER GENERAL. (a) Study.--The Comptroller General shall conduct a study on the use of the funds provided under section 18 of the National Capital Transportation Act of 1969 (as added by this Act). (b) Report.--Not later than 3 years after the date of the enactment of this Act, the Comptroller General shall submit a report to the Committee on Government Reform of the House of Representatives and the Committee on Homeland Security and Governmental Affairs of the Senate on the study conducted under subsection (a).

Title: A bill to amend the National Capital Transportation Act of 1969 to authorize additional Federal contributions for maintaining and improving the transit system of the Washington Metropolitan Area Transit Authority, and for other purposes Summary: National Capital Transportation Amendments Act of 2007 - Amends the National Capital Transportation Act of 1969 to authorize the Secretary of Transportation to provide additional funding through grants to the Washington Metropolitan Area Transit Authority (WMATA) to finance in part the capital and preventive maintenance projects included in the Capital Improvement Program. Subjects such grants to specified limitations and conditions. Prohibits funding to the WMATA until it notifies the Secretary that certain amendments to the Washington Metropolitan Area Transit Authority Compact have taken effect, including: (1) requiring that all local payments for the cost of operating and maintaining the adopted regional rail system are made from dedicated funding sources (i.e., funding which is earmarked or required under state or local law to be used to match federal appropriations authorized under this Act for payments to the WMATA); (2) establishing the Office of the Inspector General of WMATA; and (3) expanding the WMATA Board of Directors to include four additional Directors appointed by the Administrator of General Services. Authorizes appropriations in increments over ten fiscal years beginning in FY2009. Establishes within WMATA the Office of Inspector General. Requires the Inspector General to make specified reports on Office activities: (1) semiannually, to the WMATA Board of Directors and General Manager who shall transmit reports to the appropriate committees or subcommittees of Congress; and (2) annually, to the Governors of Maryland and Virginia, the Mayor of the District of Columbia, and Congress. Requires the Comptroller General to study and report to Congress on the use of funds provided under this Act.

billsum

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``Antibiotic Resistance Prevention Act of 2001''. SEC. 2. FINDINGS. The Congress finds as follows: (1) The discovery in the 1940s of antimicrobial drugs, such as penicillin and streptomycin, led to ground breaking treatment of day-to-day illnesses and fatal diseases. (2) Drug-resistant pathogens have developed because many physicians and other health professionals have historically overprescribed antimicrobial drugs. (3) Antimicrobial resistance can be spurred by patients seeking antibiotics for viruses rather than bacterial infections. Antibiotics are effective only for bacterial infections, not viral infections. (4) Patients who fail to finish their prescribed doses of antibiotics leave themselves vulnerable to certain bacteria, strengthening antibiotic resistance. (5) Microbes that have increasingly built up resistance to antibiotics include the microbes involved in pneumonia; ear infections and meningitis; skin, bone, lung, and bloodstream infections; urinary tract infections; food borne infections; and infections transmitted in health care settings. (6) Many other pathogens are also becoming resistant to conventional treatments, including the bacteria that cause tuberculosis and gonorrhea; the fungi that cause yeast infections; and the parasites that cause malaria. (7) A substantial but as yet undetermined percentage of all antibiotics produced in the United States are used in animals, with estimates ranging from 40 to 80 percent. A substantial percentage of these antibiotics are used nontherapeutically in feed or in the water of farm animals to make them grow faster, while only about 20 percent of antibiotic feed additives are used to treat established infections. (8) This usage of antibiotics in farm animals, at levels too low to cure bacterial diseases but high enough to control them, is creating selective pressure on bacteria, causing them to develop resistance to the antibiotics. (9) Antibiotic resistant bacteria selected in animals can reach humans and pass their resistance to bacteria pathogenic to humans or, if pathogenic themselves, can cause disease that is not easily treatable, prolonging recovery. (10) Statistics have shown that antibiotic resistance can cause the total costs of inpatient care to be more than double the direct costs of such care. (11) Expenses incurred by hospitals around the Nation have risen to nearly $1.3 billion per year as a result of six ordinary types of resistant bacteria. (12) The Institute of Medicine, the American Society for Microbiology, the World Health Organization, the Congressional Office of Technology Assessment, and the General Accounting Office each have found that the Nation should improve surveillance for mounting antimicrobial resistance problems; prolong the useful life of antimicrobial drugs; develop new drugs; and utilize other measures, such as improved vaccines, diagnostics, and infection control measures, to prevent and control antimicrobial resistance. SEC. 3. DEPARTMENT OF HEALTH AND HUMAN SERVICES; FUNDING FOR TOP PRIORITY ACTION ITEMS UNDER PUBLIC HEALTH ACTION PLAN TO COMBAT ANTIMICROBIAL RESISTANCE. (a) In General.--For the purpose of carrying out the top priority action items designated in the Antimicrobial Resistance Action Plan, but only to the extent that the activities involved are within the jurisdiction of the Department of Health and Human Services (as determined under Federal laws other than this Act), there are authorized to be appropriated such sums as may be necessary for each of the fiscal years 2002 through 2006. Such authorization is in addition to other authorizations of appropriations that are available for such purpose. (b) Top Priority Action Items.--For purposes of this Act, the term ``top priority action items'' are action items designated by number in the Antimicrobial Resistance Action Plan and included (by reference to such numbers and to the categories used in such Plan) in the following list: (1) In the category ``Surveillance'', the following action items: (A) Action Item #2, described in the Plan as follows: ``With partners, design and implement a national AR surveillance plan that defines national, regional, state, and local surveillance activities and the roles of clinical, reference, public health, and veterinary laboratories. The plan should be consistent with local and national surveillance methodology and infrastructure that currently exist or are being developed.''. (B) Action Item #5, described in the Plan as follows: ``Develop and implement procedures for monitoring patterns of antimicrobial drug use in human medicine, agriculture, veterinary medicine, and consumer products.''. (2) In the category ``Prevention and Control'', the following action items: (A) Action Item #25, described in the Plan as follows: ``Conduct a public health education campaign to promote appropriate antimicrobial use as a national health priority.''. (B) Action Item #26, described in the Plan as follows: ``In collaboration with many partners, develop and facilitate the implementation of educational and behavioral interventions that will assist clinicians in appropriate antimicrobial prescribing.''. (C) Action Item #39, described in the Plan as follows: ``Evaluate the effectiveness (including cost- effectiveness) of current and novel infection-control practices for health care and extended care settings and in the community. Promote adherence to practices proven to be effective.''. (D) Action Item #58, described in the Plan as follows: ``In consultation with stakeholders, refine and implement the proposed FDA framework for approving new antimicrobial drugs for use in food-animal production and, when appropriate, for re-evaluating currently approved veterinary antimicrobial drugs.''. (E) Action Item #63, described in the Plan as follows: ``Support demonstration projects to evaluate comprehensive strategies that use multiple interventions to promote appropriate drug use and reduce infection rates, in order to assess how interventions found effective in research studies can be applied routinely and most cost-effectively on a large scale.''. (3) In the category ``Research'', the following action items: (A) Action Item #70, described in the Plan as follows: ``Provide the research community genomics and other powerful technologies to identify targets in critical areas for the development of new rapid diagnostics methodologies, novel therapeutics, and interventions to prevent the emergence and spread of resistant pathogens.''. (B) Action Item #75, described in the Plan as follows: ``In consultation with academia and the private sector, identify and conduct human clinical studies addressing AR issues of public health significance that are unlikely to be studied in the private sector (e.g., novel therapies, new treatment regimens, and other products and practices).''. (C) Action Item #76, described in the Plan as follows: ``Identify, develop, test, and evaluate new rapid diagnostic methods for human and veterinary uses with partners, including academia and the private sector. Such methods should be accurate, affordable, and easily implemented in routine clinical settings (e.g., tests for resistance genes, point-of-care diagnostics for patients with respiratory infections and syndromes, and diagnostics for drug resistance in microbial pathogens, including in nonculture specimens).''. (D) Action Item #77, described in the Plan as follows: ``Encourage basic and clinical research in support of the development and appropriate use of vaccines in human and veterinary medicine in partnership with academia and the private sector.''. (4) In the category ``Product Development'', the following action items: (A) Action Item #79, described in the Plan as follows: ``Create an Interagency AR Product Development Working Group to identify and publicize priority public health needs in human and animal medicine for new AR products (e.g., innovative drugs, targeted spectrum antibiotics, point-of-care diagnostics, vaccines and other biologics, anti-infective medical devices, and disinfectants).''. (B) Action Item #80, described in the Plan as follows: ``Identify ways (e.g. financial and/or other incentives or investments) to promote the development and/or appropriate use of priority AR products, such as novel compounds and approaches, for human and veterinary medicine for which market incentives are inadequate.''. The 13 action items specified in this subsection all have top priority under the Plan, regardless of their order on the list. (c) Antimicrobial Resistance Action Plan.--For purposes of this Act, the term ``Antimicrobial Resistance Action Plan'' means the plan that-- (1) is entitled ``A Public Health Action Plan to Combat Antimicrobial Resistance''; and (2) was developed by an interagency Task Force on Antimicrobial Resistance, created in 1999, that-- (A) is cochaired by the Centers for Disease Control and Prevention, the Food and Drug Administration, and the National Institutes of Health; and (B) in addition includes-- (i) the Agency for Healthcare Research and Quality and the Health Resources and Services Administration; (ii) the Health Care Financing Administration; (iii) the Environmental Protection Agency; and (iv) the Department of Agriculture, the Department of Defense, and the Department of Veterans Affairs. (d) AR.--For purposes of this Act, the term ``AR'' means antimicrobial resistance.

