Datasets:

autoevaluate

/

autoeval-staging-eval-project-25118781-8365117

like 0

Follow

Evaluation on the Hub 34

newborn infants who sustain an acute intrapartum hypoxic ischemic insult of sufficient magnitude to result in long - term neurologic sequelae invariably have recognizable clinical encephalopathy during the first days of life . it is important to identify infants at high risk for hypoxic ischemic encephalopathy in order to provide them proper treatment soon after birth [ 3 , 4 ] . however , most newborns with perinatal asphyxia have unpredictable course ; development of hypoxic ischemic encephalopathy and neurodevelopmental outcome can not be reliably predicted[1 , 2 , 4 ] . measurements of hydroxybutyrate dehydrogenase , brain - specific creatine kinase , neuron- specific enolase , lactate dehydrogenase , and interleukin-6 , in serum or cerebrospinal fluid may have some value as markers of hypoxic severe tissue hypoxia causes the accumulation of intermediary metabolites excreted by the kidneys , notably lactate[7 , 8 ] , which can be measured readily by proton nuclear magnetic resonance ( 1h nmr ) spectroscopy[9 , 10 ] . it was previously reported that increases in urinary lactate excretion could be detected by 1h nmr spectroscopy in newborn infants with perinatal complications . in the present study , we measured urinary lactate and creatinine concentrations within the first 6 and 24 hours after birth and determined sensitivity and specificity of the ratio of urinary lactate to creatinine for the early identification of infants in whom hypoxic ischemic encephalopathy is likely to develop . we studied 50 consecutive newborn infants with perinatal asphyxia who were born in our hospitals between october 2006 and june 2007 . inclusion criteria consisted of gestational age at least 36 weeks and over 2 kg birth weight with perinatal asphyxia and some degree of hypoxic ischemic encephalopathy . perinatal asphyxia was defined as the presence of at least three of the following conditions : intrapartum distress as indicated by fetal bradycardia with a heart rate of less than 100 beats per minute , late decelerations , or absence of heart - rate variability , thick meconium - stained amniotic fluid , apgar score of 6 or less at five minutes ; need for resuscitation for more than one minute with positive - pressure ventilation and oxygen immediately after birth and arterial blood ph value of 7.20 or less or a base deficit of at least 14 mmol per liter within the first hour after birth . ischemic encephalopathy was classified as mild , moderate , or severe on the basis of the staging system described by santa and sarnat . this system assesses the infant 's level of consciousness , muscle tone , cranial nerves , primitive reflexes , spontaneous motor activity , autonomic function and seizures . ischemic encephalopathy was classified as mild if hyperexcitability or hypotonia persisted without seizures for at least 24 hours after birth ; as moderate if the infant was lethargic and had hypotonia , weak primitive reflexes , and seizures ; and as severe if the infant had frequent seizures , apnea , flaccid weakness , or coma . the exclusion criteria were maternal drug addiction , congenital infections , or perinatal infections , including chorioamnionitis and more than 42 weeks gestation and development of acute renal failure . the control group consisted of 50 normal , full - term newborns who met the following criteria : no maternal illness , normal results of fetal monitoring , apgar score of at least 8 at one and five minutes , and a normal course during the first week of life . the infants in both groups were examined daily during the first week after birth by a single examiner who did not know the results of the urinary testing . the study was approved by ethics committee of kurdistan university of medical sciences and written informed consent was obtained from the parents of the infants . urinary 1h nmr spectroscopy : spot urine samples were collected within 6 hours and again 24 hours after birth and were immediately centrifuged . the supernatants were stored at 80c for later assay . the urine samples were prepared for analysis by adding 0.05 ml of deuterium oxide to 0.45 ml of urine contained in a 5-mm nmr tube . the methyl proton signal of creatinine with a chemical shift set at 3.06 ppm was selected as an internal standard , and the resonance was assigned for lactate and other metabolites . the peak heights for lactate ( 1.34 ppm ) and creatinine ( 3.06 ppm ) were determined , and the ratio of lactate to creatinine was calculated . for statistical analysis , birth weight , gestational age , and sex were similar among the normal infants , and the infants with asphyxia that developed hypoxic ischemic encephalopathy ( table 1 ) . all infants with asphyxia developed hypoxic ischemic encephalopathy . the disease was judged to be mild in 17 , moderate in 21 , and severe in 12 patients . characteristics of 50 normal newborn infants and 50 infants with asphyxia and hypoxic ischemic encephalopathy p values are for comparisons between the infants with hypoxic ischemic encephalopathy and normal infants levels of arterial blood gas were measured within the first hour after birth l / c : lactate/ creatinine ratio ratio of lactate to creatinine in urine : the mean ratio of l / c in urine within six hours after birth was 3.32 in the infants who subsequently developed hypoxic ischemic encephalopathy- a value that was 11 times as high as that in normal infants ( 0.30.08 , p<0.0001 ) ( fig . urinary l / c ratio of 0.48 or higher had 96.1 percent sensitivity and 100 percent specificity in predicting the development of hypoxic ischemic encephalopathy . among the infants who developed hypoxic ischemic encephalopathy , there was a significant trend for the ratio to increase with the severity of the hypoxic ischemic encephalopathy in six hours : 2.20.5 in the infants with mild encephalopathy , 4.21.5 in those with moderate encephalopathy , and 3.43.3 in those with severe encephalopathy . l / c ratio within six hours after birth in a normal infant , and an infant with asphyxia and hypoxic ischemic encephalopathy the mean ratio of l / c in urine within 24 hours after birth was 1.50.55 in the infants who subsequently developed hypoxic ischemic encephalopathy - a value that was 5 times as high as the ratio in normal infants ( 0.30.08 , p<0.0001 ) . urinary l / c ratio of 0.48 or higher had 98 percent sensitivity and 100 percent specificity in predicting the development of hypoxic ischemic encephalopathy . there was a significant trend for the ratio to increase with the severity of the hypoxic ischemic encephalopathy in 24 hours : 1.10.5 in the infants with mild encephalopathy , 1.51.5 in those with moderate encephalopathy , and 23.3 in those with severe encephalopathy . sensitivity and specificity of the urinary l / c ratio at 6 hours after birth was 100 and 96 subsequently , and at 24 hours after birth sensitivity was 100 and specificity 98 ( table 2 ) . sensitivity and specifity of urinary lactate / creatinine ratio at 6 hr and24 hr after birth ppv : positive predictive value npv : negative predictive value in our study , the newborn infants with asphyxia were examined before hypoxic ischemic encephalopathy developed . we selected only infants with asphyxia and hypoxic ischemic encephalopathy . within six hours after birth , urinary l / c ratios were much higher in the infants that developed hypoxic ischemic encephalopathy . these results suggest that the urinary l / c ratio within six hours after birth is related to the occurrence and degree of hypoxic ischemic encephalopathy . chao - chang found the same result ; it is to be noted that in our study number of infants with asphyxia and hypoxic ischemic encephalopathy was almost four times more than in their study . this suggests that the biochemical derangement detected in the urine after perinatal asphyxia is more pronounced within a few hours after birth than later . the study of chao - chang showed in infants with asphyxia the urinary l / c ratio within the first six hours after birth was also significantly related to the neurodevelopmental outcome at one year of age . kant showed that urinary l / c ratios are much higher in babies with thin meconium , and meconium staining was indicator of perinatal asphyxia of newborns . our study shows that urinary l / c ratio , determined by 1h nmr within six hours after birth in infants with perinatal asphyxia , can be used to identify most of the infants who will develop hypoxic the salient abnormality in our study was a marked increase in the urinary l / c ratio within six hours after birth in newborn infants with asphyxia and hypoxic ischemic encephalopathy . urinary lactate may result from systemic tissue hypoxia , skeletal - muscle ischemia , or renal injury during asphyxia[2 , 8 13 ] . in our study , conventional indicators ( apgar scores , arterial - blood ph , and base deficits ) could not be used to predict the development of hypoxic ischemic encephalopathy , although a multivariate model that incorporated a combination of these markers was somewhat predictive in other studies[1 , 14 15 ] . most studies of perinatal asphyxia have measured biologic markers ( brain - specific creatine kinase , hypoxanthine , erythropoietin , and lactate dehydrogenase ) in serum or cerebrospinal fluid , but the tests are usually performed several days after birth , when the infants may already have hypoxic these tests may be useful as markers of tissue injury , but they offer little information that can be used to identify newborn infants at high risk for hypoxic ischemic encephalopathy . ischemic encephalopathy that may cause high urinary lactate excretion in newborns are acquired diseases ( eg , necrotizing enterocolitis ) and congenital metabolic disorders ( eg , pyruvate dehydrogenasedeficiency , glucose-6-phosphatase deficient glycogenosis , pyruvate decarboxylase deficiency , propionyl coenzyme a carboxylase deficiency , and methylmalonic - aciduria)[18 , 19 ] . ischemic brain injury in newborn infants , most of these conditions are readily distinguishable from asphyxia . in addition , 1h nmr can also be used to detect these metabolic disorders . as a limitation of the study we could not follow patients after discharge from nicu and compare growth and development in the two groups for determination relationship between urinary l / c ratio and their growth and development . we suggest further study to compare relationship between urinary l / c ratio at birth and later growth and development . our study showed that the urinary lactate / creatinine ratio in newborn infants with asphyxia is useful for predicting the development of hypoxic ischemic encephalopathy . the l / c ratio may therefore be useful in identifying infants most likely to benefit from intervention .

objectivehypoxic ischemic encephalopathy ( hie ) is a major cause of permanent neurological disabilities . perinatal asphyxia may induce neonatal mortality after birth or neurological impairment among survivors . there are no reliable methods for identifying infants at risk for this disorder.methodswe measured the ratio of lactate / creatinine ( l / c ) in urine by proton nuclear magnetic resonance spectroscopy within 6 and 24 hours after birth in 50 normal infants and 50 infants with asphyxia who developed hypoxic ischemic encephalopathy . the study was performed from september 2006 to may 2007 . for statistical analysis , the spss software was used . group comparisons were performed with chi - square and t - test(1 , 5).findingsl / c ratio was 3.32 among asphyxiated neonates in the first six hours after birth which was 11 folds greater than in normal neonates ( 0.30.08 , p=0.0001 ) . this ratio decreased to 1.50.55 for asphyxiated cases in the first 24 hours after birth , which was 5 folds greater than in control group ( p=0.0001 ) . asphyxiated neonates were subdivided into group a with mild asphyxia and l / c ratio 2.50.5 ; group b with moderate asphyxia and l / c ratio 4.21.5 ; and group c with severe asphyxia and l / c ratio 3.43.3 . the severity of asphyxia correlated with the greater l / c ratio among our cases and was significant ( p=0.0007 ) . the sensitivity and specificity of l / c ratio in cut off point of 0.48 , was 96.1% and 100% respectively.conclusionmeasurement of the urinary l / c ratio soon after birth maybe a promising tool to identify asphyxiated neonates and also to predict the severity of asphyxia .

primary immunoglobulin light chain amyloidosis ( al amyloidosis ) is a plasma cell disorder which mainly affects heart , kidneys , liver , and peripheral nervous system . cases of atypical al amyloidosis presented as spontaneous vertebral compression fractures have been rarely reported , and data about the management and clinical outcomes of the patients are scarce . herein , we present 3 new cases of al amyloidosis with spontaneous vertebral compression fracture and review 13 cases retrieved from the literature . moreover , we observed overrepresentations of liver involvement and bone marrow involvement in al amyloidosis with spontaneous vertebral compression fracture . we believe that better awareness of the rare clinical presentation as spontaneous vertebral compression fracture of al amyloidosis can facilitate earlier diagnosis and earlier treatment . primary immunoglobulin light chain amyloidosis ( al amyloidosis ) is a plasma cell disorder characterized by overproduction and accumulation of insoluble amyloid fibrils composed of immunoglobulin light chains . the most commonly affected organs are the heart , kidneys , liver , and peripheral nervous system , presenting as congestive cardiomyopathy , nephrotic - range proteinuria , hepatomegaly , and peripheral neuropathy , respectively . a spontaneous vertebral compression fracture is a rare clinical presentation in patients with al amyloidosis . here we present 3 cases of al amyloidosis with spontaneous vertebral compression fractures , liver involvement , and bone marrow involvement , with a review of the literature . all patients provided signed , informed consent , and the study was approved by peking union medical college hospital institutional review broad . case 1 was a 64-year - old man who had his thoracic spine fractured accidentally 5 years ago . a computed tomography scan was performed and suggested a vertebral compression fracture of t11 . he had a spontaneous lumbar compression fracture of l1 to l2 6 months later . another 6 months later , he developed soy urine . an abdominal ultrasound showed that the liver edge was near the costal margin and 3.7 cm below the xiphoid process . the laboratory tests revealed the following : hemoglobin , 143 g / l ( normal , 120160 g / l ) ; gamma - glutamyl transpeptidase ( ggt ) , 656 u / l ( normal , 1060 u / l ) ; alkaline phosphatase ( alp ) , 477 u / l ( normal , 50135 u / l ) ; albumin , 34 g / l ( normal , 3552 u / l ) ; creatinine , 89 mol / l ( normal , 59104 mol / l ) ; 24-hour urine protein , 5.87 g ( normal , 0.000.20 g ) ; serum phosphate , 1.45 mmol / l ( normal , 0.811.45 mmol / l ) ; calcium , 2.17 mmol / l ( normal , 2.132.70 mmol / l ) ; serum cardiac troponin i ( ctni ) , 0.02 g / l ( normal , 00.04 g / l ) ; n - terminal of the prohormone brain natriuretic peptide ( nt - probnp ) , 213 pg / ml ( normal , 0125 pg / ml ) ; serum protein electrophoresis ( spep ) , negative monoclonal protein ; serum free light chain ( flc ) kappa , 51.6 mg / dl ; serum flc lambda , 10.5 mg / dl ; serum flc ratio ( flc - r ) , 4.91 ; difference between involved and uninvolved serum immunoglobulin flc ( dflc ) , 40.1 mg / l ; bone marrow biopsy , amyloid deposits with 3.5% plasma cells ; immune staining , predominant kappa light chains ; and liver biopsy , amyloid degeneration with positive congo red staining . he was treated with 6 cycles of bortezomib , cyclophosphamide , and dexamethasone , and reached hematologic complete remission ( cr ) . at the follow - up examination 2 years later , the organ response was documented with a negative 24-hour urine protein , an alp of 153 u / l , and a ggt of 322 case 2 was a 49-year - old woman who complained of progressive back pain for 5 years and was found to have multiple spontaneous vertebral fractures . magnetic resonance imaging revealed old compression fractures involving t11 to t12 and l1 to l4 . the physical examination was notable for macroglossia and liver enlargement with a liver edge palpable 6 cm below the costal margin and 4 cm below the xiphoid process . laboratory tests indicated the following : hemoglobin , 117 g / l ( normal , 110150 g / l ; creatinine , 72 mol / l ( normal , 4584 mol / l ) ; alp , 165 u / l ; ggt , 261 u / l ; nt - probnp , 309 pg / ml ; ctni , 0.00 g / l ; serum calcium , 2.30 mmol / l ; serum phosphate , 1.4 mmol / l ; serum parathyroid hormone , 31.7 pg / ml ( normal , 12.065.0 pg / ml ) ; 24-hour urine protein , 0.41 g ; spep , no monoclonal protein ; serum flc kappa , 43.2 mg / l ; dflc , 30 mg / l ; flc - r , 3.27 ; and bone marrow ( plasma cells1% ) , gingival , and tongue biopsies , scattered interstitial amyloid deposition with positive congo red stain . the patient was treated with high - dose melphalan ( 200 mg / m ) followed by autologous stem cell transplantation ( asct ) . the alp was 153 u / l , and the ggt was reduced to 80 u / l . case 3 was a 48-year - old man who presented with lower back pain and increasing abdominal girth over the past year . the physical examination revealed hepatomegaly with the liver edge palpable 7 cm below the costal margin and 12 cm below the xiphoid process . a chest x - ray revealed multiple spontaneous vertebral and old costal fractures involving the right third and fourth ribs , as well as the left eighth rib . g / l ; creatinine , 75 mol / l ; alp , 330 u / l ; ggt , 445 u / l ; serum calcium , 2.36 mmol / l ; serum phosphate 1.35 mmol / l ; parathyroid hormone , 14.5 pg / ml ; nt - probnp , 108 pg / ml ; ctni , 0.00 g / l ; 24-hour urine protein , 0.36 g ; spep , monoclonal protein ( 0 g / l ) ; serum flc kappa , 70.6 mg / dl ; serum flc lambda , 10.6 mg / dl ; dflc , 60.0 mg / l ; flc - r , 6.66 ; bone marrow biopsy , 0.50% plasma cells , with amyloid fibrils deposited near vessels ; and liver biopsy , large amount of amorphous amyloid deposits between hepatic cells , which were positive in congo red stain . the patient was treated with melphalan , dexamethasone , and daily thalidomide . during the past 6 months since he completed treatment , he achieved a hematologic cr , with a decrease in ggt ( 233 u / l ) and alp ( 224 u / l ) . the general functional status was largely improved with no additional vertebral fractures . spontaneous vertebral compressions are rare manifestations in patients with al amyloidosis . in our case series , spontaneous vertebral compression fractures were one of the initial presenting signs of al amyloidosis . interestingly , all 3 patients in this case series had liver involvement , as demonstrated by hepatomegaly and elevation in liver enzymes , especially alp and ggt , as well as bone marrow involvement . in addition , none of the 3 patients had severe cardiac problems or involvement of other major organs . we reviewed the literature and found 13 reported patients with al amyloidosis who presented clinically with spontaneous vertebral fractures ; the characteristics of these cases are shown in table 1 . the median age of the 13 patients was 59 years ( range , 2976 years ) . it is worth noting that of 11 reported cases , 8 ( 72.7% ) also had liver involvement , 10 ( 90.9% ) had bone marrow involvement , and 7 ( 63.6% ) had both liver and bone marrow involvement , while only 1 patient had cardiac involvement , which was consistent with organ involvement in our case series . al amyloidosis with presentation of vertebral compression fractures in the literature . in patients with al amyloidosis who presented with vertebral compression fractures , one possible explanation would be the potential kappa light chain dominance among the patients with vertebral bone involvement . according to table 1 , of note , while kappa - predominance was observed in the patients with vertebral fractures and bone marrow involvement , the lambda - to - kappa light chain ratio in patients with al amyloidosis is 3.8 . this is in agreement with a former study indicating that the tropism of organ involvement in al amyloidosis can be influenced by the light chain variable region , which supports the hypothesis that patients with kappa light chains are more likely to have hepatic involvement . in another study , soft tissue and bone involvement was considered , the kappa - to - lambda ratio was 1 , and the major soft tissue and bone involvement included macroglossia and vertebral compression fractures . the mechanism underlying spontaneous vertebral compression fractures in al amyloidosis has not been identified . in most cases with compression vertebral fractures , biopsies indicate nearly complete replacement of the bone marrow by amyloid fibrils . in addition , all patients reported with al amyloidosis presenting with vertebral fractures had normal serum calcium , serum phosphatase , and serum parathyroid hormone levels , which was the same as our 3 cases . a possible explanation is that neither osteolytic lesions nor disorders of calcium phosphate metabolism cause multiple vertebral fractures in patients with al amyloidosis . instead , amyloid fibrils are first deposited near blood vessels supporting vertebrae , which may cause nutritional insufficiency in vertebrae , leading to progressive loss of bone density , and finally contributes to the compression fractures . such a mechanism is different from that in amyloidosis associated with multiple myeloma , where lytic lesions are commonly associated and become the major cause of bone fractures . treatment of the patients in this series was no more special than other cases with al amyloidosis , except that surgery using bone cement was often used in managing vertebral fractures . melphalan , bortezomib , thalidomide , cyclophosphamide , dexamethasone , and asct were used to treat our patients . fortunately , all 3 patients responded well , with an improvement in symptoms and functional status . such a favorable prognosis is largely attributed to the early diagnosis and early treatment of al amyloidosis . during the past few decades , several patients with initial fractures in vertebrae have been reported to have died from al amyloidosis due to delayed diagnosis as well as inappropriate treatment . given our results and the reports in the literature , even though vertebral compression fractures are rare in al amyloidosis , it is still important to consider al amyloidosis in the differential diagnosis of spontaneous vertebral compression fractures , especially in patients with hepatomegaly or elevated liver enzymes . bone marrow biopsy is necessary , since most of the patients can have bone marrow infiltration of amyloid deposits . the functions of major organs are largely normal in most patients ; thus , early diagnosis and early treatment are of great significance for such atypical cases of al amyloidosis .

abstractbackground : primary immunoglobulin light chain amyloidosis ( al amyloidosis ) is a plasma cell disorder which mainly affects heart , kidneys , liver , and peripheral nervous system . cases of atypical al amyloidosis presented as spontaneous vertebral compression fractures have been rarely reported , and data about the management and clinical outcomes of the patients are scarce.methods:herein , we present 3 new cases of al amyloidosis with spontaneous vertebral compression fracture and review 13 cases retrieved from the literature.results:moreover , we observed overrepresentations of liver involvement and bone marrow involvement in al amyloidosis with spontaneous vertebral compression fracture.conclusion:we believe that better awareness of the rare clinical presentation as spontaneous vertebral compression fracture of al amyloidosis can facilitate earlier diagnosis and earlier treatment .

mii oocytes were collected from superovulated 45-week - old c57bl/6babr mice , under a stereomicroscope , by mouth pipetting , and stored at 80c . prior to scbs - seq , 2 oocyte lysis buffer ( 10 mm tris - cl ph7.4 , 2% sds ) and 0.5l proteinase k were added ( final volume 12l ) followed by incubation at 37c for 1h . e14 escs were cultured in serum plus lif or 2i plus lif conditions as described previously . the 2i escs had been maintained in this medium for 24 days and matched serum escs were cultured in parallel . single escs were collected by facs in 12l of esc lysis buffer ( 10 mm tris - cl ph7.4 , 0.6% sds , 0.5l proteinase k ) using a bd influx instrument in single cell 1 drop mode . topro-3 and hoechst 33342 staining were used to select for live cells with low dna content ( i.e. in g0/g1 ) . escs were incubated at 37c for 1h and stored at 20c until required for library preparation . negative controls were either lysis buffer alone ( empty tubes ) or sorted bd accudrop beads , and were prepared and processed concomitantly with all single cell samples . bisulfite conversion was performed on cell lysates using the imprint dna modification kit ( sigma ) with the following modifications : all volumes were halved , and chemical denaturation was followed by incubation at 65c for 90min , 95c for 3min and 65c for 20min . purification was performed as described previously , and dna eluted in 10 mm tris - cl ( ph 8.5 ) and combined with 0.4 mm dntps , 0.4m oligo1 ( [ btn]ctacacgacgctcttccgatctnnnnnnnnn ) and 1 blue buffer ( sigma ) ( 24l final ) before incubation at 65c for 3min followed by 4c pause . 50u of klenow exo- ( sigma ) were added and the samples incubated at 4c for 5min , + 1c/15s to 37c , 37c for 30min . samples were incubated at 95c for 1min and transferred immediately to ice before addition of fresh oligo1 ( 10pmol ) , klenow exo- ( 25u ) , and dntps ( 1nmol ) in 2.5l total . the samples were incubated at 4c for 5min , + 1c/15s to 37c , 37c for 30min . this random priming and extension was repeated a further 3 times ( 5 rounds in total ) . i ( neb ) for 1h at 37c before dna was purified using 0.8 agencourt ampure xp beads ( beckman coulter ) according to the manufacturer s guidelines . samples were eluted in 10 mm tris - cl ( ph 8.5 ) and incubated with washed m-280 streptavidin dynabeads ( life technologies ) for 20min with rotation at room temperature . beads were washed twice with 0.1n naoh , and twice with 10 mm tris - cl ( ph 8.5 ) and re - suspended in 48l of 0.4 mm dntps , 0.4m oligo2 ( tgctgaaccgctcttccgatctnnnnnnnnn ) and 1 blue buffer . samples were incubated at 95c for 45s and transferred immediately to ice before addition of 100u klenow exo- ( sigma ) and incubation at 4c for 5min , + 1c/15s to 37c , 37c for 90min . beads were washed with 10 mm tris - cl ( ph 8.5 ) and resuspended in 50l of 0.4 mm dntps , 0.4m pe1.0 forward primer ( aatgatacggcgaccaccgagatctacactctttc - cctacacgacgctcttccgatct ) , 0.4m indexed ipcrtag reverse primer , 1u kapa hifi hotstart dna polymerase ( kapa biosystems ) in 1 hifi fidelity buffer . libraries were then amplified by pcr as follows : 95c 2min , 12 - 13 repeats of ( 94c 80s , 65c 30s , 72c 30s ) , 72c 3min , 4c hold . amplified libraries were purified using 0.8 agencourt ampure xp beads , according to the manufacturer s guidelines , and were assessed for quality and quantity using high - sensitivity dna chips on the agilent bioanalyser , and the kapa library quantification kit for illumina ( kapa biosystems ) . pools of 12 - 14 single cell libraries were prepared for 100bp paired - end sequencing on a hiseq2500 in rapid - run mode ( 2 lanes / run ) . samples from bulk cell populations were prepared according to the protocol above , with some modifications . for the bulk oocyte sample , 120 mii oocytes were collected and lysed as described above . for esc bulk cell samples , dna was purified from cell pellets using the qiaamp micro kit ( qiagen ) , according to the manufacturer s instructions , and 50ng of purified dna was used in the library preparation . one round of first strand synthesis was performed using 0.8 mm dntps and 4m oligo1 , and second strand synthesis also used 0.8 mm dntps and 4m oligo2 . raw sequence reads were trimmed to remove the first 9 base pairs , adapter contamination and poor quality reads using trim galore ( v0.3.5 , www.bioinformatics.babraham.ac.uk/projects/trim_galore/ , parameters : --clip_r1 9 --clip_r2 9 --paired ) . due to the multiple rounds of random priming performed with oligo1 , scbs - seq libraries are non - directional . trimmed sequences were first mapped to the human genome ( build grch37 ) using bismark ( v0.10.1 ; parameters : --pe , --bowtie2 , --non_directional , -- unmapped ) , resulting in 1.4% mapping efficiency ( 0.2 - 13.2% range ) . remaining sequences were mapped to the mouse genome ( build ncbi37 ) in single - end mode ( bismark parameters : --bowtie2 -- non_directional ) . methylation calls were extracted after duplicate sequences had been excluded . for oocyte bulk analysis , our mii bulk dataset was merged in silico with previously published datasets8 ( ddbj / genbank / embl accession number dra000570 ) . data visualization and analysis were performed using seqmonk , custom r and java scripts . for figure 1c , cg methylation was calculated as the average of methylation for each cpg position , and non - cpg methylation was extracted from the bismark reports . percentage of concordance was calculated as the percentage of cpgs presenting the same methylation call at the same genomic position across two cells . for correlation analysis ( pearson s ) , 2 kb windows were defined informative if at least 8 cpgs per window were sequenced . hyper - methylated and hypo - methylated cgis were defined as 80% and 20% methylation respectively . 12 and supplementary table 2 ) were extracted from previously published datasets . statistical analysis for estimating sample - specific methylation rates , estimating mean methylation rates and for clustering mii oocytes were collected from superovulated 45-week - old c57bl/6babr mice , under a stereomicroscope , by mouth pipetting , and stored at 80c . prior to scbs - seq , 2 oocyte lysis buffer ( 10 mm tris - cl ph7.4 , 2% sds ) and 0.5l proteinase k were added ( final volume 12l ) followed by incubation at 37c for 1h . e14 escs were cultured in serum plus lif or 2i plus lif conditions as described previously . the 2i escs had been maintained in this medium for 24 days and matched serum escs were cultured in parallel . single escs were collected by facs in 12l of esc lysis buffer ( 10 mm tris - cl ph7.4 , 0.6% sds , 0.5l proteinase k ) using a bd influx instrument in single cell 1 drop mode . topro-3 and hoechst 33342 staining were used to select for live cells with low dna content ( i.e. in g0/g1 ) . escs were incubated at 37c for 1h and stored at 20c until required for library preparation . negative controls were either lysis buffer alone ( empty tubes ) or sorted bd accudrop beads , and were prepared and processed concomitantly with all single cell samples . bisulfite conversion was performed on cell lysates using the imprint dna modification kit ( sigma ) with the following modifications : all volumes were halved , and chemical denaturation was followed by incubation at 65c for 90min , 95c for 3min and 65c for 20min . purification was performed as described previously , and dna eluted in 10 mm tris - cl ( ph 8.5 ) and combined with 0.4 mm dntps , 0.4m oligo1 ( [ btn]ctacacgacgctcttccgatctnnnnnnnnn ) and 1 blue buffer ( sigma ) ( 24l final ) before incubation at 65c for 3min followed by 4c pause . 50u of klenow exo- ( sigma ) were added and the samples incubated at 4c for 5min , + 1c/15s to 37c , 37c for 30min . samples were incubated at 95c for 1min and transferred immediately to ice before addition of fresh oligo1 ( 10pmol ) , klenow exo- ( 25u ) , and dntps ( 1nmol ) in 2.5l total . the samples were incubated at 4c for 5min , + 1c/15s to 37c , 37c for 30min . this random priming and extension was repeated a further 3 times ( 5 rounds in total ) . samples were then incubated with 40u exonuclease i ( neb ) for 1h at 37c before dna was purified using 0.8 agencourt ampure xp beads ( beckman coulter ) according to the manufacturer s guidelines . samples were eluted in 10 mm tris - cl ( ph 8.5 ) and incubated with washed m-280 streptavidin dynabeads ( life technologies ) for 20min with rotation at room temperature . beads were washed twice with 0.1n naoh , and twice with 10 mm tris - cl ( ph 8.5 ) and re - suspended in 48l of 0.4 mm dntps , 0.4m oligo2 ( tgctgaaccgctcttccgatctnnnnnnnnn ) and 1 blue buffer . samples were incubated at 95c for 45s and transferred immediately to ice before addition of 100u klenow exo- ( sigma ) and incubation at 4c for 5min , + 1c/15s to 37c , 37c for 90min . beads were washed with 10 mm tris - cl ( ph 8.5 ) and resuspended in 50l of 0.4 mm dntps , 0.4m pe1.0 forward primer ( aatgatacggcgaccaccgagatctacactctttc - cctacacgacgctcttccgatct ) , 0.4m indexed ipcrtag reverse primer , 1u kapa hifi hotstart dna polymerase ( kapa biosystems ) in 1 hifi fidelity buffer . libraries were then amplified by pcr as follows : 95c 2min , 12 - 13 repeats of ( 94c 80s , 65c 30s , 72c 30s ) , 72c 3min , 4c hold . amplified libraries were purified using 0.8 agencourt ampure xp beads , according to the manufacturer s guidelines , and were assessed for quality and quantity using high - sensitivity dna chips on the agilent bioanalyser , and the kapa library quantification kit for illumina ( kapa biosystems ) . pools of 12 - 14 single cell libraries were prepared for 100bp paired - end sequencing on a hiseq2500 in rapid - run mode ( 2 lanes / run ) . samples from bulk cell populations were prepared according to the protocol above , with some modifications . for the bulk oocyte sample , 120 mii oocytes were collected and lysed as described above . for esc bulk cell samples , dna was purified from cell pellets using the qiaamp micro kit ( qiagen ) , according to the manufacturer s instructions , and 50ng of purified dna was used in the library preparation . one round of first strand synthesis was performed using 0.8 mm dntps and 4m oligo1 , and second strand synthesis also used 0.8 mm dntps and 4m oligo2 . raw sequence reads were trimmed to remove the first 9 base pairs , adapter contamination and poor quality reads using trim galore ( v0.3.5 , www.bioinformatics.babraham.ac.uk/projects/trim_galore/ , parameters : --clip_r1 9 --clip_r2 9 --paired ) . due to the multiple rounds of random priming performed with oligo1 , trimmed sequences were first mapped to the human genome ( build grch37 ) using bismark ( v0.10.1 ; parameters : --pe , --bowtie2 , --non_directional , -- unmapped ) , resulting in 1.4% mapping efficiency ( 0.2 - 13.2% range ) . remaining sequences were mapped to the mouse genome ( build ncbi37 ) in single - end mode ( bismark parameters : --bowtie2 -- non_directional ) . bulk analysis , our mii bulk dataset was merged in silico with previously published datasets8 ( ddbj / genbank / embl accession number dra000570 ) . data visualization and analysis were performed using seqmonk , custom r and java scripts . for figure 1c , cg methylation was calculated as the average of methylation for each cpg position , and non - cpg methylation was extracted from the bismark reports . percentage of concordance was calculated as the percentage of cpgs presenting the same methylation call at the same genomic position across two cells . for correlation analysis ( pearson s ) , 2 kb windows were defined informative if at least 8 cpgs per window were sequenced . hyper - methylated and hypo - methylated cgis were defined as 80% and 20% methylation respectively . statistical analysis for estimating sample - specific methylation rates , estimating mean methylation rates and for clustering are detailed in supplementary note 1 .

we report a single - cell bisulfite sequencing method ( scbs - seq ) capable of accurately measuring dna methylation at up to 48.4% of cpgs . we observed that escs grown in serum or 2i both display epigenetic heterogeneity , with 2i - like cells present in serum cultures . in silico integration of 12 individual mouse oocyte datasets largely recapitulates the whole dna methylome , making scbs - seq a versatile tool to explore dna methylation in rare cells and heterogeneous populations .

the etiology underlying temporomandibular joint osteoarthritis ( tmj - oa ) is not fully understood ; however , some contributing factors are known , including internal derangement , macrotrauma , and parafunctional habits.1 - 3 in addition , functional overloading appears to be an important step in the cascade of events leading to osteoarthritis of the tmj,1,4,5 which can lead to physical disruption of cells , impaired cellular function , transient ischemia of certain cell populations and the production of neurogenic irritants.4 as a result , the joint tissues collapse . if the joint collapse occurs in both tmjs , condylar resorption causes morphologic collapse of the tmjs and a subsequent decrease in ramus height , which results in progressive mandibular retrusion with anterior open bite.4 this is called acquired open bite associated with tmj - oa . the malocclusion and retrognathic facial profile associated with acquired open bite can be improved by orthognathic surgery , including maxillomandibular advancement with counterclockwise rotation . however , patients with active tmj disease and concomitant or resultant maxillofacial skeletal discrepancies who are treated with orthognathic surgery alone often have poor outcomes and significant relapse.6 - 8 this implies that patients with presurgical tmj symptoms requiring mandibular advancement appear to have an increased risk of condylar resorption.9 in addition , orthognathic surgery requires surgical invasion , which carries risks and can result in significant postoperative discomfort.10 however , no significant alternative treatment for these patients has yet been reported . therefore , we suggest orthodontic treatment for patients with skeletal mandibular retrusion and anterior open bite due to tmj - oa , including molar intrusion , which has a beneficial effect on both esthetic appearance and occlusion . as a result of the counterclockwise rotation of the mandible caused by molar intrusion , the condyle is repositioned , and a functional adaptation in circumoral musculature can be achieved . here , we present an adult case of acquired open bite associated with tmj - oa treated using miniscrew anchorage . a 46-year 9-month - old woman presented with mandibular retrusion and circumoral musculature strain on lip closure ( figure 1 ) . she had a vertical and horizontal open bite and severe crowding of the upper anterior teeth . the only occlusal contacts were at the bilateral molars ; however , significant abrasion was detected on the anterior teeth and premolars . although the mandibular midline was shifted 2.4 mm to the left , the maxillary midline was nearly aligned with the facial midline . the molar relationship was angle class iii on the left side due to a missing lower left second premolar , and angle class i on the right side . during mandibular excursive movement , molar guidance with balancing side contacts was detected . in her history , she had been conscious of her retropositioned mandible and chin ; but during the past several years , the retrognathia increased . model analysis showed an arch length discrepancy of -5.8 mm in the upper arch and -3.5 mm in the lower arch . panoramic radiography showed the absence of the upper and lower third molars , and that the lower left second premolar had been extracted ( figure 2 ) . the lower left second molar had little or no alveolar bone support and was a floating tooth . lateral transcranial radiography of the tmj showed that both condyles were located anterior to the glenoid fossa , and no translations of the condyles were induced during mouth opening . cephalometric analysis revealed a skeletal class ii malocclusion with a severe retropositioned mandible ( figures 2 and 3 ) . the mandibular plane and gonial angles were significantly larger than the japanese norms ( frankfort - mandibular angle , 52.7 ; gonial angle , 134.1).11 the mandible exhibited a backward and downward rotation with a short ramus . although the inclination of the maxillary incisors was within the normal range , the lower incisors were labially inclined . the patient had experienced frequent tmj pain during mastication and at maximum mouth opening for at least 5 years . maximum mouth opening without pain was 28.0 mm , and tmj crepitus was detected on both sides . the diagnosis was skeletal open bite with a short mandibular ramus associated with tmj - oa . the treatment objectives were to correct the anterior open bite , establish an ideal interincisal relationship , and to achieve an acceptable occlusion with a good functional class i occlusion . this case was treated according to the following plan : extraction of both maxillary first premolars and the mandibular right second premolar.placement of multi - bracket appliances on both dentitions to align the teeth.placement of titanium miniscrews in both sides of the posterior maxilla to intrude the molars , since molar intrusion should lead to subsequent counterclockwise mandibular rotation.use of a transpalatal arch to prevent buccal tipping of the maxillary molars during intrusion . placement of titanium miniscrews in both sides of the posterior maxilla to intrude the molars , since molar intrusion should lead to subsequent counterclockwise mandibular rotation . use of a transpalatal arch to prevent buccal tipping of the maxillary molars during intrusion . although mandibular advancement with orthognathic surgery is considered an effective treatment method , surgical treatment is not strongly recommended for patients with progressive mandibular retrusion associated with tmj - oa . in addition , surgical treatment requires prolonged hospitalization and higher medical costs , and is the most invasive option . we did not want to close the anterior open bite by extruding the anterior teeth , because the vertical relationship between the incisors and jaws was considered acceptable prior to orthodontic treatment , and tooth extrusion is generally considered an unstable movement . therefore , intrusion of the maxillary molars and subsequent counterclockwise rotation of the mandible were considered good options to treat the anterior open bite in this patient . a transpalatal arch was placed between the maxillary first molars , and both the upper first and the lower right second premolars were extracted . after the extraction , standard edgewise appliances with 0.018 0.025-inch slots were placed on both dentitions , except for the upper incisors ( figure 4a ) . after leveling and alignment , titanium miniscrews ( dual top anchor ; jeil medical co. , seoul , korea ) were placed at the buccal sites of the posterior maxilla , and molar intrusion and canine retraction were initiated using elastic chains from the anchor screws . at this time , the brackets were bonded onto the upper incisors . at 1 year , 0.016 0.022-inch co - cr alloy wires were placed on both arches ( figure 4b ) . as a result of molar intrusion , her anterior open bite was nearly corrected without the aid of vertical intermaxillary elastics . after intrusion , the canine and molar relationships were changed to almost class i. at 1 year and 6 months , the space closing process and anterior retraction continued with the use of elastic chains from the miniscrews ( figure 4c ) . after 2 years and 7 months of orthodontic treatment , an acceptable occlusion was achieved without any recurrence of tmj symptoms , and the multi - bracket appliances were removed . immediately after removal , lingual bonded retainers were fixed on both dentitions , and a wraparound retainer was added to the upper arch . an acceptable occlusion was achieved , and overjet and overbite were increased to 2.2 mm and -0.7 mm , respectively . the canine and molar anteroposterior relationships were improved to class i on both sides ( figure 5 ) . lateral transcranial radiography of the tmj showed that both condyles were still anterior to the glenoid fossa , and that condylar movements during mouth opening were still poor . cephalometric analysis revealed approximately 1.5-mm maxillary molar intrusion and subsequent counterclockwise rotation of the mandible ( figure 7 ) . reduction of the excessive overjet was due to lingual inclination of the upper incisors . throughout the treatment period , maximum mouth opening without pain was 38.0 mm ; however , tmj crepitus was still detected on both sides . magnetic resonance imaging taken after treatment showed anterior disc displacement without reduction in both tmjs , and the condylar head was only black in color , which indicated cortical bone without cancellous bone and bone marrow , suggesting an avascular necrosis - like structure ( figure 8) . two years after retention , the mandibular position was nearly unchanged ( figure 7 ) . the circumoral musculature strain upon lip closure disappeared , and an acceptable occlusion was maintained without recurrence of tmj symptoms ( figure 9 ) . the canine and molar relationships remained class i , and no relapse of the anterior open bite was found . panoramic radiographs showed little or no change in condylar structure , with condylar resorption and deformity ( figure 10 ) . lateral transcranial radiography of the tmj showed that the condylar movements during mouth opening were still poor . although successful outcomes have been reported for orthognathic surgical management of maxillofacial skeletal discrepancies with signs and symptoms of tmj disease,12 the outcomes depend on the pretreatment tmj condition . orthognathic surgeries in patients with active tmj disease and concomitant or resultant maxillofacial skeletal discrepancies often have poor results and significant relapse.6 - 8,13,14 this implies that patients with tmj symptoms have an increased risk of condylar resorption . symptomatic and asymptomatic pre - existing tmj pathologies that can lead to unfavorable outcomes include the following ; internal derangements , progressive condylar resorption , condylar hyperplasia , osteochondroma , and congenital deformities.14 since the tmjs are the foundation of orthognathic surgery , the resultant pathology of tmj conditions with gross erosive changes in the articulating components of the fossa and condyle resulting in vertical height loss offers a poor base for maxillofacial skeletal and functional reconstruction . furthermore , the degenerative and osteolytic changes in the joint components due to these conditions make these tmj components highly susceptible to failure under the new functional loading resulting from orthognathic surgical repositioning of the maxillofacial skeleton . maxillomandibular advancement with counterclockwise rotation of the occlusal plane is an established procedure for patients with healthy tmjs . however , patients who had presurgical tmj symptoms and underwent orthognathic surgery alone had a statistically significant rate of skeletal relapse related to condylar remodeling and resorption . in addition , orthognathic surgery requires surgical invasion , which carries risks and can cause postoperative discomfort . therefore , orthognathic surgery is not recommended for patients with progressive mandibular retrusion associated with tmj - oa . in the present case , the patient had an anterior open bite with a retropositioned mandible caused by severe condylar resorption and deformity , indicative of tmj - oa . morphologic collapse of the joint component by tmj - oa induces a decrease in ramus height , leading to clockwise rotation of the mandible and an anterior open bite . the results of finite element model analysis showed that an open bite can induce greater tmj stress than normal occlusion.15 furthermore , clockwise rotation of the mandible , which is a major character of skeletal anterior open bite , leads to a synergistic increase in tmj stress during clenching.15 this suggests that improvement of mandibular clockwise rotation , which results in the reduction of tmj overloading , may be indispensable for treatment of acquired open bite associated with tmj - oa . however , it is nearly impossible to provide skeletal improvement in patients with anterior open bites using traditional orthodontics . several recent studies have demonstrated effective treatment of anterior open bite patients with class i or ii jaw relationships using temporary anchorage devices ( tads ) , which has now been established as a new treatment strategy.10,16 - 19 absolute molar intrusion , which was previously impossible with traditional orthodontic mechanics , using tads results in counterclockwise rotation of the mandible , and the reduced overbite is increased without incisal elongation . kuroda et al.10,17,18 reported that although the mandibular plane was rotated more than 5 by molar intrusion , the patients had no functional problems after treatment . in addition , the procedure is definitely less invasive than a le fort i osteotomy for maxillary impaction with a mandibular repositioning osteotomy , and provides superior morphologic improvement over orthognathic surgery.18 therefore , absolute anchorage with tads was used in the present case . superimposition of the cephalometric tracings before and after treatment showed counterclockwise rotation of the mandible due to upper molar intrusion . because of this mandibular rotation , the mandibular plane angle was decreased by 2.3. the mandibular condyles also exhibited rotational repositioning in the inferior direction . consequently , due to increases in the anterior and superior areas , the joint space became nearly uniform . it would be reasonable to assume that these changes in condylar position , if accomplished with optimal occlusal support , may lead to biomechanical equilibrium in the tmj . when tmj - oa is progressing , the condyle deformity is more prominent with a shorter ramus height . although tmj - oa often has an unpredictable course , optimal condylar position and stable occlusion can achieve biomechanical equilibrium in the tmj , and this may inhibit progression of tmj - oa , and occasionally lead to functional and adaptive remodeling of the condyles through resorption repair.20 in the current case , there was no recurrence of tmj symptoms during the orthodontic treatment . although anterior disc displacement without reduction and condylar resorption and deformity persisted after treatment , all symptoms of tmj disease disappeared , and long - term stability of both the occlusal and symptomatic states was obtained . growing evidence suggests that in tmj - oa , similar to oa in other joints , overloading may initiate a series of degenerative changes , such as condylar resorption , decreased mandibular ramus height , mandibular clockwise rotation , progressive mandibular retrusion , and an anterior open bite . to date , many treatment modalities for tmj - oa have been reported ; however , the treatment outcomes depend on the preoperative tmj conditions . therefore , understanding the pathogenesis of tmj - oa and its current clinical treatment is essential for developing a " good as new " treatment for tmj - oa , including the orthodontic approach . we showed here that orthodontic correction through molar intrusion using titanium miniscrews was effective for the management of an open bite and clockwise - rotated mandible associated with tmj - oa and jaw deformity .

this article reports the orthodontic treatment of a patient with skeletal mandibular retrusion and an anterior open bite due to temporomandibular joint osteoarthritis ( tmj - oa ) using miniscrew anchorage . a 46-year - old woman had a class ii malocclusion with a retropositioned mandible . her overjet and overbite were 7.0 mm and -1.6 mm , respectively . she had limited mouth opening , tmj sounds , and pain . condylar resorption was observed in both tmjs . her tmj pain was reduced by splint therapy , and then orthodontic treatment was initiated . titanium miniscrews were placed at the posterior maxilla to intrude the molars . after 2 years and 7 months of orthodontic treatment , an acceptable occlusion was achieved without any recurrence of tmj symptoms . the retropositioned mandible was considerably improved , and the lips showed less tension upon lip closure . the maxillary molars were intruded by 1.5 mm , and the mandible was subsequently rotated counterclockwise . magnetic resonance imaging of both condyles after treatment showed avascular necrosis - like structures . during a 2-year retention period , an acceptable occlusion was maintained without recurrence of the open bite . in conclusion , correction of open bite and clockwise - rotated mandible through molar intrusion using titanium miniscrews is effective for the management of tmj - oa with jaw deformity .

in the era of prostate - specific antigen ( psa ) screening , more and more patients are diagnosed with insignificant prostate cancer . because many of these cancers will not become clinically symptomatic , active surveillance ( as ) with delayed treatment has been introduced and has been reported to have similar therapeutic effects . the criteria for defining patients who are suitable to enter as protocols are mainly based on psa , clinical stage , and tumor grade . however , many studies have shown that the tumor grade obtained by prostate biopsy does not always correlate with the final pathological grade of the surgical specimen resected in a radical prostatectomy . in many cases , gleason score ( gs ) upgrading of up to 57% of cases has been reported in some studies . the incorrect assessment of tumor grade may lead to inappropriate estimation of cancer aggressiveness , resulting in under - treatment of these patients . thus , a critical factor for the success of as is the use of appropriate entry criteria . although a number of prognostic models have been developed to help to identify men who are appropriate candidates for as , it remains controversial whether to adopt psa density as an appropriate entry criterion . accordingly , we conducted a prospective data analysis in patients with low - grade prostate cancer and evaluated the potential of several clinical and pathological variables to predict upgrading of the cancer . after we obtained approval from the ethics committee at institutional review board of daegu catholic university hospital , we conducted a prospective analysis of 60 patients with low - risk prostate cancer who were recruited from 4 university hospitals ( gs6 , psa<10 ng / ml , t1/t2 , 2 positive biopsy cores ) . all patients underwent a retropubic or laparoscopic radical prostatectomy between january 2010 and december 2013 . all clinical , imaging , laboratory , and pathological data were collected and recorded prospectively and were analyzed retrospectively . we excluded patients who had received any preoperative therapy for prostate cancer ( hormone therapy , radiation therapy ) and patients who underwent less than 10-core transrectal ultrasound ( trus)-guided biopsy . biopsy cores were examined by different university - based pathologists and all radical prostatectomy samples were examined according to the standard protocol of the pathology department at each university hospital . we analyzed age , body mass index ( bmi ) , preoperative psa value , psa density , number of cores , and number of positive cores in biopsy material . we analyzed the association of these factors with upgrading of cancer in the radical prostatectomy specimen . any increase in gs between core biopsy and radical prostatectomy specimen preoperative psa was measured before the digital rectal exam , trus , or core biopsy . during trus , prostate volume was calculated according to information on the maximum transverse diameter ( d1 ) , the maximum antero - posterior diameter ( d2 ) , and the maximum longitudinal diameter ( d3 ) and by using the formula based on the prostate ellipse dimension theory : d1d2d3/6 . psa density was calculated by dividing the preoperative psa value and prostate volume . a histological report concerning tumor grade of the surgical specimen and pathological stage we estimated tumor grade by use of the contemporary criteria of the 2005 international society of urological pathology modified gleason system . statistical analysis was performed by using pasw statistics ver . 18.0 ( spss inc . , the normality condition of the numerical variables was studied by means of the kolmogorov - smirnov test . psa was the only variable with a normal distribution ; consequently , student t - test was used to compare means . to analyze other variables , the mann - whitney u test was used , and the chi - square test was used for categorical variables . the optimal cutoff values and sensitivity and specificity for quantitative variables that were found to be significant predictors were estimated by using receiver operating characteristic ( roc ) curve analysis . positive predictive value ( true positive/[true positive+false positive ] ) and negative predictive value ( true negative/[true negative+false negative ] ) were also estimated . in total , 60 patients met our inclusion criteria within the study period and were entered into the analysis . the median patient age was 63 years , the median preoperative psa value was 6.26 ng / ml , and the median psa density was 0.15 ng / ml . as we previously described , every patient underwent trus biopsy with more than 10 cores ; 58 patients ( 96.7% ) underwent 12-core biopsy . on the basis of the pathological results from the radical prostatectomy , 2 patients ( 3.3% ) were diagnosed with gs 5 prostate cancer , 40 patients ( 57.1% ) had gs 6 cancer , 27 patients ( 38.6% ) had gs 7 cancer , and 1 patient ( 1.4% ) had gs 8 . clinical stage on the basis of the digital rectal examination and trus findings was categorized as follows : 61 patients ( 86.7% ) with t1c disease and 9 patients ( 13.3% ) with t2a prostate cancer , respectively . following radical prostatectomy , a tumor upgrade was noticed in 28 patients ( 40.0% ) . extracapsular extensions were noted in 6 patients ( 10.0% ) and positive surgical margins in 8 patients ( 17.3% ) . the demographic , clinical , and pathologic data regarding the presence of pathological tumor upgrading are described in table 1 . a statistically significant correlation between preoperative psa density and postoperative gs upgrading was noted ( p=0.030 ) . no statistical correlation with postoperative gs upgrading was found for age , bmi , preoperative psa level , prostate volume , number of biopsy cores , number of positive biopsy cores , the institute where the biopsy was done , or the operation method . in the analysis of pathological outcomes after radical prostatectomy , tumor upgrading was highly associated with extracapsular cancer extension ( p=0.000 ) . in the multivariate analysis , psa density was the only statistically significant variable to predict gs upgrading ( p=0.030 ) ( table 2 ) . the estimated optimal cutoff value of psa density was 0.13 ng / ml , as obtained by roc analysis ( area under the curve=0.66 ; p=0.020 ; 95% confidence interval , 0.53 - 0.78 ) , as shown in fig 1 . it is well established that tumor grade is the most reliable and valuable parameter for estimating the prognosis of prostate cancer . by being a surrogate for tumor aggressiveness , the tumor grade allows us to stratify patients as either low , intermediate , or high risk . to date , the calculation of gleason grade has been based on pathological evaluation of the cores obtained by prostate biopsy . for patients who enter an as treatment program with close monitoring until disease progression and radical therapy , biopsy results , in combination with psa levels and clinical stage , are the data that guide treatment decisions . nevertheless , upgrading of the gs between the needle biopsy and the radical prostatectomy is not rare . upgrading was found in 30% of patients in one recent meta - analysis , and higher rates have also been published . this observation has important prognostic meaning because a significant percentage of these cases progress outside the prostate capsule . the present data , which showed gs upgrading in 40.0% of samples , also revealed 24.0% extracapsular extension . given that conservative treatment protocols are mainly applied in low - risk patients , these findings are very important . an underestimation of prostate cancer aggressiveness may lead to under - treatment and inappropriate monitoring of biologically aggressive tumors . thus , it is clear that many patients classified as having clinically localized disease and being at low risk actually have highly malignant cancer with a risk of clinical progression . several reports have indicated that the likelihood of gs upgrading will decrease as the number of cores obtained by biopsy increases . king et al . showed that in patients with a biopsy gs of 6 , an extended biopsy strategy reduced gs upgrading from 66.7% to 36.8% . 's study also showed that gs upgrading decreased from 47.9% to 23.5% by taking more than 18 cores in a cohort of patients with low - risk prostate cancer . in coogan . 's study , increasing the number of cores from 6 to10 significantly improved the accuracy of the biopsy gs . the question remains as to what the optimal number of biopsy cores should be . . showed that at least 10-core biopsies may be needed in patients with low - risk prostate cancer . adopting this concept , no statistically significant dif ferences were found in the present study when comparing 12-core biopsies with 10-core biopsies . whereas some groups have shown that an increase in positive cores correlates with an upgrading of gs , other studies could not find any association . in the present study , the association between preoperative psa level and gs upgrading also varies . whereas the studies of mian et al . and king et al . showed that psa level was a statistically significant predictor of gs upgrading . in the present study , we were not able to show an association between psa level and gs upgrading . several reports have shown that an increase in prostate weight reduces the risk of gs upgrading . an explanation for this finding might be that a small prostate size is a surrogate of low in vivo androgenicity , leading to reselection of aggressive cancers in an androgen - depleted hostile environment . however , the results in the literature vary in relation to the weight of the prostate . in the present study however , in the multivariate logistic regression analysis , prostate weight was not an independent predictor of gs upgrading . even though conf licting results regarding the interobserver reproducibility of gleason scoring in prostate biopsies have been reported , we did not observe a significant difference in gs upgrading between university pathologists in a univariate analysis ( table 2 ) . this result could partly be due to the proficiency of the pathologists and also to the number of biopsy cores being more than 10 . corcoran et al . examined the predictive characteristics of psa density in patients with low- and intermediate - risk disease on biopsy and subsequently treated with radical prostatectomy . they found that 58.3% of patients with low - grade disease after prostate biopsy were upgraded to higher scores and that psa density was a significant predictor ( p<0.001 ) of upgrading in patients with gs 6 . similar results were observed by kojima et al . and magheli et al . , with p=0.019 and p=0.037 , respectively . our results add to the above data , revealing a beneficial role of psa density in prediction of upgrading ( p=0.030 ) . a significant association of psa density with the pathological outcomes following radical prostatectomy was observed . we tried to produce a threshold level of psa density , over which the possibility of gleason upgrading increased significantly , triggering either a repeat biopsy or definitive therapy . by using the roc analysis , even though the sensitivity and negative predictive value were low , an increased specificity and positive predictive value were found ( table 3 ) . given the complexity of prostate cancer , it seems to be more reasonable to use psa density combined with other predictive factors . first , the sample size was relatively small and might have decreased the strength of the results . another limitation is that the psa density calculation was based on the estimation of prostate volume during trus made by 4 different operators . even though a standard calculation protocol was followed , the interobserver differences in the volume measurement may have negatively affected the validity of the results . last , even though the data collection was made prospectively , the analysis was done retrospectively . however , the strength of our study was that the evaluation of psa density in low - risk prostate cancer was adjusted solely for patients who underwent biopsies with more than 10 cores . equal distribution of the number of cores obtained by prostate biopsies might have reduced a statistical bias and increased the value of the results for the estimation of tumor grade . with the commonly used criteria for as , gs upgrading in a radical prostatectomy specimen is a challenging problem . psa density was an independent predictor of gs upgrading and may be included as a criterion for patients eligible for as .

purposeto evaluate prospectively the role of prostate - specific antigen ( psa ) density in predicting gleason score upgrading in prostate cancer patients eligible for active surveillance ( t1/t2 , biopsy gleason score6 , psa10 ng / ml , and 2 positive biopsy cores).materials and methodsbetween january 2010 and november 2013 , among patients who underwent greater than 10-core transrectal ultrasound - guided biopsy , 60 patients eligible for active surveillance underwent radical prostatectomy . by use of the modified gleason criteria , the tumor grade of the surgical specimens was examined and compared with the biopsy results.resultstumor upgrading occurred in 24 patients ( 40.0% ) . extracapsular disease and positive surgical margins were found in 6 patients ( 10.0% ) and 8 patients ( 17.30% ) , respectively . a statistically significant correlation between psa density and postoperative upgrading was found ( p=0.030 ) ; this was in contrast with the other studied parameters , which failed to reach significance , including psa , prostate volume , number of biopsy cores , and number of positive cores . tumor upgrading was also highly associated with extracapsular cancer extension ( p=0.000 ) . the estimated optimal cutoff value of psa density was 0.13 ng / ml2 , obtained by receiver operating characteristic analysis ( area under the curve=0.66 ; p=0.020 ; 95% confidence interval , 0.53 - 0.78).conclusionspsa density is a strong predictor of gleason score upgrading after radical prostatectomy in patients eligible for active surveillance . because tumor upgrading increases the potential for postoperative pathological adverse findings and prognosis , psa density should be considered when treating and consulting patients eligible for active surveillance .

paclitaxel is an antineoplastic drug isolated from a bark extract of taxus brevifolia ( taxaceae ) the governments of the us and canada approved paclitaxel for sale in 1992 , and a parenteral solution of paclitaxel subsequently became commercially available in japan in 1997 . paclitaxel is used clinically in the treatment of ovarian , breast , endometrial , stomach , and non - small cell lung cancers in japan . the main adverse drug reactions to paclitaxel include gastrointestinal symptoms , peripheral neuropathy , arthralgia , muscular pain , nausea and vomiting , epilation , and pyrexia . paclitaxel tends to be soluble in n , n - dimethylacetamide , acetonitrile , methanol , and ethanol but is relatively insoluble in water . because 50% ethanol is used as the solvent for clinical paclitaxel injections , we hypothesized that impairment of specific central nervous system ( cns ) functions by ethanol or its cleavage product , acetaldehyde , as well as adverse reactions related to intoxication , may occur following treatment with this preparation . thus , the possibility of adverse reactions following intake of ethanol accompanying paclitaxel administration should not be overlooked . since many hospitals in japan are located in rural areas and are not conveniently accessible by public transportation , most patients drive to the hospital . thus , it is important to consider the possible cns depressant actions of ethanol contained in injectable drug formulations , in order to reduce the risk of serious car accidents . furthermore , in the road traffic act in japan , the breath ethanol concentration that constitutes drunk driving is 0.15 mg / l this threshold is lower than those in the uk , usa , and canada ( 0.40 mg / l ) , and those in australia , germany , and france ( 0.25 mg / l ) . it is important to ensure that patients who receive paclitaxel injections containing ethanol do not have breath ethanol concentrations exceeding the legal threshold . although research on plasma ethanol concentrations following paclitaxel administration has been published previously , only a few reports have evaluated the correlation between ethanol intake during chemotherapy and the ethanol concentration in exhaled breath . here , we investigated the concentration of ethanol in exhaled breath after chemotherapy with an intravenous paclitaxel infusion . thirty japanese outpatients ( mean age 55 8.6 years [ range 3574 ] ; 2 male and 28 female ) who received treatment with paclitaxel ( 80330 mg / day ) for breast , ovarian , or gastric cancer were eligible subjects for this research . this clinical study was approved by the institutional review board for clinical trials at gunma university hospital ( maebashi , japan ) . written consent was obtained from all patients after they were informed of the study procedure . the volume of ethanol administered and the infusion rate of ethanol were calculated from the volume of the paclitaxel infusion and the administration time . immediately after administration of the intravenous infusion to a subject , a balloon - type gas detector tube ( kitagawa gas detector tube system ; komyo rikagaku kogyo kk , kanagawa , japan ) was used to measure the concentration of ethanol in exhaled breath . the levels of aspartic acid aminotransferase ( ast ) and alanine aminotransferase ( alt ) were noted from the medical records , and the alcohol drinking history was taken from each patient . correlations between the total amount of ethanol administered and the ethanol concentration in exhaled breath , and between the intravenous infusion speed and the ethanol concentration in exhaled breath , were calculated using pearson s correlation coefficient . thirty japanese outpatients ( mean age 55 8.6 years [ range 3574 ] ; 2 male and 28 female ) who received treatment with paclitaxel ( 80330 mg / day ) for breast , ovarian , or gastric cancer were eligible subjects for this research . this clinical study was approved by the institutional review board for clinical trials at gunma university hospital ( maebashi , japan ) . written consent was obtained from all patients after they were informed of the study procedure . the volume of ethanol administered and the infusion rate of ethanol were calculated from the volume of the paclitaxel infusion and the administration time . immediately after administration of the intravenous infusion to a subject , a balloon - type gas detector tube ( kitagawa gas detector tube system ; komyo rikagaku kogyo kk , kanagawa , japan ) was used to measure the concentration of ethanol in exhaled breath . the levels of aspartic acid aminotransferase ( ast ) and alanine aminotransferase ( alt ) were noted from the medical records , and the alcohol drinking history was taken from each patient . correlations between the total amount of ethanol administered and the ethanol concentration in exhaled breath , and between the intravenous infusion speed and the ethanol concentration in exhaled breath , were calculated using pearson s correlation coefficient . the patient characteristics , the amount of paclitaxel administered , the speed of the intravenous infusion , and the concentration of ethanol in exhaled breath are summarized in table i. the average ethanol concentration in exhaled breath immediately after the intravenous infusion of paclitaxel was 0.028 0.015 mg / l ( range 0.000.06 ) . ethanol concentrations in exhaled breath of individual patients hepatic function in all patients was assessed to be within the normal range , as indicated by ast and alt values of 1233 u / l and 1262 u / l , respectively . the correlation coefficient between the total amount of ethanol administered via the intravenous infusion and the ethanol concentration in exhaled breath was weak ( r = 0.25 ; p = 0.055 ) [ figure 1a ] . in contrast , the intravenous infusion speed had a relatively stronger positive correlation with the concentration of exhaled ethanol ( r = 0.49 ; p = 0.11 ) [ figure 1b ] . relationship between the ethanol concentration in exhaled breath and ( a ) the total amount of ethanol administered via the intravenous paclitaxel infusion ; and ( b ) the speed of the paclitaxel infusion . the patient characteristics , the amount of paclitaxel administered , the speed of the intravenous infusion , and the concentration of ethanol in exhaled breath are summarized in table i. the average ethanol concentration in exhaled breath immediately after the intravenous infusion of paclitaxel was 0.028 0.015 mg / l ( range 0.000.06 ) . ethanol concentrations in exhaled breath of individual patients hepatic function in all patients was assessed to be within the normal range , as indicated by ast and alt values of 1233 u / l and 1262 u / l , respectively . the correlation coefficient between the total amount of ethanol administered via the intravenous infusion and the ethanol concentration in exhaled breath was weak ( r = 0.25 ; p = 0.055 ) [ figure 1a ] . in contrast , the intravenous infusion speed had a relatively stronger positive correlation with the concentration of exhaled ethanol ( r = 0.49 ; p = 0.11 ) [ figure 1b ] . relationship between the ethanol concentration in exhaled breath and ( a ) the total amount of ethanol administered via the intravenous paclitaxel infusion ; and ( b ) the speed of the paclitaxel infusion . more than 90% of ethanol is metabolized by alcohol dehydrogenase ( adh ) and aldehyde dehydrogenase 2 ( aldh2 ) in the liver it has been reported that people with low aldh2 activity show hereditary sensitivity to the effects of alcohol , and approximately 50% of japanese people are poor alcohol metabolizers thus , the percentage of japanese people who experience facial flush and heart palpitations in association with elevated blood aldehyde concentrations after drinking alcohol is larger than that of europeans and americans . therefore , there is a greater risk of intoxication leading to a car accident in people who have poor ethanol metabolism , because the blood ethanol concentration remains high even after consumption of a relatively small amount of alcohol . ethanol is eliminated primarily by a saturable ( michaelis - menten ) process hence , the half - life of ethanol changes according to the dose or the rate of administration . paclitaxel injections contain 50% ( v / v ) ethanol ; thus , if 300 mg of paclitaxel is injected , 25 ml ethanol is also administered . furthermore , because the first - pass effect does not apply to intravenous infusions , the effects of ethanol will be greater than with oral administration . in this study , an ethanol concentration in exhaled breath that exceeded the threshold for drunk driving , as specified in the road traffic act , was not detected in any patient , but there was one case that reached more than 40% of the threshold . moreover , a previous report described several cases that exceeded the threshold defined by the law the relationship between the ethanol concentration in breath and that in blood has been investigated , and a method of deducing the blood concentration from the concentration in breath has been established . moreover , when considering the cns effects , the ethanol concentration in breath ( which reflects the arterial blood ethanol concentration ) is considered to be a more suitable indicator than the venous blood ethanol concentration . the ratio of venous blood ethanol concentrations to exhaled breath ethanol concentrations is approximately 2000 : 1 the average blood ethanol concentration estimated from our findings was 0.06 0.03 mg / ml . webster et al . reported that the average plasma ethanol concentration after administration of paclitaxel in caucasian patients was 0.07 0.10 mg / ml when the average doses of paclitaxel in both studies ( 155 76 and 293 35 mg , respectively ) are taken into consideration , the estimated blood ethanol concentrations may have been a little higher in our study . the difference in the body size between japanese and caucasian subjects may have affected this . because ethanol has a fast elimination rate , its concentrations steady state rapidly , and this is why the plasma ethanol concentration at the end of administration depends on the infusion speed . thus , the ethanol concentration in exhaled breath after administration of paclitaxel is considered to be affected by the infusion speed but not by the total amount of ethanol administered . there were several subjects who complained of facial flush or light - headedness after the end of the intravenous infusion , which may have been a response to the ethanol metabolite , acetaldehyde in these cases , markers other than the breath ethanol concentration should be considered , in order to assess the degree of intoxication . in general , patients with high sensitivity to ethanol tend to present with symptoms of alcohol impairment and also have impaired decision - making ability . the gender bias of the patients should be mentioned as a limitation of this study . because most patients in the study were outpatients with breast cancer or ovarian cancer , the majority of the patients were female . it has previously been shown that when the same dose of ethanol is administered to male and female subjects , higher blood concentrations are reached in females than in males , and this may have affected our results . we have shown that the ethanol concentration in exhaled breath after administration of paclitaxel is affected by the infusion speed rather than by the total amount of ethanol administered . however , it is difficult to predict from this information which patients will show a high breath ethanol concentration . hence , all outpatients receiving paclitaxel should avoid driving from hospital when possible and , if driving is unavoidable , they should drive only after taking a sufficient break . the possible effects of the ethanol additive should be considered carefully when administering drugs , such as paclitaxel , with a high volume of ethanol additive .

backgroundethanol is included in certain injectable preparations of anticancer drugs to increase their solubility . since the volume of ethanol in these preparations is approximately half of the total injection volume , the potential inhibitory effects of ethanol on the central nervous system can not be disregarded , especially considering that patients may drive immediately after administration of the medication . therefore , the concentration of ethanol was examined in exhaled breath after administration of paclitaxel , an anticancer medication containing ethanol.methodsthe ethanol concentration in exhaled breath immediately after an intravenous infusion of paclitaxel was measured in 30 patients , using a balloon - type gas detector tube . correlations between the concentration of ethanol in exhaled breath and the total amount of ethanol administered or the intravenous infusion speed were calculated.resultsthe mean ethanol concentration in exhaled breath was 0.028 0.015 mg / l . the correlation between the ethanol concentration in exhaled breath and the total dose of ethanol was weak ( r2 = 0.25 ; p = 0.055 ) , while the intravenous infusion speed showed a stronger positive correlation with the concentration of ethanol in the breath ( r2 = 0.49 ; p = 0.11 ) . the maximum concentration of ethanol measured in exhaled breath ( 0.06 mg / l ) was equivalent to 40% of the threshold for drunk driving , as specified in the road traffic act in japan.conclusionin this study , no patient had a breath ethanol concentration exceeding the legal threshold for drunk driving . however , it is still advisable for patients to avoid driving after receiving paclitaxel injections . when driving can not be avoided , patients should wait for a sufficient time after receiving the injection before driving .

direct immunoflourescence ( dif ) has become an indispensable diagnostic tool in the diagnosis of immunobullous lesions of the skin and has been widely used to supplement the clinical and histologic features of various vesiculobullous disorders . the utility of this technique is limited by cost , site , and time of the biopsy , technical and tissue processing factors , history of treatment and the nature of the disease . this study was undertaken to set up the immunofluorescence facility in our department and to evaluate the practical utility of dif in immunobullous dermatoses at our institution as a university granted research project . the objectives of this study was to evaluate the sensitivity of dif in immunobullous dermatoses and to study the pattern of dif . the study also aimed to correlate dif with clinical and histologic findings and to analyze discrepancies . a cross - sectional study was undertaken at the department of pathology and dermatology of a tertiary care hospital in western india from august 2010 to september 2012 . one hundred patients , of any age and sex , with strong clinical suspicion of an immunobullous lesion were included in the study . patients with a known infective etiology of the bullous lesions were excluded . after taking written informed consent of the patients , two biopsies were performed in each case ; one from the fully developed vesiculobullous lesion ( lesional biopsy ) and the other from the perilesional area within 2 cm diameter of the lesion ( perilesional biopsy ) . histopathological examination ( hpe ) finding were used as a further aid in the diagnosis whereas the perilesional biopsy , placed in normal saline / phosphate buffered saline was immediately taken to the laboratory for dif . the tissue was embedded in the cryostat embedding medium , frozen , and cut at 5 m thickness at 22c . sections were taken on poly l lysine coated glass slides , fixed with ether - alcohol mixture , and air dried for 10 min . later the slides were rinsed in phosphate buffered saline at ph 7.3 for 15 min . the sections were treated with fluorescein isothiocyanate labeled and optimally diluted ( 1:40 ) antisera , i.e. , igg , iga , igm , and c3 respectively . the slides were incubated in wet chamber for 1 h in dark room , washed with phosphate buffered saline pbs and mounted with glycerine jelly . dif was reported based on nature and site of immune deposits , semi quantitative grading of strength of fluorescence and pattern of immune complex deposits . statistical methods used to analyze this study include , percentages , ratio , sensitivity , specificity , and positive and negative predictive values . statistical methods used to analyze this study include , percentages , ratio , sensitivity , specificity , and positive and negative predictive values . ages of our patients ranged from 16 years ( a girl diagnosed as pemphigus vulgaris ) to 87 years ( a male diagnosed as bullous pemphigoid [ bp ] ) with a mean age of 57 years . the maximum ( 33% ) cases belonged to the age group of 41 - 50 years , pemphigus group being maximum ( 27% ) . fluid filled lesions ( 95% ) were the most common clinical finding followed by erosion and crusting ( 73% ) . itching ( 63% ) was the most common symptom followed by pain ( 57% ) and burning ( 55% ) . subcorneal blister was seen in 12% , subepidermal in 28% , and suprabasal in 60% of the cases . histopathological diagnosis of various immunobullous lesions [ figures 1a , 1b , 3a 4a , 5a , 6a , 7a , 7b ] along with corresponding dif findings are depicted in table 1 . ( h and e , 100 ) , ( b ) blister contains eosinophils and few neutrophils . h and e , 400 ) direct immunoflourescence of pemphigus vulgaris ( a ) lacelike intercellular space deposition of igg , ( b ) lacelike ics deposition of c3 pemphigus foliaceus ( a ) subcorneal blister with dyskeratotic acantholytic granular cells . secondary cleft formation seen in the mid - level of epidermis ( h and e , 100 ) , ( b ) direct immunofluorescence shows intercellular space deposition of igg in upper dermis bullous pemphigoid ( a ) subepidermal blister formation with an inflammatory infiltrate in the bullous cavity . ( h and e , 100 ) , ( b ) direct immunoflourescence shows linear deposition of igg in the basement membrane zone linear iga bullous dermatosis ( a ) neutrophils along the dermo - epidermal junction ( h and e , 400 ) , ( b ) direct immunoflourescence showing linear deposits of iga along the dermoepidermal junction dermatitis herpetiformis ( a ) subepidermal bulla ( h and e , 400 ) , ( b ) direct immunoflourescence showing granular deposits of iga along the dermal papillae pemphigus erythematosus ( a ) subcorneal bulla containing acantholytic cells . ( h and e , 100 ) , ( b ) subcorneal bulla contains neutrophils . ( h and e , 100 ) histopathological diagnosis and dif findings of immunobullous lesions on dif examination , intercellular space ( ics ) deposition of igg was present in 51 out of 58 cases of pemphigus vulgaris resembling fishnet pattern [ figure 2a ] . all the cases of pemphigus foliaceus showed ics deposition of igg in upper dermis [ figure 3b ] . majority ( 18/25 ) of bp showed linear igg and c3 deposition in the basement membrane zone ( bmz ) [ figure 4b ] . single patient of linear iga disease showed linear deposition of iga along the bmz [ figure 5b ] . both cases of dermatitis herpetiformis ( dh ) had granular iga deposited along the bmz [ figure 6b ] . single case of pemphigus erythematosus showed granular deposition of igg at ics and also showed igm deposition along the bmz [ figures 8a and b ] . direct immunoflourescence of pemphigus erythematosus ( a ) deposition of igg in intercellular space ( arrow ) , ( b ) granular deposition of igm at dermoepidermal junction ( arrow ) as regards the 11 dif negative cases , seven were of pemphigus vulgaris ( three had no epidermis ) and four were in remission being on long - term cyclophaphamide pulse and steroid therapy . negative immunofluorescence may be viewed as the state of immunological remission in pemphigus because most patients with negative immunofluorescence did not have relapse after discontinuation of the treatment . a total of 4 cases with specific histopathological findings of bp had negative dif due to lack of epidermis in one and technical / sampling errors in the three cases . dif was diagnostic in all the pemphigus variants including the pemphigus foliaceus ( 12% ) and the pemphigus vegetans ( 1% ) . dif also helped to confirm the diagnosis of dh , linear iga dermatosis and pemphigus erythematosus in these solitary cases respectively . the autoimmune bullous lesions result from an immune response against adhesion molecules of epidermis or bmz . there is clinical overlap among various groups of bullous diseases for example : linear iga dermatosis may mimic bp or dh . hpe reveals the site of formation of bulla , the presence of infiltrate and its composition . a differential diagnosis is generated on the basis of combination of findings in the biopsy specimen . subepidermal bullous diseases have overlapping hpe findings and hence their diagnosis on hpe findings alone is difficult . at present , diagnosis of autoimmune bullous disorders is based on immunological and molecular findings rather than clinical and hpe diagnosis alone . the ideal site for the biopsy specimen depends on the type of disorder . for bullous diseases , dif is performed using the perilesional skin that is normal appearing skin immediately adjacent to a lesion . the immune deposits are partially or completely degraded in inflamed or blistered skin and dif may be negative . the differential diagnosis of a dif test depends on primary site of immune deposition , the class of immunoglobulin or other type of immune deposits , number of immune deposits and if multiple , the identity of the most intense deposits and deposition in other sites besides the main site . with these parameters , the most frequent disorder in our study was pemphigus vulgaris and the finding is in accordance with other regional and international studies . male to female ratio was 1:1.7 , which is comparable to the findings of shamim et al . dif findings in pemphigus vulgaris showed igg positivity in ics in fishnet pattern in 51% . dif is positive in 90 - 100% of patients with active disease if an appropriate biopsy specimen has been obtained . occasionally , the fluorescence may be limited to or most intense at the level of the epidermis that is involved with blister formation that is lower epidermal layer for pemphigus vulgaris and superficial epidermal layers in pemphigus foliaceus . this variation in the intensity of fluorescence at various layers of the epidermis may be caused by differences in the relative amounts of the target desmosomal proteins for each of the two diseases , namely desmoglein 1 for pemphigus foliaceus , and desmoglein 3 for pemphigus vulgaris . immunofluorescence is required to differentiate staphylococcal scalded skin syndrome ( ssss ) from pemphigus foliaceus , since a small number of acantholytic cells are seen in case of the former ssss . the lesions of pemphigus foliaceus can become impetiginized , which produces pustules as in impetigo and subcorneal pustular dermatosis . pemphigus vulgaris and vegetans have similar dif findings and hence need to be differentiated by clinical and hpe characteristics . the combination of ics and bmz deposition of igg is seen in pemphigus erythematosus , in which immunopathologies of pemphigus foliaceus and lupus erythematosus co - exist . we had one such case , where the patient had clinical features of systemic lupus erythematosus , her rheumatoid factor and anti - nuclear antibody tests were positive and dif revealed findings of pemphigus and lupus erythematosus . thus , dif helped to confirm the diagnosis of senear - usher syndrome , a rare variant of pemphigus foliaceus . bp affects the elderly during their fifth to seventh decade of life , with an average age of onset being 65 years . nearly , 48% of the patients were in the age group of 61 - 70 years . the reported sex ratios in bp have varied from 2.4:1 to 1:5.75 in different studies due to variation in the sample size . in our present study , herpes gestationis , linear iga dermatosis and epidermolysis bullosa acquisita show subepidermal bulla with neutrophil rich infiltrate , which can be confused with bp . however , dif helps to differentiate these conditions from bp . in our present study , only two cases of dh were seen both being males aged 37 years and 38 years . nicolas et al . reported dh most commonly between the age of 25 - 55 years . inchara reported four cases of dh . but none of the four biopsy proven cases showed immunoglobulin deposits . in absence of characteristic , dif pattern they recommended to use a combination of the clinical and the serological data . differential diagnosis for deposition of igg and/or c3 at the bmz includes bp , cicatricial pemphigoid , pemphigoid gestationis , epidermolysis bullosa acquisita , and bullous systemic lupus erythematosus . c3 deposits with significantly higher intensity than igg favor the pemphigoid group of diseases such as bp , cicatricial pemphigoid , and pemphigoid gestationis . in bp and pemphigoid gestationis , the deposition consists predominantly and occasionally exclusively ( especially in pemphigoid gestationis ) , of c3 . they are present in continuous , fine , and linear patterns . in bullous systemic lupus erythematosus , approximately 60% of cases reveal bmz deposition of igg indistinguishable from that of epidermolysis bullosa acquisita . differentiation between bullous systemic lupus erythematosus and epidermolysis bullosa acquisita is based on the presence of serological evidence of systemic lupus erythematosus . in these subepidermal bullous lesions , dif / indirect immunoflourescence if on salt split skin yields higher rate of positivity in contrast with conventional dif . in bp , patterns of fluorescence was in the roof ( 40.60% ) , floor ( 9.4% ) , and combined roof and floor ( 50% ) . on indirect immunoflourescence , positivity was almost doubled with salt split technique ( 68% ) as compared to routine methods ( 36% ) . our study revealed 90% ppv and 94% sensitivity and the sensitivity was 84% in bp . false negativity was seen in 7/58 cases of pemphigus vulgaris and 4/25 cases of bp group . this was mainly due to technical errors like lack of epidermis in the biopsy ( n = 4 ) , exposure to light ( n = 1 ) , improper site of the skin biopsy ( n = 1 ) and longer stay of the biopsy in the normal saline ( n = 1 ) . total 4 histologically proven cases of pemphigus vulgaris , who were on the treatment revealed the dif negativity . this finding was against the previous documentation , which states that dif is a very reliable diagnostic test for pemphigus , which becomes positive at an early stage and remains positive for a long period after clinical remission . hence , in the absence of the characteristic dif pattern , one needs the combination of clinical , histologic , and immunologic data to support the definite diagnosis of different immunobullous disorders . however , a diagnosis based solely on the clinical or histologic findings may not be accurate . dif is extremely helpful in confirming a suspected diagnosis and in distinguishing among closely related cases of immunobullous lesions . our study concludes that the dif is an essential for diagnosing autoimmune blistering diseases with the clinical and the histopathological overlap . however , larger studies with proper selection of cases and judicious use are mandatory to optimize its utility . dif helped in confirmimg the diagnosis of bullous lesions with the clinical and histopathological overlap.in this study , a rare case of senear - usher syndrome could be diagnosed due to dif.sampling errors contributed to fn results . dif helped in confirmimg the diagnosis of bullous lesions with the clinical and histopathological overlap . in this study , a rare case of senear - usher syndrome could be diagnosed due to dif .

background : autoimmune blistering diseases are a group of bullous disorders characterized by pathogenic antibodies directed at the target antigens , which are components of the desmosomes or adhesion complex at the dermoepidermal junction . direct immunofluorescence ( dif ) is invaluable in the diagnosis of these lesions.aim:the aim of this study was to evaluate the sensitivity of dif in immunobullous dermatoses and to study the pattern of dif . the study also aims to correlate dif with clinical and histologic findings and to analyze discrepancies.materials and methods : total 100 biopsies received over a period of 2 years in the department of pathology were analyzed . dif , histopathology and clinical data were reviewed.results:out of 100 , 89 cases showed dif patterns concordant with clinical / histologic diagnosis . the sensitivity of dif was 94.44% ( 51/58 ) in the pemphigus and 84% ( 21/25 ) in the bullous pemphigoid ( bp ) group , 100% each in dermatitis herpetiformis ( 2/2 ) and linear iga disease ( 1/1 ) . a total of 11 histologically proven cases of immunobullous lesions were dif negative - four ( three of pemphigus vulgaris and one of bp ) due to having no epidermis , three ( cases of bp ) owing to sampling / technical errors and the remaining four ( cases of pemphigus vulgaris ) due to being on treatment.conclusion:immunofluorescence helps confirm the diagnosis of bullous lesions in which there is clinical and the histopathologic overlap . sampling errors contributed to false negative ( fn ) results .

while the term textiloma is used to describe a mass lesion consisting of surgical sponge , the term gossybipoma is reserved for both the mass of sponge and the foreign body reaction around it . these pathologies can mimic other common spinal mass lesions such as hematoma , abscess , soft tissue tumor , etc . their presentation is well known but varies with each case due to different kinds of reactions of body . in literature , 46 cases of gossybipoma involving the spine have been reported;[13419 ] however , it is thought to be more than this number because of medico - legal issues . in this report , we present a case of paravertebral gossybipoma , with a short review of the clinical presentation , radiologic findings and differential diagnosis of these lesions . a 40-year - old woman presented with a history of spinal operation for l4l5 lumbar disk herniation before 8 months and got admitted with non - purulent serous leakage from a small ( 5 mm ) detachment in the surgical wound . the wound was minimal erythematous at the detachment site , but there was no tenderness , swelling or fluctuation . there was no fever , and routine laboratory tests including complete blood count , erythrocyte sedimentation rate , c - reactive protein and blood biochemistry were all normal . microbiologic investigations of the serous leakage revealed no pathogens . while waiting for the microbiological results , treatment with first - generation cephalosporin was started and continued for 4 days , and the serous leakage stopped immediately with secondary healing of the wound in a 1-week period . however , the patient 's same complaints recurred , and thus she got admitted again to our clinic . a computed tomography ( ct ) of the lumbar vertebrae revealed a hyperdense mass lesion located in the left side of the previous operation site . magnetic resonance imaging ( mri ) showed a mass lesion in the left paravertebral area , which was hypointense on t1- and t2-weighted images , with peripheral hyperintense ring in t2-weighted images . mri post - contrast images showed ring enhancement of the lesion [ figure 1 ] . lumbar imaging of our case revealed a paravertebral mass lesion located in the left side of the previous operation site ( arrows ) . ( a ) axial ct scan , ( b ) axial post - contrast enhanced mri , ( c ) sagittal t2-weighted mri the patient was operated by lumbar midline reincision , and the exploration of the left paravertebral area revealed a retained sponge . the sponge was found adherent to the surrounding soft tissue by the new formed fibrotic tissue , which required individual dissection of these fibrotic attachments . histopathologic examination revealed mononuclear cell infiltration and fibrosis formation around the retained sponge [ figure 2 ] . the patient 's complaints showed improvement with no neurologic deficits , and the patient was discharged on postoperative day 3 without complications . a photomicrograph shows the mononuclear cell infi ltration and fi brosis formation around the retained sponge ( h and e , 200 ) many different kinds of hemostatic agents absorbable and non - absorbable are used to control intraoperative bleeding in neurosurgical operations . non - absorbable materials include various forms of cotton pledgets and synthetic hemostats , which should be removed before surgical closure . retained surgical sponges can be found following abdominal , gynecologic , urologic , thoracic , orthopedic or neurosurgical procedures . they are encountered in abdominal and thoracic cavities more commonly but they are also reported after extremity and spinal surgeries . a retained surgical sponge is thought to be a common entity ; however , due to the medico - legal issues , only a few cases in the literature have been reported . while the term textiloma is used to describe a mass lesion consisting of surgical sponge , the term gossybipoma is reserved for both the mass of sponge and the foreign body reaction around it . in the literature , there are 46 reported cases of gossybipoma after spinal surgery since 1965.[13419 ] in these reports , patients had presented mostly with complaints of back pain , common motor weakness and/or sensory deficits in neurologic examination , with no infectious findings , at which the placement of surgical sponge occurred at least a couple years ago before the admission.[151719 ] on the other hand , some cases admitted with fluid leakage after only a short time of the first operation . in our case , the patient presented with sterile serous leakage from the operation wound , 8 months after the previous operation . after surgery , the body gives two types of foreign body reactions against retained sponges : ( 1 ) the exudative type tissue reaction , which leads to acute abscess formation , with a tendency to form fistulas through the skin and ( 2 ) aseptic fibrous tissue reaction , which involves slow adhesion formation , such as encapsulation and granuloma formation . while the time interval to clinical presentation is short with the exudative type tissue reaction , it ranges to even decades after surgery with aseptic fibrous tissue reaction . surgical sponges with radiopaque markers are used now in most of the medical centers . due to this imaging characteristic of the gossybipomas , plain radiographs and/or had reported 13 patients with gossybipomas in thorax and abdomen , and remarked that the radiopaque marker inside the gossybipoma was seen in only nine patients ( 69.2% ) and even then did not always lead to diagnosis . in our case , the gossybipoma was revealed in ct scans as a hyperdense mass lesion , although it was not diagnostic for this lesion . because the differential diagnosis of paraspinal lesions in patients with history of spinal operations include hematomas , abscess or residual / recurrent tumors , mri with intravenous contrast enhancement is known to be the best radiologic investigation modality in these situations [ table 1 ] . kim et al . stated that mri usually shows a well - defined mass with a fibrous capsule that exhibits low signal intensity on t1-weighted images compared with the signal intensity of the paravertebral back muscles , high signal intensity in the center with hypointense rim on t2-weighted images , and strong peripheral enhancement in post - contrast images . on the other hand , mri of our case demonstrated a mass lesion , which was hypointense on both t1- and t2-weighted images , with peripheral hyperintense ring in t2-weighted images and peripheral enhancement in post - contrast images . accordingly , we believe that despite the importance of the mri in the diagnosis of gossybipoma lesions , the definitive diagnosis must be mainly aided by the high suspicion profile of the physician and the intraoperative findings . in patients with the history of spinal operation , gossybipomas should always have a place in the differential diagnosis of newly found lesions , as it is believed that they are much more common than they are reported . however , no pathognomic radiologic characteristics are defined for these lesions . for this reason , the definitive diagnosis must be mainly aided by the high suspicion profile of the physician and the intraoperative findings . thus , it must be remembered that careful inspection of the surgical field before closure is still an important basic rule in surgery .

spinal or paraspinal retained surgical sponges ( gossybipoma or textiloma ) are rare incidents and mostly asymptomatic in chronic cases , but can be confused with other masses such as a hematoma , an abscess or a tumor . in chronic cases , the presentation can be as late as decades after the initial surgery ; however , some gossybipomas cause infection or abscess formation in the early stages . the authors report a 40-year - old woman with a history of operation for lumbar disk herniation before 8 months , and got admitted with a complaint of serous fluid leakage from the operation wound . in this report , the authors discuss the clinical presentation , the radiologic findings and the differential diagnosis of gossybipoma .

suprapubic cystostomies are performed for a variety of indications that require either temporary or permanent placement of suprapubic catheters . the placement of percutaneous suprapubic catheters using a punch trocar technique involves some risks and should not be considered an innocuous procedure . among the wide variety of complications , the most serious complication is bowel injury . bowel injuries include perforation of the ileum [ 2 - 6 ] and colon as well as small bowel obstruction and volvulus [ 3,7 - 9 ] . because the percutaneous tract is blindly made at 3 to 4 cm above the symphysis pubis in the midline , the risk of bowel injury is constantly present . therefore , before a percutaneous cystostomy is performed , especially if there has been prior abdominal or pelvic surgery , or if the bladder is not full , it is strongly advised to consider using ultrasound for the detection of interposed bowel along the percutaneous tract , because the bowel may be in close proximity to the tract . however , that method does not totally guarantee the nonexistence of bowel crossing the tract , because it may be difficult for the ultrasound to detect a collapsed bowel . despite this clinical setting , there has been little study of the risk factors for bowel injury associated with percutaneous cystostomy . this may be largely due to the practical limitations in demonstrating bowel injury before and after suprapubic cystostomy . in this study , we investigated the risk factors for possible bowel interposition between the bladder and the skin at the routine puncture site of suprapubic cystostomy by computed tomography ( ct ) , assuming that a hypothetical suprapubic cystostomy was performed . we retrospectively reviewed 795 consecutive adult abdominopelvic ct scans performed for various reasons in our hospital from september to october 2009 . among them , we selected 226 patients whose bladders were distended more than 6 cm above the upper margin of the symphysis pubis . their medical charts at the time of the ct scan were analyzed retrospectively . through the ct scan images , we determined whether the bowel was interposed between the urinary bladder and the skin at a point along the midline of the abdomen , 3 cm above the upper margin of the symphysis pubis ( fig . we investigated whether the age , gender , height , history of radical pelvic surgery , or the distance between the upper margin of the symphysis pubis and the umbilicus influenced the possibility of bowel interposition between the bladder and the skin at the suprapubic puncture site . statistical analyses were performed by applying the chi - square test and multiple logistic regression using commercially available software spss ver . 14.0 ( spss inc . , chicago , il , usa ) . a p - value of < 0.05 was considered statistically significant . the patients ' mean age was 63 years ( range , 26 - 84 years ) . among the 226 patients , 22 ( 9.7% ) had undergone radical pelvic surgery previously . the mean distance between the upper margin of the symphysis pubis and the umbilicus was 14.4 cm ( range , 7.2 - 21.0 cm ) ( table 1 ) . the univariate analysis showed that sex ( female , p=0.028 ) , obesity ( body mass index [ bmi]25 kg / m , p=0.006 ) , a positive history of radical pelvic surgery ( p<0.001 ) , and a short distance ( 11 cm , p=0.016 ) between the upper margin of the symphysis pubis and the umbilicus were significantly correlated with bowel interposition at the routine suprapubic puncture site ( table 2 ) . among the 22 patients who had a radical pelvic operation , 20 had lower anterior resection , and the other 2 had segmental resection of the rectum due to rectal or colon cancer . in the multivariate analysis , obesity ( p=0.019 ) , a positive history of pelvic surgery ( p=0.001 ) , and a short distance ( p=0.016 ) between the upper margin of the symphysis pubis and the umbilicus were independent predictors for the bowel passing through the percutaneous tract ( table 3 ) . in our multivariate analysis , obesity , a history of pelvic surgery , and a short distance between the symphysis pubis and the umbilicus were independent predictors of bowel interposition through the percutaneous suprapubic cystostomy tract . prior pelvic surgery is a well known risk factor for bowel injury after percutaneous cystostomy . after a pelvic operation , the bowel can move downward through the opened space of retzius , and associated postoperative adhesions may develop between the anterior abdominal wall and peritoneum , both of which may increase the probability of bowel injury during a suprapubic cystostomy procedure . in our study , 9 of the 22 patients ( 40.9% ) who had radical pelvic surgery had an interposed bowel at the routine suprapubic cystostomy tract , whereas 17 of the 204 ( 8.3% ) without a history of pelvic surgery had bowel interposition . all of the prior pelvic surgeries were opened lower anterior resections because of rectal or colon cancer . obesity has also been considered as a risk factor for bowel injury when performing a suprapubic cystostomy because it is difficult to localize the bladder in such patients . our study presented the novel hypothesis that obesity itself is an independent predictor for bowel interposition through the cystostomy tract . we do not know the exact reason for the above finding , but assumed that because obese patients have relatively larger bowel contents as well as omental fat , the bowel tended to move downward in the limited intra - abdominal space . similarly , the correlation of bowel interposition with a short distance between the symphysis pubis and the umbilicus can be understood in the same manner . as we mentioned above , 8.3% of the patients without a history of pelvic surgery had interposition of the bowel through the routine cystostomy tract . this was much higher than the general consensus , because the placement of a suprapubic tube for urinary diversion is generally an uneventful procedure . for the safe placement of a suprapubic catheter , the most important point is the full distension of the urinary bladder before the procedure . in this study , we considered bladder distension more than 6 cm above the upper margin of the symphysis pubis as a cutoff point on the basis of data from voiding cystourethrograms performed in 20 adult patients with neuropathic bladder . in their films , the average distance between the symphysis pubis and the upper margin of the cystogram at full bladder distension was 6.2 cm . we therefore defined 6 cm as the assumptive point of full bladder distension . because a fully distended bladder in a normal patient without neuropathic bladder can rise more than 6 cm above the symphysis pubis , it seemed likely that our results overdetected the bowel interposition through the cystostomy tract . however , we should take into consideration that , clinically , the complications of suprapubic cystostomy are commonly seen in small capacity bladder with neuropathic deficits . in the practical setting , although a small capacity bladder itself would be the major risk factor for complications in performing suprapubic cystostomy , the retrospective nature of our study could not reveal that relationship . the high exclusion rate ( 71.6% ) was another major pitfall of this study , because patients who underwent abdominopelvic ct scan were not instructed to endure the urge to urinate . to our knowledge , this is the first study that attempted to reveal the risk factors of possible bowel injury related to suprapubic cystostomy , even though the study was performed by an indirect approach . this study demonstrated the risk factors for the bowel being interposed at the routine suprapubic puncture site as detected by ct scan . when performing a suprapubic cystostomy , extreme caution is needed to avoid possible bowel injury in patients who are obese , who have had previous radical pelvic operations , and who have a short distance ( 11 cm ) between the upper margin of the symphysis pubis and the umbilicus .

purposethe most serious complication of suprapubic cystostomy is bowel injury . by computed tomography ( ct ) , we investigated the risk factors of possible bowel interposition through the percutaneous suprapubic cystostomy tract.materials and methodsfrom september to october 2009 , we consecutively reviewed 795 abdominopelvic ct scans of adult patients performed for various reasons in our hospital . from these scans , we selected the films wherein the urinary bladder was distended more than 6 cm above the symphysis pubis . we then determined whether the bowel was interposed between the bladder and the skin at the routine puncture site of suprapubic cystostomy ( the midline of the abdomen 3 cm above the upper margin of the symphysis pubis ) . we analyzed which factors influenced the possibility of the bowel being interposed between the bladder and the skin at the suprapubic puncture site.resultsa total of 226 ct ( 148 males , 78 females ) scans were selected . the mean patient age was 63 years ( range , 26 - 84 years ) . the mean distance between the upper margin of the symphysis pubis and the umbilicus was 14.4 cm ( range , 7.2 - 21.0 cm ) . in the multivariate analysis , obesity , a positive history of radical pelvic surgery , and a short distance ( 11 cm ) between the symphysis pubis and the umbilicus had significant correlations with bowel interposition in the assumed tract.conclusionswhen performing a suprapubic cystostomy , extreme caution is needed to avoid possible bowel injury in patients who are obese , had a previous radical pelvic operation , or have a short distance between the upper margin of the symphysis pubis and the umbilicus .

the successful isolation of individual layers of graphene in 2004 has triggered an intense interest in its unique structural and electronic properties . a very high carrier mobility along with weak spin orbit and hyperfine interactions predestinates graphene as a promising material for spintronics , mainly if magnetic ordering can be introduced . however , due to the delocalized bonding network , ideal graphene is intrinsically nonmagnetic . therefore , developing effective methods for synthesizing ferromagnetic ( fm ) graphene with high magnetization is vital for applications in novel spintronic devices combining charge and spin manipulation . a number of factors including atomic vacancies , zigzag edges , sp functionalization , and chemical doping of foreign atoms can induce localized magnetic moments in graphene , which are indispensable for the existence of magnetic ordering . among these strategies , doping of the graphene lattice with noncarbon atoms has been identified as a promising approach for imprinting magnetic ordering into graphene while preserving / enhancing its electric / optical properties , as desirable for spintronic , optoelectronic , and magnetooptical applications . substitutional doping of graphene by light elements has recently attracted much attention ( see , e.g. , refs ( 1114 ) ) . in particular , nitrogen doping of the graphene lattice has been extensively studied , aimed at tuning the graphene electronic features , and hence its physical properties , in order to meet the requirements of a given application . n - doped graphenes have been tested as active materials for li - ion batteries , fuel cells , field - effect transistors , ultra- and supercapacitors , and in the fields of photocatalysis and electrochemical biosensing . chaban and prezhdo have argued that graphene structures containing 1/3 of nitrogen atoms or less should be stable up to 1000 k provided n having similar atomic size and one additional electron compared to a carbon atom , nitrogen acts as an n - type ( electron - donating ) dopant by increasing the number of electrons when substituted into the graphene lattice , thus affecting the graphene electric conductivity . the substitution of carbon by nitrogen atoms in the graphene lattice necessarily leads to changes in the electronic density of states , and graphitic nitrogen can provide electrons close to the fermi level of graphene . if the itinerant electrons occupy narrow bands at the fermi level , stoner magnetism can emerge , as recently shown for graphene doped with sulfur . indeed , it has been theoretically proposed that depending on the concentration and packing geometry of doping nitrogen atoms , it is possible to induce a magnetic response in graphene . however , the physical mechanism governing the emergence of magnetically ordered structures was not discussed . until now , all the experimental attempts to imprint magnetism into graphene through n - doping have failed . recently , a detailed theoretical and experimental magnetic study revealed that introduction of pyrrolic nitrogen into the graphene lattice decreases the magnetization values compared to those observed for defective graphene . % ) was identified to enhance ferromagnetism in highly oxidized graphene ( i.e. , graphene oxide ) synthesized via hydrothermal reaction . fm behavior has also been reported in other nitrogen - doped graphene oxide systems . however , n - doped graphene oxides are unsatisfactory because a high amount of oxygen ( sp functionalization ) is regarded as a dominant source of magnetism , overwhelming the effects of nitrogen doping itself . moreover , oxygen - containing functional groups drastically reduce the electric conductivity of graphene the main prerequisite for spintronic technologies . thus , development of fm n - doped graphene with negligible oxygen content and elucidation of the effect of various nitrogen configurations ( pyrrolic , pyridinic , graphitic , chemisorbed ) remains a key challenge in the fields of nanotechnologies , magnetism , and spintronics . in this work , we first report the emergence of a magnetically ordered state in graphene doped solely with nitrogen . % of nitrogen , the doping - induced paramagnetic centers commenced to interact magnetically , resulting in establishment of fm ordering at temperatures below 69 k. in the fm state , the saturation magnetization reached 1.09 emu / g , which is among the highest values reported so far for doped graphene - based systems . dft calculations demonstrated that graphitic nitrogen was dominantly responsible for evolution of the magnetically active configurations . in contrast , pyridinic and chemisorbed nitrogen had a considerably lower effect on imprinting the magnetism into graphene . this finding opens possibilities for an extensive research in spintronic and magnetooptical technologies based on graphitic n - doped graphene . graphite microparticles ( 215 m , 99.9995% , alfa aesar ) were used for all syntheses . sulfuric acid ( 98% ) , nitric acid ( 68% ) , potassium chlorate ( 99% ) , hydrochloric acid ( 37% ) , silver nitrate ( 99.5% ) , and barium nitrate ( 99.5% ) were obtained from penta , czech republic . nitrogen ( 99.9999% purity ) and ammonia ( 99.9995% purity ) were obtained from siad , czech republic . briefly , sulfuric acid ( 98% , 87.5 ml ) and nitric acid ( 68% , 27 ml ) were added to a reaction flask ( pyrex beaker with thermometer ) containing a magnetic stir bar . graphite ( 5 g ) was then added to the mixture under vigorous stirring and , keeping the reaction flask in the ice bath , potassium chlorate ( 55 g ) was slowly added . after a complete dissolution of potassium chlorate , the reaction flask was loosely capped to allow the escape of gas evolved and the mixture was continuously stirred for 96 h at room temperature . the obtained graphene oxide was then redispersed in hcl solution ( 5% , 3 l ) to remove sulfate ions and repeatedly centrifuged and redispersed in deionized water until a negative reaction on chloride and sulfate ions with silver and barium nitrate was achieved . the resulting graphite oxide was dried in a vacuum oven at 50 c for 48 h. nitrogen - doped graphenes were prepared by combined exfoliation and reduction of graphite oxide in an ammonia atmosphere . briefly , 100 mg of graphite oxide was placed inside a quartz glass capsule connected to a magnetic manipulator and mounted in a horizontal quartz glass reactor . subsequently , the sample was inserted in the hot zone of the reactor while the ammonia flow was kept at 1000 ml min and the pressure was 100 kpa . the temperature of the sample was held constantly for 12 min at 400 , 600 or 800 c . after removal from the hot zone of the reactor , the sample was cooled in an ammonia atmosphere . the gn0.015 sample was prepared at 400 c , gn0.033 sample was prepared at 600 c , and gn0.051 sample was prepared at 800 c ; the subscript reflects the level of nitrogen in the respective sample as identified from the analysis of the respective survey x - ray photoelectron spectroscopy patterns . % in all the samples studied . compared to thermally reduced graphene oxide ( trgo ) , used as a blank undoped sample , a slight increase in the oxygen content can be explained in terms of competing processes of nitrogen incorporation and reduction of graphite oxide . trgo sample was prepared at 800 c by a similar procedure using only nitrogen ( 1000 ml min ) as an exfoliating atmosphere . the residual metal content in the trgo and n - doped graphene samples was analyzed by inductively coupled plasma mass spectrometry ( icp - ms ) . an exact amount of sample ( 10 mg ) was immersed in concentrated nitric acid ( 99.999% trace metals basis ) and heated for 2 h at 100 c . afterward , the mixture was transferred into a 10 ml volumetric flask , diluted with water and any undissolved graphene was separated using a 200 nm millipore filter . the measured concentration of metals in the solution was recalculated to the amount in the tested sample ( analogically , diluted nitric acid was used as a blank ) . the atomic percent of c , o , and n , and types of bonds were assessed by x - ray photoelectron spectroscopy ( xps ) , employing a phi 5000 versaprobe ii xps system ( physical electronics ) equipped with a monochromatic al k source ( 15 kv , 50 w ) with a photon energy of 1486.7 ev . all the xps patterns were measured in a vacuum of 1.4 10 pa and at room temperature ( 22 c ) . for high resolution xps patterns , a pass energy of 23.500 ev and step size of 0.200 ev xps patterns were evaluated with a multipak ( ulvac , phi , inc . ) all binding energy values were referenced to the c 1s peak at 284.80 ev . raman spectra were acquired using a dxr raman spectroscope ( thermo scientific , u.s.a . ) the respective sample was first deposited on a glass platform and the excitation laser was focused on its surface . the laser power on the sample was set to 5 mw and the exposition time was 20 s. each measured raman spectrum was an average of 16 experimental microscans . thermogravimetric analysis ( tga ) and evolved gas analysis ( ega ) curves were recorded using a netzsch sta 449c jupiter system with an adapted qms 403c aolos quadrupole mass spectrometer . tga / ega measurements were performed in an open -al2o3 crucible under an argon atmosphere ( 80 cm min ) . a temperature program from 40 to 1000 c with a heating rate of 5 k min was used . magnetization measurements of the trgo and n - doped graphene samples were performed using a physical property measurement system ( ppms ) equipped with a vibrating sample magnetometer ( vsm ) from quantum design , u.s.a . hysteresis loops were measured over the temperature range from 5 to 300 k and under static external magnetic fields ranging from 50 to + 50 koe . temperature profiles of the mass magnetic susceptibility , mass , were recorded in a sweep mode over a temperature range from 5 to 300 k in a field of 1 koe after cooling in a field of 1 koe . magnetization values were corrected assuming the response of the sample holder , sample capsule , and respective pascal constants . atomistic calculations were performed using a spin - polarized density functional theory ( dft ) and projected augmented wave potentials ( paw ) representing atomic cores as implemented in the vienna ab initio simulation package ( vasp ) . electronic exchange and correlation effects were treated by using the perdew , burke , and ernzerhof ( pbe ) generalized - gradient approximation ( gga ) with a plane wave cutoff of 600 ev . brillouin zone integrations were performed with a 6 6 1 point - centered monkhorst pack k - point mesh per conventional 4 3 rectangular cell ( structure and cell optimization ) . the electronic density of states was calculated using the tetrahedron method with a 21 21 1 k - point mesh . partitioning of the ground state electronic density into contributions attributed to the different atoms was performed exploiting the bader analysis . total magnetic moments were calculated from the difference between the number of electrons in occupied majority- and minority - spin states . local magnetic moments were calculated by projecting the plane - wave components of all the occupied eigenstates onto spherical waves inside an atomic sphere and integrating the resulting local density of states . a full structural optimization was performed using a quasi - newton algorithm until the residual atomic forces were lower than 25 mev . simultaneously , the electronic and magnetic degrees of freedom were converged to an energy of less than 10 ev . the stability of the reported configurations was analyzed in terms of the formation energy , ef , of the n - doped complexes using the formula given as ef = 1/n[edpd egraph + n(c n ) ] , where edpd and egraph stand for the total energies of the doped and pristine graphene sheet , respectively , c and n are the chemical potentials of c and n atoms , respectively ( here , approximated by the atomic energies of c and n ) , and n is the number of substituted atoms . a positive ef indicates that the doping process is endothermic , although it does not hinder the formation of thermodynamically stable complexes . the adsorption energy ( ead ) per n atom ( n = 1 and 2 ) on a pristine layer was calculated as the total energy difference between the energy of an adatom - graphene complex , en / graph , a clean graphene layer , egraph , and an isolated n atom in the gas - phase , en , i.e. , ead = 1/n(en / graph egraph nen ) . similarly , the adsorption energy of on - surface nitrogen on n - doped graphene was calculated as the total energy difference between the energy of a doped graphene with an adatom , en / dpd , a doped graphene sheet , edpd , and a gas - phase n atom , i.e. , ead = en / dpd edpd en . to study the role of n - doping on imprinting magnetic features into graphene , three samples differing in nitrogen content were prepared ; the level of doping was solely controlled by the temperature , while all other synthetic parameters were kept constant . the trgo sample was synthesized as a reference blank sample for which no source of nitrogen ( i.e. , ammonia atmosphere ) was used during the thermal reduction of graphite oxide . the reduction process was found to be highly efficient , as evident from the very low content of oxygen ( 1 at . % , see the survey and high - resolution c 1s xps pattern in figure s1a , b in supporting information ) . the paramagnetic / fm response of graphene evolved due to defects and/or functionalization is of several orders of magnitude lower compared to that of 3d - block metals , such as iron , cobalt , nickel , and manganese . hence , the results of magnetization measurements may be incorrectly interpreted if these strong magnetic elements are present in the system as a consequence of using reactants containing 3d - block metals and/or the sample handling . thus , icp - ms was employed to quantify the presence of 3d metal impurities and exclude their effect on the magnetic properties of n - doped graphenes . the total concentration of fe , ni , co , and mn , regarded as the main magnetic impurities in trgo and n - doped graphene samples , was below 10 ppm ( see table s1 in supporting information ) . taking into account the determined concentrations and magnetic moments of the metal impurities , the total mass of fe , ni , co , and mn was estimated to be of the order of 10 emu g oe at 0 k and in a 1 koe field . as mass values for trgo and n - doped graphene systems reached orders from 10 down to 10 emu g oe in a 1 koe field ( see below ) , the contribution of fe , ni , co , and mn to the samples mass was assumed to be negligible in measurements of temperature evolution of mass and hysteresis loops , thus definitely not overshadowing the magnetic properties of graphene induced solely by nitrogen doping . doping of graphene with nitrogen was monitored by xps and raman spectroscopy . in survey xps patterns recorded for n - doped graphene samples , peaks belonging to c , n , and o were clearly observed ( see figure s2 and table s2 in supporting information ) . the content of nitrogen was found to increase progressively with the temperature at which the thermal reduction of graphite oxide in the presence of ammonia was conducted ( i.e. , 400 c , 1.5 at . the presence of nitrogen was further evidenced in the high - resolution c 1s xps profile , which showed the emergence of a peak at a binding energy of around 285.5 ev corresponding to the c n spectral component increased in area with the level of n - doping . a small shift in the maximum of the c n peak witnessed for the three n - doped graphene samples can be explained in terms of impossibility to distinguish differently coordinated nitrogen atoms with carbon atoms in graphene with similar binding energy values in the c 1s domain and the significant overlap of the c n and c o spectral components . high - resolution n 1s xps patterns of n - doped graphene samples ( see figure 2 and figure s3 and table s3 in supporting information ) showed three distinct peaks corresponding to nitrogen in different configurations inside a graphene lattice or attached covalently to a graphene sheet ( see figure 3 ) , i.e. , pyridinic nitrogen ( at 398.3 to 398.5 ev ) , graphitic nitrogen ( at 401.0 to 401.5 ev ) , and chemisorbed n / n2 ( at 404.5 to 405.5 ev ) . in contrast , no traces of pyrrolic nitrogen , usually present at 400.0 ev , were observed ( compare the high - resolution n 1s xps patterns shown in figure 2 and figure s3 in supporting information with figure 3 ) . the pyridinic and graphitic nitrogen were viewed as nitrogen incorporated inside the graphene lattice , whereas chemisorbed n / n2 was viewed as nitrogen adsorbed as adatoms . the presence of n / n2 was further confirmed by tga and ega techniques with gas electron ionization mass spectrometry , indicating emission of a fragment with m / z = 28 ( for n / n2 ) above 300 c ( see figure s4 in supporting information ) . in addition , as no fragments with m / z = 30 and 48 were detected , the samples were considered free of any no and no2 species , respectively . this agrees with the analysis of the raman spectra of n - doped graphene samples as no raman peaks around 1430 cm , characteristic for no and no2 species , are observed ( see figure 1b , d , f ) . high - resolution c 1s xps patterns of the ( a ) gn0.015 , ( c ) gn0.033 , ( e ) and gn0.051 sample with bonds indicated . raman spectra of the ( b ) gn0.015 , ( d ) gn0.033 , and ( f ) gn0.051 sample with the id / ig ratio indicated . high - resolution n 1s xps pattern of the gn0.051 sample with peaks assigned to differently coordinated nitrogen . scheme showing different bonding configurations of nitrogen in n - doped graphene and corresponding peaks in a simulated high - resolution n 1s xps pattern . raman spectra of the gn0.015 , gn0.033 , gn0.051 , and trgo sample are shown in figure 1b , d , f and figure s1c in supporting information . it can be seen that on increasing the level of n - doping , the d - to - g band intensity ratio , id / ig , increased . it is known that if nitrogen enters the graphene lattice , the intensity of the d - band , i d , in the raman spectrum of graphene is enhanced due to defects that emerge upon incorporation of nitrogen into the graphene structure . this provides further evidence that under the synthetic conditions used , accommodation of nitrogen into the graphene lattice was strongly favored over a simple adsorption / addition process . if defects are introduced into graphene , paramagnetic centers emerge that may interact via suitable mediators ( i.e. , -conduction electrons , overlapping orbitals favoring superexchange mechanism , etc . ) to generate long - range magnetic ordering in the 2d lattice . under such conditions , the magnetic susceptibility of graphene , , involves three contributions , i.e. , = dia + para + ferro , where dia is the diamagnetic term including orbital , landau and core diamagnetic contributions , para is the paramagnetic term including noninteracting ( isolated ) defect - induced paramagnetic centers , pauli paramagnetic contribution from conduction electron and van vleck contribution , and ferro is the fm term describing the magnetic response of interacting defect - induced paramagnetic centers . as expected , pristine trgo behaved in a diamagnetic manner with only a tiny paramagnetic response at low temperatures ( see figure s1d in supporting information ) due to paramagnetic centers emerging as a result of defects and/or the negligible content of oxygen functionalities , which were most likely at the edges ; the profile of mass of trgo well matched the modified curie law , i.e. , mass = mass , dia + c / t , where mass , dia is the diamagnetic contribution , c is the curie constant , and t is the temperature . similarly , the temperature evolution of mass measured for the gn0.015 and gn0.033 sample also obeyed the modified curie law ( see figure 4a , b ) . the number of paramagnetic centers increased upon increasing the level of n - doping , as expected and evidenced by an enhanced paramagnetic curie contribution ( see insets in figure 4a , b ) . however , n - doping at such levels did not imprint any magnetic configuration ( as confirmed by theoretical calculations discussed below ) and the induced paramagnetic centers were far from each other , precluding the establishment of a long - range magnetic ordering . thus , the gn0.015 and gn0.033 sample showed dominant diamagnetic behavior , as also witnessed from the isothermal magnetization curves measured at 5 k ( see insets in figure 4a , b ) . temperature evolution of the mass magnetic susceptibility , mass , of the ( a ) gn0.015 and ( b ) gn0.033 sample recorded under an external magnetic field of 1 koe . the insets in panel ( a ) and ( b ) show the temperature profile of mass after subtraction of the diamagnetic component and behavior of the 5 k hysteresis loop of the gn0.015 and gn0.033 sample , respectively . ( c ) temperature evolution of mass for the gn0.051 sample recorded under an external magnetic field of 1 koe with the curie temperature , tc , indicated . the insets show the trend of mass at low temperatures and the temperature profile of the fm contribution , mass , ferro , derived from fitting the measured mass . ( d ) hysteresis loop of the gn0.051 sample measured at a temperature of 5 k. the insets show the behavior of the hysteresis loop around the origin with the coercivity marked and field - dependent profiles of magnetization for the ferromagnetic , mferro , and paramagnetic , mpara , component derived from fitting the measured isothermal magnetization curve . ( e ) scheme showing different magnetic fractions in the gn0.051 sample and their respective profiles of mass . interestingly , for the gn0.051 sample , the temperature profile of mass was drastically different compared to the gn0.015 and gn0.033 sample as it could not be described by the modified curie law . on lowering the temperature , mass showed a saturation tendency followed by an abrupt increase , indicating two contributions , i.e. , fm and paramagnetic ( see figure 4c e ) ; contrary to the graphene systems with a lower n - doping , the diamagnetic term was found to be negligible here . the presence of both magnetic fractions can be explained by assuming that the n - doped graphene sheets within the sample contained nitrogen in different structural configurations , which have a different impact on the magnetism of graphene , as predicted by the theory discussed below . moreover , it is known that even in sheets showing fm behavior , isolated paramagnetic centers may evolve owing to the presence of vacancies and defects of topological and edge nature . in order to fit the temperature evolution of mass , the paramagnetic term was fitted using the curie function ( i.e. , mass = c / t ) over the whole temperature interval , whereas a model function involving a combination of the curie weiss law ( i.e. , mass = c/(t ) , where is the weiss temperature ) at high temperatures and brillouin function within the mean - field approximation at low temperatures was constructed to describe the fm contribution ( see inset in figure 4c ) . the fitting yielded 69 k , angular momentum number j 1.19 , and a weight - normalized ratio of ferromagnetic - to - paramagnetic contribution equal to 1.66 . note that the value of j is not an integral multiple of 0.5 as expected and must be treated as an average over all the n - doped graphene sheets in the gn0.051 sample as the sheets can have different c n configurations / arrangements with different net magnetic moments ( see below ) , as already reported for n - doped and s - doped graphene systems . furthermore , can be assigned to the curie temperature , tc , marking the transition from the paramagnetic to fm regime on lowering the temperature . thus , in accordance with the theory , if the concentration of nitrogen exceeds a threshold value ( > 5 at . % of n ) , magnetically active motifs inside the graphene lattice evolve , eventually leading to a magnetically ordered ( i.e. , fm ) state at low temperatures . % of n to the low - temperature fm regime was further confirmed by a series of hysteresis loops measured over the temperature range from 5 to 300 k ( see figure 4d and figure s5 in supporting information ) . at 5 k , the isothermal magnetization curve showed hysteresis with a coercivity of 92 oe ( see inset in figure 4d ) and saturation magnetization reaching 1.09 emu / g . the derived value of the saturation magnetization is of identical order as reported for s - doped graphenes and vertical graphenes , which are regarded as the magnetically strongest carbon - based systems prepared to date . the nonzero value of the coercivity implies that n - doping imprints magnetic anisotropy on the graphene lattice , establishing an easy axis of magnetization along which the magnetic moments of the generated paramagnetic centers energetically prefer to lie . following the mathematical procedures of liu et al . and tuek et al . and assuming the j value and weighted ferromagnetic - to - paramagnetic ratio derived from the mass vs t profile , we next attempted to separate the paramagnetic and fm contribution in the 5 k isothermal magnetization curve ( see inset in figure 4d ) . the fitting yielded a saturation magnetization of 0.65 emu / g and 0.37 emu / g for the fm and paramagnetic contributions , respectively . on raising the temperature , the coercivity decreased to zero ( see inset in figure s5b in supporting information ) and the hysteresis was lost at a temperature of 70 k ( see figure s5a in supporting information ) , indicating a transition from the fm to paramagnetic regime . thus , the experimental results suggested that when the concentration of nitrogen was increased and it became firmly embedded in the crystal lattice of graphene , the number of induced paramagnetic centers increased , eventually forming magnetically active motifs with conduction electrons providing interaction pathways between them and establishing long - range magnetic ordering upon decreasing the temperature . it was hypothesized that upon further increasing the nitrogen concentration in the graphene lattice , magnetic interactions would be strengthened , as reflected by a shift of tc to higher temperature . moreover , the presence of more paramagnetic centers would enhance the saturation magnetization , approaching the values observed for s - doped and vertically oriented graphenes , i.e. , systems where the magnetic features are imprinted by defects . here % of n was probably a consequence of the different nitrogen motifs identified in the samples by xps ( graphitic , pyridinic , and chemisorbed importantly , we did not identify pyrrolic nitrogen in the samples , which has previously been shown to cause a fall in magnetization values . to decipher the effect of nitrogen in various bonding configurations ( as identified by xps , figure 2 and figure s3 in supporting information ) on the magnetic properties of graphene , we performed a first - principles study of the structural , electronic , and magnetic properties of n - doped graphenes . the magnetic contributions of individual n - motifs were also addressed in details . we used a rectangular graphene cell containing 96 atoms , which was computationally tractable and enabled the experimentally determined total and relative ( among different bonding configurations ) content of nitrogen to be followed closely . specifically , we considered chemisorbed nitrogen ( both n and n2 ) on the top of the graphene sheet and two graphitic and pyridinic nitrogen atoms in the graphene lattice ( see figure 5 ) . top view of graphene doped with graphitic ( in para configurations ) , trimerized pyridinic and chemisorbed ( a ) n and ( b ) n2 marked respectively by red , green , and magenta , with positive ( negative ) spin densities plotted in blue ( red ) for isosurfaces at 1 10 ( panel ( a ) ) and 2.5 10e ( panel ( b ) ) . ( c , d ) the corresponding dos plot for configuration shown in panel ( a ) and panel ( b ) , respectively . the computational data fully supported the experimental results . in particular , the energetically most stable structures , as presented in figure 5a , b , exhibited fm ordering with 1.3 and 0.3 b magnetic moment per supercell for n and n2 , respectively , chemisorbed on the graphene surface . the density of state ( dos ) plots presented in figure 5c , d indicated exchange coupling mediated by the conduction electrons . moreover , the strong spin - polarized electron features at the fermi level in the dos structures showed a predominant contribution from the graphitic n atoms , which highlights their important role in developing stoner - like magnetism in n - doped graphenes . it should be noted that depending on the position of nitrogen on the graphene surface with respect to the graphitic and pyridinic nitrogen atoms , a large number of possible magnetic configurations were found with a varying effective magnetic moment per cell and exhibiting both fm and antiferromagnetic behavior or even disappearance of magnetic order . this may explain the complexity of the magnetic measurements discussed above for the gn0.051 sample , as the experimental response represented an average over a large number of structures with different net magnetic moments . thus , to understand the role and contribution of individual nitrogen motifs in triggering magnetism in n - doped graphenes , we carried out an extensive set of additional calculations with a smaller cell containing 48 atoms . the magnetic properties of graphene doped with graphitic nitrogen exhibited a strong dependence on both the nitrogen concentration and configurations . % of graphitic nitrogen ( the percentages used result from the size of the cell employed in the calculations ) are shown in figure s6 in supporting information . the magnetism of graphene doped with graphitic nitrogen has been attributed to delocalized electrons occupying narrow peaks at the fermi level ( ef ) . % of nitrogen was predicted to be nonmagnetic , in accord with dft calculations by wang et al . , and the narrow electron donor states near ef were absent in the partial density of states ( pdos ) . at 4.2 at . % of nitrogen , the computational screening identified a magnetic structure with a magnetic moment of 0.2 b per supercell in which n atoms substituted c atoms at para positions ( see figure 6 ) . the same motif was responsible for triggering ferromagnetism in the larger 96-atom cell , which highlights the importance of the graphitic nitrogen motif in imprinting fm order in n - doped graphene . n - doping generating the fm state gave rise to a strong pz electron peak at the fermi level in the electronic structure according to pdos , similar to recent reports for graphene doped with 4.2 at . the magnetic polarization was confined to a narrow part of the cell , in zigzag directions between the doping atoms , as can be seen in the inset in figure 6 presenting isosurfaces of spin densities . importantly , formation of zigzag edges by cutting graphene along a certain crystallographic direction has been shown to give rise to peculiar edge localized states near the fermi level responsible for the spontaneous formation of magnetic ordering in graphene nanoribbons . partial densities of states calculated for graphene doped with nitrogen embedded in the lattice at para positions at a concentration of 4.2 at . the supercell is shown in the inset , where an isosurface of spin - density plotted at 5 10e is also displayed . % of graphitic nitrogen , a greater number of magnetic configurations with the magnetic moment varying between 0.1 and 0.8 b / supercell ( see figure 7 and figure s7 in supporting information ) were produced . these magnetic structures contained two n atoms in the meta configuration embedded in the graphene lattice . the magnetic behavior of this system could be tuned by changing the position of the third n atom in the host lattice as it stayed on the zigzag paths between the other two n atoms . finally , because of the similar atomic sizes of nitrogen and carbon atoms , incorporation of nitrogen into the honeycomb network of graphene did not lead to any significant distortion of the host lattice . in - plane atomic displacements caused by nitrogen were below 2% of the c c distance of pristine graphene and the system remained planar . top view of graphene doped with nitrogen at a concentration of 6.25 at . positive ( negative ) spin densities are plotted in blue ( red ) for isosurfaces at 5 10e : ( a ) 0.1 , ( b ) 0.4 , ( c ) 0.7 , ( d ) 0.8 , ( e ) 0.4 , and ( f ) 0.6 b per supercell . we also considered the effect of nitrogen atoms substituting carbons in the graphene lattice ( employing a 48-atom graphene cell ) on pyrrolic bonding sites . a single pyrrolic nitrogen in graphene occupied a site inside the pentagonal ring in the vicinity of single vacancy ( sv ) or divacancy ( dv ) defect ( see figure s8a , b in supporting information ) . substitution by monomeric pyrrolic nitrogen did not result in any long - range magnetic order . c bond with an n atom led to opening of the 5-membered ring and s = 1/2 paramagnetism due to the carbon dangling bond . such a bonding configuration transformed the initial pyrrolic nitrogen into pyridinic nitrogen ( see figure s8c , d in supporting information ) . we also considered the effect of adding pyrrolic nitrogen inside the octagonal ring of the dv defect ( figure s8e , f in supporting information ) , as proposed in the work of li et al . the present calculations indicated that the nitrogen atom moved to the neighboring 5-membered ring , in accord with the study by lin et al . , forming a 6-membered ring upon relaxation in which nitrogen ( transformed into pyridinic ) was nonmagnetic . next , we considered the role of pyridinic nitrogen , which was also identified as an important motif in the experimental samples . besides monomeric pyridinic nitrogen ( s = 0 or s = 1/2 due to carbon dangling bonds ) , we also considered dimerized ( with s = 1/2 magnetic moment due to carbon dangling bond ) and trimerized pyridinic nitrogen ( with a magnetic moment of 0.3 b per supercell ) . note that the calculated ground state arrangements of multiple pyridinic nitrogen in the graphene lattice were in agreement with annular dark - field imaging reported in the work by lin et al . however , according to dos of the trimerized pyridinic nitrogen ( see figure s9 in supporting information ) , the electronic structure indicated that indirect exchange mediated by the conduction electrons was strongly compromised compared to the exchange coupling developed for graphene doped with graphitic nitrogen ( compare figure 6 and figure s9 in supporting information ) . this is in line with the suppressed magnetic moment of trimerized pyridinic nitrogen in comparison to that of trimerized graphitic nitrogen ( see the structure presented in figure 7f and dos plot in figure s7f in supporting information ) . it is also important to mention that half - metallic properties were recently predicted for the graphene - based c4n3 polymer , i.e. , a 2d radical polymer containing many trimerized pyridinic nitrogens . in contrast , the dos plot presented in figure s9 in supporting information showed finite ( nonzero ) density of states above ef in both spin - up and spin - down channel , which is most likely due to a significantly lower concentration of trimerized pyridinic nitrogen in the present study . finally , we investigated whether magnetism in graphene can also be induced by nitrogen adatoms / molecule , which were identified in the xps patterns and tga / ega measurements . thus , structures resulting from both nitrogen additions on a pristine graphene layer and simultaneous single nitrogen atom addition and graphitic substitution were analyzed ( see figure s10 and figure s11 in supporting information ) . a single n - adatom carried a magnetic moment of 0.5 b , which can be understood based on an electron counting argument : two valence electrons formed covalent bonds with neighboring c atoms , two formed a lone - pair , and the fifth valence electron gave rise to the magnetic moment . another nitrogen atom contributed 0.5 b , but no magnetic moments were induced on the c atoms . by placing another nitrogen atom in a close proximity to the preadsorbed adatom , an n2 dimer spontaneously formed , which was adsorbed over the surface and had zero magnetic moment . % of graphitic nitrogen ( see figure s11 in supporting information ) also did not induce a magnetic response in the system . to conclude , the computational study allowed elucidation of the synergistic effect of nitrogen atoms in various bonding configurations , as evidenced from high - resolution xps data . to follow closely the total and relative content of nitrogen in the experimentally prepared samples , we considered graphitic nitrogen in the para configuration , which turned out to promote formation of the motif most important for imprinting magnetism in graphene , followed by trimerized pyridinic nitrogen and chemisorbed n adatoms . in the ground state , the structure resulting from the combined effects of all these species is strongly fm . however , it should be noted that coupling between pyridinic nitrogens is much less effective in maintaining the fm structure , and chemisorbed nitrogen adatoms can only generate paramagnetism . finally , pyrrolic nitrogen has no effect on magnetism in graphene , in line with the work by ito et al . , who reported a decrease in the magnetization values with increasing concentration of pyrrolic nitrogen in the graphene lattice . in summary , on the basis of electronic - structure calculations and magnetization measurements , we have provided new insights into the role of nitrogen as a highly electronegative n - type dopant for imprinting the magnetic properties to graphene . the magnetic features of n - doped graphene depend on both the nitrogen concentration and the configuration in the host lattice , with a complex interplay between graphitic , pyridinic , and chemisorbed nitrogen . among these structural motifs , % of nitrogen , graphene behaves dominantly as a diamagnet ; paramagnetic centers are induced upon doping ; however , they do not produce magnetically active motifs . if the doping concentration is increased above the threshold doping value , magnetic interactions mediated by the conduction electron system emerge between the substitution - generated paramagnetic centers . % shows a transition to an fm state at the curie temperature of 69 k and saturation magnetization reaching 1.09 emu / g . such a high value of the saturation magnetization ranks n - doped graphenes among the magnetically strongest graphene - based systems developed so far for which the magnetic properties are imprinted by defects . as n - doping is also expected to maintain or even improve the electric ( i.e. , conduction ) features of graphene , the present work opens possibilities for further optimization of n - doped graphenes ( e.g. , exclusive presence of graphitic nitrogen ) to produce new kinds of spintronic materials .

nitrogen doping opens possibilities for tailoring the electronic properties and band gap of graphene toward its applications , e.g. , in spintronics and optoelectronics . one major obstacle is development of magnetically active n - doped graphene with spin - polarized conductive behavior . however , the effect of nitrogen on the magnetic properties of graphene has so far only been addressed theoretically , and triggering of magnetism through n - doping has not yet been proved experimentally , except for systems containing a high amount of oxygen and thus decreased conductivity . here , we report the first example of ferromagnetic graphene achieved by controlled doping with graphitic , pyridinic , and chemisorbed nitrogen . the magnetic properties were found to depend strongly on both the nitrogen concentration and type of structural n - motifs generated in the host lattice . graphenes doped below 5 at . % of nitrogen were nonmagnetic ; however , once doped at 5.1 at . % of nitrogen , n - doped graphene exhibited transition to a ferromagnetic state at 69 k and displayed a saturation magnetization reaching 1.09 emu / g . theoretical calculations were used to elucidate the effects of individual chemical forms of nitrogen on magnetic properties . results showed that magnetic effects were triggered by graphitic nitrogen , whereas pyridinic and chemisorbed nitrogen contributed much less to the overall ferromagnetic ground state . calculations further proved the existence of exchange coupling among the paramagnetic centers mediated by the conduction electrons .

we report an arboviral outbreak that occurred in gabon , central africa , from march through july 2007 , which showed the unexpected extent of the spread of ae . we also describe its association with atypical epidemiologic characteristics such as the co - circulation of chikv and denv-2 and the frequency of human co - infections . the outbreak centered on the capital of gabon ; peaked from april through may 2007 , in the heat of the long wet season ; and subsequently moved north , where the virus sequentially reached several small towns along the route to northern gabon and cameroon ( figure 1 ) . patients with suspected cases exhibited a dengue - like syndrome , including fever , arthralgia , and asthenia . conjunctival hemorrhage , maculopapular rash , headache , and vomiting were also observed in the most severe cases . distribution of the outbreak and location of the 7 towns where suspected cases have been laboratory confirmed by using quantitative reverse transcription chikungunya cases are represented by red circles , dengue cases by blue circles , and cases negative for the viruses by green circles . testing methods are described in the footnote to the table . during the course of the outbreak , 773 early blood samples ( i.e. , obtained during the first week after the onset of the disease ) were collected from febrile patients who visited identified medical health centers in libreville and other towns in gabon ( table ) . samples were tested for the presence of various arboviral rna genomes by using the taqman quantitative reverse transcription pcr ( qrt - pcr ) technology and specific primers and probes ( protocols available upon request to the corresponding author ) . among these 773 patients , 275 and 54 were positive for chikv and denv , respectively , during may and july 2007 ( table ) , with 8 cases of co - infections . using a dengue serotype - specific qrt - pcr assay , we showed that all denv patients were positive for serotype 2 ( denv-2 ) . in all 7 towns investigated on the route from libreville to cameroon ( 530 km ) , both chikv and denv-2 human cases were reported , except in cocobeach where only laboratory denv-2 confirmed cases were observed ( figure 1 ) . * chikv , chikungunya virus ; denv-2 , dengue-2 virus ; + , positive . rna was extracted from 50 l of plasma by using the abi prism 6100 nucleic acid prepstation according to the manufacturer s recommended procedures ( applied biosystems , foster city , ca , usa ) . fifty - microliter aliquots of extracted rna were then used in 100-l high capacity cdna synthesis reactions according to the manufacturer s instructions ( applied biosystems ) . finally , 10 l of each cdna reaction was then used as template for 50-l quantitative pcrs that contained 200 nmol / l of probe and 900 nmol / l of each primer . the quantitative pcrs were then thermo - cycled in a 7500 real - time pcr system ( applied biosystems ) according to manufacturer s recommended procedures . the probe used for the chikv , denv , and denv-2 assays were fam - labeled with tamra quencher ( applied biosystems ) . to investigate this atypical scenario further , we analyzed 4,807 mosquitoes belonging to various species of aedes ( 2,504 ae . sp . ) , anopheles ( 78 an . gambiae ) and mansonia ( 120 m. africana , 123 m. uniformis ) in 15 different locations in libreville where chikv or denv-2 laboratory confirmed human cases were detected . pools of 20 mosquitoes ( constituted according to species and place of collection ) were homogenized by using genogrinder 2000 ( ops diagnostics , bridgewater , nj , usa ) technology , and then tested for chikv and denv-2 by qrt - pcr . albopictus were positive for chikv and denv-2 , respectively , while no group containing other mosquito species was positive , indicating that ae . these data provide evidence for the presence of chikv and denv in gabon and for their transmission to humans by ae . these epidemiologic results also confirm our previous observation that chikv strains isolated during the gabon outbreak in 2007 belong to the central african lineage and harbor the a226v mutation as a result of adaptation to ae . more surprisingly , our results show that the spread of this mosquito in an area previously occupied predominantly by ae . one denv-2 strain ( designated as libreville 2007 ) , isolated from 1 febrile patient by using e6 vero cells was further characterized by full - length genome sequencing ( 10,695 nt ) . phylogenetic analysis showed that the denv-2 gabon 2007 strain belongs to the cosmopolitan , rather than the sylvatic , genotype ( figure 2 ) . this cosmopolitan genotype includes mainly asian but also related strains isolated in india , australia , mexico , the indian ocean , and africa ( uganda , somalia , and burkina faso ) , presumably the result of travel to these remote locations by viremic patients or the transportation of commercial goods by ship . phylogenetic relationships among dengue-2 virus ( denv-2 ) isolates based on full - length sequences ( 10,695 nt ) . a total of 85 denv-2 genomes were compared with the human isolate obtained during the gabon outbreak . a neighbor - joining tree was constructed by using mega version 3.2 ( www.megasoftware.net ) with the kimura 2-parameter corrections of multiple substitutions . branches are scaled according the number of substitutions per site , and the branch leading to the thailand 94 strain was shortened for convenience . taken together , these findings document chikv and denv-2 co - circulation that resulted in large simultaneous outbreaks in regions where ae . notably , we identified 8 patients with blood samples that tested positive for the presence of both chikv and denv-2 genomes , indicating co - infection of these patients by both viruses . however , while unlikely , genetic exchanges between the 2 viruses , either by recombination or complementation , are not definitively excluded . clinical examination of these patients ( all adults , 5 women and 3 men ) did not identify specific or severe symptoms , although given the limited number of cases and clinical and biologic investigations , this observation should be interpreted with caution . although the denv cases were few , 8 of 48 ( 17% ) denv-2 positive patients from towns affected by the 2 outbreaks tested positive for chikv ( table ) . extrapolation of this result suggests that the total number of denv-2 patients who are superinfected with chikv is likely to be high , which suggests that denv-2 infection is not the antagonist for a secondary chikv infection . in contrast , only 3% of chikv+ patients were also denv-2 + ; however , the starting period of time of infection or the sequence of infection by the 2 viruses can not be assessed . although concurrent infections of dengue and chikungunya have been reported ( 14 ) , such denv-2 and chikv co - infections have never been previously associated with transmission by ae . our study therefore provides a disconcerting example of the unexpected epidemiologic patterns that may be associated with the dispersal of both vectors ( ae . albopictus and ae . albopictus mosquitoes are now present in several temperate countries of the northern hemisphere where , given the opportunity , they could cause future arboviral epidemics . albopictus in northern italy ( 5 ) provides a potential warning of what might occur much more frequently in the future in europe and even in north america . introduction of denv or chikv in these regions are likely to generate indigenous transmission by ae . albopictus .

an outbreak of febrile illness occurred in gabon in 2007 , with 20,000 suspected cases . chikungunya or dengue-2 virus infections were identified in 321 patients ; 8 patients had documented co - infections . aedes albopictus was identified as the principal vector for the transmission of both viruses .

inflammation is a crucial physiological response for the maintenance of tissue homeostasis , protecting the host against invading microorganisms , foreign substances , or host self - disturbers , such as the molecules derived from damaged cells . after the host has been incited , important microcirculatory events occur in response to local release of proinflammatory mediators , such as histamine , prostaglandins , leukotrienes , cytokines , and chemokines , leading to higher vascular permeability and increased leukocyte recruitment . leukocytes , such as neutrophils and macrophages , play a key role in inflammatory response , by releasing further inflammatory mediators and acting as effector cells and phagocytes to remove the inflammatory agent / stimuli . despite the important roles of neutrophils for effective host defense , these cells can also cause tissue damage requiring appropriate regulation [ 3 , 4 ] . continuous inflammatory stimuli can lead to aggressive and/or prolonged inflammatory responses , which may be detrimental to the host , leading to chronic inflammation . the efficient removal of the inciting agent by phagocytes is the first signal for triggering proper resolution , through inhibition of proinflammatory mediators production and activation of their catabolism , resulting in the ceasing of further leukocyte recruitment . after that , proresolving pathways are activated in order to restore tissue structure , function , and homeostasis [ 7 , 8 ] . in this context , anti - inflammatory and proresolving molecules such as specialized lipid mediators ( lipoxin a4 , resolvins , maresins , and protectins ) , peptides / proteins ( melanocortins , galectins , and annexin a1 ) , and several other substances of different natures are released at the site of inflammation [ 7 , 9 , 10 ] . these endogenous mediators are known for their ability to decrease endothelial activation , reduce leukocyte infiltration , and activate neutrophil apoptosis , which ensures their secure removal by scavenger macrophages through a process called efferocytosis ( phagocytosis of apoptotic cells ) . annexin a1 ( anxa1 ) is an important glucocorticoid- ( gc- ) regulated protein , which contributes to the resolution of inflammation through various ways ( figure 1 ) . moreover , anxa1 acts by inducing neutrophil apoptosis , modulating monocyte recruitment , and enhancing the clearance of apoptotic cells by macrophages . emerging evidence suggests that anxa1 also induces macrophage reprogramming toward a resolving phenotype , another key event to restore tissue homeostasis . in this review , we summarize several physiological and potential therapeutic actions of anxa1 on inflammation resolution . in particular , this review highlights recent advances on the actions of this endogenous mediator and its potential clinical utility . endogenous mediators of inflammation , such as anxa1 , are potential therapeutic tools to control inflammatory diseases . although whether clinical use of proresolving strategies will be useful for treating inflammatory maladies or will show significant undesirable effects remains to be elucidated , it is believed these will be effective and have fewer side effects due to their ability to mimic or induce natural pathways of the resolution phase of inflammation [ 8 , 12 ] . annexin superfamily is composed of 13 members , grouped in view of their unique ca - binding - site architecture , which enables them to peripherally attach to negatively charged membrane surfaces [ 1315 ] . anxa1 , also known as annexin i or lipocortin i , was originally identified as a gc - induced protein active on phospholipase- ( pl- ) a2 inhibition and prevention of eicosanoid synthesis [ 1618 ] . it was subsequently recognized as an endogenous modulator of the inflammatory response , through several studies , mainly those led by dr . this 37 kda protein consists in a homologous core region of 310 amino acid residues , representing almost 90% of the structure , attached to a unique n - terminal region . in addition to mediating membrane binding , ca ions can also induce a conformational change that leads to the exposure of the bioactive n - terminal domain [ 15 , 21 , 22 ] . in fact , studies on the anti - inflammatory activity of anxa1 revealed not only that the different functions of the protein lie within the unique n - terminus , but also that synthetic peptides from the n - terminal domain may mimic the pharmacological property of the whole protein , specifically binding to formyl peptide receptors ( fprs ) . in inflammatory conditions intact anxa1 ( 37 kda ) can be cleaved by proteinase-3 and neutrophil elastase generating the 33 kda cleaved isoform , which is believed to be inactive , and peptides derived from the anxa1 n - terminus [ 2325 ] . the main cleavage sites on anxa1 are located at a , v , and v , as identified by cleavage assays coupled to mass spectrometric analyses . investigation of the anxa1250 peptide revealed a novel cleavage site at position 25 , probably unmasked due to the simpler conformation of the peptide , compared with the full - length anxa1 . in fact , the substitution of the mentioned cleavage sites allowed the generation of metabolically stable forms of anxa1 and its peptide , respectively , named superanxa1 ( sanxa1 ) and cleavage - resistant anxa1250 ( cr - anxa1250 ) . the proinflammatory nature of anxa1 cleavage products is supported by reports of increased levels of the 33 kda fragment in human and animal inflammatory samples , including bronchoalveolar lavage fluids [ 2830 ] and exudates [ 11 , 25 , 31 , 32 ] . for instance , using a model of acute pleurisy , our research group has shown increased levels of the 33 kda breakdown product of anxa1 during the time points of high neutrophil infiltration into the pleural cavity followed by regain of the intact form during the resolving phase of the pleurisy . however , what the biological functions of this and other anxa1-generated peptides are is still unclear , and this matter deserves further investigation . evidence for physiological function of anxa1 in modulating inflammation emerged from studies involving anxa1-null mice and anxa1 neutralization strategies . anxa1-null mice are viable and have a normal phenotype until they are challenged with inflammatory stimuli when they show stronger and more prolonged inflammatory reaction when compared to the wild - type ( wt ) [ 3340 ] . resistance to glucocorticoid treatment and aberrant inflammation in anxa1-deficient mice provided initial evidence for the physiological relevance of the protein . in the absence of anxa1 , the inflammatory response is exacerbated as demonstrated by increased neutrophil extravasation following zymosan - induced peritonitis and endotoxin - induced uveitis . in addition , animals lacking this protein exhibited exacerbated arthritis severity and allergic response in ovalbumin - induced conjunctivitis . anxa1 ko mice also showed increased atherosclerotic lesion size with an overall increase in lesional macrophages and neutrophils . moreover , our research group has shown the prevention of spontaneous and dexamethasone - driven resolution of inflammation by using an anxa1 neutralizing strategy . aside from the physiological role of the endogenous protein , pharmacological treatment with both human recombinant anxa1 and its n - terminal peptides exerts anti - inflammatory and proresolving effects in a variety of experimental models , highlighting their therapeutic potential for inflammation resolution [ 11 , 26 , 27 , 41 ] and wound repair . anxa1 exerts many of its anti - inflammatory and proresolving actions through the formyl peptide receptor type 2/lipoxin a4 receptor ( fpr2/alx ) . this receptor , along with fpr1 and fpr3 , composes a family of seven - transmembrane domain g protein - coupled receptors which share significant sequence homology . fpr2/alx receptor is shared by a variety of other peptide / protein and lipid ligands , mediating diverse biological functions of relevance for host defence and inflammation . interestingly , fpr2/alx agonists are associated with both proinflammatory ( e.g. , serum amyloid a and cathelicidin ) and proresolving ( e.g. , anxa1 and lxa4 ) signalling pathways [ 43 , 44 ] . however , how fpr2/alx can promote both inflammatory response and limit its duration and intensity still remains to be fully elucidated . it is noteworthy that distinct fpr2/alx domains are required for signalling by different agonists . using fpr2/alx transfected cells and chimeric fpr1 and fpr2 clones , bena and col . ( 2012 ) identified that while anxa1-mediated signalling involves the n - terminal region and extracellular loop ii of fpr2/alx , saa interacts with the extracellular loops i and ii of the same receptor . otherwise , lxa4 has been shown to activate fpr2/alx by interacting with extracellular loop iii and the associated transmembrane domain . the versatility of fpr2/alx receptors also seems to rely on the activation of receptor dimmers in a biased fashion . in contrast to the full - length anxa1 , the short anxa1 derived peptide ac226 is able to activate all members of the human fpr family and induce fpr2/alx - fpr1 heterodimerization . these observations suggest that short anxa1 mimetic peptides might fulfill other functions at variance to those reported for the parental protein . however , a good degree of selectivity was retained by longer anxa1 derived anti - inflammatory sequences such as anxa1250 . interestingly , the promiscuity of fpr2/alx seems to be linked to a network of resolution mediators as discussed by brancaleone and col . in fact , the authors provide strong evidence that the engagement of fpr2/alx by selective agonists ( such as lxa4 and antiflammin 2 ) would induce anxa1 phosphorylation and mobilization in human pmn . in a similar vein , the proresolving mediator resolvin e1 ( rve1 ) stimulates endogenous lxa4 production [ 51 , 52 ] . moreover , it has been shown that proresolving mediators such as resolvins and lxa4 induce further anti - inflammatory molecules in vivo , such as interleukin- ( il- ) 10 . taken together , these data suggest that a proresolving cascade may be operating during resolution with fpr2/alx playing a central role in this process . during inflammation neutrophils are rapidly recruited to the infected or injured tissue . however , due to the potential tissue - damaging effects of pmn , their fine - tuned regulation at the inflammatory site is required . indeed , exacerbated or overshooting inflammatory response with high neutrophil influx may account for chronic inflammatory diseases . thus , restricting leukocyte infiltration to the tissue is an essential process for spontaneous or pharmacological - induced resolution of inflammation [ 4 , 8 ] . neutrophil trafficking to the site of inflammation requires adhesion and transmigration through blood vessels , which is orchestrated by molecules on leukocytes ( e.g. , 1 , 2 integrins , and l - selectin ) and on endothelial cells ( e.g. , vascular cell adhesion molecule-1 , intercellular adhesion molecule-1 , and e - selectin ) . the leukocyte adhesion cascade is a tightly regulated process , subjected to both positive and negative regulators . for example , anti - inflammatory and proresolving mediators , such as anxa1 , are well documented to counterregulate excessive neutrophil accumulation ( an anti - inflammatory action ) . human pmn interaction with endothelial cells during the early stage of inflammation promotes modulation of anxa1 in several ways , such as induction of gene expression and mobilization and cell surface externalization of intracellular anxa1 [ 72 , 73 ] . in turn , the externalized protein acts as a brake for pmn adhesion to the microvascular wall , preventing overexuberant cell transmigration to the inflammatory site [ 4 , 27 , 72 , 74 ] . ( 2008 ) reinforced the anti - inflammatory properties of pmn - derived microparticles containing functionally active anxa1 . released upon adhesion to endothelial cells , these microparticles inhibit neutrophil / endothelium interaction under flow , in vitro , and pmn recruitment to an air pouch inflamed with il-1 , in vivo . moreover , microparticles derived from wt but not from anxa1-deficient neutrophils were able to inhibit il-1-induced leukocyte trafficking . several studies using exogenously administrated anxa1 have provided further evidence for the modulating role of anxa1 on neutrophil trafficking . in vivo observations produced through intravital microscopy techniques indicated that anxa1 and ac226 administration to mice during zymosan - induced peritonitis produced detachment of adherent neutrophils from the vascular wall with consequent inhibition of neutrophil extravasation across mouse mesenteric postcapillary venules ( table 1 ) . supporting these first findings , in vitro studies showed that recombinant anxa1 and its mimetic peptides display inhibitory effects on neutrophil rolling [ 26 , 27 , 54 , 55 ] adhesion to endothelial monolayer [ 26 , 27 , 40 , 48 , 54 , 55 ] and transmigration . shedding of l - selectin appears to be one of the molecular mechanisms that mediate the effects of anxa1 and its n - terminal peptides on neutrophil recruitment . ( 2000 ) have described the ability of the anxa1 peptide ac925 to cause transient calcium fluxes and l - selectin shedding in human neutrophils . after that , the same mechanism was linked to the inhibitory effects of ac226 on pmn capture and rolling in a flow chamber assay . similarly , promotion of l - selectin shedding was demonstrated for human recombinant anxa1 [ 57 , 58 ] , an effect mediated by cell surface metalloprotease ( sheddase ) . ( 2015 ) brought further insights into the mechanisms behind the antimigratory effects of ac226 . according to the authors , the peptide dose dependently reduces the affinity of activated neutrophils for vascular cell adhesion molecule-1 ( vcam-1 ) and intercellular adhesion molecule-1 ( icam-1 ) , a response abrogated in cells harvested from fpr2 knockout mice . they demonstrated that ac226 inhibits the adhesiveness of 1 and 2 integrins by downmodulating their affinity and valency , but without changing their cell surface expression . it was also demonstrated that ac226 interferes with the chemokine - driven activation of rap1 , an essential step in integrin activation [ 76 , 77 ] . ( 2010 ) combined in vitro and in vivo experimental strategies to show that anxa1 and its mutant cleavage - resistant form , sanxa1 , are able to augment rolling velocity and reduce adhesion of pmn to endothelial cells through fpr2 receptors . ( 2013 ) demonstrated the anti - inflammatory actions of the longer acetylated anxa1 peptide anxa1250 and its cleavage - resistant form , cr - anxa1250 . both displayed antimigratory effects in vivo , reducing leukocyte adhesion to inflamed cremaster venule , neutrophil migration into dermal air pouches in response to il-1 , and neutrophil migration into peritoneum in response to zymosan . in vivo anti - inflammatory and antimigratory properties of the short anxa1 peptide ac226 have also been extensively demonstrated , as exemplified by its ability to inhibit carrageenan - induced pmn adhesion to the vasculature and extravasation into the peritoneal fluid . the peptide was also able to prevent neutrophil recruitment in myotoxin - induced peritonitis and during lung inflammation induced by intestinal ischemia / reperfusion . moreover , ac226 showed potential benefits in an ocular model by inhibiting neutrophil influx , protein leak , chemical mediator release , and cox-2 expression during endotoxin - induced uveitis . the ac226 peptide also demonstrated antimigratory effects in a model of ovalbumin - induced allergic conjunctivitis , significantly reducing the clinical signs of conjunctivitis through the inhibition of leukocyte influx and cytokines and chemokines release , effects correlated with inhibition of the erk pathway . interestingly , increased levels of erk phosphorylation were associated with exacerbated allergic response observed in anxa1-deficient mice in comparison to wt animals . reinforcing the involvement of anxa1 pathway in neutrophil recruitment , anxa1-null mice demonstrated a higher extent of neutrophil extravasation in animal models of peritonitis [ 35 , 74 ] , allergic conjunctivitis , and uveitis . anxa1 may also be tightly coupled to the anti - inflammatory properties of other fpr2/alx agonists such as lxa4 and antiflammin 2 ( af-2 ) . the nonapeptide af-2 , which corresponds to region 246254 of anxa1 , is known to interfere with pmn activation , chemotaxis , and adhesion to endothelial cells [ 60 , 61 ] , via fpr2/alx receptor . also , lxa4 is a potent regulator of pmn trafficking in experimental inflammation [ 9 , 82 ] . interestingly , recent data indicated a crucial role for endogenous anxa1 in the detachment phenomenon promoted by both compounds . for instance , lxa4 and af-2 lost their antimigratory effects in anxa1 ko mice suggesting anxa1 as a downstream mediator of other proresolving and anti - inflammatory molecules . neutrophils are produced in the bone marrow from myeloid stem cells , which in turn proliferate , differentiate into mature neutrophils , and are delivered into circulation . although the circulatory half - life of neutrophils is now thought to be longer than previously estimated ( days instead of hours ) , at inflammatory sites the constitutive apoptotic pathway is delayed by the action of local inflammatory mediators , resulting in increased neutrophil half - life , an effect that can be opposed by proresolving mediators including anxa1 and lipoxins . in addition to affecting the migration of leukocytes through fpr activation , strong evidence of the involvement of anxa1 on neutrophil apoptosis has emerged . proapoptotic effect of anxa1 on neutrophils was first described in vitro associated with transient calcium fluxes and dephosphorylation of bad , an intracellular protein whose proapoptotic function is lost upon phosphorylation . our group demonstrated the in vivo proapoptotic functions of endogenous anxa1 during self - resolving inflammation . in an acute pleurisy model , blockage of the anxa1 pathway by using a specific anti - anxa1 antiserum prevented dexamethasone- ( dexa- ) induced resolution of neutrophilic inflammation , abolishing morphological and biochemical apoptotic events in the pleural cavity . anxa1 neutralization also hampered dexa - induced decrease of erk1/2 and ib- phosphorylation and bax accumulation . in addition , anti - anxa1 treatment prevented spontaneous resolution of neutrophilic inflammation , suggesting an important role of endogenously produced anxa1 in the proresolutive program . furthermore , pharmacological administration of ac226 peptide promoted active resolution and augmented the extent of neutrophil apoptosis . these effects were prevented by the pan - caspase inhibitor zvad - fmk and linked to activation of the cell death pathways bax and caspase-3 and inhibition of the survival - controlling pathways mcl-1 , erk1/2 , and nf-b ( figure 2 ) . in a skin allograft model , pharmacological treatment with ac226 increased transplantation survival related to inhibition of neutrophil transmigration and induction of apoptosis , thereby reducing the tissue damage compared with control animals . in vitro , ac226 counteracted the survival signal in saa - treated neutrophils , an effect associated with caspase-3 cleavage and prevented by the jnk inhibitor . ( 2013 ) also demonstrated that anxa1250 and cr - anxa1250 peptides can override the antiapoptotic effect of saa in human neutrophils in vitro . this proapoptotic effect may have contributed to the in vivo anti - inflammatory and proresolving actions of the peptides characterized by reduced granulocyte counts and enhanced efferocytosis in peptide - treated mice during peritonitis . anxa1 has also been described as a mediator of drug - induced apoptosis , supporting its involvement in the induction of cell death . the proapoptotic effect described for the histone deacetylase inhibitor ( hdcai ) fk228 , in leukemia cells , was linked to the induction of anxa1 expression , externalization , and cleavage . neutralization with anti - anxa1 antibody or gene silencing with anxa1 sirna inhibited fk228-induced apoptosis , suggesting the involvement of anxa1 in apoptotic cell death in response to hdcai . recently , the in vitro ability of hdacis to promote apoptosis was also demonstrated in bone - marrow neutrophils from wt but not from anxa1 knockout mice . in vivo , hdacis significantly reduced neutrophil numbers and induced neutrophil apoptosis in a zymosan - induced peritonitis model . it is important to keep in mind that the proapoptotic effect of anxa1 can be underestimated in dynamic in vivo models of inflammation . regarding other anti - inflammatory drugs , it is documented in a number of diverse experimental and clinical settings that small changes in apoptosis rates can promote dramatic changes in total neutrophil numbers over time . this observation is most likely due to rapid recognition and phagocytosis of apoptotic cells [ 8991 ] . macrophage phagocytic clearance of apoptotic neutrophils plays an important role in the resolution of inflammation since this process prevents excessive neutrophil activation and the exposure of tissues to noxious neutrophil intracellular contents [ 92 , 93 ] . for this reason , appropriate ( nonphlogistic ) monocyte recruitment from the bloodstream to inflammatory sites is a critical step in acute inflammation , enabling the clearance of apoptotic neutrophils and orderly progression towards resolution . it has long been established that extravasation of pmn to the site of inflammation contributes to the launch of monocyte recruitment , with pmn granule proteins being important monocyte attractors . recent research from perretti 's group indicates apoptotic neutrophils as the principal reservoir of anxa1 , which acts as important recruiting agent for monocytes to orchestrate the second resolving phase of acute inflammation . associating in vitro and in vivo experiments , professor mauro perretti 's group filled an important gap in our knowledge by demonstrating the central role of the anxa1alx / fpr2 pathway in modulating monocyte recruitment . the authors demonstrated that intraperitoneal administration of anxa1 induced monocyte migration , an effect absent in fpr2 null mice . supporting these findings , both anxa1 and fpr2/alx null mice challenged with intraperitoneal zymosan exhibited diminished recruitment of monocytes as compared to wt mice , despite the higher levels of chemoattractants . after initial steps of apoptosis , neutrophils lose their functional properties , such as the ability to move by chemotaxis , generate a respiratory burst , or degranulate . furthermore , they exhibit alterations on their intracellular pathways and cell surface molecules while some externalized molecules , such as phosphatidylserines ( ps ) , facilitate the recognition and removal of apoptotic neutrophils by macrophages [ 92 , 96 ] . recent studies have reported that anxa1 from apoptotic cells is involved in their phagocytic clearance . the first observation that anxa1 participates in the engulfment of apoptotic cells , they showed that anxa1 is exported to the outer plasma membrane of apoptotic lymphocytes , colocalizes with ps , and is required for efficient clearance of apoptotic cells , suggesting a role for anxa1 as bridging ps molecules on apoptotic cells to phagocytes . ( 2007 ) subsequently demonstrated that apoptotic neutrophils release anxa1 , which acts on macrophages , promoting the removal of effete cells . noteworthily , not only the intact form of anxa1 released by apoptotic cells but also the cleavage fragments , under 10 kda , were effective in stimulating efferocytosis . studies have also documented macrophages as a source of endogenous anxa1 , which in turn facilitates phagocytic uptake of apoptotic cells . ( 2005 ) showed that human macrophages release anxa1 upon treatment with gc and that this protein acts in autocrine or paracrine manners to increase the engulfment of apoptotic neutrophils . additional experiments with anxa1-null mice provided further evidence for a functional role of anxa1 in efferocytosis , as macrophages derived from their bone marrow were defective in clearance of apoptotic cells . in fact , the authors demonstrated , in vitro , the ability of the anxa1 mimetic peptide ac226 to promote phagocytosis of apoptotic pmn by human macrophages , an effect associated with actin rearrangement in the phagocytic cells and abrogated in the presence of fpr antagonist . subsequently , it was clearly demonstrated the nonredundant function of fpr2/alx receptor in ac226 induced efferocytosis since the peptide failed to exert its proefferocytic action on fpr2/alx deficient macrophages . furthermore , yona and coworkers ( 2006 ) associated in vitro and in vivo strategies that indicated reduced phagocytosis of zymosan particles by anxa1 knockout macrophages . it has been proposed that anxa1 released by macrophages can opsonize apoptotic cells , probably by interacting with surface - exposed ps , enhancing their uptake by phagocytes . interestingly , mcarthur 's group demonstrated that the binding of microglial - derived anxa1 to ps on the surface of apoptotic neuronal cells is critically required for phagocytosis . moreover , dalli and colleagues ( 2012 ) reported that anxa1 expressed by resident macrophages is a critical determinant for the clearance of senescent neutrophils in the bone marrow . proefferocytic effects were also observed for anxa1250 and its cleavage - resistant form ( cr- anxa1250 ) , which stimulated efferocytosis in vitro by human and mice bone - marrow derived macrophages . this effect was confirmed in vivo in a zymosan - induced peritonitis model , when the peptides significantly reduced exudate neutrophil counts and increased the number of macrophages containing ingested pmn . once phagocytic removal of apoptotic cells has failed , neutrophils undergo secondary postapoptotic necrosis , probably leading to the leakage of cytotoxic and antigenic intracellular contents into the surrounding tissue . blume and col . ( 2012 ) revealed , in two complementary studies , the role of externalized anxa1 as a fail - safe mechanism after neutrophil transition from apoptosis to secondary necrosis . first , they described anxa1 externalization during secondary necrosis , which in turn promotes the removal of dying cells and prevents proinflammatory cytokine production . in the second study , they demonstrated that in vitro anxa1 proteolysis during secondary necrosis generates a monocytic find - me signal , contributing to the recruitment of monocytes and consequently preventing inflammation . the removal of apoptotic cells has dual importance : prevention of potentially toxic content release and induction of macrophage reprogramming toward a resolving phenotype [ 101103 ] , another key event to restore tissue homeostasis . accordingly , anxa1-induced efferocytosis is coupled with increased release of transforming growth factor- ( tgf- ) and lower levels of the proinflammatory cytokine il-6 [ 65 , 67 ] . in agreement with this observation , impaired phagocytosis in anxa1-deficient macrophages is mirrored by increased release of tumor necrosis factor- ( tnf- ) and il-6 . supporting an immunomodulatory effect of anxa1 on cytokine production , anxa1-null mice showed increased mortality in a model of lps - induced endotoxic shock which was correlated with increased activation of inflammatory cells . the authors detected delayed and more prolonged increase in the levels of tnf- , il-1 , and il-6 in the blood of anxa1-null mice , as well as increased production of these cytokines by anxa1 ko macrophages . this data is consistent with the increased production of il-6 and tnf by stimulated anxa1 ko peritoneal macrophages in comparison to wt cells . moreover , in vitro studies linked anxa1 to brain homeostasis , demonstrating that exogenous anxa1 can suppress microglial activation , limiting indiscriminate phagocytosis of healthy neurones and nitric oxide ( no ) production during the phagocytic reaction . recently , the functional role of macrophage - derived anxa1 in modulating hepatic inflammation and fibrogenesis during nonalcoholic steatohepatitis ( nash ) progression was documented . nash in anxa1 ko mice was characterized by enhanced lobular inflammation resulting from increased macrophage recruitment and exacerbation of the proinflammatory m1 phenotype . in line with these results , anxa1 administration to liver macrophages suppressed m1 activation , characterized by reduced expression of inos and il-12p40 , and increased il-10 expression . interestingly , activation of fpr2 by anxa1 skewed m1 macrophages to anti - inflammatory m2-like cells , attenuating the expression of il-6 , il-1 , and tnf- . furthermore , cooray and col . ( 2013 ) revealed an anxa1-specific fpr2/alx proresolving signal pathway centered in p38 , leading to the production of il-10 by human monocytes , an effect replicated in vivo after intraperitoneal anxa1 injection . although uptake of secondary necrotic leukocytes was shown to be anxa1 independent , the protein has an anti - inflammatory action on macrophages , since phagocytosis of anxa1 knock - down necrotic cells induced increased release of proinflammatory cytokines tnf , il-6 , and il-1 by phagocytic cells . ( 2011 ) added knowledge to the immunosuppressive actions of anxa1 derived from apoptotic pmn . according to the authors , the treatment of human monocytes with anxa1-containing supernatant of apoptotic granulocytes or ac226 peptide results in a significantly diminished release of proinflammatory cytokines when the monocytes are subsequently challenged with endotoxin . taken together , these findings indicate that anxa1-induced efferocytosis collaborates with the resolution of inflammation by promoting the elimination of effete neutrophils allied to an alternative macrophage activation that downregulates the production of proinflammatory mediators . anxa1 is a gc - regulated protein that modulates a wide range of cellular and molecular steps of the inflammatory response and is deeply involved in the endogenous mechanisms that are activated to bring about proper resolution . so , it is reasonable to suppose that anxa1-based pharmacologic strategies could be as effective as steroids , without their metabolic side effects . we have discussed here the ability of anxa1 and its mimetic peptides to limit neutrophil accumulation in the tissue . besides limiting neutrophil recruitment and increasing neutrophil apoptosis indeed , anxa1 contributes to tissue homeostasis by inducing macrophage reprogramming toward a resolving phenotype . the combination of these mechanisms results in an effective resolution of inflammation , pointing to anxa1 and its mimetic peptides as promising therapeutic agents for treating inflammatory diseases . the promising findings on the potential therapeutic use of anxa1 in inflammatory diseases have stimulated the development of pharmaceutical formulations containing anxa1 mimetic peptides , such as the controlled - release hydrogels for dermal wound repair application and targeted polymeric nanoparticles . the latter demonstrated ability to enhance resolution in zymosan - induced peritonitis , promote colonic wounds healing , and protect hypercholesterolemic mice against advanced atherosclerosis . these pharmaceutical strategies offer further benefits , overcoming the critical pharmacokinetics of short peptides in vivo , protecting them from proteolysis during pharmacological treatment , and facilitating the delivery to injury sites .

neutrophils ( also named polymorphonuclear leukocytes or pmn ) are essential components of the immune system , rapidly recruited to sites of inflammation , providing the first line of defense against invading pathogens . since neutrophils can also cause tissue damage , their fine - tuned regulation at the inflammatory site is required for proper resolution of inflammation . annexin a1 ( anxa1 ) , also known as lipocortin-1 , is an endogenous glucocorticoid - regulated protein , which is able to counterregulate the inflammatory events restoring homeostasis . anxa1 and its mimetic peptides inhibit neutrophil tissue accumulation by reducing leukocyte infiltration and activating neutrophil apoptosis . anxa1 also promotes monocyte recruitment and clearance of apoptotic leukocytes by macrophages . more recently , some evidence has suggested the ability of anxa1 to induce macrophage reprogramming toward a resolving phenotype , resulting in reduced production of proinflammatory cytokines and increased release of immunosuppressive and proresolving molecules . the combination of these mechanisms results in an effective resolution of inflammation , pointing to anxa1 as a promising tool for the development of new therapeutic strategies to treat inflammatory diseases .

unawareness , lack of insight , or anosognosia refers to impaired awareness in persons with dementia [ 17 ] . awareness is multifactorial and likely modular [ 4 , 810 ] , with each domain separable and potentially unique . most of the literature on awareness in persons with dementia describes the clinical correlates of one awareness domain ( reviews by [ 1 , 4 , 11 ] ) , but the few studies that have contrasted awareness for different domains have found differential patterns of clinical correlates [ 1215 ] . this paper provides further support for the modality specific nature of awareness in dementia by contrasting the clinical correlates for awareness of balance in addition to more commonly measured awareness of day - to - day function and memory . awareness quantification remains elusive , and there is no consensus method for measuring awareness ( e.g. , [ 4 , 9 ] ) . awareness has been measured with clinician ratings [ 16 , 17 ] ; or based on discrepancy between self - report versus clinicians ' impression or versus informant report assessed with interview [ 10 , 18 ] or questionnaires [ 7 , 12 , 14 , 1921 ] ; or discrepancy between self - report and objective performance [ 21 , 22 ] , which , depending on the task , measures self - monitoring or metacognitive abilities . detail difficulties with patient / informant discrepancies and the assumption that caregiver informants ' or clinicians ' reports are a better reflection of reality . moreover , worry , anxiety , defensiveness , denial , or focus on more important problems can influence reflection for persons with dementia . caregivers ' reports may be more highly correlated with objective measures of cognition than patient self - reports , suggesting there is value in using patient / informant discrepancies . nevertheless , caregiver / patient discrepancies may be a better measurement of patients ' awareness of function , whereas clinician / patient discrepancies may be a better measure of patients ' awareness of cognition . due , in part , to measurement challenges when assessing awareness , the literature on the clinical correlates of awareness in persons with dementia is contradictory . most , but not all , of the cumulative data suggest increasing dementia severity is associated with reduced awareness [ 1 , 16 , 18 ] . others have found few group - based differences , but high individual variability in awareness declines when studied over one year , potentially because severity and awareness are mediated by cognitive reserve . other important clinical correlates of awareness include depression [ 18 , 21 , 22 , 25 ] , neuropsychiatric status [ 1921 , 26 ] caregiver burden [ 10 , 11 , 14 , 26 ] , activities of daily living , and neuropsychological status [ 12 , 19 , 20 , 22 , 2729 ] which demonstrate variability in associations with awareness across domains and measurement methods . models of awareness suggest awareness is mediated by the frontal lobes [ 2 , 3 ] or the right frontal lobe [ 30 , 31 ] , and lack of awareness is associated with other behavioural indicators of frontal dysfunction , such as increased apathy . localized imaging has implicated the orbitofrontal cortex , but most have implicated medial structures [ 34 , 35 ] , including the anterior and posterior cingulate in awareness . despite converging evidence for prefrontal involvement in awareness , awareness may or may not be associated with tests of executive function ( see review by ) . some studies demonstrate strong relationships between awareness and executive functioning [ 12 , 19 , 20 , 27 ] , with others reporting nonsignificant and trivial associations [ 19 , 29 ] . although clearly composite measures that rely on more basic cognitive functions , many summary scores from traditional tests of executive function are associated with the dorsolateral prefrontal circuit , and awareness has been associated with more midline [ 3436 ] or orbitofrontal aspects of the prefrontal cortex . contradictory data on the clinical correlates of awareness is also due to the assumption that awareness is a unitary construct ( see reviews by [ 4 , 8 ] ) . differential patterns of clinical correlates have been demonstrated for awareness of cognitive deficits versus awareness of behaviours [ 1215 ] , suggesting that awareness is modality specific . the primary purpose of this paper is to describe the clinical correlates of awareness of balance in addition to the more commonly measured awareness of function in basic and instrumental activities of daily living ( badls and iadls , resp . ) and awareness of memory . awareness of balance is important in persons with dementia due to its relation with fall risk . we hypothesize that awareness of balance will be associated with physical variables , such as gait , falls , and objectively measured balance . based on the conceptualization of markova and colleagues and work suggesting differential clinical correlates for awareness of specific domains [ 13 , 15 ] , we hypothesize that awareness of functional abilities , memory , and balance will have differential patterns of clinical correlates . a secondary purpose of this paper is to contrast awareness for balance , function , and memory for those diagnosed with mild cognitive impairment ( mci ) . reduced awareness has been demonstrated for persons at high risk for dementia , and specifically for persons with amnestic mci ( amci ) . moreover , since awareness appears to differ based on dementia subtype , awareness for balance , function , and memory could be differentially affected for participants diagnosed with dementia due to ad versus non - ad dementias . therefore , the final comparison will explore awareness in groups of persons diagnosed with amci , non - amnestic mci , ad , and non - ad dementias . patients were from an interdisciplinary memory clinic established to provide early stage dementia differential diagnoses for rural persons . for this irb approved study , patients who were diagnosed with no cognitive impairment were excluded , and only patients who received a diagnosis of dementia or a variant of mci were included . diagnoses in this specialty clinic were consistent with the review of diagnostic guidelines provided by the canadian consensus on the diagnosis and treatment of dementias using recent comprehensive blood work , ct head scan , and interprofessional assessment data from neurology , neuropsychology , and physical therapy . the assessment procedures included standardized approaches ( e.g. , questionnaires , neuropsychological testing ) and also family interviews for clinical history and interviews with the informal caregiver who accompanied patients to the clinic ( families were strongly encouraged to attend the assessment and patients were asked to bring someone who knew them well . in the unusual circumstance when patients attended the clinic alone , telephone interviews were conducted with someone who knew them well , but questionnaire data were not collected ) . the sample consisted of 259 patients ( in the clinic 's 6th data release ) , and the vast majority ( 74% ) reported their ancestry as european , 9% were first nations or metis , and 17% chose other , rather than selecting one of the aforementioned categories , african or asian ancestry . table 1 includes descriptive information for the total clinical sample ( n = 259 patients ) and details the subgroups based on diagnosis . patients with dementia due to ad was the most common diagnosis ( n = 113 ) , and another heterogeneous subgroup ( n = 100 ) was created of patients with non - ad dementias ( i.e. , vascular dementias , mixed dementias , diffuse lewy body disease , dementia due to parkinsons ' disease , huntington 's dementia , variants of frontotemporal lobar degeneration , and dementias not otherwise specified ) . in addition , a third group included patients diagnosed with amnestic ( single or multiple domain ) mild cognitive impairment ( amci ; n = 23 ) and a fourth group included patients diagnosed with nonamnestic mci ( non - amci ; n = 23 ; single or multiple domains , which included those with diagnoses of vascular cognitive impairment , no dementia ) . although most of the clinic data were focused on patients for diagnostic purposes , informal caregivers ( n = 244 ) provided important collateral and personal information . caregivers ( m age = 61.40 , sd = 14.63 ) were typically family members and most of many were females ( 64% ) : 33% were wives , 20% were husbands , 31% were daughters , 10% were sons of the patient , with a remaining 7% whose relationship status included grandchildren , nieces , nephews , or friends . clinical correlates of awareness measures ( 1 ) assessment of severity . the clinical dementia rating ( cdr ) is a standardized and psychometrically sound clinician - based rating scale ( 0 to 3 ; no impairment to severe impairment ) , but summing the box scores of the six rating areas of the cdr ( cdr - sob ) provides a more detailed quantitative measure of global dementia severity and is more sensitive to detecting changes in dementia severity over time . patients rated their performance on the reliable and valid lawton instrumental activities of daily living ( iadl higher scores indicating independent functioning ) . patients ' caregivers rated patients ' performance of adls on two psychometrically strong scales : the functional assessment questionnaire ( faq ) and the bristol adl questionnaire where higher scores indicate impaired performance . the neuropsychiatric inventory ( npi ) is a well - researched and psychometrically strong caregiver rating of patients ' behaviours and associated caregiver distress . the centre for epidemiologic studies of depression ( cesd ) , a reliable and valid screen of depression , was self - rated by patients , with four factors : ( 1 ) depressed affect ( 2 ) lack of positive affect ( 3 ) somatic / vegetative and ( 4 ) interpersonal measuring social disconnectedness . self - report of caregiver burden was assessed with the short form of the zarit burden interview , which was shown to be psychometrically similar to the longer versions . the global severity index from the brief symptom inventory ( bsi ) measured caregiver self - report of overall psychological distress . ( 5 ) assessment of physical variables . a comprehensivephysical therapy assessment included the psychometrically strong berg balance scale ( bbs ) and the performance oriented mobility assessment ( poma , which is a measure of gait and balance ) . caregiver and patient reports of falls within the past 6 months were combined with bbs to estimate the probability of falling . patient self - report on the activities - specific balance confidence ( abc ) scale measured self - reported confidence in balance while doing a variety of day - to - day activities . each patient received a comprehensive neuropsychological assessment ( see for a review of the strong psychometric properties of these tests ) , and selected measures of executive function and working memory were analyzed . the ability to alternate attention was measured with the trail making test part b ( tmt b ) . the ability to inhibit an automatic response was measured with the stroop interference score . cognitive flexibility with speeded retrieval of language - based knowledge was measured using animal naming and phonemic fluency ( benton oral word association test ) . digit span backward subtest from the wechsler adult intelligence scale 3rd edition ( wais - iii ) measured working memory . finally , the index scores from the repeatable battery for the assessment of neuropsychological status ( rbans ) were analyzed . awareness of functional deficits ( af ) was operationalized using patient / caregiver congruence on reports of the patient 's ability to independently perform six iadls : management of finances , use of telephone , use of transportation , shopping , meal preparation , and performance of housework ( patient self - report version of the lawton iadl scale ; and caregiver report of patient 's function from the bristol adl scale ) . for each iadl , congruence was ranked on a 5-point scale ; the congruence ranking was summed across the six iadl items for a total of 30 possible points , with higher scores indicating greater awareness . data were available for 201 participants , and as can be seen in table 1 , most patients had good awareness of their functional abilities . af was significantly higher in the two mci diagnostic groups when compared with the two groups with dementia diagnoses . awareness of memory ( am ) was based on congruence between patient 's self - reports of memory on a standardized scale ( self - rating of memory scale ) and performance on a neuropsychological test of new learning ( repeatable battery for assessment of neuropsychological status ; rbans delayed memory index score ) . the delayed memory measure was chosen since it best captured consolidation difficulties asked about in the self - rating of memory scale . both the self rating of memory standardized scores and the rbans index scores were transformed into a linear ranked scale from 1 to 5 , with 1 indicating the lowest self - rating of memory and the lowest memory performance . the am score was created based on the congruence in ranking between self - reported and objectively measured memory , with 5 indicating perfect congruence . complete data were available for 192 participants . as can be seen in table 1 , most participants ' am was at the mid - point of the scale , but the ad and the amci subgroups reported significantly lower am than the non - ad dementia and non - amci groups . awareness of balance ( ab ) was based on congruence between patients ' ratings of balance confidence on the abc scale and the probability of falling . the abc and probability of falling were each transformed into ranked scores with 1 indicating low confidence or high probability of falling and 4 representing high confidence or low probability of falling . the ab score was created based on the congruence in ranking between self - reported balance confidence and objectively measured probability of falling , with 1 indicating low congruence and 4 indicating perfect congruence . perfect congruence between balance confidence and objective measurement may not be sufficient for stability ; rather underestimation of balance ( i.e. , less confidence than objective measurement would support ) has been shown to be associated with greater stability ( e.g. , [ 38 , 65 ] ) . consistent with this premise , ab ranking of 5 represented an underestimation of balance confidence relative to objectively measured balance . approximately one third of the sample ( 36% ) reported equivalent balance confidence to measured stability , 27% reported greater balance confidence than would be supported by objective measurement ( i.e. , reduced awareness ) , and 37% reported an underestimation of balance , which may be appropriate awareness for maximal stability ( e.g. , [ 38 , 65 ] ) . although the sample size was relatively small , ab was high for all groups and did not differ significantly for patients with diagnoses of amci , non - amci , ad , or non - ad dementias ( see table 1 ) . zero - order correlations were completed separately for af ( table 2 ) , am ( table 3 ) , and ab ( table 4 ) . only variables with significant correlations were used to minimize specification errors ( potential over- or undercorrection ) as predictors in simultaneous multiple regression equations . for each measure of awareness , analyses were conducted for the overall sample , but also for each of the four diagnostic groups . descriptors of magnitude of association were consistent with guidelines for small , medium , and large effect sizes provided by cohen . as can be seen in table 2 , af was highly correlated with caregiver report of adls ( faq and bristol adl each large magnitude associations ) . together these data suggest af was highly associated , but not redundant , with more comprehensive measures of day - to - day function . similarly , am was highly associated , but not redundant with the measures used to create it . as can be seen in table 3 , these associations were strong for the non - ad dementia and two mci groups but trivial for the ad group . finally , ab also demonstrated moderate , but nonredundant , associations with the variables used to create it . as can be seen in table 4 , the association with the abc scale was a moderate magnitude overall and for all diagnostic groups except the non - amci group . also seen in table 4 , ab was associated with both fall history in the past 6 months for the larger samples and overall . ab was associated with probability of falling only for specific diagnostic groups and the overall sample . the cell sizes for the poma were below 10 for the mci groups , but the small association was significant for the overall sample . overall , the correlations provide evidence for the convergent validity for each of the derived awareness measures . of interest , each measure of awareness appeared orthogonal : awareness of function was not associated with either awareness of memory ( rs = 0.026 , p > 0.05 , trivial magnitude ) or balance ( rs = 0.207 , p > 0.05 , small magnitude ) , and the latter two measures of awareness are similarly not well associated ( rs = 0.153 , p > 0.05 , small magnitude ) . for the overall sample , regression diagnostics suggested the bristol adl - caregiver , npi - distress , and rbans immediate and total scale indices were multicollinear , so these variables were excluded from the regression equation . the remaining predictors of cdr - sob , iadl - patient , faq - caregiver , npi - severity , zbi , probability of falling , bbs , clock drawing , rbans language , and visuospatial / constructional indices accounted for a large proportion of af variance ( r = 0.688 , p < 0.001 ) . not all predictors were equally predictive , however , and only the faq - caregiver ( t = 4.64 , p < 0.001 ) and zbi ( t = 3.06 , p = 0.003 ) were significant predictors of af . equivalent regression procedures were conducted separately for the four diagnostic subgroups , and across these analyses only measures of function were significant predictors of af ( ad group faq - caregiver t = 3.29 , p = 0.002 ; non - ad group faq - caregiver t = 3.03 , p = 0.004 ; amci group iadl - patient t = 2.30 , p = 0.035 ; and non - amci group badl - caregiver t = 2.37 , p = 0.029 ) . awareness of memory demonstrated a different pattern of zero - order correlations ( see table 3 ) , and the results of the regression analyses also suggested that the clinical correlates of am clearly differed from those of af . for the overall sample , the initial regression diagnostics resulted in removal of npi - severity and distress in addition to the rbans total scale index score due to multicollinearity . the overall model accounted for a large proportion of variance in am ( r = 0.736 , p < 0.001 ) , but of the predictors ( iadl - patient , cesd overall , cesd depressed affect , cesd somatic / vegetative , cesd interpersonal , bsi global severity , animal naming , and rbans immediate memory were excluded ) only the cesd - lack of positive affect ( t = 3.19 , p = 0.002 ) , the rbans visuospatial / constructional index ( t = 2.63 , p = 0.01 ) , and the rbans delayed memory index ( t = 8.65 , p < 0.001 ) remained significant . the regression equations for the diagnostic groups differed from the predictors for the overall group . for the non - amci group the overall model was nonsignificant ( likely due to only 9 participants having all variables complete ) . for the non - ad dementia group the rbans delayed memory index was the only significant predictor of am ( t = 2.32 , p = 0.028 ) , but for the few amci patients with all predictors complete the delayed memory was not significant ( t = 2.22 , p = 0.053 ) . perhaps most salient was the radically different associations between am and the clinical correlates for the ad group . here , only the iadl - patient ( t = 2.15 , p = 0.035 ) and cesd lack of positive affect ( t = 2.32 , p = 0.024 ) predicted am . the zero - order correlations that drove the regression equations for ab are shown in table 4 . the regression equations for the overall sample were less plagued by small sample size problems than the two mci groups . the clinical correlates of probability of falling , poma , and the bbs were excluded , however , due to multicollinearity . the remaining predictors were all significant : faq - caregiver ( t = 4.77 , p < 0.001 ) , the abc scale ( t = 6.61 , p < 0.01 ) , and fall history in last 6 months ( coded yes / no , t = 8.01 , p < 0.001 ) and together accounted for a large proportion of variance in ab ( r = 0.757 , p < 0.001 ) . when compared across the diagnostic groups , the two regression equations for the mci groups were not statistically significant , likely due to small sample sizes . for both dementia groups the abc scale was a significant predictor of ab ( ad group t = 4.61 , p = 0.038 , non - ad t = 2.34 , p = 0.014 ) but , in addition , for the non - ad group the fall history in last 6 months was significant ( t = 3.81 , p = 0.001 ) . these data support the hypothesis that awareness for different domains , specifically awareness of function , memory , and balance , would differentially relate to clinical correlates . this is in keeping with early work on awareness demonstrating differential clinical correlates for specific awareness domains [ 1215 ] and provides support for the assertion by markova and colleagues that awareness must be conceptualized as specific to the domain being measured , and that research on one domain can not be generalized to another domain . in addition to finding differential patterns of clinical correlates across domains of awareness , these data suggest that diagnostic group is also an important consideration in the clinical correlates of awareness . this was most evident in the clinical correlates for the ad group versus the non - ad and amci groups for awareness of memory . here , the relationship between specific symptoms of depression and awareness of memory was only evident for the ad group . in contrast , the clinical correlates for the other groups remain restricted to measures of memory . regarding caution in cross - domain generalization is not sufficient , and diagnostic grouping is another important consideration , at least for some domains of awareness . awareness of function was lower for the groups diagnosed with dementia than those with mci whereas awareness of memory was lower for the group with ad dementia and the group with amci , often considered a precursor to ad , than for the non - ad dementia or non - amci groups . our data suggest that awareness of specific domains was orthogonal : awareness of function was not associated with awareness of memory or awareness of balance . this was in contrast to the findings by ott and colleagues who found moderate correlations between awareness of memory and awareness of function . our method for measuring awareness of function was similar to that used by ott and colleagues ( namely , patient / caregiver discrepancy ) , but we used a discrepancy between performance and self - report to assess memory and balance awareness , which may account for these inconsistent findings . evidence for the modality specific nature of awareness is provided by the differential patterns of clinical correlates depending on domain measured . we found that the relation between caregiver burden and distress depended on the modality of awareness measured : reduced awareness of function was associated with increased caregiver reports of burden , which is consistent with findings from previous research [ 10 , 11 , 14 ] . balance awareness was the only awareness measure associated with physical variables such as past history of falls and self - reported balance confidence . the relation between balance awareness and falls is consistent with previous research demonstrating a strong relationship between proprioception and balance or falls . balance awareness was not related to any measure of neuropsychological functioning , despite previously reported relationships between risk of falls and measures of executive function . although none of the domains of awareness were associated with measures of executive function , awareness of memory was associated with neuropsychological variables of the delayed memory index and the visuospatial / constructional indices from the rbans . the associations with neuropsychological variables differed , however , when the diagnostic groups were considered separately . interestingly , awareness of memory was not associated with the delayed memory scores for the ad group . a floor effect in the delayed memory score appears to have created problems with heteroscedasticity in the bivariate memory awareness relationship , which may have attenuated any associations . the possible floor effect in memory measures did not , however , impact the association between depressive symptoms and awareness of memory , only for the ad group . the findings of differential clinical correlates for awareness of memory based on diagnostic group may speak to some of the most contradictory findings regarding correlates of awareness . neuropsychological function is inconsistently related to awareness [ 1 , 12 , 19 , 20 , 27 , 29 ] , and the relationship between awareness in dementia and depression is complicated , with clinical lore and empirical data supporting the notion that increased awareness is associated with more symptoms of depressed mood [ 18 , 25 ] , but increased awareness and depression may only be related to subclinical ( or dysthymia ) rather than major depression . our data suggest that in addition to modality of awareness being considered when measuring associations of neuropsychological and depressive symptoms with awareness , diagnostic group is an additional important consideration . patients with dementia due to ad appear to have differential clinical correlates for awareness of memory versus patients with non - ad dementia , for example . although the prediction of differential clinical correlates for the different domains of awareness was supported , some of our predictions regarding these clinical correlates were contrary to previous research . in zero - order associations , severity was associated with awareness of function , but with no other domain of awareness . moreover , severity did not account for sufficient unique variance in awareness of function and was , therefore , not a significant predictor . this finding is in contrast to the cumulative cross - sectional data demonstrating an association between severity of cognitive impairment and awareness ( see for a thorough review ) and is contrary to the more compelling longitudinal data demonstrating decreasing awareness with increasing cognitive impairment [ 16 , 18 ] . these contrasting findings likely speak to the orthogonal and domain - specific nature of the construct of awareness . aalten and colleagues ' and mcdaniel and colleagues ' prospective studies measured awareness by clinician ratings based on an interview with patient and caregiver regarding the patient 's history of cognitive deficits and their impact on function . finally , all measures of awareness were associated with some measure of independence in daily function , particularly instrumental activities of daily living which is evidence against modality specificity . assessment of functional abilities as a clinical correlate for measures of awareness is not often reported in the literature , but the few studies that do exist suggest that decreased awareness is associated with increased functional limitations , which is consistent with our data . despite adding to the converging research on the modality - specific nature of awareness [ 4 , 810 ] , these data are limited by the inconsistency in the measurement methods used for each modality of awareness . measurement of awareness of function was based on caregiver / patient discrepancy , whereas awareness of memory and of balance was based on discrepancy between self - report and objective measures of performance . if awareness is a true construct , it should not be highly dependent on how it is measured . if , for example , awareness of function differs greatly when measured with caregiver / patient discrepancy versus patient / observation discrepancy , then this would not be a construct at all and would be considered an artifact of measurement . if awareness is an artifact of measurement , future research measuring awareness of different modalities of awareness with different methods for measuring awareness will find markedly different clinical correlates than those presented here . another more problematic limitation of these data is the fact that this sample is derived from a specialty clinic . specialty clinic patients have been postulated to have higher awareness than the general dementia population due to the referral process for specialty clinics . it is unclear how having higher awareness may have impacted the differential patterns of clinical correlates for these multiple domains of awareness . although replication is required , these data demonstrate differential patterns of clinical correlates for awareness of function and memory . in addition , this study provides a novel contribution by describing the clinical correlates for awareness of balance . these data provide evidence for modality specific relations between awareness and clinical correlates in a database with a wide range of standardized measures of clinical correlates including severity , function , neuropsychiatric symptoms , depression , caregiver burden and distress , and a comprehensive assessment of neuropsychological status . differing patterns of clinical correlates for awareness of function , awareness of memory , and awareness of balance provide support for the modality specific uniqueness of awareness measures for each of these domains . data demonstrating different patterns of awareness based on diagnostic group ( namely , amci , non - amci , ad , and non - ad dementia diagnoses ) provides further evidence for the modality specific nature of awareness . modality specificity , if replicated in different populations , for example , stroke patients , could have implications for rehabilitation . these data would suggest that rehabilitation needs to be targeted to a domain of awareness since awareness is not a unitary construct . future research is needed on the clinical course and implications for day - to - day care associated with impairments in specific modalities of awareness for persons with dementia .

awareness in dementia is increasingly recognized not only as multifactorial , but also as domain specific . we demonstrate differential clinical correlates for awareness of daily function , awareness of memory , and the novel exploration of awareness of balance . awareness of function was higher for participants with mild cognitive impairment ( amci and non - amci ) than for those with dementia ( due to alzheimer disease ; ad and non - ad ) , whereas awareness of memory was higher for both non - amci and non - ad dementia patients than for those with amci or ad . balance awareness did not differ based on diagnostic subgroup . awareness of function was associated with instrumental activities of daily living and caregiver burden . in contrast , awareness of balance was associated with fall history , balance confidence , and instrumental activities of daily living . clinical correlates of awareness of memory depended on diagnostic group : associations held with neuropsychological variables for non - ad dementia , but for patients with ad dementia , depression and instrumental activities of daily living were clinical correlates of memory awareness . together , these data provide support for the hypothesis that awareness and dementia are not unitary and are , instead , modality specific .

the term was used by hallopeau in 1889 and is derived from the greek ; thrix - hair , tillein - pull out and mania - madness . scalp is the most common site for pulling hair although other hair bearing areas may be involved . in less severe forms diagnosis is mainly by history and clinical examination , nevertheless , sometimes it is very difficult to differentiate it from other causes of noncicatricial alopecia . trichoscopy , dermoscopy hair and scalp , is a noninvasive technique for differential diagnosis of various hair and scalp diseases . here authors evaluated trichoscopic patterns in ttm and authors believe that these patterns are specific to ttm , which can aide in early diagnosis of this chronic condition . this study was carried out on 10 patients attending department of dermatology in a tertiary hospital attached to s. nijalingappa medical college at bagalkot , south india between january 2014 and july 2014 . ten patients with clinical features of ttm were subjected for a complete history and dermatological examination . demographic data such as age and gender and clinical variables in terms of site of lesions and disease duration were documented . dermlite 3 dermoscope ( 10 magnifications ) with both polarized and nonpolarized lights was employed in the study . sony camera ( digital , 14 mega pixels ) was attached to save the images . initially , ultrasound gel was applied either on the faceplate of dermoscopy or on the skin lesions and then lesions were observed through the eyepiece of dermoscopy . although polarized dermoscopy was employed , ultrasound gel was applied for clarity of images and to lessen distortions associated with light . this study was carried out on 10 patients attending department of dermatology in a tertiary hospital attached to s. nijalingappa medical college at bagalkot , south india between january 2014 and july 2014 . ten patients with clinical features of ttm were subjected for a complete history and dermatological examination . demographic data such as age and gender and clinical variables in terms of site of lesions and disease duration were documented . dermlite 3 dermoscope ( 10 magnifications ) with both polarized and nonpolarized lights was employed in the study . however , only polarized light version was used in our study . sony camera ( digital , 14 mega pixels ) was attached to save the images . initially , ultrasound gel was applied either on the faceplate of dermoscopy or on the skin lesions and then lesions were observed through the eyepiece of dermoscopy . although polarized dermoscopy was employed , ultrasound gel was applied for clarity of images and to lessen distortions associated with light . mean age of the patients was 34 years ( minimum age 13 years and maximum age 55 years ) . mean duration of disease was 19 months ( minimum 2 months and maximum 36 months ) . most common symptom was patchy loss of hair over the scalp ( 100% ) especially in the frontal area [ figure 1 ] and one patient ( 10% ) had tonsure pattern of hair loss . four patients agreed to knowingly pulling of hair , and one patient ( 10% ) gave a history of eating them ( trichophagia ) . the most common trichoscopic pattern observed in all patients was decreased hair density and hairs broken at different lengths ( 100% ) [ figure 2 ] . excoriations are also seen on the forehead trichoscopy showing decreased hair density , trichoptilosis ( yellow arrows ) , tulip hairs ( red arrows ) and perifollicular whitish areas ( red stars ) short hair with trichoptilosis ( split ends ) [ figures 25 ] , irregular coiled hairs [ figure 3 ] and upright re - growing hairs were demonstrated in 8 patients ( 80% ) each . the novel diagnostic signs like black dots and flame hair [ figure 4 ] , v - sign [ figure 3 ] , follicular hemorrhages [ figure 5 ] were observed in 3 patients ( 30% ) each . tulip hair and hair powder [ figure 6 ] patterns were observed in 1 ( 10% ) patient each . all patients ( 100% ) had the noninflammatory alopecia with follicles having distorted and collapsed inner root sheath [ figure 7 ] in histopathology . trichoscopy showing coiled hairs ( red arrows ) and v - hairs or v - sign ( yellow arrows ) trichoscopy showing flame hairs ( red arrows ) and black dots ( yellow arrows ) trichoscopy showing decreased hair density , follicular hemorrhage ( black arrow ) and trichoptilosis ( red arrows ) trichoscopy showing tulip hairs ( red arrows ) and hair powder ( yellow arrows ) histopathology showing diffuse , noninflammatory alopecia , missing hair shafts ( black stars ) and inward collapse of outer root sheath ( black arrows ) . few unaffected follicles are also seen ( yellow arrows ) ( h and e , 4 ) histopathology showing an irregular , deformed and pigmented shaft characteristic of trichomalacia ( h and e , 40 ) trichotillomania is a chronic impulse control disorder characterized by repetitive hair pulling resulting in alopecia . in young children , it is usually a habit that resolves spontaneously or with minimal treatment . in older age groups , adolescents and adults , seen predominantly in females and evidence of some form of psychological or behavioral stress is often apparent . the favorite site is the easily reached fronto - parietal region of the scalp followed by eyelashes , eyebrows , pubic hair , body hair and facial hair . this results in patchy loss of hair , often in a bizarre or angular pattern , in which the hairs are twisted and broken at various distances from the clinically normal scalp . a hairball , trichobezoar , is a rare accompaniment of ttm in those who also eat the plucked hair ( trichophagia ) . in our study , most of the patients belonged to adolescent , and middle age group and most of them were females . all of them presented with patchy hair loss over the scalp , none of the patients gave a history of hair loss in other areas . only one patient had a history of eating of pulled hairs , but there were no signs and symptoms of trichobezoar in her . the diagnosis of ttm is often difficult as other hair loss diseases appear similar in clinical manifestations . this difficulty is encountered especially with alopecia areata ( aa ) . as ttm often coexists with aa trichoscopy is a novel diagnostic technique , both simple and noninvasive , can be used as a handy bed side tool for diagnosing common hair and scalp disorder . several common trichoscopy features of ttm were identified . decreased hair density , hairs broken at different lengths , short hairs with trichoptilosis ( " split ends " ) are described in the literature as diagnostic of ttm . authors observed these findings in all the patients , and this is due to irregular and repetitive pulling of hairs leading to damage to the cuticle . irregular coiled hairs and upright re - growing hairs are also reported to be seen in ttm . in this study , these findings were demonstrated in 80% of patients . coiled hair results from hair shaft fracture and coiling of the remaining proximal part which is fixed to the scalp . black dots are believed to be remnants of hair shafts arising from tapering hairs , broken hairs , and bent hairs . in a study conducted by shim et al . rakowska et al . observed that black dots tend to be uniform in size and shape in aa , whereas in ttm and tinea capitis they are variable in diameter and round , oval , irregular in shape . it presents as a red dot corresponding to follicular ostia capped or stuffed with the blood clot and suggests a history of traumatic forced plucking . recently , flame hairs , v - sign , tulip hairs , and hair powder are described , and authors claim these signs are specific only for ttm . flame hairs are semi - transparent , wavy and cone - shaped hair residues , which develop as a result of severe mechanical hair pulling and shredding . v - sign is created when two or more hairs emerge from one follicular ostium , which are pulled simultaneously and break at the same length above scalp surface . when hair shafts are almost totally damaged by mechanical manipulation , only a sprinkled hair residue is visible . this finding is referred to as hair powder . in the present study , these trichoscopic patterns were demonstrated in variable frequency . in aa , the common trichoscopic findings are yellow dots , uniform black dots , broken hair , trichoptilosis , upright re - growing hair , and vellus hair . as some of the trichoscopic features are overlapping in ttm and aa , histopathology plays a corroborative role in definitive diagnosis . the histopathological features of ttm include empty follicles , incomplete disrupted follicular anatomy , trichomalacia , and pigment casts without significant inflammation . collapsed inner root sheath and missing hair shaft indicate the extraction of the hair follicle due to forcible hair pulling . partially extracted and distorted root sheath material with fragments of pigment can be identified as the germinative follicular epithelium may produce abnormally formed , diminished and distorted hair shaft with irregular pigmentation as a result of trauma . a new trichoscopic pattern was observed by the authors in one patient , in the form of perifollicular whitish areas [ figure 2 ] . authors believe these whitish areas represent hyperkeratosis that is due to perifollicular damage as a result of repeated hair pulling trichotillomania is often chronic and difficult to treat . patients may attempt to disguise the condition due to its social implications . hence trichoscopy , being a noninvasive and in vivo diagnostic technique , can be utilized in this condition as it plays a vital role in the diagnosis of this condition by demonstrating specific trichoscopic patterns . further studies on trichoscopic patterns correlating with duration of disease and histopathology of ttm are suggested .

introduction : trichotillomania ( ttm ) is characterized by patchy alopecia of hair bearing areas . this is because of compulsive urge to pull the hair . scalp is the most common site for pulling hair . usually , patients may have only small areas of baldness , in severe forms , tonsure pattern of baldness is observed . diagnosis is by history and clinical examination . however , it is difficult to differentiate from other causes of noncicatricial alopecia . here , authors observed trichoscopic patterns and evaluated their importance in the diagnosis of ttm.materials and methods : this study was conducted in s. nijalingappa medical college , bagalkot , from january 2014 to july 2014 . ten patients with clinically suspected ttm were included in the study . informed consent was taken and ethical clearance was obtained . dermlite3 dermoscope was used with sony camera attachment to save the images . histopathological examination was conducted in all the patients to confirm the diagnosis.results:ten patients were included in the study . mean age of the patients was 34 years . most common symptom was patchy loss of hair in the frontal area ( 100% ) . common trichoscopic feature was decreased hair density and broken hairs . trichoptilosis ( split ends ) and irregular coiled hairs were seen in 80% patients . novel diagnostic signs like black dots , flame hair , v - sign , follicular hemorrhages , were seen in 30% each . tulip hair and hair powder were observed in 10% of patients . all patients had the noninflammatory alopecia with distorted and collapsed inner root sheath in histopathology.conclusion:trichotillomania is often chronic and difficult to treat . hence , early diagnosis and treatment is necessary . authors believe that the trichoscopy plays a vital role in the diagnosis of this condition by demonstrating specific trichoscopic patterns .

physical mixtures of benfotiamin at three different mass ratios ( 1:1 , 1:2 , 1:3 and 1:4 ) were prepared . the prepared mixtures were then filled in glass bottles , sealed and stored in a dessicator until further use . a mixture of drug and polymers in three different mass ratios were wetted with water and kneaded thoroughly for 30 minutes in a glass mortar . the dissolution study of pure drug , physical mixture and solid dispersion was carried out by using usp dissolution apparatus ( type 2 ) at 100 rpm at temperature of 37 0.5c using 900 ml volume of ml p. 1.2 and p. 7.4 the volume withdrawn was replaced by fresh volume of dissolution medium to maintain constant volume of medium . the filtered samples were analyzed spectrophotometrically at 226 nm and the drug release was determined . the phase solubility studies were performed to determine stoichimetric proportions of benfotiamin and carriers- pvp k-30 and hpmc . the effects of polymers concentration at room temperature on solubility are shown in figure 1 . results of concentration of carriers on solubility of benfotiamin the plot of drug solubility against polymer concentrations at room temperature indicated a linear relationship between drug and polymer solution . both the type shows al type of plot i.e. the solubility of benfotiamine increased with increasing carrier concentration . dissolution of the pure drug , physical mixtures as well as solid dispersions of benfotiamin with pvp k-30 ( equivalent to 40 mg ) was tested in acidic buffer ( ph 1.2 ) and phosphate buffer ( ph 7.4 ) for a period of 60 minutes . dissolution of the pure drug , physical mixture and solid dispersion prepared by kneading method in ratio of 1:4 was found to be 36.63% , 41.63 and 99.72% in 50 minutes in acid buffer medium . pure drug and physical mixtures shows almost same release , whereas the solid dispersion ( 1:4 ) shows 00% drug releases in one hour . the solid dispersion prepared using ratio 1:1 , 1:2 and 1:3 showing corresponding drug releases that is 79.29% , 83.30% and 95.12% in 60 minutes as shown in figure 2 . in - vitrodissolution profile of benfotiamin with pvp k-30 in ph . increasing the drug carrier ratio from 1:1 to 1:4 improved drug release profiles observed in for all formulations in case of kneading method with pvp k-30 and hpmc but the drug release rate was higher in 1:4 ratio for both the polymers . the drug release was found to be better in solid dispersions prepared with pvp k-30 as compared to those prepared with hpmc .

the present study was aimed to increase the solubility of the poorly water soluble drug benfotiamine using hydrophilic polymers ( pvp k-30 and hpmc e4 ) . solid dispersions were prepared by kneading method . phase solubility study , in - vitro dissolution of pure drug , physical mixtures and solid dispersions were carried out . pvp and hpmc were found to be effective in increasing the dissolution of benfotiamine in solid dispersions when compared to pure drug . ft - ir , differential scanning calorimetry and x - ray diffractometry studies were carried out in order to characterize the drug and solid dispersion . to conclude that , the prepared solid dispersion of pvp-30 may to effectively used for the enhancement of solubility of poorly water soluble drugs such as benfotiamine .

atherosclerosis and its vascular damage are the leading cause of mortality and morbidity in patients with diabetes . recently , several studies have shown that cardiovascular diseases are the first cause of premature death among individuals with type 1 diabetes , demonstrating that although there have been substantial improvements in survival during the past 50 years , still challenges remain . although diabetes - related vascular complications are uncommon in the pediatric age , early functional and structural abnormalities may be present just a few years after the onset of type 1 diabetes . therefore , early diagnostic and therapeutic approaches are needed for youth with type 1 diabetes at risk for a premature vascular disease . a surrogate marker of cardiovascular disease is endothelial dysfunction , which is the inability of the artery to sufficiently dilate in response to an appropriate endothelial stimulus . the reactive hyperemia peripheral artery tonometry technique is used for a few years now as a noninvasive test to assess for early vascular changes in high - risk patient groups . in a previous study , we evaluated the prevalence of endothelial dysfunction measured as mean of reactive hyperemia index ( rhi ) , in a cohort of adolescents with type 1 diabetes . surprisingly a low rhi score was observed in 76.7% of patients , showing a dramatic prevalence of early endothelial dysfunction among type 1 diabetes individuals , even in the pediatric age . endothelial cells have got numerous functions crucial for maintaining intravascular homeostasis : they play an important role in vascular tone regulation , hemostasis , and fibrinolysis and in the production of several substances [ 6 , 7 ] . in patients with diabetes , hyperglycemia and related pathological biochemical processes trigger damage to the endothelial cells causing their dysfunction . the dysfunctional endothelium adopts prothrombotic , proinflammatory , and vasoconstrictive phenotype promoting the early development of atherosclerosis [ 3 , 6 , 7 ] . alpha - lipoic acid is a potent mitochondrial antioxidant agent that acts by multiple mechanisms promoting anti - inflammatory and antithrombotic pathways and positively influencing the nitric oxide mediated vasodilatation . in most european countries alpha - lipoic acid is licensed and used as treatment in patients with neuropathic symptoms . moreover , many studies suggest the potential role of alpha - lipoic acid in prevention and treatment of atherosclerosis and related cardiovascular disease [ 10 , 11 ] . this hypothesis is based on similar results obtained either in animal models or in patients with diabetes mellitus , especially type 2 diabetes [ 1214 ] . in streptozotocin - induced rats , it may be assumed that alpha - lipoic acid treatment can protect against impaired vascular responsiveness . in type 2 diabetes patients , alpha - lipoic acid may influence angiogenesis through an effect on some circulating factors including vegf , bfgf , mcp-1 , and il-10 . therefore , the aim of our study was to investigate the effect of alpha - lipoic acid on endothelial dysfunction in youth with type 1 diabetes . this pilot study is a 6-month , double - blind , randomized controlled trial to test the efficacy of an antioxidant diet plus alpha - lipoic acid versus an antioxidant diet alone in improving endothelial dysfunction in adolescents with type 1 diabetes . this study was a 6-month , prospective , randomized , double - blind , controlled trial conducted in pediatric patients with type 1 diabetes , performed at the pediatric department of the university of milano . the trial was performed in accordance with the declaration of helsinki . before any trial - related activities signed informed consent was obtained from all participants aged 16 years or older and from parents or guardians of participants aged younger than 16 years ( assent was obtained from minors ) . patients with type 1 diabetes were referred for study participation from the outpatient clinic of the university of milano between january 2013 and december 2013 . seventy - one patients who had been previously evaluated for the presence of endothelial dysfunction were enrolled in the trial and completed the 6-month study period . inclusion criteria were type 1 diabetes ( diabetes onset was defined according to ada criteria ) , more than 1 year from diagnosis or confirmed c - peptide negative , age between 12 and 19 years , insulin requirement more than or equal to 0.5 u / kg / day , blood glucose checks more the 3 times per day , and insulin intensive therapy ongoing . exclusion criteria were preexisting cardiovascular diseases or inflammatory systemic diseases , hypertension and prehypertension ( bp 90th percentile for age , sex , and height ) , eating disorders , obesity ( defined as bmi 95th percentile per age and sex in the 2000 cdc growth chart ) , celiac disease , inflammatory bowel disease or other significant gastrointestinal conditions , systemic glucocorticoid use ( 1-month cumulative use during last year ) or ongoing treatment with glucocorticoid use , anemia , significant multiple food allergies , uncontrolled hypothyroidism or hyperthyroidism , significant mental illness , and pregnancy . clinical history and physical examination , nutritional records , and biochemical sample were collected at baseline , after 3 months , and after 6 months ; endothelial dysfunction was evaluated at baseline and after 6 months . weight was measured unclothed to the nearest 0.1 kg using a calibrated balance scale . blood pressure was measured using a mercury sphygmomanometer , according to the national high blood pressure education program working group . moreover , all patients were in intensive insulin therapy , with either multiple daily injections or insulin pump therapy . blood sampling was performed in the fasting state at 8 a.m. levels of lipids including triglycerides ( tg ) , total cholesterol ( tc ) , ldl - cholesterol , and hdl - cholesterol were evaluated in all subjects with standard laboratory methods . blood was drawn for hba1c analysis using a fully automated high - performance liquid chromatography system ( variant ii , bio - rad laboratories , munich , germany ) . at baseline and 3 and 6 months a nutritional visit was performed by the registered dietitian of the pediatric department of the luigi sacco hospital . three - day dietary records with nutrition data were evaluated using dedicated software ( metadieta , meteda , san benedetto del tronto , ap , italy ) . data on dietary intake , reporting the types and amounts of all food and beverages consumed , with data on insulin doses and algorithms used at home , blood glucose results , and physical activity were collected . during the study period a dietary recall was collected every month ; moreover a nutritional assessment was performed at 3 and 6 months to check the patients ' compliance to the dietary plan assigned . moreover , registered dietitian evaluated the body composition using tanita bc-418 , il , usa . peripheral endothelium - dependent vasodilator capacity was estimated by assessing the rhi by means of the endopat 2000 system ( itamar medical ltd . , endothelium - mediated changes in vascular tone after occlusion of the brachial artery are reflecting a downstream hyperemic response , which is a measure for arterial endothelial function . the rh - pat score is calculated as the ratio of the average pulse wave amplitude during 1 min period starting 60 s after cuff deflation divided by the average pulse wave amplitude of a 210 s preocclusion baseline period . after the clinical assessment at baseline , each patient was randomly assigned to one of the three double - blind , study arms : 10.000 oxygen radical absorbance capacity units ( orac ) antioxidant diet plus alpha - lipoic acid ( n = 25 , group 1 ) , 10.000 orac antioxidant diet plus placebo ( n = 27 , group 2 ) , and controls ( n = 19 , group 3 ) , with no changes in dietary habits . supplementation with 400 mg of slow - release alpha - lipoic acid or placebo , both in a lyophilized formulation , was furnished by the ra of the pediatric department . patients were advised to melt the lyophilized solution in a glass of water and to get it twice a day at least 1 hour before lunch and dinner , for 6 months . the compliance with the antioxidant diet was monitored by monthly dietary recalls and a full nutritional assessment was repeated , after 3 and 6 months . both patients treated with antioxidant diet plus alpha - lipoic acid ( n = 25 , group 1 ) and patients treated with antioxidant diet plus placebo ( n = 27 , group 2 ) received the same diet plan , of 18002200 kcal per day , according to the age - group . the daily amount of carbohydrates was 60% of the total intake , with 15% of simple carbohydrates . the prescribed amount of fiber was 40 gr per day ; fats were 26% , with a monosaturated percentage of 12 , polysaturated percentage of 4 , and saturated percentage of 8 . the ratio of the fatty acid was 8 gr for omega-6 and 2 gr for omega-3 . the daily amount of proteins was 14% of the total intake , with 54% of animal proteins and 46% of vegetable proteins . no particular nutrient source to elevate the dietary orac was administered , but a list of foods with high orac content was given to each subject with detailed instruction to reach the desired assumption of orac . a similar dietary plan was assigned to patients enrolled in the control group ( n = 19 , group 3 ) , but no orac supplementation was suggested . prior to data analysis , all metric variables were checked for normality by using shapiro - wilk test . we used unpaired t - test and manova ( multiple analysis of variance ) when appropriate . results are presented as mean standard deviation ( sd ) , or percentage , unless stated otherwise . all the 71 patients enrolled completed the 6-month study period and no one dropped out of study before completing it . moreover no severe side effects have been reported by either alpha - lipoic acid group or placebo . three patients of the alpha - lipoic acid group and 2 patients of the control group reported mild abdominal pain over the first 4 weeks of the study , with no need to withdraw from the study . baseline and 6-month clinical characteristics are summarized in table 1 for each study group . at baseline , the mean age of the whole group was 16.3 3.4 years , the mean of diabetes duration was 8.1 5.2 years , the mean bmi was 21 3 , and insulin requirement was 0.83 0.29 u / kg / day . all patients enrolled in the study reported in - range levels of triglycerides , total cholesterol , ldl - cholesterol , and hdl - cholesterol per age and sex over the study period . moreover all patients showed normal blood pressure measurements per age , sex , and height . there was no statistical difference in all the demographic and clinical variables considered among the three study groups at baseline ( table 1 ) . after 3 months , a significant reduction in daily insulin requirements was observed only in group 1 , both in the amount of the total daily dose ( 0.74 u / kg / day at 3 months versus 0.83 u / kg / day at baseline , p = 0.048 ) and in the percentage of bolus ( 22.0% at 3 months versus 26.3% at baseline , p = 0.047 ) ( table 1 ) . however these data were not confirmed at 6 months , and no differences were reported among the 3 groups after 6 months of diet in terms of daily insulin requirement . these results are supported by data collected during the nutritional assessment . indeed , dietary recall to evaluate patients ' compliance to the dietary plan showed a significant increase of orac intake at month 3 in both arms ( treatment and placebo ) but not in controls . after 6 months , orac consumption decreased in the treatment group but not in the placebo group , as reported in table 1 . endothelial dysfunction was tested as rhi score in all groups at baseline and after 6 months . as described in a previous study , at baseline a low rhi score was reported in all patients enrolled , which resulted in a pathologic range ( < 1.67 ) . at 6 months , rhi score significantly improved only in the group of patients treated with antioxidant diet plus alpha - lipoic acid ( 1.72 versus 1.4 , p = 0.045 ) , reaching a normal rhi value ( table 1 and figure 1 ) . the group of patients treated with antioxidant diet plus placebo reported a better rhi score at 6 months versus baseline as well , but it did not reach the significance . no differences in rhi score were showed in the control group at 6 months versus baseline . the analyses performed on the other clinical parameters collected showed no differences at baseline and after 3 and 6 months among the three groups : bmi , 24 h blood pressure , lipid profile , hba1c , dietary habits , and body composition resulted any different among the three groups and over the study period . to the best of our knowledge , this is the first study analyzing the effects of a dietary supplementation in improving the endothelial dysfunction in youth with type 1 diabetes . in this randomized , placebo controlled double - blind trial , we found a relationship between the consumption of an antioxidant diet plus alpha - lipoic acid and the improvement in endothelial dysfunction in youth with type 1 diabetes . in particular an antioxidant diet ( 10000 orac ) plus alpha - lipoic acid ( 800 mg / day ) seems to be effective in reducing insulin requirement and daily bolus rate after 3 months and in improving endothelial dysfunction after 6 months . the efficacy of alpha - lipoic acid in improving glucose disposal has been previously described in animal models [ 1215 ] and in type 2 diabetes adult patients [ 13 , 14 , 16 ] . it was 1970 when lipoic acid was shown to enhance glucose uptake into rat tissue [ 17 , 18 ] . gradually the effects of different formulas of alpha - lipoic acid were tested both in vitro and in animal models [ 16 , 19 ] confirming the ability to increase glucose uptake and to enhance the glycogen synthesis [ 16 , 19 ] . the molecule seems to work improving insulin sensitivity by modulating the signal transduction and by increasing the glucose uptake . in patients with type 2 diabetes , an acute intravenous administration of 1000 mg of lipoic acid moreover a 4-week oral treatment with alpha - lipoic acid successfully resulted in increasing insulin sensitivity in patients with type 2 diabetes . in our small study , a supplementation with 800 mg / day of alpha - lipoic acid for 3 months effectively resulted in reducing insulin requirement . the mechanisms of action are not completely clear , since , in our knowledge , studies having pediatric type 1 diabetes patients as target are lacking . however , as reported for type 2 diabetes , we hypothesize that alpha - lipoic acid can use nicotinamide adenine dinucleotide molecules ( nadh ) for the reduction to dihydrolipoic acid , resulting in an increased ratio of nicotinamide adenine dinucleotide ( nad+ ) to nadh and thus stimulating the glycolysis pathway . in our study the alpha - lipoic beneficial effect on insulin requirement and thus on glucose uptake is reported at 3 months but it is not confirmed at 6 months . in our opinion this can be explained by a decreased compliance to the dietary supplementation , as confirmed by dietary recall and by data collected during the nutritional assessments . we also demonstrated for the very first time the power of alpha - lipoic acid in improving endothelial dysfunction in youths with type 1 diabetes . in our cohort of patients , the prevalence of endothelial dysfunction is largely represented , despite the pediatric age and the quite good metabolic control . data from registries has recently shown that a large proportion of the type 1 diabetic population does not meet the age - associated hba1c targets across all countries , especially in the youth age . moreover , data recently published by lind and colleagues showed that patients with type 1 diabetes and on - target hba1c still have a risk of death from any cause and from cardiovascular diseases more than twice the risks in the general population . these dramatic data ask for new insights into the pathogenesis of diabetes - related complications , as well as for new therapeutic approaches . thus , during the last decades , many studies have been conducted to investigate the role of inflammation in diabetes onset and in diabetes - related complications . the opportunity for an early detection of endothelial dysfunction can lead to new insights into the very first steps of the cardiovascular complications . indeed , endothelial cells play a wide spectrum of different functions , as regulating coagulation , leukocyte adhesion , and trafficking , modifying the tone of the vessel , and participating in the smooth - muscle growth . as a consequence , many different pathways can be affected by pathologic factors , leading to endothelial dysfunction . several mechanisms have been suggested to explain endothelial dysfunction : hyperglycemia itself , increased oxidative stress and subsequent ages production and protein kinase c and polyol - pathway activation , lower vitamin c plasma concentration , and significantly higher circulating reactive protein c levels [ 27 , 28 ] . alpha - lipoic acid is reported to be effective in most of these reactions , getting the role of antioxidant , anti - inflammatory molecule . indeed , although it is well defined as a therapy for preventing diabetic polyneuropathies and it is used in the management of diabetic peripheral neuropathy in both patients with type 1 and type 2 diabetes , alpha - lipoic acid has many biochemical functions . it acts as metal chelator , as scavenger of free radicals , and as reducer of the oxidized forms of other antioxidant agents such as vitamins c and e and it regulates several signal transductions . in particular alpha - lipoic acid was shown to increase the activity of enos , to downregulate the expression of the cell - adhesion molecules icam-1 and vcam-1 and of mmp-9 by the inhibition of age - induced nf - kb ( nuclear factor kappa - light - chain - enhancer of activated b cells ) adhesion factors [ 14 , 22 ] . supported by this evidence , we can speculate that a 6-month supplementation with alpha - lipoic acid 800 mg / day can positively impact endothelial dysfunction , decreasing oxidative stress and inflammation in type 1 diabetes , even in pediatrics . despite this , these data must be carefully weighed against the lack of consensus regarding the most appropriate supplementation method for alpha - lipoic acid , dosage , and treatment duration . however , in a paper recently published a 3-month treatment with 600 mg of alpha - lipoic acid was demonstrated to provide significant beneficial changes in vegf , bfgf , mco-1 , and il-10 serum levels in type 2 diabetic patients , confirming the efficacy of low - period treatment on endothelial outcomes . moreover , several studies demonstrated the efficacy of 600 or more mg of alpha - lipoic acid administered for few weeks or months [ 30 , 31 ] in the treatment of diabetic polyneuropathy . the strength of our study is the evidence for the first time of a positive association between alpha - lipoic administration and decreased endothelial dysfunction in pediatric patients with type 1 diabetes . nevertheless the trial has some limitations , and we strongly advise a larger sample and a long - term follow - up to confirm these results . moreover , the effects of alpha - lipoic acid on glycemic control need to be investigated as well , both as glycemic variability and hypo- and hyperglycemic events .

after evaluating the prevalence of early endothelial dysfunction , as measured by means of reactive hyperemia in adolescents with type 1 diabetes , we started a 6-month , double - blind , randomized trial to test the efficacy of an antioxidant diet ( alpha - lipoic acid supplementation ) to improve endothelial dysfunction . seventy - one children and adolescents , ages 17 3.9 yrs , with type 1 diabetes since 9.5 5.3 yrs , using intensified insulin therapy , were randomized into 3 arms : ( a ) antioxidant diet 10.000 orac + alpha - lipoic acid ; ( b ) antioxidant diet 10.000 orac + placebo ; ( c ) controls . bmi , blood pressure , fasting lipid profile , hba1c , insulin requirement , dietary habits , and body composition were determined in each patient . an antioxidant diet significantly improved endothelial dysfunction when supplemented with alpha - lipoic acid , unlike diet with placebo or controls . a significant reduction in bolus insulin was also observed . we speculate that alpha - lipoic acid might have an antioxidant effect in pediatric diabetes patients by reducing insulin .

to investigate the immunologic events underlying the evolution of a chronic colitis we analyzed the chronic tnbs- colitis occurring in balb / c mice administered weekly doses of intra - rectal trinitrobenzene sulfonic acid ( tnbs ) ( 6 , 7 ) . mice treated in this way initially develop intense colitis associated with severe weight loss and considerable mortality . however , about three weeks after the initiation of this form of tnbs - colitis , the colitis moderates and , while the mice do not exhibit the weight gain of control mice , they regain their lost weight . importantly , the termination phase of this inflammatory cycle is accompanied by the development of fibrotic cycle . thus , four - five weeks after initiation of chronic tnbs - colitis , the mice develop steadily increasing fibrosis of the colonic lamina propria . as shown in figure 1 , this increase in intestinal fibrosis can be demonstrated by measuring the collagen content of the colon . to understand the immunologic basis of this complex series of events we determined the cytokines produced by lamina propria cells during the various stages of the inflammation . as established as an overview in figure 2 , we noted that the production of th1 cytokines , il-12p70 and ifn- by extracted cells were greatly elevated on day 7 after initiation of tnbs administration . however , surprisingly , the production of these cytokines gradually decreased over the next 2 weeks , returning to baseline levels by day 21 and then gradually declining to levels increasingly below that observed at baseline . interestingly , an increased production of an alternative set of pro - inflammatory cytokines , namely il-23 and il-17 , accompanied the decline in the production of il-12p70 and ifn-. increased il-23 production above baseline was noted first on day 21 , and thereafter increased further until it reached a plateau on day 42 . the expression levels of both cytokines increased further until they reached a plateau on day 42 . somewhat surprisingly , increased production of il-23 and il-17 coincided with increased production of cytokines usually considered a th2 cytokines , namely , il-25 and il-13 . previous studies have shown that il-25 , a member of the il-17 family of proteins ( and designated il-17e ) , is associated with expression of th2 cytokines , at least when it is over - expressed in transgenic mice ( 8) . on day 35 a massive increase in il-25 secretion appeared and thereafter il-25 secretion further increased , reaching its highest level on day 49 . at about the same time , the secretion of il-13 was initiated and the level of this cytokine also increased until it reached a plateau on day 49 . coming now to the molecular events during intestinal fibrogenesis , in previous studies we showed that il-13 induces tgf-1 production by signaling through cell - surface il-13r2 , an il-13 receptor formerly thought to function only as a soluble decoy receptor ( 912 ) . since il-13 is produced in the later phase of chronic tnbs - colitis we reasoned that this pathway might be involved in the development of fibrosis occurring during this phase . to explore this possibility we first determined the expression of both il-13r1 and il-13r2 in extracts of colonic lpmc during the course of chronic tnbs colitis . as shown in figure 3 , il-13r1 was constitutively expressed throughout the time course of the animal model . in contrast , il-13r2 was an induced receptor since it was not evident in nave mice or in the first few weeks of chronic tnbs - colitis , but could be detected initially at a low concentration on day 35 and later at a high concentration on days 42 and 49 after initiation of colitis . the above time course of il-13r2 expression correlated with that of il-13 and was thus consistent with the possibility that the latter was an inducing cytokine . to address this question more directly we next blocked il-13 activity by administration of a plasmid ( pci - sil-13r2-fc ) encoding a soluble il-13r2-fc fusion protein ( pci - sil-13r2-fc ) or a control plasmid ( pcl empty vector ) . the administration of the pcl - sil-13r2-fc plasmid by this route , but not the control plasmid , led to a reduction in lpmc production of il-13 . this effect is consistent with that noted previously in a study by chiaramonte et al where it was shown that mice with il-13r2 receptor deficiency have reduced il-13 production and is a possible result of the fact that autocrine il-13 signaling via this receptor is necessary for optimal il-13 production ( 9 ) . in addition , as shown in figure 4 , administration pci - sil-13r2-fc led to virtually complete loss of il-13r2 expression in extracts of colonic tissue obtained at the conclusion of the study ( day 49 ) . in contrast , neutralization of tgf-1 by administration of anti - tgf-1 had no effect on receptor expression or signaling ; this was expected since there is no evidence to suggest that tgf-1 induces up - regulation of il-13r2 . taken together , these results strongly suggest that il-13 production occurring in the late phase of chronic tnbs - colitis is indeed responsible for the expression of il-13r2 . in previous studies we have shown that intra - rectal administration of nf-b decoy oligonucleotides on days 35 and 42 abrogates the inflammation and the accompanying cytokine response characteristic of the chronic inflammation at this stage of the inflammation , including the high levels of il-23 , il-17 and il-13 ( 6 ) . in addition , such treatment prevented the production of tgf-1 and the development of intestinal tissue fibrosis . however , while these data established that the il-13 and tgf-1 responses as well as the collagen deposition were an outgrowth of the inflammation , they did not address the question of whether or not il-13 and/or tgf-1 were the cause of such deposition . to address the question of whether il-13 and tgf-1 are responsible for the collagen deposition , in the present study we determined the effect of in vivo inhibition of either il-13 signaling or tgf-1 activity on the generation of tissue fibrosis . in these studies we inhibited il-13 signaling in two ways : 1 ) by intra - nasal administration of the plasmid described above encoding a soluble il-13r2-fc fusion protein ( pci - sil-13r2-fc ) or a control plasmid ( pcl empty vector ) to block the receptor with the use of a decoy ; and 2 ) by intra - rectal administration of il-13r2-specific sirna encapsulated in hvj - e or a control sirna to down - regulate the receptor by gene silencing . both the sil-13r2-fc plasmid and the sirna were administered every other day starting on day 35 after the initiation of the chronic inflammation . on the other hand , for study of the effects of inhibition of tgf-1 we administered anti - tgf--antibody or isotype control ig by an intra - peritoneal route over the same time period . the effects of these treatments on il-13 and tgf-1 levels were subsequently determined at the termination of the study on day 49 . for this purpose , lpmc extracted from the colons of sacrificed mice were cultured for 48h with anti - cd3/anti - cd28 and their secretion of il-13 and tgf-1 into the culture supernatant measured by elisa . neutralization of il-13 signaling by fusion protein or gene - silencing of il-13r2 by sirna as well as neutralization of tgf-1 by antibody was accompanied by only a small , non - significant increase in body weight and no measurable change in colitis score . thus , lpmc extracted from the colons of sacrificed mice on day 49 and evaluated for secretion of cytokines secreted equal amounts of il-12p70 , ifn- , tnf- , il-23 , il-17 , il-25 and il-4 whether or not they were subjected to neutralization of il-13 signaling or tgf-1 . in contrast , a very different picture was obtained with respect to tgf-1 secretion . in this case , the cells extracted from the colons of mice subjected to neutralization of il-13 signaling by fusion protein or il-13r2 downregulation by sirna exhibited greatly reduced production of tgf-1 . in addition , as shown in figure 5 , those mice subjected to neutralization of il-13 signaling as well as those subjected to tgf-1 neutralization displayed basal collagen levels seen in nave mice whereas those mice not subjected to such neutralization displayed undiminished collagen levels as compared to other mice with chronic tnbs - colitis . overall , these data show quite clearly that neutralization of il-13 signaling via il-13r2 does not alter the course of the inflammation of chronic tnbs - colitis but does block the development of fibrosis ; in addition , they show that such signaling results in fibrosis via its effect on the induction of tgf-1 . in summary , these findings suggest that chronic inflammation is orchestrated by a succession of cytokines that ultimately result in il-13 and tgf-1 production . in addition , blockade of this cytokine interaction can prevent intestinal fibrosis by selectively interfering with the pro - fibrotic program .