Title: To provide for funding for the top priority action items in the interagency public health action plan that has been developed in response to the problem of antimicrobial resistance, to the extent that the activities involved are within the jurisdiction of the Department of Health and Human Services Summary: Antibiotic Resistance Prevention Act of 2001 - Authorizes appropriations for FY 2002 through 2006 for carrying out certain top priority action items designated in the Antimicrobial Resistance Action Plan (developed by an interagency Task Force on Antimicrobial Resistance in 1999) and within the jurisdiction of the Department of Health and Human Services.

billsum

en

Summarize: BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates in general to an apparatus for forming impressions of a patient&#39;s teeth, gums and oral cavity and particularly relates to a dental tray having a rigid frame supporting a thin mesh or membrane for simultaneously making accurate impressions of a patient&#39;s upper and lower teeth as well as the bite registration therebetween. 2. Description of Prior Developments Dental impression trays have long been used by dentists to form impressions of various portions of a patient&#39;s mouth and teeth. Such impressions are typically used to produce dental replacement components and dental assemblies such as crowns, teeth, bridgework, dentures and other oral prostheses. One common type of dental impression tray is used to take an impression of either an upper or lower portion of the teeth and mouth by pressing a tray filled with impression material against that area of the mouth requiring repair or reconstruction. Another type of dental impression tray, referred to herein as a multiple impression tray, is used to take impressions of both upper and lower portions of a patient&#39;s teeth and mouth and to concurrently provide an impression of the relative positions of the upper and lower teeth during a bite. The upper impression corresponds to an impression section of maxilla, the lower impression corresponds to a complimentary section of mandible and the two complimentary impressions jointly provide an impression of the bite relationship of mandible to maxilla. A typical multiple impression tray includes an upper trough and a bottom trough, each filled with impression material such as a setable rubber base material. The tray is placed in a patient&#39;s mouth and the patient is instructed to bite into the impression material until the patient&#39;s upper and lower teeth substantially abut one another. During this procedure, the impression material is displaced and extruded between portions of the tray and the patient&#39;s teeth and gums. The forces developed during this displacement and extrusion of the impression material have resulted in the formation of inaccurate and distorted impressions. That is, as the impression material is pressurized during biting, it presses against the frame of the multiple impression tray causing it to flex, bend and distort in shape. If the frame does not fully recover or if it takes a permanent set, for instance during manipulation for removal from mouth or in lab production (preparation and stone moldings) an inaccurate impression will likely result. This problem is particularly noticeable with those multiple impression trays formed of highly flexible material such as plastic or thin wire. When a dental impression is taken with such a prior art impression tray, the bending and flexing of the frame can be further exacerbated as the tray is removed from the patient&#39;s mouth. Due to the forces required to free the patient&#39;s teeth from the impression material, the tray is again flexed and often spread open and twisted causing deformation and distortion of the impressions. Even after an impression has been made, it may be subject to additional distortion in the laboratory. As a technician manipulates the impression tray while producing a mold, the tray is often again flexed or bent thereby causing the movement and relative displacement of the impression material. Although some dental impression trays have been made of metal, the particular metal used has been in the form of easily deformed wire or easily flexed sheets which provide minimal rigidity against deformation and flexing. Moreover, such trays have been known to take a permanent set once they have been bent out of shape and therefore fail to return to their original shape. In this case, the impressions taken tend to be held in a deformed condition thereby yielding unsuitable impressions. Another problem particularly applicable to multiple impression trays is the inability, in some cases, of the patient to bring the upper and lower teeth into full abutting contact due to the presence of an intervening layer of material which defines upper and lower troughs for receiving impression material. This intervening layer or membrane is required to support and hold the impression material in the upper and lower troughs of the impression tray. The presence of this intervening material, even though it may be quite thin, can prevent the required contact between the upper and lower teeth and thereby prevent an accurate impression and reproduction of the patient&#39;s bite registration. The thicker the intervening material, the less likely will be the reproduction of an accurate bite registration between maxilla and mandible. An example of such prior art support material is a gauze or a meshed material which provides support for the impression material yet also allows the impression material to flow across and through it, preferably from the upper trough to the lower or bottom trough. Even though this mesh or gauze material is relatively thin, it still can prevent the upper and lower teeth from meeting. One prior conventional approach to solving this problem has been to use mesh material having wide spacings between adjacent filaments or strands. This wide spacing allows the teeth to spread the filaments apart and thereby meet between the filaments. This in turn allows full penetration of the impression material and accurate bite registration. Another approach to solving this problem relies on the use of a nonwoven fabric material to support the impression material. This nonwoven fabric material is formed of staple fibers having predetermined lengths. As such, it is generally thick and dense and must be penetrated and pierced by the teeth. When this material is pierced and sheared, its cut ends, which are taut, can fold into the impression cavity adjacent and between the teeth. These ends then extend into the impression cavity after removal from the patient&#39;s mouth and act as foreign objects in the resulting mold. This can result in a defective, deformed or substandard prosthetic molding. Accordingly, a need exists for a dental impression tray which includes a rigid structure resistant to deflection, deformation and twisting during and after the formation of a dental impression. A further need exists for a dental multiple impression tray which is formed of a rigid material and which resists plastic deformation during the forming of dental impressions. A further need exists for a dental multiple impression tray which adequately supports a layer of impression material in both its upper and lower troughs, yet allows substantially free abutting contact between a patient&#39;s upper and lower teeth during the formation of a dental impression. Still a further need exists for a dental multiple impression tray which substantially eliminates the need for piercing an intervening layer of material which supports impression material in the upper and lower troughs of the tray. Yet a further need exists for a dental multiple impression tray which eliminates the presence of sheared filaments or strands extending into a dental impression cavity carried by the tray. SUMMARY OF THE INVENTION The present invention has been developed to fulfill the needs noted above and therefore has as an object the provision of a dental tray formed of a rigid material which resists deflection, deformation, flexing, bending and twisting during the formation of a dental impression. Another object of the invention is the provision of a dental impression tray which resists bending, flexing and deformation during its removal from a patient&#39;s mouth and during subsequent handling during laboratory work. Another object of the invention is the provision of a dental impression tray having a rigid frame which resists flexure and which also resists plastic deformation. Another object of the invention is the provision of a dental impression tray which adequately supports a layer of impression material in its upper and lower troughs, yet which also allows virtually free unobstructed contact between a patient&#39;s upper and lower teeth. Still another object of the invention is the provision of a dental impression tray which substantially eliminates the need for the piercing or shearing of an intervening layer of material during the formation of a bite registration impression. Yet another object of the invention is the provision of a dental impression tray which provides accurate dental impressions free from deformities caused by flexure, twisting or bending of the frame which supports the impression material. In order to carry out the objects noted above, a dental impression tray is constructed according to the present invention so as to limit its flexure and bending during and after the formation of a dental impression. Flexure and bending, as well as twisting and deformation of the tray, are controlled by constructing the frame of the tray with a relatively rigid material such as steel. In particular, a rigid material such as steel is selected within a specified range of elastic moduli and yield strengths so as to control and limit the flexure of the impression tray, yet prevent the occurrence of plastic deformation. Even if some elastic deformation of the simultaneous impression tray takes place, for instance during the manipulation for removal from mouth or in lab production (stone molding and preparation) the rigid frame will quickly return to its original free state thereby preventing the distortion of the impression material adjacent a patient&#39;s teeth. The cross sectional shape of the steel frame may be configured so as to maximize its resistance to flexure in a preferential direction. That is, the steel frame may be formed with a rectangular or elliptical section having a major dimension or axis extending within a plane within which the maximum bending force will be applied during bite registration. The rigid frame may be provided in the form of a high elastic modulus core rod encapsulated in a plastic material. The plastic material not only adds to the aesthetics of the impression tray but also provides a softer contact surface for engagement with a patient&#39;s mouth and teeth. Additional rigidity can be provided to the impression tray by molding a plastic support structure around the rigid core. This plastic support structure can include a pair of side walls which support and control the flow of impression material. The side walls can be shaped with grooves for receiving and anchoring the impression material within the tray. Additional rigidity may be provided in the form of plastic molded stiffening ribs. In order to minimize the interference between the impression tray and the patient&#39;s teeth during the formation of a bite registration impression, the present invention adopts in one embodiment a spun-bonded, nonwoven fabric material for supporting the impression material within the upper and lower troughs of the impression tray. This spun-bonded fabric material is formed from multiple continuous filaments having average diameters less than about 0.0007 inch and loosely spread apart. As a result, it is typically not as dense and thick as fabrics made by other methods such as weaving, knitting, warpknitting and staple nonwovens, but yet still as strong. Thus, when a patient bites through the impression material and into the spun-bonded filaments, it is less likely that the filaments will be sheared because of their smaller diameter and looser and easier spreading than nonwoven materials based on staple fibers. This spreading action prevents the formation of loose cut ends and thereby prevents such ends from causing nonconformities within the impression cavities. The presence of loose cut ends can be further reduced by mounting the filamentary fabric of spun-bonded material to the frame of the impression tray in a loose or untensioned manner. In this case, even if a filament fiber is sheared, it will not be taut as in the case of a woven knitted or warp knitted material. Rather, the sheared end will be loose and untensioned and unable to project into the impression cavity. Although a spun-bonded, continuous filament membrane functions well in this application, other membrane materials may be used provided they are selected within predetermined thickness limits. For example, a thin foil of silicone could be used, or a sheet of perforated or meshed tin, or metal foil, or individual threads oriented in a predetermined direction on the multiple tray frame. The term membrane, as used to describe the support layer between the upper and lower troughs includes foils, fabrics and individual threads. Foils include metals such as tin and plastics such as silicone. Fabrics include nonwoven materials, woven, knitted and warp knitted material. Nonwoven materials include spun-bond materials, such as synthetics, and staple fibers which include natural and synthetic fibers. Threads suitable for use as membrane 30 include continuous filaments such as monofilaments and preferably multifilaments. Examples of such multifilaments are man-made synthetic fibers. Other less suitable threads may be derived from staples which are fibers having a typical length of about 1 to 21/2 inches. Staple fibers include natural fibers, synthetic fibers and blends of the two. Woven materials are not preferred for membrane 30. Grooves provided for anchoring the impression material within the multiple impression tray are formed in such a manner that they do not extend across the full height of the sidewalls. Rather, the grooves extend toward the rigid core from the top and bottom portions of the sidewalls and end short of the core so as to define a plastic reinforcing rib surrounding the rigid core. This rib can extend partially or completely around the rigid core to resist flexure and twisting of the tray. The aforementioned objects, features and advantages of the invention will, in part, be pointed out with particularity, and will, in part, become obvious from the following more detailed description of the invention, taken in conjunction with the accompanying drawings, which form an integral part thereof. BRIEF DESCRIPTION OF THE DRAWINGS In the drawings: FIG. 1 is a top plan view of a posterior dental impression tray according to the invention; FIG. 2 is a view in partial section taken along line 2--2 of FIG. 1; FIG. 3 is a view in section taken along line 3--3 of FIG. 1; FIG. 4 is a right side elevation view of FIG. 1; FIG. 5 is a left side elevation view of FIG. 1; FIG. 6 is a view in partial section taken along line 6--6 of FIG. 1; FIG. 7 is a view in partial section taken along line 7--7 of FIG. 1; FIGS. 8(a), 8(b), 8(c), 8(d), 8(e) and 8(f) are views in cross section through various embodiments of a core rod according to the invention; FIG. 9 is a view similar to FIG. 2 showing an alternate embodiment of the invention; FIG. 10 is a top plan view of another embodiment of the invention in the form of a full arch multiple impression tray; FIG. 11 is a perspective view of an alternate embodiment of the invention; and FIG. 12 is an end view of FIG. 11 taken along line 12--12 thereof. In the various figures of the drawings, like reference characters designate like parts. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will now be described in conjunction with the drawings, beginning with FIG. 1 which depicts a dental impression tray 20 constructed in accordance with the invention. Tray 20 is adapted to simultaneously form an impression of at least a portion of a patient&#39;s upper teeth or maxilla and an impression of a complimentary portion of the patient&#39;s lower teeth or mandible. At the same time, the relative position or alignment of these upper and lower mating portions is established. The relative alignment between the upper and lower teeth is known as bite registration. Since three useful measurements are provided during a single impression procedure, this type of dental impression tray is referred to as a simultaneous impression tray. As further shown in FIGS. 1 and 2, tray 20 includes a composite frame 22 having a somewhat U-shaped configuration and formed of a relatively rigid central core rod 24 surrounded at least in part by a softer encapsulating material 26. Material 26, which may be a hard rubber or plastic material, is molded around core 24. Handle 28 (FIG. 1) may be molded from plastic material 26 at the same time that the material is molded around the central core 24. In addition, membrane 30 may be mounted to frame 22 during and by this molding operation by insert molding continuously around the membrane periphery. The frame 22 includes at least a pair of legs 21,23 connected by an arcuate end portion 25 which together define a plane within which membrane 30 is supported. As discussed further below, frame 22 is designed so as to minimize deflection of legs 21 and 23 toward and away from one another within the above-noted plane. Membrane 30 is shown in FIG. 2 as being molded to the lower face of core 24, however, any suitable connection between membrane 30 and frame 22 is contemplated in accordance with the invention. Handle 28 may be molded with a pair of opposed recesses 32,34 as shown in FIG. 3 so as to provide a convenient grip between a dentist&#39;s thumb and index finger. Frame 22 and membrane 30 define an upper trough 36 and a lower trough 38 for receiving and containing dental impression material 40 as shown in phantom in FIG. 2. The impression material 40 is coated over first and second opposed sidewalls 42,44 and membrane 30. Sidewalls are also molded from the plastic material 26 during the molding of frame 22. Although sidewalls are generally preferred, they are not always required for carrying out the invention. Each sidewall 42,44 respectively includes an inner face 46,48 having a plurality of cavities or recesses 50 formed therein. For the particular posterior form of simultaneous impression tray shown in FIGS. 1 through 7, and as best seen in FIGS. 4, 5 and 6, the first or inner sidewall 42 is both shorter in its length L and its height H than the corresponding length and height of the second or outer sidewall 44. The first or inner sidewall 42 is bordered along its upper edge by a generally arcuate top wall 52 and along its lower edge by a generally arcuate bottom wall 54. In a similar fashion, the second or outer sidewall 44 is bordered along its upper edge by a generally arcuate top wall 56 and along its lower edge by a generally arcuate bottom wall 58. Walls 52 and 54 of sidewall 42 are disposed generally symmetrically about core 24 as are walls 56 and 58 of sidewall 44. A series of longitudinally spaced cavities or recesses 50 extends from top wall 52 of inner sidewall 42 along its inner face 46 and from bottom wall 54 of inner sidewall 42 along its inner face 46 in general mutual alignment toward core 24. In similar fashion, a series of cavities 50 extends from top wall 56 of outer sidewall 44 along its inner face 48 and from bottom wall 58 of outer sidewall 44 along its inner face 48 in general mutual alignment. As seen in FIG. 2, cavities 50 do not extend completely across the respective sidewall inner faces 46,48 but rather terminate before reaching the central core 24. In this manner, a first longitudinally extending rib 60 is defined along inner face 46 and a second longitudinally extending rib 62 is defined along inner face 48. Central ribs 60 and 62 extend over and along the inner faces of core 24 which border the upper and lower troughs 36,38 in order to provide added rigidity and resistance against flexure and deformation of frame 22. Although semi-cylindrical cavities 50 are shown in the drawings as defining the central ribs 60,62 any form of recess may be used. Recesses 50 assist in the retention of the impression material 40 on the multiple impression tray 20 during the formation of a simultaneous impression and during removal of the triple tray from a patient&#39;s mouth. A particularly significant aspect of the invention is the choice of material for core 24. Core 24 is designed so that it is essentially rigid at all times yet allows for a limited amount of elastic deformation during the formation of a simultaneous impression. It is important, however, to avoid any plastic deformation of the core and frame insofar as such plastic deformation will likely result in inaccurate and defective impressions. The invention therefore provides a careful balance between the forces applied to the multiple impression tray during manipulation from removal from the mouth or in lab production (stone molding and preparation), and the elastic modulus and yield strength of the core material. In this manner, minor elastic deflection of the frame may take place with complete elastic recovery so as to maintain the impression material in close contact with the patient&#39;s teeth and gums without distortion or separation of the impression material from the patient&#39;s oral impression surfaces. It has been found that the material of core 24 should be selected with an elastic modulus of at least 10 million pounds per square inch and a yield strength of at least 50 thousand pounds per square inch. Various metals such as steel alloys are particularly well suited for this application, such as stainless steel Type 301,302 and 304, for example. Steel alloys having elastic moduli of at least 28 million pounds per square inch are readily available and particularly suited for fabricating core rod 24. Other metals, such as alloys of titanium and aluminum may be used for core 24. Moreover, core 24 may be fabricated from reinforced fiber materials such as carbon-carbon and aramid fibers. In order to provide even greater rigidity and structural integrity to the impression tray, the cross section of core 24 is designed to provide the greatest resistance to bending and flexure in the plane defined by membrane 30. That is, core 24 is designed in such a manner so as to resist the relative movement of sidewalls 42 and 44 toward and away from one another so as to prevent distortion of the impression material during the formation of an impression. This in turn minimizes the flexure of the frame 22 toward and partially away from the sides of a patient&#39;s teeth during bite registration. Referring again to FIG. 2, as well as to FIGS. 6 and 7, and particularly to FIG. 8(a), core 24 may be formed with a rectangular cross section having its major dimension or largest pair of sides extending generally parallel to a plane defined by the intersection of membrane 30 with frame 22. Stated another way, the major dimension of core 24 extends transverse to the sidewalls in a direction generally parallel and coplanar with a plane which separates the upper trough 36 from the lower trough 38 symmetrically with respect to frame 22 and core 24. The minor dimension of core 24 extends generally transverse to the plane of the membrane between the upper and lower troughs. In this manner, the minor dimension or shortest sides of core 24 face one another across the gap between sidewalls 42,44 which define the sides of troughs 36,38. This orientation of the short sides or minor dimension extends generally transverse to the above-noted plane and membrane. This orientation of core 24 provides the greatest resistance to transverse bending of frame 22 toward and away from the sides of a patient&#39;s teeth during bite registration and reduces the chance of forming an inaccurate or distorted dental impression. Alternate cross sections for core 24 taken for example through arcuate end portion 25, are shown in FIGS. 8(b), 8(c), 8(d), 8(e) and 8(f). FIG. 8(b) depicts a rectangular core 24 with chamfered edges. FIG. 8(c) depicts an oval or elliptical core 24 and FIG. 8(d) depicts a core with flat upper and lower surfaces interconnected by semi-circular sides. Other sections are of course possible. In some cases, even a round section is possible as shown in FIG. 8(e) if the limits on deflection and elasticity can be maintained. Although FIGS. 8(a) through 8(e) all depict the arcuate end portion 25 of core rod 24 as being encapsulated or coated by a thin layer of plastic or elastomeric material 26, it is possible to leave the arcuate portion 25 uncoated except for its inner edge 63 which borders membrane 30, as shown in FIG. 8(f). Edge 63 of core rod 24 may be recessed or grooved to form an interlock between material 26 and core rod 24, with material 26 serving as an intermediary bonding member for securing membrane 30 to the core rod. To add further rigidity to the multiple impression tray, a pair of external ribs may be molded to core 24 along the outer faces 64,66 of the inner and outer sidewalls 42,44. As seen in FIGS. 1, 2, 4 and 5, a first outer external rib 68 is molded around core 24 along outer face 64 of sidewall 42 and a second outer external rib 70 is molded around core 24 along outer face 66 of sidewall 44. Another significant aspect of the invention is the selection of an appropriate material for membrane 30. As noted above, membrane 30 should provide adequate support for carrying a layer of impression material, yet present little or no obstacle to contact between a patient&#39;s teeth during bite registration. One suitable material for membrane 30 is a fabric made from nonwoven spun-bonded filaments. Such a fabric will function well if its overall or average thickness is maintained at or below about 0.003 inch as it forms membrane 30. Average thickness of fabrics chosen for membrane 30 should be measured according to ASTM-D-1777-64 standards. This spun-bonded filament may be advantageously maintained within a weight to area ratio of no greater than 0.4 ounce per square yard as it extends between sidewalls 42,44. In order to ensure an adequate spacing between the fibers of the filament, its air permeability between the upper and lower troughs 36,38 should be greater than about 1100 cubic feet per minute per square foot as measured according to ASTM-D-737-75 standards. When membrane 30 is constructed of such a material, it resembles a fine gauze-like, translucent, gossamer membrane. Examples of suitable fabrics include two CEREX fabrics respectively having fabric weights of 0.3 and 0.4 ounce per square yard, average thicknesses of 2.6 and 2.9 mils, burst strengths of 9 and 12 psi, and air permeabilities of 1330 and 1110 cubic feet per minute per square foot according to standard ASTM-D-737-75. Although the spun-bonded filamentary membrane which forms membrane 30 in FIGS. 1 through 7 is held on frame 22 in a somewhat flattened state, it may also be loosely held on frame 22 as shown in FIG. 9. By loosely mounting membrane 30 to frame 22 in the manner of a loose net, membrane 30 will present virtually no resistance to deformation between the interengaged surfaces of a patient&#39;s teeth during bite registration. FIG. 9 also depicts a modification to the inner faces 46 and 48 of sidewalls 42 and 44 in that these faces diverge outwardly from frame 22. This facilitates bite registration by guiding or wedging the teeth toward membrane 30. Another possible construction of membrane 30 is an array of yarn in the form of continuous filaments spanning across the multiple impression tray. An example of such an arrangement is shown in FIG. 10 in the context of a full arch multiple impression tray 20(a). A series of parallel spaced multifilament yarns 72 is strung across frame 22(a). Twenty to forty strands may be used in the embodiment of FIG. 10 and ten to twenty strands with the embodiment of FIG. 1. Threads 72 are preferably chosen as multifilament with all the filaments together having a value of less than about 2.0 tex wherein 1.0 tex equals one gram per one thousand meters in length. A pre-oriented yarn with a draw ratio of 1:1.3 to 1:3.5 has proven effective. Instead of filaments, a perforated or continuous sheet of silicone-based film having an average thickness of about 0.001 inch to 0.002 inch may be used to form membrane 30. Alternatively, a foil of highly malleable metal, either continuous or perforated, having a thickness of about 0.0005 inch to 0.001 inch may be used to form membrane 30. An example of such a perforated silicone sheet or perforated metal foil is shown in FIG. 11 wherein membrane 30 is mounted to a posterior tray 20(b) virtually identical to tray 20 of FIG. 1. FIG. 12 provides additional details of trays 20 and 20(b). There has been disclosed heretofore the best embodiment of the invention presently contemplated. However, it is to be understood that various changes and modifications may be made thereto without departing from the spirit of the invention.