to investigate the immunopathogenesis of inflammation - associated fibrosis we analyzed the chronic colitis and late - developing fibrosis occurring in balb / c mice administered weekly doses of intra - rectal trinitrobenzene sulfonic acid ( tnbs ) . we showed first in this model that an initial th1 response involving il-12p70 and ifn- subsides after three weeks to be supplanted by an il-23/il-25 response beginning after 45 weeks . this evolution is followed by gradually increasing production of il-17 and cytokines ordinarily seen in a th2 response , particularly il-13 , which reaches a plateau at 89 weeks . we then show that il-13 production results in the induction of an il-13 receptor formerly thought to function only as a decoy receptor , il-13r2 , and this receptor is critical to the production of tgf-1 and the onset of fibrosis . thus , if il-13 signaling through this receptor is blocked by administration of soluble il-13r2-fc , or by administration of il-13r2specific sirna , tgf-1 is not produced and fibrosis does not occur . these studies show that in chronic tnbs colitis , fibrosis is dependent on the development of an il-13 response that acts through a novel cell - surface - expressed il-13 receptor to induce tgf-1 .

a number of diseases affect the biliary tree ( cholangiopathies ) , though the pathological mechanisms involved and the anatomical level of the biliary tree affected vary . for example , small interlobular bile ducts are mainly affected by a th1-dominated microenvironment and cell - mediated immune response in pbc , while a th2-dominated microenvironment and increased numbers of regulatory t cells are the major features of igg4-related sclerosing cholangitis which affects mainly the extrahepatic bile ducts . ischemic damage to the biliary tree is a serious complication in liver transplantations . in this special issue , cholangiopathy with respect to genetics , pathogenesis , and pathology will be discussed in detail . herein , the anatomy and physiology of the biliary tree , basic injuries to biliary epithelial cells , basic forms of bile duct damage , and etiological classifications of cholangiopathy are reviewed . the former include the right and left hepatic ducts and their confluence and the common hepatic and bile ducts , while the latter include the bile ducts proximal to the right or left hepatic duct . the intrahepatic branching of the bile ducts is best visualized on a cholangiograph or biliary injection cast ( figures 1 and 2 ) . the extrahepatic bile duct is lined by high columnar epithelial cells , and its wall is composed of dense collagenous tissue harboring scattered smooth muscular elements . the intrahepatic bile ducts can be classified as large and small , though there is no sharp delineation of the various segments [ 1 , 5 ] . the large type consists of the right and left hepatic bile ducts and their first to third branches ( segmental and area bile ducts ) . they are lined by a tall columnar epithelium and surrounded by a dense hypocellular collagenous duct wall . in contrast , small intrahepatic bile ducts , the branches of the large intrahepatic bile duct , are classified into septal and interlobular bile ducts which are visible only under a microscope . while the septal ducts ( > 100 m in diameter ) are lined by tall columnar cells with basal nuclei , the interlobular bile ducts are lined by cuboidal cells . the fibrous ductal wall is evident in the former like large intrahepatic ducts , but not in the latter . the interlobular bile ducts are connected to the bile canalicular network by ductules ( < 20 m diameter ) lined by no more than a few minimally differentiated cuboidal cells and the canals of hering , which are lined partly by biliary epithelium and partly by hepatocytes . bile ductules are very reactive anatomical elements in the liver , and proliferating bile ductules are reportedly involved in the fibrous progression of various chronic liver diseases and are easily identifiable by immunostaining of biliary cytokeratin ( ck 7 and 19 ) . peribiliary glands , the third biliary component , are present within the fibromuscular walls of extrahepatic bile ducts and also along the large intrahepatic bile ducts [ 1 , 5 , 7 ] . peribiliary glands around the large intrahepatic bile ducts ( figure 3 ) are subdivided into intramural glands , nonbranching tubular glands , and extramural ramified glands . the latter lie in the periductal connective tissue and , in a three - dimensional model , have a linear distribution along the opposite sides of the bile ducts and indirectly drain into the bile duct lumen via their own conduit . pancreatic acini without langerhans ' islets are found intermingled with peribiliary glandular acini and are probably an intrinsic component of these glands . the extrahepatic stem cell niches are the peribiliary glands deep within the walls of the bile duct [ 6 , 8 ] . the individual anatomical components of the biliary tree each have a rather characteristic antigen , probably reflecting a site - specific function [ 9 , 10 ] . for example , the becs lining large bile ducts are columnar and mucus is detectable in the supranuclear cytoplasm , but mucin is not detectable in the interlobular bile ducts and bile ductules . in contrast , in the adult liver , the becs of intrahepatic large bile ducts constantly express muc3 , a membrane - binding type , whereas those of small bile ducts do not . muc6 is constantly and focally expressed in becs in the intrahepatic large bile ducts in normal liver . the expression of muc1 , muc2 , and muc5 was infrequent in normal livers but increased in hepatolithiasis . this study disclosed that the normal biliary tree has a specific expression of blood group antigens at different levels and that this expression is altered under pathologic conditions . in normal livers , large and septal bile ducts expressed a and b antigens in patients with comparable blood groups and also expressed h antigen frequently in patients with blood group o , a , or b and infrequently in patients with type ab . lea and leb are expressed in becs at any level in secretors . as for cytokeratin , ck7 and ck19 are expressed in becs of the biliary tree and also in peribiliary glands , while epcam is expressed in bile ductules . the intrahepatic and extrahepatic biliary tract is supplied by a network of fine vessels called the peribiliary vascular plexus ( pbp ) which exclusively derives from hepatic arterial branches [ 1113 ] . the pvp can be histologically divided into the inner , intermediate , and outer layers , with respect to the bile duct walls . these three layers are well and poorly developed in the large intrahepatic bile ducts and septal bile ducts , respectively , although the pbp around the interloblar bile ducts and bile ductules consists of scattered capillaries with no discernible layers . this plexus has a fern - like appearance around the bile duct under the scanning electron microscope . the pbp drains into the sinusoids through radicular portal veins or communicates with portal venous branches through internal roots or directly into the hepatic sinusoids in animals and probably in humans . the inner layer , a layer of capillaries , is found just beneath the basement membrane of the epithelial layer and is regularly distributed like a chain . ultrastructurally , the inner capillary layers are composed of fenestrated endothelial cells , and the number of fenestrae with a thin diaphragm is rather high on the capillary side facing the bile duct epithelium . these observations suggest that the pbp , particularly the inner layer , may participate in the physiology of the bile ducts , particularly in the exchange of substances between blood in the peribiliary vascular plexus and bile in the bile ducts and in the supply and drainage of substances to and from the biliary epithelia . the biliary tree is lined by specialized epithelial cells called becs or cholangiocytes and is not only a conduit of bile secreted by hepatocytes and cholangiocytes but also a conduit of the peribiliary glands . the bile ducts and peribiliary glands play a number of physiological roles in the biliary system , contributing to about one - third of total bile secretion , participating in bile acid and water reabsorption , and secretion via transporters , and also mediating immune responses including innate immunity . the primary hepatic bile secreted by hepatocytes is modified by becs via a series of secretory and absorptive processes that provide additional bile water ( becs secrete ~40% of daily bile production in humans ) or secrete hco3 to induce an alkakine state . becs also interact with the immune system and microorganisms and are also involved in drug metabolism . to accomplish these functions , becs display morphological and functional heterogeneity along the biliary tree . the biliary tree is essentially sterile under normal conditions , but bile is potentially contaminated by bacterial components such as pathogen - associated molecular patterns ( pamps ) including lipopolysaccharide ( lps ) and bacterial dna originating from intestinal flora , which are actually detectable in bile of patients with chronic inflammatory biliary diseases . in this context , the biliary tract is equipped with defence mechanisms , which are physical ( bile flow and biliary mucus ) , chemical ( bile salts ) , and immunological , such as secretory iga . becs also express toll - like receptors ( tlr ) and intracellular adaptor molecules and secrete antibiotic peptides and ( pro)inflammatory cytokines , thereby participating in the defense of the bile ducts . nonspecific bactericidal enzymes such as lactoferrin and lysozyme are also detected in the intrahepatic biliary tree , peribiliary glands , and bile . human -defensins ( hbds ) and cathelicidin , another antimicrobial peptide contributing to innate immunity at mucosal surfaces , are expressed in the biliary tree . is constitutively expressed in the biliary epithelium , while hbd-2 is expressed in large intrahepatic bile ducts in extrahepatic biliary obstruction , hepatolithiasis , and , to a lesser degree , pbc and psc , suggesting a response to local infection or bacterial components , cytokines such as il-1 and tnf- , and/or active inflammation . trefoil factor family ( tff ) 1 , 2 , and 3 peptides expressed at the apical surface of the epithelium play a major role in mucosal repair . iga is known to be secreted into bile by binding with the secretory component ( sc ) , and secretory iga ( siga ) functions in a number of ways to protect the biliary tract . biliary intraepithelial lymphocytes ( biels ) , which are markedly increased in immune - mediated cholangitis , are occasionally encountered in normal intrahepatic bile ducts . most of them are positive for cd8 , some are positive for cd57 , and these cells may participate in biliary innate immunity . several pathologic agents and stress affect the intrahepatic and extrahepatic biliary tree including viral , bacterial , and even parasitic infections , oxidative stress , and immunological assaults , as well as biliary epithelial injuries from necrosis , apoptosis , and hyperplasia , and also bile duct damages . in some biliary diseases such as primary biliary cirrhosis ( pbc ) and chronic ductopenic allograft rejection , the ongoing apoptosis of becs is important for progressive bile duct loss . in h&e stained sections , eosinophilic , shrunken slender cells with pyknotic nuclei in the biliary epithelial layer and fragmented and condensed nuclei in the bile duct lumen can be regarded as apoptotic bodies [ 2 , 15 ] . electron microscopically , shrunken becs with a condensed cytoplasm and pyknotic nuclei are a marker of apoptosis . apoptosis of becs can be confirmed using in situ nick - end labelling and immunostaining of single stranded dna , both of which detect dna fragmentation . in contrast , the coagulative or lytic necrosis of the biliary epithelium is occasionally encountered in toxic cholangiopathy . senescent becs show characteristic features such as an eosinophilic cytoplasm , cellular and nuclear enlargement , multinucleation , and an irregular arrangement with uneven nuclear spacing . actually , these cells also express cellular senescent markers such as the cell cycle regulators , p16 and p21 , and increased activity of senescence - associated -galactosidase ( sa--gal ) . recent studies showed that cellular senescence has at least two pathological effects in the development of biliary diseases : impaired regeneration and senescence - associated secretory phenotypes ( sasps ) . impaired regenerationsenescent cells no longer have the ability to proliferate and they are irreversibly arrested at the g1 phase of the cell cycle . the expression of senescence - related markers is increased in becs during early chronic rejection in chronic liver allograft and pbc . cellular senescence of becs is involved in impaired regeneration and eventual and progressive bile duct loss in pbc and ductopenic chronic rejection [ 21 , 22 ] . a relatively insufficient proliferative response of becs due to cellular senescence ( see below ) is also responsible for the progressive loss of bile ducts due to apoptosis . senescent cells no longer have the ability to proliferate and they are irreversibly arrested at the g1 phase of the cell cycle . the expression of senescence - related markers is increased in becs during early chronic rejection in chronic liver allograft and pbc . cellular senescence of becs is involved in impaired regeneration and eventual and progressive bile duct loss in pbc and ductopenic chronic rejection [ 21 , 22 ] . a relatively insufficient proliferative response of becs due to cellular senescence ( see below ) is also responsible for the progressive loss of bile ducts due to apoptosis . senescence - associated secretory phenotypesaccumulating evidence suggests that senescent cells remain metabolically active and play an important role in modulating the microenvironment around them by secreting cytokines , chemokines , growth factors , and profibrogenic factors . for example , senescent becs of pbc expressing ccl2 and cx3cl1 may be involved in the recruitment of monocytes and possibly t lymphocytes into portal tracts , around injured and senescent becs , and thereby responsible for the development of immune - mediated cholangitis such as pbc [ 19 , 23 ] . accumulating evidence suggests that senescent cells remain metabolically active and play an important role in modulating the microenvironment around them by secreting cytokines , chemokines , growth factors , and profibrogenic factors . for example , senescent becs of pbc expressing ccl2 and cx3cl1 may be involved in the recruitment of monocytes and possibly t lymphocytes into portal tracts , around injured and senescent becs , and thereby responsible for the development of immune - mediated cholangitis such as pbc [ 19 , 23 ] . the homeostasis of physiological and pathological biliary epithelia operates through a balance between cell loss and cell renewal . cell loss in the biliary epithelium is mainly due to apoptosis or senescence and mostly regulated by the bcl-2 family of proteins or senescence - associated factors such as p16 and p21 . the biliary epithelial cells of bile ductules or small bile ducts may be replenished by bile ductular cells or hepatic progenitor cells in the canal of hering , though such processes may be unlikely in the intrahepatic large bile ducts . as mentioned , the peribiliary glands themselves or progenitor cells located in these glands may be involved in renewal of the biliary epithelium of intrahepatic large bile ducts and extrahepatic bile ducts and also proliferation of the epithelia lining these bile ducts [ 7 , 8 ] . inhibition of the apoptotic or senescent process in the biliary epithelia may cause hyperplasia with an increased risk of neoplastic transformation . hyperplasia of lining epithelia of the septal and large bile ducts manifests as micropapillary projections or as a stratification of the epithelium with or without dilatation of the duct lumen . peribiliary glands , intramural or extramural , also show hyperplasia and proliferation and participate in the secretion of neutral , carboxylated , and sulphated mucins into the bile duct lumen . when prominent , in particular with clonorchis sinensis infections or hepatolithiasis , the term adenomatous hyperplasia or chronic proliferative cholangitis has been used . as for the proliferation and hyperplasia of bile ductules and small interlobular bile ducts , they appear tourtous and increase in their number in the portal tracts . some of these lesions are included in the so - called ductular reactions . several kinds of metaplasia are reported in the biliary epithelium of the intra- and extrahepatic biliary tree , usually in cases of chronic biliary diseases such as hepatolithiasis , parasitic cholangitis , and primary sclerosing cholangitis ( psc ) . gastrointestinal metaplasia resembling pyloric glands and goblet cells is not infrequently seen in chronically inflamed large bile ducts and peribiliary glands . this change is associated with the aberrant expression of gastric type mucus core protein ( muc ) 5ac and muc6 and also intestinal type muc2 . the so - called intramural glands with a gastric pyloric gland - like appearance are increased in long - standing biliary diseases and may reflect invagination of the biliary epithelium with gastrointestinal metaplasia . goblet cells are occasionally encountered among bile duct - lining cells and also in peribiliary glands . the expression of other molecules in intrahepatic large bile ducts , such as reg i and trefoil factors , appears to be related to intestinal or gastric metaplasia . while pancreatic acinar metaplasia is also reported infrequently in psc , its differentiation from heterotopic pancreatic acini is controversial . hepatocytic metaplasia occurs in interlobular bile ducts and bile ductules in various pathological situations but remains of unknown significance . squamous metaplasia is rarely encountered in long - standing inflammation of large bile ducts such as psc or in the lining of biliary cysts . chronic biliary diseases such as hepatolithiasis and psc are occasionally complicated by cholangiocarcinoma . in such cases , dysplastic or early such biliary epithelial lesions are known as dysplasia or atypical hyperplasia of the biliary epithelium and characterized by atypical , enlarged , and hyperchromatic nuclei , an increased nucleocytoplasmic ratio , and a loss of polarity [ 5 , 26 ] . usually either micropapillary or flat lesions affect a portion or the circumference of the bile duct . these lesions were proposed to be called biliary intraepithelial neoplasm ( bilin ) , and this terminology was recently adopted by who . they are divided into three grades according to cellular and structural atypia ; bilin-1 , bilin -2 , and bilin -3 . in bilin-1 , cellular / nuclear atypia are mild or moderate but not enough for overt malignancy , and cellular polarity is minimally disturbed and corresponding to low - grade dysplasia . in bilin-2 , cellular / nuclear atypia are evident but not marked enough for overt malignancy , and the disturbance of cellular polarity is mild or focal , corresponding to high - grade dysplasia . blin-3 shows cellular / nuclear atypia corresponding to overt malignancy , and cellular polarity is diffusely disturbed , corresponding to a so - called carcinoma in situ of the biliary tract . bilin-1 , bilin -2 , and bilin -3 are seen in both large intrahepatic and extrahepatic bile ducts , peribiliary glands , and gallbladder and considered to reflect a multistep neoplastic transformation of the biliary epithelium . in the biliary tree , there are several types of bile duct damage such as cholangiopathies and cholangitis . it occurs along the biliary tree , and the term cholangitis is used for inflammatory damage to bile ductules . suppurative cholangitis implies the presence of numerous polymorphonuclear cells around and within the wall as well as within the lumen of the ducts . this may involve ducts of any size and is occasionally associated with abscess formation cholangitic abscess . a microbial infection is often responsible , but the change also occurs in the presence of sterile bile , particularly after bile extravasation . the release of chemokines or cytokines is the likely cause in some cases . nonsuppurative cholangitis includes a spectrum of bile duct inflammation which may be granulomatous cholangitis , lymphoid cholangitis , fibrous cholangitis , and pleomorphic cholangitis according to the predominant type of inflammatory reaction present . this type involving the interlobular bile ducts constitutes the hallmark of pbc and is also found in drug - induced liver disease and sarcoidosis . lymphoid cholangitis refers to a close association between duct branches , usually interlobular bile ducts , and lymphocytic aggregates , which may show a follicular arrangement . this is found in pbc and psc with concomitant bile duct destruction or in nonbiliary disorders , in particular autoimmune and viral hepatitis c. pleomorphic cholangitis is associated with inflammatory cell infiltration . all other types of cholangitis are found in cah , pbc , psc , and other liver diseases . fibrous cholangitis ( also called sclerosing cholangitis ) with evident ductal fibrosis develops as a consequence of long - standing bile duct inflammatory , obstruction , or ischemic injury ; it can be obliterative or nonobliterative . the former is characteristic of psc , though , in our experience , it may be seen in acquired forms of sclerosing cholangitis too . becs of obliterative type are actually lost in fibrous lesions , appearing as a fibrous core . sclerosing cholangitis with bile duct obliteration suggests a diagnosis of psc in adults . in long - standing sclerosing cholangitis and also in other biliary diseases such as ischemic cholangitis , the bile duct wall shows a marked deposition of collagen fiber ( bile duct sclerosis ) . the affected bile ducts in sclerosing cholangitis show a marked increase in the number of c - kit receptor - expressing mast cells which secrete fibrogenic factors such as histamine , basic fibroblast growth factor ( bfgf ) , and/or tumour necrosis factor - alpha ( tnf- ) . the biliary epithelium itself produces and secretes fibrogenic substances such as bfgf , transforming growth factor - beta ( tgf- ) , and platelet - derived growth factor ( pdgf ) , as well as basement membrane proteins and extracellular matrix proteins . in biliary atresia , becs of the affected bile ducts variably express mesenchymal markers such as vimentin and might have acquired phenotypes of mesenchymal cells , though distinct morphological epithelial mesenchymal transition ( emt ) of biliary epithelium is hardly recognizable [ 28 , 29 ] . in all forms of bile duct sclerosis , a marked attenuation of the peribiliary vascular plexus is seen within the sclerotic duct wall , but it remains unknown whether these changes are secondary to , or responsible for , the bile duct fibrosis . the balance of cell death or dropout due to apoptosis or necrosis and the regeneration of lining biliary epithelia is important for the maintenance of bile ducts , and apoptotic activity that exceeds the proliferative response of bile duct cells results in progressive ductopenia . ductopenia is defined as a loss of bile ducts from the portal tract in which hepatic arterial branches and bile ducts of similar size run parallel . thus , portal tracts without evident bile ducts indicate a loss of bile ducts . immunostaining of biliary cytokeratins such as ck7 and ck19 is helpful for the recognition of bile ducts . ductopenia is usually defined as the absence of interlobular bile ducts in at least 50% of portal tracts . ductopenia is typically found during chronic liver allograft rejection with chronic cholestasis and also the advanced stages of pbc . mucin is impacted in the duct lumen and this is occasionally marked , leading to leakage and extravasation with the formation of mucus lakes . drainage of mucin from papilla of vater is also a clinical manifestation of mucobilia , as seen in intraductal papillary mucinous neoplasms of the pancreas . mucobilia is usually found in the neoplastic bile ducts and nonneoplastic bile ducts of intraductal papillary neoplasms of the bile duct ( formerly known as biliary papillomatosis ) or mucin - producing bile duct tumors [ 26 , 30 ] . when such changes are encountered in nonneoplastic biliary diseases such as psc and hepatolithiasis , usually microscopic neoplastic biliary lesions are found in the affected bile ducts . in cases of hemobilia , impacted erythrocytes recent endoscopic or surgical biliary manipulations in association with a primary or secondary malignancy may be underlining diseases for hemobilia . to date , many pathological terms such as oval cell proliferation , intermediate cells , and atypical bile ductular proliferation have been used to describe the increased ductule - like cells or clusters of small epithelial cells different from mature hepatocytes in the portal tract or the periportal area . this is a reaction of the ductular phenotype , possibly but not necessarily of ductular origin , commonly seen in many kinds of acute and chronic hepatobiliary diseases . recently , an international working group proposed the term ductular reaction for this lesion . ductular reaction implies a reaction of ductular phenotype , possibly but not necessarily of ductular origin . the epithelial component of a ductular reaction may actually derive from several sources : not only from the proximal branches of the biliary tree but also from the circulation ( often if not always from bone marrow ) and from biliary metaplasia of hepatocytes . reaction encompasses the complex of stroma , inflammatory cells , and other structures of diverse systems , all of which participate in the reactive lesion . bile ductular reaction is usually characterized by increased numbers in the periportal and portal areas and a common and frequent process in a number of hepatobiliary diseases . there are several reports that bile ductules are very reactive anatomical elements in the liver , and proliferated bile ductules are involved in the progression of various chronic liver diseases . our recent studies showed that bile ductular cells in pbc , psc , and also nafld may undergo cellular senescence , and these cells could produce and secrete biologically active molecules and thereby be involved in hepatic fibrogenesis and other pathologic features of the liver . ductal plate malformations ( dpms ) , which are different from reactive changes of bile ducts or ductules , develop as a result of a remodeling failure of the ductal plate followed by the development of intrahepatic bile ducts . dpms are characterized by increased numbers of abnormal bile duct - like structures and show a bridge - like structure in the dilated lumen and bulbar protrusion of biliary epithelia . dpms are observed in congenital hepatic fibrosis and caroli 's disease , biliary atresia , and other fibropolycystic liver diseases . diseases that mainly target the biliary tree ( cholangiopathies ) can be divided into several categories according to the pathogenetic mechanism involved ( table 1 ) . however , in many cholangiopathies , more than one pathogenetic mechanism is operative . the biliary tree could be affected by immunological assaults , and lymphoplasmacytic infiltration is evident around the damaged bile ducts . primary biliary cirrhosis ( pbc ) and primary sclerosing cholangitis ( psc ) are representative immune - mediated cholangiopathies . there is a mixture of immunocompetent cells in the affected bile ducts , and cd3 + , cd4 + , and cd8 + t cells that bear the t - cell receptor / are predominant in pbc , supporting that th1 immune response - predominant cytotoxicity and/or cytokine release are involved in the pathogenesis of the bile duct lesions of pbc . hla - class ii antigens are aberrantly expressed in the affected bile ducts of pbc , psc , and chronic allograft rejection . biliary innate immunity is also involved in the pathogenesis of cholangiopathies in patients with pbc and biliary atresia ( ba ) . becs possess an innate immune system consisting of the toll - like receptor ( tlr ) family and recognize pathogen - associated molecular patterns ( pamps ) . in pbc , cd4-positive th17 cells characterized by the secretion of il-17 are implicated in the chronic inflammation of bile ducts , and the presence of th17 cells around bile ducts is causally associated with the biliary innate immune responses to pamps . in ba characterized by a progressive , inflammatory , and sclerosing cholangiopathy , dsrna viruses are speculated to be an etiological agent and to directly induce enhanced biliary apoptosis via the expression of tumor necrosis factor - related apoptosis - inducing ligand ( trail ) . moreover , the epithelial - mesenchymal transition ( emt ) of biliary epithelial cells is also evoked by the biliary innate immune response to dsrna . in addition , intrahepatic small bile ducts and bile ductules are a main target in graft - versus - host disease and also hepatic allograft rejection . upregulation of regulatory t cells ( tregs ) associated with th2 predominance is reportedly important in the pathogenesis of igg4-related sclerosing cholangitis . the anatomical level of the biliary tree affected is different among these immune - mediated cholangiopathies . interestingly , the peribiliary glands are also involved in psc , graft - versus - host disease , and igg4-related sclerosing cholangitis . the biliary tree is affected by several types of infectious diseases , such as bacterial , fungal , protozoan , parasitic , and viral cholangitis . stagnation of bile due to biliary stenosis or obliteration is followed by bacterial cholangitis , frequently with sepsis or abscess formation . parasitic infections are also reported in the biliary tract including the liver , and liver flukes such as clonorchis sinensis and opisthorchis viverrini are endemic in east asia , particularly northern thailand and some parts of korea , and cholangiocarcinoma is a serious complication of parasitic cholangitis . hepatolithiasis is predominantly a disease of the far east and is causally also related to infectious cholangitis , especially bacterial cholangitis [ 27 , 34 ] . mucin plays an important role in the development of hepatoliths , which are formed within the intrahepatic large bile ducts . clinically , patients may present acutely with recurrent bacterial cholangitis and its possible complications , such as liver abscesses and septicemic shock , or with chronic complications , such as cholangiocarcinomas and intraductal papillary neoplasms . pathologically , it is characterized by pigmented calcium bilirubinate stones within dilated intrahepatic bile ducts featuring chronic inflammation , mural fibrosis , and proliferation of peribiliary glands , without extrahepatic biliary obstruction . a transient viral infection such as type a rhesus rotavirus and type 3 reovirus is reported as an initiating mechanism of biliary atresia ( ba ) , particularly perinatal type . genetic alterations affecting the biliary tree manifest as biliary dilatation , bile duct paucity , obstruction , proliferation , stone formation , and so on . caroli 's disease with congenital hepatic fibrosis ( chf ) is a representative genetic cholangiopathy . caroli 's disease with chf belongs to autosomal recessive polycystic kidney disease ( arpkd ) with ductal plate malformation characterized by a disordered remodeling of the intrahepatic biliary tree . disordered cell kinetics , including the apoptosis of biliary epithelial cells ( becs ) , may be significantly related to ductal plate malformation , and laminin and type iv collagen levels were reduced in the basement membrane of intrahepatic bile ducts of arpkd ; such a reduction is an additional factor for the dilatation of bile ducts . for example , alagille syndrome with a mutation in a ligand for the notch protein is characterized by paucity of intrahepatic bile ducts and other anomalies . cystic fibrosis ( cf ) due to a mutation in the cystic fibrosis transmembrane conductance regulator ( cftr ) is associated with focal biliary fibrosis , and the bile duct and ductules are filled with pink and amorphous secretions . low phospholipid - associated cholelithiasis ( lpac ) is characterized by a low biliary phospholipid concentration with symptomatic and recurring cholelithiasis , and lpac syndrome is associated with mutations of the adenosine triphosphate - binding cassette , subfamily b , member 4 ( abcb4 ) gene encoding the hepatobiliary phospholipid translocator multidrug resistance protein 3 . this causes recurrent cholelithiasis , continuous irritations of the biliary tract with cholangitis , chronic cholestasis , and even biliary cirrhosis . ischemic cholangiopathy is defined as focal or extensive damage to bile ducts due to an impaired blood supply . most causes of bile duct ischemia are iatrogenic , though some systemic vascular diseases also cause this type of cholangiopathy . this entity may be observed in various circumstances and is of clinical importance for practitioners involved in gastroenterology , oncology , abdominal surgery , and liver transplantation . ischemic bile duct injury may occur when small hepatic arteries or the peribiliary vascular plexus are injured or when all possible sources of arterial blood supply are interrupted . ischemic biliary injury may take the form of bile duct necrosis , bile leakage , biloma , bile duct fibrosis , or stenosis . bile duct necrosis and bilomas develop predominantly where there is an abrupt and complete interruption of the arterial blood supply , for example , when ha thrombose in a liver transplant recipient . on the contrary , fibrous stenoses develop where there is progressive injury to the hepatic arterioles , for example , after several courses of intra - arterial chemotherapy . when biliary drainage or reconstruction is not possible or has failed , liver transplantation is the only potential cure . bile ducts , particularly interlobular bile ducts , are occasionally affected by drug - induced hepatobiliary damage , various bile duct injuries , various types of cholangitis , and bile duct loss ( drug - induced cholangiopathy ) . this type of cholangitis is not infrequently associated with cholestasis . some cases presenting with progressive ductopenia and cholangitis and prolonged cholestasis mimic pbc and also psc . while the mechanism of drug - induced cholangitis remains speculative , immune - mediated processes including hypersensitivity may be operative . some forms of drug - induced cholangiopathy develop after hepatic arterial infusion of floxuridine ( fudr ) ( floxuridine- ( fudr- ) induced cholangiopathy ) . ischemic changes to the peribiliary vascular plexus may be at least partly involved in this type of cholangiopathy . although becs have low metabolic activity compared with hepatocytes , cytotoxic or cytopathic bile duct injury has been produced experimentally or accidentally by toxic substances such as -naphthylisothiocyanate , 4,4-diaminodiphenylmethane , and paraquat ( toxin - induced cholangiopathy ) . in conclusion , the anatomy and physiology of the biliary tree , basic injuries to biliary epithelial cells , basic forms of bile duct damage , and etiological classification of cholangiopathy were reviewed .

the biliary tree consists of intrahepatic and extrahepatic bile ducts and is lined by biliary epithelial cells ( or cholangiocytes ) . there are also peribiliary glands around the intrahepatic large bile ducts and extrahepatic bile ducts . the biliary tree is a conduit of bile secreted by hepatocytes and biliary epithelial cells and also of the peribiliary glands and has several physiological roles . a number of diseases affect mainly the intrahepatic and extrahepatic biliary tree , and , in this special issue , these cholangiopathies are reviewed in detail with respect to genetics , pathogenesis , and pathology . in this paper , the anatomy and physiology of the biliary tree , basic injuries to biliary epithelial cells from stress and bile duct damage , and representative cholangiopathies are briefly reviewed .

the institutional review board approved this case report prior to any review of medical records . an 80-year - old man was transferred to our institute because of an incidentally detected renal tumor . the patient underwent a right partial nephrectomy due to a previously diagnosed rcc eight years prior . recent routine follow - up ct images , which covered the lung and abdomen , revealed a right renal mass , a right adrenal mass , and three pulmonary nodules ; all of which were not seen on prior ct images ( figs . 1a - c ) . the right renal tumor and adrenal tumor had maximum diameters measuring 2.0 cm and 1.8 cm , respectively . in addition , the pulmonary nodules , with maximum diameters ranging from 8 to 10 mm , were seen in the right upper lobe , left upper lobe , and left lower lobe . the treatment modality decided upon was an rf ablation for the cytoreductive removal of the right renal tumor . however , the histological results were not confirmed before the ablation as these lesions were clinically considered to be recurrent or as metastatic lesions from the previously removed rcc . an internally - cooled rf system ( radionics , burlington , ma ) was used for the ablation of the right renal tumor , along with an electrode ( cool - tip , valleylab , boulder , co ) that was kept below 20 by means of chilled water supplied by a peristaltic pump . we selected an rf electrode with a 2 cm active tip , which corresponded to the size of the right renal tumor . the electrode was appropriately targeted in the center of the renal tumor under ultrasound ( us ) guidance and performed two cycles of rf ablation . for the first ablation cycle , for the second rf cycle , reduced electrical power ( 80 w ) was delivered for 3 minutes due to severe pain . for pain relief , a total of 50 mg of penthidine hci ( hana pharmacy corporation , hwasung , korea ) was intravenously infused during the rf ablation . a post - ablation ct performed 10 months after the ablation showed a lack of tumor enhancement within the right renal tumor ( fig . the size of the recurrent renal tumor decreased to a maximum diameter of 1.4 cm . all of the metastatic pulmonary nodules became too small to be measured on ct images ( fig . in addition , the right adrenal tumor decreased in size to a maximum diameter of 1.4 cm ( fig . chemotherapy and immunotherapy was not performed due to the poor general condition and old age of the patient . spontaneous tumor regression has been reported to occur for some types of malignant tumors , although the incidence is rare . this phenomenon may be defined when the tumors partially decrease or totally disappear without any treatment . an rcc can be a spontaneously regressing tumor and is in fact known to develop in less than 1% of rcc cases ( 1 - 5 ) . spontaneous regression of metastatic lesions from an rcc have occurred frequently following a nephrectomy , radiotherapy , or embolization ( 1 - 4 , 6 ) . as with our case , metastatic pulmonary lesions were reported to spontaneously regress following an rf ablation of a tumor ( 7 ) . these cytoreductive treatments seemed to play a major role in the spontaneous regression ; however , the role of nephrectomy accounted for only less than 50% of all reported cases with spontaneous regression ( 4 ) . immunological responses to an rcc are also quite controversial , but the use of interferon to strengthen the hosts immunity , which may ultimately improve the survival of patients with advanced stage rcc should be performed ( 8) . in general , here has been a consensus that an rf ablation can be used in treating patients with a localized rcc , which is difficult to remove surgically . recently , this treatment modality has been considered as a good alternative treatment option because of its minimally invasive nature and excellent clinical outcome . for this reason , an rf ablation might be as beneficial as a nephrectomy at inducing the spontaneous regression of rcc , although their mechanisms are unknown . both the rf ablation and a nephrectomy may be involved in stimulating the host 's immune system as if these treatments naturally kill the cells of rcc as with the use of immnunotherapy using interferon . a literature search revealed that our case was found to be the second case report on the spontaneous regression of pulmonary metastases following an rf ablation of the recurrent rcc ( 7 ) . however , we could not find any cases with spontaneous regression of adrenal metastasis from the rcc following ablation . the rf ablation might be recommended as a good alternative treatment when a cytoreductive nephrectomy is required in patients with metastatic lesions , but are in poor general physical condition . in conclusion , spontaneous regression of metastatic lesions from an rcc is extremely rare , but can result following the rf ablation of the tumor .

the spontaneous regression of metastatic lesions from renal cell carcinoma ( rcc ) is extremely rare , but may be encountered following cytoreductive treatments . we report a case of a recurrent rcc with multiple metastatic lesions which spontaneously regressed after undergoing radiofrequency ablation of the renal tumor .

mllerian anomalies are congenital defects of the female reproductive tract resulting from failure in the development of the mllerian ducts and their associated structures symptoms appear principally during adolescence or early adulthood , and affect the reproductive capacity of these women . when clinically suspected , investigations leading to diagnosis include imaging methods such as hysterosalpingography , ultrasonography , magnetic resonance imaging , and cystoscopy . a 25-year - old nulliparous lady , presented to the gynecology opd with complaints of inability to conceive . she was married for 7 years , cohabiting since 5 years . at 16 years of age , she consulted a local doctor in her village for primary amenorrhea and cyclical pain in abdomen , where some operative procedure was done . since then the patient has passage of blood mixed urine periodically every month for 2 to 3 days with suprapubic abdominal pain . external urethral meatus appeared dilated , and there was blindly ending vagina approximately 3 cm in length . on per rectum examination , uterus appeared normal in size and there was no bulge felt below it to suggest any collection . on investigations , the ultrasound showed normal uterus with endometrial thickness 9.5 mm , ovaries were normal , and bilateral kidneys were also normal . mri of abdomen showed normal uterine body and cervix with small amount of fluid in endometrial cavity , endocervical cavity , and in upper part of vagina ; below that there was a transverse vaginal septum of about 3.5 cm in thickness . [ figure 1 ] on cystoscopy , a fistulous opening of approximately 2 mm was seen below the internal sphincter of urethra through which menstrual blood was seen coming out ; the bladder and ureteric orifices were normal . vaginoplasty and repair of fistulous communication between the genital tract and the urethra was planned for the patient . the mri shows uterus with cervix and upper 2 cm of vagina containing some blood products . there is a septum between the upper and lower part of vagina ( the lower part identified by tampon in vaginal canal ) the woman was subjected to operation using abdominoperineal approach . on laparotomy , uterus was normal in size , bilateral tubes were present , and ovaries were normal . the methylene blue dye was injected into the fundus of the uterus ; dye was visualized coming out of urethra by the side of the indwelling catheter . from the perineal approach , a transverse incision was made through the vault of the short vagina , the dissection was done upward in the connective tissue between the bladder above and rectum below and vaginal space was created . after sharp and blunt dissection , cervix was visualized as dye was coming through it . the urethrovaginal fistulous tract was identified and repair was done in two layers . over the raw area of vagina , the mould change was done after a week ; the amnion graft had successfully taken up . the patient was found to be fine at follow - up after a month , with no hematuria and normal menstruation . she was explained about the fertility period and asked to come at 3 monthly follow - up . when a mullerian duct becomes obstructed , the patient may present with an abdominal mass and dysmenorrhea . if the patient is not treated in a timely fashion , the consequences can be severe , extending even to infertility . in this case , there was transverse vaginal septum in the upper part of vagina leading to hematocolpus and amenorrhea . an iatrogenic fistulous tract was probably created which led to cyclical hematuria . magnetic resonance imaging ( mri ) is the mainstay in imaging for the evaluation of mullerian agenesis and is considered a very useful diagnostic tool . in our case , mri determined the precise mullarian anomaly giving us the details regarding the presence of normal cervix with precise length of vaginal septum to help us judge the prognosis and success of the operative procedure , but we got no information about the fistulous communication as it was quite fine and narrow . the site of the opening of fistulous tract in the urethra was apparent on cystoscopy and led to the assumption that the other end tract opened in the vagina . therefore , apart from mri , cystoscopy played a major role in determining the anomaly in this case . upon literature review of cases with genitourinary fistula the fistula in that case , however , was congenital , unlike our case in which it was iatrogenic in all probability . it also presented with cyclical hematuria with no incontinence of urine due to imperforate hymen . congenital vesicouterine , cervicovesical , and vesicovaginal fistula associated with other mullarian anomalies has also been reported in literature.[46 ] iatrogenic fistulous communication between the genital tract and the urinary tract , known to occur as a complication of cesarean section , has been described in literature as youssef 's syndrome . it is characterized by cyclical hematuria , absence of vaginal bleeding , and complete urinary continence . in all these reports in which there was a fistulous communication between the urinary and the genital tract , cystoscopy , hysterosalpingography , and dye test were required for confirmatory diagnosis and only computerized tomography ( ct ) or mri did not give the full clinical picture . this report highlights the diagnostic and therapeutic challenge faced by the clinician in dealing with a fistulous genital and urinary tract communication with obstructing transverse vaginal septum . increasing awareness of this rare entity calls for more meticulous evaluation before any surgical intervention in patients with complex genitourinary anomalies .

we present a case of iatrogenic urethrovaginal fistula with transverse vaginal septum . the patient presented with cyclical hematuria and infertility . the vagina was blind - ending . the magnetic resonance imaging ( mri ) showed normal uterus with transverse vaginal septum . the cystoscopic examination during cyclical hematuria revealed bloody efflux through a small fistula below the internal urethral sphincter . vaginoplasty and repair of the urethrovaginal fistula was done . the vagina was reconstructed using an amniotic mould . the report emphasizes the importance of mri and cystoscopy in diagnosing such rare and complex anomalies .

hepatocellular carcinoma ( hcc ) is one of the most common malignancies in the world ( 700 , 000 deaths / year ) and its incidence is increasing . therapeutic options available include liver transplantation , surgical resection and local ablative therapies , but the prognosis of hcc remains poor due to high tumor recurrence rates . thus , new strategies are needed and immunotherapy based on stimulation of the antitumor immune response is a promising approach . . secreted afp , synthesized in the yolk sac , the fetal liver , and the gastrointestinal tract , is the main serum protein during the fetal development . however , afp is reexpressed in 50 to 80% of hcc , whereas its expression is low or absent in normal adult liver . several vaccination strategies based on afp as a taa have been investigated for hcc immunotherapy . briefly , afp can be presented as an antigen by human and murine dc and persisting t cd8 memory clones present in the human and the murine repertories can recognize some peptide epitopes derived from afp [ 58 ] . in murine models , murine afp can function as a tumor rejection antigen in melanoma models and afp - specific vaccination can significantly impair the growth of an autochthonous hepatocellular carcinoma . in the two conducted clinical trials , afp - specific ctl have been detected in blood after afp peptides administration but , however , it has not been correlated to an objective clinical response [ 7 , 8 ] . this could be due to the fact that onco - fetal antigens , including afp , are self - tolerated molecules and that the tumor immune evasion mechanisms have to be successfully controlled to trigger an efficient antitumor response . vaccination with altered forms of the antigen or with the xenogeneic protein is a possible strategy to overcome the tolerance to antigens [ 1113 ] . it has been successfully used to raise immune response against various antigens [ 15 , 16 ] . compared to immunotherapy strategies with monoclonal antibodies or with immunodominant peptides , vaccination with mva encoding a tumor antigen presents the advantage of raising an immune response against the whole antigen . in the context of a mva vaccination , the primary induction of the ctl response depends mostly on cross - presentation suggesting that the expression of a full - length antigen localized subcellularly should be considered during the mva vector design . in the present study , we compare the immune response elicited by the vaccination with a recombinant mva vector encoding the afp antigen either in its native secreted form or in modified membrane - associated or intracellular forms . primary chicken embryo fibroblasts ( cef ) were used for homologous recombination and amplification of recombinant vectors . cef were prepared from chicken embryos obtained from fertilized eggs ( lohmann , france ) previously incubated 11 days at 37c in a humid atmosphere . embryos were dissected and treated with a triple select solution ( invitrogen ) ( w / v ) . cef cells were maintained in eagle - based medium supplemented with 5% fetal bovine serum . the mva shuttle plasmid contains a multiple - cloning site under the control of the ph5r early - late vaccinia virus promoter surrounded by the flanking sequences of the deletion iii of the mva allowing homologous recombination and a selection gene , the e. coli xanthine - guanine phosphoribosyl - transferase gene ( gpt gene ) under the control of the p11k7.5 promoter . full - length cdna encoding the secreted form of murine afp ( s - mafp ) was obtained by pcr ( primers f5-ggccgcgctagccgccaccatgaagtggatcacacccgcttc-3 ; r5-gcagtcagggcccctgcactcagtaatacataaacgcccaaagcatcacgagttttg-3 ) and digestion with nhei and noti enzymes ( new england biolabs ) on pcineomafp . the intracellular afp sequence ( i - mafp ) was obtained by deleting the exporting signal ( nucleotides 1 to 54 ) by pcr ( primers f5-ggccgcgctagccgccaccatgaaagcattgcacgaaaatgagtt-3 ; r5-gagccacatccagggccagcttc-3 ) and enzyme digestion . the transmembrane afp ( t - mafp ) sequence was obtained by successive pcr and fusion between the s - mafp sequence and a rabies transmembrane domain , kindly provided by dr . the resulting sequences , verified by sequencing , are described in figure 1(a ) and were cloned into the corresponding sites of the mva shuttle plasmid . briefly , cef cells were infected with a mva without any inserted transgene ( mva - null ) and then transfected with the different shuttle plasmids by cacl2 precipitation . homologous recombination occurred and recombinant mva viruses are isolated by multiple steps of mycophenolic acid selection . final recombinant mva viruses were controlled by pcr , amplified in cef , and virus stocks were titrated on cef by plaque assay . cef cells were infected with each mva vector at a multiplicity of infection ( moi ) of 0.2 and incubated for 48 h. cell lysate proteins were run on a 10% sds - page gel under reducing conditions and transferred onto a nitrocellulose membrane . the membrane was incubated with a polyclonal goat anti - afp ( c-19 ) antibody ( santa cruz ) at a 1 : 1000 dilution or with a rabbit anti - rabies transmembrane domain at a 1 : 2000 dilution . the membrane was then washed and incubated with a secondary antibody coupled with horseradish peroxidase ( ge healthcare ) . c3h / hen ( c3h ) male mice ( 8 weeks ) were purchased from janvier laboratory ( france ) and were bred in the nantes ifr 26 animal facility . all experiments procedures involving animals were conducted according to the guidelines of the french agriculture ministry and were approved by the local ethical committee . mice were immunized three times subcutaneously ( s.c . ) into the flank with 5 10 pfu of mva vectors at 7-day intervals . mice subjected to regulatory t cells depletion were injected intraperitoneally ( i.p . ) 1 day prior the vaccination course with 400 g of anti - cd25 antibody ( pc61 ) purchased from bioxcell ( new hampshire , usa ) . cd8 t cells were isolated from spleen cells with mouse cd8a ( ly-2 ) microbeads and ms columns ( miltenyi biotec ) . specific t - cell response was monitored on cd8 t cells with ifn elispot kit ( diaclone ) , according to the manufacturer 's protocol . cells , plated at a concentration of 5 10 cells per well , were stimulated with 20 m of a mafp - specific cd8 restricted peptide ( nefgiastl ) described earlier , with medium alone or with mva - null at moi 10 for 24 h. ifn-secreting cells were counted on an aid elispot reader 9 ( autoimmun diagnostika ) . results are presented as the number of ifn-secreting cells per million of cd8 t cells after subtraction of nonspecific signal obtained with medium alone . blood samples were collected on days 0 , 7 , 14 , and 21 during the vaccination course . plasma was separated by centrifugation from blood collected . a fusion protein consisting of the native murine afp and a v5 tag afp open reading frame was inserted in frame with a sequence encoding the v5 epitope in the pcdna3.1/v5-his vector ( invitrogen ) . 293 cells were transfected with the resulting plasmid with lipofectamine ( invitrogen ) and the afp - v5 fusion protein was secreted in the culture supernatant . 96-well plates were coated overnight at 4c with a goat anti - v5 tag antibody ( abcam , uk ) at 1 g / ml diluted in bicarbonate coating buffer . following blocking with pbs - tween - milk ( 5% ) ( ptm ) , plates were incubated overnight at 4c with 100 l of supernatant containing the afp - v5 fusion protein . wells were then washed three times in ptm and incubated overnight at 4c with primary mouse sera diluted serially in ptm . wells were then washed three times in ptm and incubated with a goat anti - mouse igg hrp secondary antibody ( dako ) for 2 h at room temperature . following washings in ptm , wells were incubated with an abts substrate ( roche diagnostics , germany ) . statistical analyses were performed using the non - parametric kruskal - wallis or mann - whitney tests and graphpad prism software . a p value < 0.05 was considered to be statistically significant . the sequences corresponding to the secreted ( s mafp ) , intracellular ( i mafp ) , and transmembrane ( t mafp ) forms of the murine afp protein were introduced in the deletion iii of the mva genome under the control of the early - late promoter ph5r . the recombinants mva produced are presented in figure 1(a ) . specific signals corresponding to the intracellular and to the secreted mafp proteins in cellular extracts isolated from cep cells infected either by mva - i mafp ( figure 1(b ) , lane 1 ) or by mva - s mafp ( figure 1(b ) , lane 2 ) were detecting using a polyclonal antibody directed against the c - terminal part of the afp protein . the respective sizes of these two proteins are in line with the expected size of the native mafp protein and with the molecular modifications achieved . as the antibody previously used was directed against the c - terminal part of the protein where the fusion was made , the expression of the transmembrane form was confirmed by western blot using an antibody directed against the transmembrane rabies domain . a specific protein band was detected at a higher size compared to the native protein in agreement to the fusion with the supplementary domain ( figure 1(c ) , lane 1 ) . mice ( n = 4 ) were vaccinated with the different recombinants mva by three subcutaneous injections one week apart ( figure 2(b ) ) . one week after the last immunization , the specific cd8 t - cell response was measured in an interferon gamma elispot assay , with the h-2 afp peptide nefgiastl , as described previously . as shown in figure 2(b ) and as expected , no specific response was detected in mice vaccinated with the parental vector mva - null . surprisingly , no significant increase in the number of spots was observed in mice vaccinated either with mva - s mafp or with mva - i mafp . in contrast , mva - t mafp - vaccinated mice displayed a significantly higher number of ifn--producing cells compared to mice vaccinated with the other mva vectors . thus , in the context of afp vaccination by an mva vector , the transmembrane form elicits a higher cd8 t - cell immune response in c3h / hen - vaccinated mice . populations of regulatory t cells could impair the immune response against a self - antigen such as afp . to address this possibility , groups of mice were vaccinated with the mva - t mafp vector , with or without an injection of 400 g of pc61 anti - cd25 monoclonal antibody the day before the first vaccination ( figure 3(a ) ) . at sacrifice , cd4 cd25 t - cell depletion was verified by facs analysis ( data not shown ) and the cd8 t - cell response was compared in splenocytes prepared from the two groups by ifng elispot assay . a single injection of anti - cd25 antibody did not enhance significantly the afp - specific cd8 t - cell immune response ( figure 3(b ) ) . in contrast , the t reg depletion has an impact on the immune response against the vector ( figure 3(c ) ) . in fact , the antibody injection resulted in a significantly higher number of ifn--producing cd8 t cells after mva restimulation confirming that the depletion did occur . to monitor the afp - specific humoral response elicited by the vaccinations with the mva recombinant vectors , mice ( n = 3 ) were vaccinated either with the mva afp viruses or with the mva - null , by three injections one week apart and sacrificed one week after . the serological response was assessed by elisa as described in the material and methods section . the presence at sacrifice of circulating antibodies directed against the afp protein was analyzed in mice vaccinated with the four different mvas ( figure 4(b ) ) . no afp - specific antibody could be detected in the sera of mice vaccinated with mva - null , or mva - s mafp or mva - i mafp , even at the minimal dilution ( 1 : 50 ) . in contrast , vaccination with mva - t mafp elicited a significantly stronger specific antibody response . the time course of afp - specific antibody titer was assessed during the vaccination protocol ( figure 4(c ) ) . repeated immunizations ( at day 0 , day 7 , and day 14 ) with mva - t mafp led to the production of afp - specific antibodies which was maximal by day 14 and remained stable at day 21 . tolerance to tumor - associated antigen is profound , therefore strenuous immune modulation is required to overcome it and achieve meaningful response . in this paper , we assessed the ability of mva to induce an immune response against the self - antigen -fetoprotein ( afp ) , and we compared the immunogenicity of different forms of this antigen after vaccination in nave mice . three vaccines were generated to encode recombinant afp that was either secreted or membrane - bound or cytosolic . comparable strategies targeting antigen to specific subcellular compartments have been shown to efficiently modulate the specific immune response elicited . the correct expression of the recombinant afp forms by the mva vectors was first confirmed . the vaccination protocol consisted in three subcutaneous injections one week apart and one week later , both the cellular - specific cd8 t - cell response and the humoral response were monitored . expression of a cytosolic form of afp failed to raise a strong immune response as what has been shown for a soluble cytosolic fragment of the her-2 protein which is promptly degraded by the proteasome . vaccination with the transmembrane form of afp induced a stronger cd8 t - cell response compared to the ones obtained with the mva encoding the secreted and the intracellular forms of afp . since the number of specific spots was limited , we evaluated the effect of a t reg depletion on the immune response obtained and we concluded that the afp - specific cd8 response was not modulated by the cd25 t cell population during a mva - t mafp vaccination protocol . finally , the vaccination with the transmembrane form of the antigen leads to the production of antibodies directed against afp . previously , vaccination with an mva encoding a modified membrane - associated form of the epithelial tumor antigen h23 , aberrantly expressed in breast cancer , has been shown to allow the production of elevated levels of specific antibodies in vaccinated animals [ 23 , 24 ] . the difficulty to raise a significant immune response against afp compared to other taa could be due to the fact that this self - antigen is produced by the liver , which is known to constitute a specific tolerogenic environment . in conclusion , we demonstrate that the secreted and the intracellular afp antigens expressed from mva are less effective immunogens than their transmembrane counterpart . vaccination with a membrane - bound form of a self - antigen , combined with other strategies , involving stimulation with cytokines ( il2 , il12 , gm - csf ) [ 26 , 27 ] could represent a promising strategy to enhance immunogenicity in the context of mva vaccination .

aim . to investigate the ability of recombinant modified vaccinia virus ankara ( rmva ) vector to induce an immune response against a well - tolerated self - antigen . methods . rmva vectors expressing different form of -fetoprotein ( afp ) were produced and characterized . nave mice were vaccinated with mva vectors expressing the afp antigen in either a secreted , or a membrane - bound , or an intracellular form . the immune response was monitored by an ifn elispot assay and antibody detection . results . vaccination with the membrane - associated form of afp induced a stronger cd8 + t - cell response compared to the ones obtained with the mva encoding the secreted or the intracellular forms of afp . moreover , the vaccination with the membrane - bound afp elicited the production of afp - specific antibodies . conclusions . the afp transmembrane form is more immunogenic . expressing a membrane - bound form in the context of an mva vaccination could enhance the immunogenicity of a self - antigen .

malignant tumors which originated from mesenchymal tissue , has occurred very rarely in the breast . the metaplastic carcinomas which have characterized by a combination of mesenchymal and epithelial components would be uncommon malignancies of the breast . the chondrosarcoma has been a typical example of these rarest tumors of the mesenchymal tissue . a 65 years old man has presented in our department with a complaint of a right sided breast mass which has rapidly grown for 5 months . breast palpation has revealed a painless , less mobile , and firm to hard mass of 1010 cm with regular margins in area of right breast . contrast enhanced mri ( figures 1a and b ) of breasts has revealed huge mixed signal intensity multi lobulated cystic - solid extra - pulmonary mass lesion involving the right anterior chest wall extending from infra clavicular region to the level of xiphisternum measuring 10.4 cm ( si ) 10.3 cm ( ap ) 9.9 cm ( trans ) appearing predominantly hyper intense on t2w and hypo intense on t1w . heterogeneous predominantly peripheral solid tumoral enhancement has observed with multiple large loculated central areas of necrosis and intensely enhancing septae . histopathology has revealed the overall appearances of low - grade chondrosarcoma with a tumor composed of lobules of cartilage of varying size separated by fibrous tissue . immunohistochemical studies have performed by standard revealed that chondrosarcomatous elements were positive for s-100 and vimentin , but negative for cytokeratin and also for estrogen and progesterone receptors . this paper has discussed one of the rarest mesenchymal malignancies of the breast , primary chondrosarcoma . as a primary breast tumor , chondrosarcoma might occur in three different forms : as a pure neoplasm ( pure chondrosarcoma ) , as the stromal component of a histologically malignant phyllodes tumor , or as chondrosarcomatous differentiation in a metaplastic carcinoma . in this report prognosis of chondrosarcomatous breast tumors has not fully known , because many of the reported cases were difficult to analyze ( owing to lack of detailed clinical or morphologic information ) . these tumors were usually large - sized that have occurred in more than 40 year old woman . axillary lymph nodes have found in 14 - 29% of the cases , most of which were reactive hyperplasia . the present case substantiates the clinical findings of previously reported cases . to diagnose a primary chondrosarcoma of the breast , other types of pure sarcoma , such as spindle cell sarcoma , neuroectodermal tumor , angiosarcoma etc , have also been reported [ 6 , 7 ] . the history of the patient had an important feature as the mass had grown rapidly without systemic and deleterious effect on the patient s health status . these tumors have tended to grow rapidly and present themselves as a mass for a short duration [ 2 , 3 , 7 ] . a large multilobular mass with regular margins and without a sign of regional invasion has detected by palpation . previous reports have also pointed out that these large tumors have not generally invaded skin and regional lymph nodes despite their locally advanced nature [ 2 - 4 , 7 ] . a relatively circumscribed , well demarcated mass , as in our patient , was an imaging characteristic of a pure mesenchymal or a metaplastic carcinoma with sarcomatoid differentiation . it has been redported that imaging studies seldom led to the diagnosis of sarcoma in a suspected benign lesion . the mass was complex echoic on ultrasound and has shown round hyperdense opacity on mammography [ 4 , 7 , 8 ] . the very limited number of such cases has not permitted us to establish an appropriate therapeutic approach . chondrosarcoma in common locations has generally known as refractory to all types of conventional chemotherapy and radiotherapy . pure chondrosarcoma and metaplastic cancer of the breast has rarely invaded axillary lymph nodes and would be generally hormone receptor - negative [ 1 , 2 , 4 , 11 ] . this extremely rare tumor has tended to grow rapidly , and it was usually large at first physical examination . a large , hyper dense and complex echoic mass with regular margins has given the impression of a benign tumor on mammography and ultrasound . despite its large size , it has not invaded local and regional structures . regarding systemic management , there was no standard treatment protocol , and a large variety of chemotherapy protocols have been employed in treating this disease . systemic therapy principles have been derived from small retrospective case reviews of primary breast chondrosarcomas and extrapolated from studies of non - breast chondrosarcomas , since the clinical behavior and histology were similar . this fact has been supported the theory that adjuvant therapy with estrogen antagonists and other hormone manipulations had no role in treatment of mammary sarcomas . the adjuvant treatment could decrease the rates of local and systematic recurrences , but the results were not significant because of the rarity of this pathological entity and the small numbers of cases have reported , which made the evaluation of the role of the chemotherapy and the radiotherapy in the primary breast chondrosarcoma more difficult . it has seemed to be very important to identify the mammary primary sarcomas as entity separated from the carcinomas of the breast . the primitive chondrosarcoma has remained a rare pathology , among which the therapeutic modalities and the forecast were credibly identical to those of the sarcomas of the same type arising in the other localizations . it has seemed to be very important to identify the mammary primary sarcomas as entity separated from the carcinomas of the breast . the primitive chondrosarcoma has remained a rare pathology , among which the therapeutic modalities and the forecast were credibly identical to those of the sarcomas of the same type arising in the other localizations .

breast sarcomas have relatively been rare and accounted for 1% of all primary malignant tumors of the breast . pure and primary chondrosarcoma of the male breast would be an extremely rare tumor . it might arise either from the breast stroma itself , or from underlying bone or cartilage . a 65-year - old man has presented with a rapidly growing breast mass since 5 months . physical examination has established a large firm to hard mass with regular margins in the region of right breast . there was no axillary lymphadenopathy . contrast enhanced mri of breasts has shown a mixed - signal intensity multi lobulated cystic - solid mass ( 10.4 cm 10.3 cm 9.9 cm ) appearing predominantly hyper intense on t2w and hypo intense on t1w . the tumor has diagnosed as a low - grade chondrosarcoma of the breast by histopathological and immunohistochemistry analysis . right sided radical mastectomy with grafting has done . it has seemed to be very important to identify the mammary primary sarcomas as entity separated from the carcinomas of the breast .

a 26-year - old female patient was transferred to the samsung medical center from an outside institution due to severe refractory cardiogenic shock . the patient was diagnosed with non - hodgkin s lymphoma 2 years prior and underwent 6 cycles of chemotherapy , which included doxorubicin . after chemotherapy treatments were completed , the patient suffered from orthopnea and dyspnea , and an echocardiography revealed a severely depressed left ventricular ( lv ) ejection fraction ( 25% ) and dilated lv . due to complications from cancer treatments , she had an episode of acute decompensated heart failure and was referred to samsung medical center . on initial presentation , vital signs included arterial blood pressure of 79/27 mmhg , heart rate of 133 beats / min , respiratory rate of 28 breaths / min , and body temperature of 35.9c . she had pulmonary edema with bilateral pulmonary congestion ( fig . 1 ) and multiorgan failure with liver and kidney involvement . despite the use of inotropes and vasopressors , we were unable to achieve stable vital signs . percutaneous extracorporeal life support ( p - ecls ) was then placed using the left femoral artery and vein . however , the left leg became ischemic after several hours , and we decided to shift the cannulas to the right groin . the patient was brought to a hybrid operating room , and the groin was opened bilaterally . then , the arterial and venous cannulas were inserted through the common femoral artery and vein , and the catheter for the superficial femoral artery was inserted at the same time . the following day , transthoracic echocardiography revealed a distended left ventricle , and the chest x - ray showed worsening pulmonary edema . in this case , we determined that an atrial septostomy was not a viable option since both the femoral veins were already cannulated or had been surgically repaired . instead , we performed an emergency standard median sternotomy and inserted a vent catheter ( malleable 20 fr . ) with a tip - cut into the right upper pulmonary vein and passed it into the left ventricle . then , the inserted vent catheter was connected to the venous line of the p - ecls circuit via a y - shaped connector ( fig . , the pump flow was maintained at 2.4 l / min / m , obtaining a mean systemic pressure of 60 mmhg and central venous pressure of 8 mmhg . the flow through the vent catheter was measured to be 1 to 2 l / min . the patient was on p - ecls and left heart venting for 5 days . during this time , 3 ) . transthoracic echocardiography revealed improved right and lv function and decreased chamber size . when the function of the right heart and the lung improved , the drainage from the femoral vein was gradually reduced by progressively clamping the venous line and lowering the r.p.m . in this way , the system was modified from p - ecls to paracorporeal lv assist device ( lvad ) by the complete clamping of the femoral venous drainage catheter . thus , the femoral venous cannula and the oxygenator were removed on postoperative day 5 . the reasons for our decision were complete lv support , possible longer - term support due to the absence of the oxygenator and the low level of anticoagulation , and the prevention of recurrent lv distension . on postoperative day 8 , we were able to wean the patient from lvad and remove all cannulas from her chest and groin . she was extubated and was finally discharged home on hospital day 28 . during follow - up , the lv ejection fraction worsened from 40% to 20% , and the symptoms of dyspnea became worse than before hospital discharge . currently , this patient is on the heart transplant list and is waiting for transplantation . however , due to its inability to directly drain the left heart , its effectiveness in assisting the heart is limited . additionally , several factors including severely reduced lv function , blood from native pulmonary and bronchial circulation , and increased afterload due to retrograde perfusion from the arterial cannula may lead to lv distension . this resultant lv distension can cause pulmonary edema , pulmonary hemorrhage , and myocardial ischemia . although paracorporeal lvad placed through a median sternotomy provide better hemodynamic support without the risk of lv distension , complications of central cannulation such as bleeding and infection limit the widespread use of this technique . we report a case in which trans - sternal lv drainage was utilized while the patient was receiving p - ecls that was followed by a subsequent switch to paracorporeal lvad without further surgery . this strategy allowed the transformation of peripheral circulatory support into effective myocardial and systemic circulatory assistance and minimized the surgical risk . although p - ecls offers excellent support to the blood circulation , its effect on the heart is less favorable . the left atrium can receive blood from the right heart and bronchial circulation . in the case of severe lv dysfunction , the lv can not eject the received blood to overcome the increased afterload due to the retrograde p - ecls flow . the consequences of lv distension include pulmonary edema , pulmonary hemorrhage , right ventricular distension , and increased intraventricular pressure , which can lead to myocardial hypoperfusion and ischemia . the effect of p - ecls on lv distension was investigated previously by some authors . in an animal model of acute heart failure , kawashima et al . reported that the resolution of ventricular fibrillation was related to lv unloading and reduction in myocardial oxygen consumption . myocardial perfusion is proportional to the decrease in the lv wall tension and the compression of intra - myocardial coronary vessels . therefore , lv decompression favorably affects ventricular recovery and increases the possibility of weaning from p - ecls . for this reason , a careful evaluation of the status of the lv and prompt drainage in the case of a pressure increase there are several techniques to decompress the lv , including a percutaneous trans - septal left atrial approach , lv venting through the right upper pulmonary vein , and direct lv apex cannulation . although percutaneous lv venting does not require a surgical incision , the effectiveness of lv decompression can be limited according to the degree of mitral regurgitation . thus , surgical venting is a more favorable option than percutaneous septostomy . reported minimally invasive lv drainage in which an apical cannula is inserted into the lv apex transcutaneously . although direct drainage of the lv through a trans - sternal approach is technically more complex , it has the advantage of high efficacy with respect to the intraventricular dynamics . further , our group was more familiar with the trans - sternal approach at that time . management after an lv venting procedure is still controversial , particularly since there is uncertainty in terms of patient stability after weaning from p - ecls . there are three ways of weaning from venoarterial ecls , namely the one - stage removal of all ecls cannulae , vent catheter removal and subsequent venoarterial ecls weaning , and venous cannula removal and subsequent paracorporeal lvad weaning . in this case , we decided to shift to paracorporeal lvad from p - ecls by progressively clamping the venous line and lowering the flow to the oxygenator until complete exclusion from the circuit . this allows for a heparin- and oxygenator - free trial of extracorporeal circulation , which reduces the chances of bleeding or thromboembolism . the low risk of bleeding and thromboembolism allows longer - term support for heart transplant than venoarterial ecls . the other advantages of our strategy include prevention of recurrent lv distension and pulmonary edema . in summary , p - ecls offers excellent circulatory support in emergency settings and assures rapid and systemic perfusion . however , p - ecls can negatively affect lv physiology and can potentially jeopardize myocardial recovery . thus , a careful evaluation of the lv status and prompt drainage in the case of pressure increases should be considered . our strategy assures complete lv venting and allows for a simple conversion of p - ecls to paracorporeal lvad .

percutaneous extracorporeal life support ( p - ecls ) is a useful modality for the management of refractory cardiac or pulmonary failure . however , venoarterial p - ecls may result in a complication of left ventricular distension . in this case report , we discuss a patient with drug - induced dilated cardiomyopathy managed with venoarterial p - ecls and a left atrial vent catheter . the venoarterial p - ecls was modified to a paracorporeal left ventricular assist device ( lvad ) by removing the femoral venous cannula . after 28 days of hospitalization , the patient was successfully weaned from the paracorporeal lvad and discharged home from the hospital .

minimal change nephropathy ( mcn ) accounts for 25% of adults presenting with a nephrotic syndrome . although most patients respond to corticosteroid therapy , a significant number relapse frequently and may present a real therapeutic difficulty . we present a case of apparently refractory relapsing mcn that was successfully treated with a combination of sirolimus and cyclosporin . in 1989 , a 35-year - old female presented acutely with heavy proteinuria ( 22 g/24 h ) and normal renal function . she was commenced on oral prednisolone ( 60 mg od ) , and achieved complete remission within weeks . however , multiple relapses followed on reduction of the corticosteroid dose . azathioprine , cyclosporin , mycophenolate mofetil , tacrolimus and chlorambucil were all tried unsuccessfully , but neither the relapse rate nor the steroid requirements improved . in 2003 , cyclosporin was re - introduced to minimize steroid exposure with trough plasma levels of 149 g / l . in the preceding 14 years , the prednisolone dose had rarely been below 15 mg / day , and there had typically been two to three relapses per year . in 2006 , sirolimus 2 mg / day was added to her prednisolone ( 15 mg / day ) , and cyclosporin ( 6 mg / kg / day)she was also prescribed primidone since childhood for epilepsy . at review , the trough plasma levels of cyclosporin and sirolimus were 153 g / l and 2.9 g / l , respectively . steroids were gradually reduced and subsequently completely discontinued 24 months after sirolimus was added with no relapses in the last 30 months . mcn is predominantly a steroid - responsive disease , with around 75% of adult patients achieving remission by 8 weeks . unfortunately , 3060% will suffer at least one episode of relapse and around 25% will do so more frequently . a variety of immunosuppressive medications , each with its own side effect profiles , have been trialled as steroid - sparing agents with variable success . frequently relapsing minimal change disease the first documented use of sirolimus in combination with tacrolimus as a therapeutic option in mcn was published in 2005 by patel et al . . in conclusion , we have detailed a case of relapsing mcn , which has only been controlled by the combined use of sirolimus and cyclosporin . this has not only resulted in the longest period of remission , but has also allowed for the discontinuation of corticosteroids . this is the second documented use of sirolimus in this manner that we are aware of and the first that has trialled the combination of sirolimus and cyclosporin .

minimal change nephropathy ( mcn ) accounts for around 25% of adults presenting with a nephrotic syndrome . although most patients respond to corticosteroid therapy , a significant number relapse frequently and may present a real therapeutic difficulty . we present a case of apparently refractory relapsing mcn that was successfully treated with a combination of sirolimus and cyclosporin , resulting in the longest period of steroid free remission that the patient has ever experienced . to our knowledge , this is the first documented use of this combination in this manner .

telomeres are specific sections of dna at the end of chromosomes comprised of tandem dna repeats ( ttaggg ) . their biological role is to prevent dna shortening , protect chromosomes from inappropriate dna fusions , as well as dna breaks in order to maintain genomic integrity and stability ( 1 ) . importantly , upon each cell division , telomere length ( tl ) decreases by 50200 base pairs , which together with cell aging , ultimately results in a crucial tl point which triggers chromosomal fusions and/or apoptosis ( 2 ) . telomerase , consists of two subunits , an enzymatic protein component , telomerase reverse transcriptase ( tert ) , that adds the telomeric dna repeats onto the end of chromosomes , and an telomerase rna template component ( terc ) , that serves as a template for telomeric dna synthesis ( 3 ) . due to the fact that tert is responsible for telomerase activity ( ta ) , its expression is tightly regulated , being highly expressed only in periodically or continuously renewing tissues , such as in cells of the hematopoietic system , germ cells , the epidermis and tumors . contrary to tert , terc is widely expressed in all types of cells , but is unable to induce ta ( 4 ) . the complex cell aging system regulates the longevity of cells , as well as senescence . without functional telomerase , a typical ' dividing ' cell will exhibit progressive telomere shortening , which upon reaching a ' critically ' short tl , results in telomere - dependent replicative senescence and in an inability to divide further ( 4 ) . it is interesting to note that although the word ' aging ' is usually associated with old age , aging in the sense of telomeres is a life - time phenomenon that begins even before birth . age - related diseases manifest mostly in old age ; however , the aging process at the cellular level can be viewed as a lifelong progression ( 5 ) . importantly , premature aging phenotypes , collectively termed ' telomere syndromes ' ( 6 ) , can be induced by rare mutations in human tert ( htert ) . furthermore , htert overexpression in normal human fibroblasts has been shown to protect the cells from apoptosis and necrosis ( 7 ) . nonetheless , some adverse factors which have been established to cause telomere dysfunction , telomere uncapping or other types of dna damage , such as oxidative stress , can induce premature cell senescence without the presence of critically short telomeres ( 8) . telomerase and telomeres functions , due to their roles in apoptosis and senescence , have been examined in many aspects of reproduction biology , such as fertilization , placental development , stress and hypoxic conditions during pregnancy , as well as premature aging following intrauterine growth restriction ( iugr ) . it is well established that female human fertility declines with increasing maternal age and that various adverse factors can contribute to aging - associated infertility in women ( 9 ) . oocyte defects , such as chromosome abnormalities ( aneuploidy ) , are a major cause of age - related decline in female fertility as they severely impair embryo implantation and development ( 10 ) . numerous studies have focused on ta and its correlation with mammalian fertilization , as well as following the cleavage , and pre - implantation development processes . importantly , wright et al ( 11 ) demonstrated that ta exists in fetal , newborn , and adult testes and ovaries , but not in mature spermatozoa or oocytes . in human somatic cells grown in vitro or during replicative aging in vivo , telomeres erode to shorter and shorter lengths and continually decreasing levels of ta are detectable ( 12 ) . according to liu et al ( 13 ) , aberrant cleavage and increased cytofragmentation are significantly higher in homozygotic telomerase knockout ( tr ) eggs as compared to wild - type eggs . from both in vivo and in vitro fertilization ( ivf ) experiments , it appears that the absence of ta leads to telomere dysfunction , which in turn results in aberrant fertilization and the cleavage of tr gametes ( 13 ) . luteinized granulosa cells ( gcs ) surround the oocyte and are major somatic cell components of the ovarian follicle . ta is further evidence of the stemness of normal , non - cancer cells in the ovaries ( 13,14 ) . successful maturation , fertilization and pre - implantation embryonic development depends on a regulated programme of oocyte growth and differentiation coordinated with the development and differentiation of the surrounding gcs ( 15 ) . importantly , it has been demonstrated that tert is expressed by gcs at all stages of ovarian follicle development ( 16,17 ) . however , tert mrna expression and ta in gcs have been found to decrease with age and basal serum follicle stimulating hormone levels ( 18 ) . indeed , the low level of ta in the human ovaries was found to be related to the age - related primordial follicle depletion and it was suggested that ta may be used as a marker of the ovarian functional age ( 19 ) . importantly , studies have demonstrated that oocyte development is related to the ta of peripherally residing gcs . gcs play an important role in the maturation of oocytes and are closely associatd with their reproductive quality ( 20,21 ) . interestingly , ta was found to be highest in the gcs of the small preantral follicles , and to decrease subsequently through different stages of antral development ( 22 ) . moreover , it was shown that the relative tl was longer in gcs from mature oocytes compared with gcs from immature oocytes in humans ( 23 ) . upon measuring ta in human gcs obtained from ivf and intracytoplasmic sperm injection cycles , it was demonstrated that the rates of oocyte maturation and good - quality embryo generation increased in a ta level - dependent manner ( 24 ) . indeed , the same authors postulated that women with a high level of ta had a greater likelihood of becoming pregnant than those with non - detectable or low levels of ta ( 24 ) . along the same lines , the lack of ta in gcs is associated with occult ovarian insufficiency ( 25 ) . finally , in gcs obtained from the same individuals , it was shown that ta predicts ivf treatment outcomes better than tl ( 26 ) . importantly , tl in human eggs was found to predict cytoplasmic fragmentation in embryos suggesting that telomere shortening induces apoptosis in human prei - mplantation embryos , well in accordance with a telomere theory of reproductive senescence in women ( 27 ) . this data collectively suggest ta / tl of luteinized gcs is positively correlated with clinical pregnancy rate and , indicate that ta of ovarian luteinized gcs could help health workers to predict the clinical outcomes of ivf treatment . during normal pregnancies , a decrease in ta activity when comparing the early gestation period ( < 10 weeks ) , with the late gestation period ( > 10 weeks ) , is observed ( 28 ) . thus , placenta and chorionic villi specimens from the first trimester of gestation exhibit significantly more ta than placenta and chorionic villi specimens from the second and third trimester during gestation ( 29,30 ) . specifically , a high ta was identified in trophoblast cell fractions of the chorion , suggesting that this fraction is a major source of ta activity ( 31 ) . additionally , the expression of htert was observed in chorions from early stages of gestation , but not in the placenta at the late stages of gestation , with a close correlation between ta and htert expression ( 31 ) . iugr is a common pregnancy complication , which can be defined as the failure of the fetus to reach the size for which it is genetically programmed . delayed growth puts the fetus at risk during pregnancy and is associated with adverse outcomes during delivery and to neonate health problems . these may include a low birth weight , difficulty in handling the stress of vaginal delivery , decreased oxygen levels , hypoglycemia , low resistance to infection , low apgar scores ( a test given immediately after birth to evaluate the newborn 's physical condition and determine the need for special medical care ) , breathing problems associated with meconium aspiration ( inhalation of stools passed while in the uterus ) , difficulties in maintaining body temperature , an abnormally high red blood cell count , long - term growth problems , and in the most severe cases , iugr can lead to still birth ( 33 ) . interestingly , only weak ta was detected in the placenta and chorionic villi specimens from women with pregnancies complicated by iugr ( 34,35 ) . indeed , htert mrna expression was detected in the placenta and chorionic villi specimens during the first , second and third trimester of gestation in normal pregnancies , whereas copy numbers of htert were significantly lower in placenta specimens from women with pregnancies complicated by iugr ( 21 ) . the expression of hterc was observed in chorions obtained during early and late gestation and was not linked to ta ( 31 ) . on the other hand ( 36 ) , an analysis of the terc telomerase subunit gene copy number in placentas from pregnancies complicated by iugr revealed that the terc gene copy number was decreased in trophoblasts in placentas from women with pregnancies complicated by iugr , and it was thus suggested that this may promote senescence in trophoblasts in placentas from pregnancies complicated by iugr . in accordance with these data , a decreased tl was observed in placenta samples collected from women with pregnancies complicated by iugr ( 37 ) . furthermore , a decreased ta in placentas from women with pregnancies complicated by iugr was associated with increased apoptosis ( 34 ) . twins affected by growth discordance exhibit significant differences in their growth rate and size even though they develop in the same intrauterine environment ( 38 ) . importantly , birth weight discordance amongst twins is closely correlated to perinatal morbidity and mortality ( 39 ) . thus , specimens from placental tissues from twins affected by growth discordance ( > 20% weight difference ) or not ( < 20% weight difference ) were collected after birth , and ta was analyzed ( 40 ) . the results revealed that in the growth discordant group , ta was significantly higher in the larger twin than in the smaller twin ( 40 ) . oxygen is a necessity for life ; yet , it is toxic to cells when dysregulated . thus , both high and low levels of oxygen are deleterious to developing embryos . in normal pregnancies , in early gestation , the fetus and placenta exist in a relatively hypoxic environment with an ambient po2 < 20 mm hg ( 41 ) . the low oxygen tension favors cell proliferation and angiogenesis in the placenta , whereas it simultaneously supports vasculogenesis , hematopoiesis and chondrogenesis of the developing fetus ( 42,43 ) . upon establishing intervillous circulation at approximately 1012 weeks of gestation , oxygen tension rises to 4080 mmhg and remains in this range throughout the second and third trimesters . in order to support normal placental function and fetal development , the placenta adapts to the alterations in oxygen levels by the modulation of hypoxia inducible factor-1 ( hif-1 ) expression and by increasing cellular antioxidant defenses ( 44 ) . thus , restricted oxygen availability is normal and necessary in utero ; however , excessive fetal hypoxia leads to adverse outcomes , including fetal death , iugr and low birth weight ( 45 ) . indeed , intrauterine hypoxia may be due to a variety of causes , including prolapse or occlusion of the umbilical cord , placental infarction , hypertension , anemia , pulmonary disease , preeclampsia , as well as maternal smoking ( 46 ) . importantly , intrauterine hypoxia can cause cellular damage within the central nervous system and is associated with a reduced total brain volume and altered cortical volume and structure , a decrease in the total number of cells and myelination deficits ( 47 ) . this results in an increased mortality rate , including an increased risk of sudden infant death syndrome ( sids ) . moreover , oxygen deprivation in the fetus and neonate have been implicated as either a primary or as a contributing risk factor in numerous neurological and neuropsychiatric disorders such as epilepsy , attention deficit hyperactivity disorder ( adhd ) , eating disorders and cerebral palsy , as well as in the later development of neurodegenerative diseases ( 48 ) . hif-1 is a transcription factor of major importance in the cellular response to oxygen deficiency with specific roles during embryogenesis ( 49 ) . hif-1 is a heterodimeric complex composed of the two basic helix - loop - helix pas domain ( bhlh - pas ) subunits hif-1 and hif-1 ( 50 ) . the hif-1 gene is constitutively transcribed under hypoxic conditions and determines hif-1 biological activity ( 51 ) , whereas the hif-1 subunit dimerizes with several different bhlh - pas proteins and is continuously expressed ( 50 ) . hif-1 targets genes that encode proteins which regulate oxygen homeostasis and are critical for developmental and physiological processes in hypoxic environments ( 51 ) . indeed , hif-1 activity is critical for normal fetal development , as it has been shown that murine embryos lacking functional hif-1 die on / or before e10.5 ( 52 ) . an important issue to resolve is the existence of a correlation between hif-1 and ta . indeed , hif-1 expression was detectable , as demonstrated by western blot analysis , in first trimester placenta samples , but not in placental samples from the second and third trimester ( 53,54 ) . accordingly , htert protein expression was increased in placental tissues before 10 weeks than in placental tissues after 10 weeks of gestation ( 54 ) . in vitro studies thus , tl distribution in huvecs under hypoxic conditions seems to be regulated by a balance between telomere attrition by hypoxia and telomere elongation by enhanced ta acting on telomeres ( 55 ) . indeed , coussens et al ( 56 ) demonstrated that hif-1 affects telomerase regulation in murine embryological stem cells and these authors suggested that hif-1a may have a physiologically relevant role in the maintenance of functional levels of telomerase in stem cells ( 56 ) . furthermore , it was demonstrated that the htert promoter region contains two hif-1 consensus motifs , which are essential for htert transactivation by hif-1 . the introduction of an antisense oligonucleotide for hif-1 diminishes htert expression during hypoxia , indicating that the upregulation of htert under hypoxic conditions is directly mediated through hif-1 ( 54 ) . thus , nishi et al ( 54 ) suggested that the regulation of htert promoter activity by hif-1 represents a mechanism for trophoblast growth during hypoxia according to the previous data ; there are two possibilities about the association between hypoxia induction and ta . dna damage in the telomere region can be induced by hypoxia , which would result in hif-1-induced telomerase expression in order to heal the damaged chromosome ends ; or an anti - apoptotic response may be triggered by the hypoxic induction of telomerase ( 5658 ) . a rapidly growing body of empirical evidence suggests that a major burden of disease can be traced back to the intrauterine period of life . importantly the sensitive biological functions of fetal cell proliferation , differentiation and maturation respond to , or are affected by conditions in the internal or external environment . the result of these responses are structural and/or functional changes in cells , tissues and organ systems that have important long - term consequences for subsequent health and disease susceptibility ( 59 ) . exposure to psychosocial stress and/or biological stress mediators during gestation has been identified as a condition that may modulate the long - term programming effects of the intrauterine environment ( 60 ) . indeed , exposure to psychosocial stress during gestation appears to be an important risk factor for the earlier onset of complex , common age - related diseases ( 60 ) . studies on humans have demonstrated links between chronic or excessive psychosocial stress exposure and telomere biology ( 5,61,62 ) . these data suggest that stress - related changes in telomere integrity may be a possible mechanism linking psychosocial stress and age - related disease ( 63 ) . indeed , accelerated telomere shortening reflects stress - related oxidative damage to cells and increased aging ( 64 ) . substantial evidence supports the hypothesis that depression creates abnormalities in stress - related biological outcomes . thus , individuals with mood disorders have a significantly shorter tl compared with stable individuals , representing as much as 10 years of accelerated aging ( 64 ) . furthermore , it has been demonstrated that exposure to a major stress hormone , such as cortisol , is associated with the downregulation of ta in activated human t lymphocytes ( 65 ) . this is highly relevant , as leukocyte tl is a predictor of age - related disease onset and mortality ( 66 ) . there is also the question of whether cellular aging is related to patterns of allostasis ( 66 ) . telomeric dna quantity , dna damage and heat shock protein gene expression have been used as physiological stress markers in chickens ( 67 ) . exposure to maternal psychological stress during intrauterine life appears to induce not only adverse birth and neonatal outcomes , but also subsequent health and disease risk - related outcomes over the lifespan of an individual . the relevant outcomes include metabolic , endocrine , immune and cognitive processes ( 5 ) . one important question that has yet to be addressed is whether exposure to stress during intrauterine development can produce variations in tl , thereby potentially setting up a long - term trajectory at birth that defines or contributes to individual susceptibility for complex and common age - related diseases . entringer et al ( 59 ) examined the tl in leukocytes of individuals whose mothers had experienced a high level of psychological stress during pregnancy . these authors demonstrated that exposure to maternal psychosocial stress during intrauterine life was associated with a significantly shorter tl in young adulthood ( 59 ) . additionally , it has been suggested that maternal psychological stress during pregnancy may exert a ' programming ' effect on the developing telomere biology system that is already apparent at birth , as reflected by the setting of newborn tl ( 5 ) . the association between ta and maternal stress exposure during pregnancy , has not yet been investigated and may shed further light on telomere biology . indeed , it was postulated by shalev et al ( 5 ) that a ' better understanding of the mechanisms that govern and regulate telomere biology throughout the lifespan may inform our understanding of etiology and the long - term consequences of stress and mental illnesses on aging processes in diverse populations and settings ' . importantly , nutrition is a key factor supporting normal pregnancy and refers to the consumption of nutrients and the diet of the mother before , during and after pregnancy . thus , the nutritional status of the pregnant women is important as early as conception , and continues to be important throughout gestation and after birth during breastfeeding . it has been demonstrated that the nutrition of the mother is crucial as it may have an effect on the future health of the child ; poor nutririon during pregrancy may lead to health complications in the later life of the child , and may lead to the development of cancer , cardiovascular disease , hypertension and diabetes ( 68 ) . an inadequate or excessive amount of certain nutrients may lead to malformations or medical problems in the fetus and in the life of the developint child . indeed , neurological disorders and handicaps of the fetus are more common in pregnant women who are malnourished ( 69 ) . as 23.8% of babies worldwide are estimated to be born with lower than optimal weights at birth due to the lack of proper and sufficient nutrition , malnutrition poses a major risk to the health of the fetus ( 70 ) . in particular , personal habits , such as smoking , excessive alcohol and caffeine consumption , the use of certain medications and illegal drugs can negatively and irreversibly affect the development of the fetus , and these negative effects can take place during the early stages of pregnancy . specifically , a diet low in protein during gestation has no effect on placental weight , but results in a decreased weight of the offspring ( 72 ) . importantly , malnutrition in female rats has been shown to increase the production of the superoxide free radical ( o2 ) ( 73 ) . it is well established that oxidative damage is a major feature of the aging process and can lead to telomere shortening ( 74 ) , which is associated with cellular senescence in vitro and in vivo ( 75,76 ) . these data lead to the conclusion that increased cell apoptosis in the offspring can be caused by maternal protein restriction ( 75 ) . importantly , maternal diet was found to influence tl in the rat offspring ( 77,78 ) . thus , the offspring of mothers who consumed a diet low in protein during gestation had significantly shorter telomeres compared to the controls . in addition , maternal protein restriction during lactation increased longevity and reduced renal telomere shortening compared with offspring that were maternally protein - restricted in utero and then suckled by normally fed dams ( 79 ) . the nutritional programming of coenzyme q was found to be relevant to aortic tl in rats with different gestational regimes of this coenzyme ( 80 ) . the functions of telomerase and telomeres have been examinedin many aspects of reproduction biology , such as fertilization , placental development , stress and hypoxia conditions during pregnancy , as well as premature aging following iugr . importantly , varying ta activity has been shown during the progression of normal pregnancies ; ta activity being significantly higher in the early as compared to the late gestation period . it is noteworthy that under pregnancy - related pathological conditions , ta is decreased or absent , which results in significantly shorter telomeres . in depth studies on telomere biology during reproduction can improve our understanding of the significance of telomerase in fetal development and lifelong consequences on illnesses and aging processes in different populations . this understanding may lead to better prevention policies and may perhaps reveal novel therapeutic strategies .

telomeres are specific dna regions positioned at the ends of chromosomes and composed of functional non - coding repeats . upon cell division , the telomeres decrease in length by a preordained amount . when the telomeres become critically short , cells lose the ability to divide and enter a specific functioning mode designated as ' cellular senescence ' . however , human tissues express an enzyme that deters the shrinking of the telomeres , the telomerase . due to its ability to maintain telomere length , the telomerase slows down and possibly suspends the aging of the cells . in regard to this , solid evidence demonstrates that female human fertility decreases with increased maternal age and that various adverse factors , including alterations in telomerase activity , can contribute to age - associated infertility in women . the fact that telomerase activity is regulated in a time- and location - dependent manner in both embryo and placental tissues , highlights it potential importance to the successful completion of pregnancy . since maternal age is a crucial determining factor for the success of in vitro and in vivo fertilization , numerous studies have focused on telomerase activity and its correlation with mammalian fertilization , as well as the following cleavage and pre - implantation developmental processes . associations between telomerase activity and pregnancy complications have been previously observed . our aim in this review was to summarize and critically discuss evidence correlating telomerase activity with pregnancy complications .

human neurocysticercosis ( ncc ) is caused by larval stage of zoonotic tapeworm taenia solium ( pork tapeworm ) which remains a major public health problem in developing and some developed countries . porcine cysticercosis is the cause of human taeniasis and neurocysticercosis is a consequence of taeniasis . based on the available information , a very conservative and rough economic estimate indicates that the annual losses due to porcine cysticercosis in 10 west and central african countries amount to about 25 million euros . . also stated that , in china , the amount of pork discarded in the whole country due to cysticercosis annually has been estimated as 200,000,000 kg with a value of more than us $ 120,000,000 . stated that notably data on myanmar are lacking , although there are several reports of porcine cysticercosis based on meat inspection in the abattoirs in neighboring countries , 9.3% in india , 32.5% in nepal , 5.4% in china , 0.022.63% in indonesia , and 0.04 to 0.9% in vietnam . although most of myanmar culinary habits are based on thorough cooking , new food style such as barbecue and dishes based on raw or undercooked pork or pork product becomes popular among customers . moreover , small - scale pig husbandry has become one of the major sources of income in myanmar farmers . so it may be high risk of getting food - borne zoonotic diseases according to the new food style and traditional husbandry method . due to lacking of information on porcine cysticercosis in myanmar up to now , it is important to investigate the prevalence and associated risk factors . nay pyi taw area , the capital of myanmar , has big population of pigs ( about 200,000 pigs ) to support the demand of pork consumption in this area . most of the pig farmers are smallholders and most of pig husbandry systems are free ranging or semi - intensive with lack of proper sanitation . one of the main obstacles to control the t. solium infections is the lack of adequate epidemiological data on cysticercosis / taeniasis . therefore , the objectives of this community - based study were to investigate the prevalence of porcine cysticercosis and associated risk factors in pigs within study area . moreover , findings of this study will assist to develop the control strategies of porcine cysticercosis for the public health aspect . the cross - sectional studies were conducted from january to march and june to july 2014 , to investigate the prevalence of taenia solium cysticercosis in slaughtered and farmed pigs within pyinmana , lewe , and tatkon townships , nay pyi taw area . it is located between latitude 1945n and longitude 966e and with climate data ; the altitude is 115 m above sea level , annual rainfall is 115 mm , and annual temperature is 21.232.5c . an expected prevalence of 30% with a confidence level of 95% was used in this unit . in this study , 300 slaughtered pigs and 364 farmed pigs from the study area were examined although calculated samples were 298 and 323 , respectively ( table 1 ) . blood collected from the jugular vein of farmed pig was conducted for the seroprevalence and a structured questionnaire with both closed and open - ended questions was administered to owners to obtain management practices in pig husbandry . piglets younger than two months , pregnant sows , and nursing sows with litters less than two months old were excluded from this study to overcome the stress which causes adverse effect in animals . meat inspection was carried out as described by boa et al . in the three slaughterhouses of these townships . there were 300 randomly selected pigs recruited and 9 different muscles ( tongue , masseter , brain , shoulder , diaphragmatic , heart , skeletal , fore limb , and hind limb muscle ) from each pig in meat inspection . briefly , long and parallel incision into the masseter muscles on both sides of face in an upward direction was made . a deep longitudinal incision covering about 3/4 the thickness of the tongue and covering the whole length of the tongue was made to examine the cysts . after opening the pericardium , the heart was also visually examined for the presence of cysts . the heart was cut open and a deep ( 3/4 the thickness of septum ) incision into the septum was made to expose any metacestodes . all the other muscles were viewed , palpated , incised by surgical blade , and visually examined . the pig was kept under restraint at standing position and blood samples were obtained from the external jugular vein by using sterile disposable syringes and put into vacutainers with clot activators . those vacutainers were kept in cold boxes with ice and transported to department of pharmacology and parasitology , university of veterinary science , nay pyi taw , and allowed overnight at 4c to clot . to obtain serum , the clear sera were transferred to 1.5 ml microvial tubes and stored in labeled wails and kept at 20c until analysis . detection of igg antibody of t. solium cysticerci was carried out by using antibody - elisa kit ( novatec immundiagnostica gmbh co. , belgium ) according to manufacturer 's instruction . briefly , all thawed samples were diluted as 1 + 100 with igg sample diluent ( phosphate buffer ) before assaying . the 100 l controls and diluted samples were dispensed into their respective wells and the foil was covered . after incubation for 1 hour at 37c and the foil being removed , the contents of the wells were aspirated and washed three times with washing solution . and the 100 l protein a conjugate ( horseradish peroxidase ) was dispensed into all wells except a1 and covered with foil and incubated for 30 min at room temperature . after washing three times , 100 l tmb ( 3,3,5,5-tetramethylbenzidine ) substrate solution was dispensed into all wells and incubated for exactly 15 min at room temperature in the dark . the reaction was stopped by adding 100 l stop solution ( 0.2 m h2so4 ) . the absorbance was determined at 450/620 nm using an elisa reader ( stat fax ) . in each elisa kit testing , there are two cut - off controls ( c1 and d1 ) . the mean absorbance of these cut - off controls was used as cut - off value . samples are considered positive if the absorbance value is higher than 10% over the cut - off and samples are considered negative if the absorbance value is lower than 10% below the cut - off . the sensitivity and specificity of these kits to diagnose swine cysticercosis are 93.8% and > 95% , respectively . a questionnaire was developed and used to collect information on hypothesized risk factors and other related pieces of information from sampled pig owners . households in each township were selected by using the snowballing technique from those farmers willing to participate in the study . it is a technique for developing a research sample where existing study subjects recruit future subjects from their acquaintances . the questionnaire interviewed data were analyzed for the relationship between the prevalence of t. solium cysticercosis and hypothesized risk variables such as age , gender of pigs , husbandry system , feed type , environment of pig farm ( accessibility of human feces ) , personal hygiene of owners , pork consumption , cooking and eating habit of pork , use of anthelmintics in pigs and owners , and knowledge on taeniasis . they were examined for testing its significance by pearson chi - square test at = 0.05 . seroprevalence of porcine cysticercosis in farmed pigs was 15.93% ( 58/364 ) in the study area . prevalence of households with pigs infected with t. solium cysticerci by ab - elisa examination was 23.15% ( 47/203 households ) . the households with porcine cysticercosis in pyinmana , lewe , and tatkon were 0/12 ( 0% ) , 13/124 ( 10.48% ) , and 34/67 ( 50.75% ) , respectively . all the infected pigs presented parasites located in the tongue . only in one pig , the prevalence in slaughterhouses of pyinmana , lewe , and tatkon townships was 22% ( 44/200 ) , 23.33% ( 7/30 ) , and 28.57% ( 20/70 ) , respectively . univariate analysis of hypothesized risk factors of gender ( or = 3.0 ; 95% ci = 1.75.4 ) , increased age ( or = 2.3 ; 95% ci = 1.24.2 ) , husbandry system ( or = 5.1 ; 95% ci = 2.411.2 ) , feed type ( or = 16.9 ; 95% ci = 2.3124.3 ) , no hand washing habit before feeding ( or = 31.5 ; 95% ci = 4.3230.9 ) , not using anthelmintic in pigs ( or = 11.9 ; 95% ci = 5.028.5 ) and owner ( or = 2.5 ; 95% ci = 1.44.4 ) , and pork consumption of owner ( or = 37.4 ; 95% ci = 9.0156.1 ) was significantly associated with cysticercus cellulosae infection ( p < 0.05 ) . the distribution and odds ratio of significant risk factors concerning porcine cysticercosis are shown in table 2 . in southeast asia , pigs are an important source of food and economic important for smallholder farmers . older pigs may be penned or tethered although common raising practice of pigs is freely roaming in the village . in myanmar , most of the pig farmers are smallholders and practice as free - range or backyard farming . in myanmar , most of the pig farmers usually keep the weaned pigs until six to eight months of age and then send to slaughterhouse . in the village , every household keeps at least one pig not only for table waste feeding to pigs but also for extra income . most farms are having the habit of feeding waste materials such as swill and kitchen leftover , broken rice , rice bran , groundnut meal , sesame meal and local forage , and poor sanitation . the present study is the first report of t. solium cysticercosis in pigs in myanmar . pigs in the study area positive for cysticercosis have been exposed to t. solium eggs . among the 17 hypothesized risk factors , the gender of pigs ( being female ) was significantly associated with porcine cysticercosis in this study . it can be explained that female pigs were for kept long time for breeding purpose than male and so they have more risk to get exposed to t. solium eggs . however , jayashi et al . reported that gender was not a significant risk factor for porcine cysticercosis . the present study demonstrated that the older the pigs , the greater the chance to get infection . these results are in agreement with those reported by pouedet et al . , jayashi et al . , sarti et al . , garca et al . , and pondja et al . older pigs might also have greater chance to get exposed to t. solium eggs than younger ones . they might have much time to develop cyst and trigger the production of circulating antibodies . besides , it could be possible that younger pigs are protected during their first months of life against parasite infection , due to the presence of maternal cysticercus antibodies and they become susceptible later after the slow clearance of those antibodies . the result showed that pigs from households practiced semi - intensive system ( the pigs are allowed to roam freely in the environment and only panned or tethered at feeding time and night ) were more likely to have porcine cysticercosis than intensive ( the pigs are kept in the backyard or corral and not allowed to roam ) pigs . therefore , semi - intensive management system represented as an important risk factor for porcine cysticercosis in the study area as the pigs in this practice could access the infected human faeces . accessibility of infected human faeces is the main source for porcine cysticercosis [ 17 , 19 , 20 ] . among the feed types used in pig farms , this might be contaminated with t. solium eggs from infected food preparers of swill collected houses . so the collected swill should be cooked thoroughly before feeding to prevent infection including cysticercosis . use of anthelmintic in pigs and owners was significantly associated in this study . by interviewing the farmers and township veterinary officers , although ivermectin can not kill any larvae of cestode , albendazole can kill these larvae . although all the farmers wash their hands after feeding the pigs , only 21.2% famers ( 43/203 ) wash their hands before feeding . all cysticercosis positive samples were from those who do not practice hand - washing habit . pork consumption of owners is also one of the risk factors in survey of porcine cysticercosis . nine hypothesized risk factors not included in analysis were breed of pigs , place of purchase , presence of latrine , hand - washing after feeding the pigs , source of water for pigs , cleanliness of water , knowledge on taeniasis and cysticercosis , and occurrence of cyst in pork . in this study , all pigs are indigenously bred . all farmers have latrines using water , but the children do not use latrine and are used for defecation out of latrine . some farmers washed the hands before feeding the pigs and all farmers washed their hands after feeding . all farmers did not have the knowledge on taeniasis and cysticercosis and they have never seen the cysts in the pork in the study area . the presence of zoonotic agent , cysticercus cellulosae , may depend on intrinsic factors : age , gender , and extrinsic factors : pig husbandry system , hand - washing habit of owner , use of kitchen waste as pig feed , not using anthelmintic in pigs and owners , and pork consumption of owner in the study area . presence of this infection is of public health importance because it may lead to the occurrence of neurocysticercosis in human . although the occurrence of human neurocysticercosis has not been reported yet in myanmar , all public should take awareness of potential risk factors due to the prevalence with high percentage observed in this study . myanmar has no national monitoring program for t. solium cysticercus spp . in these animals yet . therefore , it is advisable to monitor whether there is high or low prevalence of t. solium cysticercosis in the whole country . it could also be suggested that confinement housing system should be developed in pig industry of myanmar to efficiently prevent porcine cysticercosis . for practicing sanitary and culinary habit , thorough cooking education programs should also be implemented for both swine breeders and consumers so as to prevent taeniasis in human and porcine cysticercosis and also other zoonotic helminth diseases in myanmar . this prevalence with relatively high percentage of porcine cysticercosis ( 15.93% ) in ab - elisa and 23.67% in slaughtered pigs indicates the presence of human taeniasis and it also leads to the associated risk of human cysticercosis and neurocysticercosis .

cross - sectional surveys were conducted to determine the prevalence and associated risk factors of taenia solium cysticercosis in pigs within nay pyi taw area , myanmar . meat inspection in three slaughterhouses , elisa test , and questionnaire surveys were conducted in this study . three hundred pigs were inspected in slaughterhouses and 364 pigs were randomly selected and examined from 203 households from three townships in nay pyi taw area . the prevalence of porcine cysticercosis in meat inspection was 23.67% ( 71/300 ) . seroprevalence of t. solium cysticercosis in pigs in the study area was 15.93% ( 58/364 ) . significant associated risk factors with t. solium cysticercosis were gender ( or = 3.0 ; 95% ci = 1.75.4 ) , increased age ( or = 2.3 ; 95% ci = 1.24.2 ) , husbandry system ( or = 5.1 ; 95% ci = 2.411.2 ) , feed type ( or = 16.9 ; 95% ci = 2.3124.3 ) , not using anthelmintics in pigs ( or = 11.9 ; 95% ci = 5.028.5 ) , not using anthelmintics in owner ( or = 2.5 ; 95% ci = 1.44.4 ) , no hand - washing before feeding ( or = 31.5 ; 95% ci = 4.3230.9 ) , and pork consumption of owner ( or = 37.4 ; 95% ci = 9.0156.1 ) in the study area . this is the first report of porcine cysticercosis in myanmar .

access to automated dna sequencing technology has made possible the rapid generation and analysis of gene transcripts expressed in organisms via expressed sequence tags ( ests ) . this information has helped to identify those genes expressed in particular stages of development and in specialized tissues or organs . novel gene products and target leads for therapeutic intervention can also be gleaned rapidly from ests . a more detailed understanding of the molecular interactions between symbionts , whether pathogenic or mutualistic , is also possible with this approach . for a sequence isolated from interacting symbionts , determining its cellular role ( or roles ) we refer to this challenge as ' the problem ' : given a sequence x expressed in an interaction between species a and b , did x originate from a or b ? various solutions are readily conceived , each with merits and faults . here , we show that a comparative lexical analysis of word counts ( specifically , hexamer frequencies ) , previously used to detect library contamination in sequencing projects , provides a powerful computational basis to infer a transcript 's species of origin . experimentally , one can attempt to solve the problem by hybridizing a clone ( as probe ) to genomic dna ( target ) from both species and determining to which target the probe hybridizes . however , if a sequence is highly conserved in the two taxa , hybridization stringency conditions can influence the outcome considerably . for high - throughput est sequence analysis , source verification by hybridization is impractical in terms of time and reagents . as an alternative to in vitro hybridization , several computational solutions are possible . were the genome sequence of both species completely determined , one could simply use sequence similarity searching . however , most plant hosts and their microbial symbionts have little or no genomic sequence data available , which makes this approach very unreliable . strong similarity to a sequence from one organism does not preclude the possibility that a similar sequence is present in the other species . exploiting this fact may seem a viable solution to the problem , as it has proven suitable for predicting the presence of introns among exons in genomic dna . however , it really is not practical , because of the need to know the reading frame for translation of a messenger rna into an amino acid . est data are of notoriously unreliable quality , sometimes having a large proportion of ambiguous bases , and sometimes having single base - pair insertions or deletions , which disrupt a reading frame . word counting is less prone to these sources of error , and uses information intrinsic to biases in codon usage by counting codon pairs as hexamers in a sliding window , whereas codons are read in non - overlapping , tiled windows . an intuitive approach to the problem that examines sequence composition is to compare the guanine and cytosine ( gc ) base content of a sequence with other sequences from the species being studied . when two species ' genomes have different gc content , this method can be very useful . in a recent investigation , for instance , sequences from the stramenopile plant pathogen phytophthora sojae and its soybean ( glycine max ) host showed a 20% difference in mean gc content . the origin of a number of sequences could readily be identified this way , but a large proportion could not , because of considerable overlap in the distributions ' tails . counting frequencies of gc is simple word counting , where the word size k is 1/2 : only two semi - words , g / c and a / t are counted . an alternative approach to determining the origin of a sequence is suggested by previous work on analysis of word counts , or k - tuple frequencies , which was intended as a means of evaluating a library for contamination when sequencing from a single model organism . the word - counting method provides distinct advantages over other computational methods . unlike sequence - similarity searching , it does not require that the full protein - coding content of both genomes be known for reasonable inferences to be made . further , word counting is sensitive to biases in codon usage and gc content commonly observed when comparing taxa , but does not require knowledge of the reading frame for amino - acid translation . that is , the underlying differences between the two organisms that result in base composition or codon usage biases can also be detected by counting words . unlike gc analysis , lexical analysis establishes a clear threshold above or below which we can infer the species of origin , and a confidence level for an inference can readily be assigned . dunning 's likelihood - ratio test of word dissimilarities also has the appealing property of being non - parametric , having no assumption of normality for the underlying frequency distribution , which makes it statistically powerful . dunning demonstrated that unreliable results can be obtained from parametric tests , such as , particularly in such cases as lexical analysis . in the experiments detailed below , we first validate the word - counting method on sequences whose origin and function are known , then compare it with ability to diagnose the origin of sequences with distributions of gc content . we examine sequences from pathogenic interactions between species from the genus phytophthora and the plant hosts g. max and medicago truncatula , then apply the word - counting approach to sequences from two microbial mutualists in association with m. truncatula , the arbuscular mycorrhizal zygomycete glomus versiforme , and the nitrogen - fixing bacterium sinorhizobium meliloti . validation sequence accession numbers , gene names , and comparison results appear in table 1 . the word - counting method was generally quite reliable when tested against sequences of known origin , being wrong in 3 cases out of 50 ; a phosphate transporter from g. versiforme and two in planta - induced genes from phytophthora infestans were misidentified as plant sequences . this indicates a failure rate of 6% - all false negatives under the null hypothesis that a transcript originates from the plant host . performance of the method was not influenced by whether the isolated source of a sequence was an mrna or dna molecule , as indicated by the column labeled ' mrna ? ' . distributions of gc content are approximately normal in two of three cases studied , those of axenic p. sojae cultures ( figure 1 ) . for sequences from infected plant cultures , roughly 25% of a total of 927 infected g. max sequences contain less than 50% gc ; most of these are likely to be plant transcripts . this is a considerably greater number than for axenic p. sojae cultures , in which fewer than 5% of mycelia and zoospore isolates contain less than 50% gc . several properties of cumulative distribution functions warrant comment , to help explain similar plots from word dissimilarity comparisons ( figures 1b,2a ) . the median of a distribution occurs where the function reaches a cumulative probability of 0.5 . medians from all three p. sojae libraries are similar , varying by less than 4% gc ( figure 1b ) . other moments of the distributions are readily apparent ; the variance is inversely related to the slope at the median value of the function . a useful property of cumulative distribution functions is that any point on the y axis gives the integrated area ( cumulative probability ) under the curve . we use this property to establish experiment - wide false - positive and false - negative rates ( figure 2a ) . in this case , calibration curves from hexamer dissimilarity tests , shown in figure 2b as solid black lines for plant and dashed black lines for stramenopile training sequences are approximately normal . the medians differ considerably , with only about 10% percent overlap in the two distributions ' tails about the neutral t - value of zero . superimposed are comparison curves from p. sojae test sets ( figure 2b ) , which parallel the gc content curves in figure 1b but show slightly less variance . axenic sequences are clearly more like stramenopiles ( b1 ) than plants ( a1 ) in hexamer composition , with all but a small percentage having positive t values . plant - like sequences are as abundant in the mixed library as detected by gc content , about 23% . as expected , the two methods agree , having positively correlated values for gc and t ( r = 0.852 , p < 10 , v = 2,641 ) . looking in more detail at the paired dissimilarity values ( figure 3 ) , the magnitudes of dissimilarity are also apparent , with longer sequences having larger dissimilarity values . blastx similarity searches against the protein sequences in nr , a non - redundant library of proteins revealed that none of the 12 plant - like mycelial transcripts significantly resemble known proteins ( e > 10 ) . among the top ten most plant - like transcripts from the infected g. max library , three had no significant matches , four matched putative arabidopsis thaliana proteins , and three matched known g. max proteins : cytochrome p450 ( accession af022460 , e < 10 ) , methylglyoxalase ( accession p46417 , e < 10 ) , and a ripening related protein ( accession af127110 , e < 10 ) . thus , the majority of the most plant - like transcripts in the infected soybean library strongly resemble characterized plant sequences . analysis results from all p. sojae and mixed - culture transcripts are available as additional data files , grouped by the library from which transcripts were sequenced . figure 4 shows that calibration curves from comparing plant and microbial symbiont training sets have good separation and minimal overlap ( about 10% ) in two of three cases , but not for training set b2 , comprised of zygomycetes and chytridiomycetes , which overlaps considerably with plants ( figure 4b ) . when comparing between plants and bacteria , the error rates are = 0.052 and = 0.084 , much lower than when comparing plants ( a2 , medicago ) with fungi ( b2 , zygomycetes and chytridiomycetes ) . error rates for comparing stramenopiles and p. infestans ests with plants are as in figure 2 ( = 0.088 , = 0.032 ) . also shown in figure 4 all resemble calibration curves from plant sequences , having similar medians and slightly less variance than the plant calibration curves . comparison curves show that the great majority of test sequences are more plant - like than otherwise , with 20% or less resembling microbial symbionts more closely than plants . a greater proportion of microbial sequences is present in the m. truncatula - g . versiforme interaction library ( 20% , figure 4b ) than in the p. medicaginis - infected m. truncatula library ( 5% , figure 4a ) . however , long 's root - hair enriched library ( mtrhe ) had a greater proportion of putative microbial sequences present ( 7% and 25% ) than any of the libraries isolated from symbiont - associated cultures . the axenic and nodulating root libraries had the smallest portion of putative microbial transcripts ( < 2% , figure 4c ) , with the axenic library closely resembling nodulating root libraries . the method of preparing a library can affect the proportion of plant and non - plant sequences , as discussed below . paired dissimilarity values in figure 5 show in greater detail which sequences are more or less like plant and symbiont . considerable variation in the degree of dissimilarity to both training sets is clear , largely due to variation in the length of sequences within test sets . d(b ) in figure 4 , most sequences lie above the identity function , and resemble the plant host more closely than the microbial symbiont . mycorrhizal test sequences are more difficult to differentiate than sequences from the rhizobacterial or pathogenic associations , as seen by the diminished variation about the identity function in mycorrhizal comparisons ( figure 5b ) , contrasted with comparisons from pathogen - infected and nodulating root libraries ( figures 5a and c , respectively ) . analysis results from all m. truncatula and mixed - culture transcripts are available as additional data files , grouped by the library from which transcripts were sequenced , and sorted from the least plant - like transcripts to the most plant - like . clearly , the word - counting approach provides a reliable solution to the problem of source identification with known confidence , and has several significant advantages . the reliability of the method is best justified in terms of the favorable validation test results , and is further corroborated by agreement with an analysis of gc content . in test cases where the correct answer is known a priori , results were correct within error rates expected from overlap in training sets . ( recall that = 0.088 for comparisons between plants and stramenopiles , and = 0.052 for comparisons between plants and bacteria . ) unlike gc content , the problem is clearly resolved by word counting with a threshold value of t = 0 , and with statistical rigor , because false - positive and false - negative rates for a set of comparisons are readily computed from cumulative distributions of dissimilarity between two training sets . optimal statistical power ( minimal false - negative rate ) is ensured when using a likelihood - ratio test statistic , as demonstrated by the pearson - neyman theorem . rather , it is sufficient that the training set be related to , but not necessarily congeners of , the species from which sequences are being compared . sequences from several species of the genus phytophthora were correctly distinguished from plant and bacterial sequences , and three genes from agrobacterium tumefaciens were correctly identified as representing a bacterial sequence . however , several caveats warrant prudence . transcribed sequences that do not encode proteins , but rather catalytic single - stranded rnas such as transfer and ribosomal rnas , should be treated independently because they are more highly conserved across taxa than messenger rnas . also , filtering or trimming of low - complexity repeat regions , such as poly(a ) or poly(t ) tracts , is helpful because comparison results can be influenced by the abundance of a single hexamer . early in our investigations , using one set of training sequences obtained from directionally cloned p. it eventually became clear that , as the p. infestans sequences were all single - pass reads from the 5 ' end of a clone generated with the t3 primer , few sequences complementary to the 3 ' end of the mrna sequence were present in the training set . large amounts of the poly(t ) hexamer would be expected when sequencing reverse complements of mrnas obtained from 3 ' sequences generated with the t7 primer . as a result , any sequence that contained a poly(t ) tract tended to resemble the plant sequences . further , because the error rates for an inference depend on the degree to which calibration curves overlap , the best results are obtained where overlap is minimal . despite these caveats , word counting presents a viable solution to the problem . the p. sojae - infected g. max library provides a clear example of contrast in both hexamer composition and gc content , resulting in readily diagnosed origins . for clear separation between the two species to appear , the two must differ in composition and a detectable proportion of transcripts from each species must be present in the library . to be detectable , the proportion of transcripts present from a particular species must be greater than the error rate obtained from calibration curves . though these criteria are true for the infected g. max library ( t < 0 for < 25% of 927 transcripts ) , they do not appear to be true for the m. truncatula libraries we analyzed ( t < 0 for 8099% of 8903,017 transcripts ) . in the p. medicaginis interaction library the p. sojae - infected library was prepared two days after infection , using a susceptible plant host strain , so as to maximize the number of pathogen transcripts present in the host tissue . medicaginis - infected library was prepared ten days after infection and individual plants varied in their degree of susceptibility ( c. vance , unpublished data ) . plants were also inoculated in a different manner : ground mycelia were dissolved in sterile water and incubated , and the resulting inoculum was pipetted onto the soil surface , rather than the plant . these differences in how tissues were cultured prior to library preparation could have produced the disparate abundance of plant transcripts , though both libraries were prepared from plant tissues infected with phytophthora . for mycorrhizal root libraries , we might explain the relative lack of symbiont sequences as resulting simply from a relative lack of transcripts in the host tissue . we might therefore expect that most of the transcripts therein originate from the plant host . confounding this result , the error rates in this comparison are the greatest among all the comparisons we performed , most likely because the evolutionary distance between fungi ( zygomycetes and chytridiomycetes ) and plants is the least among comparisons . also , zygomycete protein - coding sequences are rare in genbank , which resulted in a small training set for these fungi , and may have amplified any biases . the high false - negative rate probably led to a failure to detect some symbiont transcripts . in nodulating root libraries , we do not expect to observe an abundance of bacterial transcripts , because bacteria generally do not form polyadenylated mrnas . as the protocols used to extract and purify mrnas from tissue lysate for the libraries cited in this study all relied on the presence of polyadenylation sites the abundance of putative microbial symbiont transcripts among sequences from a pure plant root library is difficult to interpret . the predicted portion of microbial transcripts was greater in the axenic root - hair enriched library than in mixed cultures . error rates were greatest for comparisons between training sets from plant and pooled zygomycete and chytridiomycete sequences . the 13% false - positive rate does not completely explain why about 15% of root - hair enriched transcripts resemble fungal hexamer composition more closely than plants , and warrants further study . care had been taken to avoid contaminating plant tissue cultures by culturing seedlings in covered plates . because of concern that ethylene accumulation in covered plates could improperly stimulate nodulation - related gene expression , seedlings were treated with ag2so4 , an inhibitor of the plants ' response to ethylene . inhibition of the ethylene response could have resulted in synthesis of transcripts that are uncharacteristic of plant roots . analysis of another axenic root - hair enriched library , particularly one provided a carbon source to identify potential contaminants , and not treated with an inhibitor of ethylene response , would be an informative test . the transcripts identified as most and least like plant or symbiont might also be studied in more detail as candidate participants in symbiosis . symbiotic interactions , whether pathogenic or mutualistic , present novel challenges to both plant hosts and the biologists who study them . computational approaches , in concert with experimental verification , can help resolve these challenges . to characterize hexamer frequencies in plant hosts and their microbial symbionts , we collected sets of training sequences from public databases and edited them for quality . training sets were chosen to be representative of , but obtained independently from , taxa participating in symbiotic associations for which a diagnosis of origin would be made . because the species being compared are represented unevenly in public sequence databases , taxa were chosen so that roughly the same number of genes were analyzed in each training set , rather than simply to maximize the numbers of species or sequences present . training sets represent protein - coding sequences from three taxonomic groupings : plants ( a1 , medicago and glycine spp . ) , either fungi ( b2 , zygomycetes and chytridiomycetes ) or stramenopiles ( b1 ) , including ests from p. infestans , and bacteria ( b3 , rhizobium , sinorhizobium and bradyrhizobium ) . we performed pairwise comparisons with two different , taxon - specific training sets ( a and b ) to infer the origin of a transcript . training sets were obtained by querying the genbank database using the entrez retrieval tool . a preliminary query by taxon name obtained all available nucleotide sequences from that taxon , then the limits option excluded ests , stss ( sequence - tagged sites ) , gsss ( genome survey sequences ) , working draft sequences , and patented sequences from the query set . organellar ( mitochondrial and chloroplast ) dna was also excluded via the limits option . a query term to require that a sequence contain a protein - coding region ( cds ) was also added , which excluded ribosomal and transfer rna sequences . the results consisted of all sequences that contain a nuclear protein - coding sequence available for that taxon at the time of the query . ( changing slightly the composition of training sets between those dates did not notably affect the experimental outcome . ) following a previously established protocol , we used a resampling procedure to evaluate the degree of overlap between distributions of hexamer composition obtained from comparing two training sets . in this protocol , we resampled each training set 40 times by random partitioning into training ( for hexamer counts ) and test calculation pools . to control for any bias introduced by length variation , a program randomly clipped 300 nucleotide fragments for word counting . as a result , one random 300 nucleotide fragment from each training sequence was present in the training set during a single resampling replicate ; independent replicates contained different , randomly chosen training sequences and 300 nucleotide fragments . values of the test statistic from 40 resampled replicates were pooled for calibration purposes . as with the original protocol , we pooled the resulting test statistic distributions , normalized them as cumulative distributions , and then evaluated them for overlap . we call the resulting comparisons ' calibration curves ' , as they are not used directly to make inferences , but rather indirectly , to evaluate the degree of separation in hexamer counts from different taxa . overlap of calibration curves should be minimal to yield the most statistically powerful results possible . due to considerable overlap of calibration curves between taxonomically general , inclusive training sets ( that is , all eudicots , all fungi and miscellaneous eukaryotes , and all eubacteria , data not shown ) , we opted to work with specific training sets that included only the most species - specific sequences available , while maintaining approximately equal sample sizes across taxa . the most challenging case was that of the arbuscular mycorrhizal fungi , for which very few protein - coding sequences are available . to increase the amount of data in this training set ( b2 ) without biasing sample sizes , we pooled sequences from all species in the zygomycetes with all available chytridiomycete coding sequences , and compared this training set with a set from a single plant genus , medicago ( a2 ) . we chose this option , rather than including an arbitrary subset of sequences from the ascomycetes and basidiomycetes , because zygomycetes and chytridiomycetes have diverged from their common ancestor less recently than the ascomycetes and basidiomycetes , based on 18s ribosomal rna sequence data . that is , the ascomycetes and basidiomycetes are more highly derived from the common fungal ancestor than zygomycetes and chytridiomycetes , which resemble more closely the ancestral state in modern lineages . starting with a full set of sequences , we filtered for high - quality sequences by trimming regions having extensive ambiguous bases ( n - rich ) and poly(a ) or poly(t ) regions . thus , we trimmed poly(a ) and poly(t ) sites to minimize the cases in which a test sequence resembles one training set more closely than the other , simply by virtue of having an abundance of the hexamer aaaaaa or tttttt . similarly , test results obtained from short or n - rich sequences can be difficult to interpret . we allowed no more than one n per hexamer and trimmed poly(a ) or poly(t ) tracts longer than 13 nucleotides . to accommodate for possible sequence chimeras , those sequences found to contain an internal poly(a ) or poly(t ) segment longer than 13 nucleotides were partitioned into two fragments , and the longer of the two fragments was used in analysis , provided its length was at least 300 nucleotides . after trimming , we screened all remaining sequences of 300 nt or longer for similarity to escherichia coli using blastn . all blast searches used default parameters and low - complexity filtering with the programs dust or seg . the decision to exclude non - coding rna sequences from training sets was informed by the appearance of bimodal distributions of hexamer frequencies and a large degree of overlap between calibration curves ( data not shown ) , likely a result of divergent evolutionary rates between protein - coding and non - coding sequences . chloroplast and mitochondrial sequences were eliminated to avoid complications due to variation in codon usage between nuclear and organellar genomes . table 2 summarizes counts of sequences and nucleotides in training sets before and after trimming and screening . to test the validity of word counting as a solution to the problem , we identified a set of 50 gene sequences from plants ( m. truncatula and g. max ) , oomycetes ( phytophthora ) , zygomycetes ( glomus versiforme ) , and bacteria ( sinorhizobium meliloti and agrobacterium tumefaciens ) , for which the function and origin have been characterized experimentally . we chose genes known to play a role in plant - microbe interactions , as well as genes that are found across taxa . we withheld these sequences , and partial transcripts of the same genes , from training sets prior to comparative lexical analysis , and calculated hexamer dissimilarities for each of the three training sets as described below . to diagnose the species of origin for sequences expressed in symbiotic cultures , we collected sequences generated by distinct est sequencing projects from the genbank database . sequences from pathogenic interactions originated from cultures of a species from the genus phytophthora with its plant host , such as p. sojae and soybean ( g. max ) isolated from inoculated hypocotyls two days after infection and p. medicaginis and m. truncatula isolated from infected roots 10 days after infection ( c. vance , unpublished data ) . sequences expressed during mutualistic interactions were obtained from cultures with m. truncatula and mycorrhizal ( glomus versiforme ; m.j . harrison , unpublished data ) or rhizobacterial ( s. meliloti ; k. vandenbosch , unpublished data ) endosymbionts several days after inoculation . sequences expressed in pure , axenic cultures from p. sojae mycelia and zoospores and from sterile , uninoculated m. truncatula roots provided a basis for comparison in which no foreign transcripts were expected . to maximize the reliability of diagnostic comparisons , we screened test sequences for high quality as for training sequences , and for low similarity to e. coli , chloroplast and mitochondrial genes , and non - coding rna transcripts ( ribosomal and transfer rnas ) . independent blastn comparisons identified sequences having very high similarity ( e < 10 ) to vector sequences or moderately high similarity ( e < 10 ) to non - nuclear or non - coding sequences obtained from genbank . we wrote a perl program ( countgc.pl ) that calculates the gc base content of a sequence as the portion of guanine and cytosine residues among all unambiguous ( non - n ) nucleotides in a sequence . the hist method in r , version 1.1.1 aggregated continuous percentages into discrete histogram bins , using bin sizes of 2% difference in gc , with inclusive lower bin boundaries and exclusive upper bounds ; the lm method tested for linear correlation of the dissimilarity test statistic t with gc . used a likelihood - ratio test to determine whether word frequencies from a particular sequence more closely resemble the frequency distribution of control data sets from the taxon being sequenced or a distantly related outgroup . they computed a test statistic t(a , b , x ) for each sequence x as the difference of log - likelihood ratio dissimilarity measures , d(a , x ) = -2log(a , x ) , for two data sets , a control set a and an outgroup b , such that t(a , b , x ) = d(a , x ) - d(b , x ) . a negative value for t indicates that the sequence more closely resembles words from a ; conversely , a positive value indicates a likely contaminant related to b. ( dissimilarity is conceptually related to distance . however , dissimilarity does not measure distance because it does not possess the mathematical properties of a distance metric . ) unlike the calculation of calibration curves , in which 300-nucleotide subsequences are randomly resampled , hexamer dissimilarity is measured over the whole length of a test sequence when inferring a transcript 's origin . originally , the investigators used the null hypothesis that no difference exists for dissimilarity measures between the two data sets , or that t(a , b , x ) = 0 . tested two alternative hypotheses : that t < 0 , being more like a , or t > 0 , like b. lexical analysis using pentamers or heptamers yields similar error rates and very highly correlated values for the test result ( not shown ) . because white et al . reported the best results were obtained using hexamers , and because a word size of six nucleotides corresponds to the size of a dicodon , we chose to analyze hexamer frequencies . to use longer words requires more training data , because the number of possible words increases exponentially with increasing word size . use of shorter words may be adequate for some applications and will be investigated in future work . though we used white 's word - counting methods , we did make slight modifications . we simplified one program ( called hybridize ) to compute individual dissimilarity values , rather than paired differences ; a patch that details how to modify the c program is available ( see hyb2dis.txt in additional data files ) . more importantly , we amended the null hypothesis and interpreted calibration curves to test for statistically significant dissimilarity differences . though the likelihood - ratio test statistic indicates the magnitude of similarity to a or b , we do not know what values for t are significant with known confidence . when testing hypotheses , one can make two types of error : type i , or false positives , and type ii , false negatives . the false - positive rate is denoted and false - negative rate . we determine and from overlap in the calibration curves . inferring error rates from calibration curves is justified because we know the correct answer and determine the error rate via resampling , as with bootstrap methods to infer error rates or confidence intervals . we are interested in knowing from which of two organisms a sequence originated , and are reasonably confident that it came from either one or the other . thus , we assume it came from one and test whether we have evidence to refute this assumption . the null hypothesis here is that sequence x is from a. alternatively , it might be from b. evaluating the calibration curve overlap at t = 0 quantifies the associated error rates . the cumulative distribution function ( cdf ) of taxon b specifies where cdfb intersects 0 ; the cdf from a specifies as 1-cdfa(0 ) . we can thus resolve the problem with known confidence p : p ( t > 0 ) = . all other computations were performed as described previously . software used for lexical analysis was obtained via anonymous ftp from the tigr software ftp site . to characterize hexamer frequencies in plant hosts and their microbial symbionts , we collected sets of training sequences from public databases and edited them for quality . training sets were chosen to be representative of , but obtained independently from , taxa participating in symbiotic associations for which a diagnosis of origin would be made . because the species being compared are represented unevenly in public sequence databases , taxa were chosen so that roughly the same number of genes were analyzed in each training set , rather than simply to maximize the numbers of species or sequences present . training sets represent protein - coding sequences from three taxonomic groupings : plants ( a1 , medicago and glycine spp . ) , either fungi ( b2 , zygomycetes and chytridiomycetes ) or stramenopiles ( b1 ) , including ests from p. infestans , and bacteria ( b3 , rhizobium , sinorhizobium and bradyrhizobium ) . we performed pairwise comparisons with two different , taxon - specific training sets ( a and b ) to infer the origin of a transcript . training sets were obtained by querying the genbank database using the entrez retrieval tool . a preliminary query by taxon name obtained all available nucleotide sequences from that taxon , then the limits option excluded ests , stss ( sequence - tagged sites ) , gsss ( genome survey sequences ) , working draft sequences , and patented sequences from the query set . organellar ( mitochondrial and chloroplast ) dna was also excluded via the limits option . a query term to require that a sequence contain a protein - coding region ( cds ) was also added , which excluded ribosomal and transfer rna sequences . the results consisted of all sequences that contain a nuclear protein - coding sequence available for that taxon at the time of the query . ( changing slightly the composition of training sets between those dates did not notably affect the experimental outcome . ) following a previously established protocol , we used a resampling procedure to evaluate the degree of overlap between distributions of hexamer composition obtained from comparing two training sets . in this protocol , we resampled each training set 40 times by random partitioning into training ( for hexamer counts ) and test calculation pools . to control for any bias introduced by length variation , a program randomly clipped 300 nucleotide fragments for word counting . as a result , one random 300 nucleotide fragment from each training sequence was present in the training set during a single resampling replicate ; independent replicates contained different , randomly chosen training sequences and 300 nucleotide fragments . values of the test statistic from 40 resampled replicates were pooled for calibration purposes . as with the original protocol , we pooled the resulting test statistic distributions , normalized them as cumulative distributions , and then evaluated them for overlap . we call the resulting comparisons ' calibration curves ' , as they are not used directly to make inferences , but rather indirectly , to evaluate the degree of separation in hexamer counts from different taxa . overlap of calibration curves should be minimal to yield the most statistically powerful results possible . due to considerable overlap of calibration curves between taxonomically general , inclusive training sets ( that is , all eudicots , all fungi and miscellaneous eukaryotes , and all eubacteria , data not shown ) , we opted to work with specific training sets that included only the most species - specific sequences available , while maintaining approximately equal sample sizes across taxa . the most challenging case was that of the arbuscular mycorrhizal fungi , for which very few protein - coding sequences are available . to increase the amount of data in this training set ( b2 ) without biasing sample sizes , we pooled sequences from all species in the zygomycetes with all available chytridiomycete coding sequences , and compared this training set with a set from a single plant genus , medicago ( a2 ) . we chose this option , rather than including an arbitrary subset of sequences from the ascomycetes and basidiomycetes , because zygomycetes and chytridiomycetes have diverged from their common ancestor less recently than the ascomycetes and basidiomycetes , based on 18s ribosomal rna sequence data . that is , the ascomycetes and basidiomycetes are more highly derived from the common fungal ancestor than zygomycetes and chytridiomycetes , which resemble more closely the ancestral state in modern lineages . starting with a full set of sequences , we filtered for high - quality sequences by trimming regions having extensive ambiguous bases ( n - rich ) and poly(a ) or poly(t ) regions . thus , we trimmed poly(a ) and poly(t ) sites to minimize the cases in which a test sequence resembles one training set more closely than the other , simply by virtue of having an abundance of the hexamer aaaaaa or tttttt . similarly , test results obtained from short or n - rich sequences can be difficult to interpret . we allowed no more than one n per hexamer and trimmed poly(a ) or poly(t ) tracts longer than 13 nucleotides . to accommodate for possible sequence chimeras , those sequences found to contain an internal poly(a ) or poly(t ) segment longer than 13 nucleotides were partitioned into two fragments , and the longer of the two fragments was used in analysis , provided its length was at least 300 nucleotides . after trimming , we screened all remaining sequences of 300 nt or longer for similarity to escherichia coli using blastn . all blast searches used default parameters and low - complexity filtering with the programs dust or seg . the decision to exclude non - coding rna sequences from training sets was informed by the appearance of bimodal distributions of hexamer frequencies and a large degree of overlap between calibration curves ( data not shown ) , likely a result of divergent evolutionary rates between protein - coding and non - coding sequences . chloroplast and mitochondrial sequences were eliminated to avoid complications due to variation in codon usage between nuclear and organellar genomes . table 2 summarizes counts of sequences and nucleotides in training sets before and after trimming and screening . to test the validity of word counting as a solution to the problem , we identified a set of 50 gene sequences from plants ( m. truncatula and g. max ) , oomycetes ( phytophthora ) , zygomycetes ( glomus versiforme ) , and bacteria ( sinorhizobium meliloti and agrobacterium tumefaciens ) , for which the function and origin have been characterized experimentally . we chose genes known to play a role in plant - microbe interactions , as well as genes that are found across taxa . we withheld these sequences , and partial transcripts of the same genes , from training sets prior to comparative lexical analysis , and calculated hexamer dissimilarities for each of the three training sets as described below . to characterize hexamer frequencies in plant hosts and their microbial symbionts , we collected sets of training sequences from public databases and edited them for quality . training sets were chosen to be representative of , but obtained independently from , taxa participating in symbiotic associations for which a diagnosis of origin would be made . because the species being compared are represented unevenly in public sequence databases , taxa were chosen so that roughly the same number of genes were analyzed in each training set , rather than simply to maximize the numbers of species or sequences present . training sets represent protein - coding sequences from three taxonomic groupings : plants ( a1 , medicago and glycine spp . ) , either fungi ( b2 , zygomycetes and chytridiomycetes ) or stramenopiles ( b1 ) , including ests from p. infestans , and bacteria ( b3 , rhizobium , sinorhizobium and bradyrhizobium ) . we performed pairwise comparisons with two different , taxon - specific training sets ( a and b ) to infer the origin of a transcript . training sets were obtained by querying the genbank database using the entrez retrieval tool . a preliminary query by taxon name obtained all available nucleotide sequences from that taxon , then the limits option excluded ests , stss ( sequence - tagged sites ) , gsss ( genome survey sequences ) , working draft sequences , and patented sequences from the query set . organellar ( mitochondrial and chloroplast ) dna was also excluded via the limits option . a query term to require that a sequence contain a protein - coding region ( cds ) was also added , which excluded ribosomal and transfer rna sequences . the results consisted of all sequences that contain a nuclear protein - coding sequence available for that taxon at the time of the query . ( changing slightly the composition of training sets between those dates did not notably affect the experimental outcome . ) following a previously established protocol , we used a resampling procedure to evaluate the degree of overlap between distributions of hexamer composition obtained from comparing two training sets . in this protocol , we resampled each training set 40 times by random partitioning into training ( for hexamer counts ) and test calculation pools . to control for any bias introduced by length variation , a program randomly clipped 300 nucleotide fragments for word counting . as a result , one random 300 nucleotide fragment from each training sequence was present in the training set during a single resampling replicate ; independent replicates contained different , randomly chosen training sequences and 300 nucleotide fragments . values of the test statistic from 40 resampled replicates were pooled for calibration purposes . as with the original protocol , we pooled the resulting test statistic distributions , normalized them as cumulative distributions , and then evaluated them for overlap . we call the resulting comparisons ' calibration curves ' , as they are not used directly to make inferences , but rather indirectly , to evaluate the degree of separation in hexamer counts from different taxa . overlap of calibration curves should be minimal to yield the most statistically powerful results possible . due to considerable overlap of calibration curves between taxonomically general , inclusive training sets ( that is , all eudicots , all fungi and miscellaneous eukaryotes , and all eubacteria , data not shown ) , we opted to work with specific training sets that included only the most species - specific sequences available , while maintaining approximately equal sample sizes across taxa . the most challenging case was that of the arbuscular mycorrhizal fungi , for which very few protein - coding sequences are available . to increase the amount of data in this training set ( b2 ) without biasing sample sizes , we pooled sequences from all species in the zygomycetes with all available chytridiomycete coding sequences , and compared this training set with a set from a single plant genus , medicago ( a2 ) . we chose this option , rather than including an arbitrary subset of sequences from the ascomycetes and basidiomycetes , because zygomycetes and chytridiomycetes have diverged from their common ancestor less recently than the ascomycetes and basidiomycetes , based on 18s ribosomal rna sequence data . that is , the ascomycetes and basidiomycetes are more highly derived from the common fungal ancestor than zygomycetes and chytridiomycetes , which resemble more closely the ancestral state in modern lineages . starting with a full set of sequences , we filtered for high - quality sequences by trimming regions having extensive ambiguous bases ( n - rich ) and poly(a ) or poly(t ) regions . thus , we trimmed poly(a ) and poly(t ) sites to minimize the cases in which a test sequence resembles one training set more closely than the other , simply by virtue of having an abundance of the hexamer aaaaaa or tttttt . similarly , test results obtained from short or n - rich sequences can be difficult to interpret . we allowed no more than one n per hexamer and trimmed poly(a ) or poly(t ) tracts longer than 13 nucleotides . to accommodate for possible sequence chimeras , those sequences found to contain an internal poly(a ) or poly(t ) segment longer than 13 nucleotides were partitioned into two fragments , and the longer of the two fragments was used in analysis , provided its length was at least 300 nucleotides . after trimming , we screened all remaining sequences of 300 nt or longer for similarity to escherichia coli using blastn . all blast searches used default parameters and low - complexity filtering with the programs dust or seg . the decision to exclude non - coding rna sequences from training sets was informed by the appearance of bimodal distributions of hexamer frequencies and a large degree of overlap between calibration curves ( data not shown ) , likely a result of divergent evolutionary rates between protein - coding and non - coding sequences . chloroplast and mitochondrial sequences were eliminated to avoid complications due to variation in codon usage between nuclear and organellar genomes . table 2 summarizes counts of sequences and nucleotides in training sets before and after trimming and screening . to test the validity of word counting as a solution to the problem , we identified a set of 50 gene sequences from plants ( m. truncatula and g. max ) , oomycetes ( phytophthora ) , zygomycetes ( glomus versiforme ) , and bacteria ( sinorhizobium meliloti and agrobacterium tumefaciens ) , for which the function and origin have been characterized experimentally . we chose genes known to play a role in plant - microbe interactions , as well as genes that are found across taxa . we withheld these sequences , and partial transcripts of the same genes , from training sets prior to comparative lexical analysis , and calculated hexamer dissimilarities for each of the three training sets as described below . to diagnose the species of origin for sequences expressed in symbiotic cultures , we collected sequences generated by distinct est sequencing projects from the genbank database . sequences from pathogenic interactions originated from cultures of a species from the genus phytophthora with its plant host , such as p. sojae and soybean ( g. max ) isolated from inoculated hypocotyls two days after infection and p. medicaginis and m. truncatula isolated from infected roots 10 days after infection ( c. vance , unpublished data ) . sequences expressed during mutualistic interactions were obtained from cultures with m. truncatula and mycorrhizal ( glomus versiforme ; m.j . harrison , unpublished data ) or rhizobacterial ( s. meliloti ; k. vandenbosch , unpublished data ) endosymbionts several days after inoculation . sequences expressed in pure , axenic cultures from p. sojae mycelia and zoospores and from sterile , uninoculated m. truncatula roots provided a basis for comparison in which no foreign transcripts were expected . to maximize the reliability of diagnostic comparisons , we screened test sequences for high quality as for training sequences , and for low similarity to e. coli , chloroplast and mitochondrial genes , and non - coding rna transcripts ( ribosomal and transfer rnas ) . independent blastn comparisons identified sequences having very high similarity ( e < 10 ) to vector sequences or moderately high similarity ( e < 10 ) to non - nuclear or non - coding sequences obtained from genbank . we wrote a perl program ( countgc.pl ) that calculates the gc base content of a sequence as the portion of guanine and cytosine residues among all unambiguous ( non - n ) nucleotides in a sequence . the hist method in r , version 1.1.1 aggregated continuous percentages into discrete histogram bins , using bin sizes of 2% difference in gc , with inclusive lower bin boundaries and exclusive upper bounds ; the lm method tested for linear correlation of the dissimilarity test statistic t with gc . white et al . used a likelihood - ratio test to determine whether word frequencies from a particular sequence more closely resemble the frequency distribution of control data sets from the taxon being sequenced or a distantly related outgroup . they computed a test statistic t(a , b , x ) for each sequence x as the difference of log - likelihood ratio dissimilarity measures , d(a , x ) = -2log(a , x ) , for two data sets , a control set a and an outgroup b , such that t(a , b , x ) = d(a , x ) - d(b , x ) . a negative value for t indicates that the sequence more closely resembles words from a ; conversely , a positive value indicates a likely contaminant related to b. ( dissimilarity is conceptually related to distance . however , dissimilarity does not measure distance because it does not possess the mathematical properties of a distance metric . ) unlike the calculation of calibration curves , in which 300-nucleotide subsequences are randomly resampled , hexamer dissimilarity is measured over the whole length of a test sequence when inferring a transcript 's origin . originally , the investigators used the null hypothesis that no difference exists for dissimilarity measures between the two data sets , or that t(a , b , x ) = 0 . white et al . tested two alternative hypotheses : that t < 0 , being more like a , or t > 0 , like b. lexical analysis using pentamers or heptamers yields similar error rates and very highly correlated values for the test result ( not shown ) . because white et al . reported the best results were obtained using hexamers , and because a word size of six nucleotides corresponds to the size of a dicodon , we chose to analyze hexamer frequencies . to use longer words requires more training data , because the number of possible words increases exponentially with increasing word size . use of shorter words may be adequate for some applications and will be investigated in future work . though we used white 's word - counting methods , we did make slight modifications . we simplified one program ( called hybridize ) to compute individual dissimilarity values , rather than paired differences ; a patch that details how to modify the c program is available ( see hyb2dis.txt in additional data files ) . more importantly , we amended the null hypothesis and interpreted calibration curves to test for statistically significant dissimilarity differences . though the likelihood - ratio test statistic indicates the magnitude of similarity to a or b , we do not know what values for t are significant with known confidence . when testing hypotheses , one can make two types of error : type i , or false positives , and type ii , false negatives . the false - positive rate is denoted and false - negative rate . we determine and from overlap in the calibration curves . inferring error rates from calibration curves is justified because we know the correct answer and determine the error rate via resampling , as with bootstrap methods to infer error rates or confidence intervals . we are interested in knowing from which of two organisms a sequence originated , and are reasonably confident that it came from either one or the other . thus , we assume it came from one and test whether we have evidence to refute this assumption . the null hypothesis here is that sequence x is from a. alternatively , it might be from b. evaluating the calibration curve overlap at t = 0 quantifies the associated error rates . the cumulative distribution function ( cdf ) of taxon b specifies where cdfb intersects 0 ; the cdf from a specifies as 1-cdfa(0 ) . we can thus resolve the problem with known confidence p : p ( t > 0 ) = . all other computations were performed as described previously . software used for lexical analysis was obtained via anonymous ftp from the tigr software ftp site . the following files are available for download : countgc.pl : perl script used to compute gc content of sequences analyzed . hyb2dis.txt : patch file that converts white 's hybridize program to compute individual dissimilarity values . training sets ( glycinemedicago.txt,rhizobia.txt , stramenopiles.txt , zygochytrid.txt ) : fasta - formatted text files that contain the sequences used for calibration and comparison . test sets ( psojaeha.txt , psojaemy.txt , psojaezo.txt , mtrhe.txt , dsir.txt , mham.txt , kv0.txt , kv2.txt , kv3.txt ) : fasta - formatted text files containing transcripts analyzed , edited for quality . test results ( psojaeha.dat , psojaemy.dat , psojaezo.dat , mtrhe-a1b1.dat , mtrhe-a2b2.dat , dsir.dat , mham.dat , kv0.dat , kv2.dat , kv3.dat ) : text files that contain transcript analysis results , sorted from least to most plant - like . fasta - formatted text files containing transcripts analyzed , edited for quality . text files that contain transcript analysis results , sorted from least to most plant - like . we thank callum bell , mark gijzen , maria harrison , tom kepler , deb samac , and bruno sobral for valued discussions and feedback . comments from b. m. tyler and an anonymous reviewer on an earlier version of this work greatly enhanced its presentation . distribution of gc content in pure and mixed - culture libraries . ( a ) probability densities for histogram bin sizes of 0.02 ( 2% ) in base content . ( a ) calculation of statistical parameters from cdfs a and b. overlap in the upper tail of cdfa with cdfb and the lower tail of cdfb with cdfa are likely regions for error . we find the false - positive rate where 1 - cdfa intersects 0 [ cdfa(0)= 1 - ] , and the false - negative rate where cdfb crosses 0 . also shown are the medians ( ) for each distribution , where cdf( ) = 0.5 . , solid black line ) and stramenopile plus p. infestans est ( b1 , dashed black line ) training sequences . superimposed distributions of test results show dissimilarity differences for infected g. max ( green ) and axenic p. sojae mycelial and zoospore sequences ( blue and cyan , respectively ) . each point corresponds to an expressed tag from either ( a ) infected g. max or ( b ) axenic p. sojae mycelial or ( c ) zoospore sequences , compared with plant ( a1 ) and stramenopile plus p. infestans est training sequences ( b1 ) . the identity function indicates equal dissimilarity to both training sets , t = d(a ) - d(b)= 0 . calibration curves compare plant training sets ( a1 and a2 , solid black lines ) with one of three microbial symbiont training sets ( broken black lines ) : ( a ) stramenopile and p. infestans est sequences ( b1 ) ; ( b ) pooled zygomycete and chytridiomycete coding sequences ( b2 ) ; and ( c ) sequences from the genera rhizobium , sinorhizobium and bradyrhizobium ( b3 ) . cumulative distributions of test results from m. truncatula axenic and microbial symbiont mixed cultures appear in each panel ( colored lines ) . each point indicates the dissimilarity of a test sequence compared with a plant training set ( a1 or a2 ) and one of three microbial symbiont training sets : ( a ) stramenopile and p. infestans est sequences ( b1 ) ; ( b ) pooled zygomycete and chytridiomycete coding sequences ( b2 ) ; and ( c ) sequences from the genera rhizobium , sinorhizobium and bradyrhizobium ( b3 ) . sequences from m. truncatula axenic ( green ) and microbial symbiont mixed culture libraries are represented in each panel . number of sequences ( n ) and nucleotides ( nt ) , as raw , trimmed ( removed n - rich regions , poly(a ) and poly(t ) sites ) , and screened sequences ( removed ribosomal , chloroplast , and mitochondrial dna and remaining sequences shorter than 300 nucleotides ) . number of est sequences ( n ) and nucleotides ( nt ) as raw , trimmed ( limited lengths of n - rich regions , poly(a ) and poly(t ) sites ) , and screened ( removed ribosomal , chloroplast , and mitochondrial dna , and remaining sequences shorter than 300 nt ) sequences .

backgroundmost organisms have developed ways to recognize and interact with other species . symbiotic interactions range from pathogenic to mutualistic . some molecular mechanisms of interspecific interaction are well understood , but many remain to be discovered . expressed sequence tags ( ests ) from cultures of interacting symbionts can help identify transcripts that regulate symbiosis , but present a unique challenge for functional analysis . given a sequence expressed in an interaction between two symbionts , the challenge is to determine from which organism the transcript originated . for high - throughput sequencing from interaction cultures , a reliable computational approach is needed . previous investigations into gc nucleotide content and comparative similarity searching provide provisional solutions , but a comparative lexical analysis , which uses a likelihood - ratio test of hexamer counts , is more powerful.resultsvalidation with genes whose origin and function are known yielded 94% accuracy . microbial ( non - plant ) transcripts comprised 75% of a phytophthora sojae - infected soybean ( glycine max cv harasoy ) library , contrasted with 15% or less in root tissue libraries of medicago truncatula from axenic , phytophthora medicaginis - infected , mycorrhizal , and rhizobacterial treatments . mycorrhizal libraries contained about 23% microbial transcripts ; an axenic plant library contained a similar proportion of putative microbial transcripts.conclusionscomparative lexical analysis offers numerous advantages over alternative approaches . many of the transcripts isolated from mixed cultures were of unknown function , suggesting specificity to symbiotic metabolism and therefore candidates likely to be interesting for further functional investigation . future investigations will determine whether the abundance of non - plant transcripts in a pure plant library indicates procedural artifacts , horizontally transferred genes , or other phenomena .

studies of wld , an aberrant fusion protein with critical nicotinamide mononucleotide adenylyltransferase ( nmnat ) activity responsible for the slow wallerian degeneration phenotype , indicate this often shares molecular features with injury - induced axon degeneration ( conforti et al . , 2014 ) . new , endogenous regulators of wallerian degeneration have emerged , so establishing interactions among them will be important for developing appropriate therapies ( conforti et al . , 2014 ; neukomm and freeman , 2014 ; pease and segal , 2014 ) . while a conserved pathway is emerging , the relationship between nmnat2 and sterile alpha and tir motif containing 1 ( sarm1 ) , key regulators of axon degeneration with opposing influences , is still unknown ( conforti et al . , 2014 ) . each robustly delays wallerian degeneration when re - localized or sufficiently overexpressed ( mack et al . , 2001 ; milde et al . , 2013 2009 ) , but only depletion of nmnat2 , not nmnat1 or nmnat3 , triggers wld - sensitive neurite degeneration in neuronal cultures ( gilley and coleman , 2010 ) . this suggests nmnat2 is the isoform that contributes most to axon survival in a physiological context . drosophila nmnat ortholog , dnmnat , appears to have a similar role in flies ( fang et al . , 2012 ) . early loss of short - lived nmnat2 in injured axons , prior to frank degeneration , has thus been proposed as a trigger for wld - sensitive axon degeneration and the point of wld influence ( conforti et al . , 2014 ; gilley and coleman , 2010 ) . this is supported by studies that show that a critical requirement for phr1/highwire ubiquitin ligase during wallerian degeneration may be linked to its regulation of nmnat2/dnmnat turnover ( babetto et al . , 2013 ; xiong et al . , 2012 ) and the proposal that accumulation of the nmnat substrate nmn , a predicted consequence of nmnat2 loss , acts as a pro - degenerative signal ( di stefano et al . , 2014 ) . severe truncation of peripheral nerve axons and cns axon tracts in nmnat2-deficient embryos , likely responsible for their perinatal lethality , is also consistent with a critical axon survival function for nmnat2 in vivo ( gilley et al . , 2013 ; hicks et al . , 2012 ) importantly , though , this developmental phenotype appears to be primarily due to an initial outgrowth defect rather than dying - back degeneration of established axons ( gilley et al . , 2013 ) . it is required for the normal , rapid progression of degeneration after injury and other wld - sensitive insults ( gerdts et al . , 2013 ; osterloh et al . , 2012 ) . multimerization , mediated by its sam ( sterile motif ) domain , appears to be required for a pro - degenerative function dependent on its tir ( toll - interleukin-1 receptor ) domain ( gerdts et al . , 2013 ) . crucially , sarm1 depletion is currently the only known manipulation that delays wld - sensitive axon degeneration as robustly as expression of wld or other nmnats . in this study , we used axon injury in nerves and neurons from sarm1 mice to establish the relationship between nmnat2 loss and a sarm1-dependent function during wld - sensitive degeneration . remarkably , we also find that mice lacking both nmnat2 and sarm1 are viable , enabling us to examine the mechanistic origins of the developmental axon outgrowth defect associated with constitutive nmnat2 deficiency . nmnat2 levels have previously been found to decline rapidly in the distal stumps of transected wild - type scg and drg neurites prior to their degeneration at 8 hr ( gilley and coleman , 2010 ; yang et al . , 2013 ) . here , we find equivalent loss of nmnat2 in wild - type and sarm1 scg neurites by 4 hr after cut ( figure 1a ) , even though degeneration of transected sarm1 neurites is delayed for at least 3 days ( osterloh et al . , 2012 ) . levels of the nmnat substrate , nmn , and product , nad , have also been shown to respectively rise and fall in the distal stumps of transected wild - type sciatic nerves ( di stefano et al . , 2014 ) prior to axon degeneration , which occurs at around 36 hr ( beirowski et al . , 2005 ) . this is consistent with a predicted loss of nmnat2 in injured axons in vivo . here , we find that these changes are not prevented in sarm1 nerves at 30 hr after lesion ( figure 1b ) , despite sarm1 axons being preserved for at least 14 days ( osterloh et al . , 2012 ) . in fact , by 30 hr , nmn has risen significantly more than in wild - type nerves , and by 120 hr , nad levels have dropped below those in wild - type nerves at 30 hr ( a short time before they degenerate ) . together , these data suggest sarm1 promotes wallerian degeneration downstream or independently of nmnat2 loss and consequent changes in nmn and nad levels . although nmnat2 loss has been strongly implicated as a trigger for wallerian degeneration , this is difficult to prove definitively , as injury induces many simultaneous changes . we therefore assessed whether sarm1 is required during related , wld - sensitive axon degeneration induced specifically by small interfering rna ( sirna)-mediated depletion of nmnat2 ( gilley and coleman , 2010 ) . we found distal neurites of sarm1 neurons are completely protected from nmnat2 sirna - induced degeneration for at least 72 hr , and also from the later , slower loss of cell viability ( figures 1c and 1d ) . nmnat2 depletion can thus trigger sarm1-dependent axon degeneration in the absence of injury or other initiating stimuli supporting a situation in which either sarm1 itself , or a sarm1-dependent activity of a convergent pathway , promotes wld - sensitive axon degeneration downstream of nmnat2 loss . we next bred mice doubly homozygous for the nmnat2 gene trap allele ( effectively a null allele ; gilley et al . , 2013 ) and a sarm1 knockout allele ( kim et al . , 2007 ) to investigate whether sarm1 might also contribute to axon defects associated with constitutive nmnat2 deficiency during development . intriguingly , whole - mount labeling of distal phrenic nerve branches in the diaphragm and of intercostal nerves in nmnat2;sarm1 embryos / newborn pups revealed clear and reproducible rescue of the peripheral nerve axon truncation defect associated with nmnat2 deficiency in nmnat2 animals ( figures 2a and 2b ) . the underlying cause of this defect in nmnat2 embryos is restricted axon extension ( gilley et al . , 2013 ) ; therefore , to obtain a quantitative measure of rescue by sarm1 deficiency , we compared neurite outgrowth in scg explant cultures from nmnat2 and nmnat2;sarm1 embryos with that of relevant controls ( figures 2c and 2d ) . strikingly , nmnat2;sarm1 neurite outgrowth matched that in sarm1 and nmnat2;sarm1 littermate cultures , as well as in wild - type and nmnat2 cultures assessed in parallel . the axon extension defect associated with a lack of nmnat2 thus appears fully corrected in late - stage embryos and newborn mice deficient for sarm1 . consistent with this , while nmnat2 ( and nmnat2;sarm1 ) pups die at birth , nmnat2;sarm1 mice in contrast are viable and reach weaning at the expected mendelian ratios ( figure 2e ) . adult nmnat2;sarm1 mice are also fertile and , despite subtle gender- and sarm1-genotype - specific differences , their weights at 10 weeks are within a healthy range and similar to control groups ( figure 2f ) . crucially , rt - pcr and immunoblotting confirmed that the nmnat2 allele remains effectively silenced on a sarm1 background ( figures 2 g and 2h ) . this rules out reduced efficacy of the gene trap as being responsible for rescue of the phenotype . as in injured nerves , sarm1 deficiency does not prevent expected changes to nmnat metabolites in the brains of embryos lacking nmnat2 ( figure 3a ) . in fact , the relative increase in nmn in nmnat2;sarm1 brains is greater than in nmnat2 brains , presumably due to rescued outgrowth of cns axons , where changes , away from the influence of nuclear nmnat1 , should be greatest . a small , but significant , reduction in nad is also evident in nmnat2;sarm1 brains . in contrast , heterozygosity for the nmnat2 allele does not significantly alter brain nmn or nad levels on either sarm1 background . interestingly , there is a trend toward higher nmn and nad levels in sarm1 brains , independent of nmnat2-related changes , and the total adenylate pool ( atp + adp + amp ) is increased ( 1,764 113 nmol / g tissue in sarm1 brains compared to 1,314 97 in sarm1 brains ; p = 0.009 ) . thus , sarm1 itself may have some influence over nad and/or energy metabolism . in case the complexity of whole brain concealed more marked changes specifically in axons , we also assessed nucleotide levels separately in drg neurites and ganglia ( figures 3b and s1 ) . indeed , consistent with nmnat2 being the major axonal nmnat , we detected a greater relative increase in nmn and decrease in nad in nmnat2;sarm1 neurites than in brains . in contrast , changes in ganglia fractions were far more modest , indicating nmnat2 has less influence in the cell body ( and associated proximal neurite stumps ) . surprisingly , accumulation of nmn was not evident in the limited neurite outgrowth in nmnat2 cultures . however , the nmn / nad ratio is increased to the same extent as in nmnat2;sarm1 neurites , due to a much greater reduction in nad , consistent with comparable loss of nmnat activity . we speculate that , even though stunted nmnat2 neurites do not show signs of overt degeneration , their integrity could still be compromised , resulting in nmn and nad efflux and the lower than expected levels of both nucleotides . low nad in nmnat2 ganglia fractions suggests this may also extend to proximal neurite stumps and possibly even cell bodies . finally , as in brains , heterozygosity for the nmnat2 allele does not significantly alter nmn and nad levels in either drg fraction . overall , these results indicate that sarm1 is critically involved in the manifestation of the phenotype of nmnat2 mice , with it , or a dependent activity , acting downstream of predominantly axonal alterations to nmn and nad resulting from the lack of nmnat2 . crucially , this suggests significant mechanistic overlap between wld - sensitive axon degeneration and the axon outgrowth defect in these mice . we have previously implicated rising nmn , rather than declining nad , as a critical pro - degenerative event in injured axons , in part by showing that blocking nmn synthesis with nampt inhibitor fk866 and scavenging nmn via ectopic expression of bacterial nmn deamidase ( converting it to namn ) both delay wallerian degeneration ( di stefano et al . , 2014 ) . we therefore used these reagents to investigate whether nmn also limits outgrowth and survival of axons lacking nmnat2 . first , we tested the prediction that survival of nmnat2;sarm1 scg neurites should be impaired by ectopic re - expression of sarm1 due to re - activation of a sarm1-dependent degeneration pathway downstream of nmnat2 deficiency , and assessed whether these events are nmn - dependent using co - expression of nmn deamidase ( figures 4a and 4b ) . while ectopic re - expression of sarm1 ( c - terminal gfp tagged ) in sarm1 neurons ( with normal nmnat2 ) unexpectedly induced some neurite degeneration by 24 hr , it induced much more extensive degeneration of nmnat2;sarm1 neurites ( lacking nmnat2 ) and , crucially , this was significantly reduced by co - expression of nmn deamidase ( n - terminal gfp tagged ) . this suggests that , as well as promoting wallerian degeneration , nmn also drives sarm1-dependent degeneration in this context . importantly , these experiments additionally confirm that rescue of nmnat2;sarm1 axons is due to sarm1 deficiency and not other , undefined changes resulting from mouse breeding . next , we used fk866 to assess whether nmn accumulation also limits nmnat2 neurite outgrowth ( figures 4c and 4d ) . interestingly , fk866 stimulated additional outgrowth of nmnat2 drg neurites , but only for about 24 hr , after which neurites underwent complete degeneration . because fk866 causes simultaneous reductions to both nmn and nad in neuronal cultures ( di stefano et al . , 2014 ) , we considered that this later degeneration could be due to an extreme reduction in nad in neurites now lacking both nampt and nmnat2 activities and/or secondary to neuronal death caused by reduced somal nad . to overcome this , we co - treated cultures with potential sources of nad . nad itself was ineffective ( figure s2 ) , likely due to inefficient entry into neurons and/or failed conversion of more readily internalized nad precursors ( generated by extracellular degradation ) back into nad when nmnat2 is absent ( di stefano et al . , 2014 ; nikiforov et al . , 2011 ) , possibly even leading to further nmn accumulation in nmnat2 neurites . however , naad , an alternative source of nad via endogenous nad synthetase ( di stefano et al . , 2014 ) , did promote additional outgrowth and survival of nmnat2 neurites when added with fk866 ( but , importantly , not when added alone ) . together , these data suggest increased nmn does contribute to the restricted outgrowth of nmnat2 neurites , although rescue of nmnat2 neurite outgrowth by fk866 and naad still falls some way short of the outgrowth of wild - type neurites treated in the same way ( despite this also being slightly inhibitory ) ( figure 4c ) . therefore , either inhibition of nampt by fk866 or clearance of pre - accumulated nmn is relatively ineffective and/or outgrowth is not exclusively limited by nmn - dependent events . despite their shared ability to profoundly influence axon survival after injury , no link between nad metabolism and sarm1 function had previously been firmly established . our studies show not only that either sarm1 itself , or a sarm1-dependent convergent activity , acts downstream of nmnat2 loss and resulting changes to key nmnat metabolites to promote wld - sensitive axon degeneration but also that this also occurs downstream of nmnat2 deficiency and dependent changes during development to impair axon outgrowth and limit mouse survival . intriguingly , an nmnat2 depletion - dependent accumulation of nmnat substrate , nmn , also appears to be a critical pro - degenerative signal in both situations ( this study ; di stefano et al . , 2014 ) , strongly suggesting they are each mediated by activation of the same nmn- and sarm1-dependent degeneration pathway . importantly , our data appear to rule out any lasting stabilization of nad or reduced accumulation of nmn as part of the mechanism underlying protection of sarm1-deficient axons , although intriguing increases in total adenylate pool and steady - state levels of nmn and nad in sarm1 brains may yet be found to be involved . overall , our studies suggest either that changes resulting from nmnat2 loss directly activate a pro - degenerative sarm1 function in axons in a linear pathway or that parallel sarm1-dependent and nmnat2 loss - dependent signals merge at a common downstream step in a convergent pathway ( figure s3 ) . importantly , the critical sarm1-dependent event in either model likely acts upstream of calpain activation ( yang et al . , 2013 ) . given that nmnat2 depletion alone can activate sarm1-dependent neurite degeneration , the convergent pathway model would appear to require that sarm1 has constitutive pro - degenerative activity , with activation or disinhibition of a critical downstream step only occurring after nmnat2 loss . while a proposed regulatory role for the n - terminal domain of sarm1 ( gerdts et al . , 2013 ) appears more consistent with activation of a pro - degenerative function in a linear pathway , our finding that exogenous expression of sarm1(-gfp ) induces some degeneration even when nmnat2 is present ( in sarm1 neurons ) suggests it could have some constitutive pro - degenerative activity ( although conditions in these assays could also influence this outcome ) . understanding precisely how endogenous sarm1 functions in the context of nmnat2 loss and nmn accumulation during axon degeneration , and how this relates to other cellular roles of sarm1 ( conforti et al . , we had previously proposed that the early , limited extension of axons lacking nmnat2 reflects restricted supply of an nmnat - activity - dependent molecule required for axon growth , with nad being a prime candidate ( gilley et al . , 2013 ) . however , initially improved outgrowth of nmnat2 neurites further deprived of nad by fk866 challenges this idea , and the involvement of sarm1 instead suggests these neurites stop extending at the point where sarm1-dependent degeneration becomes active . in light of our findings we predict that , due to a diminishing influence of nuclear nmnat1 , nmn in nmnat2-deficient axons will rise as a function of distance from the soma , with some axon outgrowth possible up to the point at which a critical threshold is exceeded and sarm1-dependent degeneration is triggered . nad plays a key role in many diverse cellular functions ( di stefano and conforti , 2013 ) , so the fact that significant reductions in nad do not prevent the delayed degeneration of cut sarm1-deficient axons or limit the normal growth and survival of intact axons lacking both nmnat2 and sarm1 ( in culture and in mice ) was somewhat surprising . this , together with the ability of fk866 to delay degeneration of cut axons ( di stefano et al . , 2014 ) and temporarily rescue nmnat2 neurite outgrowth , despite further depletion of nad , clearly indicates that fairly substantial reductions in nad are not necessarily detrimental . however , it would be surprising if greater nad depletion did not limit axon survival in some situations . on its own , survival of nmnat2;sarm1 mice for several months with no overt problems suggests very strong correction of the defects associated with constitutive nmnat2 deficiency during early development . however , it will still be critical to establish the precise extent and duration of this rescue in an aging study . nevertheless , these mice already represent a unique resource for the identification or confirmation of other early pro - degenerative events triggered by nmnat2 loss and nmn accumulation , given that our data suggest an activated degeneration pathway is paused at a sarm1-dependent step in nmnat2;sarm1 axons . for example , sarm1 appears to act downstream of reactive oxygen species accumulation , atp depletion , and ca influx when cell death and axon degeneration are induced by the mitochondrial toxin carbonyl cyanide m - chlorophenyl hydrazone ( cccp ) ( summers et al . , 2014 ) , but it will be important to establish whether these changes also occur downstream of nmnat2 loss during wld - sensitive degeneration . they should also be particularly useful for studying non - axonal phenotypes associated with nmnat2 deficiency that may be sarm1 independent , such as its role in cardiac hypertrophy ( cai et al . , 2012 ) . to conclude , these studies have now firmly established the order of two core events in an emerging wld - sensitive and sarm1-dependent axon degeneration pathway . as additional steps are added , it will become increasingly apparent how this relates to other cell - death programs and how it might be most effectively targeted in axonal disorders . crucially , the lack of any overt defects in adult nmnat2;sarm1 mice suggest that if effective targeting of this pathway can be achieved , it could potentially provide long - term relief from symptoms without major side effects . animal work was carried out in accordance with the animals ( scientific procedures ) act , 1986 , under project license ppl 70/7620 . explant cultures of superior cervical ganglia ( scgs ) from embryonic day 18.5 ( e18.5 ) mouse embryos and postnatal day 0 ( p0 ) to p2 pups and dorsal root ganglia ( drgs ) from e13.5/14.5 and e17.5/e18.5 embryos and p0 pups , and dissociated scg neuron cultures ( p0p2 ) , were set up as described previously ( gilley et al . neurite outgrowth assays were performed and quantified as described previously ( gilley et al . , 2013 ) . nampt inhibitor fk866 ( 100 nm , generously supplied by the national institute of mental health ) , naad ( 250 m , sigma - aldrich ) , nad ( 1 mm , sigma - aldrich ) , or nmn ( 1 mm , sigma - aldrich ) were added to e17.5/e18.5 nmnat2 drg explant cultures at 2 days in vitro as described . whole brains from e18.5 mouse embryos and neurite fractions from scg explant cultures were processed as described previously for the generation of rna and/or protein extracts ( gilley et al . , 2013 ; gilley and coleman , 2010 ) . primers for rt - pcr , and primary antibodies and concentrations for immunoblotting , are listed in the supplemental experimental procedures . nmn and nad measurements in whole brains from e18.5 embryos or newborn ( p0 ) pups , uncut or lesioned sciatic nerves from adult mice , and neurite and ganglia fractions from drg cultures ( prepared as for scg cultures in gilley and coleman , 2010 ) were performed using uv - c18 high - performance liquid chromatography ( hplc ) and/or spectrofluorometric hplc analysis essentially as described previously ( di stefano et al . , 2014 ) . injections and quantification of neurite / cell - body survival were performed essentially as described previously ( gilley and coleman , 2010 ) . plasmids and sirnas injected are listed in the figure legends and in the supplemental experimental procedures . anterograde labeling of intercostal nerve axons with the lipophilic dye dii ( 1,1-dioctadecyl-3,3,3,3-tetramethylindocarbocyanine perchlorate ) in fixed p0 mouse pups and whole - mount neurofilament light - chain immunostaining of fixed diaphragms from e17.5/e18.5 embryos were performed as described previously ( gilley et al . , 2013 ) . phase - contrast and fluorescence images of primary cultures and stained / labeled tissues were acquired as described previously ( gilley et al . , 2013 ) . the student s t test , anova with tukey s or dunnett s post hoc correction ( as applicable ) , and pearson s chi - square test were used in this study . a p value > 0.05 was considered not significant , and indicates p < 0.05 , indicates p < 0.01 , and indicates p < 0.001 . conceived the study . j.g . designed and performed all experiments with the exception of nucleotide measurements , obtained by g.o . , and in vitro and in vivo neurite and nerve injury experiments , designed and performed by i.n .- f . j.g . and m.p.c .

summarysarm1 function and nicotinamide mononucleotide adenylyltransferase 2 ( nmnat2 ) loss both promote axon degeneration , but their relative relationship in the process is unknown . here , we show that nmnat2 loss and resultant changes to nmnat metabolites occur in injured sarm1-deficient axons despite their delayed degeneration and that axon degeneration specifically induced by nmnat2 depletion requires sarm1 . strikingly , sarm1 deficiency also corrects axon outgrowth in mice lacking nmnat2 , independently of nmnat metabolites , preventing perinatal lethality . furthermore , nampt inhibition partially restores outgrowth of nmnat2-deficient axons , suggesting that the nmnat substrate , nmn , contributes to this phenotype . nmnat2-depletion - dependent degeneration of established axons and restricted extension of developing axons are thus both sarm1 dependent , and sarm1 acts either downstream of nmnat2 loss and nmn accumulation in a linear pathway or in a parallel branch of a convergent pathway . understanding the pathway will help establish relationships with other modulators of axon survival and facilitate the development of effective therapies for axonopathies .

patients who are recently discharged from hospital have an increased risk of experiencing an adverse drug event , and more than half of such adverse drug events may be preventable or ameliorable.1 in one study of the quality of medication instructions following a hospitalization , coleman et al reported that 14% of recently discharged patients experienced a medication discrepancy , with an approximately equal proportion of discrepancies resulting from patient - related or health system - associated factors.2 in another study of medication discrepancies at discharge , wong et al reported that over 40% of patients experienced at least one unintentional medication discrepancy . in this study , incompletely written prescriptions and omissions of medications were identified as the most common types of errors.3 yet even when medication reconciliation is performed accurately during the discharge process , patients may misunderstand medication instructions , particularly when changes occur in complex medication regimens . for example , in one review of medication reconciliation at discharge , ziaeian et al detected either a medication error or a lack of patient understanding about a medication change in approximately 80% of patients.4 payers , providers , and policy - makers have directed increased attention and resources towards improving medication safety during care transitions . current strategies include implementing robust medication reconciliation processes , and promoting other elements of good transitional care , such as enhancing teamwork and communication , and utilizing health information technologies . in 2012 , the american pharmacists association and the american society of health - system pharmacists jointly issued a white paper entitled improving care transitions : optimizing medication reconciliation.5 in this paper , these organizations describe an expansive vision for medication reconciliation , one that is composed of multiple processes that together reduce medication errors , support safe medication use by patients , and encourage community - based providers and those practicing in hospitals and health systems to collaborate in organized medication reconciliation programs to promote overall continuity of patient care . health information technologies can improve medication reconciliation functions.6,7 patients can be empowered to assume management of their medication regimen through the use of an electronic personal health record system ( ephr ) . using the ephr , patients or authorized caregivers can maintain their medical information and medication list using a secure electronic application . patients , pharmacists , and other care providers can utilize ephr technology to promote greater patient self - efficacy in self - management of the medication regimen , and also to exchange and reconcile information among various information repositories.8 while these benefits are particularly apt during care transitions , research assessing the utility of ephr systems to improve medication management is scant.9 researchers from the university of rhode island college of pharmacy piloted an intervention to improve medication management during care transitions . the project was one of several initiatives included in the tech4impact program ( technologies for improving post - acute care transitions ) , sponsored by the center for technology and aging , a national leader in the use of patient - centered technologies for older adults . our intervention involved deploying pharmacists to visit the homes of recently discharged patients to review medication instructions and to offer patients free use of an ephr system , with ongoing support in setting up and using the ephr . we hypothesized that the pharmacist s ability to identify medication - related problems would be greater among patients who used the ephr system . to our knowledge , no study to date has coupled in - home pharmacist education with the use of an ephr system to promote safe and effective medication management during care transitions . this report presents our findings in delivering this intervention during a 6-month period occurring between august 2011 and february 2012 . this was a prospective nonrandomized pilot study in which recently hospitalized patients were offered the opportunity to meet with a pharmacist in their home within 14 days of their discharge from hospital to review medication instructions and to receive a demonstration of an ephr system . patients were informed that the pharmacist home visit would include a medication regimen review and help in setting up the ephr system , if desired . usual care consisted of medication reconciliation at discharge provided by hospital clinicians , but without subsequent home visits provided by pharmacists . the ephr utilized in this project was the er - card system , developed by er - card llc of west warwick , rhode island . this product features online password - protected sharing of health record information via the internet , or by usb drive provided by the consumer . the er - card system provides staff support for assisting with completing and updating the contents of the patient s record . medical conditions and medication information is self - reported by the patient , with pharmacists verifying medication lists with the patient s pharmacy . the study enrolled patients 50 years of age or older and having any of the following chronic conditions : cardiovascular disease and related conditions ( eg , atrial fibrillation ) , respiratory illness ( eg , chronic obstructive pulmonary disease / asthma ) , and/or diabetes mellitus . as our focus was on medication self - management among community - dwelling patients , we did not recruit patients with dementia or patients who were transitioning from the hospital to a long - term care facility . the pharmacist home visit was offered to patients who were participating in an associated care transitions initiative conducted by the rhode island quality improvement organization ( healthcentric advisors ) in cooperation with rhode island s aging and disability resource center . a third pathway for patient recruitment was on - site solicitation of patients at kent hospital in warwick , rhode island , which served as the predominant patient recruitment source . patients agreeable to the pharmacist home visit completed an informed consent process explaining the activities that the pharmacist would be providing during the home visit . patients were informed that that they were not required to utilize the ephr system to receive the pharmacist home visit , and that if they decided to utilize the ephr system , their information could be shared with other health care providers only if they provided permission . those patients deciding to utilize the ephr system completed an authorization form routinely required by the ephr vendor for compliance with the health insurance portability and accountability act . the ephr was offered to patients at no cost , and patients were allowed to discontinue their use of the ephr at any time . the study was approved by the institutional review board on human subjects at the university of rhode island and kent hospital . for patients consenting to participate in the study , a home visit was scheduled by the study pharmacist for a suggested period of 2 hours . when a medication - related problem was identified during the medication review , the pharmacist discussed the concern with the patient , and encouraged the patient to contact the prescriber or pharmacy when appropriate . the pharmacist demonstrated the ephr program using a laptop computer , and if the patient was agreeable to trying the ephr system , the pharmacist supported the patient in entering their medical information and medication list into the ephr system . during the home visit the pharmacist completed a data collection form that captured information describing the medication - related problems identified and other data relevant to the study . we categorized study participants according to the referral source and by the primary diagnosis associated with the recent hospitalization . we categorized the types of medication - related problems identified during the home visit as involving therapy duplication , interactions , medication cost , or incorrect use or underuse of a medication ( eg , poor adherence ) . we compared the frequency of medication - related problems identified between users and nonusers of the ephr system , overall and according to patient age and sex . we also documented medication discrepancies using the tool developed by dr eric a coleman s care transitions program,10 which categorizes events as patient - related or health - system related . our results are presented here as descriptive statistics , with the chi - square test used to determine the statistical significance of differences in observed rates of medication - related problems between users and nonusers of the ephr . fisher s exact test was used where any cell size was less than five observations . we attempted to contact patients no earlier than 30 days following the home visit to enquire about their satisfaction with the pharmacist visit , to determine if patients continued to utilize the ephr system , and to ascertain if patients had been rehospitalized in the period following the home visit . approximately 300 patients were identified as eligible for our program and were approached by study recruiters . while 59 of these eligible patients initially agreed to participate in the study , we were unable to schedule a home visit with 29 patients , because some did not return our subsequent telephone calls to schedule the home visit , while other patients changed their mind about participating , transitioned to a long - term care setting or died . the study pharmacists completed home visits for a total of 30 patients , with 20 of these patients agreeing to utilize the ephr system . among the 30 patients visited , 16 ( 53% ) were male and 23 ( 77% ) were 65 years of age or older . the majority of patients had been hospitalized due to a cardiovascular - related illness ( n=24 ) , while six patients were hospitalized for an exacerbation of their respiratory illness or diabetes ( see table 1 ) . at each patient home visit , the pharmacist performed a medication regimen review and documented medication - related problems that were identified . table 2 presents the range of problems discovered , which are categorized as cost - related , involving therapeutic duplication , drug interaction , underuse ( lack of use ) of a clinically important therapy , or having incorrect or unclear instructions for medication use . several patients discontinued a clinically important medication due to cost , while other patients did not appear to be utilizing indicated therapies ( eg , lack of aspirin use following a myocardial infarction , with no apparent contraindication to aspirin therapy ) . instances of therapeutic duplication included concomitant use of two proton pump inhibitors , use of two different albuterol inhaler products , and use of multiple products containing acetaminophen . the percentage of medication - related problems detected by the pharmacist was higher among those patients agreeing to use the ephr system ( 15/20 , 75% ) , as compared with patients who did not use the ephr ( 4/10 , 40% ) . medication - related problems were also identified more frequently among patients who were younger than 65 years of age , as compared with older patients ( 71% versus 61% , respectively ) , and were identified more frequently among males as compared with females ( 69% versus 57% , respectively ) . medication - related problems were identified among approximately 60% of patients who were recently hospitalized for a cardiovascular - related condition , and among 67% of patients who were recently hospitalized for a respiratory illness . despite large proportional differences across several of these cross - tabulations , statistically significant differences were not observed , reflecting the small sample size in this pilot study ( table 3 ) . table 4 presents the frequencies and types of medication discrepancies identified during the home visit using the care transitions program medication discrepancies tool for multiple events.10 discrepancies were detected among 16 of the 30 patients we visited ( 53% ) : six of the discrepancies were categorized as relating to patient - associated factors , while ten of the discrepancies were considered to have resulted from system - related factors . the most frequently observed discrepancy was conflicting information from different informational sources , as documented in five of the 30 home visits that were completed . of these 19 patients , three had been rehospitalized within 30 days ( 3/19 , 16% ) . patients who were surveyed at follow - up expressed a high level of satisfaction with the pharmacist home visit , with all patients responding affirmatively to our follow - up survey question : do you think that the pharmacist home visit was helpful in reviewing your medications and addressing your questions ? seven patients reported that they had used the ephr to share information with care providers during their post - discharge medical visits . in this pilot program , pharmacists conducting home visits frequently identified medication - related problems among recently discharged patients . at least three of the 30 patients had discontinued an important medication therapy due to high cost . in these instances , the pharmacist instructed the patient to contact her / his health care provider to discuss treatment options , which might include switching to an affordable alternative therapy ( eg , changing to a generic cholesterol - lowering medication ) . additionally , several patients reported errors related to their medication regimen that occurred during their transitioning into or out of hospital , with 16 such discrepancy events documented using the medication discrepancy tool. among the 30 patients who were visited by the pharmacist , 20 agreed to use the ephr technology , and seven patients reported that they had used the ephr to share information with their care providers during follow - up visits or rehospitalizations . while these results indicate that the ephr system can be effectively used by patients during care transitions , our sample size was too small to draw any firm conclusions regarding the characteristics of patents who are more likely to effectively utilize an ephr to manage their medication regimen . foremost , patient recruitment was difficult , because many of the patients whom we encountered were not agreeable to meeting with the pharmacist in their home . patient perceptions regarding the role of the pharmacist in the health system may have posed a barrier to our work , as pharmacists do not commonly enter the patient s home to provide medication counseling services . the lack of awareness among patients of the potential benefits of an ephr system also posed a barrier to recruitment . we provided an explanation of the ephr system and its potential benefits during recruitment , and as an element of the informed consent process . however , it was challenging to effectively explain the potential utility of the ephr during our brief recruitment encounters , especially considering that our population of focus included hospitalized or recently hospitalized patients who were often severely ill . additionally , approximately half of the patients who consented to participate in the study subsequently changed their mind about completing the home visit , or did not return telephone calls when the scheduler contacted them . most importantly , it should be recognized that this was a pilot study involving a small number of patients . larger scale application of the model is warranted before any strong conclusions can be made about the benefits of ephr systems to aid medication management during care transitions . the small sample size also limited our ability to determine a difference in effectiveness of the intervention according to the characteristics of the patients studied . additionally , the nonrandomized design may have resulted in selection bias , whereby participating patients may have generally been more accepting of the role of pharmacists and of information technology . another limitation of our study pertains to the role of the pharmacist in our model , which did not include direct intervention with the patient s pharmacy or prescribers to pursue each medication - related problem identified to its resolution . we believe that establishing more formalized communications with health care team members would be an important step towards ensuring that the visiting pharmacist s observations and recommendations are best incorporated into clinical decision - making . finally , we were unable to follow up with 11 of the 30 patients to determine their satisfaction with the intervention , or if they continued to use the ephr system . our findings from this pilot study suggest that pharmacist home visits following a hospitalization can aid in identifying medication - related problems . the frequency and clinical significance of the problems identified suggests a need for increased involvement of pharmacists during care transitions . the ability to identify such problems may be enhanced when pharmacists work together with patients to review and enter the discharge medication list into an ephr system .

backgroundsubstantial opportunity exists to improve medication management in the period following a hospital discharge . the objective of this study was to assess and improve medication management during care transitions through pharmacist home visits and the use of an electronic personal health record ( ephr ) system.methodsrecently discharged patients aged 50 years or older and having a chronic medical condition were offered the opportunity to meet with a pharmacist in the home setting to review medication instructions and receive a demonstration of an ephr system . patients agreeable to using the ephr system were offered pharmacist support with setting up the ephr system , having emphasis on documenting and reviewing medication regimens . medication - related problems identified by the pharmacist during the visit were categorized according to ephr use and by other characteristics.resultsthirty recently discharged patients with chronic disease were visited by a pharmacist over a 6-month period . the percentage of medication - related problems identified by the pharmacist was greater among those patients who agreed to use the ephr system , as compared with patients whose visit did not include use of the ephr ( 75% versus 40% , respectively ; p=0.06 ) . differing types of medication - related problems were identified , including therapy duplications , lack of use of clinically important therapies , and patient nonadherence.conclusionfor some patients , the home setting can be a suitable venue for medication review and education after discharge from hospital . assisting patients with setting up the ephr system may enhance pharmacists ability to identify and resolve medication - related problems that may lead to rehospitalization .

a small subset of patients with chronic total occlusion of the middle cerebral artery ( mca ) are refractory to medical treatment due to inadequate collateral circulation.1 surgical revascularization with extracranial to intracranial bypass has been the mainstay of treatment but its efficacy remains controversial.2 development of new endovascular devices and improved operator experience have rendered angioplasty and stenting a potential treatment option for such patients . in these case reports , we illustrate the feasibility of elective ( at least 1 month after the ischemic event ) endovascular recanalization for symptomatic mca occlusion by angioplasty and stenting , and the long term outcome . a 43-year - old male smoker with hypertension and hyperlipidemia presented with a 2-month history of recurrent transient ischemic attacks ( tia ) of left - sided weakness . angiogram demonstrated total occlusion of the right mca m1 segment with thrombolysis in cerebral ischemia ( tici ) grade 0 ( figure 1a ) . pial collaterals extending from the right anterior cerebral artery ( aca ) ( figure 1a ) and posterior cerebral artery to the right mca territory were evident . the risks and benefits of conservative medical treatment , extracranial to intracranial bypass and endovascular therapy were discussed with the patient and his families . in light of his recurrent symptoms despite medical therapy with antiplatelet agents , endovascular recanalization of the right mca was planned . under general anesthesia , the lesion was traversed with a coaxial assembly of agility soft microguidewire ( cordis endovascular , miami lakes , florida , usa ) and prowler 14 microcatheter ( cordis endovascular , miami lakes , florida , usa ) ( figure 1b ) . the microguidewire was then withdrawn , the patency of the lumen distal to the lesion confirmed through the microcatheter ( figure 1c ) and a transcend microguidewire ( boston scientific , fremont , california , usa ) was exchanged . the diameter of the proximal segment of the right mca adjacent to the lesion was approximately 2.5 mm and lesion length was 6 mm by visual estimation , compared with the 6 french guide catheter ( boston scientific , natick , massachusetts , usa ) . after withdrawing the microcatheter , a 2.58 mm apollo balloon expandable stent ( microport medical , shanghai , china ) was advanced over the microguidewire and deployed at the lesion . subsequent angiogram demonstrated resolution of the occlusion and good antegrade perfusion to the right mca territory ( tici grade 3 ) ( figure 1d ) . postoperatively , blood pressure was maintained at 100120/6080 mm hg to minimize the risk of reperfusion injury . the patient displayed no periprocedural neurological complications verified independently by a neurologist . at his 29-month follow - up , the patient remained asymptomatic on treatment with antiplatelet agent and risk factor control . ( a ) angiogram demonstrated total occlusion of the right middle cerebral artery ( mca ) m1 segment ( arrowhead ) , and pial collaterals extending from the right anterior cerebral artery territory ( arrows ) . ( b ) the lesion was traversed with an agility soft microguidewire ( arrowhead ) . ( c ) angiogram through the microcatheter confirming that the tip of the microcatheter was in the distal mca . ( d ) post stenting angiogram showed resolution of the occlusion and good antegrade perfusion to the right mca territory . a 66-year - old male smoker with diabetes mellitus and hypertension presented with a 2-month history of tia of left - sided weakness , similar to case no 1 . angiogram demonstrated total occlusion of the right mca m1 segment with tici grade 0 , and 70% stenosis of the right aca ostium ( figure 2a ) . pial collaterals extending from the right aca ( figure 2b ) and posterior cerebral artery contributed to the supply of the right mca territory . under general anesthesia , the lesion was traversed with an assembly of agility soft microguidewire and prowler 14 microcatheter , which was then exchanged with a transcend microguidewire . the diameter of the c7 segment of the right internal carotid artery adjacent to the lesion was visually estimated to be 3 mm and lesion length 8 mm . the occlusion was predilated with a maverick 29 mm balloon angioplasty ( boston scientific , natick , massachusetts , usa ) ( figure 2c ) , followed by deployment of a 2.59 mm wingspan stent ( boston scientific , natick , massachusetts , usa ) covering the entire lesion site ( figure 2d ) . subsequent angiogram demonstrated complete recanalization of the right mca with good antegrade perfusion to the right mca territory ( tici grade 3 ) ( figure 2e ) . twelve months later , there was recurrence of tia of left - sided weakness while on medical treatment . an 80% in - stent restenosis ( figure 2f ) demonstrated on angiogram was successfully treated with maverick 29 mm balloon angioplasty without complications ( figure 2g , h ) . at his next 12-month follow - up , ( a ) angiogram demonstrated total occlusion of the right middle cerebral artery ( mca ) m1 segment ( arrowhead ) and 70% stenosis of the right anterior cerebral artery ( aca ) a1 segment ( arrow ) . ( e ) post stenting angiogram showed good antegrade flow to the right mca territory . ( f ) twelve - month follow - up angiogram demonstrated 80% in - stent restenosis . ( g ) microguidewire was placed in the right aca to avoid the snow ploughing effect during right mca angioplasty occluding the right aca ostium . a 43-year - old male smoker with hypertension and hyperlipidemia presented with a 2-month history of recurrent transient ischemic attacks ( tia ) of left - sided weakness . angiogram demonstrated total occlusion of the right mca m1 segment with thrombolysis in cerebral ischemia ( tici ) grade 0 ( figure 1a ) . pial collaterals extending from the right anterior cerebral artery ( aca ) ( figure 1a ) and posterior cerebral artery to the right mca territory were evident . the risks and benefits of conservative medical treatment , extracranial to intracranial bypass and endovascular therapy were discussed with the patient and his families . in light of his recurrent symptoms despite medical therapy with antiplatelet agents , endovascular recanalization of the right mca was planned . under general anesthesia , the lesion was traversed with a coaxial assembly of agility soft microguidewire ( cordis endovascular , miami lakes , florida , usa ) and prowler 14 microcatheter ( cordis endovascular , miami lakes , florida , usa ) ( figure 1b ) . the microguidewire was then withdrawn , the patency of the lumen distal to the lesion confirmed through the microcatheter ( figure 1c ) and a transcend microguidewire ( boston scientific , fremont , california , usa ) was exchanged . the diameter of the proximal segment of the right mca adjacent to the lesion was approximately 2.5 mm and lesion length was 6 mm by visual estimation , compared with the 6 french guide catheter ( boston scientific , natick , massachusetts , usa ) . after withdrawing the microcatheter , a 2.58 mm apollo balloon expandable stent ( microport medical , shanghai , china ) was advanced over the microguidewire and deployed at the lesion . subsequent angiogram demonstrated resolution of the occlusion and good antegrade perfusion to the right mca territory ( tici grade 3 ) ( figure 1d ) . postoperatively , blood pressure was maintained at 100120/6080 mm hg to minimize the risk of reperfusion injury . the patient displayed no periprocedural neurological complications verified independently by a neurologist . at his 29-month follow - up , the patient remained asymptomatic on treatment with antiplatelet agent and risk factor control . ( a ) angiogram demonstrated total occlusion of the right middle cerebral artery ( mca ) m1 segment ( arrowhead ) , and pial collaterals extending from the right anterior cerebral artery territory ( arrows ) . ( b ) the lesion was traversed with an agility soft microguidewire ( arrowhead ) . ( c ) angiogram through the microcatheter confirming that the tip of the microcatheter was in the distal mca . ( d ) post stenting angiogram showed resolution of the occlusion and good antegrade perfusion to the right mca territory . a 66-year - old male smoker with diabetes mellitus and hypertension presented with a 2-month history of tia of left - sided weakness , similar to case no 1 . angiogram demonstrated total occlusion of the right mca m1 segment with tici grade 0 , and 70% stenosis of the right aca ostium ( figure 2a ) . pial collaterals extending from the right aca ( figure 2b ) and posterior cerebral artery contributed to the supply of the right mca territory . under general anesthesia , the lesion was traversed with an assembly of agility soft microguidewire and prowler 14 microcatheter , which was then exchanged with a transcend microguidewire . the diameter of the c7 segment of the right internal carotid artery adjacent to the lesion was visually estimated to be 3 mm and lesion length 8 mm . the occlusion was predilated with a maverick 29 mm balloon angioplasty ( boston scientific , natick , massachusetts , usa ) ( figure 2c ) , followed by deployment of a 2.59 mm wingspan stent ( boston scientific , natick , massachusetts , usa ) covering the entire lesion site ( figure 2d ) . subsequent angiogram demonstrated complete recanalization of the right mca with good antegrade perfusion to the right mca territory ( tici grade 3 ) ( figure 2e ) . twelve months later , there was recurrence of tia of left - sided weakness while on medical treatment . an 80% in - stent restenosis ( figure 2f ) demonstrated on angiogram was successfully treated with maverick 29 mm balloon angioplasty without complications ( figure 2g , h ) . at his next 12-month follow - up , the patient remained asymptomatic on medical treatment . ( a ) angiogram demonstrated total occlusion of the right middle cerebral artery ( mca ) m1 segment ( arrowhead ) and 70% stenosis of the right anterior cerebral artery ( aca ) a1 segment ( arrow ) . ( e ) post stenting angiogram showed good antegrade flow to the right mca territory . ( f ) twelve - month follow - up angiogram demonstrated 80% in - stent restenosis . ( g ) microguidewire was placed in the right aca to avoid the snow ploughing effect during right mca angioplasty occluding the right aca ostium . chronic mca occlusion as a cause of hemodynamic ischemic stroke is not a prominent clinical issue worldwide.1 while acute occlusion of the mca is commonly caused by an embolic thrombus,3 4 atherosclerotic occlusion of the intracranial arteries is more prevalent in asians . patients with chronic proximal mca occlusion may have minor or no stroke because of well developed collaterals . conversely , the prognosis for those with hemodynamic impairment is poorer.1 chronic occlusive lesion does not seem to represent a significant embolic source but threatens the patient with hemodynamic ischemia and infarct . in addition , patients with mca occlusion may have disabling cognitive impairment , especially for those with bilateral diseases.5 for our two patients , the etiology of their recurrent tias was likely to be hemodynamic impairment from total mca occlusion , arising from atherosclerotic stenosis and superimposed thrombosis based on angiographic findings . the optimal management of them was controversial.2 direct stenting of mca occlusion has been used for acute stroke but it is rarely performed electively in the chronic phase.6 our cases showed direct stenting without intra - arterial thrombolysis for symptomatic chronic mca occlusion is feasible . from our experience , the gateway balloon catheter and the wingspan stent are more suited for patients with tortuous vascular access , especially at c4 segment , as these afford better flexibility in traversing the curvature . the apollo stent is more rigid compared with the gateway wingspan system but it is preferred for patients with a smoother access path as delivery of the balloon expandable stent does not require exchanging and less procedural time was needed . our immediate technical success rate was 100% ( 2/2 ) , better than the 33% ( 1/3 ) reported in a previous study which used angioplasty alone.7 although no periprocedural complications occurred in our patients , vessel perforation from microguidewire manipulation or balloon angioplasty was a potentially serious complication . great care must be taken in monitoring the movement of the microguidewire tip to ensure its position within the true lumen . in the event of dissection , stenting may help to minimize the intimal flaps and hence is superior to angioplasty alone . hyperperfusion hemorrhage into the recanalized brain parenchyma is another major potential complication , and tight control of blood pressure is crucial postoperatively . during follow - up , one of our two patients the long term outcome of recanalization of chronic total occlusion of the mca remains uncertain . direct stenting of chronic total occlusion of the mca is technically feasible but not without the potential for major complications . further studies are needed to determine its efficacy in carefully selected patients with medically refractory cerebral ischemia due to mca occlusion .

the optimal treatment of chronic middle cerebral artery ( mca ) occlusion is unclear . angioplasty and stenting may be an alternative treatment for patients with recurrent ischemic symptoms despite medical therapy . two patients with chronic right mca occlusion successfully treated with stenting are reported , together with their long term follow - up to illustrate the feasibility of endovascular recanalization . one patient remained asymptomatic at the 29-month follow - up . another patient developed symptomatic in - stent restenosis at 12 months which resolved after repeat angioplasty . further larger scale pilot studies are needed to determine the efficacy and long term outcome of this treatment .

the incidence of colorectal cancer is one of the highest malignancies . in netherlands alone , colorectal cancer is diagnosed in 12,000 patients annually and it is the second most frequent cause of death due to malignancies . in an effort to improve the standard of care for these patients , new techniques have been introduced over the years , such as laparoscopy and tme surgery [ 3 , 4 ] . recently , much attention has been given to patient volume of both the hospital and the individual surgeon . publications have shown that a high - volume surgeon operating in a high - volume hospital leads to an improved short - term outcome such as a lower number of adverse events , shorter hospital - stay , lower postoperative mortality , and cost reduction . furthermore , a number of studies have reported increased long - term survival when patients are treated in high - volume centers . however , the relationship between operative volume of the surgeon and long - term outcome remains unclear . we therefore conducted the current study to evaluate survival rates of patients with colorectal cancer following a procedure performed by high - volume surgeons compared to low - volume surgeons . the rijnland hospital is a teaching hospital in leiderdorp , netherlands , serving approximately 200,000 people . for the current study a retrospective analysis was conducted from our prospectively collected database including all colorectal cancer patients who underwent surgery in our hospital between 2004 and 2011 . eight hundred and twenty - four patients underwent a colorectal procedure between 2004 and 2011 . for our study we used the same inclusion criteria as the national web - based registry for the surgical treatment of colorectal cancer in netherlands : the dutch surgical colorectal audit ( dsca ) . patients were excluded in case the procedure was performed for metastatic disease following previous surgery ( n = 13 ) , in case the primary tumor could not be resected ( n = 9 ) , or when the pathology report showed a different type of tumor than an adenocarcinoma ( n = 28 ) . after applying these exclusion criteria our study population of 774 patients consisted of a homogenous cohort . in order to qualify as a high - volume surgeon a cut - off point of 25 colorectal resections per year , averaged over the study period , was chosen based on recent studies [ 6 , 913 ] . taking this criterion into account for our analysis , 13 low - volume surgeons operated on 453 patients and four high - volume surgeons operated on 321 patients . perioperatively , all patients received equal care using the colorectal enhanced recovery after surgery ( eras ) protocol [ 14 , 15 ] . the data collected in our database were the patient characteristics , including the american society of anesthesiology- ( asa- ) classification ; the intraoperative data ( high - volume surgeon versus low - volume surgeon ) ; and the postoperative data , including the tnm - stage , resection margins , length of hospital - stay , and adverse events . in case of an adverse event , the type ( surgical or nonsurgical ) and the severity were recorded according to netherlands ' society of surgery standard [ 18 , 19 ] . follow - up took place in our hospital according to netherlands ' society of surgery protocol . this protocol dictates that patients are seen in the hospital for follow - up by an attending surgeon every 4 months for the first 2 years and every 6 months for the years after , with a minimum of 5-year follow - up . in the current study patients were followed up for a minimum of 3 years . at each visit , an ultrasound and cea levels were performed . also the iknl ( integral cancer centre netherlands ) was consulted in case a patient deceased , which provided us with the date and cause of death . for some patients the follow - up did not take place in our hospital , mostly due to relocation of the patient . in those cases we consulted the general practitioner and the hospital where the follow - up was taking place for survival data . it was possible to evaluate the 5-year disease - free survival ( dfs ) of 761 patients ( 13 patients lost to follow - up : 8 low - volume and 5 high - volume ) and overall survival ( os ) of 772 patients ( 3 low - volume patients were lost to follow - up ) . for assistance with the statistical analysis , the department of statistics in our hospital and the leiden university medical center were consulted . comparisons were made between the high - volume and the low - volume group for all variables : perioperative characteristics , disease - free survival , and overall survival . the -test and the independent sample t - test were used to determine the association between perioperative characteristics and volume ( high - volume versus low - volume ) . multivariate poisson regression survival models were used to determine the effect of volume on dfs and os . variables in the univariate analysis that showed a significant association were then introduced into a cox regression multivariate model . preoperative clinicopathological characteristics of the 453 low - volume and the 321 high - volume patients are shown in table 1 . the groups were comparable except the fact that a greater number of the low - volume patients had a higher asa - classification ( p < 0.001 ) and laparoscopic surgery was more frequently performed in the high - volume group compared to the low - volume group , 78% ( n = 249 ) versus 59% ( n = 266 ) , respectively ( p < 0.001 ) . the type of resection also showed a difference ( p < 0.001 ) , largely caused by a higher number of abdominoperineal resections ( apr ) in the high - volume group . the significantly larger number of patients who received chemoradiotherapy as neoadjuvant regimen in this group can be explained by the higher number of rectal cancer cases ( p < 0.001 ) . the intraoperative data are listed in table 2 . in the high - volume group , significantly less blood loss was observed compared to the low - volume group , 308 ml versus 547 ml , respectively ( p < 0.001 ) . also the conversion rate in case of laparoscopic surgery was significantly lower in the high - volume group ( 18% versus 27% , p = 0.01 ) . the postoperative characteristics are listed in table 3 . a significantly more advanced tumor ( t ) stage ( p = 0.03 ) and metastatic ( m ) stage ( p < a larger median number of lymph nodes were harvested in the high - volume group , 15.3 versus 13.5 ( p < 0.001 ) . in the high - volume group the median postoperative hospital - stay was lower compared to the low - volume group : 10 versus 13 days , respectively ( p < 0.001 ) . no difference was seen between nodal ( n ) stages or resection margins and the number and neither did the severity of both surgical and nonsurgical adverse events show a difference in both groups . the 5-year dfs in the high - volume group was 66% compared to 48% in the low - volume group ( p < 0.001 , figure 1 ) . we performed a univariate analysis to estimate the effect of all variables on the dfs . the high - volume group showed a significantly increased dfs ( hazard ratio ( hr ) 0566 ; 95% ci 0.440.74 ; p < 0.001 ) . the other pre- , intra- , and postoperative variables that showed a statistical significance for dfs in the univariate analysis are listed in the left half of table 4 . we then incorporated the statistically significant variables of the univariate analysis into a cox multivariate regression model to determine which variables remained as prognostic factors for dfs . surgeons ' volume showed to be an independent prognostic factor for dfs in favor of the high - volume surgeon ( hr 0.739 ; 95% ci 0.560.99 ; p = 0.04 ) . other independent prognostic factors for a longer dfs were lower patient 's age ( p < 0.001 ) , lower asa - classification ( p = 0.05 ) , and a lower t ( p = 0.04 ) , n ( p < 0.001 ) , and m ( p < 0.001 ) stage . we also analyzed if the time periods ( 20042007 versus 20082011 ) had an influence on dfs ; however , neither in the univariate or in the multivariate analysis did this show significance . the patients in the high - volume group showed a 5-year os of 75% as compared to 54% for the low - volume group ( p < 0.001 , figure 2 ) . similarly to what is described above , we performed a univariate analysis for os . the high - volume surgeon was significantly associated with an increased os ( hr 0.495 ; 95%ci 0.350.69 ; p < 0.001 ) . the other pre- , intra- , and postoperative variables that showed a statistical significance for os in the univariate analysis are listed in the left half of table 5 . after incorporating the statistically significant variables of the univariate analysis into a cox multivariate regression model to determine which variables remained as prognostic factors for os , the high - volume surgeon did not remain significant ( hr 0.731 ; 95% ci 0.711.68 ; p = 0.09 ) . we also analyzed if the time periods ( 20042007 versus 20082011 ) had an influence on os ; however , neither in the univariate or in the multivariate analysis did this show significance . the factors that did prove to be an independent prognostic factor were advanced age ( p < 0.001 ) , higher asa - classification ( p = 0.01 ) , and higher n ( p < 0.001 ) and m ( p < 0.001 ) stage which showed to have an independent negative influence on os . laparoscopic surgery appeared to be a positive independent prognostic factor for os ( p < 0.001 ) . in the current analysis we found that a high - volume surgeon is an independent prognostic factor for increased dfs for colorectal cancer surgery when compared to a low - volume surgeon . however , high - volume surgery did not remain as an independent prognostic factor for os in the multivariate analysis . although increased dfs is an important outcome in research , ultimately a longer os is what is most desirable in medicine and what is important to the patient . possibly in a larger cohort of patients we may show an increased os in the future since os did show to be significantly increased in the high - volume surgery patients in the univariate analysis . previous studies have been performed to investigate possible variables of short - term and long - term outcomes following colorectal resection for malignancies . these outcomes depend on numerous patient- , surgeon- , and hospital - related variables [ 5 , 9 , 2227 ] . while the patient - related variables are difficult , if not impossible to adjust , efforts aimed at improving the perioperative care have been shown to have positive impact on the postoperative outcome . some of these efforts include the administration of preoperative antibiotics , maintaining normothermia during surgery , and implementing an eras protocol [ 15 , 16 , 2830 ] . another approach that has been shown to be effective is implementing high - volume surgery of colorectal procedures . recent studies have shown an improved short - term outcome , when a high - volume surgeon performed the procedure [ 9 , 23 , 24 , 31 ] . studies reporting long - term effects for high - volume colorectal surgery , however , have shown less unanimous results [ 12 , 26 , 27 , 32 , 33 ] . although high - volume surgery showed a significant relationship towards an increased os in the univariate analysis , it did not remain as an independent prognostic factor for os in the multivariate analysis . when looking at the difference in os between the high - volume group and the low - volume group ( figure 2 ) in the univariate analysis , it seems likely that , with either a larger patient population or an increased median follow - up time , this observed difference could also become statistically significant in the multivariate analysis . this would of course be an important outcome for our patients , as increased os is even more relevant than an increased dfs . our findings are in agreement with the outcomes of studies of low - volume surgical procedures , such as esophageal and pancreatic cancer surgery , in which it has been shown that the surgeon 's caseload is an important predictor for outcome [ 34 , 35 ] . also support for our assumption of an increased os can be found in the article by rogers jr . et al . who showed that , in a group of 26,644 patients with a median follow - up of 6 years , those who were operated upon by a high - volume surgeon had an increased os following colorectal cancer . the same is seen in the cochrane analysis in which an improved survival is reported for both the high - volume surgeon and the high - volume hospital . however , not all studies reporting survival after high - volume surgery for colorectal cancer are in agreement . [ 27 , 32 , 33 , 36 , 37 ] , showing that more research in this field is required before any definite statements can be made regarding the volume an individual surgeon should perform . recently published literature has increasingly published a similar observation showing an improved os following laparoscopic colorectal surgery when compared to open colorectal surgery [ 3841 ] . it has been suggested that this improved os observed in the recent years is mostly caused by the increased experience with the procedure together with technical and procedural advances . although this can not be attributed to the implementation of high - volume surgeons alone , the fact that dfs remained as an independent prognostic factor in the multivariate analysis shows that high - volume surgery is attributed to improved survival . in a previous report , renzulli et al . observed a similar increase in dfs for high - volume surgery . however , in the multivariate analysis this did not remain significant showing that the difference in dfs seen between both groups can not be explained by the timing of the surgery and the on - call surgeon . apart from the increased dfs in the multivariate and the increased os in the univariate analysis , a number of perioperative variables also showed statistical significance in favor of the high - volume surgeon . in case a high - volume surgeon performed a laparoscopic procedure , a significantly lower number of conversions were observed . furthermore , intraoperative blood loss was significantly less in the high - volume group and a greater number of lymph nodes were harvested leading to a more accurate staging . a decrease in postoperative adverse events has been reported in case the operation was performed by a high - volume surgeon [ 9 , 11 ] . possibly , underreporting of adverse events may have taken place in our study : the number of days a patient was admitted to the hospital following surgery by a high - volume surgeon was significantly lower , suggesting a quicker and uncomplicated recovery . therefore , in our hospital , high - volume surgery does not only improve the dfs and possibly os but also improve short - term outcome the low - volume group consisted of more patients with a higher asa - classification and a higher tnm - stage [ 16 , 17 ] . the early drop of dfs seen in the low - volume patients that is demonstrated in the kaplan - meier curve is most likely due to the more advanced disease in this group ( figure 1 ) . for this reason a multivariate analysis was conducted to correct for these differences in patient population . even after this correction high - volume surgery remained as an independent factor for dfs . rectal cancer resections were performed more frequently by the high - volume surgeons , which could have caused fewer postoperative complications due to increased experience . on the other hand , one could have expected more complications following the neoadjuvant radiotherapy and chemotherapy in this group , but this was not the case in the statistical analyses . in conclusion , the current study shows that in our hospital high - volume surgery is an independent prognostic factor for increased dfs following surgery for colorectal cancer . although high - volume surgery also significantly improved os in the univariate analysis , it did not remain statistically significant in the multivariate analysis . it is possible that , with either more patients included or a longer follow - up time , this observed difference will also become statistically significant for os . to our opinion , introducing high - volume surgeons will provide better perioperative care for patients suffering from colorectal cancer resulting in both improved short - term and long - term results .

background . surgery performed by a high - volume surgeon improves short - term outcomes . however , not much is known about long - term effects . therefore we performed the current study to evaluate the impact of high - volume colorectal surgeons on survival . methods . we conducted a retrospective analysis of our prospectively collected colorectal cancer database between 2004 and 2011 . patients were divided into two groups : operated on by a high - volume surgeon ( > 25 cases / year ) or by a low - volume surgeon ( < 25 cases / year ) . perioperative data were collected as well as follow - up , recurrence rates , and survival data . results . 774 patients underwent resection for colorectal malignancies . thirteen low - volume surgeons operated on 453 patients and 4 high - volume surgeons operated on 321 patients . groups showed an equal distribution for preoperative characteristics , except a higher asa - classification in the low - volume group . a high - volume surgeon proved to be an independent prognostic factor for disease - free survival in the multivariate analysis ( p = 0.04 ) . although overall survival did show a significant difference in the univariate analysis ( p < 0.001 ) it failed to reach statistical significance in the multivariate analysis ( p = 0.09 ) . conclusions . in our study , a higher number of colorectal cases performed per surgeon were associated with longer disease - free survival . implementing high - volume surgery results in improved long - term outcome following colorectal cancer .

osteoarthritis ( oa ) is characterized by cartilage breakdown , synovial fibrosis , and osteophyte formation . the main clinical symptom of oa is chronic joint pain , which is typically treated using analgesic drugs , such as nonsteroidal anti - inflammatory drugs and corticosteroids [ 1 , 2 ] . however , due to potential adverse effects [ 3 , 4 ] and variable efficacy of these drugs for providing symptomatic pain relief , more effective analgesics are needed to improve oa treatment and patient care . in addition , because only a few effective disease - modifying drugs are available for oa [ 5 , 6 ] , a better understanding of the mechanisms that drive oa pain is required to guide drug development . nerve growth factor ( ngf ) is a widely known pain mediator and plays a critical role in the modulation of oa pain [ 811 ] . the neutralization of ngf with tanezumab , an anti - ngf monoclonal antibody , has robust analgesic effects on oa pain [ 8 , 10 , 11 ] . due to these effects , the regulation of ngf has been investigated in several in vitro and in vivo studies [ 12 , 13 ] . evidence from these studies suggests that the activity of ngf is mediated by inflammatory cytokines . for example , in an experimental arthritic mouse model , il-1 , but not tnf- , increased ngf levels in knee joints . however , the mechanism regulating ngf expression in synovial tissue ( st ) remains unclear . st contains macrophage- and fibroblast - like cells in the lining layer [ 1416 ] . the treatment of cultured synovial oa fibroblasts with il-1 and tnf- induces the production of ngf . more recent studies have shown that macrophages produce a number of inflammatory cytokines , including il-1 , il-6 , and tnf- , which contribute to oa progression and associated joint pain [ 1721 ] . despite these findings , the regulation of ngf expression in synovial macrophages is not fully understood . str / ort mice are a well - characterized oa model that spontaneously develop oa with a progression resembling that of humans [ 2224 ] . synovial hyperplasia is also observed in str / ort mice , and we previously showed that the cd11b+ macrophage population in st str / ort mice is higher than that found in c57bl/6j mice [ 17 , 18 ] . in addition , we reported that compared to synovial fibroblasts ( cd11b ) , synovial macrophages produce high levels of il-1 and tnf- in str / ort mice . here , we characterized the expression profiles of several inflammatory cytokines and ngf in the st of str / ort mice . in addition , the regulation of ngf expression by inflammatory cytokines in synovial macrophages and fibroblasts was also examined . nine - month - old male str / ort ( average body weight , 40.6 4.1 g ) and c57bl/6j ( control ; average body weight , 32.8 1.2 g ) mice ( charles river laboratories , inc . , specific pathogen - free colonies of each mouse line were maintained at nippon charles river laboratories ( kanagawa , japan ) in a semibarrier system with a controlled environment ( temperature : 23 2c ; humidity : 55% 10% ; lighting : 12 h light / dark cycle ) . all experimental protocols were approved by the kitasato university school of medicine animal care committee . c57bl/6j and str / ort mice were sacrificed by the intramuscular injection of a mixture of medetomidine , midazolam , and butorphanol tartrate . after removing skin with a scalpel , st was harvested , and total rna was then extracted from the harvested tissue using trizol ( invitrogen , carlsbad , ca , usa ) , according to the manufacturer 's instructions . the extracted total rna was used as a template for first - strand cdna synthesis using superscript iii rt ( invitrogen ) in pcr reaction mixtures consisting of 2 l cdna , specific primer set ( 0.2 m final concentration ) , and 12.5 l sybr premix ex taq ( takara , kyoto , japan ) in a final volume of 25 l . the primers for il6 and ngf were designed using primer blast software and were synthesized by hokkaido system science co. , ltd . the other primers used in this study were designed based on previously published primer sequences . the sequences of the pcr primer pairs used in this study are listed in table 1 . quantitative pcr was performed using a cfx-96 real - time pcr detection system ( bio - rad , hercules , ca , usa ) . the pcr cycles consisted of an initial denaturation step at 95c for 1 min , followed by 40 cycles of 95c for 5 s and 60c for 30 s. mrna expression was normalized to the levels of glyceraldehyde-3-phosphate dehydrogenase ( gapdh ) mrna . the gene expression levels in the st of str / ort mice were compared with those in the st of c57bl/6j mice ( str / ort / c57bl6j ) . in addition , the gene expression levels in cd11b+ cells were compared with those in cd11b cells ( cd11b+/cd11b ) . st samples were collected from both knees of five str / ort mice , and mononuclear cells were then isolated from the collected tissue by digestion with type i collagenase for 2 h at 37c . the obtained mononuclear cells were suspended in 500 l phosphate - buffered saline ( pbs ) containing biotinylated anti - cd11b antibody . following a 30 min incubation at 4c , the cells were washed with pbs , mixed with streptavidin - labelled magnetic particles ( bd imag streptavidin particles plus - dm ; bd biosciences , tokyo , japan ) , and incubated for 30 min on ice in an imag separation system ( bd biosciences ) . warmed ( 37c ) -minimum essential medium ( mem ) was added to the cell suspension to collect unbound ( cd11b - negative ) cells , and an additional 3 ml -mem was added to collect cd11b - positive cells after removing the tub from the magnetic support . the cd11b - positive and cd11b - negative cells were collected by centrifugation at 300 g for 10 min , and the obtained cells were cultured in -mem in six - well plates . tnf- , il-1 , il-6 , and ngf expression in the cells was analyzed by reverse transcription - polymerase chain reaction ( rt pcr ) . st - derived mononuclear cells , including synovial macrophages and fibroblasts , which were isolated as described above , were cultured in -mem in six - well plates . after a 1-week incubation at 37c in a 5% co2 incubator , synovial fibroblasts were incubated with either mouse recombinant tnf- ( 25 ng / ml ) , il-1 ( 50 ng / ml ) , or il-6 ( 100 ng / ml ) ( biolegend , san diego , ca , usa ) for 24 h. cells that were not treated with any cytokines were used as controls . to examine the effect of tnf- on synovial macrophages and fibroblasts , cd11b - positive and cd11b - negative cells were collected from st , as described above , and were then cultured in -mem in six - well plates . after a 1-week incubation at 37c in a 5% co2 incubator , cd11b - positive and negative cells were incubated with mouse recombinant tnf- ( 25 ng / ml ) or il-1 ( 50 ng / ml ) for 24 h. cells that were not treated with tnf- were used as controls . the treated and control cells were harvested for total rna isolation , as described above , and ngf expression was analyzed by rt pcr . ten l3 and l4 drg samples were harvested from the 9-month - old c57bl/6j and str / ort mice and were then immersed in a buffered paraformaldehyde fixative at 4c overnight . the samples were further incubated in pbs containing 20% sucrose for 24 h at 4c . after freezing in liquid nitrogen , each specimen was sectioned at 10 m thickness on a cryostat ( leica microsystems , cm3050s , wetzlar , germany ) and was then treated for 90 min at room temperature with a blocking solution of pbs containing 0.05% tween-20 and 1% skim milk . the sectioned drg specimens were stained with rabbit antibodies against calcitonin gene - related peptide ( cgrp ; 1 : 1000 ; immunostar , hudson , wi , usa ) and transient receptor potential vanilloid 1 ( trpv1 ; 1 : 500 ; calbiochem , san diego , ca , usa ) by incubation for 18 h at 4c . the drg sections were then incubated with alexa 488-conjugated goat anti - rabbit igg ( for cgrp immunoreactivity , 1 : 1000 ; molecular probes ) and alexa 488-conjugated goat anti - rabbit igg ( for trpv1 immunoreactivity , 1 : 1000 ; molecular probes ) . the immunostained sections were visualized using a fluorescence microscope ( axiovert 200 , zeiss , jena , germany ) in a treatment - blinded manner . the numbers of cgrp- and trpv - positive cells were counted , and the proportion of these cells to the total number of nucleated cells in drg was calculated for each drg sample . differences between c57bl/6j and str / ort mice were examined using the t - test . all statistical analyses were performed with spss software ( version 11.0 ; spss , inc . , chicago , il , usa ) . a p value of < 0.05 was considered statistically significant . real - time pcr analysis of the genes encoding tnf- , il-1 , il-6 , and ngf showed that the expression levels of these genes were significantly elevated in the st of str / ort mice compared to those in control c57bl/6j mice ( figures 1(a)1(d ) ) . activated macrophages reportedly produce higher levels of inflammatory cytokines , including tnf- , il-1 , and il-6 , than tissue - resident macrophages [ 18 , 26 , 27 ] . to determine whether macrophages in st also produce inflammatory cytokines , expression of the genes encoding tnf- , il-1 , and il-6 in cd11b - positive cells isolated from the st of str / ort mice was examined by real - time pcr . tnf- , il-1 , and il-6 gene expression in cd11b - positive cell fractions was higher than that in cd11b - negative cell fractions ( figures 2(a)2(c ) ) . in contrast , no differences in the gene expression of ngf were detected between the two examined cell fractions ( figure 2(d ) ) . real - time pcr analysis revealed that the gene expression of ngf increased significantly in isolated synovial cells in the presence of exogenously added tnf- and il-1 compared to untreated control cells ( figure 3 ) . in contrast , the gene expression of ngf was not affected in il-6-treated synovial cells ( figure 3 ) . ngf expression was also significantly increased in the presence of exogenously added tnf- in isolated populations of synovial fibroblasts and macrophages compared to untreated control cells ( figure 4(a ) ) . ngf expression was also significantly increased in the presence of exogenously added il-1 in isolated populations of synovial fibroblasts , but not in synovial macrophages ( figure 4(b ) ) . to investigate pain - related sensory innervation by ngf , the proportion of trpv1- and cgrp - positive cells in the drg of str / ort mice was investigated by immunohistochemistry . the number of trpv1- ( figures 5(a ) , 5(b ) , and 5(e ) ) and cgrp - positive cells ( figures 5(b ) , 5(d ) , and 5(f ) ) in the drg of str / ort mice was significantly higher compared to that found in the drg of c57bl/6j mice . in the present study investigating the mechanisms underlying the regulation of ngf and development of oa pain , higher expression of the genes encoding tnf- , il-1 , il-6 , and ngf was observed in the st of an oa str / ort mouse model compared to that in c57bl/6j mice . in addition , ngf expression was specifically detected in the cd11b - positive and cd11b - negative cell fractions isolated from st , whereas higher tnf- , il-1 , and il-6 gene expression was observed in the cd11b - positive cell fractions . notably , the treatment of cultured synovial cells with tnf- and il-1 stimulated ngf expression and tnf- also stimulated ngf expression in cd11b - positive and cd11b - negative cell fractions . the number of trpv1- and cgrp - positive cells in the drg of str / ort mice was significantly higher compared to that found in the drg of c57bl/6j mice . taken together , these findings suggest that tnf- regulates ngf expression in both synovial fibroblasts and macrophages and that il-1 regulates ngf expression in synovial fibroblasts and that these factors may contribute to the development of pain in oa patients by innervation of the peripheral nervous system . ngf is upregulated in human synovial fibroblasts , suggesting that this factor plays an important role in oa pathology [ 12 , 13 , 28 ] . ngf elevated inflammatory knee joint and tnf- and il-1 stimulate synovial fibroblasts to produce ngf . reported that ngf expression is upregulated in the knee joint of a carrageenan - treated inflammatory arthritis model and is further stimulated by the intraarticular injection of tnf- and il-1 . further , tnf- and il-1 treatment of cultured synovial fibroblasts derived from a human oa patient also increased ngf production . however , because these studies consisted of analyses of whole knee joints or cultured synovial fibroblasts exogenously stimulated with tnf- and il-1 , the cell populations responsible for regulating ngf and producing tnf- and il-1 in st were not conclusively determined . here , elevated expression of the inflammatory cytokines tnf- , il-1 , and il-6 was observed in the st of str / ort mice , and tnf- and il-1 were increased in synovial macrophages isolated from this oa model . in addition , ngf expression was stimulated by tnf- and il-1 in the synovial fibroblast fraction . taken together , these findings suggest that tnf- and il-1 stimulate ngf expression in synovial fibroblasts . a recent immunohistochemical analysis revealed that ngf not only is localized to fibroblasts , but is also produced by a specific population of macrophages in human st . however , the factor regulating ngf in macrophages was not determined . in the present study , isolated synovial macrophages and fibroblasts from str / ort mice expressed ngf at similar levels to each other . ngf expression in the macrophage fraction was also stimulated by tnf-. taken together , these findings indicate that tnf- stimulates ngf expression in both synovial fibroblasts and macrophages . ngf plays a key role in the generation of acute and chronic pain and peripheral sensitization [ 3033 ] . recent evidence suggests that the trpv1 ion channel and cgrp are involved in the development of ngf - induced persistent mechanical and thermal hypersensitivity in rats [ 30 , 31 ] . ngf acutely modulates trpv1 activity [ 32 , 33 ] and also stimulates cgrp expression in drg neurons in vitro and in vivo . consistent with this speculation , inhibition of ngf by treatment with tanezumab was recently shown to have high analgesic efficacy in oa knees compared with placebo . in the present study , cgrp- and trpv1-positive cells , which are localized in drg neurons in monoiodoacetate- ( mia- ) treated oa animals [ 35 , 36 ] , were increased in the drg of str / ort compared to c57bl/6j mice , suggesting that the elevation of synovial ngf in str / ort mice contributes to peripheral sensitization . however , several studies have shown that human oa chondrocytes also produce ngf by inflammatory cytokines [ 37 , 38 ] . further investigations are needed to clarify the contribution of chondrocytes derived ngf on peripheral sensitization . first , the mechanism underlying the development of oa pain that was proposed based on the present results was based on cross - sectional analysis and therefore no data on the effects of the observed changes on the progression of oa are available . second , although ngf was found to be elevated in the st of oa mice , it remains to be determined if the elevation of synovial ngf levels contributes to peripheral sensitization . finally , present study did not confirm that the protein levels of these cytokines correlated with the expression levels . in conclusion , the present results support the hypothesis that tnf- regulates ngf expression in synovial fibroblasts and macrophages and il-1 regulates ngf expression in synovial fibroblasts in oa mice . tnf- and il-1 may therefore regulate ngf signaling in oa joints and be suitable therapeutic targets for treating oa pain .

to investigate the role of macrophages as a regulator and producer of nerve growth factor ( ngf ) in the synovial tissue ( st ) of osteoarthritis ( oa ) joints , the gene expression profiles of several inflammatory cytokines in the st , including synovial macrophages and fibroblasts , of oa mice ( str / ort ) were characterized . specifically , real - time polymerase chain reaction analysis was used to evaluate the expression of tumor necrosis factor- ( tnf- ) , interleukin- ( il- ) 1 , il-6 , and ngf in cd11b+ and cd11b cells isolated from the st of a murine oa model . the effects of tnf- , il-1 , and il-6 on the expression of ngf in cultured synovial cells were also examined . the expression of tnf- , il-1 , il-6 , and ngf in the st of str / ort was higher than that in c57/bl6j mice . compared to the cd11b cell fraction , higher expression levels of tnf- , il-1 , and il-6 were detected in the cd11b+ cell fraction , whereas no differences in the expression of ngf were detected between the two cell fractions . notably , tnf- upregulated ngf expression in synovial fibroblasts and macrophages and il-1 upregulated ngf expression in synovial fibroblasts . il-1 and tnf- may regulate ngf signaling in oa joints and be suitable therapeutic targets for treating oa pain .