Summary: The modulus of elasticity and yield strength of a rigid core rod are set within predetermined limits as to limit the elastic deformation and prevent plastic deformation of a dental tray during multiple impression taking, bite registration and subsequent handling. The tray is formed with a frame which provides a positive recovery force when it is flexed. The cross section of the core rod may be optimized to further limit deflection in a predetermined plane. Various preferred materials including nonwoven spun-bonded filaments are selected for supporting impression material on the tray while minimizing the likelihood of obstructing a patient&#39;s teeth during full occlusion.

big_patent

en

Write a title and summarize: Human polymorphonuclear leucocytes, PMN, are highly motile cells with average 12-15 µm diameters and prominent, loboid nuclei. They are produced in the bone marrow, are essential for host defense, and are the most populous of white blood cell types. PMN also participate in acute and chronic inflammatory processes, in the regulation of the immune response, in angiogenesis, and interact with tumors. To accommodate these varied functions, their behavior is adaptive, but still definable in terms of a set of behavioral states. PMN morphodynamics have generally involved a non-equilibrium stationary, spheroid Idling state that transitions to an activated, ellipsoid translocating state in response to chemical signals. These two behavioral shape-states, spheroid and ellipsoid, are generally recognized as making up the vocabulary of a healthy PMN. A third, “random” state has occasionally been reported as associated with disease states. I have observed this third, Treadmilling state, in PMN from healthy subjects, the cells demonstrating metastable dynamical behaviors known to anticipate phase transitions in mathematical, physical, and biological systems. For this study, human PMN were microscopically imaged and analyzed as single living cells. I used a microscope with a novel high aperture, cardioid annular condenser with better than 100 nanometer resolution of simultaneous, mixed dark field and intrinsic fluorescent images to record shape changes in 189 living PMNs. Relative radial roundness, R (t), served as a computable order parameter. Comparison of R (t) series of 10 cells in the Idling and 10 in the Treadmilling state reveals the robustness of the “random” appearing Treadmilling state, and the emergence of behaviors observed in the neighborhood of global state transitions, including increased correlation length and variance (divergence), sudden jumps, mixed phases, bimodality, power spectral scaling and temporal slowing. Wavelet transformation of an R (t) series of an Idling to Treadmilling state change, demonstrated behaviors concomitant with the observed transition. We remind ourselves that there are neurobiological limits on the both the resolution afforded by empirically meaningful partitions [16], and the minimal length of a neurobiologically defensible time series [17]. In these studies I must be concerned with how long the cells being observed maintain their anatomical and functional integrity and within that viability limit, how many observations I can make without the vacuous artifice of over-sampling. The issue more generally is the selection of an appropriate sample size of an intrinsically non-stationary system. Counter-intuitively, it has been shown that under certain conditions of limited information, repeated too-short sample lengths come to be computationally superior globally [18]. In the past I have dealt with this problem by studying repeated time series derived measures yielding populations of not necessarily convergent estimates [19] with, nonetheless, distributional properties of the measures, such that I can estimate each measure' s central and higher moments, range of variation and statistical differences between measures in comparisons of varying observed system state [20]. This is the approach to be taken here. It is difficult to find a global quantitative measure on the dynamics of emergent phenomenon with the nice properties of additivity, continuity and differentiability [21], [22]. Such a measure has been called an order parameter, named for its use in tracking a system' s dynamics through transitions in the system' s degree of order. In gas-liquid transitions, the order parameter is density [23], while in ferromagnet transitions, for instance, it is net magnetization [23], [24]. Perhaps the best known example of an order parameter is relative phase, the Landau-Ginsberg order parameter [23], [24], used in the phenomenological description of thermodynamic and superconducting transitions [25]. I have examined the autonomous, time-dependent shape changes of individual Idling and Treadmilling human white cells as real, spatially extended dynamical systems. I use a global measure on the PMN' s relative radial roundness, R (t), as the order parameter. R (t) = r1/r2 is computed as the ratio of the radius of the cell assumed to be an ideal circle, r1 = p/2π in which p is the sum of the pixels outlining the cell' s perimeter and r2 = (A/π) 0. 5 using the sum of the pixels within the cell' s silhouette as the cell' s area, A. R (t) = r1 (t) /r2 (t) = {p/2π/ (A/π) 0. 50} (t) computed at each time step. If both r1 and r2 were derived from an abstract, idealized circle, R (t) = r1/r2 = 1. 0, such that log{R (t) = r1/r2} = 0, the characteristic lower limit of a generic order parameter. Deviations from this reference characterize changes in state [21]–[23], [25]. My use of the global order parameter, R (t), contrasts with a previous use of an averaged local measure, the power spectral transformation of a sequence of angles resulting from the piece wise linear segmentation of the cell' s circumference [26]. The use of R (t) more closely resembles a differential geometric pattern map [27]. One hundred and eighty-nine PMNs from fifty-three peripheral blood samples were collected from 18 healthy adult volunteers, aged 26 to 72. The blood samples were allowed to sediment gravitationally for 40 minutes at room temperature. A population of PMNs (and other white cells and platelets) were removed from the buffy coat by micropipette and, along with associated plasma, placed within a 12 mm ring painted on a glass slide, forming a ∼20–25 µm deep well, compared to the average 5. 7 µm vertical space between a plain slide and its cover slip [28]. The 5. 7 µm gap of standard slides and coverslips is considerably smaller than the average diameter of PMNs, leading to some mechanical compression of the cell contributing to their activation, and allowing the cell to move along the slide substrate and cover slip simultaneously [28]. The slides used in this study do not suffer from these deficits. PMN autonomous motions were observed using an Olympus BX41 microscope fitted with CytoViva dark field and fluorescent optical illumination systems, which includes a unique, high-aperture, cardioid annular condenser (www. scitech. com. au). The CytoViva condenser makes it possible to visualize objects of below 100 nm in diameter in real time, and with the cellular samples in an unfixed, living, active state [29], [30]. Because PMNs were treated gently, avoiding perturbations of column separation and elution, it became possible to reliably study a PMN continuously for 30 to 60 minutes before the onset of granular clumping, membrane blebbing and other signs of nascent apoptosis [31]. Data collection continued until ten each Idling and Treadmilling cells met the conditions for inclusion in the study. Specifically, only cells that maintained healthy, one state behavior, and did not have contact with any extracellular objects for the entire 30 min recording period were retained for analysis. Idling PMNs are characterized by their near spheroid shape (quasi-circular in two dimensions). In this state, the microscopically visible autonomous motions are limited to standing waves on the cell surface and low amplitude fluctuations of the cell' s microvillus border. In contrast, Treadmilling PMNs demonstrate large and irregular changes in cell shape. Multiple transient, often simultaneously appearing, pseudopodia and lamelopodia emerge from the cell surface, oriented apparently randomly and without significant movement of the PMNs center of mass. The cell' s movement was less than 1. 5 times the maximum diameter of the cell over the typical ∼30 minute recording sessions. Figure 1 portrays binary color coded, characteristic silhouettes of the round Idling, Treadmilling and elliptically polarized/translocating shape-states of PMNs. Only videos micrographs of mature, segmented neutrophils that did not have contact with any cells or extracellular entities and remained visibly healthy over the thirty minutes of observation, in addition to manifesting stable state behavior were retained for further analysis. Images were collected every 2 sec for 30 min using an Optronics Microfire 1200×1600 CCD array camera [30] resulting in a 900 point R (t) series of high resolution images per PMN. The slowness of the cell shape changing motions led to the finding that more frequent sampling within the time limit of cellular integrity was obviously redundant. In the geometric computations, each primary image was used to produce two binary, 0,1, digital daughter images: an area map of A, and perimeter map of p. The 0,1 coding of the pixels of the two daughter images were converted into binary arrays and used compute the R (t) time series. In light of the above discussion of biological constraints on sample length and the intrinsic non-stationarity of the PMNs shape motion series, statistical distributions of often individually non-convergent measures made on each of the cells, serve as the basis for comparisons of Idling and Treadmilling states. Statistical evaluations are then made on populations of possibly incomplete measures, not on the raw observations. Rules of thumb concerning sample length requirements for any particular measure [32] though easily attainable in physical and computational systems, often ignore the intrinsic series limits and non-stationarity of real, behaving, biological systems. In addition to the use of the distribution of each particular kind of measure, I study an aggregate of several, often incomplete measures, each reflecting different aspects of the shape-motional dynamics of PMNs. On the R (t) of each cell, I study: (1) The central moments of the R (t) distribution, the mean S1 and standard deviation, S2, as well as the skewness, S3, indicating the asymmetry of the density distribution of R (t), estimated using the third moment, m3, divided by the cubed root of the variance squared, S3 = m3/var3/2. The kurtosis, S4, of R (t) is computed using the relation, S4 = m4/variance2 -3 [33]; (2) An estimate of the R (t)' s orbital divergence, its sensitivity to initial conditions, in a three dimensional embedding space, was computed using a generic algorithm for the leading Lyapounov exponent, Λ1 [34]; (3) Differences in a hierarchical scaling property of R (t), by computing the scaling exponent α derived from its power (frequency) spectrum, as the slope of the middle third of the linear best fit of the log power-log frequency relation [35]; (4) An example of the time dependence of the scaling of R (t) was estimated from a Morlet continuous wavelet transformation using standard algorithms [36]–[38]. To visualize the phase space behavior I used relatively denoised, three dimensional Broomhead-King, B/K, eigenfunction, Ψi embedding of the R (t) s. To do this, I computed and plotted Ψ1, Ψ2, and Ψ3 with respect to each other [39], [40]. Each R (t) series generated an M-lagged data matrix on which an MxM Hermitean autocovariance, CM, matrix was computed, with M = 8, a typical correlation decay interval. CM was then decomposed into its eigenvalue-ordered eigenvectors. The eigenvectors associated with the three largest eigenvalues were each composed with the original R (t) series to form B/K eigenfunctions Ψ1, Ψ2, and Ψ3. These formed the axes of the B/K eigenspace reconstruction. Because R (t) behavior attributable to the lower, excluded, eigenvectors accounts for the trivial, “noise” component of the variance, the resulting eigenfunction space embedding (each successive point being a triple) is relatively denoised compared with the more commonly used phase delay space construction [41]. Another graphical representation of the orbital behavior of R (t) is its two dimensional, i = τ1, j = τ2, Recurrence Plot, RP[R (t) ]i, j, introduced by Eckmann [42]. Graphical representations of RP[R (t) ]i, j are two dimensional lattices, each point computed as RPi, j = Θ (ε), i, j = 1…N, where in R2 represents the location of the orbit in phase space at time i. is the static distance defining the “closeness” threshold, and Θ is the Heavyside function. The resulting binary series, each point ε- close or not to the previous value, is coded in black and white. Here, a standard time delay three dimensional embedding was used, with delay τ = 1 [43]. If falls within the distance of, is considered to be a recurrence of, otherwise not. Clustering in RPi, j has been used to discriminate among three characteristic patterns of intermittency [44]. There were highly significant differences between the measures S2, S3, Λ1, and α that were made on the R (t) series of the PMNs in the Idling versus the Treadmilling state, see Table 1. No significant differences were found between the two distributions of S1 or S4. The qualitative differences in the shape-motional patterns implied by the statistically significant differences in the measures in Table 1 are consistent with behavior that was observed microscopically in the two pre-polarized states: (1) The small, stochastically wavy border fluctuations in cell shape of the generic Idling PMNs; (2) A range of large, simultaneously multiscale motions in cell shape variations of R (t) in the Treadmilling state. For examples, compared with Idling, the increase in asymmetric amplitude in Treadmilling is reflected in increases in S2 and S3, and the increase in shape-motional order in Treadmilling is seen in the statistically significant decrease in Λ1, the leading Lyapounov index of expansive, orbital mixing [45]. The larger, smoother, more correlated shape motions of the Treadmilling state are seen in statistically significant increases in α in the Treadmilling versus Idling states. Without a significant difference in the means of R (t), the variational measures make the discrimination between Idling and Treadmilling states. Consistent with the differences in behavior described by direct observation and the aggregate of measures (see Table 1), Figure 2 portrays the previously described {Ψ1, Ψ2, Ψ3}1…900 B/K eigenfunctions embedding of four representative Idling cells (left column) and four Treadmilling cells (right column). The phase portraits of the Idling cells reflect symmetric, small, random fluctuations around a near stationary state. Treadmilling cells manifest larger, more irregular, asymmetric phase space motions which occupy almost an order of magnitude larger volume than that by the Idling state. Another geometric, graphical treatment of the cell' s shape motional behavior is displayed in Figure 3. We see the recurrence plots, RP[R (t) ]i, j of the four representative PMNs in the Idling state (top row) and four in the Treadmilling state (bottom row), in which ε = 1 for all plots. The RP[R (t) ]i, j of the Idling cells demonstrate more homogeneous temporal distributions of returns typical of more random data with shorter correlation lengths/relaxation times. The square patches of only lightly increased density overlaid on the more uniform surround are consistent with both the visualized small amplitude oscillations in R (t) in the Idling state and with the statistical results reported in Table 1. The RP[R (t) ]i, j of cells in the Treadmilling state are, as expected, less homogenously distributed, manifesting clustering in the return times across multiple times scales, as well as apparent discontinuous changes in their phase space patterns. For example, short interval “bursting” interleaved with low amplitude, long interval behavior is seen in the Treadmilling cells' RP[R (t) ]i, j. Treadmilling PMNs RP[R (t) ]i, j portraits are consistent with recurrence patterns of intermittency [44], [46]. Four of the seven order parameter measures demonstrated statistically significant differences between the Idling and Treadmilling PMNs, Table 1. While observing and recording the real-time behavior of 189 PMNs, I witnessed many cells transitioning from one state to another among my three defined behavioral regimes. Data series including such transitions were plagued by the same complications as were the single state series (e. g., cell-cell interactions, apoptotic behavior) in addition to too short times in one or more behavioral state to allow any analysis. I was finally able to make sufficient observations portraying a single PMN shape motion transformation in real time. Figure 4 is a Morlet wavelet graph, in continuous time along the x-axis, and scale (∼wavelength) along the Y axis. Figure 4 contributes evidence for a continuous transition in shape motion state, here from Idling to Treadmilling. Table 2 lists measures before and after this single cell transition. Note that the direction and approximate magnitude of change resemble those of the population of statistically significant values in Table 1. There are established physiological mechanisms and behavior that are consistent with both our qualitative microscopic observations and quantitative aggregate measure descriptions. PMNs are known to oscillate on multiple time and space scales, from 7 sec, 70 sec, and 260 sec membrane potential fluctuations [47] and 25 sec calcium flux oscillations [48], to the ∼8 sec bound/unbound actin oscillations [49], to 21. 6 sec and 230 sec glycolytic cycles producing NAD (P) H oscillations [47], and 10 sec and 20 sec pericellular proteolysis fluctuations [48], among many others. The R (t) series in this study evidenced scaling, board band power spectra with multiple resonances [50]. It is likely some reported modes contribute to the cell shape fluctuations directly and others contribute to the emergence of other dynamical patterns. The slowest Fourier mode in Sω [R (t) ] of the Idling state had an average 8. 457 minutes oscillation, whereas that of the slowest Sω [R (t) ] of the Treadmilling state averaged a 4. 201 minutes oscillation. It is interesting that these characteristic times correspond roughly to the results of studies of the characteristic remodeling times composed of actin filament diffusion, polymerization and then turnover coordinated with cellular migratory motions [51], [52]. It appears that the transition from Idling into the intermittent Treadmilling regime occurs as the Idling state loses some of its dynamical structural stability, and its shape motion scenario becomes driven by several quasiperiodic, multi-periodic metabolic and physiological cellular oscillator mechanisms [53], [54]. As listed in Table 1 and Table 2, a comparison of Idling with Treadmilling PMNs reveals significantly different R (t) order parameter dynamics. Projected to a two dimensional plane (Figure 1), one sees an associated difference in the underlying planar geometry, with the Idling PMNs manifesting one centroids in their circularity, and the Treadmilling PMNs with two point defined, barycentric ellipses. Many characteristics of the changes in measures in the distinct single state observations and in the computable, real-time transition from Idling to Treadmilling suggest the typical signs of a phase transition [21]–[23], [25]. These included: (1) Increasing amplitude of R (t) variability seen in the S2 and S3 of the cell shape fluctuations; (2) Decreased leading Λ1 becoming less positive in the direction of zero, shadowing the leading eigenvalue of the unknown underlying partial differential equation; (3) An increase in the log-log power spectral scaling index, α, reflecting a “less white” spectral pattern of R (t) fluctuations, also consistent with slowing; (4) The Morlet wavelet transformation of a continuous time R (t), evidenced anticipatory, high amplitude slowing and a mixed phase regimes in the neighborhood of a real-time PMN shape fluctuation transition. The eigenfunction space embedding of the sequence of triples, {Ψ1, Ψ2, Ψ3}i demonstrated directly the space-time morphogenic transformation undergone by R (t) in the Treadmilling state with reference to that of the Idling cell state. Recurrence plots, RPi, j depicted increased phase space clustering consistent with the more hierarchical, intermittent dynamics of the Treadmilling PMNs in contrast with the more randomly distributed and metrically transitive space of the Idling RPi, j. It should be noted that the action spaces of less uniform intermittency and those of more uniform transitivity reflect common metastable alternatives in the dynamics of some biological sciences [48]. Finally, I have spent hundreds of hours microscopically tracking 189 individual PMN cells in the hopes of answering these questions about state and state transitions. While only one such transition was recorded with sufficient observations in both the Idling and Treadmilling states to allow statistical analyses, many transitions were observed. I have seen Idling cells transition to Treadmilling, and Treadmilling cells ball up and Idle (although with slightly ragged aprons). I have also observed numerous instances of Idling cells polarizing and Translocating until they reach some point at which point they Idle again. The only transitions that were not observed were from the Treadmilling to the polarized, single lamelopod, Translocating state or vice versa. In either case the cells ball-up briefly into an Idling appearance before changing again. See Table 3.