cardiovascular disease ( cvd ) affects the heart and blood vessels and is the principal cause of death worldwide . considered the primary risk factor for cvd , high blood pressure , or hypertension , consists of a sustained increase in blood pressure levels . in 2000 , > 25% of the population worldwide ( approximately 1 billion ) suffered from hypertension , a figure predicted to increase to 1.56 billion by 2025 . angiotensin i - converting enzyme ( peptidyl carboxy peptidase , ec 3.4.15.1 , ace ) belongs to the class of zinc proteases that require zinc and chloride for activation . ace plays an important role in blood pressure regulation via the renin - angiotensin system ( ras ) and the kallikrein - kinnin system ( kks ) . in the kks , ace inactivates the vasodilator bradykinin , while in the ras , ace acts as an exopeptidase cleaving his - leu from the c - terminal of decapeptide angiotensin i and producing the potent vasoconstrictor octapeptide angiotensin ii . use of enzyme technologies for protein recovery and modification has led to production of a broad spectrum of food ingredients and industrial products . hydrolysis selectivity is commonly manipulated by employing proteases from different sources due to their specificity for peptide bonds adjacent to certain amino acids . ace - i inhibitory peptides derived from food proteins have attracted particular attention for their ability to prevent hypertension . compared with chemosynthetic drugs , peptides from food proteins they therefore hold promise as potent functional food additives and represent a healthier and more natural alternative to ace inhibitor drugs . dietary ace - i inhibitory peptides may be bioavailable . some ace - i inhibitory peptides resist digestion , can be absorbed in the intestine , and are stable in the blood , suggesting they may produce an acute blood pressure - lowering effect after oral administration . the first ace - i inhibitory peptide was isolated from snake venom , and since then many others have been discovered in enzymatic hydrolysates of different food proteins . food protein sources used to date include casein , whey protein , fish protein , chicken eggs , and wheat germ . . the degree of hydrolysis and inhibitory activities of angiotensin i - converting enzyme ( ace ) increased with increasing proteolysis time . population growth and shrinking food resources are ongoing challenges in developing countries , while excessive animal protein intake and associated unhealthy levels of saturated fats exposure are increasingly common in developed countries . in response , research interest has steadily grown in the search for new sources of proteins from nonconventional raw materials . the genus salvia l. belongs to the lamiaceae family and includes about 900 species found worldwide , most mainly in the mediterranean , southeast africa , and central and south america . cultivated for culinary , medicinal , and ornamental uses , salvia species form part of ethnopharmacological traditions and are an important crop , especially for small farmers . recent research has addressed the chemical composition , biological properties , and possible applications of its essential oils , which may be sources for economically promising natural products with uses in the food , pharmaceutical , and cosmetic industries . the present study objective was to identify and quantify ace - i inhibitory activity in protein hydrolysates from a salvia hispanica protein rich fraction hydrolyzed with an alcalase - flavourzyme sequential system , and in ultrafiltered fractions from this hydrolysate . chia ( s. hispanica , l. ) seeds were obtained in yucatan state , mexico . reagents were of analytical grade and purchased from j. t. baker ( phillipsburg , nj , usa ) , sigma ( sigma chemical co. , st . louis , mo , usa ) , merck ( darmstadt , germany ) , and bio - rad ( bio - rad laboratories inc . angiotensin - converting enzyme from rabbit lung ( 2 units / mg protein ) was purchased by sigma ( a6778 sigma chemical co. , st . the alcalase 2.4 l and flavourzyme 500 mg enzymes were purchased from novo laboratories ( copenhagen , denmark ) . flour was produced from 6 kg chia seed by first removing all impurities and damaged seeds , crushing the remaining sound seeds ( moulinex dpa139 , zapopan , mexico ) , and milling them ( krups 203 mill , mexico city , mexico ) . oil extraction from the milled seeds was done with hexane in a soxhlet system for 2 h. the remaining fraction was milled with 0.5 mm screen ( thomas model 4 wiley , swedesboro , nj , usa ) . the defatted chia flour was dried in a labline stove at 60c for 24 h. extraction of the protein - rich fraction was done by dry fractionation of the defatted flour according to vzquez - ovando et al . . briefly , 500 g flour was sifted for 20 min using a tyler 100 mesh ( 140 m screen ) and a ro - tap agitation system . the chia protein - rich fraction was hydrolyzed in batches by sequential treatment with alcalase and flavourzyme . a predigestion with alcalase for 60 min hydrolysis conditions were substrate concentration , 2 g/100 g ; enzyme / substrate ratio , 0.3 au g for alcalase and 50 lapu g for flavourzyme ; ph , 7 for alcalase and 8 for flavourzyme and temperature , 50c . hydrolysis was done in a reaction vessel equipped with a stirrer , thermometer , and ph electrode . in all treatments , the reaction was stopped by heating to 85c for 15 min , followed by centrifuging at 9880 g for 20 min to remove the insoluble portion . degree of hydrolysis ( dh ) was calculated by determining free amino groups with o - phthaldialdehyde following the methodology described by nielsen et al . as follows : dh = h / htot100 , where htot is the total number of peptide bonds per protein equivalent , and h is the number of hydrolyzed bonds . the htot factor is dependent on the raw material amino acid composition and was determined by reverse - phase high performance liquid chromatography ( rp - hplc ) . samples ( 24 mg protein ) were treated with 4 ml of 6 mol equivalent to l hcl , placed in hydrolysis tubes , and gassed with nitrogen at 110c for 24 h. they were then dried in a rotavapor and suspended in 1 mol l sodium borate buffer at ph 9.0 . amino acids were separated using hplc with a reversed - phase column ( 300 3.9 mm , nova - pak c18 , 4 mm ; waters ) and a binary gradient system with 25 mmol l sodium acetate containing ( a ) 0.02 g l sodium azide at ph 6.0 and ( b ) acetonitrile as solvent . flow rate was 0.9 ml min , and elution gradient was time 0.03.0 min , linear gradient a : b ( 91 : 9 ) to a b ( 86 : 14 ) ; time 3.013.0 min , elution with a b ( 8614 ) ; time 13.030.0 min , linear gradient a b ( 86 : 14 ) to a b ( 69 : 31 ) ; time 30.035.0 min , elution with a b ( 69 : 31 ) . the hydrolysate was fractionated by ultrafiltration , using a high performance ultrafiltration cell ( model 2000 , millipore ) . five fractions were prepared using four molecular weight cut - off ( mwco ) membranes : 1 kda , 3 kda , 5 kda , and 10 kda . soluble fractions prepared by centrifugation ( 9880 g for 20 min ) were passed through the membrane starting with the largest mwco membrane cartridge ( 10 kda ) . retentate and permeate were collected separately , and the retentate recirculated into the feed until maximum permeate yield was reached at this size , as indicated by a decrease in permeate flow rate . permeate from the 10 kda membrane was then filtered through the 5 kda membrane with recirculation until maximum permeate yield was reached . the 5 kda permeate was then recirculated through the 3 kda membrane and the 3 kda permeate through the 1 kda membrane . this process minimized contamination of the larger molecular weight fractions with smaller molecular weight fractions , while producing enough retentates and permeates for the following analyses . the five ultrafiltered peptide fractions ( upf ) were prepared and designated as > 10 kda ( 10 kda retentate ) ; 510 kda ( 10 kda permeate5 kda retentate ) ; 35 kda ( 5 kda permeate3 kda retentate ) ; 13 kda ( 3 kda permeate1 kda retentate ) ; < 1 kda ( 1 kda permeate ) . ace - i inhibitory activity in the hydrolysate and its upf was analyzed following the method of hayakari et al . which is based on the fact that ace - i hydrolyzes hippuryl - l - histidyl - l - leucine ( hhl ) yielding hippuric acid and l - histidyl - l - leucine . this method relies on the colorimetric reaction of hippuric acid with 2,4,6-trichloro - s - triazine ( tt ) in a 0.5 ml incubation mixture containing 40 mol potassium phosphate buffer ( ph 8.3 ) , 300 mol sodium chloride , 40 mol 3% hhl in potassium phosphate buffer ( ph 8.3 ) , and 100 mu / ml ace - i . this mixture was incubated at 37c/45 min and the reaction terminated by addition of tt ( 3% v / v ) in dioxane and 3 ml 0.2 m potassium phosphate buffer ( ph 8.3 ) . after centrifuging the reaction mixture at 10,000 g for 10 min , enzymatic activity was determined in the supernatant by measuring absorbance at 382 nm . all runs were done in triplicate . ace - i inhibitory activity was quantified by a regression analysis of ace - i inhibitory activity ( % ) versus peptide concentration , and ic50 values ( i.e. , the peptide concentration in g protein / ml required to produce 50% ace - i inhibition under the described conditions ) was defined and calculated as follows : ( 1)ace - i inhibitory activity ( % ) = ( ab)(ac)100 , where a represents absorbance in the presence of ace - i sample , b absorbance of the control , and c absorbance of the reaction blank . consider the following : ( 2)ic50=(50b)m , where b is the intersection and m is the slope . amino acid composition was determined in the upf with the highest biological activity , according to the method of alaiz et al . samples ( 24 mg protein ) were treated with 4 ml of 6 mol equivalent l hcl , placed in hydrolysis tubes , and gassed with nitrogen at 110c for 24 h. they were then dried in a rotavapor and suspended in 1 mol l sodium borate buffer at ph 9.0 . amino acids were separated using hplc with a reversed - phase column ( 300 3.9 mm , nova - pak c18 , 4 mm ; waters ) and a binary gradient system with 25 mmol l sodium acetate containing ( a ) 0.02 g l sodium azide at ph 6.0 and ( b ) acetonitrile as solvent . flow rate was 0.9 ml min , and the elution gradient was time 0.03.0 min , linear gradient a : b ( 91 : 9 ) to a b ( 86 : 14 ) ; time 3.013.0 min , elution with a b ( 8614 ) ; time 13.030.0 min , linear gradient a b ( 86 : 14 ) to a b ( 69 : 31 ) ; time 30.035.0 min , elution with a b ( 69 : 31 ) . after filtration through 10 , 5 , 3 , and 1 kda membranes in a high performance ultrafiltration cell , 10 ml of the fraction with highest ace - i inhibitory activity was injected into a sephadex g-50 gel filtration column ( 3 cm 79 cm ) at a flow rate of 25 ml / h of 50 mm ammonium bicarbonate ( ph 9.1 ) . peptide molecular masses were determined by referring to a calibration curve running molecular mass markers on the sephadex g-50 under identical conditions and those used for the test samples . molecular mass standards were thyroglobulin ( 670 kda ) , bovine gamma globulin ( 158 kda ) , equine myoglobin ( 17 kda ) , vitamin b12 ( 1.35 kda ) , and thr - gln ( 0.25 kda ) . fractions selected for further peptide purification were pooled and lyophilized before rp - hplc . one - way anovas were run to evaluate in vitro ace - i inhibitory activity and a duncan multiple range done to identify differences between treatments . all analyses were done according to montgomery and processed using the statgraphics plus version 5.1 software . with a protein content of 46.7% , the chia protein - rich fraction proved to be good starter material for hydrolysis . production of extensive ( i.e. , > 50% dh ) hydrolysates requires use of more than one protease because a single enzyme can not achieve such high dhs within a reasonable time period . for this reason , an alcalase - flavourzyme sequential system was used in the present study to produce an extensive hydrolysate . alcalase ( ec 3.4.21.62 ) is a proteinase from bacillus licheniformis and the flavourzyme ( ec 3.4.11.1 ) is a fungal protease from aspergillus oryzae with both endo- and exopeptidase activities . the bacterial endoprotease alcalase is limited by its specificity , resulting in dhs no higher than 20%25% , depending on substrate , but can attain these dhs in a relatively short time under moderate conditions . when alcalase is used to hydrolyze protein it tends to produce peptides whose c - terminals are amino acids with large side chains and no charge ( aromatic and aliphatic amino acids ) , such as ile , leu , val , met , phe , tyr , and trp . the fungal protease flavourzyme has broader specificity , which , when combined with its exopeptidase activity , can generate dh values as high as 50% . flavourzyme is recommended for production of hydrolysates or peptides with biological activity and low bitterness . both alcalase and flavourzyme tend to generate peptides with hydrophobic amino acid c - terminals , and qsar analyses of ace - i inhibitory peptides have shown that peptides with hydrophobic amino acid c - terminals exhibit potentially strong ace - i inhibition . therefore , alcalase and flavourzyme are probably suitable for preparing high - activity ace - i inhibiting peptides . in addition , both proteases are suitable for industrial applications and are microbial enzymes , meaning that they are easily obtained and relatively low cost compared to other enzymes such as proteinase k and chymotrypsin c . chia hydrolysates obtained with the alcalase - flavourzyme sequential system had clear biological activity and are promising prospects for use in new product development . the highest dh in the present study ( 51.6% ) was attained with flavourzyme at 150 min . however , it was made possible by alcalase predigestion , which increases the number of n - terminal sites , thus facilitating hydrolysis by flavourzyme . this dh was higher than reported for hard - to - cook bean hydrolyzed with alcalase - flavourzyme ( 43% ) or pepsin - pancreatin ( 26.2% ) for 90 min . but it was lower than reported for chickpea ( 65% ) hydrolyzed with alcalase - flavourzyme at 150 min and for rapeseed ( 60% ) hydrolyzed with the same system at 3 h . when hydrolyzed sequentially with alcalase and flavourzyme , chia s. hispanica is an appropriate substrate for producing extensive hydrolysates ( dh higher than 10% ) , and a natural source of peptides with potential bioactivity . a number of natural ace - i inhibitors have been isolated from different organism proteins , including peptides extracted by enzymatic hydrolysis . when added to food systems , enzymatic hydrolysates have exhibited advantages such as improved water - binding capacity , emulsifying stability , protein solubility , and nutritional quality . hydrophobicity of amino - acid side chains is normally due to relatively small peptides with molecular weights between 1,000 and 6,000 da . enzymatic hydrolysis is an effective way of producing bioactive peptides , which are short peptides released from food proteins by hydrolysis and with biological activities that may be beneficial to the organism . bioactive peptides usually contain 320 amino acids per molecule and are inactive within the parent protein molecule sequence . the protein hydrolysate obtained from the chia protein - rich fraction had 58.5% ace - i inhibition . this is lower than the 79.5% reported for yak milk casein hydrolyzed with alcalase for 240 min , but higher than the 5%50% obtained for protein hydrolysates from amaranth ( amaranthus hypochondriacus ) albumin 1 and globulin . ace - i inhibition ranged from 53.8% to 69.3% ( figure 1 ) , with clear increases ( p < 0.05 ) in activity in progressively smaller fractions ; that is , the > 10 kda fraction had the lowest activity and the < 1 kda had the highest . this coincides with a study in which the < 1 kda fraction of an alaska pollock ( theragra chalcogramma ) frame protein hydrolysate had the highest ace - inhibitory activity ( 87.6% , ic50 = 457 g / ml ) . in another study , protein hydrolysate from chinese soft - shelled turtle had a lower ace - i inhibitory effect ( ic50 = 280 g / ml ) than its corresponding < 5000 kda ultrafiltered fraction ( ic50 = 190 5 g / ml ) . a greater inhibitory effect at smaller molecular weights was also observed in a yak casein hydrolysate fraction , in which the < 6 kda fraction was the most effective ( 85.4% ) . when taken in conjunction , these results support the suggestion that ultrafiltration is an effective way of enriching ace - i inhibitory peptides from chia proteins . an amino acid profile was generated for the < 1 kda upf because it had the highest ace - i inhibitory activity . during hydrolysis , asparagine and glutamine partially converted to aspartic acid and glutamic acid , respectively ; the data for asparagine and/or aspartic acid were therefore reported as asx while those for glutamine and/or glutamic acid were reported as glx . the high inhibitory activity ( 69.3% ) exhibited by the < 1 kda upf was probably due to its high concentration of hydrophobic amino acids ( 41.68 g/100 g ) , including pro ( 6.11 g/100 g ) , phe ( 11.03 g/100 g ) , leu ( 10.23 g/100 g ) , and ile ( 6.57 g/100 g ) ( table 1 ) . amino acid c - terminal hydrophobicity has the greatest influence on ace - i inhibitory activity , and the higher the hydrophobicity the higher the inhibitory activity . found that dipeptides could have high ace - i inhibitory activity if c - terminals were aromatic amino acids and proline , and n - terminals were aliphatic amino acid branches . measured cheung 's peptides samples in the same laboratory , modeled the results with a qsar , and found that dipeptides with positively - charged amino acids at the n - terminal and bulky hydrophobic amino acids at the c - terminal had stronger ace - i inhibitory activity . using z descriptors to investigate the quantitative structure - activity relationship of ace - inhibitory dipeptides , wu et al . found that ace - inhibitory activity was strongly affected by the three - dimensional chemical properties and hydrophobicity of c - terminal amino acids ; that is , the higher the volume and the greater the hydrophobicity of the amino acids , the higher the ace - i inhibitory activity . therefore , some dipeptides with hydrophobic amino acids at the c - terminal , such as phenylalanine , tryptophan , and tyrosine , will have high ace - i inhibitory activity . wu et al . also reported that strongly hydrophobic and small n - terminal amino acids , such as valine , leucine , and isoleucine , were more suitable for high - activity tripeptides . low charge , large size , and weak hydrophobicity in the second amino acid from the n - terminal were more suitable high activity . finally , for the c - terminal , high charge , large volume , and strongly hydrophobic residues ( e.g. , aromatic amino acids ) were more suitable . in an analysis of ace - i inhibitory . found that for peptides with 6 amino acids at the c - terminal , ace - i inhibition was strongly affected by hydrophobicity , positive charge , and volume of amino acids adjacent to the c - terminal , whereas the n - terminal amino acid had no direct relationship . hydrophobicity and c - terminal amino acid size are apparently the principal aspects affecting ace - inhibitory activity . it stands to reason that hydrophobic amino acids , aromatic amino acids , and branched - chain amino acids are important components in high - activity peptides , and that proteins with high contents of these amino acid types ( especially aromatic amino acids ) have more potential to produce high activity ace - i inhibitory peptides . therefore , digestion of proteins to produce peptides with hydrophobic amino acids at the c - terminal will tend to increase ace - i inhibitory activity in any derived hydrolysates . although the structure - activity relationship of ace - i inhibitory peptides has not yet been established , these peptides show some common features . studies of the structure - activity relationships in different ace - i inhibitory peptides indicate that binding to ace is strongly influenced by substrate c - terminal tripeptide sequence . ondetti and cushman proposed a binding model for interactions between the substrate and active ace site . c - terminal tripeptide residues may interact with the s1 , s1 , and s2 subsites at the active ace site . ace appears to prefer substrates or competitive inhibitors that contain hydrophobic amino acid residues at the three c - terminal positions . captopril owes its potency and selectivity to chemical design guided by a hypothetical active site model based on the observed properties of ace and on an analogy to the known active site of a related zinc - containing peptidase . ace 's zinc ion is appropriately located between s1 and s1 , allowing it to participate in hydrolytic cleavage of the substrate peptide bond and resulting in release of a dipeptide product . studies of the structure - activity relationship in ace - i inhibitory peptides have shown that those with potent inhibitory activity have proline , phenylalanine , or tyrosine at the c - terminal , as well as hydrophobic amino acids in their sequence . in light of this previous research , the ace - i inhibitory activity observed here in the chia hydrolysate was probably due to amino acid composition ( figure 2 ) . of the upfs , the < 1 kda fraction exhibited the highest ace - i inhibitory activity and was selected for further fractionation . a molecular weight profile was generated of this upf using gel filtration chromatography ( sephadex g-50 column ) . this profile was typical of a protein hydrolysate formed by a pool of peptides , with gradually decreasing molecular masses . elution volumes between 406 and 518 ml included free amino acids and peptides with molecular masses ranging from 0.4 to 3.6 kda . this range was fractionated into three fractions and ace - i inhibitory activity determined for each . fractions with elution volumes smaller than 406 ml and greater than 518 ml were not analyzed because they largely included peptides with high molecular weights , as well as free amino acids . ace - i inhibitory activity ( % ) in the < 1 kda upf ranged from 48.4% to 62.6% ( figure 3 ) . the highest ace - i inhibitory activity was observed in fraction f1 ( 62.6% ; 427455 ml elution volume ) . its molecular mass was approximately 1.52.5 kda , indicative of 712 amino acid residues . the ic50 value for f1 ( 3.97 g / ml ) was lower than those of gel filtration ( sephadex g-25 ) peptide fractions from tuna broth hydrolysate ( 210 to 25,260 g / ml ) or from buckwheat fagopyrum esculentum moench ( sephadex c-25 = 25,715.1 g / ml ; sephadex g-10 = 21,315.1 g / ml ) . other studies suggest that ace inhibition by hydrolysates depends on the source species and hydrolysate purity level . for instance , production of a 13 kda protein hydrolysate from alaska pollock frame using an ultrafiltration membrane bioreactor system resulted in high ace - i inhibition ( ic50 = 110 g / ml ) , but further purification using consecutive chromatographic methods in a sp - sephadex c-25 column and hplc in an octadecylsilane column resulted in a still stronger effect ( ic50 = 14.7 g / ml ) . in another example , an enzymatic hydrolysate from cuttlefish ( sepia officinalis ) muscle protein was found to have high ace - i inhibitory activity ( 87.1 0.9% at 200 g / ml ) . however , size exclusion chromatography with a sephadex g-25 produced a fraction ( p6 ) with yet higher ace - i inhibition ( ic50 = 11.6 mol / l ) , which , when fractionated by reverse - phase ( rp)-hplc , was found to contain ala - his - ser - tyr , gly - asp - ala - pro , ala - gly - ser - pro , and asp - phe - gly . in ace - i inhibitory peptides from chia , the protein - rich fractions are not as potent as hypertension treatment drugs but hold promise as a safe , natural therapeutic agent without adverse side effects . the potential of chia protein - derived peptides as antihypertension agents depends on the ability of these peptides to reach their target site without suffering degradation and consequent inactivation by intestinal or plasma peptidases . resistance to peptidase degradation is a probable prerequisite for any ace inhibitory hydrolysates / peptides to exercise an antihypertensive effect after oral or intravenous administration . proline - containing peptides are generally resistant to degradation by digestive enzymes , and tripeptides containing a pro - pro c - terminal are resistant to proline - specific peptidases . however , peptide degradation or fragmentation results in smaller peptides and therefore in potentially more potent ace - i inhibitory activity . clearly , in vivo studies are needed to confirm the effect of these peptides since it is both difficult and unwise to extrapolate directly from in vitro to in vivo activity . the main challenges in doing this are determining bioavailability of ace - i inhibitory peptides after oral administration and the fact that peptides may influence blood pressure by mechanisms other than ace - i inhibition . to exert an antihypertensive effect after oral ingestion , ace - i inhibitory peptides must reach the cardiovascular system in an active form , meaning that they need to remain active during digestion by human proteases and transport through the intestinal wall into the blood . bioavailability has been studied for some ace - i inhibitory peptides , and it is known that proline - containing peptides are generally resistant to degradation by digestive enzymes . peptides can be absorbed intact through the intestine by paracellular and transcellular routes , although postabsorption bioactivity potency is inversely correlated to chain length . all the chia derivatives studied here had ic50 values far higher than the 0.0013 g / ml of captopril , a synthetic ace - i inhibitor . nonetheless , the chia purified peptides have biological potential , and the f < 1 kda fraction had high ace - i inhibitory activity , suggesting that ace - i inhibitory peptides are rich in hydrophobic amino acids ( aromatic or branched chains ) and in proline . ace - i inhibiting peptides from food sources have garnered increasing attention in recent years as promising natural biofunctional alternatives to synthetic drugs . many of these peptides have been discovered in enzymatic hydrolysates of different food - source proteins and subsequently applied in the prevention of hypertension and initial treatment of mildly hypertensive individuals . the ongoing search for natural ace inhibitors may eventually help to create safer and less costly alternatives to synthetic pharmaceutical treatments . chia proteins hydrolyzed with the alcalase - flavourzyme sequential enzyme system resulted in hydrolysates with ace - i inhibitory activity . ultrafiltration produced a very low molecular weight fraction ( < 1 kda ) which had the highest activity . enzymatic hydrolysis and ultrafiltration are promising bioprocesses for production of new bioactive food ingredients such as ace inhibitory peptides purified from chia hydrolysate .

synthetic angiotensin i - converting enzyme ( ace - i ) inhibitors can have undesirable side effects , while natural inhibitors have no side effects and are potential nutraceuticals . a protein - rich fraction from chia ( salvia hispanica l. ) seed was hydrolyzed with an alcalase - flavourzyme sequential system and the hydrolysate ultrafiltered through four molecular weight cut - off membranes ( 1 kda , 3 kda , 5 kda , and 10 kda ) . ace - i inhibitory activity was quantified in the hydrolysate and ultrafiltered fractions . the hydrolysate was extensive ( dh = 51.64% ) and had 58.46% ace - inhibitory activity . inhibition ranged from 53.84% to 69.31% in the five ultrafiltered fractions and was highest in the < 1 kda fraction ( 69.31% ) . this fraction 's amino acid composition was identified and then it was purified by gel filtration chromatography and ace - i inhibition measured in the purified fractions . amino acid composition suggested that hydrophobic residues contributed substantially to chia peptide ace - i inhibitory strength , probably by blocking angiotensin ii production . inhibitory activity ranged from 48.41% to 62.58% in the purified fractions , but fraction f1 ( 1.52.5 kda ) exhibited the highest inhibition ( ic50 = 3.97 g / ml ; 427455 ml elution volume ) . the results point out the possibility of obtaining bioactive peptides from chia proteins by means of a controlled protein hydrolysis using alcalase - flavourzyme sequentional system .

transportation planning and public health have important historical connections . in the early 20th century transportation planning and public health held similar objectives . in 1909 marsh wrote , city planning is the adaptation of a city to its proper function . this conception can be indefinitely expanded but its significance will be appreciated if we admit that no city is more healthy than the highest death rate in any ward or block and that no city is more beautiful than its most unsightly tenement ( p.27 ) . since the early 20th century , the relationship between transportation planning and public health has waxed and waned [ 1 , 3 ] . there is growing recognition that integration of theories and methods from each discipline is beneficial for advancing research and practice . of particular relevance to both transportation planning and public health are injuries due to traffic collisions . worldwide , traffic collisions are one of the leading causes of death among youth and young adults . a number of intervention strategies including black spot analyses are used in transportation planning to reduce road fatalities . there is ongoing debate in the transportation planning literature that this type of intervention may have limited effectiveness in reducing road fatalities [ 68 ] . new approaches are needed to reduce the burden of road traffic fatalities . given the need to reconnect transportation planning and public health , this paper will present rose 's strategy of preventive medicine [ 9 , 10 ] , a promising intervention approach from public health . the prevention paradox states that a preventive measure which brings much benefit to the population offers little to each participating individual ( p.38 ) . the prevention paradox is based on an important distinction between an individual case and the incidence of cases in a population . a case is defined as an episode of disorder , illness , or injury affecting an individual , while incidence is defined as the number of cases of a disease that come into being during a specific time period ( p.44 ) . the basic principle of geoffrey rose 's strategy of preventive medicine is that the causes of cases ( i.e. , why a specific individual is involved in a collision ) are different from the causes of population incidence ( i.e. , why there are over 3 million collisions per year in the united states ) . building from the prevention paradox , the primary concept of rose 's strategy is that the majority of cases do not occur in individuals at high risk . thus , a large number of people exposed to a small risk may generate many more cases than a small number exposed to a high risk ( p.59 ) . the recent study by beck provides an example of this principle related to road traffic fatalities . show that pedestrians ( 13.7 deaths per 100,000 person trips ) , cyclists ( 21.0 deaths per 100,000 person trips ) , and motorcyclists ( 536.6 deaths per 100,000 person trips ) are at higher risk of a fatal collision than motor vehicle users . despite their higher risk , pedestrians , cyclists , and motorcyclists represent only 20.5% of those killed in traffic collisions . figure 1 shows that in the usa the majority of trips ( 86% ) and therefore exposure to causes of collisions are greater for motor vehicle users . thus , the majority of those killed ( 76.6% ) are motor vehicle users who are , on average , at a lower risk ( 9.2 deaths per 100,000 person trips ) than other road users except public transit users . for interventions to be effective in reducing the total number of road deaths and injury , they must target fundamental causes ( i.e. , causes of incidence ) , which would result in a global reduction in exposure to a fundamental cause for the entire population . according to the strategy of preventive medicine road traffic fatalities can be neither understood nor properly controlled if high - risk road users are thought to constitute the entire problem . policies and practices that attempt to prevent traffic fatalities must consider all modes of transportation because they all contribute to the total number of deaths ( figure 1 ) [ 14 , 15 ] . in transportation research , the volume and speed of motor vehicle traffic could be considered two of the fundamental causes of collisions , for all road users [ 16 , 17 ] . throughout the paper , we consider exposure to moving vehicles as a fundamental cause of road traffic deaths and injuries . in this example , a global reduction in the amount of kilometers driven would result in a reduction of the likelihood of collisions for all road users , a left shift in the risk of road death and injury ( figure 2 ) [ 18 , 19 ] . for all road users , including pedestrians and cyclists , a reduction in traffic volume contributes to a lower risk of injury and death . significant public health benefits could be achieved through macrolevel interventions that influence the level of exposure to traffic volumes for all road users , for example , land use and transportation policies that encourage using safer transportation modes ( e.g. , public transit ) and area - wide traffic calming schemes covering whole metropolitan areas , among others . in the usa , recent reductions of traffic volume were associated with a reduction in the total number of road fatalities . rose 's perspective is one way to critically appraise the challenge of reducing the overall burden of collisions while maintaining the benefits of effective mobility . the implementation of interventions supported by rose 's strategy requires a dialogue between researchers , planners , policy makers , and the public . throughout this discussion we must recall that the primary function of roadways is not to cause collisions but rather the mobility and productivity of the population . because roadways have multiple functions , policy makers , planners , health officials , and the public may disagree on how to balance road safety with other competing functions . as rose states , if a problem is common and has been around for a long time , then people come to accept it even if it is large : it is the exceptional or new which causes alarm . the toll of deaths from road traffic accidents vastly exceeds that from crashing aero planes , but only the latter lead to public health inquiries ( p.57 ) . as the previous quote suggests , researchers must critically appraise their work and dialogue with policy makers and the public about complex transportation challenges in order to achieve an acceptable balance between the need for mobility and its consequences [ 2224 ] . ideally , interventions will both improve mobility and reduce the public health burden of road traffic injuries . in particular researchers must be conscious of the potential influence of structural global economic forces lead by major car and oil companies in influencing road collisions research and discourse [ 21 , 2527 ] . beck et al . state , our findings suggest that a shift from passenger vehicle travel ( lower risk ) to nonmotorized travel ( higher risk ) could result in an overall increase in the numbers of people killed in traffic measures that prevent crashes and injuries for pedestrians and bicyclists are needed , especially given the recent focus on increasing physical activity through active travel ( p.216 ) . suggests that the high - risk approach is a more acceptable intervention than a population approach , which would reduce exposure to fundamental causes , volume of motor vehicles in our example , for all road users . however , in general , interventions targeting high - risk groups ( e.g. , walkers and cyclists ) have limited population wide benefit for injury prevention . targeting the causes of incidence to reduce exposure to motor vehicle volume for all road users , the population approach , has the potential for a greater reduction in the total number of transportation fatalities in a population than the high - risk approach . compares a population approach and a high - risk approach targeting pedestrians and cyclists . in the usa , between 1999 and 2003 , a 25% reduction in the number of pedestrian and cyclist fatalities would have resulted in 1386 fewer deaths ( 1212 for pedestrians , 174 for cyclists ) . a greater number of lives would have been saved by a 4% reduction in the fatal risk for all road users ( table 1 ) . table 1 estimates the hypothesized effect of decreasing fatal risk over the entire population of road users . it shows that a 10% and 15% reduction in the fatality risk for all road users would result in a reduction of 4213 and 6320 cases , respectively . these scenarios would benefit motor vehicle occupants but also pedestrians and cyclists . in urban settings , a risk reduction of 15% could be achieved through area - wide traffic calming interventions . reducing the risk of road death and injury by intervening to reduce the level of exposure to traffic volumes , or other fundamental causes , first , the potential reduction in road injuries and deaths is much larger than with high - risk approaches . second , a population - wide prevention strategy is of benefit to high - risk road users , whatever the criteria used to define high risk ( e.g. , transportation mode , alcohol consumption , age group ) . third , it may also reduce other externalities including pollution , noise , physical inactivity of fundamental causes such as traffic volume [ 21 , 29 ] . for decades , the strong relationship between traffic volume and road traffic injuries or death has been reported , at the street , city , region , or country levels [ 30 , 31 ] . for all intersections from a road network , safety performance functions show that the expected number of collisions at intersections increases as traffic volume increases , though this relationship is not linear ( figure 3 ) . the traditional intervention strategy , recommended by the us department of transportation is to return deviant intersections to within an acceptable range of the average collisions rate at comparable intersections . as seen in figure 3(a ) , this targeted intervention approach aims to move the deviant intersections closer to the best fit regression line . this is an example of a high - risk approach that does not address the entire population of intersections or injured individuals . in montreal , for example , only 4% of pedestrian injuries occurred at 22 identified black spot intersections , whereas the remaining 96% of pedestrians were injured at more than 3500 different crash sites , none of which were black spots . the population strategy acknowledges that interventions should address the fundamental causes of road deaths and injuries , in our example , the level of exposure to moving vehicles over the entire population , and for all intersections . the population approach would ask whether it was possible to globally reduce the exposure to traffic volume ( figure 3(b ) ) and subsequently reduce the risk of death and injury at any given intersection for all road users . as the arrows show in figure 3(b ) , the traffic volume and subsequent risk are reduced at every intersection . in theory , it would result in a greater reduction of the number of injured road users than targeting deviant streets and intersections . rather we present a promising approach to think about road traffic fatalities . a detailed reading of rose 's work [ 9 , 10 ] will provide more precision and help clarify interested readers understanding . it should be noted that rose 's ideas are not without considerable debate in public health [ 3335 ] . for example , modeling studies suggest that rose 's approach is generally more cost effective ; however , in certain cases a high risk approach can have better cost / benefit ratios . for example , recent studies suggest that when compared with other roads , streets with cycle tracks have a lower risk of injury for cyclists [ 36 , 37 ] . as well , the potential of rose 's strategy for reducing social inequities in health in general [ 34 , 35 ] and in particular road fatalities for those residing in low income areas is still debated . a vulnerable population approach may be the most acceptable when attempting to act on social inequities ; however , a recent study has shown that reducing traffic volume at all intersections of a canadian city would be most beneficial in poorer neighborhoods . transportation planning and public health have important historical roots . to address common challenges , including road traffic fatalities , integration of theories and methods from both disciplines is required . geoffrey rose 's strategy of preventive medicine made an important theoretical contribution to public health and has applications to transportation . this paper allowed for both public health and transportation research to critically appraise their practice and engage in informed dialogue with the objective of improving mobility and productivity while simultaneously reducing the public health burden of road deaths and injuries .

transportation planning and public health have important historical roots . to address common challenges , including road traffic fatalities , integration of theories and methods from both disciplines is required . this paper presents an overview of geoffrey rose 's strategy of preventive medicine applied to road traffic fatalities . one of the basic principles of rose 's strategy is that a large number of people exposed to a small risk can generate more cases than a small number exposed to a high risk . thus , interventions should address the large number of people exposed to the fundamental causes of diseases . exposure to moving vehicles could be considered a fundamental cause of road traffic deaths and injuries . a global reduction in the amount of kilometers driven would result in a reduction of the likelihood of collisions for all road users . public health and transportation research must critically appraise their practice and engage in informed dialogue with the objective of improving mobility and productivity while simultaneously reducing the public health burden of road deaths and injuries .

due to the limited capacity of our visual system , selective attention needs to efficiently filter relevant stimuli from the incoming stream of visual information . which stimuli are selected for further processing is a complex process that depends on various factors such as physical salience ( e.g. , [ 1 , 2 ] ) , task - relevance [ 3 , 4 ] , threat relevance [ 5 , 6 ] , or learning experience . current visual attention theories , modeling which information is selected under which circumstances , often assume that the visual system weights such factors and assigns priority to each stimulus in the visual field , determining the probability with which it is selected [ 811 ] . naturally , as observers , we desire to attend to those stimuli that correspond to our current intentions and goals . by means of a search template that directly refers to a mental image of the desired object we can efficiently find such stimuli and deploy our attentional resources to it [ 1214 ] . high weights for features corresponding to current goals of the observer can also have detrimental effects , impairing performance . for example , contingent capture describes the effect that visual attention is captured by task - irrelevant stimuli that match the search template in one or more features [ 15 , 16 ] . it was argued that attention deployment towards stimuli that partially match the search template , regardless of its actual task - relevance , is mediated by working memory ( wm ) which may store the search template so that the observer can constantly match incoming information in ongoing tasks [ 8 , 1720 ] . a study by woodman & arita provided neurophysiological evidence that attentional templates are maintained in wm and that the strength of template representations in wm predicts the performance in a visual search task . as wm has a limited capacity , search templates maintained in wm for a search task at hand may sometimes compete with other information maintained in wm . more recent research has indeed suggested that visual selection can be closely intertwined with visual working memory processes [ 2225 ] , for example , by showing memory - driven attentional capture . for example , olivers and eimer presented observers colored items they had to maintain in wm before they were being probed for correct retrieval . during maintenance , observers performed a visual search task . when distractors shared the colors of items maintained in wm , search was slowed down compared to distractors of neutral colors , suggesting attentional capture by features in wm ( see also [ 24 , 26 ] ) . although it seems plausible that our perception can be biased towards stimuli that match our goals and intentions , perception as such is never a self - purpose ; we intend to perceive something so that we can act upon the perceived . action as the purpose of selection has been brought forward by allport 's selection - for - action theory allport and a large body of literature has pointed towards a close interrelation of selection and action since ( e.g. , [ 2834 ] ) . 's study , participants had to prepare a grasping or pointing movement according to a cue presented in the beginning of each trial . for grasping , size is a relevant dimension because grasping requires the specification of size - related parameters to control grip aperture . for pointing , luminance is a relevant dimension because pointing crucially requires the localization of to - be - pointed objects and this localization before participants executed the movement , they were shown a search display with various filled grey circles . either all circles were identical , or one circle was a size singleton ( smaller circle ) or one circle was a luminance singleton ( brighter circle ) . after the search task , participants executed the previously prepared movement towards one among various , real objects in front of them . it was found that preparing a grasping movement facilitated detection of size singletons , whereas preparing a pointing movement facilitated detection of luminance singletons . the authors concluded that planning an action biases visual perception towards dimensions that deliver important information for controlling that action . the large overlaps between visual attention and wm have been attributed to attentional control mechanisms being in some way common with those recruited in the service of wm maintenance [ 23 , 25 ] . similarly , the overlaps between visual attention and action planning have been ascribed to a common coding of perception and action [ 29 , 32 , 36 ] . it seems economically plausible that a common mechanism allows the visual system ( a ) to deploy attention to the relevant information currently available to the senses , ( b ) to maintain information not present to the senses anymore , and ( c ) to plan action related to the present / maintained visual information . this study aimed at investigating such interactions of visual attention , visual wm , and action planning . more specifically we were interested in whether attention is particularly biased towards dimensions that are both action relevant and wm relevant , for example , towards a red circle if red is to be held in wm and a grasping movement is to be executed towards a circular item . the present study combined a visual search task with a working memory ( wm ) task and a motor task . participants had to prepare a pointing or grasping movement but withhold execution until the end of a trial . participants also had to memorize a color hue until the end of a trial . at the end of a trial , participants performed the planned movement towards the memorized ( circular ) item , thus combining wm and motor planning . while participants planned the movement and held the color in their wm , they had to perform a visual search task in which they always had to respond to a diamond - shaped target among circle distractors . note that , for grasping , shape was a relevant dimension because the to - be - grasped objects were circles and thus required the specification of circle - related parameters ( e.g. , [ 37 , 38 ] ) . in some of the trials , one of the distractors could be colored ; the color could be related or unrelated to the color in wm . we hypothesized that the additional color singletons will capture attention and slow down response times ( c.f . , ) , even more so when they are related to wm content ( c.f . , ) . memory - relevance and action - relevance coincided when the additional singleton in the search task was of a color related to wm and when a grasping movement was being prepared . thus we expected the capture effect to be most pronounced when the color singleton both matches the wm content and is congruent to the action - relevant dimension , because , for such stimuli , task - relevance and action - relevance coincided . 21 volunteers ( aged 1927 years ) naive to paradigm and objective of the experiment participated for course credit . all but two were right - handed and all had normal or corrected - to - normal vision ( tested with landolt ring test , visus 1 ) . participants were seated in a comfortable chair in a dimly lit room at 50 cm distance from an lcd - tn screen ( samsung syncmaster 2233 ) . participants had a customizable keyboard ( ergodex dx1 ) on their left side in front of them with two buttons that were labeled n and were operated by the middle and index finger of the left hand . stimulus presentation and response collection were controlled by a windows pc using e - prime 2 routines . the examiner sat approximately 2 m behind the participant with a standard keyboard on her lap to register participants ' movement . movement cues were color photos taken from a female volunteer showing a forearm / hand on a black background that performs a pointing or grasping movement ( see figure 1(b ) ) . the numbers of pixels for the pointing and grasping hands were approximately identical ( ~20% of the screen ; ~80% were black pixels ) . memory items were filled circles ( diameter : 3.6 visual angle ) colored in one of nine shades of four colors ( blue , green , yellow , and red ) , that is , 36 different hues in total . rgb values were identical to those used by olivers & eimer ; see the appendix for rgb and cie(x , y ) values . search displays consisted of eight items placed on an imaginary circle with a diameter of 10.6 ( see figure 1(a ) ) . colors were taken from the same pool of colors as memory items ( see above ) . targets were grey diamonds ( 3 ) with an embedded stylized black m or n. m and n were made by removing two lines from the hourglass ; that is , m , n , and hourglass were superposable . in the target was presented equally often in each of the eight positions . in memorized color trials and neutral color trials , there was one target , one color distractor , and six grey distractors . target and color singleton were presented equally often in each of the eight positions but never in neighboring positions . each trial started with a central fixation , shown for 500 ms ( see figure 1(c ) ) , and was replaced with a movement cue shown for 1500 ms . participants were instructed to prepare the indicated movement but withhold movement execution until the end of the trial . a display followed for 1000 ms that randomly showed one of the 36 color hues . participants were instructed to memorize this hue until it was probed in the end of the trial . after a blank display showing only a fixation cross , the search display was shown . in one - third of the trials ( 320 trials ) , , a color distractor was presented that had a hue from the same color category as the memorized item but never the exact same hue ( memorized color ) . in the remaining third of the trials , a color distractor was presented that had a hue from a different color category as the memorized item ( neutral color ) . participants were instructed to respond as fast as possible ( while avoiding errors ) to the letter embedded in the target ( 50% m , 50% n ) by pressing the according button on the keyboard . after participants responded , the search display was replaced by another blank display for 500 ms . subsequently , a memory probe display appeared with three ( circular ) memory items arranged in a pyramid arrangement . participants were instructed to execute the planned movement towards the item with the memorized hue . the two other items were always from the same color category as the memorized hue ( e.g. , if the memorized items were from the category red , two out of the remaining eight hues were randomly selected to appear together with the memorized hue ) . all items being from the same color category was thought to discourage verbalization of the color and encourage a visual memory representation . for pointing movements participants had to touch the screen with the tip of their right index finger . for the grasping movement participants had to make a claw - like gesture with their right hand , touching the screen with all five fingers along the outlines of the respective memory item . after participants performed the movement , the examiner pressed one out of two buttons to register which movement had been executed by the participant ( point versus grasp ) and pressed one out of three buttons to register towards which item the movement was made ( first , second , and third colored circle within the pyramid arrangement ) . only trials in which participants performed the correct movement and towards the correct object were counted as correct trials . after an intertrial interval of 1000 ms ( black screen ) , a new fixation cross announced the beginning of a new trial . there were six experimental conditions : three color conditions ( color absent , memorized color , and neutral color ) and two movement conditions ( pointing and grasping ) . target position ( or target - color distractor position combination , resp . ) was counterbalanced with each of the six experimental conditions across the experiment . the experiment comprised 960 trials ( + 30 practice trials ) divided in 40 blocks of 48 trials , that is , 160 trials per experimental condition . after each block a pause of at least 10 sec followed and performance feedback ( rts and accuracy for the search task and accuracy for the motor task ) was provided to participants on the screen . mean response times ( rt ) and error rates were calculated for each participant separately for each of the six experimental conditions . for memorized color trials , rts were collapsed across all hues from the same category as the memory item . for neutral colors , rts were collapsed across all hues from all categories to which the memory item did not belong . only trials in which all three tasks ( search task , motor task , and memory task ) were performed correctly and trials without exceedingly long search rts ( > 2000 ms ) or short rts ( < 300 ms ) remained in the rt analyses . these criteria were reached in 64.5 % ( sd = 8.8% ) of the trials . data were submitted to a 2 3 anova with the factors color ( absent versus memorized versus neutral ) and movement ( pointing versus grasping ) . greenhouse - geisser correction was applied when appropriate . as measures of effect size , partial eta squared ( ) is reported for anovas , and epsilon ( ) is reported for t - tests . search rts depended on the presence of a color distractor , f(2,40 ) = 32.96 , p < 0.001 , = 0.622 . rts were shortest when color was absent ( m = 789 ms ) followed by distractors with neutral colors ( m = 830 ms ) and distractors with memorized colors ( m = 854 ms ) , all p < 0.001 ( contrasts ) ; see figure 2 . how much search rts were modulated by color singleton depended on preparation of a movement , f(2,40 ) = 5.44 , p = 0.008 , = 0.214 . follow - up t - test for dependent measures showed that differential movement preparation ( pointing versus grasping ) did not affect neither trials without color distractors ( m = 6 ms ) , t(21 ) = 0.79 , p = 0.440 , = 0.24 nor trials with neutral color distractors ( m = 4 ms ) , t(21 ) = 0.61 , p = 0.548 , = 0.19 . in trials with memorized color distractors , however , preparing a grasping movement increased search rts compared to preparing a pointing movement ( m = 19 ms ) , t(21 ) = 2.85 , p = 0.010 , = 0.88 . to confirm that the 2-way interaction is not a merely additive effect of wm and action planning , an additional anova was calculated in which the capture effect was taken as a dependent measure ( mean rts for color absent were subtracted from mean rts for memorized color and neutral color , resp . ) . a 2 2 anova with the factors color ( memorized versus neutral ) and movement ( pointing versus grasping ) results showed that the capture effect was not modulated by the preparation of a movement ( p = 0.084 ) but was modulated by the distractor type ( mmem = 65 ms versus mneutr = 41 ms ) , f(1,40 ) = 22.59 , p < 0.001 , = 0.530 . the increase in attentional capture for memorized colors was more pronounced for grasping ( m = 35 ms ) than for pointing ( m = 13 ms ) , f(1,40 ) = 7.72 , p = 0.012 , = 0.279 . the correct movement according to the movement cue was executed equally often for grasping ( 93.3% ) as for pointing ( 92.3% ) , p > 0.5 . the memory items were correctly identified ( in terms of executing the movement towards the item of the hue that was shown in the beginning of the trial ) in 71.0% of the trials ( sd = 2.1% ) . to reveal whether those participants that were best in memorizing were also the ones that were most distracted by memorized color distractors , pearson 's product - moment correlation was computed for memory accuracy and rt difference for color absent versus memorized color ( across movement conditions ) . results showed a strong correlation ( = 0.44 ; p = 0.024 ) ; that is , the better memory performance , the more rt impairment due to memorized colors ; see figure 3 . no such correlation was found for memory performance and rt impairment due to neutral colors ( p = 0.127 ) . the key result of the present study is an interrelation of action planning and maintenance in working memory ( wm ) . attention was particularly biased towards colors matching wm content when participants prepared a grasping movement compared to a pointing movement . when no color distractor was presented or the color distractor had a color unrelated to wm content , the preparation of the movement did not affect attention deployment . the presence of a color distractor impaired visual search even though colors were entirely search - irrelevant . even though the task could be solved and the target be found most of the times ( overall error rates ~3% ) , response times were slowed down . this is a replication of earlier findings showing that salient stimuli can capture attention against the intention of an observer [ 2 , 3941 ] . apparently , salient distracting information needs to be rejected before attention can be directed towards the task - relevant stimulus , a time demanding process . current visual attention models account for attentional capture , for example , by assuming that the weight of any bottom - up feature map can not be set to zero by the observer , regardless of the task - relevance of the feature dimension ( guided search , [ 11 , 14 ] ) . by this means , salient stimuli will always project on the master map of activations ( or , priority map , ) , based on which attention deployment is being made . the present study also showed that the attentional capture was particularly pronounced when the color distractor matched the color category that was held in wm . this suggests that stimuli matching information maintained in wm are given more priority in visual processing than stimuli of equal salience that were not maintained in wm . it should be noted that the longer response times for trials in which task - irrelevant color distractors were present do not necessarily indicate that those distractors were processed in a bottom - up manner . according to bacon and egeth , two search modes would have been applicable in the present search task : singleton detection mode in which observers search for anything that stands out from the background and feature search mode in which observers search for a predefined feature ( here , diamond ) , a search mode only possible when the target feature is known and does not change between trials . as in the present paradigm observers searched for a diamond - shape target throughout the experiment while ignoring color both search modes could have been used . applying the feature search mode ( rather than singleton detection ) would have been particularly beneficial to color - present trials as distraction by the irrelevant color singleton would have been minimized . in color absent trials , however , observers could have applied the simpler singleton detection mode as this search mode was sufficient to efficiently find the target . if this was the case longer rts for color - present trials may have been due to differences in search strategy and not to bottom - up attentional capture . different search modes in color - absent and color - present trials seem , however , rather unlikely as the trial types were completely randomized between trials . this makes it unlikely that observers switched their search mode between trials because they could not predict which trial type would follow . only as soon as stimuli showed up on the screen could observers know whether a color was present or not . regardless of the applied search mode , more priority to wm - related stimuli is well in line with the notion that visual attention and wm may rely on the same mechanism of prioritization of items [ 5254 ] and replicates earlier results showing that guidance of attention from wm occurs even when it is detrimental to performance [ 13 , 23 , 25 , 55 ] . for example , olivers and colleagues [ 13 , 23 ] argue that search templates and other representations in wm compete for resources . as a search template , items have full access to the sensory input and can bias selection towards matching objects . maintaining an item in wm ( e.g. , because it will be probed in the end of a trial ) is similar to adopting a search template ( or an attentional set ; ) . such representations ( so - called accessory memory items ) have a passive status after being encoded into wm to not interfere with an ongoing task ( here , the search task ) and can be reactivated to regain the status of a search template when they become relevant ( here , when memory probes are presented ) . reactivation of accessory memory items may also happen involuntarily , for example , when a wm matching distractor is presented during the search task . this leads to prioritization of features held in wm , attentional capture results which may impair performance ( see also [ 24 , 25 ] ) . in the present study this was the case in the , it seems that weights for features in the wm task spill over to visual search and bias attention accordingly ( e.g. , [ 53 , 56 ] ) . the increased attentional capture by color distractors matching the item held in wm could also be due to color priming from the wm displays to the search displays [ 7 , 57 ] . previous studies using a similar paradigm , however , could rule out the possibility of priming effects ( e.g. , [ 24 , 26 , 58 ] ) . those studies showed that attentional capture during a search task occurred only when previously presented items had to be remembered . when observers were merely exposed to the crucial features , no such effects were found . additional evidence comes from an imaging study when wm content was repeated in a search task , enhanced activity in a variety of brain regions known to be sensitive to the prior history of events was found . conversely , when items only had to be identified but not held in wm , their repetition elicited a suppressed response in the same regions . given the similar paradigm it seems likely that , also in the present experiment , visual search costs were due to wm content rather than repetition effects . interestingly , the present results indicate that guidance of attention from wm was most pronounced when participants prepared a grasping movement . this indicates that apart from overlaps between visual attention and wm there may also be a connection between wm and action planning ; see wm model in figure 4 . there is quite some evidence that action planning has a strong impact on perceptual processes , even in situations when action and perception are not directed to the same objects but merely overlap in time ( e.g. , [ 2834 ] ) . for example , when observers have the intention to perform an action , such as grasping or pointing , their attention can be biased towards simultaneously presented yet unrelated visual objects . this leads to faster target detection when the target is congruent to the planned action compared to incongruent targets [ 32 , 34 ] . in the present study , the feature dimension shape was crucial to the search task ; the feature diamond was task - relevant as targets were diamond - shaped ; the feature circle was task - irrelevant as distractors were circle - shaped . shape is a dimension also relevant to grasping as grasping requires the specification of shape - related parameters . for example , for a safe grip of an object , an agent needs to know the properties of its surface ; a ball is grasped differently than a cube ( e.g. , [ 37 , 38 ] ) . in the present study , participants had to grasp circular items in the memory probe display , rendering the feature circle particularly crucial for action planning . conversely , when participants had to point at the circular items , no feature should have been rendered more crucial because none of the features in the search task ( shape , color ) were particularly relevant for pointing . it appears that when circles were made relevant through planning of a grasping movement , circular distractors captured more attention than when a pointing movement was planned but only if their color matched wm content . thus wm might be a mediating process involved in the relation of action planning and attention . in terms of the wm model by olivers and colleagues the planning of an action such as a grasping movement might increase the demand on wm and thus cause additional interference in wm because it requires the maintenance of information for subsequent action execution ( see figure 3 ) . in the present study preparing a grasping movement may have needed the maintenance of an action - relevant feature circle shape in wm . this action - relevant feature may have prioritized processing of circle distractors in memorized colors in the search task , thus increasing interference with target processing and impairing performance . our data show that action planning only modulated search performance when participants prepared a grasping movement and one of the distractors was in a memorized color . this suggests that only when both circle prioritization by action - planning and color prioritization by wm maintenance coincided did attentional capture by the color singleton particularly impair search performance . this is strong evidence for a common mechanism underlying selective attention , wm , and action planning . the present results thus add to the previous literature showing that action planning is a rather dominant source of top - down control in selection and not only can modulate attention deployment but also can interact with wm content . even though nine hues had to be distinguished within one color category , participants correctly remembered the hue in ~71% of the cases ( chance level 1/3 ) . if the ability to discriminate hues was as good for color distractors as for memory probes , one would expect no distraction away from the target as the color singleton never exactly matched the hue of the memorized color . however , hues within the same color category induced a significant increase in target search time compared to a neutral color category . this indicates that , whereas participants were able to keep a relatively precise representation of the memory item in wm , a much broader variety of hues , actually the entire color category , was able to involuntarily capture attention . perception of similar hues as one color category is a basic mechanism of the visual system [ 60 , 61 ] and is , for example , crucial to perceive a constant surface under varying lighting conditions . in the present study , whether hues were perceived as belonging to one category or not might have been due to varying time pressure or processing strategies . for example , observers may have been biased towards the entire wm - relevant color category under the time pressure of the search task ( rt was stressed for the search task ) that did not allow the visual system to differentiate between hues . when the memory probe was shown in the end of a trial , however , observers were able to make more precise color judgments ( precision was stressed for the memory task ) . moreover , the visual system may have relied on color categories when no explicit incentive to differentiate between hues was present ( such as for task - irrelevant distractors during search ) ; thus attention was biased towards the entire category . this may in fact be an adaptive strategy of the visual system to cope with the invariance of physical features in real world settings . for example , color constancy describes the effect that observers perceive the color of an object constant even though the exact wavelength may change drastically as a function of environmental variables such as illumination , perspective , shading , and distance [ 63 , 64 ] . more recently it was found that attention deployment can be biased towards perceptual categories that typically share very few low - level features , even when this is detrimental to performance . the present results may provide an example in which attention deployment is biased towards a color category even though only one subset of that category ( a specific hue ) was task - relevant . a strategy to more thoroughly process colors , however , might have been used when observers had the incentive to correctly identify one hue among similar ones ( such as for the memory probe ) . this notion is in line with findings suggesting that how prominent the effect of color category on hue perception is relies on various factors such as the specific task , cognitive demands , and strategies of the observer . in the present study it should be noted that some studies suggest that longer response times for distractor - present trials in additional singleton paradigms are due to nonspatial filtering costs [ 4245 ] whereas other studies suggest they are due to attentional capture by the distractor [ 39 , 4648 ] . one reason for the diverging results may be that singletons only capture attention when they match the observer 's goal . although the present study can not contribute to answering this open question , we assume that in the present study attentional capture accounts for the longer response times for distractor - present trials . even though color distractors never matched the target category , they did match the wm content , namely , in the memorized color condition . as it was the observers ' goal to maintain items in wm , attentional capture by items matching wm content may therefore be considered attentional capture due to matching of the observer 's goal . in line with this , in a study using a similar paradigm as the present study , an n2pc component contralateral to the memory - matching distractor ( i.e. , a distractor negativity ) was found , suggesting that indeed stimuli sharing features of wm content capture attention . to sum up , the present results showed that action planning not only determines the way we perceive our visual environment but also determines how working memory ( wm ) drives attention deployment . observers were distracted from target search when a salient color item was presented concurrently to the target . this distraction was more pronounced when the colored item was related to a color held in wm , indicating attention guidance by wm content . preparing a grasping movement enhanced wm guided attention deployment . we conclude that target templates , action plans , and wm maintenance have common underlying mechanisms and compete for processing capacity .

visual search is impaired when a salient task - irrelevant stimulus is presented together with the target . recent research has shown that this attentional capture effect is enhanced when the salient stimulus matches working memory ( wm ) content , arguing in favor of attention guidance from wm . visual attention was also shown to be closely coupled with action planning . preparing a movement renders action - relevant perceptual dimensions more salient and thus increases search efficiency for stimuli sharing that dimension . the present study aimed at revealing common underlying mechanisms for selective attention , wm , and action planning . participants both prepared a specific movement ( grasping or pointing ) and memorized a color hue . before the movement was executed towards an object of the memorized color , a visual search task ( additional singleton ) was performed . results showed that distraction from target was more pronounced when the additional singleton had a memorized color . this wm - guided attention deployment was more pronounced when participants prepared a grasping movement . we argue that preparing a grasping movement mediates attention guidance from wm content by enhancing representations of memory content that matches the distractor shape ( i.e. , circles ) , thus encouraging attentional capture by circle distractors of the memorized color . we conclude that templates for visual search , action planning , and wm compete for resources and thus cause interferences .

considering the therapeutic consequences , involvement of the sentinel node by metastatic disease in breast cancer patients is of great interest to the breast surgeon in order to plan the surgical approach . unfortunately , the physical examination of the axillae can be inaccurate in identifying pathologic lymph nodes . the same is also true for the pre - treatment imaging ( with or without interventional procedures on the axillary node ) , characterized by a poor negative predictive value [ 48 ] . using gamma probe combined with ultrasound- ( us ) guided percutaneous core needle biopsy ( cnb ) could increase the accuracy of identifying the sentinel node and allow a proper histopathologic diagnosis in order to avoid further slnb . the purpose of this pilot study was to assess this new pre - operative diagnostic approach . main inclusion criteria were : women 18 years old , invasive breast carcinoma , with no clinically positive axillary node and no history of any other malignancy . multicentric cancer and previous excisional biopsy were exclusion criteria . the sentinel node occult lesion localization ( snoll ) was performed in all patients the day before surgery . a dose of 510 ( generally 7 ) mbq of technetium 99-labelled human albumin nanocolloid particles in 0.3 ml saline were administered by us - guided percutaneous injection in the area immediately surrounding the breast lesion , followed by injection of 0.2 ml saline using a 22 g needle . we used nanocolloid particles with a size range of 5100 nm ( nanocoll , ge healthcare ) . after injection , antero - posterior and lateral lymphoscintigraphic projections were obtained to identify the presence of a sentinel node and to define whether the radiocolloid has shifted to other possible sites of drainage , such as the internal mammary , intramammary , contralateral axillary or supraclavicular nodes . the hot spot was identified over the skin by the handheld gamma probe ( navigatog gps rmd ) and was examined using ultrasound logos hi vision gold ( hitachi ) using a breast - dedicated linear array transducer . the radiologist performing the us - guided biopsy established which lymph node corresponds to the hot spot under gamma probe guidance . we evaluated suspect us findings such as cortical thickening , especially if focal , markedly hypoechoic cortex , absence of the fatty hilum , large expansion , irregular shape , round shape , extracapsular tumoral extension or increased peripheral blood flow at power doppler . lymph nodes with at least 2 of these criteria were considered pathologic , and we excluded suspicious lymph nodes . patients were placed in a supine or contralateral - side - down oblique position on the table , with the ipsilateral hand placed behind the head . biopsies were performed in all patients by a single radiologist with more than 10 years experience in ultrasonography . cnb was performed with an automatic 18 g needle ( bard core biopsy instrument , tempe , usa ) after local anesthesia with 2% mepivacaine . all biopsies with a free - hand technique were performed under us guidance with direct visualization of the needle entering into the cortex of the node to confirm position of the needle tip in the appropriate location . only 1 pass the percutaneous biopsy was performed only if the lymph node corresponded to the hot spot . we considered the biopsy procedure to be successful when the obtained sample contained a large portion of solid non - fatty tissue and/or sank in formalin to be stained with haematoxylin and eosin . the skin above the first radioactive node was marked by the radiologist with an indelible ink tattoo to assist the surgeon . the puncture zone was compressed and the presence of complications such as local pain or hematoma was evaluated . the next day , in the operating room , radioactive lymph nodes were detected in all cases using the same gamma probe that was used to detect the hot spot for the us - guided pre - operative imaging . surgical slnb was performed in all cases , followed by alnd in cases of positive percutaneous biopsy . the surgeon was able to recognize the sentinel lymph node biopsy marked by the radiologist with the skin mark and correlate with the results of the standard slnb ( validate the ability of the preoperative diagnostic method to correctly identify the sentinel node ) . because the most frequent tumor site is the upper - outer quadrant of the breast , the surgeon generally used the same type of incision of the breast to identify the sentinel node using the gamma probe guide when the conservative surgery was performed . in different cases , the surgeon used a separate incision guided by the skin marker performed by the radiologist . the final histopathological diagnosis of slnb was compared with the results of the cnb of the sentinel node . the accuracy of percutaneous biopsy guided by us and gamma probe over the skin in the pre - operative staging was correlated with final pathologic reports of slnb . information on histological type and grade and biological characteristics ( eg , receptor status or peritumoral vascular invasion of the primary carcinoma ) were obtained from the pathology report of the breast specimen . for the pathological staging of the axillae , this study used the guidelines and terminology proposed by the seventh edition of the american joint committee on cancer staging manual . main patient characteristics are shown in table 1 and include age , type of surgery , location of primary breast cancer , nodal stage at percutaneous biopsy , pathological nodal stage , and biological features of the breast tumor . sentinel node identification was successful in all patients , although there were no suspicious nodes at us examination . the hot spot was detected over the skin by gamma probe in all 10 patients , and was examined using us - guided cnb in all patients . multiple sentinel nodes were not detected and no patient had the sentinel node draining to different possible sites . there were no major complications ( eg , clinically important bleeding , nerve injury , or infection ) related to the cnb procedure . one patient experienced a small amount of bleeding , which was stopped by simple local compression ; this was considered a minor complication . in all patients , nodal metastases were found at final diagnosis in 2 of 10 patients ( table 1 ) . the definitive histopathological report of slnb expressed the presence of 1 micrometastasis that was not observed in the frozen section at the extemporary analysis . in the second patient , micrometastases were observed in the para - sentinel node at slnb , but no macrometastasis in the sentinel node were found . in all the surgically excised sentinel lymph nodes , the pathologist documented the sign of the previous core needle biopsy , verifying that the biopsied lymph node was really the sentinel node . in women with early breast cancer , slnb has proved to be a safe and accurate method for evaluating axillary disease , and is associated with less morbidity than complete alnd . nevertheless , slnb is not a problem - free procedure . patients with documented lymph node involvement at the slnb usually require further alnd as a second step during the same surgical procedure , favoring scar tissue formation and edema , and increasing the rate of complications and the surgery time . hospital stays are also increased in case of slnb + alnd compared with alnd alone as suggested by goyal et al . . pre - operative knowledge of an axillary metastatic sentinel lymph node could avoid the intraoperative slnb . in fact , in cases with positive preoperative lymph node cnb , a complete alnd can be performed directly as a primary procedure . the obvious advantages of this approach are suggested by several authors that used different methods to localize the abnormal lymph node before surgery . had avoided slnb in 30% of patients with a final pathology of metastatic lymph node by performing fine needle aspiration cytology ( fnac ) of the abnormal sonographic axillary node . sever et al10 proposed the use of intradermal peritumoral microbubble us contrast agents injection and lymphatic imaging to identify and localize the sentinel node in the preoperative stage . many studies report a moderate diagnostic sensitivity of the percutaneous biopsy of a morphologically abnormal axillary lymph node and an even lower sensitivity in cases where the biopsied lymph node has an unaltered appearance and the procedure is performed randomly . but how can you differentiate the sentinel node from a regular lymph node especially when the pathological sentinel node is not always the largest one or the morphologically abnormal one ? . found metastatic involvement in 12% of the lymph nodes with normal sonographic appearance , and declared that us - guided biopsy would miss the sentinel node in 36% of the cases , resulting in false - negative axillary cnb , partly due to failure to identify the lymph node or the abnormal region of the lymph node to biopsy . furthermore , there is little information in the literature regarding the accuracy criteria for performing an axillary us . adding gamma probe over the skin could increase the sensitivity of percutaneous us - guided biopsy , providing a good approximation of detection of true sentinel lymph node . theoretically , it is well established that a negative sentinel lymph node is currently equivalent to disease - free axillae . the majority ( about 70% ) of women with clinically negative axillae will prove to be microscopically negative as well . on the other hand , it is also documented that a certain percentage of the false - negative sentinel node cnbs are for micrometastases or isolated tumor s cells . there is no current evidence showing that submicroscopic metastases predict an adverse outcome or that they require treatment . several authors [ 1820 ] demonstrated the absence of axillary recurrence during long - term follow - up in patients with sentinel node micrometastasis in which alnd was not performed . several studies were done , and one of the most recent addressing this question participated in an ibcsg trial that compared complete alnd ( used in cases with positive slnb ) to follow - up ( in patients with node - free macrometastasis disease ) . similarly , we speculate that patients with micrometastases and false - negative sentinel node proved by cnb , gamma probe and us - guided biopsy , may not need intraoperative slnb , particularly since follow - up with ultrasonography , and eventually pet , could detected early axillary disease that can be adequately treated later by therapeutic axillary dissection . nevertheless , avoiding the morbidity of slnb must be weighed against the risk of harboring axillary micrometastases that may potentially seed occult metastatic disease after a percutaneous biopsy . in the clinical context , considering a patient s expected life span and associated health problems , this situation might be defined as a minimal acceptable risk . slnb has also a false - negative rate ( 5% according to veronesi et al . ) and this is the reason why these patients are generally subject to regular follow - up with clinical and us examination of the axilla . we also suggest that cases with negative sentinel node percutaneous gamma probe and us - guided biopsy should be similarly monitored . several studies reported that the sensitivity of us in identifying axillary adenopathy has been increased by cytology sampling of the suspicious lymph node ; the approach is limited by the high rate of false - negatives results of the aspiration tecnique . in other words , the unacceptably high rate of false - negatives results makes nodal fnac an unreliable method that can not be used to avoid intraoperative slnb . as known , there are a number of possible reasons for a false - negative result at fnac : inadequate specimen sampling , a low number of metastatic lymph nodes , small - sized metastasis , and failure to visualize true sentinel lymph node during the us examination of the axilla . the aim of this study was to verify the feasibility of this innovative method to detect and to biopsy the sentinel node in order to improve confidence in identification of the metastatic lymph node in the preoperative phase . in our opinion the decision to use large cnb rather than fnac was made because the amount of tissue taken is greater than with the latter , providing a high negative predictive value . it is reasonable that increasing the volume of tissue obtained from 1 step by cnb can be more effective than multiple samples of fnac to obtain a final diagnosis . the sensitivity of the method could be increased by performing several cnbs ( 23 or 35 samples according to garcia - ortega ) from the cortex of the presumed sentinel node . do not recommend the use of cnb because of the potential complications of this procedure ( eg , bleeding and nerve damage ) ; previous reports have shown that such interventional procedures in all breast cancer patients are not cost - effective . on the other hand , complications can be reduced if the procedures are performed by an experienced , dedicated breast radiologist ( within the breast unit ) . this feature is of major importance because , in early the stage , the lymph nodes usually have normal findings at us , and they are frequently small in size . consequently , the cutting needle must be sampling only the cortical layer if performed in a technically adequate way . the second element is identification of the axillary sentinel lymph node preoperatively using the gamma probe over the skin . combining the use of the gamma probe , with which the true sentinel node can be identified with reasonable confidence , and the us - guided cnb that can avoid the sampling error dictated by the reasons mentioned above ( in case of fnac ) , the diagnostic sensitivity should , theoretically , increase . as a minimally invasive staging procedure , us - guided lymph node biopsy under percutaneous gamma probe surveillance seems attractive because it provides information during the preoperative period that could allow avoidance of intraoperative slnb if the sentinel node is negative , and hence , avoid alnd in case of micrometastasis or isolated tumor s cells . the most relevant predictive factor for sentinel node metastases is the primary carcinoma peritumoral vascular invasion . it could be suggested that whenever this pathology ( or other findings ) finding is found in association with a negative percutaneous sentinel node biopsy performed under us gamma probe guidance , intraoperative slnb should be mandatory . have reported the pre - operative use of gamma probe over the skin to detect axillary sentinel node under us guidance . the latter had evaluated the sentinel node s location using the gamma probe and then marked it with a hook wire , while motomura used the gamma probe combined with fnac to obtain the sample . to our knowledge , no other published study evaluated gamma probe - assisted sonographic localization combined with cnb of the presumed sentinel node as a one -step procedure in the pre - treatment phase of breast cancer patients . first , this is a pilot study that analyzed the feasibility of a new pre - treatment method proposed for detecting the sentinel node . second , the patient population is small because this is a pilot study , hence the results do not have a statistical impact . however , the concepts presented could improve the quality of lymph node sampling , particularly in early breast cancer patients . this could be particularly useful in cases that need slnb before neoadjuvant chemotherapy . the pre - treatment sentinel node evaluation technique described in this pilot study had shown a perfect concordance with the histological findings , even if the number of subjects enrolled in this study was relatively low . the accuracy and the clinical implications of the method in conclusion , gamma probe - assisted sonographic localization associated with cnb of the sentinel node in early breast cancer patients could be a feasible and accurate new method . further studies should investigate the definitive role of this method in pre - treatment breast cancer staging . particularly , it is necessary to investigate the clinical impact of this method in avoiding slnb , especially in cases when percutaneous sentinel node cnb is negative , without primary carcinoma peritumoral vascular invasion , in clinically node - negative breast disease patients .

summarybackgroundthe aim of this pilot trial was to study the feasibility of sentinel node percutaneous preoperative gamma probe - guided biopsy as a valid preoperative method of assessment of nodal status compared to surgical sentinel lymph node biopsy.material/methodsthis prospective study enrolled 10 consecutive patients without evidence of axillary lymph node metastases at preoperative imaging . all patients underwent sentinel node occult lesion localization ( snoll ) using radiotracer intradermic injection that detected a hot spot corresponding to the sentinel node in all cases . gamma probe over the skin detection with subsequent ultrasonographically guided needle biopsy of the sentinel node were performed . the percutaneous needle core histopathological diagnosis was compared to the results of the surgical biopsy.resultspreoperative sentinel node identification was successful in all patients.conclusionsthe combination of preoperative gamma probe sentinel node detection and ultrasound - guided biopsy could represent a valid alternative to intraoperative sentinel node biopsy in clinically and ultrasonographically negative axillary nodes , resulting in shorter duration of surgery and lower intraoperative risks .

pathogens on invading host cells express molecules that are broadly shared by all microbes and distinct from host . these include lipopolysaccharide , peptidoglycan , flagellin and microbial nucleic acids , and collectively are referred to as pathogen - associated molecular patterns ( pamps ) [ 13 ] . pattern recognition receptors ( prrs ) of the host when recognizing pamps trigger a release of inflammatory cytokines and type i interferons ( ifns ) [ 4 , 5 ] . prrs are evolutionally conserved and have been investigated extensively . from the initial investigation of toll - like receptor ( tlr ) family to the recent discoveries of retinoic acid - inducible gene - i ( rig - i)-like receptors ( rlrs ) [ 7 , 8 ] and the nucleotide - binding domain and leucine - rich repeat containing gene family ( nlrs , also known as nod - like receptors ) [ 9 , 10 ] , all the evidence point to an important role in host defense . tlrs are membrane bound receptors that sense pamps on the cell surface or in endosomes while rlrs and nlrs recognize microbial molecules in the host cytosol . the individual members of these prrs families are characterized by their ligand specificity , cellular localization and activation of unique downstream signaling pathways . immunity against different microbial pathogen primarily depends on the recognition of the specific pamp of the pathogen by the corresponding prr . double - stranded rna ( dsrna ) , a virus replication intermediate and a signature of infection , is sensed by tlr3 , two members of rlrs family , that is , the rna helicases rig - i and melanoma differentiation - associated gene 5 ( mda-5 ) , and the nlr pyrin domain ( nlrp ) 3 protein of nlr family . these trigger the release of inflammatory cytokines , that is , activating innate immunity which shapes adaptive immune response [ 11 , 13 , 14 ] . the primary cytokines involved in this response are type i ifns including ifn- and ifn- . in this review , the mechanism of innate and adaptive immunity induced by dsrna and the potential application of dsrna as a vaccine adjuvant against viral infection and anticancer immunotherapy is elaborated . tlrs are type i integral membrane glycoproteins which have a trimodular structure composed of an extracellular domain , a single transmembrane domain and an intracellular toll / il-1 receptor ( tir ) domain [ 11 , 16 , 17 ] . the extracellular n - terminal domains of tlrs contain 1628 leucine - rich repeats ( lrrs ) [ 16 , 18 ] in a horse - shoe structure . each individual lrr is composed of 2030 amino acids with a conserved characteristic repetitive sequence pattern rich in leucines , the lxxlxlxxnxl motif and two or more repeats in tandem , form curved solenoid structures suitable for protein - protein interactions . the extracellular domain of human tlr3 comprises of 23 lrrs in a horse - shoe shaped structure . the convex face of the extracellular domain of tlr3 is glycosylation - free and contains many positively charged residues while the concave face is largely glycosylated and negatively charged [ 20 , 21 ] . the dsrna binding site of tlr3 is located in two regions near the n - terminus and c - terminus . when dsrna interacts , two ectodomains of tlr3 are connected by dsrna in an when combined with tlr3 , dsrna spans the whole m consisting of two horse - shoes of the ectodomains of tlr3 ( figure 1a ) . this satisfies the minimum requirement of 4050 base pairs of dsrna allowing stable binding to tlr3 inducing signaling [ 16 , 23 , 24 ] . with the secondary structure , the transmembrane domain of tlr3 is a single -helix and the endodomain is composed of a five - stranded -sheet surrounded by five -helics that forms the tir domain . the b - b loop that connects -strand b with -helix b in the tir domain is considered the essential structure that directly interacts with the adaptor protein tir domain - containing adaptor inducing ifn- ( trif ) . in addition to the b - b loop , three boxes of conserved residues that reside in tir domain are involved in tlr3 signaling [ 25 , 27 ] . tlr3 can be found both intracellularly and on the cell surface in human fibroblasts and epithelial cells . however , it is predominantly located in intracellular vesicles , for example , endosomes , in most cell types including dendritic cells and macrophages [ 28 , 29 ] . tlr3 is activated by extracellular dsrna that is released from dsrna viruses or is produced during single - stranded rna viruses ' replication or comes from application of synthetic dsrna analogues . it is largely unknown how extracellular dsrna are delivered to the intracellular vesicles containing tlr3 . studies have suggested that cd14 may play an important role in dsrna uptake [ 20 , 30 ] . once internalized into the endosome , dsrna binds to its adaptor protein tlr3 and activates several signaling pathways . upon binding to dsrna , the b - b loop of the tlr3 tir domain combines with tir domain of trif activating several transcription factors , including nuclear factor-b ( nf-b ) , interferon regulatory factor 3 ( irf3 ) , and activating protein 1 ( ap-1 ) . there are two pathways to activate nf-b mediated by receptor - interacting protein 1 ( rip1 ) and tumor necrosis factor ( tnf ) receptor - associated factor 6 ( traf6 ) ( figure 1a ) . traf6 is a ubiquitin ligase and plays a role in rip1 polyubiquitination [ 31 , 32 ] . polyubiquitinated rip1 is recognized by ubiquitin receptors , the transforming growth factor -activating kinase ( tak ) binding protein ( tab ) 2 and 3 , which in turn activate tak1 . ib kinase - related kinase ( ikk ) and ikk are phosphorylated by the activated tak1 . this leads to phosphorylation and degradation of ib , an inhibitor of nf-b , and eventually results in the translocation of nf-b to cell nucleus . tak1 also activates the 2 other classes of kinase , jnk and p38 and these activate the family of ap-1 transcription factors . trif activates the kinase complex traf family member - associated nf-b activator ( tank)-binding kinase 1 ( tbk1 ) and ikk through its adaptor protein , nf-b activating kinase ( nak)-associated protein 1 ( nap1 ) , leading to the phosphorylation and nuclear translocaton of irf3 consequently inducing the expression of ifn- . in addition to nap1 , traf3 is also part of the tbk1/ikk complex that is involved in the trif - mediated irf3 activation . another signal from tlr3 is related to the phosphorylation of two specific tyrosine residues ( tyr and tyr ) in the tlr3 tir domain when tlr3 interacts with trif ( figure 1a ) . phosphorylated tyr recruits phosphatidylinositol 3-kinase ( pi3k ) which then activates kinase akt required for phosphorylation and activation of irf3 in nucleus . the phosphorylation of tyr and also tyr results in degradation of ib leading to nf-b release and this induces phosphorylation of nf-b which partially activates it . the unique signal pathway of trif is able to induce mammalian cell apoptosis ( figure 1a ) . trif interacts with fas - associated cell death domain ( fadd ) protein through rip1 which in turn activates procaspase-8 to initiate cell apoptosis [ 25 , 39 ] . rlrs are cytoplasmic viral rna sensors with three recognized members including rig - i , mda-5 and laboratory of genetics and physiology 2 ( lgp2 ) . in addition to the central helicase domain , rig - i and mda-5 have two caspase recruitment domains ( cards ) at its n - terminus which are responsible for downstream signaling cascade through the interaction with a card - containing adapter , mitochondrial antiviral signaling adapter ( mavs , also known as ips-1 , visa , or cardif ) located in the outer mitochondrial membrane . lgp2 , lacking the n - terminal card , works as a negative regulator of rlrs signaling . although only a single card physically interacts with mavs , both cards are essential for downstream signaling [ 42 , 43 ] . the rig - i activation is self - inhibited by the c - terminal regulatory domain ( rd ) , also referred as the c - terminal domain ( ctd ) or repressor domain , through intramolecular association between rd and both the card and the helicase domains [ 4244 ] . rd is also responsible for the binding affinity to the dsrna and 5-triphosphated single - stranded rna ( 5ppp - ssrna ) of viral rnas with a common core rna binding site specifically adapted to distinct and unique patterns [ 4447 ] . mda-5 rd preferentially binds dsrna with blunt ends but does not associate with dsrna with either the 5 or 3 overhangs . the central helicase domain displays cooperative rna binding properties [ 43 , 48 , 49 ] . the rd of mda-5 does not exhibit self - inhibitory activity [ 42 , 50 ] . mda-5 is negatively regulated by dihydroxyacetone kinase ( dak ) and other possible regulators . rig - i binds 5-triphosphate rna in single- or double - stranded forms [ 5254 ] or short dsrna of 3001000 bp without a 5-triphosphate while mda-5 recognizes long dsrna of more than 1000 bp in length and the synthetic dsrna analogue polyinosinic - polycytidylic acid [ poly ( i : c ) ] [ 5456 ] . upon sensing rna , both rig - i and mda-5 are activated and initiate downstream signaling through the common pathway via adaptor protein mavs ( figure 1b ) . mavs consists of a card at the n - terminus , a proline - rich region ( prr ) in the middle and a transmembrane domain at the c - terminus attached to the outer surface of mitochondria . activated rig - i and mda-5 associate mavs via a card - card interaction which leads to the dimerization of the mavs n - terminal card domains . once activated , binding to traf3 occurs directly through the interaction between the traf domain of traf3 and the traf - interacting motif ( tim ) in the prr of mavs [ 5860 ] . following the association of traf3 with mavs , the ring domain of traf3 forms a scaffold to assemble noncanonical ikks signal complex composed of tank , tbk1 , ikk , nap1 and nf-b essential modulator ( nemo ) . this complex then activates the signal - dependent phosphorylation of irf3 and irf7 to form a functional homodimer or heterodimer and translocates to the nucleus [ 61 , 62 ] . traf6 is essential in the activation of nf-b , jnk and p38 signaling while traf2 is involved in activation of p38 mapk which promotes il-12 and type i ifn production . moreover , tnfr - associated death domain ( tradd ) is recruited to mavs following virus infection and interacts with traf3 , tank , fadd and rip1 as well as activating both irf3 and nf-b signaling . another protein - termed stimulator of interferon genes ( sting , also known as mita or myps ) expressed either on the outer micochondrial membrane or endoplasmic reticulum directly interacts with rig - i but not mda-5 . sting has been reported to associate with major histocompatibility complex class ii ( mhc ii ) and mediates apoptotic signals via erk activation . it was recently reported that rig - i binds to an adaptor apoptosis - associated speck - like protein containing a caspase - activating and recruitment domain ( asc ) to trigger caspase-1-dependent inflammasome activation by a mechanism independent of mavs , card9 and nlrp3 . this suggests that rig - i is able to activate the inflammasome in response to certain rna viruses . nlrs are intracellular prrs sensing pamps and danger signals or danger - associated molecular patterns ( damps ) released by injured cells . the nlr family has 23 members in humans and at least 34 members in mice . nlrs are multidomain proteins with tripartite structure composed of an n - terminal effector region , a central nacht ( neuronal apoptosis inhibitory protein , naip ; class ii transactivator , ciita ; plant het product involved in vegetative incompatibility , het - e ; telomerase - associated protein 1 , tp-1 ) domain ( also known as nod domain ) , and a c - terminal region for pamps recognition . the c - terminal region is characterized by a series of lrrs and is implicated in ligand sensing and nlrs autoregulation but the precise mechanism is not clear . the nacht domain is a member of signal transduction atpases , part of the p - loop ntpase family and is related to self oligomerization and the formation of inflammasome . the n - terminal region contains several protein interaction modules , such as acidic domain , baculoviral inhibitory repeat ( bir)-like domain , card and pyrin domain ( pyd ) . accordingly , nlrs are further divided into subfamilies as nlra , nlrb , nlrc and nlrp . an additional subfamily , nlrx , is characterized by the presence of an n - terminal domain with no strong homology to any known domains of other nlr subfamily member . upon recognition of pamps , toxins , or danger signals by nlrs , a large protein complex termed the inflammasome composed of nlrs , asc and pro - caspase-1 is activated . this protein platform activates pro - caspase-1 into its active form of caspase-1 and this hydrolyzes pro - il-1 and pro - il-18 into their mature biologically active forms which are secreted extracellularly to play a role in immune response [ 14 , 71 ] . limited studies have suggested dsrna is an activator of nlrp3 inflammasome [ 7578 ] although this has been disputed . nlrp3 senses pamps either from bacteria , such as lipopolysaccharide ( lps ) , muramyl dipeptide ( mdp ) , bacterial pore - forming toxin and bacterial dna and rna , or from viruses such as viral ssrna or dsrna , dsrna analogue poly ( i : c ) . it also senses other compounds such as imidazoquinoline antiviral drugs r837 and r848 , nonmicrobial signals encompassing uric acid crystals , calcium pyrophosphate dehydrate ( cppd ) , asbestos , silica , extracellular atp , alum adjuvant and fibrillar amyloid- [ 14 , 71 , 72 , 80 ] . it is believed that nlrp3 activation results in the interaction of nlrp3 pyd with asc pyd which in turn causes asc card to associate with pro - caspase-1 card assembling the nlrp3 inflammasome ( figure 1c ) . besides nlrp3 , asc and pro - casepase-1 , human nlrp3 inflammasome contains a card - containing protein , card inhibitor of nf-b - activating ligands ( cardinal , also known as card8 ) . allen et al . ( 2009 ) utilized small heteroduplex rna ( shrna ) to knockdown the expressions of asc , nlrp3 and cardinal respectively in human thp-1 monocyte cell lines . the il-1 production triggered by lentivirus infection was significantly attenuated by the addition of shrna of asc or nlrp3 . it has been proposed that the activation of the nlrp3 inflammasome requires both microbial molecules and a second signal such as extracellular atp or pore - forming molecules . alternatively , it has also been suggested that reactive oxygen species ( ros ) may be the common nlrp3 inflammasome activator since the most striking features associated with nalp3 activators like potassium efflux and the induction of frustrated phagocytosis all leads to ros production via nadph [ 71 , 85 , 86 ] . in particular , the activation of nlrp3 inflammasome triggered by virus infection or by poly ( i : c ) requires sensing viral rna or poly ( i : c ) , lysosomal maturation , cathepsin b and ros generation . the assembly of nlrp3 inflammasome leads to the activation of pro - caspase-1 and consequently the maturation of pro - il-1 and pro - il-18 ( figure 1c ) . caspases belong to a conserved metazoan aspartate - specific cysteine proteases family with 11 members in human ( caspases 1 to 10 , and 14 ) and 10 members in murine species ( caspases 1 , 2 , 3 , 6 , 7 , 8 , 9 , 11 , 12 , and 14 ) [ 87 , 88 ] . all caspases are synthesized as inactive zymogens containing a prodomain and are divided into two subfamilies : initiator caspases and effector caspases based on the length of their prodomains . initiator caspases ( caspases 1 , 2 , 4 , 5 , 8 , 9 , 10 , 11 , 12 ) are involved in the interaction with upstream adapter molecules and possess long prodomains that contain either the death effector domain or card . effector caspases ( caspases 3 , 6 , 7 ) that possess short prodomains are activated by upstream caspases and are able to cleave multiple cellular substrates involved in apoptosis . caspase-1 , along with caspases 4 , 5 , 11 , and 12 are often referred to as proinflammatory caspases . once incorporated into nlrp3 inflammasome , pro - caspase-1 is activated by proteolytic cleavage to remove the card prodomain . the active caspase-1 in turn cleaves the il-1 , il-18 , il-33 and il-1f7 precursors into their active forms and these active cytokines are secreted extracellularly and become immunoreactive ( figure 1c ) . it was recently reported that influenza virus infection results in the activation of nlr inflammasomes in the lung . although nlrp3 is required for inflammasome activation in certain cell types , adaptive immunity to influenza virus is asc and caspase-1 dependent rather than nlrp3 dependent , suggesting a central role of asc inflammasomes . the investigators concluded that influenza virus infection stimulates nlrp3-dependent and nlrp3 independent inflammasomes in a cell type - specific manner . moreover , it has been suggested that some viral rna can activate inflammasome via interaction between rig - i and adaptor asc independent of nlrp3 , mavs , and card . dcs express a repertoire of prrs including tlrs ( tlr3 is not expressed in plasmacytoid dcs ) , rig - i and mda-5 ( absent in plasmacytoid dcs ) , as well as nlrs , and are able to recognize a range of pathogenic microbes [ 9294 ] . the interaction of pamps and prrs on dcs induces the maturation and activation of dcs via transcription , translation and secretion of inflammatory cytokines and chemokines through the signal pathways as described above . the activated dcs , characterized by enhanced antigen presentation capacity and referred to as antigen - presenting cells ( apcs ) , migrate to draining lymph nodes and interact with t and/or b lymphocytes initiating the immunity process . among the cytokines triggered and secreted , type i ifn plays a major role in the cross - priming of cd8 t - cells by promoting the expression of costimulatory molecules of dcs . the proliferation and differentiation of the lymphocytes are mediated by signals from the activated dcs which comprise of the co - presentation of mhc molecules and pathogen - derived peptides . additionally , signals from costimulatory molecules including cd80 and cd86 , as well as the instructional signals , for example , il-12p70 for th1 , il-4 for th2 , and il-6 and il-23 for th17 from the presenting dcs are also present . dsrna receptors which include tlr3 and rig - i / mda-5 are expressed in myeloid dcs ( mdcs ) and primarily produce il-12 and ifn- when recognition of dsrna occurs . however , poly ( i : c ) with different molecular weights have differential effects on the maturation of dcs . interestingly , co - culture of bone marrow - derived dcs with protein and poly ( i : c ) reduced the antigen uptake by dcs . however , the reduced uptake of antigen did not affect ctl priming by dcs suggesting that the reduction in uptake of soluble antigen in the presence of poly ( i : c ) is independent of tlr - mediated dc activation . newly primed cd4 t - cells are programmed by various cytokines and other factors from dcs and other innate immune cells to differentiate into th1 or th2 or th17 effector cells or regulatory t - cells ( treg ) . th1 lymphocytes are produced by the nave cd4 t - cells ( th0 ) interacting with il-12 from mdcs to stimulate the expression of signal transducer and activator of transcription ( stat ) 1 and subsequently that of t box expressed in t - cells ( t - bet ) . activated th1 cells produce cytokines like il-2 and ifn- that are cofactors in cd8 ctls activation and synergistically activate mdcs acting via a feedback loop . it is believed that dsrna is capable of inducing robust il-12p70 production which reduces the threshold of th1 response and herein promotes th1-biased adaptive immunity through tlr3 and jnk pathways [ 98 , 100 ] . tnf- , type i ifn and il-18 also play important roles in the induction of th1 response by dsrna . type i ifn can activate mdcs directly by inducing phenotypic maturation which includes but is not restricted to upregulation of mhc class i , class ii , cd40 , cd80 , cd86 and higher expression of cd83 . besides inducing mdcs maturation and activation , ifn-/ upregulates the expression of chemokine receptor ccr7 to sensitize mdcs to ccl19 and ccl21 which promote the migration of mdcs from peripheral tissues towards the t - cell area of lymphoid organs . type i ifn is also necessary for the generation of a th1 cd4 adaptive t - cell response whereas il-12p40 and type ii ifn are not . therefore , the activation of th1 cell response induced by dsrna is possibly mediated by its capacity of inducing robust type i ifn production . however , at low concentrations of dsrna ( 0.11 g / ml ) , human lymphocytes express prototypic th2 cytokine il-4 . indeed , when coadministered with protein antigen , in addition to the induction of robust th1 biased immunity , dsrna is also capable of enhancing th2 antigen - specific immune response [ 104106 ] . when stimulated by dsrna along with specific antigen , activated dcs are able to induce antigen - specific cd8 cytotoxic t lymphocytes ( ctls ) activation through cross - presentation and cross - priming mechanism . during viral infection of mdcs , dsrna is produced during replication in the infected mdcs and the latter in turn activates mdcs through trif , mavs , nlrp3 inflammasome and possibly another undefined signal pathway(s ) to become apcs . apcs present endogenous antigens including those from intracellular viral origin with mhc class i molecules to nave cd8 lymphocytes along with costimulatory factors and instructional signals to activate the lymphocytes becoming mhc - i restricted ctls . however , in most cases , the virus does not invade mdcs directly but instead infects cells other than mdcs . in such cases , the extrinsic viral antigen and dsrna can be taken up into mdcs and these mdcs in turn present the antigen epitope with mhc - i molecules to cd8 lymphocytes inducing a ctl response . this mechanism is referred to as cross - priming and inducible by tlr3-trif signaling and mda-5-mavs signaling [ 107 , 108 ] . type i ifn produced through these signal pathways also enhances the cross - priming ability of mdcs possibly via augmenting their capacity to deliver costimulatory signals or directly stimulation of cd8 t - cells . the mechanism of mdcs uptake of the extrinsic antigens involves phagocytosis of particulate antigen , pinocytosis of soluble antigen and receptors mediating cross - presentation such as fc receptor , mannose receptor and dectin-1 . the ability of cell - associated poly ( i : c ) with antigen to induce robust cross - priming responses in nave mice is completely lost in the tlr3-deficient chimera mice . immunized with protein along with alum and poly ( i : c ) , the expansion of antigen - specific cd8 t - cell can be reduced in both mavs - deficient and trif - deficient mice and entirely abrogated in the bideficient mice . type i ifn produced through trif or mavs signal pathway also enhances cross - priming by mdcs [ 102 , 109 ] . a recent report suggested that cd8 t - cells can be activated by dsrna directly triggering tlr3 . priming of ifn--producing cd8 t - cells by dying tumor cells failed in the absence of a functional il-1 receptor 1 and in nlpr3-deficient or caspase-1-deficient mice unless exogenous il-1 was present . th17 cell is a proinflammatory lymphocyte belonging to th cell subset [ 113 , 114 ] . this subset preferentially produces il-17 , il-17f , il-22 , and il-21 , but not ifn- or il-4 . nave t - cells are induced by transforming growth factor ( tgf)- to differentiate into two reciprocal subsets , that is , th17 cells and treg cells under different polarizing signals . il-6 is the polarizing signal of th17 which switches the transcriptional program initiated by tgf- to induce the development of th17 cells and blocks the development of treg cells [ 116118 ] . in fact , th17 cells can express such receptors if induced by tgf- acting through ror-t which is a unique transcription factor of th17 ( the human counterpart of murine ror-t is ror - c ) . ror-t is the key transcription factor that orchestrates the differentiation of th17 effector cell lineage by inducing transcription of the il-17 gene in nave helper t - cells and is also required for the development of il-17 producing cells in the presence of il-6 and tgf- . il-6 is involved in upregulation of il-23r mrna expression , and il-6 and il-23 synergistically augment its protein expression . therefore , il-23 acts on t - cells that are already committed to the th17 lineage rather than inducing th17 differentiation . th17 cells are engaged in the neutrophil related inflammation against infections of fungi and certain extracellular bacteria . most parenchymal cells express il-17 receptors that interact with il-17 that are expressed primarily from th17 cells to produce proinflammatory factors such as il-1 , il-6 , il-8 , tumor necrosis factor ( tnf ) and matrix metalloproteinases [ 115 , 123 ] . th17 cells can also induce chemokine production which attracts numerous effector t - cells into inflammatory area promoting the inflammatory response . thus , inappropriate regulation of th17 cells activities is associated with chronic inflammation and severe immunopathologic conditions such as autoimmunity . trif signaling in mdcs might induce il-12 and il-23 production and play a role in th17 activation . however , the tlr3 pathway activated by dsrna induces activation of irf3 and irf7 which exclusively induce p35 and p28 but not p19 . these in turn would induce il-12 ( p35 and p40 ) and il-27 ( epstein - barr virus - induced gene 3 and p28 ) but not il-23 ( p19 and p40 ) . stimulation of endosomal tlr3 by poly ( i : c ) can induce mdcs to produce both il-12p70 and il-27 ; the former promotes th1 cells to produce ifn- which can inhibit th17 cells generation and the latter inhibits th17 cells differentiation in a stat1-dependent manner . trif - dependent type i ifn production along with its downstream signaling pathway negatively regulates th17 development and constrains th17-mediated autoimmune inflammation in mice . it has also been reported that poly ( i : c ) can induce synthesis of both il-17 and il-21 and drive the differentiation of nave th cells into an il-21 but not into an il-17-producing phenotype without affecting the levels of transcription factors t - bet , gata-3 , or retinoic acid receptor - related orphan receptor c . thymic stromal lymphopoietin ( tslp ) is a hemopoietic cytokine capable of conditioning mdcs and orientating the differentiation of nave t - cells towards a th2 profile . mdcs activated by a combination of tslp and poly ( i : c ) are capable of priming nave cd4 t - cells to differentiate into th17-cytokine - producing cells with a central memory t - cell phenotype without changing the th2 polarization property of tslp . innate immunity shapes adaptive immunity . activated immune cells present specific antigen epitope associated with mhc - i / ii molecules along with costimulatory and instructional signals to nave t - cells to stimulate activation , differentiation and proliferation of immunoreactive t - cells . as a potent activator of both innate and adaptive immunity , dsrna simultaneously administered with a foreign antigen can act as an immunoadjuvant to induce specific adaptive immunity against the foreign antigen [ 91 , 130 ] . upon dsrna stimulation , type i ifn production by dcs is critical for the adjuvant property of poly ( i : c ) . type i ifn is considered to be the major player linking innate to adaptive immunity . besides activating dcs in an autocrine or paracrine manner , type i ifn is capable of inducing an antigen - specific cd8 t - cell response , a cd4 th1 cell response and enhances the primary antibody response . ( 2009 ) demonstrated that proliferation and ifn- production of antigen - specific cd8 t - cells in the mice immunized by antigen gp33 ( an h-2d restricted peptide derived from lymphocytic choriomeningitis virus glycoprotein 3341 ) with poly ( i : c ) adjuvant is abrogated when this regimen is administered in tlr3 mice . the mrna of tlr3 is undetectable in either cd8 effector or cd8 effector memory t - cells . cd8 t - cell proliferation and the ability of inf- production are not affected by direct stimulation with poly ( i : c ) and specific tcr . therefore , it appears that the adjuvant effect of poly ( i : c ) may be tlr3-dependent without any direct effect on cd8 t - cells . however , ngoi et al . ( 2008 ) experimenting on ( c57bl/6 ) mice that were tlr3 and trif - deficient , with the poly ( i : c ) ( invivogen ) but using a different antigen , staphylococcal enterotoxin a , showed that cd8 t - cells expansion was not impaired , that is , a type i ifn production in response to poly ( i : c ) occurred . splenocytes from nave wild - type mice can produce il-10 in a dose - dependent manner upon stimulation with poly ( i : c ) in the absence of antigen while il-10 production was impaired in tlr3 mice . although these il-10 producing cells may be innate immune cells , the il-10 produced acts as a suppressive signal for adaptive immunity . thus , the presence of tlr3 may suppress the development of adaptive immunity . indeed , the activation of nk cells , involved in innate immunity , is inducible by poly ( i : c ) via both mavs- and trif - dependent pathways . reported that in mavs - deficient or trif - deficient mice immunized with ova , alum and poly ( i : c ) , the antigen - specific cd8 t - cell expansion was reduced in either mavs - deficient or trif - deficient mice and was entirely abrogated in the doubly deficient mice . hence , the adjuvant effects of poly ( i : c ) requires a cooperative activation of tlr and cytoplasmic rna helicase pathways . contamination of proteins used as antigens in these studies with other tlr ligands or the contamination of cd8 t - cells with other immune cells like innate cells might be a possible explanation of the discrepancy . with respect to human cd8 t - cells , tlr3 mrna expression has been detected in human effector and effector memory cells but not in nave and central memory t - cells . the addition of poly ( i : c ) significantly increased the quantity of ifn- released by effector and/or effector memory cd8 t - cells in response to pha in a dose - dependent manner . however , poly ( i : c ) by itself did not detectably induce ifn- release by any of the purified cd8 t - cell subsets . furthermore , the addition of poly ( i : c ) had no effect on the cytolytic activity of ctl . therefore , it is likely that the adjuvant effects and the corresponding mechanism of poly ( i : c ) are different in human and mouse cells . ( 2009 ) reported that mice vaccinated with h5n1 influenza vaccine with pika ( a stabilized dsrna ) as adjuvant experienced a maximum three - fold increase in antibody titer comparable to that produced by mice immunized by vaccine with complete freund 's adjuvant . vaccination significantly reduced the virus titer in the lung of mice challenged after immunization with the h5 vaccine and pika adjuvant . without a specific vaccine , sole pika administration was also capable of reducing pulmonary viral titer in mice . this immunoprotective property of dsrna against influenza virus was further demonstrated by other studies using another synthetic dsrna analogue poly iclc comprising of poly ( i : c ) stabilized with l - lysine and carboxymethylcellulose [ 136 , 137 ] . pika was also able to induce activation and proliferation of b cells and nk cells . when hbsag was coadministered , an increase in hbsag - specific igg production was noted . nonetheless , most studies suggested that poly ( i : c ) based dsrna analogues displayed th1 adjuvant property capable of activating antigen specific cd4 and cd8 t - cells when administrated as vaccine adjuvant [ 92 , 105 , 131 , 132 , 139 , 140 ] . another dsrna analogue , poly ( i : c12u ) ( ampligen ) , was effective in inducing mdcs maturation and promoted th1 cytokine il-12 production while significantly decreased suppressive cytokine il-10 production compared to that induced by poly ( i : c ) in healthy donors . intranasal administration of an ampligen adjuvanted h5n1 vaccine resulted in the secretion of vaccine - specific iga and igg in nasal mucosa and serum respectively and protected mice against homologous and heterologous viral challenge . immunization of mice by hepatitis c virus nonstructural protein 3 and poly ( i : c ) emulsified with montanide isa 720 have demonstrated that the protein - based vaccine adjuvant , poly ( i : c ) was capable of eliciting th1-biased adaptive immunity although the protein - based vaccine alone favors th2-polarization . additionally , the adjuvant potency of poly ( i : c ) emulsified with montanide isa 720 was much stronger than that of dispersed delivered poly ( i : c ) which suggests that protection of poly ( i : c ) from rapid degradation by ribonucleases was crucial for the adjuvant property of poly ( i : c ) . other groups have also suggested an th1 adjuvant role of poly ( i : c ) [ 92 , 139 ] . more importantly , induction of cd4 th cells by poly ( i : c ) is required for memory in cd8 t lymphocytes . therefore , it seems that the adjuvant property of distinct dsrna molecules may be different as suggested by avril et al . . several synthetic dsrna analogues are commercially available such as poly ( i : c ) , poly ( i : c12u ) , poly iclc , poly ( a : u ) and pika . poly ( i : c ) is a mismatched dsrna with one strand being a polymer of inosinic acid , the other a polymer of cytidylic acid . it was discovered in 1967 by hilleman 's group who also discovered ifn induction by dsrna before the discovery of its molecular receptors of tlr3 and mda-5 [ 56 , 146 ] . however , toxicity concerns prevent the clinical utility of poly ( i : c ) [ 147149 ] . thus , most studies using poly ( i : c ) as an immunoprotective or vaccine adjuvant have been undertaken in animals . attempts to design dsrna analogues that can induce ifn with less toxicity have resulted in poly ( i : c13u ) being modified to poly ( i : c12u ) . poly ( i : c12u ) differs from poly ( i : c ) in that every 13th cytosine of the dsrna , cytosine ( c ) is replaced by uracil ( u ) . uracil is unable to bond hydrogen to the hypoxanthine of the partner poly ( i ) strand and therefore results in a mismatched base which would be more readily degraded than the parent molecule . this poly ( i : c ) analogue has been applied in clinical trials for chronic fatigue syndrome and aids . it was generally well - tolerated via intravenous administration with insomnia and dry skin the most commonly reported adverse events . poly iclc was introduced by levy et al . in 1975 and comprised of poly ( i : c ) with poly - l - lysine and carboxymethylcellulose . this complex is 510 times as resistant to hydrolysis by primate serum as the parent poly ( i : c ) and has a thermal denaturation temperature about 40c higher than that of poly ( i : c ) . it was able to induce significant levels of serum ifn in monkey and chimpanzee under conditions in which poly ( i : c ) itself induced no ifn . in an early clinical trial in patients with malignancy , toxic reactions composed of fever , nausea , hypotension , thrombocytopenia and leukopenia , erythema , polyarthralgia with myalgia . clinical information regarding pika is limited and the available data are only from animals [ 135 , 138 , 155 ] . ( 2009 ) reported that poly ( i : c ) and its analogues poly iclc and poly ( i : c12u ) are effective adjuvants for the induction of protein - specific cellular immune responses . among the three molecular analogues , poly iclc was the most potent adjuvant in monkeys . another study using hiv gag as antigen showed that both poly ( i : c ) and poly iclc were able to induce antigen - specific cd4 t - cell response without il-4 and il-17 secretion , confirming th1-polarized adjuvanticity . gowen et al . revealed that poly ( i : c ) treatment significantly protected tlr3 mice from the lethal punta toro virus infection despite deficiencies in cytokine induction while poly ( i : c12u ) was unable to protect tlr3 mice from lethal challenge . however , in wild - type mice , poly ( i : c12u ) treatment was able to promote ifn- , ifn- , and il-6 production and conferred protection from punta toro infection . these results suggested that both tlr3 and mda-5 are required for poly ( i : c ) to elicit immune responses but poly ( i : c12u ) requires only tlr3 . ( 2008 ) . distinct forms of poly ( i : c ) with different molecular weights or poly ( i : c12u ) are not equivalent in their biological behavior . dcs and macrophages are major sensor cells to invading pathogen and transformed cells via germ - line encoded prrs . upon sensing pathogens or tumor cells , activation involves these cells becoming apcs triggering innate immunity and thereby shaping adaptive immunity through cross - priming to eliminate the invading microbes and tumor cells . cancer cells are malignantly transformed cells of the host and are capable of expressing antigens that are not expressed or in trace amount in healthy host and are referred to as tumor associated antigens ( taas ) . adaptive immunity is the major mechanism to eliminate cancer cells in the late stage of host defense responses by the generation of tumor - specific immunity . various reports have demonstrated that the recruitment of tumor infiltrating lymphocytes , especially cd8 t - cells , is closely related to prognosis of the patients [ 159161 ] . however , the anticancer immunity of the tumor - bearing host is usually weak or anergic due to either the weak antigenicity of taas or because of suppressive immunity in the host . thus , enhancing the immune response , in particular taa - specific ctl response and overcoming the immune suppression is crucial for anticancer immunity . indeed , provenge ( also known as sipuleucel - t or apc8015 ) ( dendreon , seattle , wa ) , a new cancer vaccine for advanced prostate cancer , was recently approved by fda at april 29 , 2010 . provenge works by ex vivo stimulation of isolated autogenous dcs of the patient with a fusion protein of full - length human prostatic acid phosphatase ( pap ) and granulocyte - macrophage colony stimulating factor . the pap activated apcs are suspended in lactated ringer 's solution , after removing the excessive antigen , and then infused into the patient resulting in innate and adaptive immunity against cancer cells . agonists of tlrs with the capacity of priming and shaping adaptive immunity have aroused significant interest in the development of cancer immunotherapy , in particular imiquimod , unmethylated cytosine preceding guanosine motif oligodeoxynucleotides ( cpg odns ) , and dsrna which act as agonistically with tlr7 , tlr9 , and tlr3 , respectively . activation of tlr3 by dsrna was capable of inducing either anticancer immune response or cancer cells apoptosis via tlr3 receptor expressed on a variety of cancer cells [ 168173 ] . apoptosis of cancer cells presents the immune system with a new repertoire of taas in a tlr3 activation context that is favorable to the development of long - term anticancer immune responses . poly ( i : c12u ) is capable of inducing phenotypic and functional maturation of dcs generated from peripheral blood monocytes of advanced ovarian cancer patients with sustained bioactive il-12p70 production . dcs primed with tumor lysate and matured with poly ( i : c12u ) are capable of generating th1-biased specific anticancer responses in peripheral blood t - cells derived from cancer patients in the presence of ascites medium containing immunosuppressive cytokines . using ovarian cancer ascites as an in vitro model , cd8 t - cells derived from ascites fluid primed with tumor antigen loaded dcs matured with poly ( i : c12u ) , exhibited cytotoxic activity with the capacity of lysis of autologous tumor cells [ 140 , 174 ] . another synthetic poly ( i : c ) derivative , poly iclc , more effective as an type i ifn inducer in humans but also associated with more clinical side - effects , has been involved in a variety of clinical trials of malignancy treatment in the last 30 years [ 176180 ] . when poly iclc was used either in monotherapy or in combination therapy , it exhibited immunomodulatory effects and enhancement of il-2-induced nk lytic activity in cancer patients . however , sole poly iclc administration did not improve the survival of cancer patients [ 177 , 179 , 180 ] . despite the unfavorable results of poly iclc in tumor therapy , auspicious results were noted when used as a cancer vaccine adjuvant in mice . when poly iclc was administered with tumor antigen - derived peptide epitopes as a cancer vaccine adjuvant in a murine brain tumor model this facilitates the infiltration of antigen - specific t - cells into the tumor site , promotes tumor homing of antigen - specific t - cells and improves the survival of tumor - bearing mice by inducing long term antitumor protection . a phase i / ii clinical trial using type i polarizing dcs loaded with peptides in combination with poly iclc in patients with recurrent malignant glioma is currently being conducted . polyadenylic polyuridylic acid [ poly ( a : u ) ] is another type of synthetic dsrna analogue that has been used in combination with chemotherapy for locally advanced gastric cancer after curative surgery patients compared with chemotherapy alone despite of its inefficiency as a single adjuvant . a prolonged overall and recurrence - free survival was noted . poly ( a : u ) is capable of inducing th1 cell generation and antibody production in mice when coadministered with protein . in vivo targeted delivery of tumor associated epitope to apcs in conjunction with poly ( a : u ) resulted in correction of the ineffective response to idiotypic epitopes , control of tumor growth , establishment of immune memory and protection against tumors bearing antigenic variants . the immunoadjuvant effects of poly ( a : u ) is believed to signal tlr3 and tlr7 . tlr3 expresses not only on immune cells sensing dsrna and triggering immune response but also on tumor cells exhibiting other functions . it is well known that viral infection is closely related with carcinogenesis and approximately 20% of all cancers are associated with infectious agents such as human papillomavirus and hepatitis viruses . prevention of viral infection is able to significantly reduce the occurrence rate of cancer [ 193195 ] . inhibition of virus replication reduced the development of cancer dramatically even in chronically viral infected patients [ 194 , 196 ] . in this scenario , it is suspected that dsrna , as intermediate of viral replication , is involved in the carcinogenesis . long before the discovery of tlr3 , researchers have found that dsrna , such as poly ( a : u ) treatment is capable of enhancing carcinogenesis in animals [ 197 , 198 ] . studies have suspected that activation of tlrs in cancer cells could promote tumor progression and chemoresistance by activation of nf-b to induce upregulation of antiapoptotic proteins and to inhibit proapoptotic proteins . consistently , several groups have reported that tlr agonists stimulate the proliferation and suppressor function of treg cells and so attenuate the antitumor effects [ 199 , 200 ] . however , most studies were conducted by activation of the tlrs other than tlr3 [ 190 , 201 , 202 ] . recent reports suggested that tlr3 expression is much higher in metastatic cancer cells in comparison with primary cancer cells . in human hepatocellular carcinoma cells , tlr3 can be expressed both on cell surface and in cytosol and only activation of the cytoplasmic tlr3 can induce cancer apoptosis accompanied by the down - regulation of antiapoptotic protein . in situ stimulation of tlr3 and synergistic molecule cd40 can transform ovarian cancer - infiltrating dcs from immunosuppressive to immunostimulatory cells thus exhibiting therapeutic potential of tlr3 activation . activation of tlr3 in nasopharyngeal carcinoma cells can inhibit cell migration by downregulation of chemokine receptor cxcr4 suggesting antimetastasis activity of endogenous human tlr3 expression in cancer cells . thus , it seems that activation of endogenous human tlr3 expressed by cancerous cells may induce direct pro - apoptotic activity of the tumor cells . additionally , mrna escaping from damaged tissue or contained within endocytosed cells could serve as an endogenous ligand for tlr3 . double - stranded rna and its synthetic analogues , such as poly ( i : c ) and poly ( a : u ) have long been known to be potent type i ifn inducers and immunomodulators . however , the fact tlr3 recognized dsrna and activates nf-b signal pathway was only discovered in 2001 . subsequently , other dsrna receptors , rig - i / mda-5 and nlrp3 have been uncovered [ 7 , 75 , 206 ] . it is unknown if there are any endogenous ligands that share these receptors with exogenous dsrna . additionally , dsrna receptors especially tlr3 are found expressed ubiquitously in the body . it is reasonable that not all types of cells are involved in sensing viral infection and eliciting immune response . thus , the role of these receptors in other type of cells deserves further exploration . dsrna is able to induce both innate and adaptive immunity to eliminate the invading virus . however , the virus may evolve protective mechanism that enables it to destroy the dsrna - induced signaling thereby protecting itself by evasion from the immune response of the host [ 207 , 208 ] . recent report suggested that poly ( i : c ) binds to endo / lysosomal mda-5 and activates apoptotic caspases in melanoma cells to induce their self degradation by autophagy and apoptosis . the possibility that other dsrna receptors may be present in tumor cells deserves further investigation . having such knowledge would be very helpful for development of therapeutic tumor vaccine with dsrna analogue adjuvant . it appears that there needs to be a balancing act between the possible carcinogenesis and the immune stimulating property of dsrna when dsrna analogues are considered as immunoadjuvants in tumor immunotherapy . although dsrna have displayed favorable immunostimulatory and protective properties , many questions remain to be answered . further investigations to uncover its roles in viral infection , carcinogenesis or anticancer actions deserve consideration .

dsrna can be detected by pattern recognition receptors , for example , tlr3 , mda-5 , nlrp3 to induce proinflammatory cytokines responsible for innate / adaptive immunity . recognized by endosomal tlr3 in myeloid dcs ( mdcs ) , dsrna can activate mdcs into mature antigen presenting cells ( mapcs ) which in turn present antigen epitopes with mhc - i molecules to nave t cells . coadministration of protein and synthetic dsrna analogues can elicit an antigen - specific th1-polarized immune response which stimulates the cd8 + ctl response and possibly dampen th17 response . synthetic dsrna analogues have been tested as vaccine adjuvant against viral infections in animal models . however , a dsrna receptor , tlr3 can be expressed in tumor cells while other members of tlr family , for example , tlr4 and tlr2 have been shown to promote tumor progression , metastasis , and chemoresistance . thus , the promising potential of dsrna analogues as a tumor therapeutic vaccine adjuvant should be evaluated cautiously .