Title: A Third Measure-Metastable State in the Dynamics of Spontaneous Shape Change in Healthy Human's White Cells Summary: Human white blood cells, polymorphonuclear leucocytes (PMN), were microscopically imaged and analyzed as single living cells. PMN are generally observed in a spheroid Idling state transitioning to an activated, egg-shaped, translocating state when triggered by the body' s signals of infection or inflammation. Occasionally, PMN are observed in a third behavioral state that looks like dancing in place, with protrusions thrown out and retracted, sometimes several simultaneously, in apparently random directions. This behavior previously had been thought to be associated with disease. Here this third state, that I call Treadmilling, is a relatively common way that PMN from healthy people get "stuck" in an intermediate phase. Relative radial roundness, R (t), served as a computable order parameter, and time series of R (t) were derived from microscopic image series of each of 189 PMN. Only R (t) series from cells that stayed healthy, maintained a single behavioral state and did not have contact with other bodies for the 30 min recording period were analyzed further. Comparison of measures made on the R (t) series of cells in the Idling versus Treadmilling states quantitatively distinguish states and suggest behavior in the vicinity of global state transitions. Wavelet transformation of an R (t) series of a captured state change supports this finding.

lay_plos

en

Summarize: CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 60/901,553, filed Feb. 15, 2007. The entire disclosure of this prior application is hereby incorporated by reference. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT This invention has been created without the sponsorship or funding of any federally sponsored research or development program. FIELD OF THE INVENTION The present invention relates generally to the quality assurance of the precision of image-guided robotic radiosurgery systems. BACKGROUND OF THE INVENTION Robotic radiosurgery systems, such as CyberKnife™, use a high-precision robotic manipulator, with an image-guided system delivering beams of radiation to the target from multiple predefined beam directions. A robotic arm is used to position a radiation source in order to achieve flexibility in aiming radiation beams. Robot-controlled radiation devices, of which the Cyberknife™ radiosurgery system is one example, contain a linear accelerator (LINAC) mounted on a robotic arm allowing beams of radiation to be directed from any angle. This design is typically referred to as a non-isocentric design. These radiation delivery systems do not usually rotate around a fixed center or axis; therefore, a set of pre-programmed positions is often configured into the system&#39;s software to produce repeatable and accurate targeting. A pre-programmed position is defined as a node, and a set of pre-programmed positions (nodes) is defined as a “path”. In order to achieve the accuracy of SRS treatment, each node in a path must be calibrated to a high degree of precision. Most commonly, each node is calibrated so that the radiation beam axis precisely passes through a certain reference point, the alignment center, from a predefined angle. Once initially calibrated (during installation), subsequent verifications are needed to confirm that at each node the radiation beam continues to precisely pass through the alignment center from the predefined angle. The present invention provides an accurate and simple apparatus and method to accomplish the subsequent verification. Prior to the present invention, there is no apparatus or method to accomplish this verification accurately and quickly. SUMMARY OF THE INVENTION The present invention is designed to provide the necessary verifications needed to confirm that the radiation beam in an image guided SRS delivery system accurately and precisely passes through the alignment center for optimal results in radiation therapy treatments. The invention achieves verification of the alignment of each node in an image guided SRS system by using the combination of radiographic image guidance and the LINAC&#39;s internal laser beam which corresponds with the beam&#39;s central axis to precisely align a gimbal based apparatus that indicates alignment. The gimbal based apparatus provides a readout of the quantitative analysis of beam alignment. BRIEF DESCRIPTION OF THE DRAWINGS In describing the invention, reference will at times be made to the accompanying drawings in which: FIG. 1 is a perspective view of the beam detection apparatus of the present invention mounted on a gimbal assembly. FIG. 2 is another perspective view of the beam detection apparatus of the present invention mounted on a gimbal assembly, showing the alignment mirror component of the apparatus as it used in the invention. FIG. 3 is a perspective view of the present invention in use with basic components/setup of an image guided SRS system. FIG. 4 cross sectional view of one embodiment of the invention with a florescent screen-based detection assembly. FIG. 5 shows a portion of a computer screen shot of the radiographic image guided alignment results. DETAILED DESCRIPTION Before the subject invention is described further, it is to be understood that the invention is not limited to the particular embodiments of the invention described below, as variations of the particular embodiments may be made and still fall within the scope of the invention. It is also to be understood that the terminology employed is for the purpose of describing particular embodiments, and is not intended to be limiting. The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims. In the following description, numerous specific details are set forth to provide a thorough understanding of the embodiments. One skilled in the art to which this invention belongs will recognize, however, that the techniques described can be practiced without one or more of the specific details, or with other methods, components, materials, etc. In other instances, well known structures, materials or operations are not shown or described in detail to avoid obscuring certain aspects. In this specification, the singular forms “a,” “an” and “the” include plural reference unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs. FIG. 1 shows the beam detection apparatus 10 mounted on a gimbal assembly 40. The beam detection apparatus 10 houses an alignment fixture 15. One side of the beam detection apparatus 10 has a radiation detector 20 located behind the alignment fixture 15. The beam detection apparatus 10 is made of a radio-lucent durable material such as lucite or other suitable material known to one skilled in the art to which this invention belongs. The alignment fixture 15 is made of radio opaque material such as steel or other suitable material known to one skilled in the art to which this invention belongs. A common rotation center of a gimbal is the defined as the point where the two rotation axis of the gimbal intersect and is that point in space that remains stationary when the gimbal is rotated in either axis. The alignment fixture 15 is placed at the gimbal assembly&#39;s common rotation center which is to be positioned at the SRS system&#39;s alignment center 14. The alignment fixture 15 can take on symmetric geometric shapes such as a square/cube, triangle/pyramid or the like shape in other embodiments of this invention. The alignment fixture 15 can also be an array of radio-opaque markers positioned symmetrically at the gimbal assembly&#39;s common rotation center or the like in other embodiments of this invention. In this embodiment of the present invention, the alignment fixture 15 is a metallic ball. FIG. 2 shows the present invention with the radiation beam detection apparatus 10 mounted on a gimbal assembly 40. A radiation detector 20 such as film is attached to the beam detector apparatus 10. The alignment mirror 18 is shown supported by the beam detector apparatus 10, such that it is parallel to the radiation detector 20. A laser light beam 5 which corresponds to the central axis is shown exiting the LINAC 50 and striking the alignment mirror. The alignment mirror 18 is used to indicate when the radiation detector 20 is perpendicular to the beam central axis. The beam detector apparatus 10 supports the alignment mirror 18 and the radiation detector 20, which are parallel to each other on either side of the alignment fixture 15. The alignment fixture 15 is located at an appropriate distance from the radiation detector 20 in the current embodiment, approximately 2 cm. The gimbal assembly 40 has two axes of rotation 25 and 30, as shown in FIGS. 1 and 2. This permits the radiation detector 20 to be oriented perpendicular to the central axis at each node. In the current embodiment, markings on the gimbal assembly 40 provide the orientation of the alignment fixture 15 in both axes 25 and 30. Although the current embodiment provides for manually adjusting the gimbal 40, future embodiments will provide motorized adjustment, which will be integrated into the quality assurance software computer program. FIG. 3 shows the apparatus of the present invention as it is used with an image guided SRS system. The beam detector apparatus 10 mounted on a gimbal assembly 40 is positioned on the treatment table 65 of the SRS system and is flanked on either side by radiographic imaging detectors 57 and 62. Radiographic (x-ray) sources 55 and 60 are positioned above the treatment table 65 at a suitable angle such that the radiation emitted strikes the imaging detectors 57 and 62, aligning perpendicularly at the alignment center 14. This radiographic image guiding system is used to position the gimbal assembly&#39;s common rotation center, also the center of the alignment fixture 15, to the SRS system&#39;s alignment center. The result of this alignment process is shown in part by FIG. 5. The laser beam 5 that is emitted from the LINAC 45, 50 strikes the alignment mirror 18. The laser beam is reflected to its origin such that the beam central axis is considered perpendicular to the radiation detector 20. After initial calibration (installation), the orientation of each calibrated node (beam 5 ) is known. Therefore, the gimbal assembly 40 can be set according to the orientation information of each beam 5 to properly align the film 20 for measurement. As shown in FIGS. 1, 2 and 3, the detector (film) 20 is rigidly mounted in a fixed relationship with the alignment fixture 15 and rotates with the center of the gimbal assembly 40. Either gimbal angle 25 or 30 may be adjusted to rotate and position the film 20 such that it is perpendicular to the axis of the known orientation of the calibrated node (beam). In one embodiment, the process can be fully automated, allowing interfacing between the image guided SRS system and software-controlled stepping motors to align the film 20 with a node (beam) before exposure. This method is carried out for each node. The type of radiation detectors 20 can vary depending on the measurement&#39;s efficiency requirements. Various film can be used with or without an automatic swapping mechanism. In other embodiments, instead of using film to capture images, solid-state detector arrays (such as amorphous-silicon) or florescent screens coupled with a camera can be used. FIG. 4 shows the use of a florescent screen 21 coupled with a camera 75, where a mirror 70 is used to capture the resulting images with the camera 75 for analysis. In such embodiments, the use of solid-state detector arrays or florescent screens coupled with a camera allows efficient measurement and analysis of all node positions. With additional costs, an amorphous silicon panel can be used for direct digital measurement to simplify the mechanical configuration. In the current embodiment, where the radiographic detector 20 is film, verification of beam alignment is accomplished by analyzing the field of the resulting radiographic image of the alignment fixture 15 for eccentricity. If the radiation beam 5 is perfectly aligned with the alignment center 14, and with the alignment fixture being a metallic ball, the resulting exposure on the film 20 will show a perfectly concentric circular radiation field. This invention allows verification of all pre-calibrated radiation beam positions. The analysis obtained can be utilized to re-calibrate the beam (node) alignment either manually by entering beam correction data or automatically by digitally updating beam correction data. In addition to the verification of beam alignment, by measuring the field width of 50% intensity (FWHM, or Field Width of Half Magnitude), the source-to-alignment center distance (SAD) can also be determined as described in patent application Ser. No. 12/006,629, Apparatus and Method for Robotic Radiosurgery Beam Geometry Quality Assurance, Wu, Xiaodong. It is to be understood, that the subject invention described herein is not limited to the particular embodiments of the invention described herein, as variations of the particular embodiments may be made and still fall within the scope. It is also to be understood that the terminology employed is for the purpose of describing particular embodiments, and is not intended to be limiting. It should be noted that the methods and apparatus described herein are not limited to use only with robotic radiosurgery treatment. In alternative embodiments, the methods and apparatus herein may be used in applications within other areas of the medical technology field as well as outside the medical technology field utilizing the application of radiation beams. The contents of all patents, patent applications, published articles, books, reference manuals and abstracts cited herein are hereby incorporated by reference in their entirety to more fully describe the state of art to which the invention pertains. As various changes can be made in the above-described subject matter without departing from the scope and the spirit of the invention, it is intended that all subject matter contained in the above description, shown in the accompanying drawings, or defined in the appended claims will be interpreted as descriptive and illustrative, and not in a limiting sense. Many modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described. Equivalents Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the claims.

Summary: A method and apparatus for verifying radiation beam alignment in an image guided stereotactic radiosurgery (SRS) delivery system such as the Cyberknife™. This invention achieves precise verification of radiation beam alignment with a radiation beam detection apparatus mounted on a gimbal assembly. The radiation beam detection apparatus houses an alignment fixture of varying geometric shape, such as a metallic ball or can be an array of radio-opaque markers positioned symmetrically at the gimbal assembly&#39;s common rotation center. The radiation detection apparatus comprises a radiation detector such as film and an alignment mirror, which are parallel to each other on opposite sides of the alignment fixture. The radiation detector is used to capture a radiographic image of the alignment fixture and the circular radiation field. The resulting image is analyzed to determine the eccentricity of the radiation field and whether adjustment of node positions is required to eliminate any eccentricity.

big_patent

en

Write a title and summarize: SECTION 1. SHORT TITLE. This Act may be cited as the ``America's Cup Act of 2011''. SEC. 2. DEFINITIONS. In this Act: (1) 34th america's cup.--The term ``34th America's Cup''-- (A) means the sailing competitions, commencing in 2011, to be held in the United States in response to the challenge to the defending team from the United States, in accordance with the terms of the America's Cup governing Deed of Gift, dated October 24, 1887; and (B) if a United States yacht club successfully defends the America's Cup, includes additional sailing competitions conducted by America's Cup Race Management during the 1-year period beginning on the last date of such defense. (2) America's cup race management.--The term ``America's Cup Race Management'' means the entity established to provide for independent, professional, and neutral race management of the America's Cup sailing competitions. (3) Eligibility certification.--The term ``Eligibility Certification'' means a certification issued under section 4. (4) Eligible vessel.--The term ``eligible vessel'' means a competing vessel or supporting vessel of any registry that-- (A) is recognized by America's Cup Race Management as an official competing vessel, or supporting vessel of, the 34th America's Cup, as evidenced in writing to the Administrator of the Maritime Administration of the Department of Transportation; (B) transports not more than 25 individuals, in addition to the crew; (C) is not a ferry (as defined under section 2101(10b) of title 46, United States Code); (D) does not transport individuals in point-to-point service for hire; and (E) does not transport merchandise between ports in the United States. (5) Supporting vessel.--The term ``supporting vessel'' means a vessel that is operating in support of the 34th America's Cup by-- (A) positioning a competing vessel on the race course; (B) transporting equipment and supplies utilized for the staging, operations, or broadcast of the competition; or (C) transporting individuals who-- (i) have not purchased tickets or directly paid for their passage; and (ii) who are engaged in the staging, operations, or broadcast of the competition, race team personnel, members of the media, or event sponsors. SEC. 3. AUTHORIZATION OF ELIGIBLE VESSELS. Notwithstanding sections 55102, 55103, and 55111 of title 46, United States Code, an eligible vessel, operating only in preparation for, or in connection with, the 34th America's Cup competition, may position competing vessels and may transport individuals and equipment and supplies utilized for the staging, operations, or broadcast of the competition from and around the ports in the United States. SEC. 4. CERTIFICATION. (a) Requirement.--A vessel may not operate under section 3 unless the vessel has received an Eligibility Certification. (b) Issuance.--The Administrator of the Maritime Administration of the Department of Transportation is authorized to issue an Eligibility Certification with respect to any vessel that the Administrator determines, in his or her sole discretion, meets the requirements set forth in section 2(4). SEC. 5. ENFORCEMENT. Notwithstanding sections 55102, 55103, and 55111 of title 46, United States Code, an Eligibility Certification shall be conclusive evidence to the Secretary of the Department of Homeland Security of the qualification of the vessel for which it has been issued to participate in the 34th America's Cup as a competing vessel or a supporting vessel. SEC. 6. PENALTY. Any vessel participating in the 34th America's Cup as a competing vessel or supporting vessel that has not received an Eligibility Certification or is not in compliance with section 12112 of title 46, United States Code, shall be subject to the applicable penalties provided in chapters 121 and 551 of title 46, United States Code. SEC. 7. WAIVERS. (a) In General.--Notwithstanding sections 12112 and 12132 and chapter 551 of title 46, United States Code, the Secretary of the department in which the Coast Guard is operating may issue a certificate of documentation with a coastwise endorsement for each of the following vessels: (1) M/V GEYSIR (United States official number 622178). (2) OCEAN VERITAS (IMO number 7366805). (3) LUNA (United States official number 280133). (b) Documentation of LNG Tankers.-- (1) In general.--Notwithstanding sections 12112 and 12132 and chapter 551 of title 46, United States Code, the Secretary of the department in which the Coast Guard is operating may issue a certificate of documentation with a coastwise endorsement for each of the following vessels: (A) LNG GEMINI (United States official number 595752). (B) LNG LEO (United States official number 595753). (C) LNG VIRGO (United States official number 595755). (2) Limitation on operation.--Coastwise trade authorized under paragraph (1) shall be limited to carriage of natural gas, as that term is defined in section 3(13) of the Deepwater Port Act of 1974 (33 U.S.C. 1502(13)). (3) Termination of effectiveness of endorsements.--The coastwise endorsement issued under paragraph (1) for a vessel shall expire on the date of the sale of the vessel by the owner of the vessel on the date of enactment of this Act to a person who is not related by ownership or control to such owner. (c) Operation of a Dry Dock.--A vessel transported in Dry Dock #2 (State of Alaska registration AIDEA FDD-2) is not merchandise for purposes of section 55102 of title 46, United States Code, if, during such transportation, Dry Dock #2 remains connected by a utility or other connecting line to pierside moorage. Speaker of the House of Representatives. Vice President of the United States and President of the Senate.