lichen sclerosus et atrophicans ( lsa ) is a chronic inflammatory muco - cutaneous disorder , characterized by sclerotic and atrophic lesions , most commonly found in adult women . it affects the anogenital area in 8598% of the cases and less frequently the extrgenital area . the most commonly affected extragenital areas are the neck and the shoulders , but also the inner thighs , the submammary area , the wrist and occasionally the oral mucosa . the involvement of the scalp is not frequent and its outcome could be similar to scarring alopecia , which could be the result of different diseases . the etiology of lsa is still unknown . besides the genetic and local factors ( koebner phenomenon ) and the autoimmune hypothesis , supported by the association of different autoimmune disorders , especially of thyroid origin ( 30% of cases ) , an infectious hypothesis has also been proposed . a 57-year - old caucasian woman presented with a history of asymptomatic frontoparietal lesion . such lesion , which had been developing over the 3 previous years , was initially erythematous and became progressively atrophic and sclerodermic . the patient had been living in a highly endemic area for borrelia burgdorferi , but she could not recall any tick bite or erythema chronicum migrans . she also reported the simultaneous onset of migrating diffused myoarthralgias involving knees , hands , ankles , elbows , shoulders , as well as short - term memory impairment for two years , worsened previous seasonal insomnia for one year . moreover , she presented migrating paresthesias involving the left side of the body for one month . the dermatological examination revealed an atrophic - sclerodermic lesion of about 10 cm in length and 3 cm in width , from the scalp to the centre of the forehead as reported in figure 1 . the skin was thin , inelastic , mother - of - pearl in shade , with erythematous margins of the lesion with subsequent scarring alopecia as well ( figure 1 ) . figure 1lichen sclerosus et atrophicans with frontoparietal distribution , mimicking scleroderma en coup de sabre . a skin biopsy was obtained from the scalp and after histological examination three different pathologists confirmed independently the diagnosis of lsa . it consisted of epidermal atrophy , oedema with superficial layer , hyperkeratosis and collagen production with cell rarefaction . lymphoid infiltrate was observed even in the dermal - subepidermal junction indicating a possible later evolution of the lsa toward morphoea ( figure 2 ) . figure 2h&e stained section of the lesion ( a ) 2,5 magnification of the entire histological section , ( b ) 20 magnification of the lichen sclerosus et atrophicans features ( c ) 40 magnification of the lymphatic infiltrate . h&e stained section of the lesion ( a ) 2,5 magnification of the entire histological section , ( b ) 20 magnification of the lichen sclerosus et atrophicans features ( c ) 40 magnification of the lymphatic infiltrate . serological igm and igg for borrelia burgdorferi with enzyme - linked immunoassay test ( elisa ) confirmed by western blot analysis was negative . anti - nuclear antibodies ( ana ) , extractable nuclear antigen antibodies ( ena ) , anti - native dna antibodies ( n - dna ) , anti - neutrophil cytoplasmic antibodies ( anca ) and erythrocyte sedimentation rate were negative . pcr analysis for the detection of borrelia burgdorferi was performed on dna obtained from formalin - fixed paraffin - embedded skin biopsy , blood and urine as previously reported . the diagnosis of lyme borreliosis was made on the basis of clinical data , supported by the pcr positivity for borrelia genome . the patient underwent antibiotic treatment with 2 cycles ceftriaxone 2 gr / day i.v for 21 days . after about 6 months since the beginning of antibiotic therapy , the lesion had not progressed , all other clinical symptoms improved and blood pcr resulted negative . the patient received vitamin e 400 mg 2x / day per os for 3 months and applied topic vitamin e prior to uva-1 therapy . thanks to this combined therapy a remarkable regression of the atrophic - sclerodermic lesion was observed . this report describes a case of lsa , which was unusual for the involvement of the scalp . the lesion was mimicking scleroderma en coup de sabre , which is a frontal or frontoparietal linear morphoea characterized by a linear band of depressed atrophy on skin and scalp . the classical features of lsa are represented by hypopigmented papules that coalesce into white plaques with epidermal atrophy . although anogenital lsa is associated with a risk of 45% of squamous cell carcinoma , extragenital lesions do not seem to carry any risk of malignant degeneration . the isolated linear frontoparietal involvement was described in few cases and may clinically simulate scleroderma en coup de sabre , requiring careful histopathological recognition . in this case it has already been reported that overlap of histologic features between lsa and morphoea may occur , however in the reported case the clinical and the histologic features were not ambiguous of lsa . the possible later evolution toward morphoea in this case , due to the migration of the lymphatic infiltrate , is not unusual since morphoea and lsa may be closely related such that the latter could be considered the superficial expression of the same disease process which results in morphoea . regarding the possibility of an infectious etiology of lsa , since the first proposal by aberer and stanek in 1987 several european studies some atrophic skin diseases have been proposed as manifestation of lyme borreliosis with contradictory results . the detection methods , the examined specimens , such as sera , skin biopsies and urine , together with the different geographic region could explain the conflicting results on the association of borrelia with morphoea and lichen sclerosus et atrophicus . moreover in the manifestation of long standing infection of borrelia the paucity of microorganisms could lead to a low detection rate by pcr , especially when the analysis is performed on archival biopsies . no decision can be made to date as to whether bb plays a role as causative agent of different types of circumscribed scleroderma and lsa . with regard to the disparate findings in different geographic areas , it can be speculated that lsa may be caused in some cases by bb genotypes which are present in that area only . to support this infectious etiology in endemic regions , the fact that in this case borrelia dna was detected both on dna obtained from the biopsy and from blood and urine , strongly supports the hypothesis that borrelia has a causative role on the onset of this unusual lsa . moreover , the geographical location , middle europe , has been highly associated with borrelia prevalence . indeed , it is well known that there are significant geographic differences in borrelia infections with a higher prevalence in areas in middle europe . to further support this theory , lyme disease affects mostly the skin : about 80% of all lyme borreliosis cases present skin manifestations . we recognise that classical dermatological events include erythema chronicum migrans ( ecm ) , lymphadenosis benigna cutis ( labc ) or borrellial lymphocytoma ( bl ) and acrodermatitis cronica et atroficans ( aca ) , but there is growing evidence that some cases of other cutaneous manifestations could be related to borrelial late infection , mostly borrelia afzelii . common laboratory tests are not usually revealing for the diagnosis of lyme borreliosis and serologic tests support the diagnosis , but are not always essential in this regard . in this case of lsa mimicking scleroderma en coup de sabre , an associaton with lyme borreliosis is proposed . to our knowledge , this is the first case of lsa , mimicking scleroderma en coup de sabre , which was associated with lyme borreliosis . our findings indicate an association between this particular form of lsa and borrelia , suggesting that borrelia burgdorferi itself could represent a causative agent of this atypical form of lsa , however it can not be excluded that borrelia could be only one of the predisposing agent triggering it . in conclusion we propose that tissue pcr for dna of borrelia should be performed in patients with lsa in endemic area , because it could represent a rare manifestation of borreliosis , and in those cases lsa should be treated with proper antibiotic therapy in order to eradicate the microorganism .

lichen sclerosus et atrophicans ( lsa ) is a chronic , inflammatory skin disease of unknown etiology , characterized by atrophy.we report a case of lsa with frontoparietal distribution , mimicking scleroderma en coup de sabre , causing scarring alopecia . the case was associated with borrelia infection . the lesion improved with 2 cycles of antibiotic therapy with ceftriaxone 2 gr / day i.v for 21 days associated with uva-1 therapy and local and systemic vitamin e supply ( 400 mg 2x / day per os for 3 months ) . this case stresses the importance of identifying clinical manifestations associated with lyme disease and the use of tissue pcr to detect borrelial dna in patients with these lesions , but characterized by negative serology for borrelia .

castleman 's disease is a lymphoproliferative disorder with benign hyperplastic lymph nodes characterized histologically by ( a ) follicular hyperplasia , and ( b ) capillary proliferation with endothelial hyperplasia ( 1 ) . this disease has been classified histopathologically as hyalinevascular , plasma cell , or a mixed type variant of the two ( 2 , 3 ) . the plasma cell and mixed types are often associated with ' multicentric castleman 's disease ' ( mcd ) , which shows various systemic manifestations , such as fever , anemia , hypergammaglobulinemia , hypoalbuminemia , and an increase in acute phase proteins ( 2 ) . mcd is often refractory to conventional therapeutic strategies , such as corticosteroid , cytotoxic agents , and/or radiation ( 4 , 5 ) . the frequency of mcd associated with a lung lesion among the japanese population is high ( ~70% ) ( 6 ) and such progressive lung lesions often lead to death ( 2 , 7 ) . interleukin-6 ( il-6 ) is a pleiotropic cytokine with a wide range of biologic activities , such as hematopoiesis , regulation of immune responses , and inflammatory responses ( 4 ) . patients with the plasma cell type castleman 's disease often generate large quantities of il-6 in the germinal centers of hyperplastic lymph nodes ( 8) . ' tocilizumab ' is a humanized anti - interleukin-6 receptor antibody that neutralizes the pleiotropic actions of il-6 . it was approved for use in japan for the treatment of castleman 's disease in 2005 . this report describes a case of mcd with an associated lung lesion , which responded dramatically to tocilizumab in combination with corticosteroid and tacrolimus . a 43-yr - old female visited a nearby hospital because of abnormal shadows including multiple nodules and reticular shadows on chest radiography found at an annual medical checkup in 2005 . they were unable to obtain a biopsy specimen from one of the nodules in s10 of the left lung because the patient had a strong bleeding tendency . she was referred to this hospital for further examination on june 30 , 2005 . on admission , the laboratory data were : erythrocyte sedimentation rate , 119 mm/1 hr ; white cell count , 8,900/l ; hemoglobin , 8.4 g / dl ; platelet count , 39.410/l ; serum aspartate aminotransferase , 22 iu / l ; alanine aminotransferase , 22 ; total protein , 9.7 g / dl ; albumin 2.6 ; creatinine , 0.48 ; pt , 13.1 sec ( inr 1.45 ) ; aptt , 39.6 ( control , 10.4 ) ; fibrinogen , 750 mg / dl ; kl-6 , 277 u / ml ( reference range < 500 ) ; c - reactive protein , 11.7 mg / dl ( < 0.3 ) ; serum immunoglobulin ( ig)g , 4,570 ( 870 - 1740 ) ; iga , 491(110 - 400 ) , igm , 706 ( 35 - 220 ) , ch50 , 52.3 u / ml ( 30 - 50 ) , soluble il-2 receptor , 1,400 ; serum il-6 , 6.8 pg / ml ( < 4 ) ; rheumatoid factor ( rf ) , 1,330 iu / ml ( < 20 ) . autoantibodies , including antinuclear antibody , anti - ds - dna , anti - sm , anti - rnp , cytoplasmic antineutrophil cytoplasmic antibody ( anca ) , and myeloperoxidase - anca were all negative . chest ct scan disclosed a slight enlargement of the mediastinal lymph nodes , centrilobular nodules , thin - walled cysts , the thickening of the bronchovascular bundles , and ground - grass opacities , all of these findings were compatible with those of lymphocytic interstitial pneumonia ( lip ; fig . gallium citrate scintigraphy did not reveal any evident accumulation . a lung surgeon and a thoracic physician declined to perform a lung biopsy because of her bleeding tendency ( bleeding time : 6 min 30 sec ) and poor general condition . a biopsy of an inguinal lymph node was obtained for making a definite diagnosis ( fig . she was diagnosed with mcd and undifferentiated arthritis based on the characteristic pathology of the specimen of the inguinal lymph node , ct findings of the bilateral lung lesions and laboratory data . she was initially administered intravenous corticosteroid ( methylprednisolone , 500 mg / day , 3 consecutive days ) followed by oral corticosteroid ( methylprednisolone , 16 mg / day ) , and , 375 mg / m rituximab every week for 4 weeks . the polyarthralgia instantly disappeared ; however , none of the other clinical and laboratory parameters were fully resolved . therefore the therapeutic regimen was changed to tocilizumab ( 8 mg / kg , every 2 weeks ) , oral corticosteroid ( methylprednisolone , 16 mg / day ) on october 25 , 2005 . the patient requested that the interval between tocilizumab to be increased to more than every two weeks . the dose of corticosteroid in combination with tocilizumab should be kept as low as possible to avoid various side effects , such as osteoporosis , hyperglycemia , and hypertension . both the possible merits and demerits of the drug were explained to the patient and her oral consent was obtained . laboratory findings , including anemia , hypergammaglobulinemia , and an increase in acute phase proteins responded to this regimen ( fig . the enlargement of mediastinal lymph nodes and abnormal shadows were also partially alleviated ( fig . the intervals of the tocilizumab - administration sessions were extended from every 2 weeks to every 3 weeks from january 2006 . oral corticosteroid was gradually tapered from 16 mg / day finally to 4 mg / day . the treatment of mcd includes various therapeutic strategies such as corticosteroid , chemotherapy , rituximab , or tocilizumab . rituximab , an immunoglobulin g1 ( igg1 ) monoclonal antibody to cd20 , has the potential for b - lymphocyte depletion via antibody - dependent cell mediated - cytotoxicity ( adcc ) , complement dependent cytotoxicity ( cdc ) , and apoptosis . kaposi 's sarcoma - associated herpes virus ( kshv / hhv8 ) was thought to be associated with the development of castleman 's disease , especially in patients infected with human immunodeficiency virus ( hiv ) and rituximab was reported to be effective in hiv - related castleman 's disease ( 11 ) . the effectiveness of rituximab was limited in the present case because the patient was not infected with hiv . a humanized anti - interleukin-6 receptor antibody , tocilizumab , was shown to be effective for the treatment of mcd in an open label trial , and has been widely used in japan ( 5 ) . the frequency of mcd associated with a lung lesion is relatively low ( 10 - 20% ) in the united states . in contrast , nishimoto et al . reported that 18 of 28 japanese cases ( = 64.3% ) had a lung lesion ( 6 ) . the ct findings of intrathoracic involvement in mcd include bilateral hilar and mediastinal lymphadenopathy , centrilobular nodular opacities , thin - walled cysts , interlobular septal thickening , and ground - glass attenuation ( 9 ) . some reports have noted that the lung lesion in mcd is compatible with lymphocytic interstitial pneumonia ( lip ) ( 5 , 9 ) . ( 12 ) reported a case of mcd with a lung lesion that responded to tocilizumab . ( 7 ) described that the administration of tocilizumab for 2 yr had no effect on the lung lesion in an mcd patient . il-6 production by the germinal center b cells in the swollen lymph nodes of patients with mcd is remarkable ( 8) , but the roles of t cells are unknown . if t cells do participate in the pathogenesis , immunosuppressive drugs for t cells should be useful . in fact , mcd , which is classified as a lymphoproliferative disorder , has characteristics of an autoimmune disease , demonstrated by the production of autoantibodies . several studies have shown that these drugs are active not only against t cells but also against other cells . they suppress the promotion of il-6 in the rheumatoid synovium where t cells are relatively scarce ( 13 ) . they also suppress il-6 production in monocytes , and tnf- production in b cells ( 14 , 15 ) . pham et al . ( 16 ) reported that inhibition of nf-b and nfat activation in aggressive b - cell lymphomas by calcineurin inhibitors suppressed the cd40 ligand expression in b cells and lymphoma cell survival in an in vitro experiment . some of these actions of tacrolimus , if not all , may be associated with the efficacy of the drug for the treatment of mcd . ( 17 ) reported that non - cytostatic immunomodulatory therapy including corticosteroid , cyclosporine a and thalidomide treatment was effective for castleman 's disease . the long - time use of tocilizumab and corticosteroid is necessary for the treatment of mcd . corticosteroid has various dose - related side effects , and acquisition of drug resistance possible . p - glycoprotein ( p - gp ) plays a pivotal role in the latter . peripheral lymphocytes in patients with autoimmune diseases could express p - gp on their cell surface . calcineurin inhibitors have an antagonistic activity to p - gp : they may inhibit corticosteroid - resistance in peripheral lymphocytes in vivo ( 18 , 19 ) . the dose of corticosteroid could be tapered in the current case , at least in part , due to the antagonistic activity to p - gp of tacrolimus . in conclusion , this is the first report to describe that tocilizumab , in combination with corticosteroid and tacrolimus , shows a dramatic effectiveness in the treatment of a lung lesion in an mcd patient .

this report presents the case of a patient demonstrating multicentric castleman 's disease ( mcd ) with a lung lesion that was successfully treated with an anti - interleukin-6 receptor antibody , tocilizumab in combination with corticosteroid and tacrolimus . a 43-yr - old female with abnormal shadows on a chest x - ray was referred to the hospital for further examination . she was diagnosed as having mcd based on the characteristic pathology of inguinal lymph node , lung lesions , laboratory data , and undifferentiated arthritis . corticosteroid and rituximab therapy did not fully ameliorate the symptoms ; thus , the therapeutic regimen was changed to include tocilizumab , oral corticosteroid and tacrolimus . this regimen resulted in clinical remission and the dose of tocilizumab and corticosteroid could be tapered . tocilizumab in combination with corticosteroid and tacrolimus may therefore be a beneficial treatment regimen for lung lesions associated with mcd .

carpal tunnel syndrome ( cts ) is the most common entrapment neuropathy1,2,3 , caused by compression and traction of the median nerve at the level of the carpal tunnel , which is a cylindrical , inelastic cavity , delimitated by the carpal bones and transverse carpal ligament4 , 5.the compression results in impaired nerve conduction , paresthesia , and pain , which worsen at night and often wake the patient6 , 7 . the treatment for cts can be broadly divided into surgical and non - surgical approaches . according to the findings of several important randomized controlled trials , carpal tunnel - release surgery is effective in 7075% of patients , but is relatively invasive and can be accompanied by complications10 . furthermore , recurrence after surgery , although uncommon , can be difficult to treat11 . moreover , surgical decompression leaves 8% of patients in a worse condition than they were previously12 , and persistent pain in the scar or proximal palm 5 years after numerous non - surgical , less - invasive treatment options are available , including oral medication , splinting , exercise , corticosteroid injections , and mobilization interventions14,15,16,17 . only a few complications result from non - surgical approaches in those with mild - to - moderate cts . thus , non - surgical treatment might be indicated for patients with cts when surgery is not desired or for any other reason not immediately indicated18 . to the best of our knowledge , surgical decompression or carpal tunnel release . however , there is currently limited evidence indicating any benefit from splinting , exercise , and mobilization15 , 16 . this study aimed at prospectively assessing the effectiveness of nocturnal splinting by using clinical scores and ncs . of the 66 consecutive outpatients to our neurological clinic , 41 patients who met the inclusion criteria were finally enrolled ( fig . all individuals provided informed consent to participate in this study , and the local ethics committee of the hospital approved this study . the inclusion criteria of the report of the quality standards subcommittee of the american academy of neurology were implemented19 , whereby all the patients must meet at least one of the first 2 items and one of the remaining 5 items below to be included in the study:19 , 20 ( 1 ) numbness in the median nerve territory or the whole hand ; ( 2 ) pain or hypesthesiain the hand ; ( 3 ) awakened from sleep by numbness or pain mid - night or early in the morning ; ( 4 ) numbness relieved by shaking the hand and aggravated by flexing the wrist , or numbness becoming more severe in winter than in summer ; ( 5 ) weakness of the hand ; ( 6 ) atrophy of the thenar muscle ; and ( 7 ) positive phalen or tinel sign . in this study , patients with the following conditions were excluded : ( 1 ) clinical or / and electrophysiological findings suggesting ulnar nerve lesion , cervical radiculopathy , polyneuropathy , systematic diseases ( e.g. , diabetes mellitus , hypothyroidism , and rheumatoid arthritis ) , and stroke20 ; ( 2 ) cts caused by wrist trauma or deformity20 ; ( 3 ) prior treatment for cts through any approach , either surgical or non - surgical ; and ( 4 ) severe weakness or atrophy of the hand , and no response of compound muscle action potentials ( cmap ) elicited from the muscle of the abductor pollicis brevis ( mapb ) on ncs . the follow - up was completed in 20 patients with splinting ( fig . 1 ) . this study had a prospective design recommended by american association of neuromuscular and electrodiagnostic medicine ( aanem)21 . all the subjects enrolled in this study underwent electrophysiological detection after oral informed consent was obtained . electrophysiological detections were completed on keypoint 4 ( detec , denmark ) by one examiner . while ncs was performed , surface electrodes were used for stimulating or recording . while recording cmap , the median and ulnar nerves were both stimulated at the wrist . while recording the sensory nerve action potentials ( snap ) , the median and ulnar nerves were also stimulated at the wrist , and ring electrodes were placed at digits 2 and 5 , respectively . in addition , for comparing the difference in distal sensory latency ( dsl ) , the median and ulnar nerves were stimulated at the wrist , recording the snap at digit 4 . the following parameters were analyzed : the distal motor latency ( dml ) from the wrist to mapb or abductor digiti minimi ; the sensory conduction velocity ( scv ) from the wrist to digits 2 , 5 , and 4 ; and the dsl . needle electromyographic detection was performed to observe abnormal spontaneous activities only when the amplitude of the cmap of mapb reduced . considering stevens ( aanem ) and our previous study20 , 22 , the following electrodiagnostic criteria for cts were used in this study : ( 1 ) scv ( wristdigit 2 ) < 40.0 m / s or scv ( wristdigit 4 ) < 43.5 m / s ; dml ( wrist to mapb ) 3.7 ms ( distance 5.56.5 cm ) ; or dsl 0.4 ms ; and ( 2 ) normal sensory or motor conduction in the ipsilateral ulnar nerve . symptom severity scale ( sss ) and functional status scale ( fss ) were used to evaluate the patients at each hospital visit23 . sss consists of 11 questions with multiple - choice responses , which includes 6 critical domains for the evaluation of cts : pain , paresthesia , numbness , weakness , nocturnal symptoms , and over - all functional status . fss consists of 8 functional activities , including writing , buttoning of clothes , household chores , and bathing and dressing . each question was scored 1 point ( mildest / no difficulty with the activity ) to 5 points ( most severe / unable to perform the activity ) . the overall score was calculated as the mean of the scores for all the individual items . items that were left unanswered and if not applicable , they were not included in the calculation of the overall score23 . all the subjects were instructed to make stereoplasm splints of approximately 912 cm 57 cm size by themselves and bring them to us for assessment . subsequently , they were asked to wear each splint on the dorsal and palmar surface of the hand , centered at the distal wrist crease , immobilizing the wrist in the neutral posture at bedtime , keeping the fingers relatively free.the wrists were fixed to ensure that they were neither too tight nor too loose . meanwhile , the subjects were instructed to avoid flexing their wrists during any daytime activities such as washing clothes , riding a bicycle , working on a computer , and carrying heavy grocery bags . the follow - up was completed in 20 patients ( 31 wrists ) with splinting . all statistical analyses were performed using statistical package for social sciences ( spss ) for version 17.0 ( spss china , shanghai ) . one - sample t - test was used to compare the values with known population means , and paired - sample t - test was used to compare paired measurement data . in bivariate correlations , data of normality was analyzed by person correlations , else by spearman correlations . the shapiro - wilk test was used to test the normality of the measurement data . values of p<0.05 were considered statistically significant ; * represents p<0.05 , * * p<0.01 and * * * p<0.001 . of the 41 patients who met the inclusion criteria , 90% were female , and the mean age of all patients was approximately 50 years old . the clinical data are presented in table 1table 1.clinical data of the subjectsall 41 patients20 patients with splintingage ( years)2072 ( 50.2 12.0)2672 ( 52.5 12.6)illness duration ( years)1.1 1.71.5 2.3male / female ( wrists)4 ( 5)/37 ( 59)1 ( 1)/19 ( 30)bilateral hands affected ( cases)2411right hand affected ( cases)114left hand affected ( cases)6 ( 4 left - handed)5 ( 4 left - handed)numbness ( or pain ) at night ( cases)216tinel sign ( wrists)1811phalen sign ( wrists)2014 . in 20 patients ( 31 wrists ) with cts treated by splinting , sss ( 1.77 0.38 , 1.55 0.38 ; t=5.956 , p=0.000 ) and fss ( 1.53 0.31 , 1.40 0.27 ; t=5.452 , p=0.000 ) decreased . in addition , dml ( 4.53 1.25 , 4.14 0.76 ; t=2.431 , p=0.021 ) shortened and dsl ( 1.24 0.61 , 0.97 0.60 ; t=2.978 , p=0.006 ) decreased significantly after splinting ( table 2table 2.comparison of clinical scores and ncs findings of splinting in 20 patients ( 31 wrists)parametersbefore splintingafter splintingclinical scoressss1.77 0.381.55 0.38fss1.53 0.311.40 0.27parameters of ncsdml ( ms)4.53 1.25 4.14 0.76scv of wrist digit 2 ( m / s)42.02 8.29 42.12 7.58scv of wrist digit 4 ( m / s)38.20 6.72 38.51 6.42dsl ( ms)1.24 0.610.97 0.60ncs : nerve conduction studies ; sss : symptom severity scale ; fss : functional status scale ; dml : distal motor latency ; scv : sensory conduction velocity ; dsl : sensory latency difference between median and ulnar nerve*p<0.05 , * * p<0.01 , * * * p<0.001 ) . there was no improvement in the clinical scores in 9 patients ( 14 wrists , 45.8% ) after splinting . there were significant correlations between sss and dml ( r=0.420 , p=0.019 ) , scv of wrist digit 2 ( r=0.425 , p=0.017 ) , and scv of wrist digit 4 ( r= 0.519 , p=0.003 ) . no correlations were noted between sss and dsl ( p>0.05 ) , and between fss and all the parameters of ncs ( p>0.05 ) ( table 3table 3.correlation of clinical scores with ncs findings in 20 patients treated by splinting dml scv of wristdigit2 scv of wristdigit4dslsss0.420*0.425*0.519 * 0.189fss0.1920.1750.3190.124values represent correlation coefficients*p<0.05 ) . ncs : nerve conduction studies ; sss : symptom severity scale ; fss : functional status scale ; dml : distal motor latency ; scv : sensory conduction velocity ; dsl : sensory latency difference between median and ulnar nerve * p<0.05 , * * p<0.01 , * * * p<0.001 values represent correlation coefficients in this study , 90% of patients with cts were female , and the mean age was approximately 50 years , which is consistent with the epidemiological data3 . studies have shown that females with the highest body mass index ( bmi ) are more likely to develop cts24 , 25 . a bmi 30 kg / m almost doubled the risk of cts , and when bmi was assessed as a continuous variable , the hazard ratio increased approximately linearly with increasing bmi24 . splinting is the most common method among the non - surgical treatments available for cts7 . in this study , a self - administered questionnaire was used to assess the severity of symptoms and functional status in cts , as questionnaires are reproducible , internally consistent , valid , and responsive to clinical change23 . the questionnaire for clinical evaluation was subjective , but it can be semi - quantitative . we recommend that the questionnaire should be used at least in the clinical research on cts , so that the outcome of each researcher is relatively comparable . in this study , both sss and fss were 3 points , which suggested that the condition in most patients was not severe . in a previous study , 89% of patients with severe cts experienced recurrence of the symptoms within 1 year after conservative treatment , whereas only 60% of patients with mild cts experienced recurrence26 . therefore , the conservative approach is more successful in patients with mild nerve lesion than with severe cts . conservative management with splinting should be initiated in patients with cts with only mild symptoms12 . splinting is an acceptable method for patients in the early phases of cts , as it is simple and inexpensive and can be used at home . in this study , sss and fss decreased significantly , dml shortened , and dsl decreased . moreover , 54.2% of patients with cts were effective after neutral wrist nocturnal splinting . neutral wrist splinting can reduce the pressure on the median nerve and increase blood flow , especially when the wrist is held in a flexion position at night27 . in a review assessing the effectiveness of conservative therapy for cts , it was reported that splinting is an effective therapy especially when used for the whole day28 . no improvement was noted in the clinical scores of almost half the patients in this study . this could be because the splints made by the patients may not have immobilized the wrist . additionally , patients low compliance for the complex course of splinting may have influenced the therapeutic effect , although we emphasized that the patients should follow our guidelines strictly . splinting reduces latency , suggesting that the intervention may alter the underlying pathophysiological course of cts4 . moreover , there was no correlation between sss and dsl , and between fss and the parameters of ncs . thus , there was a weak correlation between the clinical scores and ncs , which is consistent with the findings of a previous study29 . therefore , the use of both clinical scores and ncs may allow us to evaluate the therapeutic effect of splinting on cts through different aspects . overall , conservative approaches such as splinting have a negligible incidence of serious complications and should be used more widely12 . providing patients the facts about their conditions and nevertheless , patients with cts who do not show satisfactory improvement with non - surgical treatment should be offered surgery30 . the therapeutic effect of combination splinting and other conservative treatments on cts were not compared , and the number of patients enrolled in this study was small , which were the main limitations in this study . moreover , patients made the splints by themselves , which may cause a variation in the therapeutic effect among individuals , although the splints that they made were checked . in conclusion , neutral wrist nocturnal splinting is effective in at least the short term in patients with cts . there is a weak correlation between the clinical scores and ncs , which suggests that both approaches should be used to assess the therapeutic effect of treatment on cts .

[ purpose ] to prospectively assess the effectiveness of neutral wrist nocturnal splinting in patients with carpal tunnel syndrome ( cts ) by using clinical scores and nerve conduction studies ( ncs ) . [ subjects and methods ] forty - one patients enrolled in the study were clinically evaluated by a symptom severity scale ( sss ) and functional status scale ( fss ) , and were electrophysiologically evaluated by conventional ncs ; distal motor latency ( dml ) , sensory conduction velocity ( scv ) , and difference in sensory latency between the median and ulnar nerves ( dsl ) were measured . subjects were treated with wrist splinting . patients who showed no improvement in symptoms were treated with other conservative treatments , the remaining patients continued to wear splints . sss , fss , and ncs were evaluated after splinting as well . [ results ] the follow - up was completed in 20 patients ( 31 wrists ) with splinting . sss and fss decreased , the dml shortened and dsl decreased significantly after splinting for 3.03 1.16 months . there were significant correlations between sss and dml , scv of wrist digit 2 , and scv of wrist digit 4 . no correlations were found between sss and dsl , and fss and the parameters of ncs . [ conclusion ] neutral wrist nocturnal splinting is effective in at least short term for cts patients . there is a weak correlation between clinical scores and ncs , which suggests that both approaches should be used to effectively assess the therapeutic effect of cts treatment .

acute patellar dislocation is a common injury usually associated with a significant traumatic mechanism resulting in lateral displacement . vertical axis rotation following dislocation is a rare variant of this type of injury and can prevent closed reduction in the acute setting . a 32-year old gentleman presented with an irreducible patella dislocation following an unusual atraumatic mechanism . following attempts at closed reduction under sedation and regional nerve block , eventual open reduction and soft tissue reconstruction was required under general anesthetic . during the open reduction procedure , it was noted that the patella had dislocated into a lateral extra - articular position and rotated around its vertical axis . a review of the literature suggests dislocations such as the current presentation , are extremely rare and although have been described to occur with minor trauma , have never been described to occur following a largely atraumatic event . in such cases , closed reduction may be impossible even with adequate analgesia due to patella position and soft tissue obstruction . acute patellar dislocation is defined as the abrupt disruption in the relationship of the patella within the femoral groove . patellar dislocation is a relatively common occurrence and is usually managed in the emergency department with closed manipulation under sedation . however , when the patella itself rotates around its vertical axis during dislocation , surgical intervention is usually required . a 32-year old gentleman was admitted to our trauma department with a painful , immobile right knee . he sustained the injury externally rotating his knee whilst in slight flexion while he was moving from the driver s seat to the passenger s seat of his car . the first event was 15 years prior , when his knee twisted in flexed position while pushing a car . the second event was four years prior , when he sustained an injury while pushing a van , this time with the right knee fully extended . on this occasion , our patient had no other significant past medical or surgical history and explained his right knee was completely asymptomatic prior to this current event . on examination , there was an obvious deformity suggesting lateral displacement of the patella with a sulcus in the skin evident over the femoral groove . furthermore , the knee was held fixed in 15 degrees of flexion . due to patient positioning difficulties we were unable to obtain true ap and lateral views on x - ray . the radiographs demonstrated a laterally displaced and a mal - rotated patella in the vertical plane ( see figs . 1 and 2 ) . lateral radiograph of the right knee demonstrating rotation of patella our patient was subsequently taken to theatre where one final attempt of closed reduction was carried out under general anaesthetic and muscle relaxation . ultimately , this failed and an open reduction was performed . complete rupture of the medial patellofemoral ligament ( mpfl ) was identified with the patella situated lateral to the lateral femoral condyle , everted by approximately 100 degrees . the knee joint was washed out with normal saline and the medial patella retinaculum was repaired . after the repair , post - operative radiographs confirm the patella in a satisfactory position in the antero - posterior and lateral planes ( see figs . 3 and 4 ) . the patient was placed in an extension splint for comfort purposes immediately post - operatively . early mobilization was encouraged after 5 days and the patient was referred for early physiotherapy . at 3 months follow - up , our patient had no further episodes of dislocation , full range of knee extension and flexion , and normal patella tracking . a hypermobility assessment at this stage revealed a beighton score of 2 with extension beyond 10 degrees of both elbows only . intraoperative antero - posterior florous copy image following successful reduction lateral radiograph of the right knee following surgery in knee splint patellar dislocations can vary widely in their pattern of presentation however vertical axis rotation complicates only a small number of these cases . in 1844 , cooper described the earliest case of patellar dislocation with vertical axis rotation . since then , only a handful of case reports describing vertical axis rotation of the patella have been published with the majority describing the location of the patella within the femoral trochlea ( intra - articular ) [ 2 - 11 ] . our case is rare as our patient had a less common variant of extra - articular patellar dislocation complicated by vertical axis rotation and by the fact , that the causative mechanism was largely atraumatic . previous descriptions postulate that the prominence of the lateral femoral condyle acts as a pivot point , which can cause the patella to rotate around on its vertical axis . in this case , however , the patient denies any trauma , and instead describes externally rotating the leg whilst extended as the mechanism of injury . it is almost certain that the previous dislocations in our patient s case had resulted in significant damage of the mpfl . with the patient reporting his injury taking place with the knee slightly flexed , the function of the mpfl in this case as the primary medial restraint during the first 20 degrees of flexion was likely to be inadequate . previous authors have described similar cases of extra - articular lateral patellar dislocation with vertical axis rotation and have noted in their subsequent reviews of the limited literature that intra - aritcular dislocations were usually related to far more significant trauma than extra - articular dislocations [ 3 - 10 ] . this was also the finding in a previous report highlighting the relative minor force resulting in an extra - articular dislocation . we feel this may be an indication of the chronic deficiency in the mpfl likely contributing to cases of extra - articular dislocation . on reviewing the previous cases of extra - articular dislocation in the literature , none had described a completely atraumatic mechanism and none had discussed previous dislocations or previous surgical history in their patients . detailed imaging can be difficult to obtain in the acute scenario ; however in these cases ct imaging may clarify patella position and demonstrate mechanical engagement of the patella on the lateral femoral condyle . in one case report , ct imaging was utilized and confirmed avulsions of the vastusmedialis muscle and medial crus of the patella tendon with resultant impaction of the medial border on the patella onto the lateral femoral condyle . in this case , imaging led to the decision for open reduction being required , minimizing further attempts at closed reduction which could in theory result in further damage . it is difficult to be absolutely sure why attempts at closed reduction had failed in our particular case , but this is likely to be multifactorial . vertical axis rotation results in impaction of the lateral edge of the patella on the lateral femoral epicondyle which may result in a corresponding femoral defect resulting in a lodging effect . furthermore patient factors , namely obesity and large muscle mass around the knee made manipulation technically difficult in our case . open reduction under general anaesthetic is rarely necessary for routine patellar dislocations however there are some obvious advantages . these include ; the possibility of direct visualisation of the obvious damage to the soft tissue structures contributing to or resultant from the dislocation . in our case it was likely the mpfl had been damaged previously and repair is likely to help in restoring central patella tracking and overall stability . in this case , the patient was noted as having a shallow trochlea which might have accounted for his increased tendency to dislocations . direct visual inspection may also help determine patients who are at risk of recurrent dislocations due to factors relating to their bony morphology and allow the surgeon to plan further management accordingly . lastly , visualisation of the articulating surfaces allows the surgeon to identify and address any osteochondral defects and corresponding loose bodies which may otherwise have contributed to long term future problems requiring eventual surgical intervention . from our experience with this case , difficulty in reducing a dislocated patella should alert surgeons to the possibility of an extra - articular dislocation with possible vertical axis rotation . in these scenarios , multiple attempts at reduction we were able to achieve adequate analgesia and sedation using local and regional anaesthesia , without successful reduction of the dislocation . although some authors have demonstrated successful closed reduction with the use of local anaesthetic and muscle relaxants , this is not always effective . furthermore , attempted closed reduction under general anaesthesia in our case was also unsuccessful , demonstrating how closed reduction can be futile in certain cases . we would recommend a low threshold for open reduction in such cases by a specialist knee surgeon who may assess and reconstruct damaged soft tissue damage in one operation vertical axis rotation is a rare entity complicating patella dislocations . in this rare event emergency physicians should be aware of this complication and refer to the relevant specialist for open reduction under general anaesthesia in order to minimize patient discomfort and potential articular surface damage .

introduction : acute patellar dislocation is a common injury usually associated with a significant traumatic mechanism resulting in lateral displacement . vertical axis rotation following dislocation is a rare variant of this type of injury and can prevent closed reduction in the acute setting.case presentation : a 32-year old gentleman presented with an irreducible patella dislocation following an unusual atraumatic mechanism . following attempts at closed reduction under sedation and regional nerve block , eventual open reduction and soft tissue reconstruction was required under general anesthetic . during the open reduction procedure , it was noted that the patella had dislocated into a lateral extra - articular position and rotated around its vertical axis . following patella reduction , the medial patellar retinaculum was repaired . examination under anesthetic revealed satisfactory tracking of patella following repair.conclusion:a review of the literature suggests dislocations such as the current presentation , are extremely rare and although have been described to occur with minor trauma , have never been described to occur following a largely atraumatic event . in such cases , closed reduction may be impossible even with adequate analgesia due to patella position and soft tissue obstruction . open reduction is essential in these situations .

sexually transmitted chlamydia trachomatis infection is of widespread public health concern because of its prevalence and potentially devastating reproductive consequences , including pelvic inflammatory disease ( pid ) , infertility , and ectopic pregnancy [ 13 ] . the negatively charge elementary bodies ( eb ) , infectious particles of c. trachomatis , invade the mucosal surface of the female genital tract and persist in them for a long time . abundant in vitro data suggests that the inflammatory response to chlamydiae is initiated and sustained by actively infected host cells including epithelial cells and resident macrophages . c. trachomatis has the ability to infect both epithelial cells and resident macrophages . these infected host cells act as first responders to initiate and propagate immune responses , which later participate in initiation of adaptive immune responses . activation of adaptive immune responses consequently leads to accumulation of effector t and b cells at the site of chlamydia infection and plays critical roles in controlling the infection [ 5 , 6 ] . however , c. trachomatis uses various strategies to escape the host immune response and persist for a prolonged period of time , subsequently leading to the many disease manifestations associated with the infection . this is a common scenario for most intracellular organisms such as mycobacteria , where cells produce excessive inflammatory mediators to contribute to disease manifestation by damaging neighboring cells . for example , results from studies using the murine model of c. trachomatis revealed that tubal dilation frequently occurred as an end result for a primary infection , suggesting that the inflammatory process resulting from a single c. trachomatis infection is sufficient to result in long - term tissue damage . like other infectious microorganisms , inflammatory mediators have been documented to be hallmarks of c. trachomatis infection and its pathogenesis [ 46 ] . because of the inherent difficulties in acquiring human tissue samples for study , researchers have taken advantage of multiple animal models of chlamydia infection to examine the nature and timing of the inflammatory response . we have shown by in vitro experiments that primary chlamydia infection of human epithelial cells and mouse macrophages occurs within 2 days of infection and is characterized by significant production of il-6 , tnf , and il-8 . it is well documented that inflammatory cytokines and chemokines play critical role for the recruitment and chemoattractant of neutrophils and other leukocytes . neutrophils have the capability to destroy accessible ebs , and when recruited in high numbers , they release matrix metalloprotease ( mmps ) molecules and neutrophil elastase , which have been shown to contribute to tissue damage [ 10 , 11 ] . to control inflammation triggered by infectious organisms , alternative strategies that could balance the levels of inflammatory mediators released during infection are of intense interest . recently active compounds with the capacity to modulate host inflammatory responses have received considerable attention as they may be potential new therapeutic agents for the treatment of inflammatory diseases [ 1215 ] . naringenin is a naturally occurring polyphenolic compound containing two benzene rings linked together with a heterocyclic pyrone ring . naringenin is a normal constituent of the human diet in grapefruit and tomatoes and is known to exhibit a variety of biological activities , such as enzyme inhibitors , antioxidants , anticancer , and as an anti - inflammatory agent [ 1721 ] . since its discovery , naringenin 's wide ranges of pharmacological properties have attracted the attentions of many researchers because of its anti - inflammatory properties . its anti - inflammatory property is actively studied in macrophages and ex vivo human whole - blood models [ 2224 ] . in this study , we investigated the anti - inflammatory capacity of naringenin to regulate cytokines and chemokines produced by mouse j774 macrophages infected with live c. trachomatis ( mopn nigg ii ) . we used multiplex elisa to determine a broad range of inflammatory cytokines and chemokines produced during the interaction of c. trachomatis and macrophages . we then assessed the ability of naringenin to regulate the production level of these mediators . next , we determined the potential mechanism(s ) by which naringenin may modulate inflammatory mediators by investigating its effect on tlr2 , tlr4 , and cd86 receptors , as well as the p38 mapk pathway . the findings from our study are discussed here in the context of naringenin as a potential new immunomodulator of c. trachomatis induced inflammation . mouse j774 macrophages were obtained from the american type culture collection ( atcc , manassas , va , usa ) and cultured as already described . c. trachomatis mopn nigg ii was purchased from atcc ( atcc vr-123 ) and propagated as previously described . to establish infection , macrophages ( 10 cells / well ) were seeded in 24-well plates for 24 h after which they were infected with live c. trachomatis infectious particles ( 10 ) in 500 l of growth media / well . the cells were then incubated at 37c under 5% co2 and culture supernatants were collected at 48 h after infection . the optimum bacterium dose and duration of infection were determined as reported . as a positive control , macrophages ( 10 cells / well ) were stimulated with e. coli lps ( 1 g / ml ) and culture supernatants were collected at 48 h after stimulation . collected supernatants were centrifuged at 450 g for 10 min at 4c and stored at 80c until used . the stock solution of naringenin ( sigma , st . louis , mo , usa ) was prepared by dissolving 40 mg of naringenin in 1 ml dimethyl sulfoxide ( dmso ) . after 2-day infection of macrophages with c. trachomatis , the media were replaced with fresh media containing various concentrations ( 0.01 , 0.1 , 1 , and 10 g / ml ) of naringenin . cell - free supernatants were collected after an additional 48 h incubation following centrifugation at 450 g for 10 min at 4c and stored at 80c until used . milliplex mouse 32-plex cytokine and chemokines detection reagent ( catalogue number mpxmcyto-70 k - pmx32 ) was purchased from millipore ( emd millipore corporation , billerica , ma , usa ) and the assay was performed as described . cytotoxicity of naringenin to mouse j774 macrophages was measured using the 3-(4 , 5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide ( mtt ) dye reduction assay and the celltiter 96 cell proliferation assay kit ( promega , madison , wi , usa ) . cells were seeded in a 96-well plate at a density of 10 cells / well in 50 l media and incubated overnight at 37c under 5% co2 . naringenin was added to cells in concentrations ranging from 0.1 to 100 g / ml and after 48 h supernatants were removed , cells were washed twice with sterile pbs , followed by addition of 15 l of mtt dye solution to each well , and cells were further incubated for 3 h at 37c under 5% co2 . to stop the reaction , 100 l of solubilization solution / stop mixture was added to each well and plates incubated for 30 min at room temperature ( rt ) . absorbance at 570 nm was measured using a tecan sunrise plate reader ( tecan us inc . the percentage of cell viability was obtained using the optical density readings of naringenin treated cells compared to those of normal cells ( control ) , where % viability = [ a]test/[a]control 100 , where [ a]test is the absorbance of the test sample and [ a]control is the absorbance of control sample . mouse j774 macrophages ( 10 cells / ml ) were left uninfected or infected with c. trachomatis and after 48 h infection the media were removed and replenished with fresh media containing 1 g / ml of naringenin . following incubation for an additional 48 h , cells were scraped from wells , washed , and then blocked with fc blocking antibody ( bd bioscience ) in facs ( fluorescence - activated cell sorting ) buffer ( pbs containing 0.1% nan3 and 1% fetal bovine serum ) for 15 min at 4c . cells were next washed two times followed by staining with fluorochrome - conjugated antibodies ( 50 l in facs buffer ) against mouse tlr2 ( pe ) , tlr4 ( fitc ) , cd80 ( pe - cy7 ) , and cd86 ( apc ) ( ebiosciences ) . cells were incubated with fluorochrome antibodies for 30 min at 4c , washed 2 times , and then fixed using 2% paraformaldehyde solution . data were acquired on a bd facscanto ii flow cytometer ( bd bioscience ) with at least 10 events for each sample . tlr2 , tlr4 , cd80 , and cd86 positive cells and their mean fluorescence intensity ( mfi ) were analyzed using flowjo software ( treestar inc . , mouse j774 macrophages ( 3 10 cells / well ) were infected with live c. trachomatis ( 3 10 ifu / well ) in 6-well plates for 48 h followed by replacement of fresh media containing 1 g / ml of naringenin . rna was extracted from the cell pellets using qiagen rneasy kit ( qiagen inc . , valencia , ca , usa ) , which included a dnase - i digestion step . qrt - pcr was employed to quantify mrna gene transcripts of cd86 and tlr2 using taqman rna - to - ct 1-step kit in combination with taqman gene expression assays ( applied biosystems by life technologies , foster city , ca , usa ) as reported . amplification of gene transcripts was performed according to the manufacturer 's protocol using abi viia 7 real - time pcr ( applied biosystem by life technologies ) and standard amplification conditions . the relative changes in gene expression were calculated using the following equation : 2 where all values were normalized with respect to the housekeeping gene gapdh mrna levels . amplification using 50 ng rna was performed in a total volume of 20 l . each real - time pcr assay was performed in triplicates and the results are expressed as the mean sd . to determine if the p38 mapk pathway is employed by c. trachomatis to trigger production of cytokines and chemokines by mouse j774 macrophages , we next blocked p38 mapk signaling with its specific inhibitor , sb203350 ( emd millipore corporation , billerica , ma , usa ) . mouse j774 macrophages ( 10 cells / well ) were preincubated with 20 m of sb203350 for 24 h , infected with c. trachomatis ( 10 ifu / well ) , and incubated for an additional 72 h. cell - free supernatants were collected by centrifugation and the production levels of randomly selected cytokines ( il-6 , tnf , il-12p70 , and il-1 ) and chemokines ( ccl5 and cxcl10 ) were determined using single elisas as described previously . the 20 m concentration and 24 h inhibition time point used for sb203350 were optimal conditions predetermined in our laboratory . mouse j774 macrophages ( 3 10 cells / well ) were seeded in 6-well plates and infected with live c. trachomatis ( 3 10 ifu / well ) for 15 , 30 , and 60 min . cells were lysed at different time points using 1x ripa buffer ( sigma ) supplemented with phosphatase inhibitors ( sigma ) . immediately cells were transferred to microcentrifuge tubes , sonicated for 15 sec to shear dna and reduce sample viscosity followed by centrifugation at 450 g for 10 min at 4c . the concentrations of proteins were determined by the bicinchoninic acid assay ( bca ) ( thermo scientific , rockford , il , usa ) . proteins were separated by sds - page , transferred to nitrocellulose membranes , and blocked with blocking buffer ( tris - buffered saline ( tbs ) ) containing 0.1% tween-20 and 5% w / v nonfat milk . after blocking for 1 h , the membrane was washed 3 times for 5 min each with wash buffer ( tbs , 0.1% tween-20 ) and incubated overnight with gentle agitation at 4c with phospho - p38 or total p38 primary antibodies ( cell signaling technology inc . beverly , ma , usa ) each at a dilution of 1 : 1000 ( diluted in primary antibody dilution buffer ( 1x tbs , 0.1% tween-20 , 5% bovine serum album ( bsa ) , and dh2o ) . following overnight incubation , the membrane was washed 3 times and incubated with hrp - conjugated secondary antibody ( cell signaling ) at 1 : 2000 ( diluted in blocking buffer ) with gentile agitation for 1 h at rt . after 3 washes , protein bands were visualized using lumiglo substrate ( cell signaling ) on scientific imaging film ( kodak inc . , the sizes of total p38 and phospho - p38 were determined from the biotinylated protein ladder . biotinylated secondary antibody ( 1 : 1000 diluted in blocking buffer ) was used to detect the protein markers . for some experiments , macrophages were infected with c. trachomatis in the presence and absence of naringenin at 1 g / ml to determine if naringenin may exert its anti - inflammatory activity by blocking the p38 mapk pathway . protein lysates were collected and used in western blotting to detect the phosphorylation of p38 mapk as described in the preceding paragraph . the two - tailed unpaired student 's t - test was used to compare the data . like other infection agents , c. trachomatis induces the secretion of various inflammatory mediators upon its infection of macrophages . in the present study , we employed multiplex elisa to identify and quantify cytokines and chemokines in supernatants from macrophages infected with live c. trachomatis . infected macrophages produced significant ( p < 0.001 ) levels of cytokines ( il-6 , tnf , il-10 , il-12p70 , il-1 , il-1 , and gm - csf ) and chemokines ( ccl4 , cxcl10 , cxcl5 , ccl5 , and cxcl1 ) ( figures 1(a ) and 1(b ) ) . however , the production levels of these mediators were reduced in a dose - dependent manner in the presence of added naringenin ( figures 1(a ) and 1(b ) ) . supernatants of c. trachomatis infected macrophages that contained 10 g / ml of added naringenin showed a significant reduction in the levels of cytokines and chemokines ( p < 0.001 ) ( figures 1(a ) and 1(b ) ) . the inhibitory activity of naringenin was significantly ( p < 0.01 ) observed with as little as 1 g / ml ( figure 1(a ) ) , suggesting the potency of naringenin even at low concentrations . naringenin similarly reduced the production levels of cytokines and chemokines in a dose - dependent manner ( p < 0.001 ) when lps was used as the stimulant , especially at 10 g / ml ( figures 1(a ) and 1(b ) ) . overall , our results indicate that naringenin has an anti - inflammatory effect against c. trachomatis induced inflammatory mediators by macrophages . to ensure that the inhibitory effect of naringenin is not attributed to cell death , cytotoxicity studies were performed employing the mtt assay and j774 macrophages exposed to various concentrations of naringenin ( 0.01 to 100 g / ml ) . with the exception of the 100 g / ml naringenin concentration , all other tested concentrations exhibited between 85% and 100% cell viability , suggesting that naringenin is effectively nontoxic to macrophages at these concentrations ( figure 2(a ) ) . 96-well plate with cell death occurring in the presence of 100 g / ml of naringenin ( yellow color ) versus viable cells at other naringenin concentrations ( dark purple color ) . overall , these results demonstrate that naringenin 's anti - inflammatory effect on inflammatory mediators produced by c. trachomatis infected macrophages is not attributed to cell death but rather to alternative mechanisms . receptors on host cell surfaces such as tlrs recognize extracellular stimuli for subsequent intracellular signaling processes . multiple studies have shown that tlr2 and tlr4 play pivotal roles in the recognition of c. trachomatis [ 2629 ] . to begin to understand the mechanism(s ) by which naringenin modulates inflammatory mediators , we first focused on whether or not naringenin will affect the putative tlr2 and tlr4 receptors expressed on c. trachomatis infected mouse j774 macrophages . as compared to unstimulated cells , c. trachomatis infected cells expressed more tlr2 and tlr4 receptors , which were markedly downregulated in the presence of added naringenin , especially for tlr2 ( figures 3(a ) and 3(c ) ) . in addition , the mfi for tlr2 and tlr4 on c. trachomatis infected cells was significantly increased ( p < 0.05 ) as shown by ratios of 22 and 16 , respectively , in comparison to those of j774 and naringenin only uninfected cells ( figure 3(e ) ) . when naringenin was added to c. trachomatis infected macrophages , the mfi of tlr2 and tlr4 reduced significantly ( p < 0.05 ) as compared with that of c. trachomatis infected macrophages ( figure 3(e ) ) , suggesting the ability of naringenin to down - regulate the expression of these receptors . our result provides evidence that naringenin diminishes the recognition of c. trachomatis by its putative tlr2 and tlr4 receptors to possibly exert its anti - inflammatory downstream effects during reinfection of cells by c. trachomatis . for t cells to be fully activated , antigen presenting cells must express costimulatory molecules such as cd80 and cd86 . therefore , down - regulating the expression of either cd80 or cd86 or both may negatively impact the activation of t cells . here we tested if naringenin may impact t - cell activation by down - regulating cd80 and cd86 expression levels on c. trachomatis infected macrophages . our flow cytometric results show that naringenin at 1 g / ml downregulates the expression of cd86 induced by c. trachomatis infected macrophages but not that of cd80 as compared to macrophages exposed only to c. trachomatis ( figures 3(b ) and 3(d ) ) . moreover , naringenin significantly reduced ( p < 0.05 ) the mfi of cd86 on c. trachomatis infected cells from 18 to 9 ( figure 3(e ) ) . on the other hand , naringenin did not reduce the mfi of cd80 on infected cells ( figure 3(e ) ) , indicating its selective modulation of costimulatory molecules on c. trachomatis infected cells . this finding further suggests that naringenin anti - inflammatory effect is not only limited to innate immune responses but also to adaptive immune responses since the expression of either cd80 or cd86 or both plays critical roles for activation of t cells during adaptive immune responses . as a further validation of our flow cytometric results , we next determine the effect of naringenin on the mrna gene transcript expression levels of tlr2 and cd86 in c. trachomatis infected j774 macrophages . c. trachomatis enhanced the gene transcripts expression levels of tlr2 and cd86 , which were both significantly ( p < 0.05 ) downregulated ( up to a 2-fold decrease ) in the presence of naringenin ( at 1 g / ml ) ( figure 4 ) . combining these findings suggests that naringenin downregulates tlr2 and cd86 expression at both the protein and mrna gene transcripts levels , thus underscoring its role in regulating c. trachomatis inflammation in macrophages . among the many mapk pathways multiple studies have suggested that p38 is a key mapk pathway that is activated by intracellular pathogen to induce inflammatory mediators [ 3133 ] . to investigate if the p38 pathway is exploited by c. trachomatis for production of its concomitantly elicited inflammatory mediators , we treated j774 macrophages with a p38 specific inhibitor followed by quantification of randomly selected cytokines and chemokines in collected supernatants . with the exception of il-1 , our result shows that the levels of il-6 , il-12p70 , tnf , ccl5 , and cxcl10 were significantly reduced ( p < 0.05 ) when macrophages were treated with the p38 inhibitor ( figure 5 ) , suggesting that this pathway is used by c. trachomatis for their production by macrophages . given that p38 mapk mediates , in part , the production of inflammatory mediators by c. trachomatis infected macrophages , we investigated if this pathway may be used by naringenin to exert its anti - inflammatory effect in macrophages . therefore , we first determined that indeed c. trachomatis could induce the phosphorylation of p38 mapk in j774 macrophages for the production of its inflammatory mediators . our time - kinetics experiment shows that c. trachomatis infected macrophages expressed the highest p38 phosphorylation at 60 min ( figure 6(a ) ) . however , in the presence of naringenin , the phosphorylation of p38 reduced as indicated by the reduced band intensity ( figure 6(b ) ) . similarly , lps induced the phosphorylation of p38 at 60 min of stimulation , but naringenin reduced its ability to induce phosphorylation of p38 ( figure 6(c ) ) . overall , our results show increased phosphorylation of p38 map kinase in c. trachomatis infected macrophages , which was downregulated by naringenin , suggesting a potential downstream mechanism for naringenin to regulate inflammatory mediators . inflammatory responses to c. trachomatis are initiated and sustained by actively infected host cells including epithelial cells and resident macrophages . the influx of inflammatory cells in pathogen - induced diseases can be either beneficial or detrimental to the host . therefore , immunointervention strategies that can reduce the influx of inflammatory cells in a beneficial fashion could potentially impact the pathogenesis of diseases . along with other controlling strategies , our laboratory is also interested in evaluating anti - inflammatory molecules to control c. trachomatis inflammation . previously we have shown that the anti - inflammatory cytokines , il-10 , downregulate essential inflammatory mediators produced by epithelial cells infected with live c. trachomatis . in the present paper we explored the natural flavonoid , naringenin , as a potential anti - inflammatory agent to regulate inflammatory mediators produced by c. trachomatis infected macrophages . among the numerous structural diversities , we selected naringenin based on its abundance in nature and potential application in medicine . the following observations were made here : ( 1 ) by multiplex elisa a spectra of cytokines and chemokines , which may perpetuate an early c. trachomatis inflammation , were revealed , ( 2 ) naringenin downregulated cytokines and chemokines as produced by c. trachomatis infected macrophages , ( 3 ) naringenin downregulated tlr2 and tlr4 and also the cd86 costimulatory molecule on infected macrophages , and ( 4 ) naringenin inhibited the ability of c. trachomatis to phosphorylate p38 mapk for production of its inflammatory mediators by macrophages . activation of immune cells , especially macrophages with microbial stimuli , influences the nature and progression of disease . in this study , analysis from c. trachomatis infected macrophages revealed increased levels of gm - csf , il-1 , il-1 , il-6 , tnf , il-12p70 , and il-10 after a 2-day infection , with tnf , il-6 , and il-1 being more robustly produced ( figure 1(a ) ) . indeed this observation is of no surprise since cytokines are secreted at different magnitudes during the infection process . it is well reported that all secreted cytokines have their own specific role during the infection process [ 1 , 48 ] . one plausible explanation for lower levels of il-12p70 , il-10 , il-1 , and gm - csf may be attributed to differences in the time kinetics for their optimum secretion during the infection process . interestingly , this finding is in agreement with previous studies where lower levels of il-10 were detected during borrelia infection of human monocytes and c. trachomatis infection of human epithelial cells and macrophages . the heightened secretion of tnf , il-6 , and il-1 by c. trachomatis infected macrophages may have some relevancy to the initiation of a chlamydia inflammation . it has been demonstrated that il-6 , tnf , and il-1 have crucial roles in increasing the intracellular adhesion molecule ( icam ) . infection of nonimmune host epithelial cells and resident tissue innate immune cells with chlamydia results in an increase in adhesion molecules , whereby these molecules promote binding of small proteins such as chemokines on cell surfaces . chemokines play critical role attracting leukocytes to the site of infection , where the leukocytes presence can be seen either as beneficial or detrimental to the host . the main leukocytes that are recruited and attracted by chemokines during an early inflammatory process are macrophages and neutrophils [ 16 ] . our result shows that c. trachomatis infected macrophages produced greater quantities of ccl4 , cxcl10 , ccl5 , cxcl1 , and cxcl5 ( figure 1(b ) ) . the production levels of most chemokines are typically influenced by the type of cytokines present in the inflammatory milieu . the different profiles of chemokines produced by infected macrophages in this study correlated with the high levels of il-6 , tnf , and il-1. high levels of il-6 , tnf , and il-1 apparently cause chemokines to stick to endothelial cell surfaces for efficient attraction mainly due to an increase in icam . overall , our results clearly demonstrate that the spectra of cytokines and chemokines produced by c. trachomatis infected macrophages may have significant roles in initiating its inflammatory process and thus pathogenesis of disease . naringenin has a broad - spectrum medicinal application against bacteria , parasitic , and viral infections . 's study showed an antifilarial activity of naringenin against the filarial parasite , brugia malayi . naringenin was also shown to exhibit antimicrobial activity against pathogenic bacteria like listeria monocytogenes , escherichia . similarly , an antiviral activity of naringenin was shown against herpes simplex virus type-1 ( hsv ) , polivirus , parainfluenza virus type-3 , and respiratory syncytial virus ( rsv ) . du and colleagues demonstrated that naringenin regulates immune system function in a lung cancer infection model , where it reduced il-4 but increased il-2 and ifn- levels . in a different study , shi et al . also showed that naringenin displayed an inhibitory role in allergen - induced airway inflammation by reducing il-4 , il-13 , ccl5 , and ccl11 . for the first time , in the present study we have shown that naringenin has an anti - inflammatory effect in an in vitro c. trachomatis infection model . naringenin reduced in a dose - dependent manner the level of major inflammatory mediators secreted by c. trachomatis infected macrophages , which was not attributed to cell death . these studies suggest that naringenin has a broader immune - regulatory property in different disease models , especially inflammatory diseases . in this study , we have clearly demonstrated that naringenin altered the levels of numerous cytokines and chemokines in c. trachomatis infected macrophages by its alteration of multiple inflammatory pathways . induction of inflammatory pathway initially starts when invasive pathogens are recognized by cell surface receptor molecules such as tlrs in the host , followed by activation of various signaling pathways . it is well documented that c. trachomatis is recognized by tlrs specifically tlr2 and tlr4 on macrophages to induce secretion of inflammatory mediators , which can be either beneficial or detrimental to the host [ 29 , 39 ] . here in the present study we show enhanced expression of both tlr2 and tlr4 on c. trachomatis infected macrophages and whose expression levels were reduced by naringenin ( figures 3 and 4 ) . our study suggests the capacity of naringenin to inhibit the interaction of c. trachomatis with its upstream putative receptors to potentially mediate its anti - inflammatory effect in macrophages . tlr - stimulated macrophages induce effectors of the adaptive immune system such as cd40 , cd80 , and cd86 to drive t - cell activation and proliferation . the cd28-mediated costimulatory signal can result in an enhanced t - cell proliferation and cytokine production which contributes to the development of various inflammatory diseases [ 4042 ] . our flow cytometry result demonstrates that c. trachomatis induced the expression of cd80 and cd86 , however , with only cd86 expression being modulated by naringenin ( figures 3 and 4 ) . although we have not shown it in this study , but inhibiting cd80 and cd86 expression has a possibility to impair the activation of t cells and eventually blocking effectors of the adaptive immune system . lim and coworkers documented significant reduction in the levels of il-2 and ifn- when both cd80 and cd86 costimulatory molecules were inhibited confirming the key role played by costimulatory molecules in functional t - cell activation . weakened t - cell activation is directly associated with less interaction between antigen presenting ( apc ) cells and t cells . thus , our data provides mechanical insights of c. trachomatis engulfment by macrophages as indicative by heightened expression of cd80 and cd86 , which eventually contributes to the activation of adaptive immune responses . down - regulation of only cd86 expression in the presence of naringenin provides evidence for its broader capability in modulating inflammatory response during c. trachomatis infection . however , the perplexing question remains as to why naringenin inhibited cd86 but not cd80 expression even though both are costimulatory molecules highly needed for t - cell activation and also by which cell - to - cell binding forces depend on their recognition . it has been reported that treatment with cd80/86 blocking antibodies reduced the interaction force of cell : cell conjugates [ 43 , 44 ] . both cd80 and cd86 can bind to the t - cell stimulatory receptor cd28 and to the inhibitory receptor ctla4 . cd86 appeared to strengthen apc : t - cell interactions more markedly than cd80 since higher force reduction was observed after blocking cd86 alone than that achieved by disrupting cd80 alone [ 44 , 45 ] . therefore , the ability of cd86 and not cd80 to induce stronger apc : t - cell interaction indicates its crucial ability in initiating immune responses . upon microbial recognition by tlrs , mapk signaling pathways of the many mapk pathways , p38 is considered to be an important pathway to induce inflammatory mediators during c. trachomatis infection . our inhibition study supports this idea , where in the presence of a p38 inhibitor the levels of il-12p70 , il-6 , tnf , ccl5 , and cxcl10 ( figure 5 ) were significantly reduced suggesting that this pathway is employed by c. trachomatis to induce these respective inflammatory mediators . furthermore , phosphorylation of p38 by c. trachomatis in macrophages in this study ( figure 6 ) underscores that it triggers this pathway for producing its concomitant inflammatory mediators . of outmost significance , naringenin inhibited the ability of c. trachomatis to phosphorylate p38 in macrophages , suggesting possibly its attenuation of concomitantly produced cytokines and chemokines . other investigators have reported that naringenin 's inhibitory role in allergen airway infection is associated with its down - regulating the activation of the nf-b pathway via mapk pathway . in another study , it was also shown that naringenin manifested its anti - inflammatory functions in vitro by inhibiting nfb in macrophages [ 47 , 48 ] . shi et al . also reported that naringenin can suppress mucous production by inhibiting nfb activity in a murine model of asthma . overall , our findings coupled with the above mentioned reports provide evidence that inflammatory signaling pathways including mapk , especially p38 and nfb , are potential targets for naringenin anti - inflammatory effects . c. trachomatis has a prolonged and unique developmental life cycle which takes 2472 h for completion after entry into target cells . this process involves lysis and reinfection of cells by the released ebs after binding to their cognate cell surface receptors . reinfection reportedly is one of the major characteristics of c. trachomatis persistent infection [ 4 , 31 ] contributing to the pathogenesis of disease . the ability of naringenin to reduce cell surface receptor expression and associated inflammatory signaling pathways 48 h after infection of cells with c. trachomatis is a testament of naringenin regulation of inflammatory mediators during the reinfection process . even though we focused on selected cell surface receptors and signaling pathways in this study , we can not dismiss the involvement of other receptors like the nucleotide binding site / leucine - rich repeat ( nbs / lrr ) protein , nod2 that is recognized by c. trachomatis ( and our unpublished observation ) or the nfb signaling pathway that reportedly mediates naringenin anti - inflammatory actions . admittedly , the precise mechanisms by which naringenin downregulates surface receptors and signaling pathways were not investigated here . nevertheless , we can not rule out the possibility that naringenin regulatory activity may be the direct consequences of its reducing the c. trachomatis infectious load in macrophages , ultimately resulting in less induction of inflammatory mediators . whether or not naringenin has anti - bactericidal activity against c. trachomatis in macrophages is the topic of our ongoing investigations . in summary , most intracellular microorganisms including c. trachomatis prefer not to be targeted by regimens that impair their perpetuation in cells by inducing unwanted immune responses to amplify the disease progression . therefore , in such scenarios , immunointervention approaches that focus on reducing any unwanted host immune response is attractive and can be viewed as alternative means to prevent or control severe inflammatory responses . our findings presented here are the first , to our knowledge , to demonstrate that naringenin is an immunomodulator of inflammatory responses triggered by c. trachomatis in macrophages . reduction of these inflammatory mediators by naringenin is mediated upstream by modulating tlr2 , tlr4 , and cd86 macrophage surface receptors and downstream via the p38 mapk signaling pathway . more studies are warranted to further explore the in vivo relevancy of naringenin in controlling severe inflammatory responses that are induced not only by c. trachomatis but also by other similar pathogenic microorganisms .

chlamydia trachomatis , the agent of bacterial sexually transmitted infections , can manifest itself as either acute cervicitis , pelvic inflammatory disease , or a chronic asymptomatic infection . inflammation induced by c. trachomatis contributes greatly to the pathogenesis of disease . here we evaluated the anti - inflammatory capacity of naringenin , a polyphenolic compound , to modulate inflammatory mediators produced by mouse j774 macrophages infected with live c. trachomatis . infected macrophages produced a broad spectrum of inflammatory cytokines ( gm - csf , tnf , il-1 , il-1 , il-6 , il-12p70 , and il-10 ) and chemokines ( ccl4 , ccl5 , cxcl1 , cxcl5 , and cxcl10 ) which were downregulated by naringenin in a dose - dependent manner . enhanced protein and mrna gene transcript expressions of tlr2 and tlr4 in addition to the cd86 costimulatory molecule on infected macrophages were modulated by naringenin . pathway - specific inhibition studies disclosed that p38 mitogen - activated - protein kinase ( mapk ) is involved in the production of inflammatory mediators by infected macrophages . notably , naringenin inhibited the ability of c. trachomatis to phosphorylate p38 in macrophages , suggesting a potential mechanism of its attenuation of concomitantly produced inflammatory mediators . our data demonstrates that naringenin is an immunomodulator of inflammation triggered by c. trachomatis , which possibly may be mediated upstream by modulation of tlr2 , tlr4 , and cd86 receptors on infected macrophages and downstream via the p38 mapk pathway .

most human disease pathways are evolutionarily conserved with other organisms . for example , the nematode worm caenorhabditis elegans , which is relatively distant in phylogeny from humans , is used as a model system to study human parkinson 's disease ( 1 ) . despite limited functional mimicry of some human diseases ( 2 ) and recent advances in patient - based disease genetics due to genome - wide association studies ( gwas ) and disease genome sequencing , non - human model organisms remain indispensable in human disease research , because ( i ) disease - associated dna variants typically explain only a small proportion of disease heritability ; ( ii ) detailed molecular mechanisms of disease processes often can not be studied directly in humans for ethical reasons ( 3 ) . while model organisms will remain critical for human disease research into the future , the functional relevance of pathways conserved between humans and other species can sometimes be nonobvious ( 4 ) , hampering identification of new human disease models in other , more experimentally tractable organisms . the identification of human disease - relevant pathways conserved in model organisms will allow new opportunities for studying diseases , disease genes and drug candidates , and often allow for genetic manipulations of the disease phenotype to illuminate molecular mechanisms of disease progression . therefore , bioinformatics tools that can efficiently translate the biology of model organisms into new insights about human diseases are critical to connect model organism observations to human disease research . here , we present a new web - based tool for prioritizing the human diseases most relevant to a given set of model organism genes . morphin ( model organisms projected on a human integrated gene network ) harnesses model organisms to investigate human disease by performing an orthology - based projection of model organism pathway genes onto a human integrated functional gene network ( humannet ( 5 ) ) . genome - scale functional gene networks have proven useful in prioritizing novel candidate genes for phenotypes in diverse species , including for human diseases ( 6 ) . a typical use case for morphin is as follows : suppose a user obtained a list of worm ( c. elegans ) genes involved in , for example , dauer induction , and wants to identify the human diseases most relevant to the worm dauer induction pathway . the user can submit the worm genes for dauer induction to the morphin server , which then returns the following results : ( i ) human orthologs of the worm query genes , ( ii ) a list of human diseases significantly associated with the worm dauer induction pathway , based upon gene set enrichment or network - based closeness , ( iii ) gene networks from humannet between human orthologs of the worm genes for dauer induction and the associated human disease genes , ( iv ) a list of prioritized human orthologs of worm genes most relevant to each associated human disease . the user can actively link the model organism pathway to the most relevant human diseases , and thus potentially identify new disease models and find novel candidate genes for those human diseases . morphin substantially differs from other tools for mapping model - to - disease pathway associations , which are based on either intersection of orthologous genes ( e.g. phenologs ( 4 ) , kobas ( 7 ) ) or semantic similarity ( e.g. phenomenet ( 8) , phenodigm ( 9 ) ) . for example , morphin employing the fisher 's exact test is equivalent to searching for phenologs for the model organism gene set . however , morphin additionally uses not only overlap but also functional links between orthologous genes from pathways of model species and human to measure their association , by projecting orthologous genes of the model species on a human gene network , enabling detection of functional association between pathways with no overlap ( 10 ) . this extra detection powered by a network algorithm , riddle ( reflective diffusion and local extension ) , may be particularly beneficial if annotation of a model pathway or a human disease is largely incomplete . moreover , gene functional links within and between pathways allow prioritization of the model pathway genes for a disease , and may provide new molecular insights about pathogenesis . once a user submits a set of model organism query genes , morphin performs the following analyses . first , morphin identifies human orthologs of the submitted model organism query genes using the inparanoid algorithm ( 11 ) . morphin then measures associations between human disease pathways and the query genes , calculated by overlap - based fisher 's exact test and network - based riddle algorithm , and returns all significantly associated human diseases . third , morphin visualizes gene networks depicting the functional couplings between the query genes and human disease genes . finally , morphin returns a list of query genes prioritized by relevance to each of the associated human diseases . figure 2 shows representative screenshots of the morphin web interface . the overall design of the morphin web server . once a user submits a set of query genes for one of nine supported model organisms , morphin performs the following analyses : morphin first identifies human orthologs of the submitted model organism genes using inparanoid ( 11 ) . morphin then searches for related human disease pathways to the query genes using fisher 's exact test ( 12 ) and riddle ( 10 ) . third , for each significantly associated human disease pathways , morphin displays the gene network between the query genes and disease genes by humannet links . ( b ) a table of significantly associated human disease pathways ranked by the fisher 's exact test . the p - value represents the statistical significance by fisher 's exact test ; the q - value represents the adjusted significance for multiple hypotheses test ; the morphin web server currently supports nine model organisms : c. elegans ( worm ) , danio rerio ( zebrafish ) , dictyostelium discoideum ( social ameba ) , drosophila melanogaster ( fruit fly ) , mus musculus ( mouse ) , rattus norvegicus ( rat ) , saccharomyces cerevisiae ( budding yeast ) , schizosaccharomyces pombe ( fission yeast ) and xenopus laevis ( african clawed frog ) . the protein sequences of human , zebrafish , mouse , rat were downloaded on 25 february , 4 december , 9 september 2013 from the ncbi reference sequence ( refseq ) database ( http://www.ncbi.nlm.nih.gov/refseq ) ( 13 ) , worm ws239 from wormbase ( http://www.wormbase.org ) ( 14 ) , social ameba on 28 january 2014 from dictybase ( http://dictybase.org ) ( 15 ) , fruit fly release 5.54 from flybase ( http://flybase.org ) ( 16 ) , budding yeast on 25 november 2013 from saccharomyces genome database ( http://www.yeastgenome.org ) ( 17 ) , fission yeast on 28 january 2014 from pombase ( http://www.pombase.org ) ( 18 ) and african clawed frog on 28 january from uniprot ( http://www.uniprot.org ) ( 19 ) . users can submit query genes using gene names or unique systematic ids , although we generally recommend using unique systematic ids . details of supported gene ids are available on the morphin tutorial page . to identify human orthologs for the model organism query genes , morphin employs the inparanoid 4.1 standalone algorithm ( http://inparanoid.sbc.su.se ) ( 11 ) , which allows multiple human orthologs for a given query gene by considering not only the best ortholog but also its functionally similar paralogs ( in - paralogs ) ( 20 ) . this algorithm achieves a balance between sensitivity and specificity in identifying orthologs across two species ( 21,22 ) by distinguishing in - paralogs duplicated after speciation from out - paralogs duplicated before speciation . this score indicates the relative similarity to the two - way best - hit orthologs and ranges from 0 to 1 , where 1 indicates the maximum likelihood of orthology . the suggested default threshold is 0 , which maximizes sensitivity at the expense of specificity . however , the in - paralog score threshold can be increased so as to use only the most confident orthologs in subsequent analyses . notably , where gene expansions have occurred , inparanoid allows for multiple human orthologs for each model organism gene , each associated with its own in - paralog score ( figure 2a ) . morphin shows go annotations for each human ortholog of the query genes , from which we may quickly capture functional properties of query genes in a human context . for more extensive functional characterization of the query genes in human contexts , morphin also returns a list of the human genes closely connected to the query genes in humannet along with their go annotations . such annotations supplement the group - wise analysis search for functionally associated human disease pathways . morphin returns those human diseases significantly associated with the query gene set as determined by two algorithms : gene set enrichment by fisher 's exact test ( 12 ) ( figure 2b ) and riddle , a measure of network proximity between two gene sets ( 10 ) ( figure 2c ) . fisher 's exact test is a classic overlap - based enrichment analysis , which measures the statistical significance of the observed overlap between two gene sets . when adjusted for multiple hypotheses ( assessing significance as a q - value ) , this test requires the presence of common member genes between two gene sets . considering that current annotations for many pathways are still largely incomplete , we might thus anticipate associations between pairs of gene sets to be missed due to failure to observe the overlap . to overcome this limitation , we previously developed a network - based measure of association between two gene sets , riddle ( 10 ) . riddle determines functional closeness between two gene sets using a set - wise distance on an integrated functional human gene network , humannet ( 5 ) . because riddle measures association based upon network connections between two gene sets , not their overlap in gene content , it can also detect relationships between gene sets which have no overlap , thus increasing its power to identify relevant human diseases . while fisher 's exact test can not detect associations between gene sets with no overlap , it showed slightly better performance for sets with overlap in a previous study using simulated test data ( 10 ) . in addition , we anticipate that the two methods may be somewhat complementary since they employ entirely different methodologies . therefore , morphin provides the search results from both methods in two tables of candidate human diseases , one ranking pathways with q - value < 0.1 by fisher 's exact test and the other ranking pathways with fdr ( false discovery rate ) < 0.01 by riddle ( limited to the top 1000 pathways ) . morphin currently tests gene sets from seven databases of human pathways , including five databases cataloging human disease genes : ( i ) disease ontology ( http://disease-ontology.org downloaded on 4 april 2014 ) ( 24 ) , ( ii ) genetic association database ( gad , http://geneticassociationdb.nih.gov , downloaded on 14 december 2013 ) ( 25 ) , ( iii ) genome - wide association study catalog ( gwas catalog , http://geneticassociationdb.nih.gov , downloaded on 5 december 2013 ) ( 26 ) , ( iv ) human phenotype ontology ( hpo , http://www.human-phenotype-ontology.org/ downloaded on 7 april 2014 ) ( 27 ) , ( v ) online mendelian inheritance in man ( omim , http://omim.org , downloaded on 4 december 2013 ) ( 28 ) and two databases for pathways or biological processes : ( i ) kyoto encyclopedia of genes and genomes ( kegg , http://www.kegg.jp , downloaded on 18 december 2013 ) ( 29 ) and gene ontology biological processes ( gobp , http://www.geneontology.org , downloaded on 17 december 2013 ) ( 30 ) . particularly , gobp annotations are provided with various types of evidence including exclusively computational annotation ( inferred from electronic annotation ) . to achieve high specificity in morphin analysis , we used only highly reliable annotation with experimental or literature evidence : inferred from direct assay , expression pattern , genetic interaction , mutant phenotype , physical interaction and traceable author statement . users also need to be aware of potentially inaccurate gene - to - disease associations by gwas due to its mapping strategy , based on a gene 's physical proximity to functional genetic variation affecting diseases . network representations of human disease genes associated with model organism query genes can help interpret the associations and better prioritize genes of interest . morphin provides network visualizations for each candidate human disease significantly associated with the model organism query genes . clicking on the network icon beside each human pathway name opens a web - based network view ( figure 2d ) displayed using cytoscape web , an interactive network browser ( http://cytoscapeweb.cytoscape.org/ ) ( 31 ) . the cytoscape web browser requires flash player to be installed on the local client machine . ( note that visualizing particularly large networks may be problematic depending on the performance of the local client machine . ) genes are grouped into three categories , represented as boxes : query genes ( orange nodes ) , disease genes ( blue nodes ) and overlap genes between two gene sets ( red genes ) , and are linked by humannet functional associations . morphin shows both group - level connections ( black edges ) and gene - level connections ( blue edges ) ( figure 2d ) . the riddle algorithm can find connections between a group of query genes and a group of disease genes with no overlapping genes ( see figure 3 for examples ) . sometimes two groups are connected in the absence of gene - level connections between them . this is possible because riddle measures closeness between two groups of genes using not only direct connections but also indirect ones . clicking on a network link shows detailed information about that link including its supporting evidence and confidence scores ( lls , log likelihood score ) ( 32,33 ) . clicking on a node provides detailed information for that gene including its name , category ( query gene , disease gene or overlap gene ) and total connection score to the disease genes , represented as a weighted sum of lls as calculated in ( 33 ) . networks between human orthologs of the 11 worm genes linked to an increased number of fat associated organelles ( query genes ) and human homocystinuria ( a ) or hyperhomocysteinemia ( b ) genes ( disease pathway genes ) . despite no overlap between query genes and disease pathway genes ( there is no box for overlap genes ) riddle detected statistically significant association between them by using humannet - based connections between genes from the two gene sets . although a group of query genes from a model organism is found to be significantly associated with a human disease , individual query genes may not be equally relevant to the disease . hence , prioritizing the query genes for the disease by functional relevance will be useful for follow - up functional studies focusing on key candidate genes . query genes that overlap with the human disease genes might be considered to be top candidates , which will be listed in the first table . the rest of the query genes are prioritized for relevance to the disease based on network connectivity scores to the disease genes and listed in the second table ( figure 2e ) . for more reliable candidate selection , morphin employs two complementary ranking systems : group ranks and global ranks . group ranks are assigned among the group of query genes , while global ranks are assigned for all genes in humannet . both group and global ranks of each query gene are presented in the table , allowing the user to assess both relevance within the query gene set and relevance relative to all other human genes . a query gene highly ranked among its group as well as among all human genes may be a particularly strong candidate for the disease . lastly , morphin returns all human genes prioritized for the disease by total connectivity scores to the disease genes in the third table for users who want to see disease candidate genes other than the query genes . in order to evaluate the capability of morphin for disease model discovery , we assessed its power to prioritize gene - to - disease relationships annotated by two distinct methods : manual curation and semantic similarity . to construct validation sets of gene disease relationships , we downloaded 149 and 88 manually curated gene - omim sets from wormbase ( 14 ) and mouse genome informatics ( 34 ) , respectively , on 14 april 2014 . for fly and zebrafish , such annotations by manual curation we therefore compiled 68 and 152 gene - omim sets for fly and zebrafish , respectively , from phenomenet ( 8) , which is a cross - species phenotype ontology network based on semantic similarity ( selecting pairs with similarity score > 0.1 ) . in all four species , morphin , with the default in - paralog score threshold , outperformed the conventional fisher 's exact test in prioritizing reference gene - omim sets ( figure 4 ) . morphin that employs not only the overlap - based fisher 's exact test but also the network - based riddle algorithm significantly improved identification of the reference gene - omim sets over the use of using fisher 's exact test only in mouse , worm , fly and zebrafish ; 3.4 percentage points(pp ) , 12.1pp , 8.8pp and 3.3pp more matches in the top 10 ranks , respectively . the network - based method was critical particularly for fly and zebrafish , in which the overlap - based fisher 's exact test could identify none or only a few reference gene - omim relationships . the different degree of contribution of riddle across the four species may be attributable to the differences in cross - species phenotype association approaches . manual curation generally uses literature information , which mostly contains experimental data , and the majority of traditional disease models have been established from orthology - based hypotheses . disease models by manual curation are likely to contain orthologous overlaps between model species and human . in contrast , semantic approaches of gene disease modeling do not consider genetic components of testing phenotypes , allowing associations between phenotypes of model species and human diseases even in the absence of orthologous genes in common . the reciprocal of the rank of the matching subset of reference gene - omim disease pairs is shown for fisher 's exact test ( fet ) and morphin in mouse ( a ) , worm ( b ) , fly ( c ) and zebrafish ( d ) . morphin identified 85.2% , 67.1% , 8.8% and 5.3% of the reference gene - omim pairs , while the conventional fet method identified 81.8% , 55.0% , 0.0% and 2.0% in the top 10 ranks for mouse , worm , fly and zebrafish , respectively . the riddle algorithm improved the performance of morphin by 3.4pp , 12.1pp , 8.8pp and 3.3pp in the four species , respectively . to demonstrate application of morphin in identification of new disease models , here we present two case studies using worm genes annotated according to the worm phenotype ontology ( wpo ) ( 35 ) . first , morphin shows a pre - computed example using six worm genes modulating dauer induction ( wpo:0001539 ; f52d10.3 , c54d1.3 , y110a7a.10 , f52b5.5 , r13h8.1 , f55a3.3 ) , which is known as an animal model of human diabetes ( 36 ) . both fisher 's exact test and riddle identified diabetes - related terms among the top ranked human diseases ( figure 2b and c ) . fisher 's exact test identified type ii diabetes mellitus ( kegg) in the fourth rank and riddle identified pregnancy in diabetics ( gad) in the third rank and type ii diabetes mellitus ( kegg) in the 16th rank . dauer formation is known to be regulated by insulin signaling pathways in worm ( 37 ) . riddle also identified two insulin - related biological processes , cellular response to insulin stimulus ( gobp) and insulin - like growth factor receptor signaling pathways ( gobp) , tied in the fourth rank , while fisher 's exact test returns the most relevant term insulin signaling pathway ( kegg) as the 41st rank . another example is a set of 11 worm genes associated with an increased number of fat associated bodies ( wpo:0001888 ; f54c9.7 , c54h2.5 , c17g10.5 , r11h6.1 , c02a12.4 , f01g10.3 , zk622.3 , f01g10.2 , k04e7.2 , zc416.6 , c49f5.1 ) . high levels of homocysteine in blood and urine confer risk of cardiovascular diseases ( 38 ) . animal studies have suggested that a high fat diet is associated with an elevated homocysteine level ( 39 ) . in contrast , riddle identified not only the related pathway homocysteine metabolic process ( gobp) but also the related diseases homocystinuria ( hpo) and hyperhomocysteinemia ( hpo) as third and fifth ranks , respectively , suggesting some of the query genes may be relevant to defects of homocysteine metabolism . there are no overlapping genes between the query genes and each of the two diseases ( figure 3 ) , explaining why only the network - based riddle method was effective at identifying the association with such diseases , which now suggest potential future experimental directions . morphin identifies human diseases most relevant to model organism pathway genes using highly sensitive and statistically robust methods incorporating a human gene network . for each significant human disease association , morphin also prioritizes the query genes for disease relevance and visualizes the gene network comprised of query and disease genes . morphin thus facilitates connecting model organism discoveries with relevant human diseases by ( i ) identifying potential new model systems for disease research , ( ii ) prioritizing new disease gene candidates for follow - up studies and ( iii ) using network data and visualization to promote insight about underlying biology of human disease . morphin will be updated as significant changes in annotations for human disease pathways and new versions of humannet become available in the future . national research foundation of korea ( 20100017649 , 2012m3a9b4028641 , 2012m3a9c7050151 to i.l . ) ; national institutes of health , national science foundation , cancer prevention research institute of texas , u.s .

despite recent advances in human genetics , model organisms are indispensable for human disease research . most human disease pathways are evolutionally conserved among other species , where they may phenocopy the human condition or be associated with seemingly unrelated phenotypes . much of the known gene - to - phenotype association information is distributed across diverse databases , growing rapidly due to new experimental techniques . accessible bioinformatics tools will therefore facilitate translation of discoveries from model organisms into human disease biology . here , we present a web - based discovery tool for human disease studies , morphin ( model organisms projected on a human integrated gene network ) , which prioritizes the most relevant human diseases for a given set of model organism genes , potentially highlighting new model systems for human diseases and providing context to model organism studies . conceptually , morphin investigates human diseases by an orthology - based projection of a set of model organism genes onto a genome - scale human gene network . morphin then prioritizes human diseases by relevance to the projected model organism genes using two distinct methods : a conventional overlap - based gene set enrichment analysis and a network - based measure of closeness between the query and disease gene sets capable of detecting associations undetectable by the conventional overlap - based methods . morphin is freely accessible at http://www.inetbio.org/morphin .

type 2 diabetes ( t2 dm ) and obesity have become epidemic in malaysia . according to the latest national health and morbidity surveys , 14.9% of malaysian adults aged 30 years and above are diabetic and they are often obese or overweight [ 1 , 2 ] . moreover , diabetic nephropathy ( dn ) is the most common cause of end - stage renal disease ( esrd ) and contributes to 57% of patients with t2 dm in this country . although t2 dm represents a preventable and treatable cause of esrd , the number of esrd cases caused by t2 dm has increased and accounts for more than 50% of incident dialysis patients [ 35 ] . pentraxin 3 ( ptx3 ) is an acute - phase glycoprotein and a soluble receptor acting as an opsonin . thereby , its levels may reflect more directly the inflammatory status of the vasculature [ 6 , 7 ] . recently , several clinical investigations have demonstrated that elevated plasma ptx3 levels are associated with cardiovascular [ 8 , 9 ] and chronic kidney diseases ( ckd ) [ 10 , 11 ] . furthermore , plasma ptx3 levels are inversely associated with body mass index ( bmi ) suggesting that ptx3 may play a role in obesity and metabolic syndrome [ 12 , 13 ] . interestingly , with the approach of genome - wide scan and linkage analysis , chromosome 3q is found to be linked with diabetes and dn in many ethnic groups [ 1416 ] . the gene encoding for ptx3 protein is located in chromosome 3q25.32 and resides in the linkage region . have shown that ptx3 is positively associated with proteinuria in turkish subjects with t2 dm hypertensive patients , while renin angiotensin system blockade lowers plasma ptx3 levels in the patients [ 17 , 18 ] . however , there are gender and racial differences of plasma ptx3 levels [ 7 , 19 ] , by which the association of ptx3 with kidney dysfunction may be influenced . in the present study , we examined plasma ptx3 levels in a malay cohort , including ngt subjects , t2 dm patients with and without dn . the aim of our study was to investigate the association of plasma ptx3 levels with t2 dm and dn in this malay population . data from our study are also useful for better understanding the different effects of ptx3 in dn and ckd . we collected the samples of subjects with ngt and patients with t2 dm from the collaborating centers all over malaysia . the ethnic distribution of our study subjects was 67.6% malay , 15.3% indian , 14.8% chinese , and 2.3% indigenous sabahans and sarawakians . to avoid the error caused by ethnic stratification , indian , chinese , indigenous sabahans , and sarawakians were excluded in the present study . finally , 103 ( 50 males/53 females ) malay individuals with ngt ( controls ) and 193 ( 99/94 ) malay patients with t2 dm ( cases ) were included into the analyses . diagnoses of t2 dm were done based on the world health organization ( who ) criteria . the diagnoses of dn were based on urine albumin - to - creatinine ratio ( acr ) suggested by ada . the patients with t2 dm and normoalbuminuria ( acr < 3.5 mg / mmol ) were considered as controls for dn , while the patients with macroalbuminuria ( acr 35 mg / mmol ) and esrd who needed dialysis were included as the cases for dn . except for the patients with esrd , all other subjects were required to give urine under fasting conditions early in the morning . clinical characteristics of all malay subjects with ngt and t2 dm with and without dn are summarized in table 1 . informed consent was obtained from all subjects , and the study was approved by the local ethical committees . data and materials transfer agreement from the institute for medical research , malaysia to karolinska institutet , sweden was signed prior to the study . body weight and height were measured using a calibrated digital scale ( seca , birmingham , uk ) . the who / international association for the study of obesity ( iaso)/international obesity task force ( iotf ) has proposed bmi cut - off values of 23.024.9 kg / m for classification of overweight and of 25.0 kg / m for obesity for adult asians . based on the malaysian clinical practice guidelines , subjects with bmi value 23.0 kg / m are considered as overweight . systolic and diastolic blood pressures were measured using a digital sphygmomanometer ( omron healthcare , inc . , creatinine in serum and urine were measured using randox assayed multisera ( randox laboratories ltd . , urine or serum was mixed with sodium hydroxide in biochemistry analyzer ( selectra e ) . the amount of the complex formed was measured at wavelength of 490 to 510 nm . estimate of glomerular filtration rate ( gfr ) in the dialysis patient was calculated by the mean of renal urea and creatinine clearance from a 24-hour urine correction . a total of 25 ml venous blood samples were collected from each subject early in the morning after an overnight fasting and then stored at 80c . plasma ptx3 concentrations were determined using a commercial enzyme - linked immunosorbent assay kit ( quantakine dptx 30 ; r&d systems inc . , briefly , 20 l of standard and plasma samples was assayed duplicate in the microtiter plate wells coated with a specific ptx3 monoclonal antibody followed by incubation at room temperature for 2 hours . anti - ptx3 polyclonal antibody conjugated to alkaline phosphatase was added to each well and incubated for two hours at room temperature . after washing step , 200 l of substrate solution was added to each well followed by incubation for 30 minutes at room temperature . the solution of 2 n sulfuric acid was added to each well to stop the reaction . absorbance was measured at 450 nm with corrections set at 540 nm using microplate reader . the values of plasma ptx3 levels were extrapolated from a curve drawn using a standard ptx3 . all data were expressed as mean ( 95% ci ) for normally distributed variables and as geometric means ( 95% ci ) for nonnormally distributed variables . normal probability plots were created and parameter distributions were transformed to the common logarithm for obtaining a normal distribution before performing statistical analysis . the one - way analysis of variance ( anova ) was used for comparisons involving more than two groups or independent t - test for comparison between two groups . pearson and spearman analyses were conducted to determine correlations with continuous and noncontinuous variables , respectively . all analyses were performed using pasw statistic base 18 ( spssinc , chicago , usa ) . in both males and females , there was no difference in age , waist circumference , and hba1c between t2 dm patients and ngt subjects . although plasma ptx3 levels in males and females differed significantly , ptx3 had no relationship with age in males ( p = 0.647 ) or females ( p = 0.626 ) . thus , all subsequent analyses of plasma ptx3 levels were done separately in males and females . our analyses indicated that plasma ptx3 levels in t2 dm patients with and without dn were lower as compared with ngt subjects in males ( 2.62 versus 3.98 ng / ml ; p = 0.021 ) but not in females ( 3.24 versus 3.09 ng / ml ; p = 0.748 ) . figure 1(a ) showed that plasma ptx3 levels were consistently decreased from ngt to t2 dm without dn and to the patients with dn in males ( 3.98 , 2.78 , and 1.63 ng / ml ; p = 0.008 anova test ) . among males , the patients with dn had lower ptx3 levels compared to t2 dm without dn ( 1.63 versus 3.08 ng / ml ; p = 0.013 ) . in females , however , there was no statistically significant difference of the mean values of plasma ptx3 levels among ngt and t2 dm with and without dn ( 3.09 , 3.55 , and 2.11 ng / ml ; p = 0.262 , anova test ) ( figure 1(b ) ) . there was a negative correlation between plasma ptx3 levels and bmi in male subjects with ngt ( r = 0.390 ; p = 0.012 ) ( figure 2 ) but not in females ( p = 0.330 ) . the correlation between ptx3 and bmi was not found in all male and female t2 dm patients with and without dn . in malaysia , the adults with bmi value 23.0 kg / m are considered to be overweight . to further understand whether the association between ptx3 and dn in t2 dm was influenced by bmi , we performed the comparative analyses in the patients with overweight ( bmi 23 kg / m ) and lean patients ( bmi < 23 kg / m ) , respectively . in males with overweight , we found that plasma ptx3 levels were gradually decreased from subjects with ngt to t2 dm patients without dn and to the patients with dn ( 3.68 , 2.60 and 1.42 ng / ml ; p = 0.044 , anova test ) ( figure 3 ) . in lean males and also in all females , plasma ptx3 levels of ngt and t2 dm with and without dn were varied but not with any statistical significance . in the present study , we analyzed plasma ptx3 levels in malay subjects with ngt and t2 dm with and without dn . lower levels of ptx3 were found to be associated with t2 dm and dn in males but not in females . furthermore , ptx3 was found to be inversely associated with bmi in males with ngt . the correlation was not observed both in males and females with t2 dm and dn . males have a higher prevalence of t2 dm and dn in many populations including malaysians [ 1 , 35 ] . epidemiologic reports have demonstrated that dn is 30% more frequent in males than in females . genetic studies have also showed that dna polymorphisms in the genes of sex - determining region y - box 2 , angiotensin ii type 1 , and type 2 receptors are associated with dn with gender - specific effects [ 2628 ] . previously , yamasaki et al . observed that plasma ptx3 levels between males and females in a healthy japanese population are different . in the present study , we demonstrate that plasma ptx3 levels gradually decreased from ngt to t2 dm without dn to t2 dm with dn particularly among males but not in females . furthermore , an inverse correlation between ptx3 and bmi was found in male subjects with ngt . this correlation was not seen in all females and males with t2 dm and dn . taking together , data from previous and present studies implicate that ptx3 most likely has gender - specific effects in t2 dm and dn , which should be taken into our consideration in further investigations . several studies have reported that increased ptx3 levels are associated with impaired renal function in ckd [ 10 , 11 ] . the similar association of ptx3 with dn is seen in turkish patients with t2 dm . in the present study , however , we demonstrate that decreased ptx3 levels are associated with dn in malay men with t2 dm . dubin et al . have demonstrated that there are racial differences of ptx3 in term of association with kidney dysfunction . second , the ages of turkish t2 dm subjects with dn ( at 42 years old ) are younger and their duration of diabetes are shorter compared to malay t2 dm patients with dn ( at the age of 55 years old ) in the present study . furthermore , clinical observations have indicated that two main causes of ckd are diabetes and high blood pressure , which are responsible for up to two - thirds of the cases . the progresses and mechanisms of dn and ckd may be different , while ptx3 may have different effects in these two diseases . we have shown that plasma ptx3 levels were inversely correlated with bmi in males with ngt , which is consistent with previous reports [ 7 , 12 , 13 ] . in the present study , there is a limitation with lack of lean subjects because all patients with t2 dm and female subjects with ngt had mean values of bmi at least 27.2 kg / m . recently , a study has demonstrated that ptx3 is expressed in adipose tissue , and its tissue specific expression reflects endothelial dysfunction . although we did not analyze plasma levels of adiponectin in this malay cohort , the accumulated documents have shown that adiponectin is inversely proportional to obesity and t2 dm in different populations including malaysians . plasma / serum adiponectin levels in the patients with t2 dm and obese subjects are decreased compared to that in healthy control subjects [ 31 , 32 ] . therefore , we hypothesize that ptx3 , as similar to adiponectin , may have protective effects in increased body weight . further investigation is needed to fully understand the cellular mechanism of ptx3 reduction in t2 dm and dn . in conclusion , the present study provides the first evidence that decreased plasma ptx3 levels are associated with t2 dm and dn in malay men and also suggests that ptx3 may have different effects in dn and ckd .

recent reports have demonstrated that elevated plasma long pentraxin 3 ( ptx3 ) levels are associated with cardiovascular and chronic kidney diseases . in the current study , we investigated the plasma ptx3 levels in 296 malay subjects including the subjects with normal glucose tolerance ( ngt ) and type 2 diabetes ( t2 dm ) patients with or without dn by using an enzyme - linked immune - sorbent assay . results showed that in males , plasma ptx3 levels in t2 dm patients without dn were lower than that in the subjects with ngt ( 2.78 versus 3.98 ng / ml ; p = 0.021 ) . plasma ptx3 levels in t2 dm patients with dn were decreased compared to the patients without dn ( 1.63 versus 2.78 ng / ml ; p = 0.013 ) . in females , however , no significant alteration of plasma ptx3 levels among ngt subjects and t2 dm patients with and without dn was detected . furthermore , an inverse correlation between ptx3 and body mass index was found in male subjects with ngt ( p = 0.012 ; r = 0.390 ) , but not in male t2 dm patients , neither in all females . the current study provided the first evidence that decreased plasma ptx3 levels are associated with t2 dm and dn in malay men and also suggested that ptx3 may have different effects in dn and chronic kidney diseases .

focal segmental glomerulosclerosis ( fsgs ) is a pathological term to indicate glomerular lesion associated with various etiological factors . in native kidneys , , fsgs can be classified as recurrent disease or fsgs associated with chronic transplant glomerulopathy , calcineurin inhibitor ( cni ) toxicity and in long - standing grafts with hyperfiltration injury . the incidence of recurrent fsgs is approximately 30% and secondary disease occurs in 10 - 20% of the cases . the distinction between these various types is difficult because of lack of pretransplant diagnosis and overlapping morphological features . we analyzed 24 graft biopsies with fsgs and tried to etiologically classify them basing on the accompanying morphological features on the graft biopsies and clinical features . it is important to diagnose the condition adequately and promptly to protect the graft and inhibit the progression of the disease . out of 363 allograft biopsies received between january 2012 and december 2013 , 24 diagnosed as fsgs were included in the study . three routine stains were done in all biopsies , which included hematoxylin and eosin , periodic acid - schiff 's , and masson 's trichrome . immunofluorescence with immunoglobulin ( ig ) g , igm , iga , c3c and c1q was done . criteria to diagnose fsgs included segmental sclerosis , hyalinosis and or lipid deposition , focal or segmental collapse of the tuft with prominence of podocytes of variable degree depending on the histological type of lesion diagnosed . mean serum creatinine level was 2.7 mg / dl and mean 24 h urinary protein was 3.2 g. secondary fsgs was reported in 18 cases ( 75% ) . causes included chronic humoral rejection in seven cases ( 38% ) , cni ( cyclosporine and tacrolimus ) toxicity in six cases ( 33% ) , and in long - standing grafts with hypertensive nephron loss and hyperfiltration injury in five cases ( 29% ) . the type of donor , biochemical parameters and pretransplant diagnosis for various categories are given in table 1 . recurrent and new - onset primary diseases seven cases with chronic glomerular and tubulointerstitial changes with positive c4d were classified as chronic humoral rejection . glomerular changes included thickening and duplication of basement membrane , increase in mesangial matrix and cellularity , and focal segmental sclerosis [ figure 1 ] . c4d was given as positive when 10 - 50% of capillaries ( c4d2 ) or more than 50% of capillaries ( c4d3 ) showed linear circumferential staining . positive c4d and segmental lesion in chronic humoral rejection ( 200 ) chronic humoral rejection mean serum creatinine level was 2.7 mg / dl and 24 h urinary protein was 2.8 g. six lesions were classified as cni toxicity . histological features included striped fibrosis in interstitium and nodular hyaline arteriolar sclerosis ( ah2 and ah3 ) in vessels [ figure 2 ] . nodular hyaline arteriolar sclerosis ( periodic acid - schiff , 200 ) calcineurin inhibitor toxicity mean serum creatinine level was 2.1 mg / dl and mean 24 h urinary protein was 800 mg . hyperfiltration injury was diagnosed in five cases where hypertensive glomerular changes such as thickening and wrinkling of basement membrane , ischemic collapse of the tuft , and widening of bowman 's space and fsgs was seen . vessels showed marked subintimal fibrosis with > 50% narrowing of lumen and associated with chronic tubulointerstitial changes . mean serum creatinine level was 2.1 mg / dl and mean 24 h urinary protein was 300 mg . clinical and morphological details are given in table 4 . focal segmental glomerulosclerosis is a pathological term to indicate glomerular lesion associated with various clinical situations in renal allografts . fsgs is a common cause of end - stage disease and recurrence in grafts is approximately 30% . we classified fsgs in renal grafts as recurrent disease , new - onset primary fsgs in cases where the native diagnosis was not fsgs , and secondary fsgs when associated with drug toxicity , chronic rejection or hypertension , depending on the clinical features and in correlation with various morphological features that are associated with fsgs . this number does not indicate the exact incidence , as native biopsy diagnosis is not available in many cases . risk of recurrence includes young age of the patient , presence of mesangial proliferation , and rapid progression to end - stage disease and pretransplant bilateral nephrectomy . recurrence occurs in renal grafts in early post - transplant period . these patients present with heavy proteinuria usually of nephrotic range . this criterion and an available diagnosis of native disease are helpful in diagnosing recurrent disease . in our series , all the four cases had a biopsy diagnosis of fsgs . the type of fsgs in native kidney was available in three cases , and recurrence disease had a similar pattern to native disease . recurrence can be classified as recurrence of same variant ( 51% ) , recurrence of same variant preceded by minimal change disease ( 19% ) and recurrence with a different variant of fsgs ( 19% ) . graft survival is poor and progression to end - stage renal disease is rapid and is as high as 50% . it is therefore important to diagnose and differentiate this entity from other causes of fsgs . ( a ) collapsing glomerulopathy ( jones , 200 ) . ( b ) focal segmental glomerulosclerosis - not otherwise specified ( h and e , 200 ) chronic transplant glomerulopathy and chronic humoral rejection are other conditions in which fsgs can occur . the mechanism for this is chronic immunological glomerular endothelial and podocyte injury , which is resulting in fsgs . this particular lesion is relatively easy to diagnose as associated features of chronic graft damage are seen , and c4d is positive . these patients presented in late post - transplant period mostly after 3 years and presentation is due to the rise in creatinine and mild proteinuria . these lesions are purely based on pathology diagnosis as serum levels do not correlate with the extent of renal damage and clinical features are not specific . glomerular changes include glomerular hypertrophy , capillary collapse , focal segmental or focal global sclerosis . fsgs results from hyperfiltration injury due to loss of functioning nephrons rather than direct toxic effects on podocytes . presence of hyaline arteriopathy , stripped fibrosis , [ figure 4 ] tubular atrophy with or without isometric vacuolation , and absence of heavy proteinuria help to diagnose this particular entity . striped fibrosis ( masson 's trichrome , 100 ) the true incidence of glomerulonephritis in grafts is not exactly known and ranges from 4% to 20% . membranous nephropathy and fsgs are most common of the glomerulonephropathies that can be seen in grafts with an incidence of 1 - 9% . we diagnosed two cases of new - onset fsgs in patients presenting with nephrotic range proteinuria . histologically , there were no features of hypertension or cni toxicity and c4d was negative . new - onset fsgs has favorable clinical course when compared with recurrent disease and hence it is important to identify this lesion . in long - standing grafts with nephron loss and chronic tubulointerstitial changes we described this entity separately when arterial changes are predominant and tell - tale signs of cni toxicity are absent . an attempt was made to etiologically classify these lesions as there is a difference in treatment and prognosis . it is important to make a diagnosis carefully using clinical information and pathology when a decision about second transplant has to be made .

recurrence of fsgs in renal allo grafts is a major cause of graft loss . in this context , we tried to diagnose and classify fsgs in renal allografts . indications for biopsy included graft dysfunction and/or proteinuria . three hundred and sixty - three graft biopsies were studied over a period of 2 years . we classified fsgs into recurrent fsgs , new - onset primary fsgs and fsgs secondary to chronic humoral rejection , calcineurin inhibitor toxicity , and nephron loss and hyperfiltration injury . twenty - four cases were diagnosed as fsgs , constituting 6.6% . secondary fsgs was the most common fsgs in grafts in our study . incidence of recurrent fsgs may not be accurate as pretransplant biopsy is available in very few cases .

a 17-year - old girl presented with painless swelling of the right neck and supraclavicular lymph nodes accompanied with fever and fatigue in february 2007 . the pathology report after lymph node biopsy indicated that the normal lymph node structure had disappeared and scattered distributions of reed - sternberg ( rs ) cells and hodgkin disease ( hd ) cells occurred . immunohistochemical staining showed that these cells were positive for cd30 ( figure 1a ) , paired box protein 5 ( pax5 ) ( figure 1b ) , and epstein - barr virus ( ebv ) , and negative for cd15 and anaplastic lymphoma kinase ( alk ) . treatment with 4 cycles of abvd was conducted as induction chemotherapy followed by bilateral neck and supraclavicular radiation therapy ( 36 gy ) . the patient achieved complete remission ( cr ) but , after about 1 year , relapsed with inguinal and mediastinal lymph node involvement , as detected by positron emission tomography ( pet)/computed tomography ( ct ) scan . afterwards , 8 cycles of salvage chemotherapy with cyclophosphamide , vindesine , epirubicin , and prednisone ( chop ) were performed , and the patient achieved cr again . a pet / ct scan in april 2010 indicated relapse , with mediastinal , left axillary , retroperitoneal , pelvic cavity , and inguinal lymph node involvement and multiple nodules at the thoracolumbar vertebrae , right iliac crest , and right ischium . the patient was diagnosed with hl of nodular sclerosis subtype after a left inguinal lymph node biopsy . she then underwent 2 cycles of salvage chemotherapy with rituximab , cyclophosphamide , vindesine , epirubicin , prednisone , and etoposide ( r - chope ) and underwent asct in december 2010 . a pet / ct scan in june 2011 subsequently demonstrated relapse once more , with nodules in the liver , spleen , and lung ( figure 2a ) . consequently , 2 cycles of salvage chemotherapy with gemcitabine , dexamethasone and nedaplatin ( gdp ) were given , but the disease persisted at the end of therapy . on october 20th , 2011 , results of ct scan showed that the number and size of nodules in the lung significantly increased ( figure 2b ) . the patient exhibited persistent fever and systemic failure , and showed an eastern cancer oncology group ( ecog ) score of 3 . in october 2011 , the patient began brentuximab monotherapy , with a dose of 1.8 mg / kg , once every 3 weeks . following the first course of brentuximab , the patient 's body temperature dropped gradually after 4 days of treatment and returned to normal 1 week later . because of bone marrow involvement , white blood cell , hemoglobin , and platelet counts decreased markedly before treatment . however , the patient continued with brentuximab therapy without interruption under the support of granulocyte colony - stimulating factor ( g - csf ) , thrombopoietin ( tpo ) , and interleukin-11 ( il-11 ) . following the first course of brentuximab , ct scan showed that the lung nodules were significantly reduced in size and number ( figure 2c ) . after the second treatment , the patient began to recover from pancytopenia and regain physical strength , and her condition improved significantly . after the third course of treatment , the patient was capable of self - care , indicating an ecog score of 2 . pet / ct scan suggested partial remission ( pr ) . after the fourth course of treatment , anemia began to improve , with hemoglobin increasing from 60 to 100 g / l . after physical activity palpitations disappeared , the patient 's heart rate fell from 110130 to 7080 beats / min . shrinkage was noted in multiple nodular shadows in double lung fields ( figure 2d ) . after the sixth course of treatment , hemoglobin count had nearly returned to normal , and lesions in the lungs , liver , spleen , bones , mediastinum , and abdomen significantly decreased . a pet / ct scan showed that the lung nodules had disappeared , and the maximum standard uptake values ( suvmax ) of thoracolumbar vertebral nodules and liver and spleen nodules had decreased to normal ( figure 3 ) . the patient encountered reversible adverse reactions during treatment , including peripheral neuropathy , elevated aminotransferases , hair loss , and dry cough , and these adverse effects were controlled with symptomatic treatments . at the time this paper was submitted tissue specimens were collected after lymph node biopsy , sectioned , and stained to detect cd30 and pax5 . a , reed - sternberg ( rs ) cells show cd30-positive membrane ( white arrow ) . a , nodules before treatment with gemcitabine , dexamethasone , and nedaplatin ( gdp ) in june 2011 . c , in november 2011 , after the first course of brentuximab , significant shrinkage of lung nodules was noted . d , in february 2012 , after the fourth course of brentuximab , the nodules had nearly disappeared . we introduced brentuximab therapy to a patient with hl refractory to chemotherapy , radiotherapy , and asct . the patient 's most recent relapse involved several organs , including the liver , lungs , bones , bone marrow , and mediastinal and retroperitoneal lymph nodes . to the best of our knowledge , this is the first patient with hl in the mainland of china who underwent brentuximab treatment . brentuximab , a new targeted therapy for lymphoma , is an antibody - drug conjugate which consists of the anti - cd30 monoclonal antibody cac10 conjugated with the cytotoxic agent monomethyl auristatin e ( mmae ) . as a monoclonal antibody moreover , chemotherapeutic drugs can also be coupled to the monoclonal antibody to directly target tumor cells , resulting in more specific and effective anti - tumor action . this new drug has shown dramatic efficacy on a number of relapsed and refractory hl patients . our data showed that brentuximab 's efficacy on this refractory and relapsed case appeared quickly . further , after 6 courses of brentuximab , all lesions disappeared and cr was achieved . adverse effects including peripheral neuropathy , elevated aminotransferases , hair loss , and dry cough appeared but could be controlled with symptomatic treatments .

at present , approximately 20% of hodgkin lymphomas ( hl ) are relapsed and refractory , and therapeutic methods including chemotherapy , radiotherapy , and even stem cell transplantation are unsatisfactory . brentuximab vedotin , composed of cd30 antibody and a chemotherapeutic agent , is a new targeted drug that eradicates tumor cells by binding to the cd30 antigen on their surface . in clinical trials , the response rate and complete remission rate of this drug were 73% and 40% , respectively , for relapsed and refractory hl . here we report a case of cd30-positive relapsed and refractory hl that was treated with brentuximab . before the treatment with brentuximab , the patient underwent chemotherapy , radiotherapy , and autologous stem cell transplantation . however , the disease continued to progress , affecting multiple organs and prompting symptoms such as persistent fever . after the treatment with brentuximab , the patient 's condition improved . body temperature returned to normal after 4 days . lung nodules were reduced in size and number after a single course of treatment , and pet / ct showed partial remission and complete remission after 3 and 6 courses of treatment , respectively . the entire treatment process progressed smoothly , though the patient experienced some symptoms due to chemotherapy , including peripheral neuritis of the limbs , irritating dry cough , and mild increase in aminotransferase . no serious adverse effects were observed . the current general condition of the patient is good ; the continuous complete remission has amounted to 6 months .