Title: To facilitate the hosting in the United States of the 34th America's Cup by authorizing certain eligible vessels to participate in activities related to the competition, and for other purposes Summary: America's Cup Act of 2011 - Authorizes eligible competing or supporting vessels operating only in preparation for, or in connection with, the 34th America's Cup commencing in 2011 in the United States to position competing vessels and transport individuals, equipment, and supplies for such competition in and around U.S. ports. Prohibits vessels from operating unless issued an Eligibility Certification from the Administrator of the Maritime Administration of the Department of Transportation (DOT). Subjects noncompliant vessels to certain penalties. Authorizes the Secretary of the department in which the Coast Guard is operating to issue a certificate of documentation with a coastwise endorsement for the vessels: (1) M/V GEYSIR, (2) OCEAN VERITAS, and (3) LUNA. Authorizes issuance of a certificate of documentation with a coastwise endorsement for liquefying natural gas (LNG) tanker vessels: (1) LNG GEMINI, (2) LNG LEO, and (3) LNG VIRGO. Limits authorized coastwise trade for each vessel to the carriage of natural gas, as defined in the Deepwater Port Act of 1974. Prohibits a vessel transported in Dry Dock #2 (state of Alaska registration AIDEA FDD-2), if, during such transportation, such dock remains connected by a utility or other connecting line to pierside moorage, from being considered merchandise for purposes of certain coastwise trade requirements a vessel must otherwise meet before engaging in merchandise transportation.

billsum

en

Summarize: By. Lizzie Edmonds. and Simon Cable Showbusiness Correspondent. Earlier in the day, they had greeted huge crowds outside Buckingham Palace as the country rejoiced at victory in the Second World War. And this is how – according to filmmakers, at least – the young Princess Elizabeth and Princess Margaret subsequently mingled with the masses as the raucous VE Day celebrations continued into the night. Girls’ Night Out is a fictionalised version of the evening of May 8, 1945, when the future queen and her sister slipped out of the Palace and joined in with the party spirit. Elizabeth detailed the occasion in her teenage diaries, recalling the event was ‘great fun’ as she mixed with revellers in the streets. Elizabeth's friend and cousin, the Honourable Margaret Rhodes, claimed many years later in her memoir the group slipped out of the palace to join the nation's carousing. The new film will put what it will claim is flesh on the bones of that extraordinary assertion. However, that flesh is likely to prove highly controversial as it will suggest Princess Margaret danced exuberantly in a Trafalgar Square fountain and the sisters then went on to a club in Liverpool. Trafalgar Square has been transformed for the filming of VE Day production Girl's Night Out (pictured). Hundreds of actors took to the London landmark today to film scenes for the movie - which is a re-imagining of events on May 8 1945. Revelers smile at the camera as they celebrate the end of the Second World War in Europe. It is thought more than one million people in the UK celebrated on that night - many of whom flocked to Trafalgar Square. A fictional Princess Elizabeth, played by Canadian actress Sarah Gadon grins in glee as she watches over the events taking place at the London landmark. In one fictional scene, Princess Margaret - dressed in fur and her best baby-pink gown - wades through knee-deep water in the Trafalgar Square fountains (pictured) Princess Margaret, played by Bel Powley, lifts up her skirt to make her way round the fountain in the re-imagined VE Day celebrations. The script has not been verified by the Palace - although the book on which is it based is thought to have been approved by the Queen. The fictional Princess Margaret dances in rather raucous celebration - a scene that is certainly not documented in Mrs Rhodes' extraordinary memoir. The. Final Curtsey by Margaret Rhodes was written with the. full knowledge of the Queen - who is said to have read and approved. sections of the text. However, there has been no official corroboration of its account of the VE Day celebrations. The book recounts how, on the night of May 8, the Queen. enjoyed ‘a unique burst of personal freedom; a Cinderella moment in. reverse’. Mrs Rhodes. writes: ‘I can’t remember exactly what we got up to, and so the Queen. has provided me with an aide-memoire taken from her diary entries for. that time.’ The memoir. states young Princess Margaret's diary entry for the following day. reads: 'PM announced unconditional surrender. Sixteen of us went out in. crowd, cheered parents on balcony. Up St J’s St [St James’s Street],. Piccadilly, great fun. 'Out. in crowd again – Trafalgar Square, Piccadilly, Pall Mall, walked simply. miles. Saw parents on balcony at 12.30am – ate, partied, bed 3am!’ It. also says the future Queen wrote in her diary: 'Out in crowd,. Whitehall, Mall, St J St, Piccadilly, Park Lane, Constitution Hill, ran. through Ritz. Walked miles, drank in Dorchester, saw parents twice,. miles away, so many people. Later she wrote: 'Out in crowd. again. Embankment,. Piccadilly. Rained, so fewer people. Congered into house [a reference to. the conga and Buckingham Palace]... Sang till 2am. Bed at 3am!’ Actress Sarah Gadon, who plays the young Princess Elizabeth in the film, can be seen enjoying the crowds in a fabulous pink embellished dress. Princess Elizabeth smiles and laughs with a handsome man in uniform in the controversial film. The actress looks lost in the crowd before leading a young man in full uniform through the party-goers. King George VI waves from the balcony of Buckingham on VE Day as he stands with Queen Elizabeth (centre left) and their children Princess Elizabeth (left) and Princess Margaret (right) The cast of Girls' Night Out celebrate the fall of Nazi Germany by climbing on to a lion statue in Trafalgar Square. The filming took place exactly 69 years after the original public holiday. The party continues among the crew of the film, which has an all-star cast and has been filmed in numerous locations across the country. Later in the memoir, Mrs Rhodes, writes: 'A. gang of us, including the two Princesses, were given permission by the. King and Queen to slip away anonymously and join the rejoicing crowds on. the streets. 'There must. have been about 16 of us and we had as escort the King’s Equerry, a. very correct Royal Navy captain in a pinstriped suit, bowler hat and. umbrella. 'Princess. Elizabeth was in uniform, as a subaltern in the Auxiliary Transport. Service – the ATS. She pulled her peaked cap well down over her face to. disguise her much-photographed image. Miraculously she got away with it.' Cast and crew surround the landmark's fountain in a scene which appears to be between takes. Uniformed cast members vigorously wave a selection of British and American flags in one scene. Revelers wade in to the water at the central London landmark - hitching up their skirts and shorts. The film has already caused controversy as it depicts a young Elizabeth kissing an RAF gunner. The celebrations continue for the cast members - many of whom are wearing hats and waving small Union Jacks. The film is a re-imaging of events, based on a memoir. A fun-loving cast member wrapped in a Union Jack flag with a party hat on her head smiles as she walks through the streets. The new film, Girls Night Out, however, varies from this account somewhat. In. some scenes, the young royals are seen chatting with handsome young men -. before Princess Margaret jumps into the Trafalgar Square fountain. Young. Elizabeth can be seen getting very close to a man in uniform - and is. later shown kissing a dashing young RAF Lancaster gunner. The film stars Rupert Everett. as King George VI, Emily Watson as Queen Elizabeth as well as Sarah Gadon as. Princess Elizabeth and Bel Powley as Margaret. According. to the film an adventurous Margaret, then just 15, slips away from her guards and hops on a bus. Princess. Elizabeth then races around the city in a bid to find her younger sister - finding the gunner, who has no idea who she is, along the way. As she attempts. to find Margaret, she and her companion visit a couple of sleazy Soho nightclubs - and eventually the princess's identity is revealed. Two female characters seem to be having a whale of a time drinking beer and waving their flags while wandering through the crowds on set. Men from the armed forces wave flags and drink from bottles of beer while chatting to young women. Despite what the controversial kissing scene in the film would suggest, Princess Elizabeth had already met Phillip by 1945. A cast member with a trumpet is wheeled around by a colleague. The film has been part-produced by British Pathe. Four cast members, some wearing party hats, chat to one another while another plays a trumpet while sitting in a wheelbarrow

Summary: Photographs show the dramatic re-imagination of VE day which marked the surrender of Nazi Germany in 1945. Young Elizabeth seen talking with young men, while Princess Margaret dances in Trafalgar Square fountain. Scenes are from controversial new film Girls Night Out - an adaptation of the Honourable Margaret Rhodes's memoir. The film has not been verified by the Palace - but sections of memoir thought to have been approved by the Queen.

cnn_dailymail

en