activation of mast cell degranulation has been demonstrated to be an important mediator of allergic disease and more recently , as an initiator or contributor to autoimmune disease [ 1 - 4 ] . mast cells are granulocytes that emanate from myeloid progenitors in bone marrow and play a critical role in innate immunity as vital sentinel cells that combat invading microorganisms at tissue / environment interfaces [ 1 - 4 ] . mast cells are phagocytic and can directly destroy pathogens ; they also release inflammatory mediators which promote inflammation by recruiting and activating other leukocytes . as regulators of adaptive immunity , mast cells promote antigen presentation , naive t cell differentiation into helper t cells , and induction of acquired immunity towards parasites via ige / fcr binding [ 1 - 4 ] . the major contribution of mast cells to both immune function and dysfunction results from the release of a plethora of inflammatory mediators through a process known as regulated exocytosis [ 1 - 5 ] . this process occurs in many cell types and involves the storage of intracellular pools of inflammatory mediators , hormones or neurotransmitters in pre - formed granules / vesicles . upon activation of the cell , fusion can be activated through receptor stimulation or by membrane depolarization via 2 messengers , for example ca . the transport , fusion and release of vesicle contents through exocytosis is mediated by a family of proteins known as the snares [ 7 - 11 ] . soluble n - ethylmaleimide - sensitive factor attachment protein receptors have been demonstrated to play a pivotal role in regulated exocytosis ( degranulation ) in mast cells [ 12 - 22 ] and represent a mechanical step involved in inflammatory mediators release that can be targeted for the design and development of therapeutics . we review the expression , localization and operation of various functional snare complexes in both murine and human mast cells . we evaluate the published functional data that has been used to implicate specific snares and snare complexes as indispensable mediators of mast cell degranulation . vesicular trafficking of essential molecules between cellular compartments and into and out of cells is required for cell function and survival . in neurons , neurotransmitter release is widely acknowledged as critical for the development and function of the nervous system in all higher organisms . the snare family of proteins mediates the highly regulated processes of vesicular assembly and disassembly [ 6 , 810 ] . numerous proteins are involved in the formation and disassembly of active snare complexes during membrane fusion . each set of snare proteins act as a vesicle loading signal , a mechanical address ( delivering the vesicle to the correct target membrane ) , and in the mechanical process of fusing two opposing membranes . the neuronal and immunological snare proteins have a another layer of complexity added to this paradigm , the vesicles are loaded with cargo , but dock and await a chemical fusion signal . the snare family of evolutionarily conserved proteins was first identified in the 1980s in yeast and a decade later in mammalian cells . snares are found in most eukaryotic cells ; 25 members have been identified in saccharomyces cerevisiae , 54 members in arabidopsis thaliana and > 36 members in humans . the proteins are composed of a simple domain structure highlighted by a snare motif , a stretch of 6070 amino acids arranged in a heptad repeat [ 6 - 11 ] . core complexes form stable structures , which are composed of four intertwined parallel -helices contributed by three to four different snare members [ 6 - 11 ] . these complexes consist of a central core of three glutamine residues and one arginine residue bordered by hydrophobic stacked layers of side chains . soluble n - ethylmaleimide sensitive factor attachment protein receptors can be classified on the basis of whether they contain a q or r residue in their motif and are referred to as either a qa , qb , qc , qbc , or r - snares based on the position of their contributing motif in the assembled snare complex . the vesicle - associated membrane protein ( vamp ) family of snares are examples of the r - snare sub - type and are characterized by a single transmembrane domain , a snare motif and a n - terminal domain containing profilin - like folds [ 8 , 10 ] . the syntaxin family of snares is an example of the qa or qc sub - type and are characterized by a single transmembrane domain , a snare motif and a n - terminal domain made up of anti - parallel three - helix bundles [ 8 , 10 ] . the synaptosome - associated protein ( snap ) family of snares is an example of the qbc subtype and contain two snare motifs joined by a flexible linker and that is palmitoylated and therefore lacks a transmembrane domain [ 8 , 10 ] . the snap family is unique in that they contribute two snare motifs to the snare complex . soluble n - ethylmaleimide - sensitive factor attachment protein receptors were previously classified based on whether they localized to the vesicle membrane ( v - snares ; e.g. vamps ) or to the target plasma membrane ( t - snares ; e.g. syntaxins and the snap families ) but these classifications have subsequently been shown to have a number of exceptions . soluble n - ethylmaleimide - sensitive factor attachment protein receptors localized on opposing membranes [ vesicle : vesicle or vesicle : plasma membrane ] drive fusion of membranes using the free energy released during the formation of the stable four - helix bundle . post - fusion snare proteins end up on the interior surface of the target membrane . these bundles are recycled via dissociation mediated by n - ethylmaleimide - sensitive factor ( nsf ) and other co - factors such as snap ( soluble nsf attachment protein ) . mechanical models [ 6 - 11 ] all predict that snares function to bring opposing membranes into close proximity initiating fusion events . the presence of ca is indispensable , acting to bridge the opposing membranes , which leads to the exclusion of water allowing lipid mixing , fusion and subsequent exocytosis . ca - regulated snare complexes are involved in neurotransmitter release [ 8 , 23 ] . the neuronal snare complex was the first snare complex identified and the most vigorously dissected . docked vesicles containing snare complexes composed of syntaxin 1a and snap-25 on the plasma membrane and vamp-2 on the vesicular membrane allow for the rapid ( millisecond ) release of neurotransmitters upon ca influx . free , uncomplexed membrane snares form cis - snare acceptor complexes on the plasma membrane in response to the actions of regulatory proteins . these acceptor complexes on the plasma membranes interact with snares on opposing vesicular membranes and form trans - snare complexes that are fusion ready. these docked vesicles persist for a substantial period of time until ca influx triggers the final step of fusion and cargo ( neurotransmitter ) release through the actions of ca sensors such as synaptotagmin and complexins . various investigators have reported the expression of multiple snares in murine and human mast cells [ 12 , 13 , 15 , 17 , 1922 , 2431 ] . composite rt - pcr data identifying snare mrna in murine and human mast cells are presented in table 1 . the neuronal snare snap-25 showed weak mrna expression in human mast cells , but was not detected via western blot in the same study . multiple studies report the expression of several vamp family representatives mrna [ vamp-1 , 2 , 3 , 7 , 8 ( r snares ) ] and several members of the syntaxin family [ syntaxin 1 , 2 , 3 , 4 ( qa snares ) ] as well . snare family mrna expression in murine and human mast cells immunoblotting studies confirm that snap-23 is the consensus representative of the qb , c family in both murine and human mast cells ( see composite of protein expression data presented in table 2 ) . interestingly , two groups have reported the expression of the neuronal snap-25 qb , c snare protein in primary murine mast cells via immunoblot and immunohistochemistry [ 25 , 27 ] . these data could not be recapitulated in published work by several groups in primary murine mast cells [ 12 , 22 ] and the rat cell line rbl-2h3 [ 13 , 22 , 24 ] . the reason[s ] behind this discrepancy is not clear , but may involve specificity of antibodies and/or limits of detection of signal . protein expression of vamp and syntaxin family members correlate well with mrna studies , as the majority of snares detected via rt - pcr were also detected via immunoblot . snare family protein expression ( via immunoblotting ) in murine and human mast cells immunohistochemistry studies in primary murine mast cells [ 12 , 18 , 21 ] have demonstrated that snap-23 and syntaxin 4 localize to the plasma membrane , while syntaxin 3 , vamp-2 and vamp-8 appear to localize to secretory granules . detected snap-25 expression in the secretory granules of rat primary mast cells ( rpmc ) . similar immunohistochemistry results in rbl-2h3 cells [ 13 , 14 , 24 , 29 , 31 ] have been reported demonstrating plasma membrane localization of snap-23 , syntaxin 4 and syntaxin 3 ; and secretory granule localization of syntaxin 3 , vamp-2 , 3 , 7 and 8 . in human mast cells , sander et al . demonstrated that snap-23 and syntaxin 4 localize in the plasma membrane while vamp-3 , vamp-7 and vamp-8 are dispersed throughout the cytoplasm , suggesting granule localization . however , upon activation of the mast cell , only vamp-7 and vamp-8 appear to redistribute to the periphery of the cell , suggesting fusion and degranulation . immunoprecipitation ( ip ) pull - down studies in primary murine mast cells , rbl-2h3 cells , and human mast cells have identified snare complexes composed of snap-23 and syntaxin 4 in complex with the r - snares , vamp-2 [ 13 , 18 , 28 , 29 ] , vamp-8 [ 13 , 15 , 17 , 18 , 22 ] ; vamp-7 and vamp-3 . in addition , complexes composed of snap-23 , syntaxin 3 and vamp-8 also co - precipitated . . demonstrated that ip with anti - snap-23 antibody in rbl-2h3 cells pulled down syntaxin 2 , 3 , 4 and vamp-2 , 3 , 8 . interestingly , n - ethylmaleimide ( nem ) treatment was required to observe vamp-8 co - precipitation . it was also demonstrated that ip with anti - syntaxin 4 resulted in the co - precipitation of snap-23 , vamp-2 , vamp-3 and vamp-8 , while ip with anti - syntaxin 2 or syntaxin 3 only pulled down snap-23 . these data suggest that ternary complexes in rbl-2h3 cells consist of snap-23 , syntaxin 4 and a member of the r - snares family , presumably vamp-2 , 3 or 8 . showed that in rbl-2h3 cell lysates ; syntaxin 4 co - precipitated with snap-23 and vamp-8 within and outside of lipid rafts ; however , syntaxin 3 , snap-23 and vamp-8 co - precipitates were found to be complexed only within lipid rafts . the implication of these two different complexes and their unequal distribution in the membrane remains unclear . additional studies by hepp et al . demonstrated co - precipitated complexes of snap-23 , vamp-2 and syntaxin 4 in rbl-2h3 cells and also showed that most of the snap-23 associated with vamp-2 and syntaxin 4 in these complexes is phosphorylated . an elegant study by puri et al . demonstrated that snap-23 , syntaxin 4 , vamp-2 complexes are present in lipid rafts and showed that snap-23 functions to recruit non - lipid raft - associated syntaxin 4 into a functional complex . once again it was demonstrated that a predominant proportion of the snap-23 in complexes was phosphorylated , implicating snap-23 phosphorylation as a key prerequisite to complex formation . our group has demonstrated that in rbl-2h3 cells , snap-23 co - precipitates with syntaxin 4 and vamp-8 ; however , nem treatment was needed to observe vamp-8 association . in human mast cells isolated from surgical tissues , sander et al . demonstrated that snap-23 co - precipitated with syntaxin 4 , vamp-7 and vamp-8 , but not vamp-2 and vamp-3 . in derived mast cells , vamp-8 was shown to associate preferentially with syntaxin 4 and snap-23 , and to a lesser degree , vamp-2 . however , it appears that vamp-2 and vamp-3 may act to substitute for vamp-8 in vamp-8-deficient cells , perhaps due to an unusual compensatory mechanism . isolation of ternary complexes of snare proteins after cellular activation has proven anything but trivial . previous data have demonstrated that only 5% of the snap-23 present in rbl-2h3 cells is actually capable of forming a complex after activation . furthermore , it is suggested that snare complexes have limited lifespans after activation - induced formation [ 35 , 36 ] . using recombinant snare proteins , foster et al . demonstrated the in vitro association of the recombinant snares , snap-23 , vamp-2 and syntaxin 4 and further demonstrated that deletion of the amino terminus and the second coiled - coil domain of snap-23 inhibited binding to both vamp-2 and syntaxin 4 . although immunolocalization and ip studies identify the individual snare proteins and their complexes associated with mast cell function , functional studies aimed at disrupting snare complex formation / action provide a practical method to dissect the role of these complexes in mast cell degranulation . snare proteins also function to mediate constitutive trafficking events through both endocytic and secretory pathways ; reviewed in hong et al . previously published functional data have implicated the snares snap-23 , syntaxin 4 , vamp-2 , vamp-3 , vamp-7 and vamp-8 in mast cell degranulation in studies using streptolysin - o - permeabilized cells and inhibitory recombinant snare proteins , snare neutralizing antibodies [ 12 , 17 , 19 ] ; overexpression studies [ 13 , 14 , 22 , 29 , 38 ] , rna interference methods [ 20 , 22 , 39 ] and snare - deficient mice [ 18 , 21 ] . a compilation of functional data implicating the various snare proteins is presented in table 3 . functional data implicating snare proteins in mast cell degranulation the most compelling evidence for the role of snare proteins in mast cell degranulation is presented in data describing vamp-8-deficient mice [ 18 , 21 ] . . demonstrated that mast cells derived from the bone marrow of these mice [ bmmc ] had a 50% decrease in their ability to release -hexosaminidase and serotonin but had normal histamine and tnf- release . tiwari et al . showed that bmmc from vamp-8-deficient mice resulted in a 50% decrease in -hexosaminidase and histamine , but no changes in cytokine / chemokine release . our group has shown via sirna that we could demonstrate about a 50% knockdown in rbl-2h3 degranulation after targeting vamp-8 mrna / protein . interestingly , puri et al . also showed that vamp-2 and vamp-3 do not play a role in mast cell degranulation as bmmc derived from vamp-3-deficient animals and mast cells derived from vamp-2-deficient stem cells showed normal degranulation . these data are confirmed by studies with tetanus toxins [ 17 , 40 ] , which are known to cleave and inactivate vamp-2 but do not have any effect on mast cell degranulation . supporting evidence for the role of vamp-8 in mast cell degranulation comes from sander et al . , who demonstrated that neutralizing anti - vamp-8 antibodies inhibit degranulation in streptolysin - permeabilized human mast cells by 60% . data from this report also demonstrated a role for vamp-7 ( 50% inhibition ) but not vamp-2 and vamp-3 . similarly , lippert et al . demonstrated that recombinant vamp-8 inhibited ca-/gtps - mediated degranulation in permeabilized rbl-2h3 cells by 30% . our group 's sirna studies also implicate snap-23 and syntaxin 4 as essential for rbl-2h3 degranulation , as knockdown of these snares resulted in 30% inhibition of degranulation when compared to control sirna treatment . in support of our data , salinas et al . demonstrated that in permeabilized rpmc , neutralizing antibodies to snap-23 and syntaxin 4 resulted in 25% and 65% inhibition of histamine release . in addition , sander et al . demonstrated that neutralizing antibodies to snap-23 and syntaxin 4 inhibited histamine release from permeabilized human mast cells with inhibition reaching 90% and 40% , respectively . earlier studies by guo et al . demonstrated that anti - snap-23 neutralizing antibody decreased rpmc degranulation , although this inhibition required high antibody concentrations ( 500 g / ml ) . recently , suzuki et al . demonstrated that a shrna to snap-23 knocked down degranulation in stimulated rbl-2h3 cells by 30% , similar to the maximal inhibition we have observed for snap-23 . in addition , liu et al . demonstrated that treatment of rbl-2h3 cells with syntaxin 4 sirna resulted in a decrease in antigen - induced histamine and -hexosaminidase release . interestingly , various groups [ 13 , 14 , 29 , 37 ] have implicated syntaxin 4 , vamp-7 and snap-23 in mast cell degranulation via overexpression studies . overexpression of syntaxin 4 , vamp-7 and snap-23 all had an effect on degranulation in rbl-2h3 cells , although the effects were manifested as either an augmentation or inhibition of degranulation . the exact mechanism leading to augmentation or inhibition has yet to be elucidated but may involve competition for free snare proteins or competition for regulatory proteins . because many of the snare - deficient transgenic mice are embryonic lethal ( table 4 ) , sirna methods may represent the only efficient way to characterize degranulation pathways in both in vitro and in vivo models of anaphylaxis and autoimmune disease . mast cell phenotype of snare knockout animals / cells these reports provide evidence that these snares do not participate in the mast cell degranulation process . there are a number of studies published recently that utilize sirna to validate the role of individual snares or snare complexes mediating trafficking events in various cell types [ 46 - 54 ] . however , an interesting report published recently eloquently suggests that the abundance of snare - member isoforms and therefore the overall increase in snare redundancy may play a major role in the lack of snare sirna cellular efficacy . in addition , the authors describe the phenomenon that many cell types appear to express a sizeable reserve of snare proteins not required for normal physiological cellular processes ( a so - called snare reserve ) . interestingly , the literature is scant with respect to sirna studies characterizing snare - protein function in mast cells . in addition , as snares are intracellular targets , the use of biotherapeutics such as recombinant proteins or neutralizing antibodies is not possible as these large proteins can not as of yet be targeted to the inside of the cell . therefore , interfering rna offers an exciting new approach for the development of a snare - directed therapy . to date , several sirna - based therapies have initiated clinical trials for the treatment of viral diseases , cancer and macular degeneration . in addition , our sirna data identifies snap-23 and syntaxin 4 as essential for rbl-2h3 degranulation , and knockdown of these snares resulted in 30% inhibition of degranulation when compared to control sirna treatment . these studies reflect the effect that a snare sirna therapeutic could have as we utilized whole cells stimulated with physiologic stimuli . however , additional studies focused on in vivo delivery of these sirna and testing in animal models of disease are warranted . sec1/munc18 ( sm ) proteins are arch - shaped cytosolic proteins that have been demonstrated to bind syntaxins and regulate intracellular trafficking [ 57 , 58 ] . specifically , munc182 has been demonstrated to play a role in mast cell degranulation [ 15 , 26 , 31 ] . sm proteins appear to regulate snare activity in several ways [ 57 - 60 ] . they can bind non - complexed syntaxins and act as negative regulators of snare assembly and interestingly , can also bind to trans - complexes and promote fusion . members of the munc13 family of accessory proteins also have been demonstrated to act as positive regulators of mast cell degranulation . complexins are cytosolic snare regulatory proteins that bind snare complexes and lock the snare machinery into a primed state awaiting a final trigger of fusion events [ 57 , 60 ] . specifically , complexin ii has been demonstrated to function as a positive regulator of mast cell degranulation as sirna to complexin ii attenuates ige - induced degranulation . synaptotagmins are type i membrane calcium binding proteins that facilitate the formation of the snare calcium phospholipid complex that triggers final fusion and release of mediators from the cell [ 57 , 60 ] . in mast cells , the rab family of gtpases has been implicated in the control of degranulation in mast cells . secretory carrier membrane proteins ( scamps ) are accessory proteins that play a role in the regulation of mast cell degranulation . scamp-1 and scamp-2 are postulated to function at the later stages of membrane fusion , in concert with phospholipase d , to form functional fusion pores . finally , as previously mentioned vide supra , snare disassembly is mediated by the proteins snap and the atpase nsf [ 60 , 64 ] . snap functions to capture the snare complex and allow the binding of nsf and the subsequent disassembly of the snare complex . the important qb , c and qa snares on the plasma membrane unequivocally appear to be snap-23 and syntaxin 4 , while the most likely r - snare partners on the vesicle membranes appear to be both vamp-7 and vamp-8 ( fig . 1 ) . functionally , there is growing evidence that ternary complexes of the above snares are critically involved in the mast cell degranulation process . disruption of these complex 's formation or interactions with regulators may offer a window for therapeutic intervention and the development of novel small molecules for the treatment of allergic and autoimmune disease . model of the mast cell snare complex mediating degranulation based on functional findings [ 1214 , 1622 , 29 , 3738 ] . ( a ) snap-23 and syntaxin 4 represent the consensus plasma membrane snares involved in mast cell degranulation . under normal physiological conditions , vamp-7 and/or vamp-8 represent the secretory granule ( vesicle ) snare that interacts with snap-23 and syntaxin 4 to form a functional ternary complex . ( b ) in the absence of vamp-8 , it appears that a compensatory mechanism may allow vamp-2 and/or vamp-3 to associate with snap-23 and syntaxin 4 to mediate ternary complex formation and possible function .

mast cell function and dysregulation is important in the development and progression of allergic and autoimmune disease . identifying novel proteins involved in mast cell function and disease progression is the first step in the design of new therapeutic strategies . soluble n - ethylmaleimide - sensitive factor attachment protein receptors ( snares ) are a family of proteins demonstrated to mediate the transport and fusion of secretory vesicles to the membrane in mast cells , leading to the subsequent release of the vesicle cargo through an exocytotic mechanism . the functional role[s ] of specific snare family member complexes in mast cell degranulation has not been fully elucidated . here , we review recent and historical data on the expression , formation and localization of various snare proteins and their complexes in murine and human mast cells . we summarize the functional data identifying the key snare family members that appear to participate in mast cell degranulation . furthermore , we discuss the utilization of rna interference ( rnai ) methods to validate snare function and the use of sirna as a therapeutic approach to the treatment of inflammatory disease . these studies provide an overview of the specific snare proteins and complexes that serve as novel targets for the development of new therapies to treat allergic and autoimmune disease .

colorectal adenocarcinoma ( crc ) is one of the most common cancers worldwide and the third leading cause of death in the united states . crc can be histologically subtyped into adenocarcinoma ( ac ) , which accounts for the large majority of cases ; mucinous ac ; signet - ring cell carcinoma ( srcc ) , and other even less frequent subtypes . primary srcc of the colon is a rare entity , accounting for less than 1% of all crc . srcc is associated with a higher - grade tumor associated with young age , female patients , and distinct molecular patterns , such as microsatellite instability ( msi ) and activating mutations of the braf gene compared to mucinous ac . however , since clinical symptoms tend to occur late in the course of srcc , most cases are usually detected at an advanced stage with a poor overall survival rate . primary srcc at an early stage is rare , and only 27 cases have been reported . we report a case of a 36-year - old female who presented with progressive right lower quadrant pain and was diagnosed with primary srcc of the cecum . the patient responded well without any adverse reactions to an adjuvant fluropyrimidine ( 5-fu)-based therapy with oral capecitabine . a 36-year - old female presented to her primary care physician with progressive right lower quadrant abdominal pain without any significant past medical and family history . computed tomography ( ct ) scan of the abdomen and pelvis with contrast showed a 4.9 3.5 3.1 cm , lobulated , septated cystic mass arising from the cecum . the mass demonstrated wall enhancement with multiple coarse calcifications and ascites inferior to the mass ( fig . the specimen revealed organ - confined disease with final pathological staging iia ( pt3 , pn0 , pmx ) . high - grade mucinous carcinoma with signet - ring cells invaded the muscularis propria into the subserosal adipose tissue ( fig . the cells clustered into various sizes of clusters and gland - like structures at 40 magnification . at 400 magnification , the moderately differentiated malignant cells formed classical columnar strips ( fig . 3 ) . at 600 magnification , the cells floated within the abundant extracellular mucin pools as either clusters or isolated single cells ( fig . 4 ) . molecular study specific for msi showed the preserved protein expression of mlh1 , pms2 , msh2 and msh6 . carcinoembryonic antigen was within the normal limit ( < 0.3 ng / ml ) . due to the patient 's young age , early - stage disease , and aggressive high - grade mucinous carcinoma with microsatellite stability , an adjuvant 5-fu - based therapy with oral capecitabine the patient has completed 4 of the planned 8 cycles and has tolerated and responded to the therapy without any significant hematological or nonhematological toxicities . based on several reports including a large population - based study of 197,757 crc patients , srcc is a distinct entity based both on clinical presentation and pathology . srcc occurs in the younger population with female predominance , usually less than 40 years of age . more than 96% of cases of srcc arise in the stomach with the rest occurring in the colon , rectum , gallbladder , pancreas , urinary bladder , and breast . srcc usually presents at an advanced stage with node - positive disease and metastatic spread , which results in poor prognosis . a unique feature of srcc is its fibrotic appearance and preference for peritoneal metastasis over the liver . pathologically , srcc demonstrates unique features that distinguish the cells from routine ac of the colon and confer aggressiveness to these cells . the signet - ring , malignant cells are seen floating in abundant extracellular mucin pools either as clusters or isolated cells . these cells have a slightly lower prevalence of kras mutation but a higher braf mutation rate as compared to classical ac , and the prognostic implication is unknown . loss of e - cadherin expression has been reported and contributes to the high - grade and invasive nature of srcc as the cells acquire stem cell - like characteristics . there is some evidence that srcc patients with stage ii disease do not benefit from adjuvant therapy , whereas stage iii patients with high msi benefited from single - agent 5-fu adjuvant therapy . the overall prognosis of srcc in general is similar to other cancers in that staging and grade are important determinants . the available literature suggests that the tumor staging is the best predictive factor for the prognosis of srcc of the colon where higher tumor staging means poorer prognosis . the 5-year survival rate in srcc of the colon ranges from 0 to 12% , and disease recurrence is more frequent in srcc of the colon compared to ac . absence of lymphovascular invasion , lack of lymph node metastasis , and lower tnm stage had a favorable effect on the survival of srcc patients . patients with srcc can definitely benefit from closer follow - up or even intensified adjuvant therapy due to their high rates of local and distant recurrence . in a study by hugen et al . , adjuvant chemotherapy for srcc stage iii of the colon was associated with improved survival . other than presenting with abdominal pain and being microsatellite stable , her srcc occurred in the cecum and had invaded the subserosal fat . instead of having a fibrotic appearance , her cancer is more cystic in appearance than the generally reported srcc . due to early disease of stage iia and microsatellite stability in our patient , an adjuvant 5-fu - based therapy with oral capecitabine primary srcc is considered a distinct entity based on the clinical and pathological features . in this case report , we have shown a rare case of primary srcc of the cecum . given the poor prognosis of these patients , early disease of stage ii in microsatellite - stable patients should be considered for adjuvant 5-fu - based therapy in an attempt to prevent recurrence .

backgroundcolorectal adenocarcinoma ( crc ) is the third leading cause of death in the united states . one of the histologic subtypes of crc is signet - ring cell carcinoma ( srcc ) , which has a distinct molecular and tumor biology from that of adenocarcinoma . primary srcc diagnosed at an early stage is very rare as most cases are detected at an advanced stage . therefore , overall prognosis of srcc is poor.case presentationa 36-year - old female presented to her primary care physician with new - onset progressive right lower quadrant pain without any significant past medical or family history . computed tomography scan of the abdomen and pelvis with contrast showed a 4.9 3.5 3.1 cm , lobulated , septated cystic mass arising from the cecum . the mass demonstrated wall enhancement and contained focal areas of coarse calcification . there was nodal involvement either locally or distally . the patient underwent right hemicolectomy , and pathology revealed a high - grade mucinous carcinoma with signet - ring cell variant invading through the muscularis propria and into the subserosal adipose tissue . the margins were negative for tumor , and no lymphovascular or perineural invasion was noted . none of the 14 resected pericolonic lymph nodes was positive for malignancy . hence , she was staged as pt3 , pn0 , pmx - stage iia . the appendix was not involved . microsatellite instability testing showed the preservation of mlh1 , pms2 , msh2 and msh6 proteins by ihc and pcr . carcinoembryonic antigen level was within normal limits . due to the patient 's young age , aggressive histology and microsatellite - stable status , adjuvant fluropyrimidine ( 5-fu)-based therapy with the single agent capecitabine was initiated . the patient completed 6 months of adjuvant therapy and has been disease free for approximately 18 months.conclusionprimary srcc of the cecum is a rare disease . given the poor prognosis of these patients , early - stage disease with microsatellite - stable patients should be considered for adjuvant 5-fu - based therapy in an attempt to prevent recurrence .

despite a considerable progress in malaria control in iran over the past few years that led to significant reduction of cases , the disease still remains a major health problem in south and southeastern parts of the country . 2008 , afsharpad et al . 2012 ) and insecticide resistance of anopheles vectors ( enayati et al . 2012 ) are aggravated by continuous influx of imported cases , mostly with plasmodium falciparum , from neighboring countries of afghanistan and pakistan ( zakeri et al . the latest checklists of iranian mosquitoes include 28 anopheles species , identified mostly on the basis of morphological features , and a few by dna - based approaches ( azari - hamidian 2007 ) . maculipennis are known to be responsible for transmission of malaria in the country ( manouchehri et al . some important malaria vectors in iran are assumed to be members of species complexes or species groups , which are often difficult to distinguish morphologically . application of dna - based approaches has resolved some cryptic species in iranian complex species including an . fluviatilis , however , the identity of some members are still doubtful or were refuted later ( azari - hamidian 2007 , naddaf et al . this , to great extent , is due to introduction of molecular markers such as its2 and 28s - d3 genes for discriminating the members of this complex species in india ( manonmani et al . biology , variation in behaviors , and role of this species in malaria transmission in different geographical areas of iran has been extensively reviewed by others ( eshghi et al . 1976 , edalat 19971998 , hanafi - bojd et al . 2012 ) . in an early study comparison of its2 sequence of iranian specimens from various localities in south and southeastern iran revealed only species y , which is presumably species t ( naddaf et al . 2003 ) , however , rapd - pcr analysis of same specimens revealed two distinct patterns , separating representatives of fars province from other areas ( naddaf et al . analysis of 28s - d3 gene from same populations corroborated rapd results , fars province specimens showed to be identical to species u in india , while individuals from other areas exhibited heterozygocity at the only base pair position that identifies species u and t ( naddaf et al . 2010 ) . in addition , in a separate study based on 28s - d3 analysis , species t and species u were reported from jiroft of fars province and chabahar of sistan va baluchestan province , respectively ( mehravaran et al . 2011 ) . the aim of this study was to evaluate cytochrome oxidase i ( coi ) gene alongside 28s - d3 as a diagnostic tool for identification of an . coi gene sequences have been extensively used for population studies and resolving evolutionary relationship among closely related species groups of insects ( lunt et al . 1996 ) and anopheline mosquitoes ( krzywinski and besansky 2003 ) . variations in this fragment have been exploited as dna barcodes for identifications of culicidae mosquitoes including an . fluviatilis mosquitoes originated from different localities in south and southeastern areas of iran including fars , hormozgan , kerman , and sistan va baluchestan provinces . the extraction method and identity of some mosquitoes based on its2 and/or 28-d3 genes were described previously ( naddaf et al . all the dna samples were initially subjected to allele specific ( as)-pcr based on 28s - d3 gene as described by singh et al . the coi gene was amplified using universal primers , ubc6 ( 5- gga gga ttt gga aat tga tta gtt cc -3 ) and ubc9 ( 5-ccc ggt aaa att aaa ata taa act tc-3 ) , designed by simon et al . each 25l reaction contained 20 pmol of each primer , 2 mm mg cl2 , 10 mm tris - hcl , 50 mm kcl , 150m of dntps , 1u of taq , and 2l of dna . pcr products were purified using a gel band purification kit ( pharmacia , piscataway , nj , usa ) according to manufacturer s recommendations and later sequenced using the same primers as used for amplification at seqlab laboratory in germany . the sequences were manually edited and corrected using bioedit software , version 7.1.3.0 ( hall 1999 ) and fragments of 474 bp length were selected for analysis . the distances between groups and between individual sequences were calculated , and phylogenetic tree for iranian sequences was generated using the kimura two parameter ( k2p ) model of neighbor - joining method in a complete deletion procedure using mega 4 software ( tamura et al . the sequence data for the coi gene sequences were submitted to genbank with the accession numbers jx020706-jx020729 . fluviatilis mosquitoes originated from different localities in south and southeastern areas of iran including fars , hormozgan , kerman , and sistan va baluchestan provinces . the extraction method and identity of some mosquitoes based on its2 and/or 28-d3 genes were described previously ( naddaf et al . all the dna samples were initially subjected to allele specific ( as)-pcr based on 28s - d3 gene as described by singh et al . the coi gene was amplified using universal primers , ubc6 ( 5- gga gga ttt gga aat tga tta gtt cc -3 ) and ubc9 ( 5-ccc ggt aaa att aaa ata taa act tc-3 ) , designed by simon et al . ( each 25l reaction contained 20 pmol of each primer , 2 mm mg cl2 , 10 mm tris - hcl , 50 mm kcl , 150m of dntps , 1u of taq , and 2l of dna . pcr products were purified using a gel band purification kit ( pharmacia , piscataway , nj , usa ) according to manufacturer s recommendations and later sequenced using the same primers as used for amplification at seqlab laboratory in germany . the sequences were manually edited and corrected using bioedit software , version 7.1.3.0 ( hall 1999 ) and fragments of 474 bp length were selected for analysis . the distances between groups and between individual sequences were calculated , and phylogenetic tree for iranian sequences was generated using the kimura two parameter ( k2p ) model of neighbor - joining method in a complete deletion procedure using mega 4 software ( tamura et al . the sequence data for the coi gene sequences were submitted to genbank with the accession numbers jx020706-jx020729 . all the dna specimens from fars province yield only a product of approximately 375 bp length indicative of species u , whereas specimens from hormozgan , kerman and sistan va baluchestan provinces amplified two bands of 375 bp and 128 bp length . phylogenetic analysis using coi gene grouped individuals from fars province in two distinct clades separate from other iranian individuals representing populations of hormozgan , kerman , and sistan va baluchestan ( fig . the mean distance between iranian and indian groups was 1.66% , while the value between fars group and the group comprising other iranian members was 2.06% . the indian group exhibited the same distance ( 2.06% ) with fars group . the highest distance ( 3.09% ) among iranian individuals was between specimens 930 from fars province and 398 from sistan va baluchestan province . six individuals belonging to two clades ( 87 , 97 , 655 , and 928 ) and ( 92 ) from fars province showed 100% identity . in addition , ten individuals from other geographical areas including four from koveh ( 170 , 172 , 173 , and 186 ) and one from minab ( 121 ) in hormozgan province , two from abchekan ( 392393 ) in sistan va baluchestan province , and three from kahnouj in kerman province ( 815 , 836 , and 839 ) were 100% identical . accurate identification of malaria vectors is not only one of the most basic requisite for success of malaria control programs , but also has become an intriguing issue for understanding speciation process and evolution of anopheles mosquitoes . in absence of cytotaxonomic evidence , rapd - pcr methodology and variation in 28s - d3 gene have resolved two potential sibling species in an . we report further evidence for the occurrence of these two sibling species by coi analysis of mitochondrial dna from the same specimens . anopheles fluviatilis james is a complex of cryptic species ; cytotaxonomic studies of polythene chromosomes has revealed three reproductively isolated species in india known as s , t , and u ( subbarao et al . 1994 ) . application of the first dna - based method using its2 gene identified two putative species of x and y that are presumably equivalent to species s and t , respectively ( manonmani et al . later , a complete as - pcr assay based on variations of 28s - d3 gene against chromosomally examined specimens identified all the members of the complex ( singh et al . fluvialitis mosquitoes of iran . however , the same specimens displayed variations in 28s - d3 gene ; the individuals from fars exhibited similarity with species u in india whereas individuals from others areas showed heterozygocity at the single nucleotide position that identifies species u and t. the identity of an . fluviatilis complex in iran became complicated as the heterozygocity in 28-d3 was not reflected in its2 fragment and individuals from fars province exhibited dual identity of t and u based on its2 and 28s genes , respectively ( chen et al . fluviatilis sibling species were not addressed in their study , however , k2p genetic distances between different species of culicidae were reported to be > 2% . in our study , the mean distance between iranian and indian populations was 1.66% , whereas the value between fars group and the group comprising other iranian individuals was 2.06% . the distance between most individuals from fars province and individuals from other areas was > 2% . two individuals ( 9192 ) from fars province exhibited almost equivalent distance with all other members including those ( 930 , 926 , 928 , 655 , 87 , and 97 ) from the same province . jf966741 , unpublished ) that showed a high divergence from other sequences and appeared as an out group beyond an . the results of present study were almost concordant with earlier results obtained by rapd - pcr methodology and 28s - d3 analysis ( naddaf et al . this study shows that coi gene can be used as a useful tool along other dna markers like 28-d3 gene for dissolving closely related taxa of an . fluviatilis mosquitoes ( by its2 and 28s - d3 genes ) from india , iran , and other geographical areas by this genetic marker can bring more insight into taxonomy of this sibling species . this study shows that coi gene can be used as a useful tool along other dna markers like 28-d3 gene for dissolving closely related taxa of an . fluviatilis mosquitoes ( by its2 and 28s - d3 genes ) from india , iran , and other geographical areas by this genetic marker can bring more insight into taxonomy of this sibling species .

background : anopheles fluviatilis , one of the major malaria vectors in iran , is assumed to be a complex of sibling species . the aim of this study was to evaluate cytochrome oxidase i ( coi ) gene alongside 28s - d3 as a diagnostic tool for identification of an . fluviatilis sibling species in iran.methods:dna sample belonging to 24 an . fluviatilis mosquitoes from different geographical areas in south and southeastern iran were used for amplification of coi gene followed by sequencing . the 474475 bp coi sequences obtained in this study were aligned with 59 similar sequences of an . fluviatilis and a sequence of anopheles minimus , as out group , from genbank database . the distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using kimura two parameter ( k2p ) model of neighbor - joining method.results:phylogenetic analysis using coi gene grouped members of fars province ( central iran ) in two distinct clades separate from other iranian members representing hormozgan , kerman , and sistan va baluchestan provinces . the mean distance between iranian and indian individuals was 1.66% , whereas the value between fars province individuals and the group comprising individuals from other areas of iran was 2.06%.conclusion : presence of 2.06% mean distance between individuals from fars province and those from other areas of iran is indicative of at least two sibling species in an . fluviatilis mosquitoes of iran . this finding confirms earlier results based on rapd - pcr and 28s - d3 analysis .

actinic granuloma is an uncommon granulomatous reaction hypothesized to be an autoimmune response to actinic damage to elastic tissue ( o'brien , 1978 ) . it is more commonly seen in women , with a female male ratio ranging from 1.2:1 to 2:1 ( gutierrez - gonzalez et al . , 2013 , limas , 2004 , o'brien , 1975 , ragaz and ackerman , 1979 ) . case studies and observational studies suggest that factors associated with this condition include diabetes mellitus and exposure to sun , radiation , intense light , tanning beds , and high heat ( table 1 ) . actinic granuloma classically presents as an annular plaque , most commonly on sun - exposed areas of the head , neck , and upper extremities , with an atrophic or hypopigmented center and elevated erythematous borders . there is also an ocular variant of actinic granuloma , which has been reported to occur as a yellow to pink plaque on the conjunctiva ( konar et al . , 2014 , mittal et al . , 2013 ) . we present this case and review of the literature to emphasize the association between actinic granuloma and temporal arteritis , a serious inflammatory condition that could lead to blindness if misdiagnosed . a 62-year - old caucasian male presented during the summer with a 3-month history of asymptomatic papules on the arms , legs , and trunk . the patient was previously treated with a course of methylprednisolone , which resulted in some improvement . physical examination revealed multiple tan - to - pink infiltrated annular papules on the chest , back , upper arms , and legs . laboratory studies showed a normal complete blood count , normal lyme and anaplasma titers , and negative hepatitis b and c serologies . liver function testing showed aspartate aminotransferase ( ast ) of 57 and alanine aminotransferase ( alt ) of 79 . erythrocyte sedimentation rate ( esr ) was elevated to 104 mm / hr . histopathologic examination showed an interstitial granulomatous infiltrate in the superficial and mid - dermis composed of histiocytes , lymphocytes , occasional eosinophils , and numerous multinucleated giant cells ( fig . 2 ) . verhoeff - van gieson stain showed fragmented elastin fibers within the cytoplasm of occasional multinucleated giant cells ( fig . periodic acid - schiff stain ( pas ) , acid - fast bacillus ( afb ) , and fite stains were negative . differential diagnosis based on histopathology included actinic granuloma , interstitial granulomatous dermatitis , interstitial granulomatous drug reaction , and granuloma annulare . given the presence of numerous multinucleated giant cells , findings on the verhoeff - van gieson stain , and solar elastosis with the time of presentation during summer , the patient was diagnosed with actinic granuloma . although the patient s headaches were not classic enough to prompt an earlier workup for temporal arteritis , temporal artery biopsy was performed because the patient complained of headaches and had an elevated esr . biopsy results revealed giant cell arteritis of the right temporal artery , and verhoeff - van gieson stain revealed focal disruption in the temporal artery internal elastic lamina . the patient was started on hydroxychloroquine 200 mg orally bid and prednisone 2.5 mg daily for his temporal arteritis , with partial clearance of his skin lesions . though his skin lesions drastically improved on this regimen , persistent esr elevation required an increase in prednisone to 40 mg po daily and the addition of methotrexate . the term actinic granuloma was first proposed by john obrien in 1975 after he observed histologic similarities in patients with annular lesions . because of its clinically similar appearance to granuloma annulare , some critics have questioned whether the condition should be classified as a separate entity or simply as granuloma annulare occurring in sun - damaged skin ( ragaz and ackerman , 1979 ) . others have accepted the distinction but have reclassified the lesions morphologically as annular elastolytic giant cell granuloma ( hanke et al . , 1979 ) . both of these terms , however , are descriptive only , while actinic granuloma offers an etiologic implication ( limas , 2004 ) . histopathologic examination of actinic granuloma shows an inflammatory process limited to the superficial dermis , with usually nonpalisading granulomas , greater frequency of multinucleated giant cells , solar elastosis , and no increase in mucin ( al - hoqail et al . , 2002 ) . this is in contrast to the deep , as well as superficial , dermal infiltrate with more commonly palisading granulomas ; reduced frequency of multinucleated giant cells ; and increased mucin deposition seen in granuloma annulare ( al - hoqail et al . , 2002 ) . four general histologic patterns of actinic granuloma have been described : histiocytic , giant cell , necrobiotic or vascular , and sarcoid ( o'brien , 1985 ) . the giant cell pattern is the original pattern , initially consisting of a small granuloma that becomes annular as it advances into elastotic tissue nearby . the necrobiotic variant , also known as the vascular variant , consists of areas of ischemic necrosis in the advancing granulomatous edge . lastly , the sarcoid variant often demonstrates atrophic stroma , fibrosis , and a persistent inflammatory reaction . of the four histologic patterns , the giant cell and necrobiotic histologic patterns appear to be more common patterns in females than males ( gutierrez - gonzalez et al . , 2013 ) . in general , treatment for actinic granuloma includes topical and intralesional corticosteroids , psoralen ultraviolet a therapy , antimalarials , cyclosporine , methotrexate , and cryotherapy ( reisenauer et al . , 2012 ) . case reports and observational studies have demonstrated variable results with these treatment modalities ( table 1 ) . temporal arteritis , also known as giant cell arteritis ( gca ) , is a form of medium - to - large - vessel vasculitis with the possible complication of vision loss if left untreated ( smith and swanson , 2014 ) . criteria for diagnosis include the presence of three or more of the following : age of 50 years or older , new headache , a clinically abnormal temporal artery , an esr greater than 50 mm / hr , and an abnormal temporal artery biopsy ( smith and swanson , 2014 ) . interestingly , temporal arteritis occurs preferentially in women ( smith and swanson , 2014 ) . giant cell arteritis has been most notably associated with polymyalgia rheumatica ( smith and swanson , 2014 ) . comorbidities in addition to polymyalgia rheumatic in gca include osteoporosis , cardiovascular conditions , diabetes mellitus , hypokalemia , and pseudophakia , all conditions that appear to have a high burden in the populations affected by gca ( petri et al . , 2015 ) . temporal arteritis has also been associated with extreme ear pain ( aui - aree et al . , 2010 ) . other cutaneous conditions and manifestations with which temporal arteritis has had rare associations include psoriatic arthritis , scalp abscess , scalp ulceration with necrosis , butterfly rash of the face , tongue changes , gangrene or ulcers of the leg , purpura and ecchymoses , urticaria , edema , lividity , tender nodules , hyperpigmentation , tortuous arteries , and supravascular pallor ( aui - aree et al . , 2010 , baum et al . , 1982 , corli et al . the association between actinic granuloma and temporal arteritis was first postulated in 1978 by john obrien ( see also lau et al . , 1997 ) . a few years later , the same author noted a histologic finding of actinic arteritis in a small vessel within the dermis of a polymyalgia patient ( lau et al . the underlying basis of this association is thought to be related to actinic degeneration of elastic tissue not only of the skin , but also of the internal elastic lamina of vessels ( gutierrez - gonzalez et al . , 2013 , o'brien and regan , 1999 ) . since then , few reports in the literature have demonstrated the association between actinic granuloma and temporal arteritis ( lau et al . , 1997 , shoimer and wismer , 2011 ) ; interestingly , all cases demonstrating the association have occurred in males , despite the higher prevalence of actinic granuloma in females . our patient had a unique clinical presentation that differed from previously reported cases of actinic granuloma associated with temporal arteritis . ( 1997 ) described two elderly gentlemen who presented with solitary lesions on the forehead , and shoimer and wismer ( 2011 ) described an elderly gentleman who presented with erythematous annular confluent plaques in predominantly sun - exposed locations . our case further supports the possibility of temporal arteritis in a variety of presentations of actinic granuloma . given the severe consequences of temporal arteritis , most notably blindness , we emphasize the importance of ruling out temporal arteritis in any patient presenting with actinic granuloma and headaches . if an associated temporal arteritis is suspected , systemic corticosteroids should be started to suppress the immune system and prevent blindness .

actinic granuloma is a rare granulomatous reaction that is more commonly seen in females and thought to occur as an autoimmune response to actinic damage of elastic tissue . we discuss a case of a patient with actinic granuloma presenting with concomitant temporal arteritis . our case and review of the literature emphasize the association between actinic granuloma and temporal arteritis , a serious inflammatory condition that could lead to blindness if misdiagnosed .

we applied the blastp program ( 5 ) to identify , for each predicted protein sequence in the h37rv genome ( genbank accession no . ae000516 ) . following genbank annotations , we compared 3,972 predicted proteins in h37rv with 4,187 predicted proteins in cdc1551 . we used a strict search criterion ( e = 10 - 50 ) to identify truly orthologous gene pairs . we aligned ( 6 ) the putative orthologous pairs of amino acid sequences ( n = 3,428 ) , then imposed this alignment on the dna sequences . visual inspection of amino acid alignments showed that certain alignments , usually near the n - terminus or c - terminus , had regions of very low sequence identity . examination of the dna sequences of the corresponding genes showed that these regions of low identity were typically caused by a frameshift in one of the two genomes relative to the other . whether these frameshifts are biologically real or result from sequencing error was uncertain ; therefore , we eliminated 119 such gene pairs from our data set . for the remaining gene pairs ( n = 3,309 ) , we computed the proportion of synonymous substitutions per synonymous site ( ps ) and the proportion of nonsynonymous substitutions per site ( pn ) by using nei and gojobori s method ( 7 ) . because values of ps and pn were very low in most cases , we did not correct for multiple hits . because ps values appeared to fall into two groups ( see results ) , we used a simple probabilistic model to separate these two sets of gene pairs . we assumed that the probability of synonymous substitution followed two separate binomial distributions , designated models a and b , with probabilities of success ( i.e. , of a synonymous difference ) designated pa and pb , respectively . using the bayes equation , for each gene pair with a given ps value , we computed the probability that model a applies , given the observed ps : p(a|ps ) = ( psa ) fa /[(psa ) fa + ( psb ) fb ] , where fa is the frequency of cases to which model a applies , fb the frequency of cases to which model b applies , psa is the binomial probability of obtaining the observed ps , given the number of synonymous sites in the gene and a probability of a synonymous difference equal to pa ; and psb is the binomial probability of obtaining the observed ps , given the number of synonymous sites in the gene and a probability of a synonymous difference equal to pb . of 3,309 pairs of putatively homologous protein - coding genes in the h37rv and cdc1551 genomes of m. tuberculosis , 2,662 ( 80.5% ) showed no synonymous or nonsynonymous nucleotide differences between the two genomes , and 3,010 ( 91.0% ) showed no synonymous differences between the two genomes . however , in a small number of gene pairs , the proportion of synonymous differences per synonymous site ( ps ) was surprisingly high . in 13 ( 0.4% ) gene pairs , ps was > 0.01 , and in 3 gene pairs ps exceeded 4% . these extreme ps values seen in a small number of gene pairs are much higher than generally observed between alleles at neutrally evolving loci in eukaryotes ( 8) . thus , the comparison of protein - coding genes between the two m. tuberculosis genomes suggested the existence of two distinct groups of gene pairs : a large group having few or no synonymous differences and a much smaller group with a substantial degree of synonymous divergence . we used a simple probabilistic model ( see methods ) to separate these two sets of gene pairs , designated group a and group b , respectively ( figure ) . the application of this method showed 11 loci with unusually high ps values and probabilities of assignment to group a of < 50% ( figure ) . a plot of p(a|ps ) , the probability of assignment of a locus to group a given the observed ps value , as a function of ps at 3,309 loci compared between the h37rv and cdc1551 genotypes of mycobacterium tuberculosis . the plot shows the bimodal nature of the distribution of ps values , with overall higher values of ps at the 11 loci having p(a|ps ) > 50% . we assumed that group a members are truly orthologous gene pairs that diverged at the time of the common ancestor of the h37rv and cdc1551 genomes . group a included 3,298 pairs , with mean ps for all genes of 0.000328 0.000022 standard error . when ps was estimated for the 3,298 genes concatenated together ( a total of 934,413 synonymous sites ) , an estimate of ps = 0.000348 0.00019 was obtained . the range of ps values in group a was between zero and 0.012 ; a total of 288 loci in group a had ps values other than zero . these results show a substantial level of nucleotide diversity , approximately half the level of nucleotide diversity in humans ( 9 ) . rates of nucleotide substitution per unit time are difficult to estimate in bacteria given the lack of calibration from the fossil record ( 10 ) . to obtain an estimate of the rate of synonymous nucleotide substitution , we used published data on comparisons of escherichia coli and salmonella typhimurium ( 11,12 ) , which are believed to have diverged approximately 100 million years ago ( 13,14 ) ( table 1 ) . this procedure yielded estimates for the last common ancestor of h37rv and cdc1551 in the range of 34,00038,000 years ( table 1 ) . these estimates are approximately twice previous estimates of the age of the common ancestor of worldwide m. tuberculosis ( 2,3 ) . to obtain the observed mean ps value between h37rv and cdc1551 within 15,00020,000 years would require a rate of synonymous substitution approximately twice that observed in enterobacteria . based on synonymous substitutions between escherichia coli and salmonella typhimurium , assumed to have diverged 100 million years ago ( 13,14 ) . estimates are shown standard error , based on standard error of mean ps . group b consisted of 11 gene pairs with mean ps of 0.0286 0.0050 ( table 2 ) . paired sample t - test of the hypothesis that ps = pn , p<0.01 . the quantities ps and pn are the proportion of nucleotide difference per synonymous site and per nonsynonymous site , respectively . in enterobacteria , a negative correlation exists between observed proportions of synonymous difference and codon bias ( 11 ) . in the case of mycobacterium , codon bias results mainly from the very high third position g+c content of most genes ( 15 ) . in our data , however , we observed no correlation between ps and proportion g+c at third codon positions ( r = -0.010 ; not significant ) . a number of additional possibilities may explain the occurrence of gene pairs with higher than expected ps values : 1 ) balanced polymorphism . selectively maintained polymorphisms are expected to be much older than neutral polymorphisms and may even predate speciation events ( 16 ) . in the case of haploid organisms such as bacteria , balancing selection would take the form of frequency - dependent selection rather than overdominant selection . 2 ) differential deletion . in a multi - gene family , if one member of an orthologous pair of genes were deleted in one genotype , the gene pairs would involve paralogous , not orthologous comparisons . 3 ) horizontal gene transfer . a gene obtained by one of the two genotypes from another bacterial species one indication of a balanced polymorphism is a higher rate of nonsynonymous than synonymous substitution ( 8) . there was no strong evidence of such selection in the present case ; ps was greater than pn at 10 of the 11 loci , and pn exceeded ps only slightly at one locus ( table 2 ) . in addition , we compared ps and pn in sliding windows of 30 codons along the length of these genes . no regions were observed in which pn was greater than ps ( data not shown ) . thus , there was no evidence of positive selection acting on specific regions of these genes . on the other hand , differential deletion can probably explain some cases , most notably members of the pe multi - gene family ( 11 ) ( table 2 ) . the remaining gene pairs are possibly cases of horizontal gene transfer ( table 2 ) , for which there is some recent evidence in m. tuberculosis ( 17 ) . our results did not support the hypothesis that the common ancestor of m. tuberculosis was relatively recent ( 2 ) . rather , the pattern of nucleotide substitution at synonymous sites suggested a divergence time for the two available genotypes of this species approximately 35,000 years ago . since h37rv and cdc1551 represent two genotypes sampled from within the species , they are probably not the most divergent genotypes possible . thus , the last common ancestor of m. tuberculosis likely occurred considerably earlier than 35,000 years ago . while the difference between an estimate of 15,00020,000 years and one of 35,000 years is not large on an evolutionary time scale , such a difference is substantial on the scale of human history . for example , the existence of two genotypes in the current population of m. tuberculosis with a common ancestor at 35,000 years is evidence against the hypothesis that m. tuberculosis arose , presumably from m. bovis , at the time of human domestication of cattle ( 18 ) . our result is thus consistent with phylogenetic analyses based on insertion - deletion events , which suggest that the m. tuberculosis lineage was a human pathogen well before the origin of m. bovis ( 19 ) . thus , along with recent evidence of an ancient origin and extensive polymorphism in the malaria parasite plasmodium falciparum ( 20,21 ) , our study provides evidence against the long - held view that virulent pathogens are invariably evolutionarily recent ( 22 ) . our estimate is conservative because the rate of synonymous substitution may actually be lower in mycobacterium than in enterobacteriaceae , given the highly skewed g+c content in the former . furthermore , our estimate of the mean proportion of synonymous difference was conservative because we excluded 119 loci with potential frameshifts between the two genotypes as well as a set of 12 loci with unusually high ps values . in addition to the 12 loci assigned to our group b , certain other loci might also have originated from horizontal gene transfer . however , even if horizontal gene transfer has occurred at other loci besides those in group b , eliminating further loci with relatively high ps values from group a will not affect the results greatly . for example , if we eliminate the 10 loci with highest ps values from group a , mean ps will be reduced only to 0.000299 , and the estimated age of the common ancestor will be barely affected . the degree of polymorphism observed in this study is unlikely to have been substantially influenced by sequencing errors . the error rate for finished sequences from the institute for genomic research ( where cdc1551 was sequenced ) has been independently estimated at < 1 in 88,000 bases ( 23 ) . assuming a similar error rate for both 4.4 mega - bp m. tuberculosis genomes , we would expect to see approximately 100 differences between them due to sequencing errors . approximately 21 such differences would be expected in the 938,778 synonymous sites in group a and group b genes . in fact , 411 synonymous differences were observed at these sites ; thus , even if present , sequencing errors are likely to have made up only a small fraction ( approximately 5% ) of the total synonymous polymorphism . at such a rate , sequencing errors would have little effect on our estimates of nucleotide diversity at synonymous sites or the age of the common ancestor of the two genomes . in addition , the hypothesis that the single nucleotide polymorphisms ( snps ) observed between these genotypes are real received strong support from a recent study that observed a number of the same snps in clinical isolates ( 24 ) . moreover , since sequencing errors are expected to occur at random with respect to the reading frame of coding sequences , the fact that mean ps exceeded mean pn in both group a and group b was strong evidence against the hypothesis that a substantial proportion of the observed polymorphism was due to sequencing error . simple considerations of probability can explain why earlier studies produced relatively low estimates of this species age . if we assume that the per - site probability of a synonymous difference between two m. tuberculosis genomes is equal to the mean ps observed between h37rv and cdc1551 ( 0.000328 ) , then the probability is approximately 95% that no synonymous differences will be seen in a gene with 150 synonymous sites . the probability that no synonymous differences will be seen in 10 such loci chosen at random is approximately 60% , and the probability that no synonymous differences will be observed at 20 such loci is approximately 37% . on the other hand , the probability that no synonymous differences will be seen at 100 these calculations emphasize the need to examine a very large number of nucleotide sites to obtain a reliable estimate of nucleotide diversity and thus of the age of the most recent common ancestor in cases where the frequency of substitution is less than one in a thousand . even when the frequency of substitution is between one in a thousand and one in a hundred , substantial stochastic error is possible if the number of loci examined is small . thus , any study that estimates population parameters from nucleotide sequence data needs to survey a substantial number of loci . these considerations are particularly important in the case of pathogenic microorganisms , where a number of factors ( including both natural selection and horizontal gene transfer ) may lead to substantial differences among loci with respect to the level of nucleotide diversity . comparison of two complete genomes of m. tuberculosis showed a greater extent of sequence polymorphism than would be expected on the basis of previous studies , in turn suggesting that analysis of additional genomes will likely show further polymorphism . polymorphism in any species of pathogen may complicate therapeutic strategies because it implies the existence of variation on which selection can act , including selection imposed by human vaccines and pharmacologic agents ( 20 ) . on the other hand , known polymorphisms may prove useful to investigators in reconstructing the evolutionary relationships among clinical isolates and in providing markers for understanding the genetic basis of complex phenotypic traits .

comparison of the pattern of synonymous nucleotide substitution between two complete genomes of mycobacterium tuberculosis at 3,298 putatively orthologous loci showed a mean percent difference per synonymous site of 0.000328 0.000022 . although 80.5% of loci showed no synonymous or nonsynonymous nucleotide differences , the level of polymorphism observed at other loci was greater than suggested by previous studies of a small number of loci . this level of nucleotide difference leads to the conservative estimate that the common ancestor of these two genotypes occurred approximately 35,000 ago , which is twice as high as some recent estimates of the time of origin of this species . our results suggest that a large number of loci should be examined for an accurate assessment of the level of nucleotide diversity in natural populations of pathogenic microorganisms .

taken together , malaria ( caused by plasmodium species ) , human african trypanosomiasis ( hat , caused by trypanosoma brucei ) , chagas disease ( caused by t. cruzi ) , and leishmaniasis ( caused by leishmania species ) represent diseases with an estimated combined burden of over 87 million disability - adjusted life years . while progress has certainly been made toward the discovery of new hits , much work remains to translate these hits into promising chemical lead series that may be advanced for drug development . target repurposing , wherein inhibitors of human homologues of essential parasite proteins are assessed for efficacy against parasite cells . we have recently initiated the repurposing of a variety of kinase inhibitors for parasitic diseases and have also described the use of established human phosphodiesterase inhibitors as starting points for lead discovery . we have described the discovery of neu-617 ( 1 ) , a derivative of the approved human cancer drug lapatinib ( 2 ) , which acts as a potent , orally bioavailable growth inhibitor of t. brucei that showed a modest effect in a mouse model of bloodstream infection . based on the close phylogenetic relationship between the kinomes of the trypanosomatid parasites ( t. brucei , t. cruzi , and leishmania major ) , we hypothesized that all the pathogens would be susceptible to these inhibitors . we have therefore tested 1 , along with the other analogs synthesized during the course of our hit - to - lead optimization program , against the two other kinetoplastid parasites . based on our previous observation that related chemotypes show activity against plasmodium falciparum , we also screened this set of compounds against cultures of drug - sensitive and drug - resistant strains of malaria . in doing so , we noted differential structure activity relationships for these compounds growth inhibitory properties against each of the parasites , thus launching a multiparasite optimization campaign from the same lead series . in this paper , we describe these cross - pathogen assay results and outline our evaluation of replacements for the quinazoline scaffold of 1 for each of the parasites . we posit that such a cross - screening approach can be a highly fruitful method for identification of new protozoan parasite growth inhibitors . first , in order to ascertain antiparasitic activities of our 66 previously reported analogs , we measured their growth inhibitory activities against t. cruzi ( intracellular amastigotes ) , l. major ( promastigote and intracellular amastigote life stages ) , and p. falciparum ( d6 , drug sensitive strain ) . the structures of the most potent compounds for each parasite are shown in figure 1 and table 1 , and the complete set of screening data for these is tabulated in the supporting information ( tables s1s7 ) . program progression from 2 to four sem values within 50% . * % inh at 10 m . control compounds : t. brucei , suramin ; t. cruzi , benznidazole ; l. major , amphotericin b ; p. falciparum , chloroquine . from these experiments , we observed that 15 morpholinosulfonamide compounds were identified with activity against l. major promastigotes : seven of these were submicromolar inhibitors and two were also submicromolar against intracellular amastigotes ( the most relevant life stage for human infections of leishmaniasis ) . the des - fluoro analog neu-551 ( 3 ) showed the highest activity against promastigotes ( ec50 = 0.50 m ) . we initially tested compounds against t. cruzi at a single concentration and found that 32 compounds inhibited proliferation > 65% at 10 m concentrations ; of these 32 compounds , the homopiperazinyl sulfonamide - substituted tail was preferred ( neu-628 ( 4 ) , ec50 = 0.51 m ) . the active compounds against p. falciparum ( drug - sensitive d6 strain ) all contained a basic nitrogen at the end of the tail group with neu-627 ( 5 ) being the most potent with an ec50 of 27 nm . though we note that the number of headgroup replacement analogs tested was far smaller and less diverse than the tail variations , the lapatinib headgroup 3-chloro-4-((3-fluorobenzyl)oxy)aniline showed optimal potency against all of the parasites , except for both leishmania life stages . previous efforts focused on the head ( 4-benzyloxyanilines ) and tail ( denoted as r in figure 1 ) regions of lapatinib , while maintaining the central quinazoline scaffold ( highlighted in blue in figure 1 ) . thus , we planned a broader evaluation of other bicyclic aromatic replacements for the quinazoline scaffold that would test the important features of the chemotype for activity . these scaffold replacements were selected for exploration of the requisite nitrogen atom positioning in the heteroaromatic ring ( see the heterocycle precursors highlighted in figure 2 , dihalides 69 ) . in addition , the cyanoquinoline and thienopyrimidine scaffolds ( dihalides 1012 ) were selected in order to include other established tyrosine kinase inhibitor chemotypes . for a matched exploration of these scaffolds , we elected to maintain the four permutations of head / tail combinations that displayed the most potency in each parasite ( shown in figure 1 ) in the new analogs that we prepared . we first set out to synthesize the requisite dihalogenated scaffolds shown in figure 2 . the syntheses of 6- and 7-bromo-4-chloroquinolines 6a and 6b were carried out via the gould was devised to draw out essential interactions with either nitrogen of the quinazoline scaffold . the requisite cyanoquinoline template 12 was prepared using established protocols similar to that of the 4-chloroquinolines . though few examples of cinnoline or phthalazine based kinase inhibitors exist in the literature , we opted to prepare analogues utilizing both heterocycles to test the required positioning of the two nitrogen atoms on the scaffold . preparation of 6-bromo-4-chlorocinnoline 8a commenced with the bromination of o - aminoacetophenone 13 followed by diazotization of the amine and in situ cyclization to the 6-bromocinnolin-4(1h)-one 15 ( scheme 1 ) . we hypothesized that this side reaction occurred via chloride displacement under the acidic conditions of the reaction ( scheme s1 , see supporting information ) . a 10:1 product ratio of 8a to 8b could be achieved through the use of thf as solvent and 3 equiv of pocl3 . the regiomeric 7-bromo-4-chlorocinnoline 8c was prepared in a similar fashion starting instead with the acylation of 3-bromoaniline 16 to 2-amino-4-bromoacetophenone 17 , followed by diazotization and chlorination . reagents and conditions : ( a ) nbs , ch2cl2 , 10 c 23 c , o.n . ; ( b ) nano2 , aq . hcl , h2o , 75 c , o.n . ; ( c ) pocl3 , thf , reflux , 2 h ; ( d ) ( i ) bcl3 , ( ch2cl)2 , 0 c ; ( ii ) alcl3 , ch3cn , 80 c , o.n . ; ( iii ) aq . hcl , 80 c , 30 min ; ( b ) nano2 , aq . hcl , h2o , 75 c , o.n . ; ( c ) pocl3 , thf , reflux , 2 h. the 7-bromo-1-chlorophthalazine template 9a was synthesized as shown in scheme 2 . aryl bromination of phthalide 19 was carried out in acidic medium with nbs to produce a separable mixture of 4- and 6-bromophthalide 20 . benzylic bromination was achieved using a modification of an established procedure , and the resulting dibromides 21a , b were converted to the corresponding bromophthalazinone 22 upon treatment with hydrazine . as with 15 , 22a was converted to the dichlorinated side product 9b on treatment with neat pocl3 , though dilution minimized this side reaction . acetonitrile with 3 equiv of pocl3 provided a > 10:1 ratio of the desired chlorination product 9a . the 6-bromo-1-chlorophthalazine scaffold 9c could be synthesized in an identical manner starting with the commercially available 5-bromophthalide 20b . reagents and conditions : ( a ) nbs , h2so4 , cf3co2h , 23 c , 40 h ; ( b ) nbs , aibn , chcl3 , reflux , 1 h ; ( c ) n2h4 , i - proh , reflux , 1.5 h ; ( d ) pocl3 , ch3cn , reflux , 3 h. amination of the dihalogenated quinoline , isoquinoline , cyanoquinoline , and thienopyrimidine scaffolds was carried out by applying methods similar to those we previously reported ( scheme 3 ) . however , low yields ( 20% ) resulted when these conditions were applied to the cinnoline and phthalazine templates . switching the solvent to toluene and using 4 equiv of amine improved yields to 5478% . suzuki couplings using the requisite boronates and 57 mol % pd(pph3)4 or 1 mol % pd(oac)2 provided the final analogs . yields of the cinnoline or phthalazine products were drastically improved by switching to 2.5 mol % pdcl2(pph3)2 or 5 mol % pd(oac)2 with extended reaction times . a higher catalyst loading of pd(oac)2 was employed in lieu of pdcl2(pph3)2 in situations where the pph3o byproduct could not be separated from the products . reagents and conditions : ( a ) 1.1 equiv of amine , i - proh , reflux , o.n . ; ( b ) 4 equiv of amine , toluene , reflux , 2.5 h ; ( c ) 4 equiv of amine , toluene , 50 c , o.n . ; ( d ) arbpin , et3n , pd(oac)2 , 1:1 h2o / etoh , mw , 120 c , 13 h ; ( e ) arbpin , et3n , pdcl2(pph3)2 , 1:1 h2o / etoh , mw , 120 c , 1 h ; ( f ) arbpin , aq . na2co3 , pd(pph3)4 , 3:2 glyme / etoh , n2 , 85 c , 712 h. with this set of new analogs that are matched to the previously described antiparasitic agents , we set out measuring these analogs activities against t. brucei , t. cruzi , l. major , and p. falciparum , and counter - screened against host cells ( nih 3t3 and hepg2 cell lines ) using assays that we previously reported . a small number of compounds showed activity against nih 3t3 cells ; these are summarized in the supporting information , table s8 . all sem values within 25% unless noted otherwise . * % inh at 5 m . compound 1 remained the most potent t. brucei growth inhibitor among this set of analogs . a pair of quinoline - based compounds , 50 and 52 , each with a basic aliphatic amine on the tail group show double digit nanomolar potency ( 79 and 87 nm , respectively ) . the potency of these compounds seems to be driven by the aliphatic amine in the tail region rather than by the placement of nitrogen atoms in the scaffold , because the analogous isoquinoline analogue 58 is approximately equipotent ( 100 nm ) to 50 . the quinoline analogs 50 , 51 , and 52 displayed submicromolar potency against intracellular amastigotes of t. cruzi . most other analogs showed a complete loss of activity , perhaps due to issues with penetration into both the host cell and the parasite . ( with intracellular parasites , we note that compensating effects from interactions with host cell targets can not be ruled out . ) however , the 3-cyanoquinoline analogue 83 , shows a 5-fold improvement in potency over the matched original quinazoline analog 4 . in the headgroup region , the 3-fluoro substituent affords a 10-fold increase in potency over the matched des - fluoro analog ( cf . the quinoline 51 displayed a slight drop in potency compared with the quinazoline 4 , and the matched isoquinoline 59 is 10-fold less potent . taken together with the cyanoquinoline analog 83 , this data demonstrates the apparent importance of two h - bond acceptor motifs in the scaffold . in the case of l. major , 47 showed a 2.5-fold increase in potency from the matched quinazoline analogue 3 ( 0.20 versus 0.50 m respectively ) against the promastigote life stage of l. major . the corresponding isoquinoline compound 55 showed a complete loss in activity , reinforcing the essentiality of the n1 atom of the quinazoline . interestingly , there was no activity observed against the amastigote life stage of the parasite for 47 . in contrast , the 7-substituted quinoline 52 displayed submicromolar potency against both life stages ( 0.40 m against promastigotes and 0.89 m versus amastigotes ) . compared with the quinazoline compound 4 , the analogous cinnoline 68 displayed increased potency against amastigotes ( 0.24 m ) albeit with a significant decrease in potency against the promastigote form . this lack of correlation of compounds between promastigote and amastigote life stages of the parasite has been reported by us and others recently . other compounds displaying modest potency include 76 and 91 , both containing the n - methylhomopiperazinyl sulfonamide tail . in p. falciparum cultures , three isoquinoline compounds with a basic amine at the terminus of the tail region showed modest potency highlighted by 57 being nearly equipotent to the parent quinazoline 5 ( 40 vs 27 nm ) . though the matching quinoline 49 showed a complete loss in activity , its regioisomer 50 was slightly more active than 5 ( ec50 = 19 nm ) . the four quinoline analogs without a basic amine on the tail group were within 2-fold of 5 with 48 being the most potent with an ec50 = 16 nm . similarly , all four thienopyrimidine analogs with a basic tail group amine ( 8992 ) were potent , within 4-fold of 5 . among these compounds there was no preference for either thienopyridine isomer ; the n - methylpiperazinyl tail group was 2.5- to 4-fold more potent than the n - methylhomopiperazinyl tail on each scaffold . among the phthalazines , 74 and 76 , both with a basic nitrogen on the tail and substituted at the 6-position ( regiomeric to 5 ) were equipotent to 5 . also requiring a basic amine on the tail region , the cinnoline analogs with piperazinyl and homopiperazinyl moieties ( 6568 ) showed modest to high potency against p. falciparum d6 strain . excitingly , the 7-substituted isomers ( 66 and 68 ) were highly potent antiplasmodial agents ( 14 and 3 nm , respectively ) . since we observed that the most potent compounds against p. falciparum were 4-aminoquinolines ( similar to the prototypical antimalarial agent chloroquine ) , we tested them against drug resistant parasite strains w2 and c235 . we were gratified to observe that all of the compounds tested are similarly active against drug resistant strains of p. falciparum ( table s9 , supporting information ) , suggesting that despite the shared scaffold , these analogs likely display a mechanism of action or mechanism of resistance that differs from those of chloroquine . our studies demonstrate which of these scaffolds are the most promising for further optimization on a parasite - by - parasite basis . , it is clear that the quinoline scaffold is significantly active across all four pathogens . we note that cinnoline ( c ) and quinoline ( a ) generally provide the most potent antiplasmodial agents , and the 7-position substitutions are slightly favored in both of these templates . for t. brucei , the 7-substituted quinolines and 6-substituted isoquinolines appear optimal ( noting that , despite the differential numbering of the scaffolds , these two particular scaffolds present the same relative regiochemistry ) . analogous diagrams for the other pathogens are also provided in figure 3 ( and a diagram for leishmania promastigotes is in the supporting information ( figure s1 ) . a summary of the preferred bicyclic scaffold for each parasite is shown in figure 3e , noting that none appear to be markedly better than the others against leishmania intracellular amastigotes . bar chart showing range of potencies for each scaffold ( as labeled in tables 2 and 3 ) for ( a ) malaria , ( b ) t. brucei , ( c ) l. major ( amastigotes ) , and ( d ) t. cruzi . regiochemical information is shown by the suffix number ( e.g. , scaffold a-7 is the 7-substituted quinoline scaffold ) . quinolines are shown in blue , isoquinolines in green , cinnolines in yellow , phthalazines in orange , cyanoquinolines in red , thieno[3,2-d]pyrimidines in purple , thieno[2,3-d]pyrimidines in light gray , and quinazolines in dark gray . for all parasites except for t. brucei , we also note a preference for tail substituents with a basic amine present . considering only the most potent compounds ( ec50 0.1 m for the extracellular parasites t. brucei and p. falciparum ; ec50 1 m for the intracellular parasites l. major and t. cruzi ) , we note that the n - methylpiperizine and n - methylhomopiperazine are preferred among analogs that were tested , over the less - basic morpholine or nonbasic morpholinosulfonamide substituents ( table 4 ) . at this point , we can not discern whether this is an effect that is mediated by the biological target(s ) involved in proliferation inhibition , by parasite permeation , or by a combination of both ; this will be a matter for further investigation . potent compounds are ec50 0.1 m . potent compounds are ec50 1 m . we have previously observed that molecules bearing these head and tail combinations possess problematic physicochemical properties , likely due to the molecular size and lipophilicity . the intent of the present work was to explore the central scaffold functionality , rather than to address these shortcomings . nonetheless , we selected five representative compounds from among the most potent to be tested for their physicochemical properties ( table 5 ) . not unexpectedly , compounds tested were > 99% plasma protein bound with limited thermodynamic aqueous solubility ( < 1 m ) . such properties are undoubtedly a result of the high molecular weights and clogp values ; these issues remain the focus of ongoing efforts , which are now focused on specific scaffolds for each pathogen . in summary , through a cross - parasite screening campaign of existing quinazoline t. brucei proliferation inhibitors , we uncovered new hits against three other protozoan parasites . encouraged by that initial success , we focused on exploring the central heterocycle scaffold , an exercise that has uncovered additional highly potent compounds . scaffold variations have revealed heteroatom positioning essential for activity within this chemotype , while variations to regiochemical attachment points have introduced a new set of regioisomers with multiparasite potency . thus , we have established a new lead series for each of these protozoan parasites , which can be now advanced in parallel for drug discovery against four different parasitic diseases . with this in mind , further optimization of physicochemical properties and cellular selectivity of each is ongoing , with a specific focus on the head and tail regions . ( st . louis , mo ) , fisher scientific , frontier scientific services , inc . ( newark , de ) , or matrix scientific ( columbia , sc ) and used as received . boronic acids and esters and aniline reagents were purchased , except for those whose syntheses are listed in the supporting information . reaction solvents were dried by passage through alumina columns on a purification system manufactured by innovative technology ( newburyport , ma ) . nmr spectra were obtained with varian nmr systems , operating at 400 or 500 mhz for h acquisitions as noted . lcms analysis was performed using a waters alliance reverse - phase hplc , with single - wavelength uv visible detector and lct premier time - of - flight mass spectrometer ( electrospray ionization ) . all newly synthesized compounds that were submitted for biological testing were deemed > 95% pure by lcms analysis ( uv and esi - ms detection ) prior to submission for biological testing . preparative lcms was performed on a waters fraction lynx system with a waters micromass zq mass spectrometer ( electrospray ionization ) and a single - wavelength uv yields reported for products obtained by preparative hplc represent the amount of pure material isolated ; impure fractions were not repurified . in a flame - dried 250 ml round - bottom flask were added 6-bromocinnolin-4(1h)-one ( 1.00 g , 4.44 mmol ) , anhydrous tetrahydrofuran ( 45 ml ) , and phosphorus oxychloride ( 1.25 ml , 13.41 mmol ) . the mixture was refluxed for 1 h at which point a deep green / blue solution had resulted . the solution was cooled to 0 c and was quenched by the dropwise addition of sat . the mixture was allowed to warm to room temperature and stir for an additional 1 h. water ( 50 ml ) was added , and the mixture was extracted with dichloromethane ( 3 100 ml ) . nahco3 ( 50 ml ) , washed with brine ( 50 ml ) , dried over na2so4 , concentrated on to silica , and purified by flash column chromatography using a gradient of 15% methanol in dichloromethane to yield an inseparable 10:1 mixture of 8a and 8b as a brown solid in 85% yield . h nmr ( 500 mhz , cdcl3 ) 9.36 ( s , 1 h ) , 8.43 ( d , j = 8.8 hz , 1 h ) , 8.36 ( d , j = 2.0 hz , 1 h ) , 7.98 ( dd , j = 9.3 , 2.0 hz , 1 h ) . lcms found 242.9 [ m + h ] . in a flame - dried 25 ml round - bottom flask were added 7-bromocinnolin-4(1h)-one ( 166 mg , 0.74 mmol ) , anhydrous tetrahydrofuran ( 7 ml ) , and phosphorus oxychloride ( 0.2 ml , 2.15 mmol ) . the mixture was refluxed for 1 h at which point a deep green / blue solution had resulted . the solution was cooled to 0 c and was quenched by the dropwise addition of sat . . the mixture was allowed to warm to room temperature and stir for an additional 1 h. water ( 12 ml ) was added , and the mixture was extracted with dichloromethane ( 3 25 ml ) . nahco3 ( 20 ml ) , washed with brine ( 20 ml ) , and dried over na2so4 to yield 8c as a dark brown solid in 92% yield . h nmr ( 500 mhz , cdcl3 ) 9.39 ( s , 1 h ) , 8.76 ( d , j = 2.0 hz , 1 h ) , 8.09 ( d , j = 9.3 hz , 1 h ) , 7.95 ( dd , j = 9.0 , 1.7 hz , 1 h ) . lcms found 242.9 [ m + h ] . in a flame - dried 25 ml round - bottom flask were added 7-bromophthalazin-1(2h)-one ( 205 mg , 0.91 mmol ) , anhydrous acetonitrile ( 9 ml ) , and phosphorus oxychloride ( 0.3 ml , 3.22 mmol ) . the mixture was refluxed for 2 h , then cooled to 0 c , diluted with dichloromethane ( 20 ml ) , and quenched with a dropwise addition of sat . after 1 h , the layers were separated and the aqueous was extracted with dichloromethane ( 2 30 ml ) . the combined organic layers were washed with sat . nahco3 ( 25 ml ) , washed with brine ( 20 ml ) , dried over na2so4 , and concentrated to yield 9a as an orange solid in 91% yield . h nmr ( 500 mhz , cdcl3 ) 9.45 ( s , 1 h ) , 8.498.51 ( m , 1 h ) , 8.10 ( dd , j = 8.8 , 2.0 hz , 1 h ) , 7.91 ( d , j = 8.8 hz , 1 h ) . lcms found 242.9 [ m + h ] . in a flame - dried 50 ml round - bottom flask were added 6-bromophthalazin-1(2h)-one ( 402 mg , 1.78 mmol ) , anhydrous acetonitrile ( 18 ml ) , and phosphorus oxychloride ( 0.5 ml , 5.36 mmol ) . the mixture was refluxed for 2 h , then cooled to 0 c , diluted with dichloromethane ( 40 ml ) , and quenched with a dropwise addition of sat . the biphasic mixture was stirred vigorously and allowed to warm to room temperature . after 1 h , the layers were separated , and the aqueous was extracted with dichloromethane ( 2 50 ml ) . the combined organic layers were washed with sat . nahco3 ( 40 ml ) , washed with brine ( 30 ml ) , dried over na2so4 , and concentrated to yield 29c as a yellow solid in 94% yield . h nmr ( 500 mhz , cdcl3 ) 9.39 ( s , 1 h ) , 8.178.21 ( m , 2 h ) , 8.10 ( dd , j = 8.8 , 2.0 hz , 1 h ) . in a 250 ml round - bottom flask were added 1-(2-amino-5-bromophenyl)ethanone ( 8.34 g , 39.0 mmol ) , water ( 30 ml ) , and conc . the mixture was cooled to 0 c in an ice bath and allowed to stir for 15 min until a suspension resulted . aqueous sodium nitrite ( 2 m , 20 ml , 40.0 mmol ) was then added dropwise with an addition funnel . the resulting solution was allowed to warm to room temperature over 1.5 h and was stirred at room temperature overnight , then refluxed for 6 h. the mixture was cooled to room temperature , water ( 200 ml ) was added , and the mixture was extracted with ethyl acetate ( 3 200 ml ) . the combined organic layers were then washed with brine ( 50 ml ) , dried over sodium sulfate , filtered , and concentrated onto silica . the crude product was then purified by flash column chromatography using a gradient of 110% methanol in dichloromethane to yield 15 as a dark brown solid in 82% yield . h nmr ( 500 mhz , dmso - d6 ) 14.09 ( br . s. , 1 h ) , 8.09 ( d , j = 2.2 hz , 1 h ) , 7.92 ( dd , j = 8.8 , 2.2 hz , 1 h ) , 7.79 ( s , 1 h ) , 7.71 ( d , j = 9.1 hz , 1 h ) . in a 50 ml round - bottom flask were added 1-(2-amino-4-bromophenyl)ethanone ( 712 mg , 3.33 mmol ) , water ( 3 ml ) , and conc . the mixture was cooled to 0 c in an ice bath and allowed to stir for 15 min until a suspension resulted . aqueous sodium nitrite ( 2 m , 1.84 ml , 3.68 mmol ) was then added dropwise with an addition funnel . the resulting solution was allowed to warm to room temperature over 1.5 h and was stirred at room temperature overnight , then refluxed for 6 h. the mixture was cooled to room temperature , water ( 35 ml ) was added , and the mixture was extracted with ethyl acetate ( 3 40 ml ) . the combined organic layers were then washed with brine ( 20 ml ) , dried over sodium sulfate , filtered , and concentrated onto silica . the crude product was then purified by flash column chromatography using a gradient of 2050% ethyl acetate in hexanes , then ethyl acetate to yield 18 as a light brown solid in 26% yield . h nmr ( 500 mhz , dmso - d6 ) 13.49 ( s , 1 h ) , 7.92 ( d , j = 8.8 hz , 1 h ) , 7.76 ( s , 1 h ) , 7.73 ( d , j = 2.0 hz , 1 h ) , 7.53 ( dd , j = 8.8 , 2.0 hz , 1 h ) . in a 100 ml round - bottom flask was dissolved isobenzofuran-1(3h)-one ( 4.01 g , 29.9 mmol ) in trifluoroacetic acid ( 14 ml , 182 mmol ) and sulfuric acid ( 6.5 ml , 122 mmol ) . n - bromosuccinimide ( 7.95 g , 1.49 mmol ) was added portionwise over 8 h , and the solution was stirred at room temperature for an additional 87 h. the solution was diluted with water ( 40 ml ) and ethyl acetate ( 40 ml ) . the organic layer was separated , and the aqueous layer was extracted with ethyl acetate ( 3 50 ml ) . the combined organic layers were washed with brine ( 25 ml ) , dried over na2so4 , and concentrated onto silica . the crude product was then purified by flash column chromatography using 1020% ethyl acetate in hexanes to yield 20a as white solid in 57% yield . h nmr ( 500 mhz , cdcl3 ) 7.98 ( d , j = 1.5 hz , 1 h ) , 7.77 ( dd , j = 8.3 , 1.5 hz , 1 h ) , 7.40 ( d , j = 8.3 hz , 1 h ) , 5.27 ( s , 2 h ) . lcms found 212.9 [ m + h ] . in a 50 ml round - bottom flask n - bromosuccinimide ( 958 mg , 5.38 mmol ) , 2,2-azobis(2-methylpropionitrile ) ( 75 mg , 0.46 mmol ) , and chloroform ( 23 ml ) . the mixture was refluxed for 2.5 h , then cooled to room temperature and quenched with sat . the organic layer was removed , washed with water ( 20 ml ) , washed with brine ( 15 ml ) , and concentrated onto silica . the crude product was purified by flash column chromatography using a gradient of 510% ethyl acetate in hexanes to yield 21a as a white solid in 61% yield . h nmr ( 500 mhz , cdcl3 ) 8.06 ( d , j = 1.5 hz , 1 h ) , 7.90 ( dd , j = 8.1 , 1.7 hz , 1 h ) , 7.52 ( d , j = 8.3 hz , 1 h ) , 7.37 ( s , 1 h ) . were added 5-bromoisobenzofuran-1(3h)-one ( 499 mg , 2.34 mmol ) , n - bromosuccinimide ( 421 mg , 2.37 mmol ) , 2,2-azobis(2-methylpropionitrile ) ( 38 mg , 0.23 mmol ) , and chloroform ( 10 ml ) . the mixture was refluxed for 2.5 h , then cooled to room temperature and quenched with sat . the organic layer was removed , washed with water ( 10 ml ) , washed with brine ( 5 ml ) , and concentrated onto silica . the crude product was purified by flash column chromatography using 10% ethyl acetate in hexanes to yield 21b as a white solid in 49% yield . h nmr ( 500 mhz , cdcl3 ) 7.747.83 ( m , 3 h ) , 7.36 ( s , 1 h ) . gcms found 289.8 [ m ] . in a 25 ml round - bottom flask was dissolved 3,6-dibromoisobenzofuran-1(3h)-one ( 143 mg , 0.49 mmol ) in ethanol ( 5 ml ) . hydrazine monohydrate ( 0.12 ml , 2.48 mmol ) was then added via a syringe , and the solution was refluxed for 1.5 h. the solution was cooled to room temperature , and ice water ( 15 ml ) was added to the reaction mixture . the precipitate was vacuum filtered and dried under a vacuum overnight to yield 22a as a white solid in 56% yield . h nmr ( 500 mhz , dmso - d6 ) 12.82 ( br . s. , 1 h ) , 8.39 ( s , 1 h ) , 8.30 ( d , j = 2.0 hz , 1 h ) , 8.11 ( dd , j = 8.5 , 2.2 hz , 1 h ) , 7.90 ( d , j = 8.3 hz , 1 h ) . in a 25 ml round - bottom flask was dissolved 3,5-dibromoisobenzofuran-1(3h)-one ( 302 mg , 1.04 mmol ) in ethanol ( 10 ml ) . hydrazine monohydrate ( 0.25 ml , 5.18 mmol ) was then added via a syringe , and the solution was refluxed for 1.5 h. the solution was cooled to room temperature , and ice water ( 30 ml ) was added to the reaction mixture . the precipitate was vacuum filtered and dried under a vacuum overnight to yield 22b as a white solid in 73% yield . h nmr ( 500 mhz , dmso - d6 ) 12.78 ( br . s. , 1 h ) , 8.33 ( s , 1 h ) , 8.23 ( d , j = 2.0 hz , 1 h ) , 8.12 ( d , j = 8.3 hz , 1 h ) , 8.00 ( dd , j = 8.3 , 2.0 hz , 1 h ) . to a solution of the appropriate aryl chloride ( 1 equiv ) in 2-propanol ( 0.15 m ) was added 3-chloro-4-((3-fluorobenzyl)oxy)aniline or 4-(benzyloxy)-3-chloroaniline ( 1.1 equiv ) . the formed precipitate was collected by vacuum filtration to obtain the desired products . to a solution of the appropriate aryl chloride ( 1 equiv ) in 2-propanol ( 0.15 m ) the combined organic layers were washed with water , washed with brine , dried over na2so4 , and concentrated . the crude products were purified by flash column chromatography to obtain the desired products . a solution of the appropriate 4-chlorocinnoline ( 1 equiv ) and 3-chloro-4-((3-fluorobenzyl)oxy)aniline or 4-(benzyloxy)-3-chloroaniline ( 4 equiv ) in toluene ( 0.1 m ) was refluxed for 2.5 h and cooled to room temperature . triethylamine ( 4 equiv ) was added , and the mixture was returned to reflux for an additional 30 min . the mixture was cooled back to room temperature , and the formed yellow precipitate was vacuum filtered , washed with ethyl acetate , concentrated onto silica , and purified by flash column chromatography . a solution of the appropriate 1-chlorophthalazine ( 1 equiv ) and 3-chloro-4-((3-fluorobenzyl)oxy)aniline or 4-(benzyloxy)-3-chloroaniline ( 4 equiv ) in anhydrous toluene ( 0.2 m ) was heated at 50 c overnight . the combined organic layers were washed with brine , dried over na2so4 , concentrated onto silica , and purified by flash column chromatography . synthesized by general procedure b. flash column chromatography : 2050% ethyl acetate in hexanes to yield 23 as a light brown solid in 90% yield . h nmr ( 500 mhz , dmso - d6 ) 8.99 ( s , 1 h ) , 8.63 ( s , 1 h ) , 8.46 ( d , j = 5.4 hz , 1 h ) , 7.80 ( d , j = 1.5 hz , 2 h ) , 7.437.51 ( m , 2 h ) , 7.277.36 ( m , 4 h ) , 7.19 ( td , j = 8.7 , 2.2 hz , 1 h ) , 6.80 ( d , j = 5.4 hz , 1 h ) , 5.26 ( s , 2 h ) . lcms found 456.8 [ m + h ] . synthesized by general procedure b. flash column chromatography : 2070% ethyl acetate in hexanes to yield 24 as a brown solid in 70% yield . h nmr ( 500 mhz , dmso - d6 ) 8.98 ( s , 1 h ) , 8.63 ( s , 1 h ) , 8.45 ( d , j = 5.4 hz , 1 h ) , 7.80 ( s , 2 h ) , 7.50 ( d , j = 7.3 hz , 2 h ) , 7.397.46 ( m , 3 h ) , 7.35 ( t , j = 7.3 hz , 1 h ) , 7.30 ( s , 2 h ) , 6.79 ( d , j = 5.4 hz , 1 h ) , 5.23 ( s , 2 h ) . synthesized by general procedure b. flash column chromatography : 2050% ethyl acetate in hexanes to yield 25 as a tan colored solid in 82% yield . h nmr ( 399 mhz , dmso - d6 ) 9.05 ( s , 1 h ) , 8.43 ( d , j = 5.1 hz , 1 h ) , 8.31 ( d , j = 8.8 hz , 1 h ) , 8.05 ( d , j = 2.2 hz , 1 h ) , 7.67 ( dd , j = 8.8 , 2.2 hz , 1 h ) , 7.417.52 ( m , 2 h ) , 7.257.37 ( m , 4 h ) , 7.18 ( td , j = 8.6 , 2.6 hz , 1 h ) , 6.76 ( d , j = 5.9 hz , 1 h ) , 5.25 ( s , 2 h ) . synthesized by general procedure b. flash column chromatography : 2050% ethyl acetate in hexanes to yield 26 as an off - white solid in 83% yield . h nmr ( 500 mhz , dmso - d6 ) 9.04 ( s , 1 h ) , 8.43 ( d , j = 4.9 hz , 1 h ) , 8.31 ( d , j = 9.3 hz , 1 h ) , 8.05 ( d , j = 2.0 hz , 1 h ) , 7.67 ( dd , j = 9.0 , 2.2 hz , 1 h ) , 7.49 ( d , j = 6.8 hz , 2 h ) , 7.397.46 ( m , 3 h ) , 7.35 ( t , j = 7.3 hz , 1 h ) , 7.30 ( s , 2 h ) , 6.75 ( d , j = 5.4 hz , 1 h ) , 5.23 ( s , 2 h ) . synthesized by general procedure b. flash column chromatography : 1030% ethyl acetate in hexanes to yield 27 as a pale red - brown solid in 97% yield . h nmr ( 500 mhz , dmso - d6 ) 9.24 ( s , 1 h ) , 8.80 ( s , 1 h ) , 8.07 ( d , j = 2.4 hz , 1 h ) , 8.02 ( d , j = 5.9 hz , 1 h ) , 7.82 ( dd , j = 8.8 , 1.5 hz , 1 h ) , 7.727.79 ( m , 2 h ) , 7.417.49 ( m , 1 h ) , 7.277.35 ( m , 2 h ) , 7.137.23 ( m , 3 h ) , 5.21 ( s , 2 h ) . synthesized by general procedure b. flash column chromatography : 1030% ethyl acetate in hexanes to yield 28 as a light red solid in 93% yield . h nmr ( 500 mhz , dmso - d6 ) 9.22 ( s , 1 h ) , 8.80 ( s , 1 h ) , 8.07 ( d , j = 2.4 hz , 1 h ) , 8.02 ( d , j = 5.9 hz , 1 h ) , 7.81 ( dd , j = 8.8 , 1.5 hz , 1 h ) , 7.737.78 ( m , 2 h ) , 7.48 ( d , j = 7.3 hz , 2 h ) , 7.40 ( t , j = 7.6 hz , 2 h ) , 7.33 ( t , j = 7.3 hz , 1 h ) , 7.21 ( d , j = 8.8 hz , 1 h ) , 7.15 ( d , j = 5.9 hz , 1 h ) , 5.18 ( s , 2 h ) . lcms found 439.2 [ m + h ] . synthesized by general procedure b. flash column chromatography : 1030% ethyl acetate in hexanes to yield 29 as a salmon colored solid in 91% yield . h nmr ( 500 mhz , dmso - d6 ) 9.27 ( s , 1 h ) , 8.45 ( d , j = 8.8 hz , 1 h ) , 8.08 ( dd , j = 12.0 , 2.2 hz , 2 h ) , 8.01 ( d , j = 5.4 hz , 1 h ) , 7.75 ( ddd , j = 13.8 , 9.2 , 2.4 hz , 2 h ) , 7.46 ( m , j = 5.9 hz , 1 h ) , 7.277.35 ( m , 2 h ) , 7.107.23 ( m , 3 h ) , 5.22 ( s , 2 h ) . synthesized by general procedure b. flash column chromatography : 1030% ethyl acetate in hexanes to yield 30 as a burnt orange solid in 81% yield . h nmr ( 500 mhz , dmso - d6 ) 9.24 ( s , 1 h ) , 8.45 ( d , j = 8.8 hz , 1 h ) , 8.10 ( d , j = 2.0 hz , 1 h ) , 8.05 ( d , j = 2.4 hz , 1 h ) , 8.01 ( d , j = 5.9 hz , 1 h ) , 7.76 ( dd , j = 9.0 , 2.2 hz , 1 h ) , 7.72 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.48 ( d , j = 6.8 hz , 2 h ) , 7.41 ( t , j = 7.3 hz , 2 h ) , 7.34 ( t , j = 7.8 hz , 1 h ) , 7.21 ( d , j = 9.3 hz , 1 h ) , 7.13 ( d , j = 5.9 hz , 1 h ) , 5.19 ( s , 2 h ) . synthesized by general procedure c. flash column chromatography : 5% methanol in dichloromethane to yield an inseparable 10:1 mixture of 31 and dichloro side product as a vibrant yellow solid in 54% yield . h nmr ( 500 mhz , dmso - d6 ) 9.33 ( s , 1 h ) , 8.78 ( s , 1 h ) , 8.70 ( d , j = 1.5 hz , 1 h ) , 8.14 ( d , j = 8.8 hz , 1 h ) , 7.97 ( dd , j = 9.3 , 1.5 hz , 1 h ) , 7.54 ( d , j = 2.0 hz , 1 h ) , 7.48 ( td , j = 8.3 , 6.3 hz , 1 h ) , 7.40 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.307.37 ( m , 3 h ) , 7.20 ( td , j = 9.3 , 2.0 hz , 1 h ) , 5.29 ( s , 2 h ) . synthesized by general procedure c. flash column chromatography : 5% methanol in dichloromethane to yield an inseparable 10:1 mixture of 32 and dichloro side product as a yellow solid in 68% yield . h nmr ( 500 mhz , dmso - d6 ) 9.32 ( s , 1 h ) , 8.78 ( s , 1 h ) , 8.71 ( d , j = 2.0 hz , 1 h ) , 8.14 ( d , j = 9.3 hz , 1 h ) , 7.97 ( dd , j = 9.0 , 1.7 hz , 1 h ) , 7.477.55 ( m , 3 h ) , 7.44 ( t , j = 7.6 hz , 2 h ) , 7.337.41 ( m , 3 h ) , 5.26 ( s , 2 h ) . synthesized by general procedure c. flash column chromatography : 5% methanol in dichloromethane to yield 33 as a brown solid in 55% yield with 84% purity . h nmr ( 500 mhz , dmso - d6 ) 9.43 ( s , 1 h ) , 8.76 ( s , 1 h ) , 8.41 ( d , j = 2.0 hz , 1 h ) , 8.35 ( d , j = 9.3 hz , 1 h ) , 7.90 ( dd , j = 9.0 , 2.2 hz , 1 h ) , 7.55 ( d , j = 2.4 hz , 1 h ) , 7.49 ( m , j = 6.3 hz , 1 h ) , 7.41 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.317.37 ( m , 3 h ) , 7.20 ( td , j = 8.4 , 2.7 hz , 1 h ) , 5.29 ( s , 2 h ) . synthesized by general procedure c. flash column chromatography : 5% methanol in dichloromethane to yield 34 as a metallic bronze colored solid in 57% yield with 85% purity . h nmr ( 500 mhz , dmso - d6 ) 9.42 ( s , 1 h ) , 8.75 ( s , 1 h ) , 8.41 ( d , j = 2.0 hz , 1 h ) , 8.35 ( d , j = 8.8 hz , 1 h ) , 7.90 ( dd , j = 9.0 , 2.2 hz , 1 h ) , 7.54 ( d , j = 2.4 hz , 1 h ) , 7.51 ( d , j = 7.3 hz , 2 h ) , 7.43 ( t , j = 7.6 hz , 2 h ) , 7.40 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.337.38 ( m , 2 h ) , 5.26 ( s , 2 h ) . synthesized by general procedure d. flash column chromatography : 520% ethyl acetate in dichloromethane to yield 35 as a yellow solid in 69% yield . h nmr ( 500 mhz , dmso - d6 ) 9.21 ( s , 1 h ) , 9.13 ( s , 1 h ) , 8.87 ( s , 1 h ) , 8.16 ( d , j = 2.4 hz , 1 h ) , 8.11 ( dd , j = 8.8 , 1.5 hz , 1 h ) , 7.99 ( d , j = 8.8 hz , 1 h ) , 7.81 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.47 ( td , j = 7.9 , 6.1 hz , 1 h ) , 7.297.36 ( m , 2 h ) , 7.25 ( d , j = 9.3 hz , 1 h ) , 7.17 ( td , j = 8.7 , 2.2 hz , 1 h ) , 5.24 ( s , 2 h ) . synthesized by general procedure d. flash column chromatography : 520% ethyl acetate in dichloromethane to yield 36 as a light greenish brown solid in 78% yield . h nmr ( 500 mhz , dmso - d6 ) 9.20 ( s , 1 h ) , 9.14 ( s , 1 h ) , 8.88 ( s , 1 h ) , 8.15 ( d , j = 2.4 hz , 1 h ) , 8.13 ( dd , j = 8.5 , 1.7 hz , 1 h ) , 8.00 ( d , j = 8.8 hz , 1 h ) , 7.80 ( dd , j = 9.0 , 2.7 hz , 1 h ) , 7.50 ( d , j = 7.3 hz , 2 h ) , 7.42 ( t , j = 7.6 hz , 2 h ) , 7.35 ( t , j = 7.3 hz , 1 h ) , 7.27 ( d , j = 8.8 hz , 1 h ) , 5.21 ( s , 2 h ) . synthesized by general procedure d. flash column chromatography : 520% ethyl acetate in dichloromethane to yield 37 as a light brown solid in 64% yield . h nmr ( 500 mhz , dmso - d6 ) 9.42 ( s , 1 h ) , 9.09 ( s , 1 h ) , 8.62 ( d , j = 9.3 hz , 1 h ) , 8.33 ( d , j = 2.0 hz , 1 h ) , 8.19 ( d , j = 2.4 hz , 1 h ) , 8.16 ( dd , j = 9.0 , 2.2 hz , 1 h ) , 7.83 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.47 ( td , j = 7.8 , 5.9 hz , 1 h ) , 7.32 ( m , j = 7.3 hz , 2 h ) , 7.25 ( d , j = 9.3 hz , 1 h ) , 7.17 ( td , j = 8.5 , 2.0 hz , 1 h ) , 5.24 ( s , 2 h ) . synthesized by general procedure d. flash column chromatography : 530% ethyl acetate in dichloromethane to yield 38 as a green - gray colored solid in 75% yield . h nmr ( 500 mhz , dmso - d6 ) 9.25 ( s , 1 h ) , 9.09 ( s , 1 h ) , 8.51 ( d , j = 8.8 hz , 1 h ) , 8.33 ( d , j = 2.0 hz , 1 h ) , 8.17 ( dd , j = 8.8 , 2.0 hz , 1 h ) , 8.14 ( d , j = 2.9 hz , 1 h ) , 7.78 ( dd , j = 9.0 , 2.7 hz , 1 h ) , 7.49 ( d , j = 6.8 hz , 2 h ) , 7.42 ( t , j = 7.6 hz , 2 h ) , 7.35 ( t , j = 7.3 hz , 1 h ) , 7.26 ( d , j = 8.8 hz , 1 h ) , 5.21 ( s , 2 h ) . synthesized by general procedure a , collected as a yellow solid in 80% yield . h nmr ( 400 mhz , dmso - d6 ) 9.03 ( s , 1h ) , 8.85 ( br , s , 1h ) , 8.23 ( d , j = 8.8 hz , 1h ) , 7.73 ( d , j = 8.8 , 1h ) , 7.59 ( d , j = 2.4 , 1h ) , 7.457.50 ( m , 1h ) , 7.307.39 ( m , 4h ) , 7.187.22 ( m , 1h ) , 5.30 ( s , 2h ) . synthesized by general procedure a , collected as a yellow solid in 52% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.02 ( s , 1h ) , 8.82 ( br , s , 1h ) , 8.22 ( d , j = 9.0 hz , 1h ) , 7.72 ( d , j = 8.5 hz , 1h ) , 7.57 ( s , 1h ) , 7.5 ( d , j = 7.0 hz , 2h ) , 7.43 ( t , j = 7.5 hz , 2h ) , 7.35 ( m , 3h ) , 5.26 ( s , 2h ) . h nmr ( 400 mhz , dmso - d6 ) ppm 10.64 ( s , 1 h ) , 8.71 ( s , 1 h ) , 7.87 ( d , j = 2.9 hz , 1 h ) , 7.74 ( s , 1 h ) , 7.57 ( dd , j = 8.8 , 2.2 hz , 1 h ) , 7.47 ( m , 1 h ) , 7.31 ( m , 3 h ) , 7.19 ( td , j = 8.1 , 2.2 hz , 1 h ) , 5.28 ( s , 2 h ) . h nmr ( 500 mhz , dmso - d6 ) ppm 9.7 1 ( s , 1 h ) , 8.54 ( s , 1 h ) , 7.89 ( d , j = 2.0 hz , 1 h ) , 7.68 ( s , 1 h ) , 7.58 ( dd , j = 8.8 , 2.9 hz , 1 h ) , 7.49 ( d , j = 7.8 hz , 2 h ) , 7.42 ( t , j = 7.6 hz , 2 h ) , 7.35 ( t , j = 7.3 hz , 1 h ) , 7.26 ( d , j = 8.8 hz , 1 h ) , 5.23 ( s , 2 h ) . h nmr ( 500 mhz , dmso - d6 ) 9.80 ( s , 1h ) , 8.49 ( s , 1h ) , 8.12 ( s , 1h ) , 8.02 ( d , j = 2.4 hz , 1h ) , 7.67 ( dd , j = 2.7 , 9.03 hz , 1h ) , 7.437.49 ( m , 1h ) , 7.247.35 ( m , 3h ) , 7.18 ( dt , j = 2.4 , 8.6 hz , 1h ) , 5.24 ( s , 2h ) . h nmr ( 500 mhz , dmso - d6 ) ppm 9.94 ( s , 1 h ) , 8.49 ( s , 1 h ) , 8.19 ( s , 1 h ) , 8.02 ( d , j = 2.4 hz , 1 h ) , 7.68 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.49 ( m , 2 h ) , 7.41 ( m , 2 h ) , 7.34 ( m , 1 h ) , 7.27 ( d , j = 9.3 hz , 1 h ) , 5.21 ( s , 2 h ) . lcms found 445.9 [ m + h ] . in a 25 ml microwave vial equipped with a stir bar were added aryl bromide ( 1 equiv ) , boronic ester ( 1.3 equiv ) , 1:1 water / ethanol ( 0.04 m ) , triethylamine ( 3 equiv ) , and palladium(ii ) acetate ( 0.01 m in acetone , 1 mol % ) . the vial was sealed with a septum , and the contents were irradiated to and held at 120 c with stirring for 1 h. the reaction mixture was cooled to room temperature , diluted with water ( 8 ml ) , and extracted with dichloromethane ( 3 8 ml ) . naoh ( 1 m , 2 5 ml ) , water ( 5 ml ) , and brine ( 5 ml ) . the crude product was purified by flash column chromatography . in a 25 ml microwave vial equipped with a stir bar were added aryl bromide ( 1 equiv ) , boronic ester ( 1.3 equiv ) , 1:1 water / ethanol ( 0.04 m ) , triethylamine ( 3 equiv ) , and bis(triphenylphosphine)palladium(ii ) chloride ( 2.5 mol % ) . the vial was sealed with a septum , and the contents were irradiated to and held at 120 c with stirring for 1 h. the reaction mixture was cooled to room temperature , diluted with water ( 8 ml ) , and extracted with dichloromethane ( 3 8 ml ) . naoh ( 1 m , 2 5 ml ) , water ( 5 ml ) , and brine ( 5 ml ) . the organic layer was then dried over na2so4 and concentrated on to silica . the crude product was purified by flash column chromatography . in a 25 ml microwave vial equipped with a stir bar were added aryl bromide ( 1 equiv ) , boronic ester ( 1.3 equiv ) , 1:1 water / ethanol ( 0.04 m ) , triethylamine ( 3 equiv ) , and palladium(ii ) acetate ( 5 mol % ) . the vial was sealed with a septum , and the contents were irradiated to and held at 120 c with stirring for 3 h. the reaction mixture was cooled to room temperature , diluted with water ( 8 ml ) , and extracted with dichloromethane ( 3 8 ml ) . naoh ( 1 m , 2 5 ml ) , water ( 5 ml ) , and brine ( 5 ml ) . the crude product was purified by flash column chromatography . to a solution of the appropriate aryl iodide ( 1 equiv ) in 3:2 dimethoxyethane / ethanol ( 0.05 m ) 2 m na2co3 ( 6 equiv ) , and pd(pph3)4 ( 5 mol % ) . the mixture was purged with nitrogen and heated at 85 c for 7 h. the mixture was cooled to room temperature and filtered , and the filtrate was concentrated . the residue was dissolved in ethyl acetate , washed with water , washed with brine , dried over na2so4 , and purified by flash column chromatography . to a solution of the appropriate aryl bromide ( 1 equiv ) in 3:2 dimethoxyethane / ethanol ( 0.05 m ) 2 m na2co3 ( 6 equiv ) , and pd(pph3)4 ( 7 mol % ) . the mixture was heated at 85 c for 12 h , then cooled to room temperature , and the solvents were removed under reduced pressure . the residue was purified by silica column chromatography ( hexanes / ethyl acetate ) and then by reverse phase chromatography ( water / acetonitrile ) unless otherwise mentioned . synthesized by general procedure a. flash column chromatography : 25% methanol in dichloromethane , isolated as a yellow solid in 27% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.10 ( br . s. , 1 h ) , 8.61 ( d , j = 2.0 hz , 1 h ) , 8.43 ( d , j = 5.4 hz , 1 h ) , 8.04 ( dd , j = 8.8 , 2.0 hz , 1 h ) , 7.92 ( d , j = 8.8 hz , 1 h ) , 7.457.52 ( m , 2 h ) , 7.39 ( t , j = 7.8 hz , 1 h ) , 7.297.37 ( m , 6 h ) , 7.20 ( td , j = 8.8 , 2.0 hz , 1 h ) , 7.00 ( dd , j = 8.1 , 1.7 hz , 1 h ) , 6.77 ( d , j = 5.4 hz , 1 h ) , 5.28 ( s , 2 h ) , 3.753.81 ( m , 4 h ) , 3.193.26 ( m , 4 h ) . lcms found 540.1 [ m + h ] . synthesized by general procedure a. flash column chromatography : 25% methanol in dichloromethane , isolated as a yellow solid in 24% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 8.99 ( br . s. , 1 h ) , 8.47 ( d , j = 5.4 hz , 1 h ) , 8.41 ( d , j = 8.8 hz , 1 h ) , 8.12 ( d , j = 2.0 hz , 1 h ) , 7.88 ( dd , j = 8.8 , 1.5 hz , 1 h ) , 7.457.51 ( m , 2 h ) , 7.267.40 ( m , 7 h ) , 7.20 ( td , j = 8.8 , 2.4 hz , 1 h ) , 7.02 ( dd , j = 8.3 , 2.0 hz , 1 h ) , 6.76 ( d , j = 5.4 hz , 1 h ) , 5.27 ( s , 2 h ) , 3.743.82 ( m , 4 h ) , 3.203.27 ( m , 4 h ) . synthesized by general procedure a. flash column chromatography : 05% methanol in dichloromethane , isolated as a tan colored solid in 65% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.14 ( s , 1 h ) , 8.78 ( d , j = 2.0 hz , 1 h ) , 8.47 ( d , j = 5.4 hz , 1 h ) , 8.17 ( d , j = 8.8 hz , 2 h ) , 8.11 ( dd , j = 8.8 , 2.0 hz , 1 h ) , 7.98 ( d , j = 8.8 hz , 1 h ) , 7.88 ( d , j = 8.3 hz , 2 h ) , 7.51 ( d , j = 7.3 hz , 2 h ) , 7.48 ( d , j = 1.5 hz , 1 h ) , 7.43 ( t , j = 7.6 hz , 2 h ) , 7.327.39 ( m , 3 h ) , 6.80 ( d , j = 5.4 hz , 1 h ) , 5.25 ( s , 2 h ) , 3.613.70 ( m , 4 h ) , 2.882.97 ( m , 4 h ) . synthesized by general procedure a. flash column chromatography : 25% methanol in dichloromethane , isolated as a tan colored solid in 63% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.02 ( s , 1 h ) , 8.50 ( m , j = 5.4 hz , 2 h ) , 8.25 ( d , j = 1.5 hz , 1 h ) , 8.18 ( d , j = 8.8 hz , 2 h ) , 7.97 ( dd , j = 8.8 , 1.5 hz , 1 h ) , 7.87 ( d , j = 8.3 hz , 2 h ) , 7.51 ( d , j = 7.3 hz , 2 h ) , 7.47 ( d , j = 2.0 hz , 1 h ) , 7.44 ( t , j = 7.6 hz , 2 h ) , 7.36 ( m , j = 6.8 hz , 1 h ) , 7.307.34 ( m , 2 h ) , 6.79 ( d , j = 5.4 hz , 1 h ) , 5.24 ( s , 2 h ) , 3.623.70 ( m , 4 h ) , 2.902.97 ( m , 4 h ) . synthesized by general procedure a. flash column chromatography : 510% methanol in dichloromethane , isolated as a yellow solid in 40% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.19 ( br . s. , 1 h ) , 8.78 ( d , j = 2.0 hz , 1 h ) , 8.47 ( d , j = 5.4 hz , 1 h ) , 8.16 ( d , j = 8.8 hz , 2 h ) , 8.12 ( dd , j = 8.8 , 2.0 hz , 1 h ) , 7.98 ( d , j = 8.8 hz , 1 h ) , 7.87 ( d , j = 8.8 hz , 2 h ) , 7.457.52 ( m , 2 h ) , 7.307.38 ( m , 4 h ) , 7.20 ( td , j = 8.7 , 2.7 hz , 1 h ) , 6.81 ( d , j = 5.4 hz , 1 h ) , 5.28 ( s , 2 h ) , 2.95 ( br . s. , 4 h ) , 2.352.43 ( m , 4 h ) , 2.15 ( s , 3 h ) . synthesized by general procedure a. flash column chromatography : 510% methanol in dichloromethane , isolated as a yellow solid in 33% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.10 ( br . s. , 1 h ) , 8.50 ( d , j = 8.3 hz , 2 h ) , 8.25 ( d , j = 2.0 hz , 1 h ) , 8.16 ( d , j = 8.3 hz , 2 h ) , 7.97 ( dd , j = 8.8 , 2.0 hz , 1 h ) , 7.87 ( d , j = 8.3 hz , 2 h ) , 7.457.52 ( m , 2 h ) , 7.297.38 ( m , 4 h ) , 7.20 ( td , j = 8.5 , 2.0 hz , 1 h ) , 6.80 ( d , j = 5.4 hz , 1 h ) , 5.28 ( s , 2 h ) , 2.96 ( br . s. , 4 h ) , 2.40 ( br . then prep hplc : 595% acetonitrile in water , isolated as a yellow solid in 10% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 8.77 ( d , j = 2.0 hz , 1 h ) , 8.46 ( d , j = 5.4 hz , 1 h ) , 8.27 ( s , 1 h ) , 8.078.15 ( m , 3 h ) , 7.97 ( d , j = 8.8 hz , 1 h ) , 7.92 ( d , j = 8.3 hz , 2 h ) , 7.457.52 ( m , 2 h ) , 7.307.38 ( m , 4 h ) , 7.20 ( td , j = 8.5 , 2.4 hz , 1 h ) , 6.80 ( d , j = 5.4 hz , 1 h ) , 5.28 ( s , 2 h ) , 3.36 ( m , j = 5.2 , 2.5 , 2.5 hz , 2 h ) , 3.33 ( t , j = 6.3 hz , 2 h ) , 2.532.57 ( m , 2 h ) , 2.47 ( m , j = 5.9 hz , 2 h ) , 2.22 ( s , 3 h ) , 1.74 ( quin , j = 5.9 hz , 2 h ) . synthesized by general procedure a. flash column chromatography : 520% methanol in dichloromethane , isolated as a brown solid in 32% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.06 ( s , 1 h ) , 8.478.52 ( m , 2 h ) , 8.23 ( d , j = 2.0 hz , 1 h ) , 8.12 ( d , j = 8.3 hz , 2 h ) , 7.96 ( dd , j = 8.8 , 2.0 hz , 1 h ) , 7.91 ( d , j = 8.3 hz , 2 h ) , 7.457.52 ( m , 2 h ) , 7.297.37 ( m , 4 h ) , 7.20 ( td , j = 8.5 , 2.4 hz , 1 h ) , 6.79 ( d , j = 4.9 hz , 1 h ) , 5.27 ( s , 2 h ) , 3.39 ( m , j = 3.4 hz , 2 h ) , 3.313.35 ( m , 2 h ) , 2.63 ( br . s. , 2 h ) , 2.58 ( br . s. , 2 h ) , 2.29 ( br . s. , 3 h ) , 1.741.83 ( m , 2 h ) . synthesized by general procedure a. flash column chromatography : 3050% ethyl acetate in hexanes , isolated as a biege solid in 59% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.27 ( s , 1 h ) , 8.71 ( s , 1 h ) , 8.06 ( d , j = 2.4 hz , 1 h ) , 8.03 ( dd , j = 8.3 , 1.5 hz , 1 h ) , 7.98 ( d , j = 5.4 hz , 1 h ) , 7.88 ( d , j = 8.8 hz , 1 h ) , 7.76 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.47 ( td , j = 8.1 , 6.3 hz , 1 h ) , 7.40 ( t , j = 7.8 hz , 1 h ) , 7.297.36 ( m , 4 h ) , 7.23 ( d , j = 9.3 hz , 1 h ) , 7.157.21 ( m , 2 h ) , 7.02 ( dd , j = 8.3 , 2.0 hz , 1 h ) , 5.23 ( s , 2 h ) , 3.753.82 ( m , 4 h ) , 3.203.26 ( m , 4 h ) . synthesized by general procedure a. flash column chromatography : 3050% ethyl acetate in hexanes , isolated as an orange solid in 81% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.21 ( s , 1 h ) , 8.56 ( d , j = 8.8 hz , 1 h ) , 8.13 ( d , j = 2.4 hz , 1 h ) , 8.11 ( d , j = 2.0 hz , 1 h ) , 8.00 ( d , j = 5.4 hz , 1 h ) , 7.94 ( dd , j = 8.8 , 1.5 hz , 1 h ) , 7.78 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.47 ( td , j = 8.0 , 6.3 hz , 1 h ) , 7.357.41 ( m , 2 h ) , 7.307.35 ( m , 2 h ) , 7.28 ( d , j = 7.8 hz , 1 h ) , 7.207.25 ( m , 2 h ) , 7.18 ( td , j = 8.8 , 2.4 hz , 1 h ) , 7.03 ( dd , j = 8.1 , 2.2 hz , 1 h ) , 5.23 ( s , 2 h ) , 3.763.81 ( m , 4 h ) , 3.213.25 ( m , 4 h ) . lcms found 540.2 [ m + h ] . synthesized by general procedure a. flash column chromatography : 2050% ethyl acetate in hexanes , isolated as an orange solid in 55% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.35 ( s , 1 h ) , 8.86 ( s , 1 h ) , 8.18 ( d , j = 8.8 hz , 2 h ) , 8.12 ( dd , j = 8.8 , 1.5 hz , 1 h ) , 8.04 ( d , j = 2.4 hz , 1 h ) , 8.03 ( d , j = 5.9 hz , 1 h ) , 7.96 ( d , j = 8.3 hz , 1 h ) , 7.90 ( d , j = 8.3 hz , 2 h ) , 7.76 ( dd , j = 9.3 , 2.9 hz , 1 h ) , 7.50 ( d , j = 6.8 hz , 2 h ) , 7.42 ( t , j = 7.3 hz , 2 h ) , 7.35 ( t , j = 7.3 hz , 1 h ) , 7.25 ( d , j = 9.3 hz , 1 h ) , 7.22 ( d , j = 5.9 hz , 1 h ) , 5.21 ( s , 2 h ) , 3.633.70 ( m , 4 h ) , 2.902.96 ( m , 4 h ) . synthesized by general procedure a. flash column chromatography : 3050% ethyl acetate in hexanes , isolated as an orange solid in 81% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.26 ( s , 1 h ) , 8.65 ( d , j = 9.3 hz , 1 h ) , 8.25 ( d , j = 1.5 hz , 1 h ) , 8.16 ( d , j = 8.8 hz , 2 h ) , 8.12 ( d , j = 2.9 hz , 1 h ) , 8.018.07 ( m , 2 h ) , 7.88 ( d , j = 8.3 hz , 2 h ) , 7.78 ( dd , j = 9.0 , 2.7 hz , 1 h ) , 7.50 ( d , j = 6.8 hz , 2 h ) , 7.42 ( t , j = 7.3 hz , 2 h ) , 7.35 ( t , j = 7.3 hz , 1 h ) , 7.27 ( d , j = 5.9 hz , 1 h ) , 7.23 ( d , j = 9.3 hz , 1 h ) , 5.20 ( s , 1 h ) , 3.623.69 ( m , 4 h ) , 2.892.97 ( m , 4 h ) . synthesized by general procedure a. flash column chromatography : ethyl acetate , isolated as a cream colored solid in 53% yield . h nmr ( 500 mhz , cdcl3 ) ppm 8.118.14 ( m , 2 h ) , 7.797.89 ( m , 7 h ) , 7.54 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.36 ( td , j = 7.8 , 5.9 hz , 1 h ) , 7.28 ( s , 1 h ) , 7.217.27 ( m , 2 h ) , 7.18 ( d , j = 5.9 hz , 1 h ) , 7.03 ( td , j = 8.3 , 2.4 hz , 1 h ) , 6.97 ( d , j = 8.8 hz , 1 h ) , 5.15 ( s , 2 h ) , 3.08 ( br . s. , 4 h ) , 2.49 ( t , j = 4.6 hz , 4 h ) , 2.28 ( s , 3 h ) . synthesized by general procedure a. flash column chromatography : ethyl acetate , isolated as a pale orange solid in 52% yield . h nmr ( 500 mhz , cdcl3 ) ppm 8.14 ( d , j = 5.9 hz , 1 h ) , 8.02 ( d , j = 8.8 hz , 1 h ) , 7.95 ( d , j = 2.0 hz , 1 h ) , 7.837.91 ( m , 5 h ) , 7.76 ( dd , j = 8.5 , 1.7 hz , 1 h ) , 7.50 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.37 ( td , j = 7.8 , 5.9 hz , 1 h ) , 7.227.27 ( m , 2 h ) , 7.21 ( d , j = 5.9 hz , 1 h ) , 7.007.07 ( m , 2 h ) , 6.98 ( d , j = 8.8 hz , 1 h ) , 5.16 ( s , 2 h ) , 3.11 ( br . s. , 4 h ) , 2.52 ( t , j = 4.6 hz , 4 h ) , 2.29 ( s , 3 h ) . synthesized by general procedure a. flash column chromatography : 5% methanol in dichloromethane , isolated as an orange solid in 73% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.36 ( s , 1 h ) , 8.85 ( s , 1 h ) , 8.098.14 ( m , 3 h ) , 8.05 ( d , j = 2.4 hz , 1 h ) , 8.02 ( d , j = 5.9 hz , 1 h ) , 7.917.97 ( m , 3 h ) , 7.77 ( dd , j = 8.8 , 2.9 hz , 1 h ) , 7.47 ( td , j = 8.1 , 6.3 hz , 1 h ) , 7.297.36 ( m , 2 h ) , 7.24 ( d , j = 9.3 hz , 1 h ) , 7.22 ( d , j = 5.4 hz , 1 h ) , 7.18 ( td , j = 9.3 , 2.0 hz , 1 h ) , 5.24 ( s , 2 h ) , 3.353.38 ( m , 2 h ) , 3.313.35 ( m , 2 h ) , 2.542.58 ( m , 2 h ) , 2.472.49 ( m , 2 h ) , 2.23 ( s , 3 h ) , 1.75 ( quin , j = 5.8 hz , 2 h ) . synthesized by general procedure a. flash column chromatography : 5% methanol in dichloromethane , isolated as a pale yellow solid in 68% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.26 ( s , 1 h ) , 8.64 ( d , j = 8.8 hz , 1 h ) , 8.23 ( d , j = 1.5 hz , 1 h ) , 8.13 ( d , j = 2.4 hz , 1 h ) , 8.10 ( d , j = 8.3 hz , 2 h ) , 8.008.06 ( m , 2 h ) , 7.92 ( d , j = 8.3 hz , 2 h ) , 7.79 ( dd , j = 9.0 , 2.7 hz , 1 h ) , 7.47 ( td , j = 8.3 , 6.3 hz , 1 h ) , 7.297.35 ( m , 2 h ) , 7.27 ( d , j = 5.9 hz , 1 h ) , 7.22 ( d , j = 9.3 hz , 1 h ) , 7.18 ( td , j = 8.7 , 2.7 hz , 1 h ) , 5.23 ( s , 2 h ) , 3.36 ( m , j = 4.9 , 2.4 , 2.4 hz , 2 h ) , 3.313.35 ( m , 2 h ) , 2.532.58 ( m , 2 h ) , 2.462.49 ( m , 2 h ) , 2.23 ( s , 3 h ) , 1.75 ( quin , j = 5.8 hz , 2 h ) . synthesized by general procedure b. flash column chromatography : 210% methanol in dichloromethane , isolated as a yellow solid in 67% yield . s. , 1 h ) , 8.30 ( s , 1 h ) , 8.26 ( d , j = 4.9 hz , 1 h ) , 7.95 ( dd , j = 9.0 , 1.2 hz , 1 h ) , 7.487.59 ( m , 1 h ) , 7.327.41 ( m , 2 h ) , 7.29 ( t , j = 7.8 hz , 1 h ) , 7.177.24 ( m , 2 h ) , 7.087.17 ( m , 3 h ) , 7.02 ( td , j = 8.4 , 2.2 hz , 1 h ) , 6.876.94 ( m , 2 h ) , 5.13 ( s , 2 h ) , 3.763.82 ( m , 4 h ) , 3.093.16 ( m , 4 h ) . synthesized by general procedure b. flash column chromatography : 28% methanol in dichloromethane , then 50100% ethyl acetate in hexanes , isolated as a yellow solid in 38% yield . s. , 1 h ) , 8.31 ( d , j = 8.8 hz , 1 h ) , 7.96 ( d , j = 8.8 hz , 1 h ) , 7.387.50 ( m , 3 h ) , 7.237.35 ( m , 5 h ) , 7.15 ( d , j = 8.8 hz , 1 h ) , 7.06 ( m , j = 8.3 , 2.0 hz , 2 h ) , 5.24 ( s , 2 h ) , 3.903.96 ( m , 4 h ) , 3.273.32 ( m , 4 h ) . synthesized by general procedure a. flash column chromatography : 2% methanol and 18% acetone in dichloromethane , then 1% methanol in ethyl acetate , isolated as a yellow solid in 8% yield . s. , 2 h ) , 8.098.40 ( m , 4 h ) , 7.91 ( d , j = 7.8 hz , 2 h ) , 7.487.60 ( m , 3 h ) , 7.44 ( t , j = 7.6 hz , 3 h ) , 7.37 ( t , j = 7.3 hz , 2 h ) , 5.26 ( s , 2 h ) , 3.613.70 ( m , 4 h ) , 2.872.99 ( m , 4 h ) . synthesized by general procedure b. flash column chromatography : 28% methanol in dichloromethane , then 10100% ethyl acetate in dichloromethane , isolated as a yellow solid in 71% yield . s. , 1 h ) , 8.40 ( d , j = 8.8 hz , 1 h ) , 8.05 ( d , j = 8.3 hz , 2 h ) , 8.01 ( d , j = 8.8 hz , 1 h ) , 7.95 ( d , j = 8.3 hz , 2 h ) , 7.52 ( d , j = 7.3 hz , 2 h ) , 7.48 ( br . s. , 1 h ) , 7.43 ( t , j = 7.6 hz , 2 h ) , 7.36 ( t , j = 7.3 hz , 1 h ) , 7.30 ( d , j = 8.8 hz , 1 h ) , 7.17 ( d , j = 8.8 hz , 1 h ) , 5.25 ( s , 2 h ) , 3.773.82 ( m , 4 h ) , 3.073.12 ( m , 4 h ) . synthesized by general procedure a. flash column chromatography : 510% methanol in dichloromethane , then 1030% methanol in ethyl acetate , isolated as a yellow solid in 15% yield . h nmr ( 500 mhz , dmso - d6 ) 9.81 ( s , 1 h ) , 9.01 ( s , 1 h ) , 8.82 ( s , 1 h ) , 8.218.34 ( m , 4 h ) , 7.88 ( d , j = 8.3 hz , 2 h ) , 7.61 ( d , j = 2.0 hz , 1 h ) , 7.437.53 ( m , 2 h ) , 7.297.40 ( m , 3 h ) , 7.20 ( t , j = 8.8 hz , 1 h ) , 5.29 ( s , 2 h ) , 2.95 ( br . synthesized by general procedure b. flash column chromatography : 510% methanol in dichloromethane , isolated as a yellow solid in 50% yield . s. , 1 h ) , 8.39 ( d , j = 8.8 hz , 1 h ) , 7.938.04 ( m , 5 h ) , 7.48 ( br . s. , 1 h ) , 7.42 ( td , j = 8.1 , 5.9 hz , 1 h ) , 7.31 ( d , j = 7.8 hz , 2 h ) , 7.26 ( d , j = 9.8 hz , 1 h ) , 7.16 ( d , j = 8.8 hz , 1 h ) , 7.06 ( td , j = 8.5 , 2.0 hz , 1 h ) , 5.25 ( s , 2 h ) , 3.483.52 ( m , 2 h ) , 3.46 ( t , j = 6.3 hz , 2 h ) , 2.732.77 ( m , 2 h ) , 2.692.73 ( m , 2 h ) , 2.40 ( s , 3 h ) , 1.95 ( dt , j = 11.4 , 5.8 hz , 2 h ) . lcms found 618.1 [ m + h ] . synthesized by general procedure b. flash column chromatography : 210% methanol in dichloromethane , isolated as a yellow solid in 61% yield s. , 1 h ) , 8.62 ( s , 1 h ) , 8.31 ( br . s. , 1 h ) , 8.14 ( d , j = 8.8 hz , 1 h ) , 8.02 ( d , j = 8.3 hz , 2 h ) , 7.94 ( d , j = 8.8 hz , 2 h ) , 7.48 ( br . s. , 1 h ) , 7.387.45 ( m , 2 h ) , 7.237.33 ( m , 3 h ) , 7.16 ( d , j = 8.8 hz , 1 h ) , 7.06 ( td , j = 8.4 , 2.2 hz , 1 h ) , 5.25 ( s , 2 h ) , 3.473.50 ( m , 2 h ) , 3.45 ( t , j = 6.6 hz , 2 h ) , 2.702.74 ( m , 2 h ) , 2.662.70 ( m , 2 h ) , 2.38 ( s , 3 h ) , 1.891.96 ( m , 2 h ) . synthesized by general procedure b. flash column chromatography : 515% methanol in dichloromethane , isolated as a yellow solid in 52% yield . s. , 1 h ) , 8.39 ( d , j = 8.8 hz , 1 h ) , 7.938.04 ( m , 5 h ) , 7.48 ( br . s. , 1 h ) , 7.42 ( td , j = 8.1 , 5.9 hz , 1 h ) , 7.31 ( d , j = 7.8 hz , 2 h ) , 7.26 ( d , j = 9.8 hz , 1 h ) , 7.16 ( d , j = 8.8 hz , 1 h ) , 7.06 ( td , j = 8.5 , 2.0 hz , 1 h ) , 5.25 ( s , 2 h ) , 3.483.52 ( m , 2 h ) , 3.46 ( t , j = 6.3 hz , 2 h ) , 2.732.77 ( m , 2 h ) , 2.692.73 ( m , 2 h ) , 2.40 ( s , 3 h ) , 1.95 ( dt , j = 11.4 , 5.8 hz , 2 h ) . lcms found 632.1 [ m + h ] . synthesized by general procedure c. flash column chromatography : 4080% ethyl acetate in hexanes , then prep hplc 3050% acetonitrile in water , isolated as a yellow solid in 9% yield . h nmr ( 500 mhz , dmso - d6 ) 9.27 ( s , 1 h ) , 9.14 ( s , 1 h ) , 8.78 ( s , 1 h ) , 8.27 ( dd , j = 8.3 , 1.5 hz , 1 h ) , 8.16 ( d , j = 2.4 hz , 1 h ) , 8.09 ( d , j = 8.3 hz , 1 h ) , 7.82 ( dd , j = 9.0 , 2.7 hz , 1 h ) , 7.407.50 ( m , 2 h ) , 7.39 ( s , 1 h ) , 7.307.36 ( m , 3 h ) , 7.27 ( d , j = 8.8 hz , 1 h ) , 7.18 ( td , j = 8.7 , 2.2 hz , 1 h ) , 7.07 ( dd , j = 8.3 , 2.0 hz , 1 h ) , 5.25 ( s , 2 h ) , 3.763.82 ( m , 4 h ) , 3.223.27 ( m , 4 h ) . synthesized by general procedure c. flash column chromatography : 4080% ethyl acetate in hexanes , then prep hplc 3050% acetonitrile in water , isolated as a pale yellow solid in 14% yield . h nmr ( 500 mhz , dmso - d6 ) 9.24 ( s , 1 h ) , 9.16 ( s , 1 h ) , 8.62 ( d , j = 8.3 hz , 1 h ) , 8.308.36 ( m , 2 h ) , 8.21 ( d , j = 2.4 hz , 1 h ) , 7.84 ( dd , j = 9.0 , 2.7 hz , 1 h ) , 7.47 ( td , j = 7.8 , 5.9 hz , 1 h ) , 7.387.43 ( m , 2 h ) , 7.297.36 ( m , 3 h ) , 7.26 ( d , j = 9.3 hz , 1 h ) , 7.18 ( td , j = 8.7 , 2.2 hz , 1 h ) , 7.06 ( dd , j = 8.3 , 2.0 hz , 1 h ) , 5.25 ( s , 2 h ) , 3.753.83 ( m , 4 h ) , 3.213.28 ( m , 4 h ) . synthesized by general procedure c. flash column chromatography : 50100% ethyl acetate in hexanes , then prep hplc 3050% acetonitrile in water , isolated as a yellow solid in 9% yield . h nmr ( 500 mhz , dmso - d6 ) 9.36 ( s , 1 h ) , 9.18 ( s , 1 h ) , 8.93 ( s , 1 h ) , 8.36 ( dd , j = 8.3 , 1.5 hz , 1 h ) , 8.20 ( d , j = 8.3 hz , 2 h ) , 8.17 ( d , j = 8.3 hz , 1 h ) , 8.15 ( d , j = 2.9 hz , 1 h ) , 7.94 ( d , j = 8.3 hz , 2 h ) , 7.82 ( dd , j = 9.0 , 2.7 hz , 1 h ) , 7.50 ( d , j = 7.3 hz , 2 h ) , 7.42 ( t , j = 7.6 hz , 2 h ) , 7.35 ( t , j = 7.3 hz , 1 h ) , 7.30 ( d , j = 9.3 hz , 1 h ) , 5.22 ( s , 2 h ) , 3.633.69 ( m , 4 h ) , 2.902.98 ( m , 4 h ) . synthesized by general procedure c. flash column chromatography : 5100% ethyl acetate in hexanes , then prep hplc 3050% acetonitrile in water , isolated as a yellow solid in 23% yield . h nmr ( 500 mhz , dmso - d6 ) 9.28 ( s , 1 h ) , 9.19 ( s , 1 h ) , 8.70 ( d , j = 8.8 hz , 1 h ) , 8.45 ( d , j = 2.0 hz , 1 h ) , 8.41 ( dd , j = 8.5 , 1.7 hz , 1 h ) , 8.20 ( d , j = 2.4 hz , 1 h ) , 8.18 ( d , j = 8.3 hz , 2 h ) , 7.91 ( d , j = 8.3 hz , 2 h ) , 7.83 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.50 ( d , j = 6.8 hz , 2 h ) , 7.42 ( t , j = 7.3 hz , 2 h ) , 7.35 ( t , j = 6.8 hz , 1 h ) , 7.27 ( d , j = 8.8 hz , 1 h ) , 5.21 ( s , 2 h ) , 3.633.69 ( m , 4 h ) , 2.912.97 ( m , 4 h ) . synthesized by general procedure b. flash column chromatography : 37% methanol in dichloromethane , then prep hplc 595% acetonitrile in water , isolated as an orange solid in 39% yield . s. , 1 h ) , 9.18 ( s , 1 h ) , 8.91 ( s , 1 h ) , 8.35 ( d , j = 7.3 hz , 1 h ) , 8.128.21 ( m , 6 h ) , 7.93 ( d , j = 8.3 hz , 2 h ) , 7.83 ( d , j = 6.8 hz , 1 h ) , 7.47 ( td , j = 8.3 , 6.3 hz , 1 h ) , 7.307.36 ( m , 2 h ) , 7.28 ( d , j = 8.8 hz , 1 h ) , 7.18 ( td , j = 8.7 , 2.2 hz , 1 h ) , 5.25 ( s , 2 h ) , 2.96 ( br . s. , 4 h ) , 2.352.43 ( m , 4 h ) , 2.15 ( s , 3 h ) . synthesized by general procedure b. flash column chromatography : 310% methanol in dichloromethane , then prep hplc 595% acetonitrile in water , isolated as a dull yellow solid in 28% yield . h nmr ( 500 mhz , dmso - d6 ) 9.28 ( s , 1 h ) , 9.20 ( s , 1 h ) , 8.70 ( d , j = 8.3 hz , 1 h ) , 8.47 ( d , j = 2.0 hz , 1 h ) , 8.42 ( dd , j = 8.5 , 1.7 hz , 1 h ) , 8.21 ( d , j = 2.9 hz , 1 h ) , 8.168.20 ( m , 3 h ) , 7.91 ( d , j = 8.3 hz , 2 h ) , 7.84 ( dd , j = 9.0 , 2.7 hz , 1 h ) , 7.48 ( td , j = 8.3 , 6.3 hz , 1 h ) , 7.307.36 ( m , 2 h ) , 7.27 ( d , j = 9.3 hz , 1 h ) , 7.18 ( td , j = 8.7 , 2.7 hz , 1 h ) , 5.25 ( s , 2 h ) , 2.96 ( br . s. , 4 h ) , 2.39 ( t , j = 4.6 hz , 4 h ) , 2.15 ( s , 3 h ) . synthesized by general procedure b. flash column chromatography : 510% methanol in dichloromethane , then prep hplc 595% acetonitrile in water , isolated as an orange solid in 29% yield . h nmr ( 500 mhz , meoh - d4 ) 8.94 ( s , 1 h ) , 8.73 ( s , 1 h ) , 8.25 ( s , 2 h ) , 8.20 ( dd , j = 8.5 , 1.2 hz , 1 h ) , 8.008.06 ( m , 3 h ) , 7.95 ( d , j = 8.3 hz , 2 h ) , 7.88 ( d , j = 2.4 hz , 1 h ) , 7.59 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.38 ( td , j = 8.1 , 5.9 hz , 1 h ) , 7.28 ( d , j = 7.8 hz , 1 h ) , 7.23 ( d , j = 9.8 hz , 1 h ) , 6.997.06 ( m , 2 h ) , 5.18 ( s , 2 h ) , 3.603.66 ( m , 2 h ) , 3.47 ( t , j = 6.6 hz , 2 h ) , 3.223.28 ( m , 4 h ) , 2.77 ( s , 3 h ) , 2.142.21 ( m , 2 h ) . synthesized by general procedure b. flash column chromatography : 515% methanol in dichloromethane , then prep hplc 595% acetonitrile in water , isolated as a light yellow solid in 29% yield . h nmr ( 500 mhz , meoh - d4 ) 8.99 ( s , 1 h ) , 8.51 ( d , j = 8.3 hz , 1 h ) , 8.25 ( s , 1 h ) , 8.178.22 ( m , 2 h ) , 7.97 ( s , 4 h ) , 7.91 ( d , j = 2.9 hz , 1 h ) , 7.587.63 ( m , 1 h ) , 7.39 ( td , j = 7.8 , 5.9 hz , 1 h ) , 7.29 ( d , j = 7.8 hz , 1 h ) , 7.24 ( d , j = 9.3 hz , 1 h ) , 7.007.08 ( m , 2 h ) , 5.20 ( s , 2 h ) , 3.543.59 ( m , 2 h ) , 3.47 ( t , j = 6.6 hz , 2 h ) , 2.973.04 ( m , 4 h ) , 2.60 ( s , 3 h ) , 2.06 ( quin , j = 6.3 hz , 2 h ) . synthesized by general procedure d. flash column chromatography : 030% methanol in dichloromethane , isolated as a yellow solid in 20% yield . h nmr ( 400 mhz , dmso - d6 ) 9.91 ( br , s , 1h ) , 8.73 ( s , 1h ) , 8.55 ( s , 1h ) , 8.18 ( d , j = 8.8 hz , 1h ) , 7.98 ( d , j = 8.8 hz , 1h ) , 7.55 ( d , j = 2.4 hz , 1h ) , 7.457.50 ( m , 1h ) , 7.377.41 ( m , 1h ) , 7.307.35 ( m , 6h ) , 7.177.22 ( m , 1h ) , 7.02 ( d , j = 8.0 hz , 1h ) , 5.29 ( s , 2h ) , 3.763.79 ( m , 4h ) , 3.203.23 ( m , 4h ) . lcms found 565.0 [ m + h ] . synthesized by general procedure d. flash column chromatography : 020% ethyl acetate in hexanes , isolated as a yellow solid in 50% yield . h nmr ( 400 mhz , dmso - d6 ) 9.99 ( s , 1h ) , 8.87 ( s , 1h ) , 8.55 ( s , 1h ) , 8.24 ( d , j = 8.8 hz , 1h ) , 8.14 ( d , j = 8.0 hz , 2h ) , 8.01 ( d , j = 8.8 , 1h ) , 7.85 ( d , j = 8.4 hz , 2h ) , 7.467.51 ( m , 3h ) , 7.39 ( t , j = 7.2 hz , 2h ) , 7.297.34 ( m , 3h ) , 5.22 ( s , 2h ) , 3.603.63 ( m , 4h ) , 2.872.89 ( m , 4h ) . lcms found 611.1 [ m + h ] . synthesized by general procedure d. flash column chromatography : 030% methanol in dichloromethane , isolated as a yellow solid in 16% yield . h nmr ( 400 mhz , dmso - d6 ) 10.01 ( br , s , 1h ) , 8.89 ( s , 1h ) , 8.59 ( s , 1h ) , 8.27 ( d , j = 8.8 hz , 1h ) , 8.16 ( d , j = 8.0 hz , 2h ) , 8.05 ( d , j = 8.8 hz , 1h ) , 7.88 ( d , j = 8.0 hz , 2h ) , 7.55 ( br , s , 1h ) , 7.457.70 ( m , 1h ) , 7.317.35 ( m 4h ) , 7.177.21 ( m , 1h ) , 5.30 ( s , 2h ) , 2.95 ( br , s , 4h ) , 2.38 ( br , 4h ) , 2.14 ( s , 3h ) . synthesized by general procedure d. flash column chromatography : 030% methanol in dichloromethane , isolated as a yellow solid in 32% yield . h nmr ( 400 mhz , cdcl3 ) 8.71 ( s , 1h ) , 8.14 ( d , j = 8.8 hz , 1h ) , 8.08 ( d , j = 2.4 hz , 1h ) , 7.99 ( dd , j = 8.8 , 2.2 hz , 1h ) , 7.807.82 ( m , 2h ) , 7.66 ( d , j = 8.8 hz , 2h ) , 7.47 ( s , 1h ) , 7.41 ( d , j = 2 hz , 1h ) , 7.367.39 ( m , 1h ) , 7.23 ( s , 1h ) , 7.197.20 ( m , 1h ) , 7.17 ( d , j = 2 hz , 1h ) , 7.05 ( dd , j = 8.0,2.4 hz , 1h ) , 7.01 ( d , j = 8.8 hz , 1h ) , 5.19 ( s , 2h ) , 3.363.40 ( m , 4h ) , 2.562.62 ( m , 4h ) , 2.33 ( s , 3h ) , 1.811.85 ( m , 2h ) . synthesized by general procedure e , isolated as a yellow solid in 12% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.68 ( s , 1 h ) , 8.59 ( s , 1 h ) , 8.01 ( d , j = 2.4 hz , 1 h ) , 7.94 ( s , 1 h ) , 7.67 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.47 ( m , 1 h ) , 7.40 ( m , 1 h ) , 7.37 ( d , j = 7.8 hz , 1 h ) , 7.32 ( m , 2 h ) , 7.25 ( m , 2 h ) , 7.18 ( td , j = 9.3 , 2.4 hz , 1 h ) , 7.08 ( dd , j = 7.8 , 2.4 hz , 1 h ) , 5.25 ( s , 2 h ) , 3.78 ( m , 4 h ) , 3.23 ( m , 4 h ) , lcms found 547.0 , [ m + h ] . h nmr ( 500 mhz , dmso - d6 ) 9.64 ( s , 1h ) , 8.49 ( s , 1h ) , 8.18 ( s , 1h ) , 8.05 ( d , j = 2.93 hz , 1h ) , 7.71 ( dd , j = 2.44 , 8.79 hz , 1h ) , 7.447.50 ( m , 1h ) , 7.137.41 ( m , 7h ) , 7.04 ( dd , j = 1.95 , 8.30 hz , 1h ) , 5.25 ( s , 2h ) , 3.78 ( t , j = 4.7 hz , 4h ) , 3.21 ( t , j = 4.7 hz , 4h ) . synthesized by general procedure e , isolated as a yellow solid in 8% yield . h nmr ( 400 mhz , dmso - d6 ) ppm 8.61 ( s , 1 h ) , 9.83 ( s , 1 h ) , 8.15 ( m , 3 h ) , 7.98 ( s , 1 h ) , 7.88 ( d , j = 8.8 hz , 2 h ) , 7.65 ( m , 1 h ) , 7.49 ( m , 2 h ) , 7.42 ( t , j = 7.3 hz , 2 h ) , 7.35 ( m , 1 h ) , 7.27 ( d , j = 8.8 hz , 1 h ) , 5.23 ( s , 2 h ) , 3.65 ( m , 4 h ) , 2.94 ( m , 4 h ) . synthesized by general procedure e , isolated as a yellow solid in 40% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.79 ( s , 1 h ) , 8.52 ( s , 1 h ) , 8.41 ( s , 1 h ) , 8.03 ( d , j = 2.0 hz , 1 h ) , 7.97 ( d , j = 8.3 hz , 2 h ) , 7.88 ( d , j = 8.3 hz , 2 h ) , 7.68 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.49 ( d , j = 7.8 hz , 2 h ) , 7.42 ( t , j = 7.6 hz , 2 h ) , 7.35 ( t , j = 7.3 hz , 1 h ) , 7.29 ( d , j = 9.3 hz , 1 h ) , 5.22 ( s , 2 h ) , 3.65 ( m , 4 h ) , 2.94 ( m , 4 h ) . synthesized by general procedure e , isolated as a yellow solid in 36% yield . h nmr ( 400 mhz , dmso - d6 ) ppm 9.84 ( s , 1 h ) , 8.62 ( s , 1 h ) , 8.14 ( m , 3 h ) , 7.99 ( d , j = 2.2 hz , 1 h ) , 7.87 ( d , j = 8.8 hz , 2 h ) , 7.66 ( dd , j = 9.2 , 2.6 hz , 1 h ) , 7.47 ( m , 1 h ) , 7.32 ( m , 2 h ) , 7.26 ( d , j = 8.8 hz , 1 h ) , 7.19 ( td , j = 8.8 , 2.2 hz , 1 h ) , 5.26 ( s , 2 h ) , 2.95 ( m , 4 h ) , 2.38 ( m , 4 h ) , 2.14 ( s , 3 h ) . synthesized by general procedure e , isolated as a yellow solid in 25% yield . h nmr ( 500 mhz , dmso - d6 ) ppm 9.79 ( s , 1 h ) , 8.52 ( s , 1 h ) , 8.41 ( s , 1 h ) , 8.05 ( d , j = 2.4 hz , 1 h ) , 7.95 ( d , j = 8.3 hz , 2 h ) , 7.87 ( d , j = 8.3 hz , 2 h ) , 7.69 ( dd , j = 8.8 , 2.4 hz , 1 h ) , 7.47 ( m , 1 h ) , 7.32 ( m , 2 h ) , 7.28 ( d , j = 8.8 hz , 1 h ) , 7.18 ( td , j = 8.5 , 2.4 hz , 1 h ) , 5.24 ( s , 2 h ) , 2.95 ( m , 4 h ) , 2.37 ( m , 4 h ) , 2.14 ( s , 3 h ) . synthesized by general procedure e , isolated as a pale yellow solid in 4% yield . the product was separated by silica column chromatography ( dichloromethane / methanol ) and purified by hplc to obtain the formic acid salt . h nmr ( 500 mhz , dmso - d6 ) ppm 9.82 ( s , 1 h ) , 8.61 ( s , 1 h ) , 8.22 ( s , 1 h ) , 8.068.13 ( m , 3 h ) , 7.99 ( d , j = 2.4 hz , 1 h ) , 7.91 ( d , j = 8.8 hz , 2 h ) , 7.66 ( dd , j = 9.0 , 2.7 hz , 1 h ) , 7.47 ( td , j = 8.3 , 6.3 hz , 1 h ) , 7.297.36 ( m , 2 h ) , 7.26 ( d , j = 8.8 hz , 1 h ) , 7.18 ( td , j = 8.7 , 2.2 hz , 1 h ) , 5.26 ( s , 2 h ) , 3.35 ( dt , j = 5.1 , 2.3 hz , 2 h ) , 3.32 ( t , j = 6.1 hz , 2 h ) , 2.532.58 ( m , 2 h ) , 2.48 ( d , j = 5.9 hz , 2 h ) , 2.23 ( s , 3 h ) , 1.74 ( quin , j = 5.9 hz , 2 h ) . synthesized by general procedure e , isolated as a pale yellow solid in 10% yield . the product was separated by silica column chromatography ( dichloromethane / methanol ) and purified by hplc to obtain the formic acid salt . h nmr ( 500 mhz , cdcl3/cd3od ) ppm 8.46 ( s , 1 h ) , 8.10 ( s , 1 h ) , 7.89 ( m , 5 h ) , 7.60 ( m , 1 h ) , 7.39 ( m , 1 h ) , 7.28 ( d , j = 7.8 hz , 1 h ) , 7.24 ( d , j = 9.3 hz , 1 h ) , 7.04 ( m , 2 h ) , 5.20 ( s , 2 h ) , 3.57 ( m , 2 h ) , 3.45 ( t , j = 6.6 hz , 2 h ) , 3.05 ( m , 4 h ) , 2.63 ( s , 3 h ) , 2.08 ( m , 2 h ) .

tropical protozoal infections are a significant cause of morbidity and mortality worldwide ; four in particular ( human african trypanosomiasis ( hat ) , chagas disease , cutaneous leishmaniasis , and malaria ) have an estimated combined burden of over 87 million disability - adjusted life years . new drugs are needed for each of these diseases . building on the previous identification of neu-617 ( 1 ) as a potent and nontoxic inhibitor of proliferation for the hat pathogen ( trypanosoma brucei ) , we have now tested this class of analogs against other protozoal species : t. cruzi ( chagas disease ) , leishmania major ( cutaneous leishmaniasis ) , and plasmodium falciparum ( malaria ) . based on hits identified in this screening campaign , we describe the preparation of several replacements for the quinazoline scaffold and report these inhibitors biological activities against these parasites . in doing this , we have identified several potent proliferation inhibitors for each pathogen , such as 4-((3-chloro-4-((3-fluorobenzyl)oxy)phenyl)amino)-6-(4-((4-methyl-1,4-diazepan-1-yl)sulfonyl)phenyl)quinoline-3-carbonitrile ( neu-924 , 83 ) for t. cruzi and n-(3-chloro-4-((3-fluorobenzyl)oxy)phenyl)-7-(4-((4-methyl-1,4-diazepan-1-yl)sulfonyl)phenyl)cinnolin-4-amine ( neu-1017 , 68 ) for l. major and p. falciparum .

dizziness has a high incidence worldwide , and the impact of vestibular disease on quality of life has been increasingly investigated . many patients with dizziness restrict their daily activities and leisure in order to reduce the risk of onset of unpleasant and frightening symptoms , as well as to avoid the social embarrassment and stigma that these symptoms may cause1 . benign paroxysmal positional vertigo ( bppv ) is a disease with a high incidence worldwide , and can be regarded as the most frequent vestibular disease2 . there are few studies correlating bppv and meniere 's disease ( md ) and their combined influence on the quality of life of patients3 4 . simultaneous diagnosis of bppv and md may worsen symptoms of dizziness and thus worsen the quality of life , because the discomfort caused by these symptoms can significantly change the ability of patients to perform their usual tasks4 . among existing evaluation instruments , the dizziness handicap inventory ( dhi ) is an internationally validated instrument . this questionnaire assesses patients ' perception of the effects of the disabling vertigo on their quality of life , including the physical , emotional , and functional aspects . it is important to assess the individual 's condition at the beginning of treatment and to monitor the evolution of the disease course1 ( chart 1 ) . legend : physical aspects - questions 1 , 4 , 8 , 11 , 13 , 17 and 25 ; functional aspects - questions 3 , 5 , 6 , 7 , 12 , 14 , 16 , 19 and 24 , emotional aspects - questions 2 , 9 , 10 , 15 , 18 , 20 , 21 , 22 and 23 . each yes answer = 4 points ; sometimes = 2 points ; no = 0 points . treatment options for vertigo patients include medications , vestibular rehabilitation ( vr ) and , more rarely , surgical procedures5 . vr has been used as a strategy for the treatment of vestibular disorders because its goals are to provide security to the patient and integrate them into their social environment . vr aims to promote visual stabilization , improve static and dynamic balance , decrease sensitivity during head movement , and improve the overall function of the patient via proprioceptive and vestibular visual stimulation maneuvers6 . the objective of this study was to evaluate the pre- and post - vr quality of life of patients with md - associated bppv by using the brazilian version of the dhi as an evaluation tool . the study was approved by the ethics in research on humans foundation regional university of blumenau ( furb ) , under protocol 180/09 . the sample consisted of 12 patients of both genders with a diagnosis of meniere 's disease associated with benign paroxysmal positional vertigo ( bppv ) of the posterior canal , who were seen at the ent clinic during the period from october to december 2009 . inclusion criteria were as follows : clinical diagnosis of meniere 's disease with complementary electrocochleographic findings , presence of nystagmus triggered by dix hill pike maneuvers and lateral placement test identified under the guidance of videonystagmography , no treatment initiation or maintenance during the period between surveys , agreement to undergo surgery to the ear , and agreement to signing a consent form . we excluded patients with signs and symptoms of vestibular central origin , those with musculoskeletal abnormalities that impair the performance of the maneuvers ( diagnostic and therapeutic ) , individuals who began vestibular rehabilitation before completing the questionnaire , and patients undergoing vestibular rehabilitation lasting less than 5 sessions , considering the research period . the sessions were held once a week individually , with each session lasting 1 hour . vr started with the canalith repositioning maneuver of epley , where the individual sitting on the table adopts a supine position and the therapist rotates the head to the side of the affected labyrinth . after a minute , the head is rotated to the opposite side and the patient is instructed to stay in the same position for another minute , returning to a seated position at the end . this was followed by the brandt and daroff habituation exercises . from the seated position on the table , the patient adopts a lateral recumbent position ( first on the side that causes the dizziness ) , maintains the position for 30 seconds or until the dizziness passes , changes to a lateral seated position , waits for the same time period , and then lies on the opposite side and waits for 30 seconds . each patient was taught the exercises and instructed to repeat them at home 1020 times a day . in addition , we performed the cawthorne - cooksey visual exercises consisting of up and down and side - to - side eye movements as well as extension of an arm and focusing on the finger as it approaches and moves away from the face . all movements were repeated 20 times , starting slowly and becoming progressively faster , with the patient sitting or lying down . in another exercise , with the individual sitting or standing , only the head moved forward and back , after a back and forth motion ; these motions were first performed slowly and then rapidly , with eyes open and progressing to accomplishment of each movement and with eyes closed for 1 minute . the brazilian version of the dhi was completed by participants before undergoing the first session of vr and after the last treatment session . subjects were instructed to mark the item that best demonstrated their perception of the influence of vertigo on their quality of life at the time , with doubts addressed by the researchers present during the survey . no , corresponding to 0 ( zero ) , occasional presence of symptoms / problems was reported as sometimes , and was scored as 2 points , and the presence of severe symptoms / problems was marked the minimum score of the questionnaire was 0 ( zero ) and the maximum was 100 points , with 7 items referring to physical aspects , 9 to functional aspects , and 9 to emotional aspects7 . for data analysis , we first used the shapiro - wilk test of normality , proceeding with the wilcoxon test for comparisons between samples before and after vestibular rehabilitation , and the friedman test to compare the impact of physical , emotional , and functional scores after standardizing the values by calculating the percentage according to the maximum possible score to be obtained on each item . spearman correlation was used to evaluate the relationship between aspects , the total score , and the characteristics of the sample test . all analyses were processed in 4.0 bioestat considering significance at p < 0.05 . in the stipulated period for data collection , 12 individuals fulfilled the criteria for inclusion and exclusion . there were 4 ( 33.33% ) men and 8 ( 66.66% ) women , all caucasian , aged between 35 and 86 years ( mean , 53.17 15.75 years ) . three ( 25% ) were less than 40 years old , 6 ( 50% ) were aged between 40 and 59 years , and 3 ( 25% ) were aged 60 years or more ( table 1 ) . there was a significant reduction in all dhi values after vr , independent of the aspect . the median final values were 0 ( zero ) for the physical aspect , 1 for the emotional aspect , and 1 for the functional aspect , demonstrating the favorable impact of vr on the quality of life of our patients ( table 2 ) . generally , the score must be reduced by at least 18 after treatment to be indicative of benefit1 . in our series , 7 ( 58.33% ) patients showed a reduction greater than 18 points , 5 ( 41.67% ) did not show a reduction greater than 18 points , and 3 ( 25% ) did not achieve a pre - vr score large enough to show such a reduction . in the evaluation of post - vr scores , 2 ( 16.6% ) patients who had scores less than 18 pre - vr , despite showing an improvement in the aspects evaluated , did not show score reductions of the specified magnitude . p < 0.01 when compared to before . to compare the effects on the different aspects , the raw score values were normalized as percentage values , with 100% indicating the maximum score in every aspect . next , we compared the pre- and post - vr scores . in the preoperative evaluation , we noted that the diseases had a greater impact on physical and functional aspects than on the emotional aspect . although none of the aspects showed a predominant effect of vr , the differences in the pre- and post - vr values showed that vr had the greatest influence on the physical aspect ( table 3 ) . p < 0.05 when compared to emotional aspect in the first evaluation ( pre - vr ) , the correlation between the physical and functional aspects was moderately positive , and that between the emotional and functional aspects was strongly positive , indicating the interrelationship of these factors on quality of life of the volunteers , i.e. , the functional aspect influences and is influenced by physical and emotional aspects . however , analysis of the difference ( pre - post ) showed a weak positive correlation between the emotional and functional aspects ( table 4 ) . in the pre- and post - vr analyses , there was a lack of correlation between age and gender with the dhi scores , indicating that the results of the vr were not affected by these characteristics ( table 5 ) . it should be noted that the sample size did not allow generalization of the results ; however , considering the results , the importance of vr is evident . in another study with 15 subjects who were diagnosed as having bppv associated with mnire 's disease , the physical aspect was the most affected4 , but there are few studies analyzing both conditions together and using vr for the treatment of this combination . regarding gender , there was a predominance of women ( 75% ) in the sample , which agrees with previous studies that found a prevalence of dizziness and bppv in 61.3% to 62.5% of female patients8 9 10 . some authors suggest that the variations in natural hormones in women could be related to this increased incidence , but did not elucidate this theory11 . as for meniere 's disease ( md ) alone , there are reports of an equal distribution between genders12 . the most prevalent age group in this study also coincides with the findings obtained by other authors , who indicated that 48% to 60% of subjects were between 41 and 60 years of age4 7 . other studies have also reported the coexistence of these 2 diseases , with patients initially presenting symptoms of md followed by symptoms of bppv13 14 . one hypothesis for this relationship between the 2 diseases is the possible release of otoconia by damage to the utricle by endolymphatic hydrops and hypertension3 . the dhi - brazilian version was used to assess the impact of vr on the quality of life of patients and , based on the significant score decrease in most patients , it is argued that vr is favorable for these patients . the dizziness and other symptoms that often accompany vestibular disorders may manifest during social , familial , and professional activities , thus causing physical , financial , and psychological distress to the patients15 16 17 and necessitating interventions to eliminate or minimize these symptoms . individuals end up restricting their head movements and activities to prevent vertigo , thereby imposing physical constraints that lead to functional loss and consequent emotional turmoil , which explains the damage caused by these disorders . we found that pre - vr , the greatest impact was noted on the physical and functional aspects while after vr , the greatest influence was noted on the physical aspect , despite the reduction of the values in the functional and emotional aspects as well . it was noted that after the improvement in physical symptoms , individuals were able to resume their routine activities that were previously restricted due to dizziness or fear of symptoms , and this improvement consequently improved functional and emotional aspects , which are dependent on the physical aspects . this result contrasts the results of a previous study18 , where a sample of 6 patients , aged 4370 years , with complaints of dizziness and tinnitus showed no significant improvement in the functional and emotional aspects and no improvement in the physical aspect after vr . it should be noted that apart from vertigo , some individuals had age - related comorbidities ( such as osteoarthritis and osteoporosis ) , which by itself has limited some of the emotional issues such as fear of high places and fear of being alone at home or going out unaccompanied . therefore , it is likely that the answers to these questions were influenced by comorbidities , so it is not possible to separate them from the symptom of vertigo / dizziness . this situation indicates that the analysis of the emotional aspect should be undertaken with care , because if the individual is unable to perform some physical activity for problems not related to dizziness , even after the improvement of vertigo , he / she will be unable to do the same . the correlation between the physical and functional aspects and between emotional and functional aspects in pre - vr assessments demonstrates the interrelationship of these factors with the quality of life of individuals , i.e. , the functional aspect influences and is influenced by the physical and emotional aspects . however , this effect appears to be greater when the symptoms are exacerbated by vertigo , since after vr , no such correlation was observed . the relationship between the functional and physical aspects is also highlighted in other studies , where the similar scores for these aspects were explained by the fact that in bppv , onset of symptoms is closely related to certain positions or head movements , the relevant questions for which are contained in both aspects of ihl - brazilian version19 20 . similarly , studies involving individuals with md associated with higher scores on the physical and functional aspects to the chronic nature of the disease with clinical manifestations floating , recurrent and lasting , that can compromise not only physical , but also the functionality of these patients4 21 . in another study with 6 patients aged 4370 years , the analysis of the dhi questionnaire after vr showed that patients experienced an improvement in functional and emotional aspects , although the difference was not significant18 . furthermore , the relationship of the functional to the emotional aspects can be understood by the rationale that when there is improved functionality , the individual returns to his / her daily habits , accomplishing all movements restricted before the onset of vertigo . thus , the individual becomes more confident with regard to leaving the house without company and can simply raise the head or turn over in bed without being afraid of triggering symptoms . the results of vr were not affected by age and/or gender , similar to previous studies that indicate no relationship between improvement in patients with vertigo and after vr with these variables20 22 . in this context , the geriatric population responds to treatment as well as a younger population , but most of the elderly patients require a greater number of treatment sessions to achieve the same result as the young23 . moreover , other studies describe that age is not necessarily associated with loss of independence in activities of daily living , and therefore , it is not possible to relate the age - diminished ability with greater independence or improvement in vertigo after vestibular alteration24 . on the other hand , dizziness has a more detrimental effect on quality of life of elderly than in younger adults , according to studies with these populations25 26 27 28 . regarding gender , some authors report that the variable is not related to any advantage or disadvantage in relation to response to treatment7 , a fact verified by the results presented here . as individuals in the sample were out of the crisis period during the questionnaire analysis and underwent vr , the results discussed are restricted to perception of symptoms by individuals on a daily basis , whereas in vertigo , the symptoms are exacerbated . finally , we would like to point out the importance of multidisciplinary medical and physiotherapy in the diagnosis and treatment to achieve greater security and adherence to this treatment modality . the results obtained through the dhi brazilian version show that the quality of life of patients with bppv associated with md improved after 5 sessions of vr in all aspects analyzed . we noticed that the diseases had a greater impact on the physical and functional aspects of quality of life before vr , with the highest rate of improvement noted in the perception of physical appearance after the therapy . although the sample consisted of a small number of patients , the results obtained with vr were surprising and further studies need to be developed , especially involving the 2 pathologies . moreover , the vr was well accepted by volunteers who showed increased enthusiasm and confidence with the evolution of treatment and reduction of symptoms .

summary introduction : vertigo is a symptom that impacts the patients ' quality of life and may force them to cease performing activities of daily living . here , we discuss benign paroxysmal positional vertigo ( bppv ) and meniere 's disease ( md ) , which show exacerbated symptoms when they appear in association . vestibular rehabilitation ( vr ) is an effective treatment in reducing vertigo , especially in conjunction with other therapies . aim : to evaluate the quality of life of patients with bppv and md before and after vr . method : we conducted a descriptive observational qualitative and quantitative case study with 12 patients aged 35 to 86 years . all patients diagnosed with bppv and md received treatment in the ent clinic . the brazilian dhi questionnaire , which assesses the quality of life with a focus on physical , emotional , and functional aspects , was used for data collection , and was completed by patients before the first session and after the fifth session of vr . data were tested using the shapiro - wilk normality test , followed by wilcoxon , friedman , and spearman correlation tests ( p < 0.05 ) . results : there were significant improvements in scores for all aspects , with median changes ranging from 12 to 0 in the physical , 6 to 1 in the emotional , and 11 to 1 in the functional aspect . there were no correlations between the scores and sample characteristics . conclusion : vr was an effective method for the treatment of patients with bppv and md ; it improves quality of life and shows the maximal influence on physical aspect scores , regardless of age or gender .

the penn diabetes heart study ( pdhs ) is an ongoing , cross - sectional study of individuals with type 2 diabetes ( aged 3575 years ) without clinical evidence of cvd ( myocardial infarction , coronary revascularization or angiographic disease , positive stress test , clinical peripheral arterial disease or peripheral arterial revascularization , stroke , or transient ischemic attack ) . the university of pennsylvania institutional review board approved the study protocol , and all subjects gave written informed consent ( 4 ) . the ankle - brachial index ( abi ) was calculated by dividing the average of the ankle pressures by the highest brachial pressure . participants with an abi > 1.4 ( n = 13 ) reflecting noncompressible arteries were excluded ( 5 ) . each subject had the estimated glomerular filtration rate ( egfr ) calculated based on the abbreviated modification of diet in renal disease study equation ( 6 ) . plasma levels of fetuin - a ( 4.3 and 10.2% , respectively , intra - assay and inter - assay coefficient of variation ) were measured by enzyme - linked immunosorbent assay ( biovendor laboratory medicine , modrice , czech republic ) . high - sensitivity c - reactive protein ( hscrp ) was measured by immunoturbidimetric assay ( wako , osaka , japan ) . student 's t test was used for normal continuous variables and the kruskal - wallis for nonnormal distributed variables . the association between a 1-sd change in fetuin - a and pad was examined using unadjusted and multivariable adjusted logistic regression models as described in table 1 . analyses were performed on stata 10.0 software ( stata , college station , tx ) . association between fetuin - a and pad data are odds ratios ( 95% ci ) and were obtained by logistic regression model . model 2 : model 1 + smoking , hypertension , hypercholesterolemia , metabolic syndrome , a1c , framingham risk score ( % ) , and medications ( ace inhibitors , aspirin , statins , insulin , metformin , sulfonylureas , and thiazolidinediones ) . the ankle - brachial index ( abi ) was calculated by dividing the average of the ankle pressures by the highest brachial pressure . participants with an abi > 1.4 ( n = 13 ) reflecting noncompressible arteries were excluded ( 5 ) . each subject had the estimated glomerular filtration rate ( egfr ) calculated based on the abbreviated modification of diet in renal disease study equation ( 6 ) . plasma levels of fetuin - a ( 4.3 and 10.2% , respectively , intra - assay and inter - assay coefficient of variation ) were measured by enzyme - linked immunosorbent assay ( biovendor laboratory medicine , modrice , czech republic ) . high - sensitivity c - reactive protein ( hscrp ) student 's t test was used for normal continuous variables and the kruskal - wallis for nonnormal distributed variables . the association between a 1-sd change in fetuin - a and pad was examined using unadjusted and multivariable adjusted logistic regression models as described in table 1 . analyses were performed on stata 10.0 software ( stata , college station , tx ) . association between fetuin - a and pad data are odds ratios ( 95% ci ) and were obtained by logistic regression model . model 2 : model 1 + smoking , hypertension , hypercholesterolemia , metabolic syndrome , a1c , framingham risk score ( % ) , and medications ( ace inhibitors , aspirin , statins , insulin , metformin , sulfonylureas , and thiazolidinediones ) . among 738 subjects in the study sample , pad prevalence was 5.1% , the mean age was 58.7 9.3 years , 37.1% were female , 63.2% were caucasians , and 32.1% were african americans . the median fetuin - a level was 292.4 ng / ml ( interquartile range 115.5 ) . individuals with pad had a significantly lower fetuin - a level compared with individuals without pad ( 269.3 vs. 293.4 , p < 0.001 ) . no significant differences were noted in other cardiovascular risk factors , metabolic syndrome , kidney function , inflammation , bmi , serum albumin ( the only surrogate marker of liver function collected on the pdhs ) , or medication use . fetuin - a levels decreased consistently ( p for trend < 0.02 ) across abi clinically relevant cut points ( < 0.7 , 0.70.9 , 0.91.1 , and 1.11.4 ) ( 7 ) ( see supplemental fig . 1 in the online appendix [ available at http://care.diabetesjournals.org/cgi/content/full/dc09-1541/dc1 ] ) . the odds of pad were significantly increased for each sd decrease in fetuin - a ( odds ratio 1.6 [ 95% ci 1.12.3 ] , p = 0.001 ) and the association persisted in incremental models that adjusted fully for age , sex , race , kidney function , cardiovascular risk factors , medication use , and hscrp ( 1.6 [ 1.0582.5 ] , p = 0.03 ) ( table 1 ) . a similar trend was noted among subjects with egfr > 80 ml min 1.73 m ( 1.9 [ 1.03.4 ] , p = 0.05 ) , suggesting that our findings were not confounded by the presence of moderate kidney disease . finally , in a fully adjusted subgroup analysis , participants with hscrp levels <3 mg / dl ( n = 460 ) had higher odds of pad ( 2.6 [ 1.45.0 ] , p = 0.002 ) , whereas subjects with high hscrp levels ( 3 mg / dl ; n = 234 ) did not ( 0.82 [ 0.41.6 ] , p = 0.59 ) . low levels of fetuin - a have been linked to medial arterial calcification and flow limiting aortic stenosis in humans ( 8,9 ) . in this study , we demonstrate that lower levels of fetuin - a are associated with pad in subjects with type 2 diabetes . to our knowledge , this is the first study to report such a relationship in the absence of advanced kidney disease or prevalent cvd . notably , in analysis stratified by the centers for disease control and prevention / american heart association defined hscrp risk strata ( 10 ) , fetuin - a conferred increased odds of pad in subjects with hscrp <3 mg / dl and also in participants with interleukin ( il)-6 levels below the median ( data not shown ) . this is consistent with studies reporting an increased cvd risk mortality with fetuin - a deficiency independent of hscrp and il-6 ( 11 ) and points to a unique role for this negative acute - phase protein as a biomarker of pad beyond traditional and novel cardiovascular risk factors . remarkably , animal models appear to track with our clinical observations . in mice lacking the fetuin - a gene , the aorta was found to be spared of calcification and fibrosis , whereas peripheral vessels in the skin and kidney showed evidence of extensive calcification ( 2 ) , and the small artery involvement preceded the renal impairment ( 3 ) . however , in the absence of direct imaging data , we are unable to define the type of vascular phenotype ( intimal calcification or medial calcification ) that account for the observed association . an abi of < 0.9 is 95% sensitive and 99% specific for a stenotic lesion ( > 50% ) ( 12 ) . therefore , we assume that some degree of eccentric atherosclerotic calcification contributes to the association observed while acknowledging that multiple types of vascular calcification may coexist in type 2 diabetes ( 13 ) . nonalcoholic liver disease and other phenotypes related to insulin resistance , including type 2 diabetes ( 14 ) , are associated with higher levels of fetuin - a ( 15 ) . we controlled for most potential confounding factors and found no attenuation of the inverse association of fetuin - a with pad . in particular , because of this inverse relationship , a significant confounding effect was not expected by any condition associated with high fetuin - a levels . finally , our study is limited by cross - sectional design , which limits causal inferences . in summary , low plasma fetuin - a levels are associated with pad in type 2 diabetes independent of traditional and contemporary risk factors . our findings suggest a unique role for fetuin - a deficiency as a biomarker of pad in the setting of type 2 diabetes .

objectivefetuin - a is an inhibitor of vascular calcification and a mediator of insulin resistance . this study evaluated the association of plasma fetuin - a and peripheral arterial disease ( pad).research design and methodsa total of 738 individuals with type 2 diabetes ( mean age 58.7 years , 37.1% female ) without known cardiovascular or kidney disease were included in this cross - sectional analysis.resultssubjects with pad had a significantly lower fetuin - a ( 264.3 vs. 293.4 ng / dl , p < 0.001 ) . in multivariable analysis , a 1-sd decrease in fetuin - a increased the odds of pad ( odds ratio 1.6 , p = 0.02 ) . subgroup analysis revealed an increased odds even in subjects with glomerular filtration rate > 80 ( odds ratio 1.9 , p = 0.05 ) or high - sensitivity c - reactive protein <3 mg / dl ( odds ratio 2.7 , p = 0.002).conclusionslower circulating fetuin - a is associated with pad in type 2 diabetes beyond traditional and novel cardiovascular risk factors . our findings suggest a potentially unique role for fetuin - a deficiency as a biomarker of pad in patients with type 2 diabetes .

the efforts made to comprehend the essence of disease and its causes have shaped the history of medicine . even today we are unable to grasp why a particular person suffers from this or that affliction , and despite the advances made in deciphering the genetic code which in any case explains only how the basic mechanism works , not why the only recourse left seems to be to place our faith in a higher power . here we can discern a cause and effect chain , which in particular offers the practicable perspectives of prophylaxis and treatment . up till the time that robert koch discovered more than a hundred years ago that anthrax was caused by a bacterium , raging epidemics were seen as an expression of god s curse . while it was possible to control plague and cholera , in addition to new epidemics such as hiv / aids and sars long - forgotten scourges like but such spectacular pathogens account for only part of our problems ; the advances made in clinical medicine mean that today not only are we seeing patients with compromised immune systems , who in earlier times would have long succumbed to their underlying disease , but that now such forms of immunosuppression induced , for instance , as a result of major surgery and organ transplants have become a serious problem in intensive care units . this means that it is not only the classic pathogens that are in the spotlight but also a plethora of ubiquitous microorganisms , which as saprophytes have hitherto elicited little attention but are found on all surfaces in a hospital and on the hands of staff . bereft of these insights , ignaz phillip semmelweis made the ingenious observation in vienna during the 19th century that primitive hand disinfection was able to reduce considerably the incidence of fatal puerperal fever . today many of these epidemics and infections have been brought under control , but in intensive care medicine sepsis continues to be the chief nemesis and while we can not exactly define the situation , an infection is implicated in the case of the vast majority of patients who die here , or has indeed been the cause of death . and here we come upon a fortuitous confluence of all the factors that facilitate microbial invasion of the human body . the body s natural barriers have been breached through medical interventions , with the common integument sporting myriad large - lumened indwelling catheters , waldeyer s tonsilar ring breached by plastic tubes and probes , and even the longer male urethral tract is fitted with a catheter all the more to facilitate retrograde passage of bacteria . on the other hand , immunocompromising therapeutic agents such as cytostacis and glucocorticoids , which in addition to the inability to ingest nutrition in a natural and efficient manner ensure that invading microorganisms will be able to multiply . drugs administered as stress ulcus prophylaxis give rise to a shift in the bacterial flora of the throat , thus laying the foundation for a lower respiratory tract infection . with regard to bacterial resistance , antibiotic therapy , especially when used as prophylaxis , results in the bacteria becoming less sensitive to the drugs , while reinforcing selective pressures . disinfectants can be deployed not only against all potential microbial reservoirs outside the body , but also on the skin and mucous membranes . in the inanimate environment they can be used with essentially more potent effects than antibiotics , whose use must be governed by considerations of not unduly taxing the body . the hands of personnel as well as the therapeutic devices ranging from the respirator to the catheter are the chief sources of infection in intensive care units . if one disregards the endogenous gut flora and their antibiotic - induced alteration , we can target all microbes giving rise to nosocomial infections with disinfectants before their inoculation . disinfection is the cornerstone of any well - organized and hence effective infection control policy . only recently has a european study reported on the impressive reduction in the incidence of infections brought about by iodine - based products on the skin or at vascular access points as well as by antiseptic hand disinfection . an international study , which was launched in the usa , underlined the importance of oral decontamination in ventilation pneumonia , which is a key player among the nosocomial infections . disinfection , antibiotic therapy and possibly extracorporeal elimination methods can be contemplated for direct prevention of the establishment and multiplication of microorganisms . the latter are still in the incipient stages , while antibiotic treatment represents a double - edged sword since it acts selectively and the entire organism has to be taken into consideration . only disinfectants are able to unleash their full destructive might against microbes , especially when used on treatment devices that are not amenable to sterilization , but subsequent removal and , possibly , ensuring hand protection , can be a problem . discussions postulate the merits of using quaternary ammonium vs alcohol - based solutions , but what is decisive is optimal use to assure effective infection control tailored to the respective site of use . an objective evaluation of the suitability of such measures against the background of high costs is possible only through documentation of the clinical effects . already before the large outcome studies conducted during the past 20 years in the field of intensive care medicine attempts were made to analyze infection control on a large scale in central europe . while it is not easy to furnish proof of a direct link between efficient control and prevention methods and the incidence of infection , there is by now a consensus on the role of hand hygiene and of disinfection of the human body and of surfaces . but an international study that would be conducted only a decade later was not able to gain any further insights and could only emphatically advocate that european standards be introduced . however , this study spanning 14 countries and more than 1000 intensive care units cast light on the importance of antiseptics . for disinfection of puncture sites before insertion of vascular catheters mainly alcoholic solutions were used ; the solution used for the urethral opening was not specified , and most disappointing aspect of this comprehensive survey was the fact that hand hygiene was assigned only a peripheral role . in an age when medicine , in particular intensive care medicine , is risking becoming impaled on its own sword , with nosocomial infections being seen as one of the most critical aspects of high tech medicine , disinfection can serve as a bulwark against rising infection rates . emeritus assistant clinical director of the clinic for anaesthetics and general intensive medicine , vienna , austria . clinical investigator and legally sworn expert . he received a doctor s degree in 1963 and started a specialist training which he finished in 1969 as a specialist for anaesthetics . later he moved as austrian un - soldier to cyprus , afterwards to the albert einstein college of medicine , new york . in 1979 but he did not stay there : he became head of anaesthetics and intensive care department of the children hospital modid in tehran , iran . after his return he is named assistant medical director of the ahk vienna and finally assistant board director for the clinic for anaesthetics and general intensive care medicine vienna . he engages himself to a high degree in different ethics committees ( vice director of the inter - faculty institute for ethics in medicine , vice director of the ethics committee of the vienna medical faculty , chairman of the ethics committee and board - member of eurotransplant leiden , president of the austrian medical society of vienna , and member of the ethics committee of the austrian medical association ) . emeritus assistant clinical director of the clinic for anaesthetics and general intensive medicine , vienna , austria . clinical investigator and legally sworn expert . he received a doctor s degree in 1963 and started a specialist training which he finished in 1969 as a specialist for anaesthetics . later he moved as austrian un - soldier to cyprus , afterwards to the albert einstein college of medicine , new york . in 1979 but he did not stay there : he became head of anaesthetics and intensive care department of the children hospital modid in tehran , iran . after his return he is named assistant medical director of the ahk vienna and finally assistant board director for the clinic for anaesthetics and general intensive care medicine vienna . he engages himself to a high degree in different ethics committees ( vice director of the inter - faculty institute for ethics in medicine , vice director of the ethics committee of the vienna medical faculty , chairman of the ethics committee and board - member of eurotransplant leiden , president of the austrian medical society of vienna , and member of the ethics committee of the austrian medical association ) .

in infectious diseases we can discern a cause and effect chain , which in particular offers the practicable perspectives of prophylaxis and treatment . however , to date we have not been able to control them . apart from new epidemics , such as those caused by hiv and sars , long - forgotten scourges like tb are enjoying a comeback . furthermore , the advances made in clinical medicine mean that induced immunosuppression , for instance as a result of major surgery or organ transplantation , has become a serious problem in intensive care units . the body s natural barriers are breached through medical interventions while , on the other hand , immunocompromising therapeutic agents such as cytostacis and glucocorticoids ensure that invading microorganisms will be able to multiply . drugs administered as stress ulcus prophylaxis give rise to a shift in the bacterial flora of the throat , thus laying the foundation for a lower respiratory tract infection . with regard to bacterial resistance , antibiotic therapy , especially when used as prophylaxis , results in the bacteria becoming less sensitive to the drugs , while reinforcing selective pressures . the hands of personnel as well as the therapeutic devices ranging from the respirator to the catheter are the chief sources of infection in intensive care units . disinfection , antibiotic therapy and , possibly , extracorporeal elimination methods can be contemplated to selectively prevent the establishment and multiplication of microorganisms . however , only disinfectants are able to unleash their full destructive might against microbes , especially when used for medical devices that are not amenable to sterilization , even if their subsequent removal and , possibly , the issue of staff hand protection , can be a problem . while it is not easy to furnish proof of a direct link between efficient control and prevention methods and the incidence of infection , there is by now a consensus on the role of hand hygiene and of disinfection of the human body and of surfaces . in an age when medicine , in particular intensive care medicine , is at risk of becoming impaled on its own sword , disinfection could serve as a bulwark against rising infection rates .

all genetic variations originate from mutations , which are defined as changes in dna sequence . mutations can affect either germline cells ( the cells which produce gametes ) or somatic cells ( all the cells other than germline cells ) . in human genetics , the term mutation has often been reserved for dna sequence changes that cause genetic diseases and are consequently relatively rare . dna sequence variants , which are more common in populations ( i.e. , such sequence variants in which two or more alleles at locus demonstrate frequencies > 1% ) , are said to be polymorphic ( having many forms ) . such loci ( plural of locus ) are termed polymorphisms , although nowadays , alleles with frequency < 1% are often called polymorphisms as well . many genetic and epigenetic alterations are supposed to contribute directly or indirectly to bladder tumor induction [ 3 , 4 ] . attempts are undertaken to classify tumors with regards to the molecular characteristics of changes in neoplastic cells in order to be able to identify the relationship between the type of these changes and clinical characteristics . every type of cancer has biological subsets that differ in clinical behavior and response to treatment . personalized cancer medicine is defined as treatment based on the molecular characteristics of a tumor from individual patient . nowadays this branch of medicine has great potential in the therapy of many types of cancer . somatic mutations of p53 , rb , fgfr3 , cdkn2a , and ras genes belong to the group of mutations that most frequently accompany the occurrence of urinary bladder carcinoma [ 3 , 4 , 5 ] . some of the constitutive changes of the genes ( germline ) , e.g. , a72p polymorphism of p53 gene , were also analyzed with regards to the higher risk of neoplasm development . there are also reports , indicating correlations between constitutive mutations of cdkn2a gene and breast cancer , melanoma cancer , nervous system tumours and squamous cell carcinoma of the head / neck region [ 7 , 8 , 9 ] , but rather little is known either about the frequency of its occurrence or of its significance in urinary bladder carcinoma . most frequently described polymorphisms of cdkn2a gene are the substitution of alanine to threonine in the second exon ( a148t- rs 3731249 ) and the two , which occur in the 3 untranslated region of cdkn2a : nt 500c > g and nt540c > t . the cdkn2a gene ( omim 600160 ) , localized at chromosome 9p21 encodes p16i cyclin - dependent kinase inhibitor and p14ar activator of p53 . both gene products have an independent first exon ( 1-alpha exon and 1-beta exon , respectively ) , but share exons 2 and 3 and are translated in different reading frames . the genes are involved in the negative control of cell proliferation ; p16 produces a g1 cell - cycle arrest by inhibiting the phosphorylation process of retinoblastoma protein ( rb ) , and p14 acts both at g1/s phases in a p53-dependent manner via binding and inhibiting mdm2 protein . there are three major mechanisms at the base of genetic inactivation of cdkn2a gene , including deletions of both alleles , deletion of one allele and mutation of the other allele or deletion or mutation of the first allele and hypermethylation of the second allele . unlike other suppressor genes , which most often undergo inactivation in result of point mutations , deletions are the most frequent mechanisms by which cdkn2a gene is inactivated . regarding urinary bladder carcinoma , homozygotic deletions at 9p21 locus ( cdkn2a ) are found in approximately 20 - 30% of cases , while the loss of heterozygosity may be observed even in 60% of cases [ 3 , 8 ] . the aim of our study was to characterize a148 t polymorphism of cdkn2a gene in bladder cancer patients . dna from 84 subjects was analyzed , all of them patients of the department of urology , the j.p . urologists m. rozniecki and partners department of urology in ask with diagnosed tumor of the urinary bladder ( 130 men and 26 women , 32 - 86 year old , the mean age : 62.3 years ) . a detailed medical history was obtained from all the enrolled participants , taking into account the effect of risk factors on neoplastic disease progression . all the identified neoplasms were assessed by two histopathologists for staging and grading according to who histopathological classification . the mean observation period per individual patient was 32 months ( 16 - 59 ) . clinical data of the bladder cancer group ( the dark blue color designates the cases in which a148 t polymorphism of cdkn2a gene was found ) d - death , dacc - death in accident , dint - death of intrinsic cause division of studied material with regards to tumor staging and grading blood samples ( 5 ml ) , collected onto edta3k ( potassium versenate ) , were used as study material . a roche magna pure compact automatic workstation was used to isolate dna from 1 ml of anticoagulated blood ( out of all samples ) by means of a nucleic acid isolation kit i - large volume ( cat . no . the volume and purity of obtained dna were determined by absorbance ( a ) measurements directly in aqueous solutions . the measurements were performed by an nd-1000 spectrophotometer in uv light ( measurement of uv adsorbed by dna bases ) . nucleic acid concentration was determined by comparing measurement results for blind trial ( distilled water ) and absorbance levels of studied sample at wavelength of 260 nm ( this wave length corresponds to the maximal absorption for nucleic acids ) . absorbance at = 280 nm is characteristic for proteins and reflects protein- derived contaminations . 100 ng ) , 2.5 l of 10 reaction buffer ( 700 mm tris - hcl , ph 8.3 , 166 mm ( nh4)2so4 , 25 mm mgcl2 ) , 0.5 l of 2,5 mm dntps ( takara ) , 1 l of each primer pair ( 5 pmol/ l ) , 1.25 u of taq dna polymerase ( novazym ) , and 18.75 l of distilled water in a total volume of 25 l were used . the used primers included : 5cccaagcttgcatggagccggcggcg3 and 5cgggatccctttcaatcggggatgt3. the applied pcr procedure : preliminary denaturation for 10 minutes at 95c , followed by 40 cycles of 30-second denaturation in 95c , 30-second annealing in 58c , and 30-second elongation in 72c . pcr products of leukocytes ( 10 l ) were electrophoresed on 2.0% agarose gel and stained with ethidium bromide . the gels were evaluated by visual inspection in uv light . the search for a148 t polymorphism in exon 2 of cdkn2a gene was carried out by the msscp technique in two different temperature profiles ( the first one at 23c , for 120 minutes and the second one at 37c for 40 minutes , 23c for 25 minutes , and at 15c for 25 minutes ) and by the sequencing technique . pcr products were sequenced to rule out / confirm mutation or polymorphism , identified during electrophoresis ( genomed sp . the chi - square ( ) test , g test is used to assess the significance of differences in contingency tables . both tests lead to the same conclusions when each cell of the contingency table has a sufficiently high number ( o > 10 ) of observations . however , while the chi - square test can not be used for lower numbers in any cell , no such restrictions occur for g test . a null hypothesis of no effect can not be rejected when g statistics is higher than the critical value g0,05 = 3.841 for 1 degree of freedom ( table 22 ) . blood samples ( 5 ml ) , collected onto edta3k ( potassium versenate ) , were used as study material . a roche magna pure compact automatic workstation was used to isolate dna from 1 ml of anticoagulated blood ( out of all samples ) by means of a nucleic acid isolation kit i - large volume ( cat . the volume and purity of obtained dna were determined by absorbance ( a ) measurements directly in aqueous solutions . the measurements were performed by an nd-1000 spectrophotometer in uv light ( measurement of uv adsorbed by dna bases ) . nucleic acid concentration was determined by comparing measurement results for blind trial ( distilled water ) and absorbance levels of studied sample at wavelength of 260 nm ( this wave length corresponds to the maximal absorption for nucleic acids ) . absorbance at = 280 nm is characteristic for proteins and reflects protein- derived contaminations . 100 ng ) , 2.5 l of 10 reaction buffer ( 700 mm tris - hcl , ph 8.3 , 166 mm ( nh4)2so4 , 25 mm mgcl2 ) , 0.5 l of 2,5 mm dntps ( takara ) , 1 l of each primer pair ( 5 pmol/ l ) , 1.25 u of taq dna polymerase ( novazym ) , and 18.75 l of distilled water in a total volume of 25 l were used . the used primers included : 5cccaagcttgcatggagccggcggcg3 and 5cgggatccctttcaatcggggatgt3. the applied pcr procedure : preliminary denaturation for 10 minutes at 95c , followed by 40 cycles of 30-second denaturation in 95c , 30-second annealing in 58c , and 30-second elongation in 72c . pcr products of leukocytes ( 10 l ) were electrophoresed on 2.0% agarose gel and stained with ethidium bromide . the search for a148 t polymorphism in exon 2 of cdkn2a gene was carried out by the msscp technique in two different temperature profiles ( the first one at 23c , for 120 minutes and the second one at 37c for 40 minutes , 23c for 25 minutes , and at 15c for 25 minutes ) and by the sequencing technique . pcr products were sequenced to rule out / confirm mutation or polymorphism , identified during electrophoresis ( genomed sp . the g test , based on the likelihood ratio , was applied . like the chi - square ( ) test , g test is used to assess the significance of differences in contingency tables . both tests lead to the same conclusions when each cell of the contingency table has a sufficiently high number ( o > 10 ) of observations . however , while the chi - square test can not be used for lower numbers in any cell , no such restrictions occur for g test . a null hypothesis of no effect can not be rejected when g statistics is higher than the critical value g0,05 = 3.841 for 1 degree of freedom ( table 22 ) . common polymorphic variants of cdkn2a gene were found in our study at codon 148 in exon 2 ( ala148thr ) in 9 cases ( tab . all the confirmed cases were first identified by the msscp technique and then verified by sequencing . the obtained frequencies were compared with the control group from the polish population , examined by debniak and colleagues , and a significant difference was found in the prevalence of a148 t polymorphism in the bladder cancer group ( g test , table 2 2 : nbladder cancer = 156 , ncontrol = 1210 , g = 4.298 , p < 0.05 ) . no differences were observed in the frequencies of nt500c > g alleles or in the frequencies of nt540c > t alleles , either in the bladder cancer group or in the reference control group . we used the data for the control group , published by other authors , because they were obtained in studies on a large number of subjects ( i.e. , 1210 ) for the polish population , and by researchers , who are unquestionable authorities in the studies on hereditary predispositions to neoplasm development , including the a148 t variant of cdkn2a gene . frequencies of cdkn2a variants in controls and in the bladder cancer group results of electrophoresis ( msscp ) of cdkn2a gene exon 2 and of sequentioning of particular codon 148 variants . the black arrow designates the g / g ( ala / ala ) homozygotic system , the blue arrow the heterozygotic a / g ( thr / ala ) system and the red arrow the homozygotic a / a ( thr / thr ) system . the incidence rates of particular variants in codon 148 of cdkn2a gene in various neoplasms , found in the polish population . the occurrence of adenine instead of guanine in codon 148 is associated with the change of the coded amino acid - alanine ( cgg ) - to threonine ( cga ) . n- the number of studied subjects controls - a control group for the polish population , consisting of 500 newborns and 710 adult ; significant - designates a group of neoplasms , in which the percent of the threonine - encoding variant was statistically significantly higher than in the control population ; not significant - designates a group of neoplasms in which the distribution of incidence of the threonine - encoding variant is not different from that in the general population . based on the study by dbniak et al cdkn2a gene inactivation is one of the genetic events , leading to urinary bladder cancer development . according to published reports , 14 - 39% of homozygotic deletions are found in urinary bladder cancer , as well as approximately 12% of hemizygotic deletions of the gene and about 3% of mutations [ 5 , 14 ] . for comparison , in renal cancer homozygotic deletions however , because cdkn2a gene inactivation plays the key role in the molecular mechanism of urinary bladder cancer development , as designed by goebell et al . in 2010 , our interest focused on the constitutional mutations of that gene . the a148 t variant is broadly cited as a common polymorphism , following functional studies , which indicate that these amino acid substitutions do not affect the ability of p16 to precipitate with cdk4/ cdk6 proteins . variable frequencies of cdkn2a germline muta tions and polymorphism have been reported in different collections of melanoma families in sweden , poland , great britain , and brazil [ 1620 ] . the incidence rates of these changes are also higher in cases of liver carcinoma , nervous system tumors , and pancreatic or breast cancers . see table 5 for exemplary data . in poland , the incidence of cdkn2a variant - an alanine to threonine substitution at codon 148 ( a148 t ) - has been estimated for approximately 3 to 3.5% of the population [ 13 , 21 ] . recent studies have shown that a148 t polymorphism is in linkage disequilibrium with a second alteration in the cdkn2a promoter ( p-493 variant ) , which appears to affect gene expression . in the polish control population , the frequency of a148 t changes in 1,210 control samples ( 500 newborns and 710 adults ) was assessed by debniak et al . at 2.89% . the same research team studied the incidence of a148 t variant of cdkn2a gene ( see their report of 2007 ) in the polish population of patients with breast cancer ( young women ) , colon , lung , melanoma , prostate , bladder , kidney , stomach , pancreas and thyroid cancers ( see figure 1 for a partial presentation of results ) [ 13 , 30 , 31 ] . significant differences were found for the first four neoplasms in the above list , indicating that the carrier state of the variant may be associated with an increased risk of tumor development . the results , obtained for a group of 223 urinary bladder carcinoma cases ( 3.1% ) did not differ from those for the control group . it should be emphasized that those patients came from the pomeranian region while in our study patients from the lodz voivodeship ( central poland ) prevailed ( 131/156 ) . the results of our study ( 5.77% ) indicate that , regarding the polish population ( d macroregion ) , a148 t variant seems to be associated with an increased bladder cancer risk . however , it should eventually be justified to refer to the comparison of results in the study group with those in the control group , representative for the studied region . the frequency of variant a148 t found by us in patients with bladder cancer is similar to the results published in the work of sakano et al . ( 6% ) for patients with bladder cancer in the population of stockholm county in sweden . however , the result can not be compared with a general population as the authors do not specify what is the frequency of this variant in the population of swedes . the obtained results should by all means be confirmed in a study on a larger population , representing the d macroregion , especially that the results of studies on other neoplasms differ among populations or even within the same population , when differentiated for example by age ( the groups of patients below and above the age of 50 years ) . breast cancer can be an example , the results for which were different from those in the control group in the group of women below 50 , while no differences in the incidence rates were observed between the control group and the group of women above 50 . in case of the studied group , 8 out of 9 a148 t polymorphism cases of cdkn2a gene were identified in men at the age above 60 years at diagnosis ( data specified in table 4 ) . no recurrence was observed in 7 out of 9 diagnosed cases . in 6/9 cases , there were neoplasms in high clinical stage ; while in 5/9 cases there were tumors with high malignancy grade ( g2-g3 ) . summing up and taking into account the analysis of clinical parameters and the age of disease occurrence , a148 t polymorphism of cdkn2a gene was found in the studied group only in men , in whom the disease was diagnosed at the age above 60 years , while the diagnosed neoplasms were in the majority of cases characterized by higher clinical stage and higher grade of malignancy , as well as by a low percentage of recurrence . nevertheless , this has been the first study that attempted to show a potential association between a148 t alterations and an increased risk for bladder cancer development . prevalence of a148 t variant of cdkn2a gene vs. clinical data genotypes and allele frequencies of the a148 t allele in different populations studies on genetic predispositions to neoplasm development allow to distinguish the group of subjects with an increased risk for neoplastic changes vs. the general population . the more we learn about human genetics and human variations , the more apparent it becomes that our individual make - up has a noticeable impact on the risk of cancer development and finally on the effectiveness of therapeutic medications . t variant of cdkn2a gene seems to be associated with an increased risk for developing bladder cancer . nevertheless , according to debniak et al . ( 2005 ) , it does not imply that a148 t polymorphism is associated with an increased risk of the diseases alone but it rather suggests the existence of some interactive modifiers that , when grouped together , may trigger the malignancy process . the study was approved by the ethics committee of the medical university of d ( permission no rnn/66/02/ke ) . this work was supported by the state committee for scientific research , poland ( kbn grant no 2p05c 076 30 ) .

objectivesthe a148 t polymorphism of cdkn2a gene is observed in various neoplasms with the incidence rate of 3 - 35% , however , rather little is known either about the frequency of its occurrence or of its significance in urinary bladder carcinoma.materials and methodsdna was isolated from blood of 156 patients with urinary bladder carcinoma ( 130 men ) . in histopathology , 84 cases were classified as g1 , 42 as g2 , and 30 as g3 . the clinical stage was in 81 cases estimated at ta and in 75 cases at t1-t4 . a148 t polymorphism was detected by the msscp technique and by sequencing.resultsa148t polymorphism was identified in 9/156 urinary bladder carcinoma cases ( only in men ) . the obtained results were compared with the polymorphism incidence for the polish population , estimated by debniak et al . the occurrence in the group of the bladder cancer patients turned out higher ( 5.77% ) from that in the control group ( 2.89% ) ( g test , table 22 : nbladder cancer = 156 , ncontrol = 1210 , g = 4.298 , p < 0.05).conclusionsumming up and taking into account the analysis of clinical parameters and the age of the disease occurrence , the a148 t polymorphism of cdkn2a gene was identified in the study group only in men , in whom the disease was diagnosed above the age of 60 , while the diagnosed neoplasms were in the majority of cases characterized by higher clinical stages and higher grades of malignancy . this has been the first study that attempted to show a potential association between a148 t alterations and an increased risk for bladder cancer development .

craniosynostosis is a wonderfully descriptive term , meaning " the skull has fused bone " . however , it is also a fairly nonspecific clinical designation , encompassing multiple presentations ranging from isolated single suture involvement to multi - sutural fusions5 ) . multi - sutural fusion can occur as isolated fusions or with associated anomalies that occur outside the skull . epidemiologic studies have suggested that the incidence of craniosynostosis may be as high as 1 in 1700 live births612 ) . for example , early theories regarding the pathogenesis of this condition , based on clinical observations and an experimental animal model , included intrauterine constraint811 ) . over the last quarter century , there have been many advances in the understanding of craniosynostosis , resulting in more rational management of the problems associated with this condition , both in its simple form and its syndromic manifestations315 ) . these advances have included reduced emphasis on the technical aspects of this disease and greater emphasis on its pathology and natural history , along with more accurate analysis of the morphology of the craniofacial skeleton1310 ) . more recently , genetic studies have identified the genetic loci of many craniosynostosis syndromes , as well has determining the downstream pathways associated with disease development . recent clinical and genetic studies have identified multiple forms of human craniosynostosis , each associated with mutations within various growth factor signaling pathways . knowledge gathered from these investigations may result in the future development of alternative strategies to enhance or perhaps even replace current approaches for the treatment of craniosynostosis . craniosynostosis was first treated surgically in the late 1800s , using techniques such as fragmentation of the cranial vault and linear craniectomies . these early procedures were associated with high rates of reossification and poor esthetic outcomes , mandating many subsequent procedures7 ) . at present , however , simple craniectomy is used only in patients with transient cranial decompression . these early procedures have been supplanted by surgical remodeling of the affected area of the cranial vault and orbits . surgery is generally performed at age 69 months to take full advantage of the regenerative capacity of the skull at this age . three stages of growth have determined the approach to the management of craniosynostosis3 ) . during this time , cerebral growth is the greatest , and craniosynostosis may have detrimental effects on the developing brain . the original surgical approach consisted of excision of the premature suture or sutures by linear craniectomy , allowing the growing brain to expand . if urgent decompression was required , fronto - orbital advancement and multiple suture excisions were performed , resulting in lateral and posterior expansion . after the second year , cerebral growth slows ; nevertheless , severe craniostenosis may still lead to papilledema and potential visual failure . the cranial capacity must therefore be expanded by large bilateral decompressive craniotomies , generous fronto - orbital advancement , or a combination of these procedures . definitive facial surgery can be performed , beginning at age 10 years , although waiting until maturity may achieve better esthetic outcomes . patients with crouzon syndrome who have proptosis and/or maxillary hypoplasia are especially likely to need surgical treatment1214 ) . early surgical correction has been limited by a late diagnosis and the risks associated with intraoperative blood loss , which was less effectively managed in the past than currently13 ) . since the beginning of the 21st century , many centers have tended to determine whether a less invasive procedure could be performed at an earlier stage with acceptable risk . endoscopic linear craniectomy , with postoperative application of helmets and cranial remodeling through small skin incisions , has led to cosmetic results comparable to those of more invasive procedures if performed during the first 46 months of life , with acceptable blood loss and operative risks13 ) . more recently , the combination of frontal advancement and posterior cranial enlargement during the first months of life has been found to protect both the ocular and posterior cranial structures . currently , a free bone flap ( floating technique ) or springs are used to allow for cerebral growth until a rigid fronto - orbito - maxillary advancement can be performed13 ) . the advent of osteodistraction has lowered the age for facio - maxillary advancement ( 35 years ) , and may avoid the necessity of repeating fronto - orbital procedures . this has reduced the risks of dural tears and postoperative cerebrospinal fluid fistulas in a significant proportion of patients . as the procedures used to remodel the calvarial vault are extensive although the mortality rate has been reported to be as high as 2.3% , most international studies had mortality rates of 1.5% to 2%7 ) . most deaths were attributed to hemorrhagic complications , but various other causes have been reported , including air emboli , cerebral edema , and respiratory infections4 ) . attention to intraoperative hemodynamics and careful postoperative intensive care unit monitoring are critical in minimizing overall morbidity and mortality rates . during this time , cerebral growth is the greatest , and craniosynostosis may have detrimental effects on the developing brain . the original surgical approach consisted of excision of the premature suture or sutures by linear craniectomy , allowing the growing brain to expand . if urgent decompression was required , fronto - orbital advancement and multiple suture excisions were performed , resulting in lateral and posterior expansion . after the second year , cerebral growth slows ; nevertheless , severe craniostenosis may still lead to papilledema and potential visual failure . the cranial capacity must therefore be expanded by large bilateral decompressive craniotomies , generous fronto - orbital advancement , or a combination of these procedures . definitive facial surgery can be performed , beginning at age 10 years , although waiting until maturity may achieve better esthetic outcomes . patients with crouzon syndrome who have proptosis and/or maxillary hypoplasia are especially likely to need surgical treatment1214 ) . early surgical correction has been limited by a late diagnosis and the risks associated with intraoperative blood loss , which was less effectively managed in the past than currently13 ) . since the beginning of the 21st century , many centers have tended to determine whether a less invasive procedure could be performed at an earlier stage with acceptable risk . endoscopic linear craniectomy , with postoperative application of helmets and cranial remodeling through small skin incisions , has led to cosmetic results comparable to those of more invasive procedures if performed during the first 46 months of life , with acceptable blood loss and operative risks13 ) . more recently , the combination of frontal advancement and posterior cranial enlargement during the first months of life has been found to protect both the ocular and posterior cranial structures . currently , a free bone flap ( floating technique ) or springs are used to allow for cerebral growth until a rigid fronto - orbito - maxillary advancement can be performed13 ) . the advent of osteodistraction has lowered the age for facio - maxillary advancement ( 35 years ) , and may avoid the necessity of repeating fronto - orbital procedures . this has reduced the risks of dural tears and postoperative cerebrospinal fluid fistulas in a significant proportion of patients . as the procedures used to remodel the calvarial vault are extensive , complications can occur following surgery for craniosynostosis . although the mortality rate has been reported to be as high as 2.3% , most international studies had mortality rates of 1.5% to 2%7 ) . most deaths were attributed to hemorrhagic complications , but various other causes have been reported , including air emboli , cerebral edema , and respiratory infections4 ) . attention to intraoperative hemodynamics and careful postoperative intensive care unit monitoring are critical in minimizing overall morbidity and mortality rates . the combination of early technical success with recent advances in treatment14 ) has indicated the necessity of multidisciplinary management . the overall approach can be distilled into six principles9 ) : 1 ) care should be provided by multi - disciplinary teams ; 2 ) care should be a protocol - driven process , with all forms of care defined and delivered optimally ; 3 ) care should be longitudinal , as age , healing and growth processes ; 4 ) secure financial support is needed to implement such longitudinal care11 ) ; 5 ) competent professionals should be involved in ongoing education and training in teaching and research ; and 6 ) research should explore causes , treatment strategies , and treatment outcomes . centers with the appropriate vision and infrastructure are necessary to optimize the care of patients with craniosynostosis , as well as to enhance scientific knowledge and education about this disease . several investigations have evaluated the roles of various growth factors and cytokines in determining the fate of sutures . fibroblast growth factors ( fgfs ) are particularly important , as mutations in their receptors have been implicated in many craniosynostosis syndromes . mutations in three of the four known fgf receptors have been associated with premature pathologic suture fusions1617 ) . recent advances in developmental biology and genetics have identified some of the events governing suture fate , highlighting multiple axes of cellular signaling with the potential for clinical manipulation . such knowledge and comprehension may facilitate therapeutic translations , ultimately enhancing or perhaps even replacing contemporary modalities for treating craniosynostosis .

craniosynostosis has a varied clinical spectrum , ranging from isolated single suture involvement to multi - sutural fusions . greater understanding of the pathogenesis of craniosynostosis has led to the development of practical treatment protocols . three stages of growth have determined the approach to managing craniosynostosis : the early period , up to 12 months ; the intermediate period , from 1 to 10 years ; and the late period , beginning at 10 years . this review discusses current surgical management and future perspectives in craniosynostosis .

type 2 diabetes mellitus ( t2 dm ) is a common chronic health condition in the elderly . the number of elderly t2 dm patients has been growing worldwide , especially in upper - middle income countries such as thailand . based on the findings of the fourth thai national health examination survey in 2009 , diabetes was most prevalent in women , the elderly , and urban areas . the prevalence of impaired fasting glucose and undiagnosed diabetes increased with age , peaking at age 75 years and 5564 years , respectively.1 diabetes in the elderly is associated with a greater risk of t2dm - related micro- and macrovascular complications , cognitive disorders , physical disability , morbidity , and mortality;25 the selection of antidiabetic treatment for elderly t2 dm patients poses many challenges for a number of reasons . first , elderly t2 dm patients have a greater incidence of hypoglycemia6 which can precipitate serious events such as falls and accompanying fractures . the study by zhao et al7 showed that hypoglycemia patients had higher rates of fall - related fractures than those without hypoglycemia , within 30 days and 1 year ( 0.64% vs 0.02% and 2.11% vs 0.50% , respectively ) . second , elderly t2 dm patients are more likely to have comorbidities with their diabetes , leading to the use of polypharmacy.4,8,9 third , chronic kidney disease often occurs in elderly t2 dm patients;10 the prevalence of chronic kidney disease among t2 dm patients in australia,11 india,12 finland,13 singapore,14 and the us15 ranged from 40% to 70% . with these associated challenges for elderly t2 dipeptidyl peptidase-4 ( dpp-4 ) inhibitors show particular promise for treating elderly t2 dm patients because they have excellent tolerability profiles , low risk of hypoglycemia , and little effect on body weight.4,16,17 therefore , this study evaluated the cost - effectiveness of dpp-4 inhibitor monotherapy compared with sulfonylurea ( sfu ) monotherapy or metformin monotherapy for treating elderly t2 dm patients in the thai context . from a thai health care system perspective , we conducted a cost - utility analysis and used a validated ims core diabetes model ( cdm ) , version 8.5 , to estimate long - term costs and outcomes associated with each treatment over a lifetime horizon . details of this model are described elsewhere.18,19 a 3% discount rate per annum was applied to both costs and outcomes in line with the thai health technology assessment ( hta ) guideline.20 the cohort population was thai people with t2 dm aged at least 65 years . table 1 presents the baseline demographics , risk factors , and clinical complications of the cohort , which were obtained from published data and hospital databases in thailand.2128 the all - cause mortality rate was also adjusted with the age - specific mortality rate of thai people.29 utility values used in the cdm were based mostly on published studies conducted in other countries.3034 this study was approved by the buddhachinaraj regional hospital ethics committee on august 8 , 2014 . as the patient data is de - identified patient consent was not required . these medications were administered as a monotherapy and then compared with either metformin monotherapy or sfu monotherapy . metformin and sfu are considered as usual care for elderly t2 dm patients in thailand . second , we convened a panel of stakeholders to discuss the scope and appropriate comparators of the study , including endocrinologists , and policy makers , and then followed the consensus of the meeting . this study used the normal daily dose of each treatment option : saxagliptin ( 5 mg ) , sitagliptin ( 100 mg ) , vildagliptin ( 100 mg ) , glipizide ( 10 mg ) , and metformin ( 2,000 mg ) . only the direct medical costs , such as cost of intervention , concurrent medications , diabetic screening , management , and treatment complications , were included in the cost - effectiveness analysis . cost data were derived from the published literature and retrospective hospital database analyses ( table 2).3641 all costs were inflated using thailand s consumer price index42 and presented in the year 2014 thb value . costs were converted to us$ at a rate of thb32.96 per us$ as of december 30 , 2014.43 the cost of dpp-4 inhibitors was proposed to the subcommittee for the development of the national list of essential medicine by the pharmaceutical companies . total cost per year of saxagliptin , sitagliptin , and vildagliptin was thb13,492 ( us$409.34 ) , thb16,570 ( us$502.73 ) , and thb15,900 ( us$482.40 ) , respectively . glipizide and metformin we used a median of the median prices of those generic products44 as recommended by the thai hta guideline.45 the annual total costs of metformin and sfu were thb496 ( us$15.05 ) and thb149 ( us$4.52 ) , respectively . due to limited evidence of treatment efficacy in thailand , we performed a systematic review and meta - analysis to estimate the pooled efficacy of dpp-4 inhibitor monotherapy compared to sfu monotherapy and metformin monotherapy in elderly t2 dm patients . the medline , embase , and clinicaltrial.gov databases were systematically searched from their inception to august 2014 . we found only one study46 that indicated noninferiority of alogliptin compared to glipizide in hba1c reduction ( the weighted mean difference 0.09 ; 95% ci , to 0.06 ) , substantially lower risk of hypoglycemia ( risk ratio [ rr ] 0.21 ; 95% ci , 0.110.41 ) , lower risk of severe hypoglycemia ( rr 0.23 ; 95% ci , 0.031.99 ) , and no weight gain with dpp-4 inhibitor monotherapy compared to glipizide monotherapy in elderly t2 dm patients ( table 3 ) . three studies5,47,48 compared metformin with dpp-4 inhibitor monotherapy and concluded that dpp-4 inhibitor was an effective and well - tolerated treatment option for elderly t2 dm patients . in addition , reduction in hba1c after treatment with dpp-4 inhibitors in elderly t2 dm patients was not significantly different from those in younger patients.49 therefore , we decided to systematically search a meta - analysis study that compared dpp-4 inhibitor monotherapy with metformin monotherapy in t2 dm patients , and found two eligible studies.50,51 both were high quality studies ( with scores of at least 9 of 11 ) based on the assessment of multiple systematic reviews , we decided to use wu et als51 meta - analysis as it was the most up - to - date . the efficacy of hba1c reduction from the baseline of metformin monotherapy was estimated from the pooled analysis of seven studies48,5257 included in the meta - analysis of wu et al.51 of those studies,48,5257 severe hypoglycemia was presented in two studies,52,55 for which the rr was estimated . the calculation details are shown in table 3 . to determine the robustness of the findings , we undertook a probabilistic sensitivity analysis and presented the relationship between the probability of favoring dpp-4 inhibitors and the value of the willingness to pay for an additional unit of quality - adjusted life year ( qaly ) as a cost - effectiveness acceptability curve . the current acceptable thai ceiling threshold of thb160,000/qaly ( us$4,854.37/qaly ) was recommended by the subcommittee for the development of the universal health coverage benefit package and service delivery in thailand.58 a series of one - way sensitivity analyses were also performed to determine the effect of hba1c change , risk of hypoglycemia , drug cost , and discount rate . from a thai health care system perspective , we conducted a cost - utility analysis and used a validated ims core diabetes model ( cdm ) , version 8.5 , to estimate long - term costs and outcomes associated with each treatment over a lifetime horizon . details of this model are described elsewhere.18,19 a 3% discount rate per annum was applied to both costs and outcomes in line with the thai health technology assessment ( hta ) guideline.20 the cohort population was thai people with t2 dm aged at least 65 years . table 1 presents the baseline demographics , risk factors , and clinical complications of the cohort , which were obtained from published data and hospital databases in thailand.2128 the all - cause mortality rate was also adjusted with the age - specific mortality rate of thai people.29 utility values used in the cdm were based mostly on published studies conducted in other countries.3034 this study was approved by the buddhachinaraj regional hospital ethics committee on august 8 , 2014 . as the patient data is de - identified patient consent was not required . these medications were administered as a monotherapy and then compared with either metformin monotherapy or sfu monotherapy . metformin and sfu are considered as usual care for elderly t2 dm patients in thailand . second , we convened a panel of stakeholders to discuss the scope and appropriate comparators of the study , including endocrinologists , and policy makers , and then followed the consensus of the meeting . this study used the normal daily dose of each treatment option : saxagliptin ( 5 mg ) , sitagliptin ( 100 mg ) , vildagliptin ( 100 mg ) , glipizide ( 10 mg ) , and metformin ( 2,000 mg ) . only the direct medical costs , such as cost of intervention , concurrent medications , diabetic screening , management , and treatment complications , were included in the cost - effectiveness analysis . cost data were derived from the published literature and retrospective hospital database analyses ( table 2).3641 all costs were inflated using thailand s consumer price index42 and presented in the year 2014 thb value . costs were converted to us$ at a rate of thb32.96 per us$ as of december 30 , 2014.43 the cost of dpp-4 inhibitors was proposed to the subcommittee for the development of the national list of essential medicine by the pharmaceutical companies . total cost per year of saxagliptin , sitagliptin , and vildagliptin was thb13,492 ( us$409.34 ) , thb16,570 ( us$502.73 ) , and thb15,900 ( us$482.40 ) , respectively . glipizide and metformin we used a median of the median prices of those generic products44 as recommended by the thai hta guideline.45 the annual total costs of metformin and sfu were thb496 ( us$15.05 ) and thb149 ( us$4.52 ) , respectively . due to limited evidence of treatment efficacy in thailand , we performed a systematic review and meta - analysis to estimate the pooled efficacy of dpp-4 inhibitor monotherapy compared to sfu monotherapy and metformin monotherapy in elderly t2 dm patients . the medline , embase , and clinicaltrial.gov databases were systematically searched from their inception to august 2014 . we found only one study46 that indicated noninferiority of alogliptin compared to glipizide in hba1c reduction ( the weighted mean difference 0.09 ; 95% ci , to 0.06 ) , substantially lower risk of hypoglycemia ( risk ratio [ rr ] 0.21 ; 95% ci , 0.110.41 ) , lower risk of severe hypoglycemia ( rr 0.23 ; 95% ci , 0.031.99 ) , and no weight gain with dpp-4 inhibitor monotherapy compared to glipizide monotherapy in elderly t2 dm patients ( table 3 ) . three studies5,47,48 compared metformin with dpp-4 inhibitor monotherapy and concluded that dpp-4 inhibitor was an effective and well - tolerated treatment option for elderly t2 dm patients . in addition , reduction in hba1c after treatment with dpp-4 inhibitors in elderly t2 dm patients was not significantly different from those in younger patients.49 therefore , we decided to systematically search a meta - analysis study that compared dpp-4 inhibitor monotherapy with metformin monotherapy in t2 dm patients , and found two eligible studies.50,51 both were high quality studies ( with scores of at least 9 of 11 ) based on the assessment of multiple systematic reviews , we decided to use wu et als51 meta - analysis as it was the most up - to - date . the efficacy of hba1c reduction from the baseline of metformin monotherapy was estimated from the pooled analysis of seven studies48,5257 included in the meta - analysis of wu et al.51 of those studies,48,5257 severe hypoglycemia was presented in two studies,52,55 for which the rr was estimated . to determine the robustness of the findings , we undertook a probabilistic sensitivity analysis and presented the relationship between the probability of favoring dpp-4 inhibitors and the value of the willingness to pay for an additional unit of quality - adjusted life year ( qaly ) as a cost - effectiveness acceptability curve . the current acceptable thai ceiling threshold of thb160,000/qaly ( us$4,854.37/qaly ) was recommended by the subcommittee for the development of the universal health coverage benefit package and service delivery in thailand.58 a series of one - way sensitivity analyses were also performed to determine the effect of hba1c change , risk of hypoglycemia , drug cost , and discount rate . in the base - case scenario , all three dpp-4 inhibitors incurred higher costs and yielded fewer qalys ( 5.965 qalys vs 5.986 qalys ) . in other words , all dpp-4 inhibitors were dominated , making metformin monotherapy a cost - saving treatment in elderly t2 dm patients in thai context ( table 4 ) . all three dpp-4 inhibitors were more effective ( equal 0.031 higher qalys ) but more costly than sfu . saxagliptin yielded the lowest incremental cost per qaly , followed by vildagliptin and sitagliptin ( thb3,632,604/qaly or us$110,212.50/qaly , thb4,335,273/qaly or us$131,531.34/qaly , and thb4,530,556/qaly or us$137,456.19/qaly , respectively ) . with the current thai threshold of thb160,000/qaly ( us$4,854.37/qaly ) , dpp-4 inhibitors were not cost - effective compared to sfu for treating elderly t2 dm patients in the thai context ( table 4 ) . as vildagliptin and sitagliptin were dominated by saxagliptin , the results of one - way sensitivity analysis , therefore , were displayed on saxagliptin compared to sfu . the change in hba1c from the baseline of dpp-4 inhibitors , discount rate , risk of severe hypoglycemia , and cost of saxagliptin had some effect on the incremental cost - effectiveness ratio ( icer ) ( figure 1 ) . the greater the effect of dpp-4 inhibitors on the reduction of hba1c from baseline , the lower icer ( figure 1 ) . based on the cost - effectiveness acceptability curve ( figure 2 ) , all dpp-4 inhibitors were not a cost - effective treatment compared to sfu at the ceiling threshold of 160,000 thb / qaly . compared to metformin , the probability of dpp-4 inhibitors being cost - effective was even smaller than being compared to sfu . in the base - case scenario , all three dpp-4 inhibitors incurred higher costs and yielded fewer qalys ( 5.965 qalys vs 5.986 qalys ) . in other words , all dpp-4 inhibitors were dominated , making metformin monotherapy a cost - saving treatment in elderly t2 dm patients in thai context ( table 4 ) . all three dpp-4 inhibitors were more effective ( equal 0.031 higher qalys ) but more costly than sfu . saxagliptin yielded the lowest incremental cost per qaly , followed by vildagliptin and sitagliptin ( thb3,632,604/qaly or us$110,212.50/qaly , thb4,335,273/qaly or us$131,531.34/qaly , and thb4,530,556/qaly or us$137,456.19/qaly , respectively ) . with the current thai threshold of thb160,000/qaly ( us$4,854.37/qaly ) , dpp-4 inhibitors were not cost - effective compared to sfu for treating elderly t2 dm patients in the thai context ( table 4 ) . as vildagliptin and sitagliptin were dominated by saxagliptin , the results of one - way sensitivity analysis , therefore , were displayed on saxagliptin compared to sfu . the change in hba1c from the baseline of dpp-4 inhibitors , discount rate , risk of severe hypoglycemia , and cost of saxagliptin had some effect on the incremental cost - effectiveness ratio ( icer ) ( figure 1 ) . the greater the effect of dpp-4 inhibitors on the reduction of hba1c from baseline , the lower icer ( figure 1 ) . based on the cost - effectiveness acceptability curve ( figure 2 ) , all dpp-4 inhibitors were not a cost - effective treatment compared to sfu at the ceiling threshold of 160,000 thb / qaly . compared to metformin , the probability of dpp-4 inhibitors being cost - effective was even smaller than being compared to sfu . elderly patients with diabetes have an increased risk of t2dm - related morbidity and mortality . the treatment goal for elderly t2 dm patients is to optimize glycemic control while minimizing the risk of drug - associated adverse events . thus , this study was conducted to generate economic evidence of dpp-4 inhibitors for t2 dm treatment in response to a request by the subcommittee for the development of the national list of essential medicine in 2014 . the findings of the study were submitted and presented to the subcommittee in 2015 to justify policy decision in terms of the value for money . this cost - effectiveness study followed the thai national hta guideline.59 our findings indicated that dpp-4 inhibitor monotherapy was not a cost - effective treatment for elderly t2 dm patients in thailand compared to either sfu monotherapy or metformin monotherapy . efficacy in hba1c reduction , risk of severe hypoglycemia , and cost of dpp-4 inhibitors play an important role in the findings of the study . we are not aware of other studies evaluating the cost - effectiveness of dpp-4 inhibitor monotherapy in elderly t2 dm patients . geng et al60 conducted a systematic review of cost - effectiveness of dpp-4 inhibitors for treating t2 dm ; the eleven included studies assessed dpp-4 inhibitors as an add - on therapy . of those , seven studies compared dpp-4 inhibitors and metformin with sfu and metformin . six studies concluded that dpp-4 inhibitors were cost - effective compared to sfu for treating t2 dm patients for whom metformin monotherapy failed to achieve glycemic control . our study was strengthened by incorporating input parameters , such as costs , baseline cohort characteristics , and adverse events , from data sources that were reliable and relevant to the thai context . . first , based on our systematic review , we found only one study46 that evaluated the efficacy and safety of a dpp-4 inhibitor monotherapy compared to sfu monotherapy in elderly t2 dm patients . this study indicated noninferiority in hba1c reduction but a lower risk of hypoglycemia and no weight gain with the dpp-4 inhibitor monotherapy compared to sfu monotherapy . only three studies5,47,48 compared dpp-4 inhibitor monotherapy with metformin monotherapy in elderly t2 dm patients . however , hba1c reduction after treatment with dpp-4 inhibitors was not significantly different in elderly t2 dm patients vs younger t2 dm patients.49 we addressed this limitation by the pooled analysis of seven studies48,5257 included in the meta - analysis study by wu et al51 that compared metformin monotherapy with dpp-4 inhibitor monotherapy in t2 dm patients . second , we tried our best to use resource utilization and cost data from thailand . some cost data were not available , such as the cost of an infected ulcer ; we assumed them equal to zero . we reanalyzed our base - case analysis , assuming the cost of an infected ulcer similar to an uninfected ulcer . the results showed a slightly lower icer from thb3,632,604/qaly ( us$110,212.50/qaly ) to thb3,630,697/qaly ( us$110,154.64/qaly ) comparing saxagliptin to sfu . metformin monotherapy was still a dominant treatment compared to dpp-4 inhibitor monotherapy , when assuming equal cost of an infected and uninfected ulcer . even though costs , baseline cohort characteristics , and adverse events were obtained from published studies or hospital databases in thailand , this study relies on utility values and transition probabilities within the cdm from studies conducted in other countries . given these limitations , the confirmation of this study s however , the findings indicate that treating elderly t2 dm patients using dpp-4 inhibitor monotherapy in a thai context may not be cost - effective . for treating elderly t2 dm patients in thailand , dpp-4 inhibitor monotherapy is not a cost - effective treatment compared to metformin monotherapy . in addition , dpp-4 inhibitor monotherapy is not a cost - effective treatment compared to sfu monotherapy at the current thai threshold of thb160,000/qaly . the high acquisition cost of dpp-4 inhibitors is one of the key factors in the findings of this study .

backgroundthe management of type 2 diabetes mellitus ( t2 dm ) in elderly population poses many challenges . dipeptidyl peptidase-4 ( dpp-4 ) inhibitors show particular promise due to excellent tolerability profiles , low risk of hypoglycemia , and little effect on body weight . this study evaluated , from the health care system s perspective , the long - term cost - effectiveness of dpp-4 inhibitor monotherapy vs metformin and sulfonylurea ( sfu ) monotherapy in thai elderly t2 dm patients.methodsthe clinical efficacy was estimated from a systematic review and meta - analysis . baseline cohort characteristics and cost parameters were obtained from published studies and hospital databases in thailand . a validated ims core diabetes model version 8.5 was used to project clinical and economic outcomes over a lifetime horizon using a 3% annual discount rate . costs were expressed in 2014 thai baht ( thb ) ( us dollar value ) . incremental cost - effectiveness ratios were calculated . base - case assumptions were assessed through several sensitivity analyses.resultsfor treating elderly t2 dm patients , dpp-4 inhibitors were more expensive and less effective , ie , a dominated strategy , than the metformin monotherapy . compared with sfu , treatment with dpp-4 inhibitors gained 0.031 more quality - adjusted life years ( qalys ) at a total cost incurred over thb113,701 or us$3,449.67 , resulting in an incremental cost - effectiveness ratio of thb3.63 million or us$110,133.50 per qaly . at the acceptable thai ceiling threshold of thb160,000/qaly ( us$4,854.37/qaly ) , dpp-4 inhibitors were not a cost - effective treatment.conclusiondpp-4 inhibitor monotherapy is not a cost - effective treatment for elderly t2 dm patients compared with metformin monotherapy and sfu monotherapy , given current resource constraints in thailand .